Darwin, Andrew J.; Ziegelhoffer, Eva C.; Kiley, Patricia J.; Stewart, Valley
1998-01-01
The expression of several Escherichia coli operons is activated by the Fnr protein during anaerobic growth and is further controlled in response to nitrate and nitrite by the homologous response regulators, NarL and NarP. Among these operons, the napF operon, encoding a periplasmic nitrate reductase, has unique features with respect to its Fnr-, NarL-, and NarP-dependent regulation. First, the Fnr-binding site is unusually located compared to the control regions of most other Fnr-activated operons, suggesting different Fnr-RNA polymerase contacts during transcriptional activation. Second, nitrate and nitrite activation is solely dependent on NarP but is antagonized by the NarL protein. In this study, we used DNase I footprint analysis to confirm our previous assignment of the unusual location of the Fnr-binding site in the napF control region. In addition, the in vivo effects of Fnr-positive control mutations on napF operon expression indicate that the napF promoter is atypical with respect to Fnr-mediated activation. The transcriptional regulation of napF was successfully reproduced in vitro by using a supercoiled plasmid template and purified Fnr, NarL, and NarP proteins. These in vitro transcription experiments demonstrate that, in the presence of Fnr, the NarP protein causes efficient transcription activation whereas the NarL protein does not. This suggests that Fnr and NarP may act synergistically to activate napF operon expression. As observed in vivo, this activation by Fnr and NarP is antagonized by the addition of NarL in vitro. PMID:9696769
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
Yamamoto, Hiroki; Serizawa, Masakuni; Thompson, John; Sekiguchi, Junichi
2001-01-01
Maltose metabolism and the regulation of the glv operon of Bacillus subtilis, comprising three genes, glvA (6-phospho-α-glucosidase), yfiA (now designated glvR), and glvC (EIICB transport protein), were investigated. Maltose dissimilation was dependent primarily upon the glv operon, and insertional inactivation of either glvA, glvR, or glvC markedly inhibited growth on the disaccharide. A second system (MalL) contributed to a minor extent to maltose metabolism. Northern blotting revealed two transcripts corresponding to a monocistronic mRNA of glvA and a polycistronic mRNA of glvA-glvR-glvC. Primer extension analysis showed that both transcripts started at the same base (G) located 26 bp upstream of the 5′ end of glvA. When glvR was placed under control of the spac promoter, expression of the glv operon was dependent upon the presence of isopropyl-β-d-thiogalactopyranoside (IPTG). In regulatory studies, the promoter sequence of the glv operon was fused to lacZ and inserted into the amyE locus, and the resultant strain (AMGLV) was then transformed with a citrate-controlled glvR plasmid, pHYCM2VR. When cultured in Difco sporulation medium containing citrate, this transformant [AMGLV(pHYCM2VR)] expressed LacZ activity, but synthesis of LacZ was repressed by glucose. In an isogenic strain, [AMGLVCR(pHYCM2VR)], except for a mutation in the sequence of a catabolite-responsive element (cre), LacZ activity was expressed in the presence of citrate and glucose. Insertion of a citrate-controlled glvR plasmid at the amyE locus of ccpA+ and ccpA mutant organisms yielded strains AMCMVR and AMCMVRCC, respectively. In the presence of both glucose and citrate, AMCMVR failed to express the glv operon, whereas under the same conditions high-level expression of both mRNA transcripts was found in strain AMCMVRCC. Collectively, our findings suggest that GlvR (the product of the glvR gene) is a positive regulator of the glv operon and that glucose exerts its effect via catabolite
Synergic role of the two ars operons in arsenic tolerance in Pseudomonas putida KT2440.
Fernández, Matilde; Udaondo, Zulema; Niqui, José-Luis; Duque, Estrella; Ramos, Juan-Luis
2014-10-01
The chromosome of Pseudomonas putida KT2440 carries two clusters of genes, denoted ars1 and ars2, that are annotated as putative arsenic resistance operons. In this work, we present evidence that both operons encode functional arsenic-response regulatory genes as well as arsenic extrusion systems that confer resistance to both arsenite [As(III)] and arsenate [As(V)]. Transcriptional fusions of P(ars1) and P(ars2) to lacZ revealed that expression of both operons was induced by arsenite and arsenate. We generated single mutants in ars1 and ars2, which showed lower resistance to arsenic than the wild-type strain. A double ars1/ars2 was found to be highly sensitive to arsenic. Minimum inhibitory concentrations (MICs) for single mutants decreased two- to fourfold with respect to the parental strain, while in the double mutant the MIC decreased 128-fold for arsenite and 32-fold for arsenate. Bioinformatic analysis revealed that the ars2 resistance operon is part of the core genome of P. putida, while the ars1 operon appears to only occur in the KT2440 strain, suggesting that ars1 was acquired by horizontal gene transfer. The presence of ars1 in KT2440 may explain why it exhibits higher resistance to arsenic than other P. putida strains, which bear only the ars2 operon.
Elliott, T
1992-01-01
This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.
Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe
2018-05-28
In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.
Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T
2016-10-01
Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.
2013-01-01
β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479
Jiang, Bei; Xiao, Bo; Liu, Linde; Ge, Yihe; Hu, Xiaomei
2016-01-01
Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1) and phz2 (phzA2B2C2D2E2F2G2)] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1. PMID:26735915
Nakada, Yuji; Jiang, Ying; Nishijyo, Takayuki; Itoh, Yoshifumi; Lu, Chung-Dar
2001-01-01
Pseudomonas aeruginosa PAO1 utilizes agmatine as the sole carbon and nitrogen source via two reactions catalyzed successively by agmatine deiminase (encoded by aguA; also called agmatine iminohydrolase) and N-carbamoylputrescine amidohydrolase (encoded by aguB). The aguBA and adjacent aguR genes were cloned and characterized. The predicted AguB protein (Mr 32,759; 292 amino acids) displayed sequence similarity (≤60% identity) to enzymes of the β-alanine synthase/nitrilase family. While the deduced AguA protein (Mr 41,190; 368 amino acids) showed no significant similarity to any protein of known function, assignment of agmatine deiminase to AguA in this report discovered a new family of carbon-nitrogen hydrolases widely distributed in organisms ranging from bacteria to Arabidopsis. The aguR gene encoded a putative regulatory protein (Mr 24,424; 221 amino acids) of the TetR protein family. Measurements of agmatine deiminase and N-carbamoylputrescine amidohydrolase activities indicated the induction effect of agmatine and N-carbamoylputrescine on expression of the aguBA operon. The presence of an inducible promoter for the aguBA operon in the aguR-aguB intergenic region was demonstrated by lacZ fusion experiments, and the transcription start of this promoter was localized 99 bp upstream from the initiation codon of aguB by S1 nuclease mapping. Experiments with knockout mutants of aguR established that expression of the aguBA operon became constitutive in the aguR background. Interaction of AguR overproduced in Escherichia coli with the aguBA regulatory region was demonstrated by gel retardation assays, supporting the hypothesis that AguR serves as the negative regulator of the aguBA operon, and binding of agmatine and N-carbamoylputrescine to AguR would antagonize its repressor function. PMID:11673419
Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†
Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.
2003-01-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D
1996-01-01
The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231
Chanda, Palas Kumar; Ganguly, Tridib; Das, Malabika; Lee, Chia Yen; Luong, Thanh T; Sau, Subrata
2007-11-30
Previously it was reported that promoter of groES-groEL operon of Staphylococcus aureus is induced by various cell-wall active antibiotics. In order to exploit the above promoter for identifying novel antistaphylococcal drugs, we have cloned the promoter containing region (P(g)) of groES-groEL operon of S. aureus Newman and found that the above promoter is induced by sublethal concentrations of many antibiotics including cell-wall active antibiotics. A reporter S. aureus RN4220 strain (designated SAU006) was constructed by inserting the P(g)-lacZ transcriptional fusion into its chromosome. Agarose-based assay developed with SAU006 shows that P(g) in single-copy is also induced distinctly by different classes of antibiotics. Data indicate that ciprofloxacin, rifampicin, ampicillin, and cephalothin are strong inducers, whereas, tetracycline, streptomycin and vancomycin induce the above promoter weakly. Sublethal concentrations of ciprofloxacin and ampicilin even have induced P(g) efficiently in microtiter plate grown SAU006. Additional studies show for the first time that above promoter is also induced weakly by arsenate salt and hydrogen peroxide. Taken together, we suggest that our simple and sensitive assay systems with SAU006 could be utilized for screening and detecting not only novel antistaphylococcal compounds but also different toxic chemicals.
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.
2013-01-01
Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm
Wang, Guohao; Xu, Yuquan
2012-01-01
Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817
The rpoE operon regulates heat stress response in Burkholderia pseudomallei.
Vanaporn, Muthita; Vattanaviboon, Paiboon; Thongboonkerd, Visith; Korbsrisate, Sunee
2008-07-01
Burkholderia pseudomallei is a gram-negative bacterium and the causative agent of melioidosis, one of the important lethal diseases in tropical regions. In this article, we demonstrate the crucial role of the B. pseudomallei rpoE locus in the response to heat stress. The rpoE operon knockout mutant exhibited growth retardation and reduced survival when exposed to a high temperature. Expression analysis using rpoH promoter-lacZ fusion revealed that heat stress induction of rpoH, which encodes heat shock sigma factor (sigma(H)), was abolished in the B. pseudomallei rpoE mutant. Analysis of the rpoH promoter region revealed sequences sharing high homology to the consensus sequence of sigma(E)-dependent promoters. Moreover, the putative heat-induced sigma(H)-regulated heat shock proteins (i.e. GroEL and HtpG) were also absent in the rpoE operon mutant. Altogether, our data suggest that the rpoE operon regulates B. pseudomallei heat stress response through the function of rpoH.
Operon-mapper: A Web Server for Precise Operon Identification in Bacterial and Archaeal Genomes.
Taboada, Blanca; Estrada, Karel; Ciria, Ricardo; Merino, Enrique
2018-06-19
Operon-mapper is a web server that accurately, easily, and directly predicts the operons of any bacterial or archaeal genome sequence. The operon predictions are based on the intergenic distance of neighboring genes as well as the functional relationships of their protein-coding products. To this end, Operon-mapper finds all the ORFs within a given nucleotide sequence, along with their genomic coordinates, orthology groups, and functional relationships. We believe that Operon-mapper, due to its accuracy, simplicity and speed, as well as the relevant information that it generates, will be a useful tool for annotating and characterizing genomic sequences. http://biocomputo.ibt.unam.mx/operon_mapper/.
Detecting uber-operons in prokaryotic genomes
Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying
2006-01-01
We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: , the first of its kind. PMID:16682449
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34†
Grass, Gregor; Große, Cornelia; Nies, Dietrich H.
2000-01-01
Ralstonia sp. strain CH34 is resistant to nickel and cobalt cations. Resistance is mediated by the cnr determinant located on plasmid pMOL28. The cnr genes are organized in two clusters, cnrYXH and cnrCBA. As revealed by reverse transcriptase PCR and primer extension, transcription from these operons is initiated from promoters located upstream of the cnrY and cnrC genes. These two promoters exhibit conserved sequences at the −10 (CCGTATA) and −35 (CRAGGGGRAG) regions. The CnrH gene product, which is required for expression of both operons, is a sigma factor belonging to the sigma L family, whose activity seems to be governed by the membrane-bound CnrY and CnrX gene products in response to Ni2+. Half-maximal activation from the cnrCBA operon was determined by using appropriate lacZ gene fusions and was shown to occur at an Ni2+ concentration of about 50 μM. PMID:10671463
Detecting uber-operons in prokaryotic genomes.
Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying
2006-01-01
We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.
Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann
2015-01-01
The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.
Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann
2016-01-01
The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting. PMID:26858693
An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.
Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K
2003-01-01
The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.
Evidence against the selfish operon theory.
Pál, Csaba; Hurst, Laurence D
2004-06-01
According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.
Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo
2002-03-01
Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.
Organization of tcp, acf, and toxT genes within a ToxT-dependent operon.
Brown, R C; Taylor, R K
1995-05-01
The toxin coregulated pilus (TCP) is required for Vibrio cholerae to colonize the human intestine. The expression of the pilin gene, tcpA, is dependent upon ToxR and upon ToxT. The toxT gene was recently mapped within the TCP biogenesis gene cluster and shown to be capable of activating a tcpA::TnphoA fusion when cloned in Escherichia coli. In this study, we determined that ToxR/ToxT activation occurs at the level of tcpA transcription. ToxT expressed in E. coli could activate a tcp operon fusion, while ToxR, ToxR with ToxS, or a ToxR-PhoA fusion failed to activate the tcp operon fusion and we could not demonstrate binding of a ToxR extract to the tcpA promoter region in DNA mobility-shift assays. The start site for the regulated promoter was shown by primer extension to lie 75 bp upstream of the first codon of tcpA. An 800-base tcpA message was identified, by Northern analysis, that correlates by size to the distance between the transcriptional start and a hairpin-loop sequence between tcpA and tcpB. The more-sensitive assay of RNase protection analysis demonstrated that a regulated transcript probably extends through the rest of the downstream tcp genes, including toxT and the adjacent accessory colonization factor (acf) genes. An in-frame tcpA deletion, but not a polar tcpA::TnphoA fusion, could be complemented for pilus surface expression by providing tcpA in trans. This evidence suggests that the tcp genes, including toxT, are organized in an operon directly activated by ToxT in a ToxR-dependent manner. Most of the toxT expression under induced conditions requires transcription of the tcpA promoter. Further investigation of how tcp::TnphoA insertions that are polar on toxT expression retain regulation showed that a low basal level of toxT expression is present in toxR and tcp::TnphoA strains. Overall, these observations support the ToxR/ToxT cascade of regulation for tcp. Once induced, toxT expression becomes autoregulatory via the tcp promoter, linking tcp
Evolutionary dynamics of nematode operons: easy come, slow go.
Qian, Wenfeng; Zhang, Jianzhi
2008-03-01
Operons are widespread in prokaryotes, but are uncommon in eukaryotes, except nematode worms, where approximately 15% of genes reside in over 1100 operons in the model organism Caenorhabditis elegans. It is unclear how operons have become abundant in nematode genomes. The "one-way street" hypothesis asserts that once formed by chance, operons are very difficult to break, because the breakage would leave downstream genes in an operon without a promoter, and hence, unexpressed. To test this hypothesis, we analyzed the presence and absence of C. elegans operons in Caenorhabditis briggsae, Caenorhabditis remanei, and Caenorhabditis brenneri, using Pristionchus pacificus and Brugia malayi as outgroups, and identified numerous operon gains and losses. Coupled with experimental examination of trans-splicing patterns, our comparative genomic analysis revealed diverse molecular mechanisms of operon losses, including inversion, insertion, and relocation, but the presence of internal promoters was not found to facilitate operon losses. In several cases, the data allowed inference of mechanisms by which downstream genes are expressed after operon breakage. We found that the rate of operon gain is approximately 3.3 times that of operon loss. Thus, the evolutionary dynamics of nematode operons is better described as "easy come, slow go," rather than a "one-way street." Based on a mathematic model of operon gains and losses and additional assumptions, we projected that the number of operons in C. elegans will continue to rise by 6%-18% in future evolution before reaching equilibrium between operon gains and losses.
Problem-Solving Test: Tryptophan Operon Mutants
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2010-01-01
This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…
Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.
Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J
1996-07-01
A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene.
Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.
Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J
1996-01-01
A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene. PMID:8763940
Zabeau, M; Stanley, K K
1982-01-01
Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
A global analysis of adaptive evolution of operons in cyanobacteria.
Memon, Danish; Singh, Abhay K; Pakrasi, Himadri B; Wangikar, Pramod P
2013-02-01
Operons are an important feature of prokaryotic genomes. Evolution of operons is hypothesized to be adaptive and has contributed significantly towards coordinated optimization of functions. Two conflicting theories, based on (i) in situ formation to achieve co-regulation and (ii) horizontal gene transfer of functionally linked gene clusters, are generally considered to explain why and how operons have evolved. Furthermore, effects of operon evolution on genomic traits such as intergenic spacing, operon size and co-regulation are relatively less explored. Based on the conservation level in a set of diverse prokaryotes, we categorize the operonic gene pair associations and in turn the operons as ancient and recently formed. This allowed us to perform a detailed analysis of operonic structure in cyanobacteria, a morphologically and physiologically diverse group of photoautotrophs. Clustering based on operon conservation showed significant similarity with the 16S rRNA-based phylogeny, which groups the cyanobacterial strains into three clades. Clade C, dominated by strains that are believed to have undergone genome reduction, shows a larger fraction of operonic genes that are tightly packed in larger sized operons. Ancient operons are in general larger, more tightly packed, better optimized for co-regulation and part of key cellular processes. A sub-clade within Clade B, which includes Synechocystis sp. PCC 6803, shows a reverse trend in intergenic spacing. Our results suggest that while in situ formation and vertical descent may be a dominant mechanism of operon evolution in cyanobacteria, optimization of intergenic spacing and co-regulation are part of an ongoing process in the life-cycle of operons.
A phylogenomic analysis of the Actinomycetales mce operons.
Casali, Nicola; Riley, Lee W
2007-02-26
The genome of Mycobacterium tuberculosis harbors four copies of a cluster of genes termed mce operons. Despite extensive research that has demonstrated the importance of these operons on infection outcome, their physiological function remains obscure. Expanding databases of complete microbial genome sequences facilitate a comparative genomic approach that can provide valuable insight into the role of uncharacterized proteins. The M. tuberculosis mce loci each include two yrbE and six mce genes, which have homology to ABC transporter permeases and substrate-binding proteins, respectively. Operons with an identical structure were identified in all Mycobacterium species examined, as well as in five other Actinomycetales genera. Some of the Actinomycetales mce operons include an mkl gene, which encodes an ATPase resembling those of ABC uptake transporters. The phylogenetic profile of Mkl orthologs exactly matched that of the Mce and YrbE proteins. Through topology and motif analyses of YrbE homologs, we identified a region within the penultimate cytoplasmic loop that may serve as the site of interaction with the putative cognate Mkl ATPase. Homologs of the exported proteins encoded adjacent to the M. tuberculosis mce operons were detected in a conserved chromosomal location downstream of the majority of Actinomycetales operons. Operons containing linked mkl, yrbE and mce genes, resembling the classic organization of an ABC importer, were found to be common in Gram-negative bacteria and appear to be associated with changes in properties of the cell surface. Evidence presented suggests that the mce operons of Actinomycetales species and related operons in Gram-negative bacteria encode a subfamily of ABC uptake transporters with a possible role in remodeling the cell envelope.
A phylogenomic analysis of the Actinomycetales mce operons
Casali, Nicola; Riley, Lee W
2007-01-01
Background The genome of Mycobacterium tuberculosis harbors four copies of a cluster of genes termed mce operons. Despite extensive research that has demonstrated the importance of these operons on infection outcome, their physiological function remains obscure. Expanding databases of complete microbial genome sequences facilitate a comparative genomic approach that can provide valuable insight into the role of uncharacterized proteins. Results The M. tuberculosis mce loci each include two yrbE and six mce genes, which have homology to ABC transporter permeases and substrate-binding proteins, respectively. Operons with an identical structure were identified in all Mycobacterium species examined, as well as in five other Actinomycetales genera. Some of the Actinomycetales mce operons include an mkl gene, which encodes an ATPase resembling those of ABC uptake transporters. The phylogenetic profile of Mkl orthologs exactly matched that of the Mce and YrbE proteins. Through topology and motif analyses of YrbE homologs, we identified a region within the penultimate cytoplasmic loop that may serve as the site of interaction with the putative cognate Mkl ATPase. Homologs of the exported proteins encoded adjacent to the M. tuberculosis mce operons were detected in a conserved chromosomal location downstream of the majority of Actinomycetales operons. Operons containing linked mkl, yrbE and mce genes, resembling the classic organization of an ABC importer, were found to be common in Gram-negative bacteria and appear to be associated with changes in properties of the cell surface. Conclusion Evidence presented suggests that the mce operons of Actinomycetales species and related operons in Gram-negative bacteria encode a subfamily of ABC uptake transporters with a possible role in remodeling the cell envelope. PMID:17324287
Hypermutation in derepressed operons of Escherichia coli K12
Wright, Barbara E.; Longacre, Angelika; Reimers, Jacqueline M.
1999-01-01
This article presents evidence that starvation for leucine in an Escherichia coli auxotroph triggers metabolic activities that specifically target the leu operon for derepression, increased rates of transcription, and mutation. Derepression of the leu operon was a prerequisite for its activation by the signal nucleotide, guanosine tetraphosphate, which accumulates in response to nutritional stress (the stringent response). A quantitative correlation was established between leuB mRNA abundance and leuB− reversion rates. To further demonstrate that derepression increased mutation rates, the chromosomal leu operon was placed under the control of the inducible tac promoter. When the leu operon was induced by isopropyl-d-thiogalactoside, both leuB mRNA abundance and leuB− reversion rates increased. These investigations suggest that guanosine tetraphosphate may contribute as much as attenuation in regulating leu operon expression and that higher rates of mutation are specifically associated with the derepressed leu operon. PMID:10220423
Teaching the Big Ideas of Biology with Operon Models
ERIC Educational Resources Information Center
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
Gene context conservation of a higher order than operons.
Lathe, W C; Snel, B; Bork, P
2000-10-01
Operons, co-transcribed and co-regulated contiguous sets of genes, are poorly conserved over short periods of evolutionary time. The gene order, gene content and regulatory mechanisms of operons can be very different, even in closely related species. Here, we present several lines of evidence which suggest that, although an operon and its individual genes and regulatory structures are rearranged when comparing the genomes of different species, this rearrangement is a conservative process. Genomic rearrangements invariably maintain individual genes in very specific functional and regulatory contexts. We call this conserved context an uber-operon.
High accuracy operon prediction method based on STRING database scores.
Taboada, Blanca; Verde, Cristina; Merino, Enrique
2010-07-01
We present a simple and highly accurate computational method for operon prediction, based on intergenic distances and functional relationships between the protein products of contiguous genes, as defined by STRING database (Jensen,L.J., Kuhn,M., Stark,M., Chaffron,S., Creevey,C., Muller,J., Doerks,T., Julien,P., Roth,A., Simonovic,M. et al. (2009) STRING 8-a global view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res., 37, D412-D416). These two parameters were used to train a neural network on a subset of experimentally characterized Escherichia coli and Bacillus subtilis operons. Our predictive model was successfully tested on the set of experimentally defined operons in E. coli and B. subtilis, with accuracies of 94.6 and 93.3%, respectively. As far as we know, these are the highest accuracies ever obtained for predicting bacterial operons. Furthermore, in order to evaluate the predictable accuracy of our model when using an organism's data set for the training procedure, and a different organism's data set for testing, we repeated the E. coli operon prediction analysis using a neural network trained with B. subtilis data, and a B. subtilis analysis using a neural network trained with E. coli data. Even for these cases, the accuracies reached with our method were outstandingly high, 91.5 and 93%, respectively. These results show the potential use of our method for accurately predicting the operons of any other organism. Our operon predictions for fully-sequenced genomes are available at http://operons.ibt.unam.mx/OperonPredictor/.
Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.
Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent withmore » the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.« less
Glycopeptide Resistance vanA Operons in Paenibacillus Strains Isolated from Soil
Guardabassi, Luca; Perichon, Bruno; van Heijenoort, Jean; Blanot, Didier; Courvalin, Patrice
2005-01-01
The sequence and gene organization of the van operons in vancomycin (MIC of >256 μg/ml)- and teicoplanin (MIC of ≥32 μg/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX), and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and vanB operons. The vanAPT operon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA operons whereas vanAPA in P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanAPA by PCR mapping, restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of pentadepsipeptide peptidoglycan precursors ending in d-Ala-d-Lac, as demonstrated by d,d-dipeptidase activities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved from a common ancestor. PMID:16189102
Glycopeptide resistance vanA operons in Paenibacillus strains isolated from soil.
Guardabassi, Luca; Perichon, Bruno; van Heijenoort, Jean; Blanot, Didier; Courvalin, Patrice
2005-10-01
The sequence and gene organization of the van operons in vancomycin (MIC of >256 microg/ml)- and teicoplanin (MIC of > or =32 microg/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX), and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and vanB operons. The vanA(PT) operon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA operons whereas vanA(PA) in P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanA(PA) by PCR mapping, restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of pentadepsipeptide peptidoglycan precursors ending in D-Ala-D-Lac, as demonstrated by D,D-dipeptidase activities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved from a common ancestor.
Souza, André L F; Invitti, Adriana L; Rego, Fabiane G M; Monteiro, Rose A; Klassen, Giseli; Souza, Emanuel M; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2010-02-01
The pathway of electron transport to nitrogenase in the endophytic beta-Proteobacterium Herbaspirillum seropedicae has not been characterized. We have generated mutants in two nif-associated genes encoding putative ferredoxins, fdxA and fdxN. The fdxA gene is part of the operon nifHDKENXorf1orf2fdxAnifQmodABC and is transcribed from the nifH promoter, as revealed by lacZ gene fusion. The fdxN gene is probably cotranscribed with the nifB gene. Mutational analysis suggests that the FdxA protein is essential for maximum nitrogenase activity, since the nitrogenase activity of the fdxA mutant strain was reduced to about 30% of that of the wild-type strain. In addition, the fdxA mutation had no effect on the nitrogenase switch-off in response to ammonium. Nitrogenase activity of a mutant strain lacking the fdxN gene was completely abolished. This phenotype was reverted by complementation with fdxN expressed under lacZ promoter control. The results suggest that the products of both the fdxA and fdxN genes are probably involved in electron transfer during nitrogen fixation.
Sequence and features of the tryptophan operon of Vibrio parahemolyticus.
Crawford, I P; Han, C Y; Silverman, M
1991-01-01
The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.
Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.
Lawrence, J
1999-12-01
The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.
Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus.
Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P
2006-05-01
Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with D-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. D-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating D-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na(+) and moderate concentrations of Mg(2+) and Ca(2+) but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg(2+)-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg(2+)-induced repression of the dlt operon in S. aureus.
Cation-Induced Transcriptional Regulation of the dlt Operon of Staphylococcus aureus
Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P.
2006-01-01
Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with d-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. d-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating d-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na+ and moderate concentrations of Mg2+ and Ca2+ but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg2+-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg2+-induced repression of the dlt operon in S. aureus. PMID:16672616
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are
Operon Conservation and the Evolution of trans-Splicing in the Phylum Nematoda
Guiliano, David B; Blaxter, Mark L
2006-01-01
The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution of polycistronic pre-mRNAs. Conserved operons were found in Pristionchus pacificus, Nippostrongylus brasiliensis, Strongyloides ratti, Brugia malayi, and Ascaris suum. In nematodes closely related to the rhabditine C. elegans, a related family of SL2-like spliced leaders is used for operonic transcript resolution. However, in the tylenchine S. ratti operonic transcripts are resolved using a family of spliced leaders related to SL1. Non-operonic genes in S. ratti may also receive these SL1 variants. In the spirurine nematodes B. malayi and A. suum operonic transcripts are resolved using SL1. Mapping these phenotypes onto the robust molecular phylogeny for the Nematoda suggests that operons evolved before SL2-like spliced leaders, which are an evolutionary invention of the rhabditine lineage. PMID:17121468
Solving a discrete model of the lac operon using Z3
NASA Astrophysics Data System (ADS)
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro
2010-11-01
Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization
NASA Astrophysics Data System (ADS)
Igoshin, Oleg
2011-03-01
Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.
Evidence for Moonlighting Functions of the θ Subunit of Escherichia coli DNA Polymerase III
Dietrich, M.; Pedró, L.; García, J.; Pons, M.; Hüttener, M.; Paytubi, S.; Madrid, C.
2014-01-01
The holE gene is an enterobacterial ORFan gene (open reading frame [ORF] with no detectable homology to other ORFs in a database). It encodes the θ subunit of the DNA polymerase III core complex. The precise function of the θ subunit within this complex is not well established, and loss of holE does not result in a noticeable phenotype. Paralogs of holE are also present on many conjugative plasmids and on phage P1 (hot gene). In this study, we provide evidence indicating that θ (HolE) exhibits structural and functional similarities to a family of nucleoid-associated regulatory proteins, the Hha/YdgT-like proteins that are also encoded by enterobacterial ORFan genes. Microarray studies comparing the transcriptional profiles of Escherichia coli holE, hha, and ydgT mutants revealed highly similar expression patterns for strains harboring holE and ydgT alleles. Among the genes differentially regulated in both mutants were genes of the tryptophanase (tna) operon. The tna operon consists of a transcribed leader region, tnaL, and two structural genes, tnaA and tnaB. Further experiments with transcriptional lacZ fusions (tnaL::lacZ and tnaA::lacZ) indicate that HolE and YdgT downregulate expression of the tna operon by possibly increasing the level of Rho-dependent transcription termination at the tna operon's leader region. Thus, for the first time, a regulatory function can be attributed to HolE, in addition to its role as structural component of the DNA polymerase III complex. PMID:24375106
Wu, Chenggang; Ayala, Eduardo A.; Downey, Jennifer S.; Merritt, Justin; Goodman, Steven D.; Qi, Fengxia
2010-01-01
The ciaRH operon in Streptococcus mutans contains 3 contiguous genes, ciaXRH. Unlike the CiaRH system in other streptococci, only the ciaH-null mutant displays defective phenotypes, while the ciaR-null mutant behaves like the wild type. The objective of this study was to determine the mechanism of this unusual property. We demonstrate that the ciaH mutation caused a >20-fold increase in ciaR transcript synthesis. A ciaRH double deletion reversed the ciaH phenotype, suggesting that overexpressed ciaR might be responsible for the observed ciaH phenotypes. When ciaR was forced to be overexpressed by a transcriptional fusion to the ldh promoter in the wild-type background, the same ciaH phenotypes were restored, confirming the involvement of overexpressed ciaR in the ciaH phenotypes. The ciaH mutation and ciaR overexpression also caused transcriptional alterations in 100 genes, with 15 genes upregulated >5-fold. Bioinformatics analysis identified a putative CiaR regulon consisting of 8 genes/operons, including the ciaXRH operon itself, all of which were upregulated. In vitro footprinting on 4 of the 8 promoters revealed a protected region of 26 to 28 bp encompassing two direct repeats, NTTAAG-n5-WTTAAG, 10 bp upstream of the −10 region, indicating direct binding of the CiaR protein to these promoters. Taken together, we conclude that overexpressed CiaR, as a result of either ciaH deletion or forced expression from a constitutive promoter, is a mediator in the CiaH-regulated phenotypes. PMID:20639331
A Novel Method for Accurate Operon Predictions in All SequencedProkaryotes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Price, Morgan N.; Huang, Katherine H.; Alm, Eric J.
2004-12-01
We combine comparative genomic measures and the distance separating adjacent genes to predict operons in 124 completely sequenced prokaryotic genomes. Our method automatically tailors itself to each genome using sequence information alone, and thus can be applied to any prokaryote. For Escherichia coli K12 and Bacillus subtilis, our method is 85 and 83% accurate, respectively, which is similar to the accuracy of methods that use the same features but are trained on experimentally characterized transcripts. In Halobacterium NRC-1 and in Helicobacterpylori, our method correctly infers that genes in operons are separated by shorter distances than they are in E.coli, andmore » its predictions using distance alone are more accurate than distance-only predictions trained on a database of E.coli transcripts. We use microarray data from sixphylogenetically diverse prokaryotes to show that combining intergenic distance with comparative genomic measures further improves accuracy and that our method is broadly effective. Finally, we survey operon structure across 124 genomes, and find several surprises: H.pylori has many operons, contrary to previous reports; Bacillus anthracis has an unusual number of pseudogenes within conserved operons; and Synechocystis PCC6803 has many operons even though it has unusually wide spacings between conserved adjacent genes.« less
The groESL Chaperone Operon of Lactobacillus johnsonii†
Walker, D. Carey; Girgis, Hany S.; Klaenhammer, Todd R.
1999-01-01
The Lactobacillus johnsonii VPI 11088 groESL operon was localized on the chromosome near the insertion element IS1223. The operon was initially cloned as a series of three overlapping PCR fragments, which were sequenced and used to design primers to amplify the entire operon. The amplified fragment was used as a probe to recover the chromosomal copy of the groESL operon from a partial library of L. johnsonii VPI 11088 (NCK88) DNA, cloned in the shuttle vector pTRKH2. The 2,253-bp groESL fragment contained three putative open reading frames, two of which encoded the ubiquitous GroES and GroEL chaperone proteins. Analysis of the groESL promoter region revealed three transcription initiation sites, as well as three sets of inverted repeats (IR) positioned between the transcription and translation start sites. Two of the three IR sets bore significant homology to the CIRCE elements, implicated in negative regulation of the heat shock response in many bacteria. Northern analysis and primer extension revealed that multiple temperature-sensitive promoters preceded the groESL chaperone operon, suggesting that stress protein production in L. johnsonii is strongly regulated. Maximum groESL transcription activity was observed following a shift to 55°C, and a 15 to 30-min exposure of log-phase cells to this temperature increased the recovery of freeze-thawed L. johnsonii VPI 11088. These results suggest that a brief, preconditioning heat shock can be used to trigger increased chaperone production and provide significant cross-protection from the stresses imposed during the production of frozen culture concentrates. PMID:10388700
Chen, Juhong; Alcaine, Samuel D; Jackson, Angelyca A; Rotello, Vincent M; Nugen, Sam R
2017-04-28
T7 bacteriophages (phages) have been genetically engineered to carry the lacZ operon, enabling the overexpression of beta-galactosidase (β-gal) during phage infection and allowing for the enhanced colorimetric detection of Escherichia coli (E. coli). Following the phage infection of E. coli, the enzymatic activity of the released β-gal was monitored using a colorimetric substrate. Compared with a control T7 phage, our T7 lacZ phage generated significantly higher levels of β-gal expression following phage infection, enabling a lower limit of detection for E. coli cells. Using this engineered T7 lacZ phage, we were able to detect E. coli cells at 10 CFU·mL -1 within 7 h. Furthermore, we demonstrated the potential for phage-based sensing of bacteria antibiotic resistance profiling using our T7 lacZ phage, and subsequent β-gal expression to detect antibiotic resistant profile of E. coli strains.
Zhao, Chungui; Zhang, Yi; Chan, Zhuhua; Chen, Shicheng; Yang, Suping
2015-01-01
Arsenic (As) is widespread in the environment and causes numerous health problems. Rhodopseudomonas palustris has been regarded as a good model organism for studying arsenic detoxification since it was first demonstrated to methylate environmental arsenic by conversion to soluble or gaseous methylated species. However, the detailed arsenic resistance mechanisms remain unknown though there are at least three arsenic-resistance operons (ars1, ars2, and ars3) in R. palustris. In this study, we investigated how arsenic multi-operons contributed to arsenic detoxification in R. palustris. The expression of ars2 or ars3 operons increased with increasing environmental arsenite (As(III)) concentrations (up to 1.0 mM) while transcript of ars1 operon was not detected in the middle log-phase (55 h). ars2 operon was actively expressed even at the low concentration of As(III) (0.01 μM), whereas the ars3 operon was expressed at 1.0 μM of As(III), indicating that there was a differential regulation mechanism for the three arsenic operons. Furthermore, ars2 and ars3 operons were maximally transcribed in the early log-phase where ars2 operon was 5.4-fold higher than that of ars3 operon. A low level of ars1 transcript was only detected at 43 h (early log-phase). Arsenic speciation analysis demonstrated that R. palustris could reduce As(V) to As(III). Collectively, strain CGA009 detoxified arsenic by using arsenic reduction and methylating arsenic mechanism, while the latter might occur with the presence of higher concentrations of arsenic. PMID:26441915
mar Operon Involved in Multidrug Resistance of Enterobacter aerogenes
Chollet, Renaud; Bollet, Claude; Chevalier, Jacqueline; Malléa, Monique; Pagès, Jean-Marie; Davin-Regli, Anne
2002-01-01
We determined the sequence of the entire marRAB operon in Enterobacter aerogenes. It is functionally and structurally analogous to the Escherichia coli operon. The overexpression of E. aerogenes MarA induces a multidrug resistance phenotype in a susceptible strain, demonstrated by a noticeable resistance to various antibiotics, a decrease in immunodetected porins, and active efflux of norfloxacin. PMID:11897595
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.
2001-01-01
The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085
Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T
2011-06-01
Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.
Man, T K; Pease, A J; Winkler, M E
1997-06-01
The arrangement of the Escherichia coli serC (pdxF) and aroA genes into a cotranscribed multifunctional operon allows coregulation of two enzymes required for the biosynthesis of L-serine, pyridoxal 5'-phosphate, chorismate, and the aromatic amino acids and vitamins. RNase T2 protection assays revealed two major transcripts that were initiated from a promoter upstream from serC (pdxF). Between 80 to 90% of serC (pdxF) transcripts were present in single-gene mRNA molecules that likely arose by Rho-independent termination between serC (pdxF) and aroA. serC (pdxF)-aroA cotranscripts terminated at another Rho-independent terminator near the end of aroA. We studied operon regulation by determining differential rates of beta-galactosidase synthesis in a merodiploid strain carrying a single-copy lambda[phi(serC [pdxF]'-lacZYA)] operon fusion. serC (pdxF) transcription was greatest in bacteria growing in minimal salts-glucose medium (MMGlu) and was reduced in minimal salts-glycerol medium, enriched MMGlu, and LB medium. serC (pdxF) transcription was increased in cya or crp mutants compared to their cya+ crp+ parent in MMGlu or LB medium. In contrast, serC (pdxF) transcription decreased in an lrp mutant compared to its lrp+ parent in MMGlu. Conclusions obtained by using the operon fusion were corroborated by quantitative Western immunoblotting of SerC (PdxF), which was present at around 1,800 dimers per cell in bacteria growing in MMGlu. RNase T2 protection assays of serC (pdxF)-terminated and serC (pdxF)-aroA cotranscript amounts supported the conclusion that the operon was regulated at the transcription level under the conditions tested. Results with a series of deletions upstream of the P(serC (pdxF)) promoter revealed that activation by Lrp was likely direct, whereas repression by the cyclic AMP (cAMP) receptor protein-cAMP complex (CRP-cAMP) was likely indirect, possibly via a repressor whose amount or activity was stimulated by CRP-cAMP.
Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.
Cowing, D W; Kenyon, C
1992-10-01
mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.
Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.
Dana, Catherine E; Glauber, Kristine M; Chan, Titus A; Bridge, Diane M; Steele, Robert E
2012-01-01
Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp) that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.
Escherichia coli mutant with altered respiratory control of the frd operon.
Iuchi, S; Kuritzkes, D R; Lin, E C
1985-01-01
In wild-type Escherichia coli, fumarate reductase encoded by the frd operon is inducible by its substrate in the absence of molecular oxygen and nitrate. Synthesis of this enzyme under permissive conditions requires the fnr+ gene product, which is believed to be a pleiotropic regulatory protein that activates transcription. A spontaneous mutant was isolated in which the expression of the frd operon no longer depended on the presence of fumarate or the fnr+ gene product. Aerobic repression of the operon was abolished, but nitrate repression remained intact. Transductional analysis showed that the mutation was closely linked to the frd locus. The mutant phenotype strongly suggests that repression by molecular oxygen and nitrate is mediated by different mechanisms. PMID:3882660
Tian, Tian; Salis, Howard M.
2015-01-01
Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. PMID:26117546
Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.
2013-01-01
To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051
Iuchi, S; Cole, S T; Lin, E C
1990-01-01
In Escherichia coli, sn-glycerol-3-phosphate can be oxidized by two different flavo-dehydrogenases, an anaerobic enzyme encoded by the glpACB operon and an aerobic enzyme encoded by the glpD operon. These two operons belong to the glp regulon specifying the utilization of glycerol, sn-glycerol-3-phosphate, and glycerophosphodiesters. In glpR mutant cells grown under conditions of low catabolite repression, the glpA operon is best expressed anaerobically with fumarate as the exogenous electron acceptor, whereas the glpD operon is best expressed aerobically. Increased anaerobic expression of glpA is dependent on the fnr product, a pleiotropic activator of genes involved in anaerobic respiration. In this study we found that the expression of a glpA1(Oxr) (oxygen-resistant) mutant operon, selected for increased aerobic expression, became less dependent on the FNR protein but more dependent on the cyclic AMP-catabolite gene activator protein complex mediating catabolite repression. Despite the increased aerobic expression of glpA1(Oxr), a twofold aerobic repressibility persisted. Moreover, anaerobic repression by nitrate respiration remained normal. Thus, there seems to exist a redox control apart from the FNR-mediated one. We also showed that the anaerobic repression of the glpD operon was fully relieved by mutations in either arcA (encoding a presumptive DNA recognition protein) or arcB (encoding a presumptive redox sensor protein). The arc system is known to mediate pleiotropic control of genes of aerobic function.
Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T
2015-09-01
To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Quantitative approaches to the study of bistability in the lac operon of Escherichia coli.
Santillán, Moisés; Mackey, Michael C
2008-08-06
In this paper, the history and importance of the lac operon in the development of molecular and systems biology are briefly reviewed. We start by presenting a description of the regulatory mechanisms in this operon, taking into account the most recent discoveries. Then we offer a survey of the history of the lac operon, including the discovery of its main elements and the subsequent influence on the development of molecular and systems biology. Next the bistable behaviour of the operon is discussed, both with respect to its discovery and its molecular origin. A review of the literature in which this bistable phenomenon has been studied from a mathematical modelling viewpoint is then given. We conclude with some brief remarks.
Wegener, Marius; Vogtmann, Kristina; Huber, Madeleine; Laass, Sebastian; Soppa, Jörg
2016-12-01
Reporter genes facilitate the characterization of promoter activities, transcript stabilities, translational efficiencies, or intracellular localization. Various reporter genes for Escherichia coli have been established, however, most of them have drawbacks like transcript instability or the inability to be used in genetic selections. Therefore, the glpD gene encoding glycerol-3-phosphate dehydrogenase was introduced as a novel reporter gene for E. coli. The enzymatic assay was optimized, and it was verified that growth on glycerol strictly depends on the presence of GlpD. The 5'-UTRs of three E. coli genes were chosen and cloned upstream of the new reporter gene glpD as well as the established reporter genes lacZ and gusA. Protein and transcript levels were quantified and translational efficiencies were calculated. The lacZ transcript was very unstable and its level highly depended on its translation, compromising its use as a reporter. The results obtained with gusA and glpD were similar, however, only glpD can be used for genetic selections. Therefore, glpD was found to be a superior novel reporter gene compared to the established reporter genes lacZ and gusA. Copyright © 2016 Elsevier B.V. All rights reserved.
Michel, Gérard P F; Aguzzi, Anthony; Ball, Geneviève; Soscia, Chantal; Bleves, Sophie; Voulhoux, Romé
2011-07-01
Although classical type II secretion systems (T2SSs) are widely present in Gram-negative bacteria, atypical T2SSs can be found in some species. In Pseudomonas aeruginosa, in addition to the classical T2SS Xcp, it was reported that two genes, xphA and xqhA, located outside the xcp locus were organized in an operon (PaQa) which encodes the orphan PaQa subunit. This subunit is able to associate with other components of the classical Xcp machinery to form a functional hybrid T2SS. In the present study, using a transcriptional lacZ fusion, we found that the PaQa operon was more efficiently expressed (i) on solid LB agar than in liquid LB medium, (ii) at 25 °C than at 37 °C and (iii) at an early stage of growth. These results suggested an adaptation of the hybrid system to particular environmental conditions. Transposon mutagenesis led to the finding that vfr and fimV genes are required for optimal expression of the orphan PaQa operon in the defined growth conditions used. Using an original culturing device designed to monitor secretion on solid medium, the ring-plate system, we found that T2SS-dependent secretion of exoproteins, namely the elastase LasB, was affected in a fimV deletion mutant. Our findings led to the discovery of an interplay between FimV and the global regulator Vfr triggering the modulation of the level of Vfr and consequently the modulation of T2SS-dependent secretion on solid medium.
Perkins, J B; Bower, S; Howitt, C L; Yocum, R R; Pero, J
1996-11-01
Northern (RNA) blot analysis of the Bacillus subtilis biotin operon, bioWAFDBIorf2, detected at least two steady-state polycistronic transcripts initiated from a putative vegetative (Pbio) promoter that precedes the operon, i.e., a full-length 7.2-kb transcript covering the entire operon and a more abundant 5.1-kb transcript covering just the first five genes of the operon. Biotin and the B. subtilis birA gene product regulated synthesis of the transcripts. Moreover, replacing the putative Pbio promoter and regulatory sequence with a constitutive SP01 phage promoter resulted in higher-level constitutive synthesis. Removal of a rho-independent terminator-like sequence located between the fifth (bioB) and sixth (bioI) genes prevented accumulation of the 5.1-kb transcript, suggesting that the putative terminator functions to limit expression of bioI, which is thought to be involved in an early step in biotin synthesis.
Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia
2011-10-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.
Perkins, J B; Bower, S; Howitt, C L; Yocum, R R; Pero, J
1996-01-01
Northern (RNA) blot analysis of the Bacillus subtilis biotin operon, bioWAFDBIorf2, detected at least two steady-state polycistronic transcripts initiated from a putative vegetative (Pbio) promoter that precedes the operon, i.e., a full-length 7.2-kb transcript covering the entire operon and a more abundant 5.1-kb transcript covering just the first five genes of the operon. Biotin and the B. subtilis birA gene product regulated synthesis of the transcripts. Moreover, replacing the putative Pbio promoter and regulatory sequence with a constitutive SP01 phage promoter resulted in higher-level constitutive synthesis. Removal of a rho-independent terminator-like sequence located between the fifth (bioB) and sixth (bioI) genes prevented accumulation of the 5.1-kb transcript, suggesting that the putative terminator functions to limit expression of bioI, which is thought to be involved in an early step in biotin synthesis. PMID:8892842
Mesak, Lili R; Mesak, Felix M; Dahl, Michael K
2004-01-01
Background The Bacillus subtilis glucokinase operon was predicted to be comprised of the genes, yqgP (now named gluP), yqgQ, and glcK. We have previously established a role for glcK in glucose metabolism. In the absence of enzymes that phosphorylate glucose, such as GlcK and/or enzyme IIGlc, accumulated cytoplasmic glucose can be transported out of the cell. Genes within the glucokinase operon were not previously known to play a role in glucose transport. Here we describe the expression of gluP and its function in glucose transport. Results We found that transcription of the glucokinase operon was regulated, putatively, by two promoters: σA and σH. Putative σA and σH-recognition sites were located upstream of and within gluP, respectively. Transcriptional glucokinase operon – lacZ fusions and Northern blotting were used to analyze the expression of gluP. GluP was predicted to be an integral membrane protein. Moreover, the prediction of GluP structure revealed interesting signatures: a rhomboid domain and two tetracopeptide repeat (TPR) motifs. Microscopic analysis showed that GluP minus cells were unable to divide completely, resulting in a filamentous phenotype. The cells were grown in either rich or minimal medium. We found GluP may be involved in glucose transport. [14C]-glucose uptake by the GluP minus strain was slightly less than in the wild type. On the other hand, trehalose-derived glucose in the growth medium of the GluP minus strain was detected in very low amounts. Experimental controls comprised of single or multiple genes mutations within the glucose transporting phosphotransferase system. Conclusions gluP seems to be regulated only by a putative σA-dependent promoter. The glucose uptake and export assays suggest that GluP is important for glucose export and may act as an exporter. This also supports the role of the glucokinase operon in glucose utilization. PMID:15050034
Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.
Adebali, Ogun; Sancar, Aziz; Selby, Christopher P
2017-11-10
Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José
2013-01-01
Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.
Prevalence of transcription promoters within archaeal operons and coding sequences
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
Structure and regulation of the Yersinia pestis yscBCDEF operon.
Haddix, P L; Straley, S C
1992-01-01
We have investigated the physical and genetic structure and regulation of the Yersinia pestis yscBCDEF region, previously called lcrC. DNA sequence analysis showed that this region is homologous to the corresponding part of the ysc locus of Yersinia enterocolitica and suggested that the yscBCDEF cistrons belong to a single operon on the low-calcium response virulence plasmid pCD1. Promoter activity measurements of ysc subclones indicated that yscBCDEF constitutes a suboperon of the larger ysc region by revealing promoter activity in a clone containing the 3' end of yscD, intact yscE and yscF, and part of yscG. These experiments also revealed an additional weak promoter upstream of yscD. Northern (RNA) analysis with a yscD probe showed that operon transcription is thermally induced and downregulated in the presence of Ca2+. Primer extension of operon transcripts suggested that two promoters, a moderate-level constitutive one and a stronger, calcium-downregulated one, control full-length operon transcription at 37 degrees C. Primer extension provided additional support for the proposed designation of a yscBCDEF suboperon by identifying a 5' end within yscF, for which relative abundances in the presence and absence of Ca2+ revealed regulation that is distinct from that for transcripts initiating farther upstream. YscB and YscC were expressed in Escherichia coli by using a high-level transcription system. Attempts to express YscD were only partially successful, but they revealed interesting regulation at the translational level. Images PMID:1624469
Levitin, Anastasia; Yanofsky, Charles
2010-01-01
Tryptophan, phenylalanine, tyrosine, and several other metabolites are all synthesized from a common precursor, chorismic acid. Since tryptophan is a product of an energetically expensive biosynthetic pathway, bacteria have developed sensing mechanisms to downregulate synthesis of the enzymes of tryptophan formation when synthesis of the amino acid is not needed. In Bacillus subtilis and some other Gram-positive bacteria, trp operon expression is regulated by two proteins, TRAP (the tryptophan-activated RNA binding protein) and AT (the anti-TRAP protein). TRAP is activated by bound tryptophan, and AT synthesis is increased upon accumulation of uncharged tRNATrp. Tryptophan-activated TRAP binds to trp operon leader RNA, generating a terminator structure that promotes transcription termination. AT binds to tryptophan-activated TRAP, inhibiting its RNA binding ability. In B. subtilis, AT synthesis is upregulated both transcriptionally and translationally in response to the accumulation of uncharged tRNATrp. In this paper, we focus on explaining the differences in organization and regulatory functions of the at operon's leader peptide-coding region, rtpLP, of B. subtilis and Bacillus licheniformis. Our objective was to correlate the greater growth sensitivity of B. licheniformis to tryptophan starvation with the spacing of the three Trp codons in its at operon leader peptide-coding region. Our findings suggest that the Trp codon location in rtpLP of B. licheniformis is designed to allow a mild charged-tRNATrp deficiency to expose the Shine-Dalgarno sequence and start codon for the AT protein, leading to increased AT synthesis. PMID:20061467
A mutation in a new gene bglJ, activates the bgl operon in Escherichia coli K-12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giel, M.; Desnoyer, M.; Lopilato, J.
1996-06-01
A new mutation , bglJ4, has been characterized that results in the expression of the silent bgl operon. The bgl operon encodes proteins necessary for the transport and utilization of the aromatic {beta}-glucosides arbutin and salicin. A variety of mutations activate the operon and result in a Bgl{sup +} phenotype. Activating mutations are located upstream of the bgl promoter and in genes located elsewhere on the chromosome. Mutations outside of the bgl operon occur in the genes encoding DNA gyrase and in the gene encoding the nucleoid associated protein H-NS. The mutation described here, bglJ4, has been mapped to amore » new locus at min 99 on the Escherichia coli K-12 genetic map. The putative protein encoded by the bglJ gene has homology to a family of transcriptional activators. Evidence is presented that increased expression of the bglJ product is needed for activation of the bgl operon. 56 refs., 3 figs., 3 tabs.« less
Moreno-Letelier, Alejandra; Olmedo, Gabriela; Eguiarte, Luis E.; Martinez-Castilla, Leon; Souza, Valeria
2011-01-01
The high affinity phosphate transport system (pst) is crucial for phosphate uptake in oligotrophic environments. Cuatro Cienegas Basin (CCB) has extremely low P levels and its endemic Bacillus are closely related to oligotrophic marine Firmicutes. Thus, we expected the pst operon of CCB to share the same evolutionary history and protein similarity to marine Firmicutes. Orthologs of the pst operon were searched in 55 genomes of Firmicutes and 13 outgroups. Phylogenetic reconstructions were performed for the pst operon and 14 concatenated housekeeping genes using maximum likelihood methods. Conserved domains and 3D structures of the phosphate-binding protein (PstS) were also analyzed. The pst operon of Firmicutes shows two highly divergent clades with no correlation to the type of habitat nor a phylogenetic congruence, suggesting horizontal gene transfer. Despite sequence divergence, the PstS protein had a similar 3D structure, which could be due to parallel evolution after horizontal gene transfer events. PMID:21461370
Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron
2013-06-21
Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.
Chromosomal Organization of Rrna Operons in Bacillus Subtilis
Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.
1988-01-01
Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199
A quantitative study of the benefits of co-regulation using the spoIIA operon as an example
Iber, Dagmar
2006-01-01
The distribution of most genes is not random, and functionally linked genes are often found in clusters. Several theories have been put forward to explain the emergence and persistence of operons in bacteria. Careful analysis of genomic data favours the co-regulation model, where gene organization into operons is driven by the benefits of coordinated gene expression and regulation. Direct evidence that coexpression increases the individual's fitness enough to ensure operon formation and maintenance is, however, still lacking. Here, a previously described quantitative model of the network that controls the transcription factor σF during sporulation in Bacillus subtilis is employed to quantify the benefits arising from both organization of the sporulation genes into the spoIIA operon and from translational coupling. The analysis shows that operon organization, together with translational coupling, is important because of the inherent stochastic nature of gene expression, which skews the ratios between protein concentrations in the absence of co-regulation. The predicted impact of different forms of gene regulation on fitness and survival agrees quantitatively with published sporulation efficiencies. PMID:16924264
A quantitative study of the benefits of co-regulation using the spoIIA operon as an example.
Iber, Dagmar
2006-01-01
The distribution of most genes is not random, and functionally linked genes are often found in clusters. Several theories have been put forward to explain the emergence and persistence of operons in bacteria. Careful analysis of genomic data favours the co-regulation model, where gene organization into operons is driven by the benefits of coordinated gene expression and regulation. Direct evidence that coexpression increases the individual's fitness enough to ensure operon formation and maintenance is, however, still lacking. Here, a previously described quantitative model of the network that controls the transcription factor sigma(F) during sporulation in Bacillus subtilis is employed to quantify the benefits arising from both organization of the sporulation genes into the spoIIA operon and from translational coupling. The analysis shows that operon organization, together with translational coupling, is important because of the inherent stochastic nature of gene expression, which skews the ratios between protein concentrations in the absence of co-regulation. The predicted impact of different forms of gene regulation on fitness and survival agrees quantitatively with published sporulation efficiencies.
Bergström, S; Lindberg, F P; Olsson, O; Normark, S
1983-09-01
Specific DNA probes from Escherichia coli K-12 were used to analyze the sequence divergence of the frd and ampC operons in various species of gram-negative bacteria. These operons code for the fumarate reductase complex and the chromosomal beta-lactamase, respectively. We demonstrate that the two operons show the same general pattern of divergence, although the frd operon is considerably more conserved than is the ampC operon. The major exception is Salmonella typhimurium LT2, which shows a strong homology to the E. coli frd probe but none to the E. coli ampC probe. The operons from Citrobacter freundii and Shigella sonnei were cloned and characterized by physical mapping, Southern hybridization, and protein synthesis in minicells. In S. sonnei, as in E. coli K-12, the frd and ampC operons overlap (T. Grundström and B. Jaurin, Proc. Natl. Acad. Sci. U.S.A. 79:1111-1115, 1982). Only minor discrepancies between the two operons were found over the entire frd-ampC region. In C. freundii, the ampC and frd operons do not overlap, being separated by about 1,100 base pairs. Presumably the inducible property of the C. freundii chromosomal beta-lactamase is encoded by this 1,100-base-pair DNA segment.
Yu, Xuefei; Zheng, Wei; Bhat, Somanath; Aquilina, J. Andrew
2015-01-01
Bacillus sp. CDB3 possesses a novel eight-gene ars cluster (ars1, arsRYCDATorf7orf8) with some unusual features in regard to expression regulation. This study demonstrated that the cluster is a single operon but can also produce a short three-gene arsRYC transcript. A hairpin structure formed by internal inverted repeats between arsC and arsD was shown to diminish the expression of the full operon, thereby probably acting as a transcription attenuator. A degradation product of the arsRYC transcript was also identified. Electrophoretic mobility shift analysis demonstrated that ArsR interacts with the ars1 promoter forming a protein-DNA complex that could be impaired by arsenite. However, no interaction was detected between ArsD and the ars1 promoter, suggesting that the CDB3 ArsD protein may not play a regulatory role. Compared to other ars gene clusters, regulation of the Bacillus sp. CDB3 ars1 operon is more complex. It represents another example of specific mRNA degradation in the transporter gene region and possibly the first case of attenuator-mediated regulation of ars operons. PMID:26355338
The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.
Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A
1987-01-01
The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477
Berghofer, Y.; Klein, A.
1995-01-01
Methanococcus voltae, which contains four different gene groups that encode [NiFe]-hydrogenases, was transformed with integration vectors to achieve polar inactivation of two of the four hydrogenase operons that encode the selenium-free enzymes Vhc and Frc. Transformants which were selected by their acquired puromycin resistance showed site-specific insertions in either the vhc or frc operon by single crossover events. Southern hybridization revealed tandem integrations of whole vectors in the vhc operon, whereas only one vector copy was found in the frc operon. Northern (RNA) hybridizations showed a pac transcript of defined size, indicating strong termination in front of the hydrogenase genes downstream. In spite of the apparent abolition of expression of selenium-free hydrogenases through these polar insertions, they were not lethal to cells upon growth in selenium-deprived minimal medium, which we had previously shown to strongly induce transcription of the respective operons in M. voltae. Instead, like wild-type control cultures, transformants responded to selenium deprivation only with a reduction in growth rate. We conclude that loss of the potential to express a selenium-free hydrogenase can nevertheless be balanced by very small amounts of selenium hydrogenases under laboratory conditions in which the hydrogen supply is not likely to be a limiting growth factor. PMID:16535019
Kumar, Sanath; Smith, Kenneth P.; Floyd, Jody L.; Varela, Manuel F.
2010-01-01
A putative mannitol operon of the phosphoenolpyruvate phosphotransferase (PTS) type was cloned from Vibrio cholerae O395 and its activity studied in Escherichia coli. The 3.9 kb operon comprising of three genes is organized as mtlADR. Based on the sequence analysis, these were identified as genes encoding a putative mannitol-specific enzyme IICBA (EIIMtl) component (MtlA), a mannitol-1-phosphate dehydrogenase (MtlD) and a mannitol operon repressor (MtlR). The transport of [3H]mannitol by the cloned mannitol operon in E. coli was 13.8±1.4 nmol/min/mg protein. The insertional inactivation of EIIMtl abolished mannitol and sorbitol transport in V. cholerae O395. Comparison of the mannitol utilization apparatus of V. cholerae with those of Gram-negative and Gram positive bacteria suggests highly conserved nature of the system. MtlA and MtlD exhibit 75% similarity with corresponding sequences of E. coli mannitol operon genes, while MtlR has 63% similarity with MtlR of E. coli. The cloning of V. cholerae mannitol utilization system in an E. coli background will help in elucidating the functional properties of this operon. PMID:21184218
Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M
2014-12-01
Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.
Mata Martin, Carmen; Sun, Zhe; Zhou, Yan Ning; Jin, Ding Jun
2018-01-01
In the fast-growing Escherichia coli cells, RNA polymerase (RNAP) molecules are concentrated and form foci at clusters of ribosomal RNA (rRNA) operons resembling eukaryotic nucleolus. The bacterial nucleolus-like organization, spatially compartmentalized at the surface of the compact bacterial chromosome (nucleoid), serves as transcription factories for rRNA synthesis and ribosome biogenesis, which influences the organization of the nucleoid. Unlike wild type that has seven rRNA operons in the genome in a mutant that has six (Δ6 rrn ) rRNA operons deleted in the genome, there are no apparent transcription foci and the nucleoid becomes uncompacted, indicating that formation of RNAP foci requires multiple copies of rRNA operons clustered in space and is critical for nucleoid compaction. It has not been determined, however, whether a multicopy plasmid-borne rRNA operon (p rrnB ) could substitute the multiple chromosomal rRNA operons for the organization of the bacterial nucleolus-like structure in the mutants of Δ6 rrn and Δ7 rrn that has all seven rRNA operons deleted in the genome. We hypothesized that extrachromosomal nucleolus-like structures are similarly organized and functional in trans from p rrnB in these mutants. In this report, using multicolor images of three-dimensional superresolution Structured Illumination Microscopy (3D-SIM), we determined the distributions of both RNAP and NusB that are a transcription factor involved in rRNA synthesis and ribosome biogenesis, p rrnB clustering, and nucleoid structure in these two mutants in response to environmental cues. Our results found that the extrachromosomal nucleolus-like organization tends to be spatially located at the poles of the mutant cells. In addition, formation of RNAP foci at the extrachromosomal nucleolus-like structure condenses the nucleoid, supporting the idea that active transcription at the nucleolus-like organization is a driving force in nucleoid compaction.
Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José
2013-01-01
Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560
Williams, Bryan J.; Du, Rui-Hong; Calcutt, M. Wade; Abdolrasulnia, Rasul; Christman, Brian W.; Blackwell, Timothy S.
2013-01-01
Summary Agmatine is the decarboxylation product of arginine and a number of bacteria have devoted enzymatic pathways for its metabolism. Pseudomonas aeruginosa harbours the aguBA operon that metabolizes agmatine to putrescine, which can be subsequently converted into other polyamines or shunted into the TCA cycle for energy production. We discovered an alternate agmatine operon in the P. aeruginosa strain PA14 named agu2ABCA′ that contains two genes for agmatine deiminases (agu2A and agu2A′). This operon was found to be present in 25% of clinical P. aeruginosa isolates. Agu2A′ contains a twin-arginine translocation signal at its N-terminus and site-directed mutagenesis and cell fractionation experiments confirmed this protein is secreted to the periplasm. Analysis of the agu2ABCA′ promoter demonstrates that agmatine induces expression of the operon during the stationary phase of growth and during biofilm growth and agu2ABCA′ provides only weak complementation of aguBA, which is induced during log phase. Biofilm assays of mutants of all three agmatine deiminase genes in PA14 revealed that deletion of agu2ABCA′, specifically its secreted product Agu2A′, reduces biofilm production of PA14 following addition of exogenous agmatine. Together, these findings reveal a novel role for the agu2ABCA′ operon in the biofilm development of P. aeruginosa. PMID:20149107
Sinha, Amit; Langnick, Claudia; Sommer, Ralf J; Dieterich, Christoph
2014-09-01
Discovery of trans-splicing in multiple metazoan lineages led to the identification of operon-like gene organization in diverse organisms, including trypanosomes, tunicates, and nematodes, but the functional significance of such operons is not completely understood. To see whether the content or organization of operons serves similar roles across species, we experimentally defined operons in the nematode model Pristionchus pacificus. We performed affinity capture experiments on mRNA pools to specifically enrich for transcripts that are trans-spliced to either the SL1- or SL2-spliced leader, using spliced leader-specific probes. We obtained distinct trans-splicing patterns from the analysis of three mRNA pools (total mRNA, SL1 and SL2 fraction) by RNA-seq. This information was combined with a genome-wide analysis of gene orientation and spacing. We could confirm 2219 operons by RNA-seq data out of 6709 candidate operons, which were predicted by sequence information alone. Our gene order comparison of the Caenorhabditis elegans and P. pacificus genomes shows major changes in operon organization in the two species. Notably, only 128 out of 1288 operons in C. elegans are conserved in P. pacificus. However, analysis of gene-expression profiles identified conserved functions such as an enrichment of germline-expressed genes and higher expression levels of operonic genes during recovery from dauer arrest in both species. These results provide support for the model that a necessity for increased transcriptional efficiency in the context of certain developmental processes could be a selective constraint for operon evolution in metazoans. Our method is generally applicable to other metazoans to see if similar functional constraints regulate gene organization into operons. © 2014 Sinha et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Lohße, Anna; Ullrich, Susanne; Katzmann, Emanuel; Borg, Sarah; Wanner, Gerd; Richter, Michael; Voigt, Birgit; Schweder, Thomas; Schüler, Dirk
2011-01-01
Bacterial magnetosomes are membrane-enveloped, nanometer-sized crystals of magnetite, which serve for magnetotactic navigation. All genes implicated in the synthesis of these organelles are located in a conserved genomic magnetosome island (MAI). We performed a comprehensive bioinformatic, proteomic and genetic analysis of the MAI in Magnetospirillum gryphiswaldense. By the construction of large deletion mutants we demonstrate that the entire region is dispensable for growth, and the majority of MAI genes have no detectable function in magnetosome formation and could be eliminated without any effect. Only <25% of the region comprising four major operons could be associated with magnetite biomineralization, which correlated with high expression of these genes and their conservation among magnetotactic bacteria. Whereas only deletion of the mamAB operon resulted in the complete loss of magnetic particles, deletion of the conserved mms6, mamGFDC, and mamXY operons led to severe defects in morphology, size and organization of magnetite crystals. However, strains in which these operons were eliminated together retained the ability to synthesize small irregular crystallites, and weakly aligned in magnetic fields. This demonstrates that whereas the mamGFDC, mms6 and mamXY operons have crucial and partially overlapping functions for the formation of functional magnetosomes, the mamAB operon is the only region of the MAI, which is necessary and sufficient for magnetite biomineralization. Our data further reduce the known minimal gene set required for magnetosome formation and will be useful for future genome engineering approaches. PMID:22043287
Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria
2016-01-01
The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the
Chen, Chao-Hsien; Huang, Chiang-Ching; Chung, Tsao-Chuen; Hu, Rouh-Mei; Huang, Yi-Wei; Yang, Tsuey-Ching
2011-01-01
KJ09C, a multidrug-resistant mutant of Stenotrophomonas maltophilia KJ, was generated by in vitro selection with chloramphenicol. The multidrug-resistant phenotype of KJ09C was attributed to overexpression of a resistance nodulation division (RND)-type efflux system encoded by an operon consisting of five genes: smeU1, smeV, smeW, smeU2, and smeX. Proteins encoded by smeV, smeW, and smeX were similar to the membrane fusion protein, RND transporter, and outer membrane protein, respectively, of known RND-type systems. The proteins encoded by smeU1 and smeU2 were found to belong to the family of short-chain dehydrogenases/reductases. Mutant KJ09C exhibited increased resistance to chloramphenicol, quinolones, and tetracyclines and susceptibility to aminoglycosides; susceptibility to β-lactams and erythromycin was not affected. The expression of the smeU1-V-W-U2-X operon was regulated by the divergently transcribed LysR-type regulator gene smeRv. Overexpression of the SmeVWX pump contributed to the acquired resistance to chloramphenicol, quinolones, and tetracyclines. Inactivation of smeV and smeW completely abolished the activity of the SmeVWX pump, whereas inactivation of smeX alone decreased the activity of the SmeVWX pump. The enhanced aminoglycoside susceptibility observed in KJ09C resulted from SmeX overexpression. PMID:21930878
Induction of the mar operon by miscellaneous groceries.
Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P
2004-01-01
To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli
Hohmeier, Angela; Stone, Timothy C.; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam
2015-01-01
Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. PMID:26070674
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Zheng, Desen; Hao, Guixia; Cursino, Luciana; Zhang, Hongsheng; Burr, Thomas J
2012-09-01
The characterization of Tn5 transposon insertional mutants of Agrobacterium vitis strain F2/5 revealed a gene encoding a predicted LysR-type transcriptional regulator, lhnR (for 'LysR-type regulator associated with HR and necrosis'), and an immediate upstream operon consisting of three open reading frames (lhnABC) required for swarming motility, surfactant production and the induction of a hypersensitive response (HR) on tobacco and necrosis on grape. The operon lhnABC is unique to A. vitis among the sequenced members in Rhizobiaceae. Mutagenesis of lhnR and lhnABC by gene disruption and complementation of ΔlhnR and ΔlhnABC confirmed their roles in the expression of these phenotypes. Mutation of lhnR resulted in complete loss of HR, swarming motility, surfactant production and reduced necrosis, whereas mutation of lhnABC resulted in loss of swarming motility, delayed and reduced HR development and reduced surfactant production and necrosis. The data from promoter-green fluorescent protein (gfp) fusions showed that lhnR suppresses the expression of lhnABC and negatively autoregulates its own expression. It was also shown that lhnABC negatively affects its own expression and positively affects the transcription of lhnR. lhnR and lhnABC constitute a regulatory circuit that coordinates the transcription level of lhnR, resulting in the expression of swarming, surfactant, HR and necrosis phenotypes. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.
The rec A operon: a novel stress response gene cluster in Bacteroides fragilis
Nicholson, Samantha A; Smalley, Darren; Smith, C. Jeffrey; Abratt, Valerie R
2014-01-01
Bacteroides fragilis, an opportunistic pathogen of humans, is a leading cause of bacteraemias and anaerobic abscesses which are often treated with metronidazole, a drug which damages DNA. This study investigated the responses of the B. fragilis recA three gene operon to the stress experienced during metronidazole treatment and exposure to reactive oxygen species simulating those generated by the host immune system during infection. A transcriptionally regulated response was observed using quantitative RT-PCR after metronidazole and hydrogen peroxide treatment, with all three genes being upregulated under stress conditions. In vivo and in vitro analysis of the functional role of the second gene of the operon was done using heterologous complementation and protein expression (in Escherichia coli), with subsequent biochemical assay. This gene encoded a functional bacterioferritin co-migratory protein (BCP) which was thiol-specific and had antioxidant properties, including protection of the glutamine synthetase III enzyme. This in vitro data supports the hypothesis that the genes of the operon may be involved in protection of the bacteria from the oxidative burst during tissue invasion and may play a significant role in bacterial survival and metronidazole resistance during treatment of B. fragilis infections. PMID:24703997
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
Genetics in methylotrophic bacteria: Appendix. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lidstrom, M.E.
This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promotersmore » and transcriptional regulation.« less
Buchet, Anne; Eichler, Knut; Mandrand-Berthelot, Marie-Andrée
1998-01-01
The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ fusion studies showed that both operons are coexpressed during anaerobic growth in the presence of carnitine, respond to common environmental stimuli (like glucose and nitrate), and are modulated positively by the same general regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF specific regulatory protein mediating the carnitine signal restored induction in an fnr mutant, corresponding to its role as the primary target for anaerobiosis. Transcript analysis identified two divergent transcription start points initiating 289 bp apart. DNase I footprinting revealed three sites with various affinities for the binding of the cAMP-CRP complex inside this regulatory region. Site-directed mutagenesis experiments indicated that previously reported perfect CRP motif 1, centered at −41.5 of the cai transcriptional start site, plays a direct role in the sole cai activation. In contrast, mutation in CRP site 2, positioned at −69.5 of the fix promoter, caused only a threefold reduction in fix expression. Thus, the role of the third CRP site, located at −126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp cis-acting sequence overlapping the fix mRNA start site was found, by deletion analysis, to be necessary for cai transcription. This region is thought to be involved in transduction of the signal mediated by the CaiF regulator. PMID:9573142
Costa, Cristina S; Pizarro, Ramón A; Antón, Dora N
2009-11-01
A transcriptional fusion (opgG1::MudJ) to the opgGH operon of Salmonella enterica serovar Typhimurium (S. Typhimurium) LT2, isolated by resistance to mecillinam, was used to study the influence of global regulators RpoS, ppGpp, and cAMP/cAMP-receptor protein (CRP) on expression of the opgGH operon and osmoregulated periplasmic glucan (OPG) content. Neither high growth medium osmolarity nor absence of ppGpp or CRP had important effects on opgG1::MudJ expression in exponential cultures. However, under the same conditions, OPG content was strongly decreased by high osmolarity or cAMP/CRP defectiveness, and reduced to a half by lack of ppGpp. In stationary cultures, high osmolarity as well as CRP loss caused significant descents in opgG1::MudJ expression that were compensated by inactivation of RpoS sigma factor. No effect of RpoS inactivation on OPG content was observed. It is concluded that opgGH expression in S. Typhimurium is only slightly affected by high osmolarity, but is inversely modulated by RpoS level. On the other hand, osmolarity and the cAMP/CRP global regulatory system appear to control OPG content, either directly or indirectly, mainly at the post-transcriptional level.
Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A
2017-11-01
The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and
Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz
2017-01-01
ABSTRACT The glucose/mannose-phosphotransferase system (PTS) permease EIIMan encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EIIFru, respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EIIMan. Expression of genes for EIIMan and EIIFru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN. Carbohydrate transport by EIIMan had a negative influence on expression of manLMN but not fruRKI. In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR. Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of E<10(-5)) are included in 27 clusters. Five clusters are associated with metabolism, containing P450 genes restricted to the Brassica family and predicted to be involved in secondary metabolism. Operon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter
2008-01-01
Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of
Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli.
Goh, Shan; Hohmeier, Angela; Stone, Timothy C; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam
2015-08-15
Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Searles, L L; Wessler, S R; Calvo, J M
1983-01-25
Three mutations, each causing constitutive expression of the Salmonella typhimurium leu operon, were cloned into phage vector lambda gt4 on EcoRI DNA fragments carrying all of that operon except for part of the promoter-distal last gene. Sequence analysis of DNA from these phage demonstrated that each contains a single base change in the leu attenuator. Transcription of mutant DNA in vitro resulted in transcription beyond the usual site of termination. The level of beta-IPM dehydrogenase, the leuB enzyme, was elevated 40-fold in a strain carrying one of these mutations, and starvation of this strain for leucine had little effect on the amount of activity expressed. Using a strain with a wild-type promoter-leader region of the leu operon, the rates of synthesis and degradation of leu leader RNA and readthrough RNA (leu mRNA) were measured by DNA-RNA hybridizations with specific DNA probes. The rate of synthesis of the leu leader was about the same in cells grown with excess or with limiting leucine. On the other hand, the rate of synthesis of leu mRNA was 12-fold higher for cells grown in limiting leucine as opposed to excess leucine. The rate of degradation of these RNA species was the same under both conditions of growth. Thus, the variation in expression of the leu operon observed for cells grown in minimal medium is, for the most part, not caused by control over the frequency of initiation or by the differential stability of these RNA species. Rather, the variation is a direct result of the frequency of transcription termination at an attenuator site. These results taken together suggest that transcription attenuation is the major mechanism by which leucine regulates expression of the leu operon of S. typhimurium for cells growing in a minimal medium.
Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.
Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco
2013-04-01
Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.
Bruni, C B; Musti, A M; Frunzio, R; Blasi, F
1980-01-01
A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067
Venturi, V; Wolfs, K; Leong, J; Weisbeek, P J
1994-10-17
Pseudobactin 358 is the yellow-green fluorescent siderophore [microbial iron(III) transport agent] produced by Pseudomonas putida WCS358 under iron-limiting conditions. The genes encoding pseudobactin 358 biosynthesis are iron-regulated at the level of transcription. In this study, the molecular characterization is reported of a cosmid clone of WCS358 DNA that can stimulate, in an iron-dependent manner, the activity of a WCS358 siderophore gene promoter in the heterologous Pseudomonas strain A225. The functional region in the clone was identified by subcloning, transposon mutagenesis and DNA sequencing as the groESL operon of strain WCS358. This increase in promoter activity was not observed when the groESL genes of strain WCS358 were integrated via a transposon vector into the genome of Pseudomonas A225, indicating that multiple copies of the operon are necessary for the increase in siderophore gene promoter activity. Amplification of the Escherichia coli and WCS358 groESL genes also increased iron-regulated promoter activity in the parent strain WCS358. The groESL operon codes for the chaperone proteins GroES and GroEL, which are responsible for mediating the folding and assembly of many proteins.
Recinos, David A.; Sekedat, Matthew D.; Hernandez, Adriana; Cohen, Taylor Sitarik; Sakhtah, Hassan; Prince, Alice S.; Price-Whelan, Alexa; Dietrich, Lars E. P.
2012-01-01
Evolutionary biologists have postulated that several fitness advantages may be conferred by the maintenance of duplicate genes, including environmental adaptation resulting from differential regulation. We examined the expression and physiological contributions of two redundant operons in the adaptable bacterium Pseudomonas aeruginosa PA14. These operons, phzA1-G1 (phz1) and phzA2-G2 (phz2), encode nearly identical sets of proteins that catalyze the synthesis of phenazine-1-carboxylic acid, the precursor for several phenazine derivatives. Phenazines perform diverse roles in P. aeruginosa physiology and act as virulence factors during opportunistic infections of plant and animal hosts. Although reports have indicated that phz1 is regulated by the Pseudomonas quinolone signal, factors controlling phz2 expression have not been identified, and the relative contributions of these redundant operons to phenazine biosynthesis have not been evaluated. We found that in liquid cultures, phz1 was expressed at higher levels than phz2, although phz2 showed a greater contribution to phenazine production. In colony biofilms, phz2 was expressed at high levels, whereas phz1 expression was not detectable, and phz2 was responsible for virtually all phenazine production. Analysis of mutants defective in quinolone signal synthesis revealed a critical role for 4-hydroxy-2-heptylquinoline in phz2 induction. Finally, deletion of phz2, but not of phz1, decreased lung colonization in a murine model of infection. These results suggest that differential regulation of the redundant phz operons allows P. aeruginosa to adapt to diverse environments. PMID:23129634
Nagel, Raimund; Turrini, Paula C. G.; Nett, Ryan S.; Leach, Jan E.; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J.
2016-01-01
Summary Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the gibberellin (GA) phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid (JA) mediated defense response.Here the function of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae investigated in over 100 isolates.The Xoc operon leads to production of the bioactive GA4, an additional step beyond production of the penultimate precursor GA9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (>90%), but absent in the other major oryzae pathovar.These results indicate selective pressure for production of GA4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. PMID:28134995
Quandt, Erik M; Hammerling, Michael J; Summers, Ryan M; Otoupal, Peter B; Slater, Ben; Alnahhas, Razan N; Dasgupta, Aurko; Bachman, James L; Subramanian, Mani V; Barrick, Jeffrey E
2013-06-21
The widespread use of caffeine (1,3,7-trimethylxanthine) and other methylxanthines in beverages and pharmaceuticals has led to significant environmental pollution. We have developed a portable caffeine degradation operon by refactoring the alkylxanthine degradation (Alx) gene cluster from Pseudomonas putida CBB5 to function in Escherichia coli. In the process, we discovered that adding a glutathione S-transferase from Janthinobacterium sp. Marseille was necessary to achieve N 7 -demethylation activity. E. coli cells with the synthetic operon degrade caffeine to the guanine precursor, xanthine. Cells deficient in de novo guanine biosynthesis that contain the refactored operon are ″addicted″ to caffeine: their growth density is limited by the availability of caffeine or other xanthines. We show that the addicted strain can be used as a biosensor to measure the caffeine content of common beverages. The synthetic N-demethylation operon could be useful for reclaiming nutrient-rich byproducts of coffee bean processing and for the cost-effective bioproduction of methylxanthine drugs.
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel
2015-01-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539
Davies, Robert L.; Campbell, Susan; Whittam, Thomas S.
2002-01-01
The mosaic structure and molecular evolution of the leukotoxin operon (lktCABD) was investigated by nucleotide sequence comparison of the lktC, lktB, and lktD genes in 23 Mannheimia (Pasteurella) haemolytica, 6 Mannheimia glucosida, and 4 Pasteurella trehalosi strains. Sequence variation in the lktA gene has been described previously (R. L. Davies et al., J. Bacteriol. 183:1394–1404, 2001). The leukotoxin operon of M. haemolytica has a complex mosaic structure and has been derived by extensive inter- and intraspecies horizontal DNA transfer and intragenic recombination events. However, the pattern of recombination varies throughout the operon and among the different evolutionary lineages of M. haemolytica. The lktA and lktB genes have the most complex mosaic structures with segments derived from up to four different sources, including M. glucosida and P. trehalosi. In contrast, the lktD gene is highly conserved in M. haemolytica. The lktC, lktA, and lktB genes of strains representing the major ovine lineages contain recombinant segments derived from bovine or bovine-like serotype A2 strains. These findings support the previous conclusion that host switching of bovine A2 strains from cattle to sheep has played a major role in the evolution of the leukotoxin operon in ovine strains of M. haemolytica. Homologous segments of donor and recipient alleles are identical, or nearly identical, indicating that the recombinational exchanges occurred relatively recent in evolutionary terms. The 5′ and 3′ ends of the operon are highly conserved in M. haemolytica, which suggests that multiple horizontal exchanges of the complete operon have occurred by a common mechanism such as transduction. Although the lktA and lktB genes both have complex mosaic structures and high nucleotide substitution rates, the amino acid diversity of LktB is significantly lower than that of LktA due to a higher degree of evolutionary constraint against amino acid replacement. The recombinational
Gaugué, Isabelle; Oberto, Jacques; Putzer, Harald; Plumbridge, Jacqueline
2013-01-01
B. subtilis grows more rapidly using the amino sugar glucosamine as carbon source, than with N-acetylglucosamine. Genes for the transport and metabolism of N-acetylglucosamine (nagP and nagAB) are found in all the sequenced Bacilli (except Anoxybacillus flavithermus). In B. subtilis there is an additional operon (gamAP) encoding second copies of genes for the transport and catabolism of glucosamine. We have developed a method to make multiple deletion mutations in B. subtilis employing an excisable spectinomycin resistance cassette. Using this method we have analysed the contribution of the different genes of the nag and gam operons for their role in utilization of glucosamine and N-acetylglucosamine. Faster growth on glucosamine is due to the presence of the gamAP operon, which is strongly induced by glucosamine. Although the gamA and nagB genes encode isozymes of GlcN6P deaminase, catabolism of N-acetylglucosamine relies mostly upon the gamA gene product. The genes for use of N-acetylglucosamine, nagAB and nagP, are repressed by YvoA (NagR), a GntR family regulator, whose gene is part of the nagAB yvoA(nagR) operon. The gamAP operon is repressed by YbgA, another GntR family repressor, whose gene is expressed divergently from gamAP. The nagAB yvoA synton is found throughout the Bacilli and most firmicutes. On the other hand the ybgA-gamAP synton, which includes the ybgB gene for a small protein of unknown provenance, is only found in B. subtilis (and a few very close relatives). The origin of ybgBA-gamAP grouping is unknown but synteny analysis suggests lateral transfer from an unidentified donor. The presence of gamAP has enabled B. subtilis to efficiently use glucosamine as carbon source. PMID:23667565
Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J
2017-05-01
Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Jiang, Longfei; Luo, Chunling; Zhang, Dayi; Song, Mengke; Sun, Yingtao; Zhang, Gan
2018-05-18
Primitive electronic waste (e-waste) recycling activities release massive amounts of persistent organic pollutants (POPs) and heavy metals into surrounding soils, posing a major threat to the ecosystem and human health. Microbes capable of metabolizing POPs play important roles in POPs remediation in soils, but their phylotypes and functions remain unclear. Polychlorinated biphenyls (PCBs), one of the main pollutants in e-waste contaminated soils, have drawn increasing attention due to their high persistence, toxicity, and bioaccumulation. In the present study, we employed the culture-independent method of DNA stable-isotope probing to identify active biphenyl and PCB degraders in e-waste-contaminated soil. A total of 19 rare operational taxonomic units and three dominant bacterial genera ( Ralstonia, Cupriavidus, and uncultured bacterium DA101) were enriched in the 13 C heavy DNA fraction, confirming their functions in PCBs metabolism. Additionally, a 13.8 kb bph operon was amplified, containing a bphA gene labeled by 13 C that was concentrated in the heavy DNA fraction. The tetranucleotide signature characteristics of the bph operon suggest that it originated from Ralstonia. The bph operon may be shared by horizontal gene transfer because it contains a transposon gene and is found in various bacterial species. This study gives us a deeper understanding of PCB-degrading mechanisms and provides a potential resource for the bioremediation of PCBs-contaminated soils.
Adham, Sirin A I; Rodríguez, Sonia; Ramos, Angelina; Santamaría, Ramón I; Gil, José A
2003-07-01
The tyrosinase operon ( melC) from Streptomyces glaucescens was cloned and functionally expressed in Brevibacterium lactofermentum and Corynebacterium glutamicum under the control of the promoter of the kan gene from Tn 5. Recombinant corynebacterial cells containing the tyrosinase operon produced melanin on agar plates and in liquid culture when supplemented with copper and tyrosine. A conjugative bifunctional replacement vector for transcriptional/translational signal screening (pEMel-1) was constructed using expression of the melC operon from S. glaucescens, which can be used for cloning promoter sequences as EcoRI- NdeI fragments. When the DNA fragments with promoter activity such as cspBp or trpp were inserted into pEMel-1, B. lactofermentum harboring the chimeric plasmids produced melanin at different stages of growth, allowing temporal detection of promoter activity. The vector was also used to detect the activity of a Streptomyces promoter ( xysAp), which was inactive in B. lactofermentum, after PCR mutagenesis. The melC operon can be used for the visual, inexpensive (compared to the high price of starch azure for amylase detection), and non-selective (in contrast to the kan or cat genes) screening of several thousand clones at high colony density without killing of the transformants due to the presence of iodine (as in the case of amylase assay).
Zamora-Chimal, Criseida; Santillán, Moisés; Rodríguez-González, Jesús
2012-10-07
In this paper we introduce a mathematical model for the tryptophan operon regulatory pathway in Bacillus subtilis. This model considers the transcription-attenuation, and the enzyme-inhibition regulatory mechanisms. Special attention is paid to the estimation of all the model parameters from reported experimental data. With the aid of this model we investigate, from a mathematical-modeling point of view, whether the existing multiplicity of regulatory feedback loops is advantageous in some sense, regarding the dynamic response and the biochemical noise in the system. The tryptophan operon dynamic behavior is studied by means of deterministic numeric simulations, while the biochemical noise is analyzed with the aid of stochastic simulations. The model feasibility is tested comparing its stochastic and deterministic results with experimental reports. Our results for the wildtype and for a couple of mutant bacterial strains suggest that the enzyme-inhibition feedback loop, dynamically accelerates the operon response, and plays a major role in the reduction of biochemical noise. Also, the transcription-attenuation feedback loop makes the trp operon sensitive to changes in the endogenous tryptophan level, and increases the amplitude of the biochemical noise. Copyright © 2012 Elsevier Ltd. All rights reserved.
Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.
2017-01-01
Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111
Kim, Dae Hun; Ko, Kwan Soo
2015-07-01
To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.
Hirakawa, Hidetada; Hirakawa, Yuko; Greenberg, E. Peter
2015-01-01
The bacterium Rhodopseudomonas palustris grows with the aromatic acid benzoate and the alicyclic acid cyclohexanecarboxylate (CHC) as sole carbon sources. The enzymatic steps in an oxygen-independent pathway for CHC degradation have been elucidated, but it was unknown how the CHC operon (badHI aliAB badK) encoding the enzymes for CHC degradation was regulated. aliA and aliB encode enzymes for the conversion of CHC to cyclohex-1-enecarboxyl–coenzyme A (CHene-CoA). At this point, the pathway for CHC degradation merges with the pathway for anaerobic benzoate degradation, as CHene-CoA is an intermediate in both degradation pathways. Three enzymes, encoded by badK, badH, and badI, prepare and cleave the alicyclic ring of CHene-CoA to yield pimelyl-CoA. Here, we show that the MarR transcription factor family member, BadR, represses transcription of the CHC operon by binding near the transcription start site of badH. 2-Ketocyclohexane-1-carboxyl–CoA, an intermediate of CHC and benzoate degradation, interacts with BadR to abrogate repression. We also present evidence that the transcription factor BadM binds to the promoter of the badDEFGAB (Bad) operon for the anaerobic conversion of benzoate to CHene-CoA to repress its expression. Contrary to previous reports, BadR does not appear to control expression of the Bad operon. These data enhance our view of the transcriptional regulation of anaerobic benzoate degradation by R. palustris. PMID:25888170
Hirano, M; Mori, H; Onogi, T; Yamazoe, M; Niki, H; Ogura, T; Hiraga, S
1998-02-01
The sopAB operon and the sopC sequence, which acts as a centromere, are essential for stable maintenance of the mini-F plasmid. Immunoprecipitation experiments with purified SopA and SopB proteins have demonstrated that these proteins interact in vitro. Expression studies using the lacZ gene as a reporter revealed that the sopAB operon is repressed by the cooperative action of SopA and SopB. Using immunofluorescence microscopy, we found discrete fluorescent foci of SopA and SopB in cells that produce both SopA and SopB in the presence of the sopC DNA segment, but not in the absence of sopC, suggesting the SopA-SopB complex binds to sopC segments. SopA was exclusively found to colocalize with nucleoids in cells that produced only SopA, while, in the absence of SopA, SopB was distributed in the cytosolic spaces.
Deaner, Matthew; Holzman, Allison; Alper, Hal S
2018-04-16
Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ventura, Marco; Zink, Ralf; Fitzgerald, Gerald F; van Sinderen, Douwe
2005-01-01
The incorporation and delivery of bifidobacterial strains as probiotic components in many food preparations expose these microorganisms to a multitude of environmental insults, including heat and osmotic stresses. We characterized the dnaK gene region of Bifidobacterium breve UCC 2003. Sequence analysis of the dnaK locus revealed four genes with the organization dnaK-grpE-dnaJ-ORF1, whose deduced protein products display significant similarity to corresponding chaperones found in other bacteria. Northern hybridization and real-time LightCycler PCR analysis revealed that the transcription of the dnaK operon was strongly induced by osmotic shock but was not induced significantly by heat stress. A 4.4-kb polycistronic mRNA, which represented the transcript of the complete dnaK gene region, was detected. Many other small transcripts, which were assumed to have resulted from intensive processing or degradation of this polycistronic mRNA, were identified. The transcription start site of the dnaK operon was determined by primer extension. Phylogenetic analysis of the available bifidobacterial grpE and dnaK genes suggested that the evolutionary development of these genes has been similar. The phylogeny derived from the various bifidobacterial grpE and dnaK sequences is consistent with that derived from 16S rRNA. The use of these genes in bifidobacterial species as an alternative or complement to the 16S rRNA gene marker provides sequence signatures that allow a high level of discrimination between closely related species of this genus.
The Mannitol Operon Repressor MTIR belongs to a new class of transcription regulators in bacteria.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, K.; Borovilos, M.; Zhou, M
2009-12-25
Many bacteria express phosphoenolpyruvate-dependent phosphotransferase systems (PTS). The mannitol-specific PTS catalyze the uptake and phosphorylation of d-mannitol. The uptake system comprises several genes encoded in the single operon. The expression of the mannitol operon is regulated by a proposed transcriptional factor, mannitol operon repressor (MtlR) that was first studied in Escherichia coli. Here we report the first crystal structures of MtlR from Vibrio parahemeolyticus (Vp-MtlR) and its homolog YggD protein from Shigella flexneri (Sf-YggD). MtlR and YggD belong to the same protein family (Pfam05068). Although Vp-MtlR and Sf-YggD share low sequence identity (22%), their overall structures are very similar, representingmore » a novel all {alpha}-helical fold, and indicate similar function. However, their lack of any known DNA-binding structural motifs and their unfavorable electrostatic properties imply that MtlR/YggD are unlikely to bind a specific DNA operator directly as proposed earlier. This structural observation is further corroborated by in vitro DNA-binding studies of E. coli MtlR (Ec-MtlR), which detected no interaction of Ec-MtlR with the well characterized mannitol operator/promoter region. Therefore, MtlR/YggD belongs to a new class of transcription factors in bacteria that may regulate gene expression indirectly as a part of a larger transcriptional complex.« less
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia
2016-08-01
To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.
Borchert, S; Stachelhaus, T; Marahiel, M A
1994-01-01
The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553
Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R
2001-01-01
Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).
Frías, José E; Flores, Enrique
2015-07-01
Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria
López-Garrido, Javier; Casadesús, Josep
2012-01-01
Invasion of intestinal epithelial cells is a critical step in Salmonella infection and requires the expression of genes located in Salmonella pathogenicity island 1 (SPI-1). A key factor for SPI-1 expression is DNA adenine (Dam) methylation, which activates synthesis of the SPI-1 transcriptional activator HilD. Dam-dependent regulation of hilD is postranscriptional (and therefore indirect), indicating the involvement of unknown cell functions under Dam methylation control. A genetic screen has identified the std fimbrial operon as the missing link between Dam methylation and SPI-1. We show that all genes in the std operon are part of a single transcriptional unit, and describe three previously uncharacterized ORFs (renamed stdD, stdE, and stdF). We present evidence that two such loci (stdE and stdF) are involved in Dam-dependent control of Salmonella SPI-1: in a Dam(-) background, deletion of stdE or stdF suppresses SPI-1 repression; in a Dam(+) background, constitutive expression of StdE and/or StdF represses SPI-1. Repression of SPI-1 by products of std operon explains the invasion defect of Salmonella Dam(-) mutants, which constitutively express the std operon. Dam-dependent repression of std in the ileum may be required to permit invasion, as indicated by two observations: constitutive expression of StdE and StdF reduces invasion of epithelial cells in vitro (1,000 fold) and attenuates Salmonella virulence in the mouse model (>60 fold). In turn, crosstalk between std and SPI-1 may play a role in intestinal infections by preventing expression of SPI-1 in the caecum, an intestinal compartment in which the std operon is known to be expressed.
Tadmor, Arbel D.; Tlusty, Tsvi
2008-01-01
We propose a biophysical model of Escherichia coli that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity. PMID:18437222
Wolfe, C J; Haygood, M G
1993-08-01
Ribosomal RNA (rRNA) operon copy number and gene order were determined for the luminous bacterial symbiont of Kryptophanaron alfredi, an anomalopid (flashlight) fish, and estimated for the luminous symbionts of 3 other fish families and of 3 luminous seawater isolates. Compared with the seawater isolates and other fish symbionts, the copy number of rRNA genes in the K. alfredi symbiont was radically reduced, although gene order appeared conserved among all the strains. The K. alfredi symbiont possesses only a single rRNA operon, whereas the other strains examined have minimum copy numbers ranging from 8 to 11. No difference in copy number was observed between light organ and seawater isolates of the same species, or between isolates of the same species from the light organs of 2 different host families. Thus, the anomalopid symbiosis appears unique among characterized light organ symbioses.
Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.
Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D
2015-01-01
Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage
Boyd, Eric S.; Barkay, Tamar
2012-01-01
Mercuric mercury (Hg[II]) is a highly toxic and mobile element that is likely to have had a pronounced and adverse effect on biology since Earth’s oxygenation ∼2.4 billion years ago due to its high affinity for protein sulfhydryl groups, which upon binding destabilize protein structure and decrease enzyme activity, resulting in a decreased organismal fitness. The central enzyme in the microbial mercury detoxification system is the mercuric reductase (MerA) protein, which catalyzes the reduction of Hg(II) to volatile Hg(0). In addition to MerA, mer operons encode for proteins involved in regulation, Hg binding, and organomercury degradation. Mer-mediated approaches have had broad applications in the bioremediation of mercury-contaminated environments and industrial waste streams. Here, we examine the composition of 272 individual mer operons and quantitatively map the distribution of mer-encoded functions on both taxonomic SSU rRNA gene and MerA phylogenies. The results indicate an origin and early evolution of MerA among thermophilic bacteria and an overall increase in the complexity of mer operons through evolutionary time, suggesting continual gene recruitment and evolution leading to an improved efficiency and functional potential of the Mer detoxification system. Consistent with a positive relationship between the evolutionary history and topology of MerA and SSU rRNA gene phylogenies (Mantel R = 0.81, p < 0.01), the distribution of the majority of mer functions, when mapped on these phylograms, indicates an overall tendency to inherit mer-encoded functions through vertical descent. However, individual mer functions display evidence of a variable degree of vertical inheritance, with several genes exhibiting strong evidence for acquisition via lateral gene transfer and/or gene loss. Collectively, these data suggest that (i) mer has evolved from a simple system in geothermal environments to a widely distributed and more complex and efficient
Role of the parCBA Operon of the Broad-Host-Range Plasmid RK2 in Stable Plasmid Maintenance
Easter, Carla L.; Schwab, Helmut; Helinski, Donald R.
1998-01-01
The par region of the stably maintained broad-host-range plasmid RK2 is organized as two divergent operons, parCBA and parDE, and a cis-acting site. parDE encodes a postsegregational killing system, and parCBA encodes a resolvase (ParA), a nuclease (ParB), and a protein of unknown function (ParC). The present study was undertaken to further delineate the role of the parCBA region in the stable maintenance of RK2 by first introducing precise deletions in the three genes and then assessing the abilities of the different constructs to stabilize RK2 in three strains of Escherichia coli and two strains of Pseudomonas aeruginosa. The intact parCBA operon was effective in stabilizing a conjugation-defective RK2 derivative in E. coli MC1061K and RR1 but was relatively ineffective in E. coli MV10Δlac. In the two strains in which the parCBA operon was effective, deletions in parB, parC, or both parB and parC caused an approximately twofold reduction in the stabilizing ability of the operon, while a deletion in the parA gene resulted in a much greater loss of parCBA activity. For P. aeruginosa PAO1161Rifr, the parCBA operon provided little if any plasmid stability, but for P. aeruginosa PAC452Rifr, the RK2 plasmid was stabilized to a substantial extent by parCBA. With this latter strain, parA and res alone were sufficient for stabilization. The cer resolvase system of plasmid ColE1 and the loxP/Cre system of plasmid P1 were tested in comparison with the parCBA operon. We found that, not unlike what was previously observed with MC1061K, cer failed to stabilize the RK2 plasmid with par deletions in strain MV10Δlac, but this multimer resolution system was effective in stabilizing the plasmid in strain RR1. The loxP/Cre system, on the other hand, was very effective in stabilizing the plasmid in all three E. coli strains. These observations indicate that the parA gene, along with its res site, exhibits a significant level of plasmid stabilization in the absence of the parC and
Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.
Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard
2010-07-01
Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.
Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong
2008-12-31
CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.
Heinzinger, N K; Fujimoto, S Y; Clark, M A; Moreno, M S; Barrett, E L
1995-01-01
The phs chromosomal locus of Salmonella typhimurium is essential for the dissimilatory anaerobic reduction of thiosulfate to hydrogen sulfide. Sequence analysis of the phs region revealed a functional operon with three open reading frames, designated phsA, phsB, and phsC, which encode peptides of 82.7, 21.3, and 28.5 kDa, respectively. The predicted products of phsA and phsB exhibited significant homology with the catalytic and electron transfer subunits of several other anaerobic molybdoprotein oxidoreductases, including Escherichia coli dimethyl sulfoxide reductase, nitrate reductase, and formate dehydrogenase. Simultaneous comparison of PhsA to seven homologous molybdoproteins revealed numerous similarities among all eight throughout the entire frame, hence, significant amino acid conservation among molybdoprotein oxidoreductases. Comparison of PhsB to six other homologous sequences revealed four highly conserved iron-sulfur clusters. The predicted phsC product was highly hydrophobic and similar in size to the hydrophobic subunits of the molybdoprotein oxidoreductases containing subunits homologous to phsA and phsB. Thus, phsABC appears to encode thiosulfate reductase. Single-copy phs-lac translational fusions required both anaerobiosis and thiosulfate for full expression, whereas multicopy phs-lac translational fusions responded to either thiosulfate or anaerobiosis, suggesting that oxygen and thiosulfate control of phs involves negative regulation. A possible role for thiosulfate reduction in anaerobic respiration was examined. Thiosulfate did not significantly augment the final densities of anaerobic cultures grown on any of the 18 carbon sources tested. on the other hand, washed stationary-phase cells depleted of ATP were shown to synthesize small amounts of ATP on the addition of the formate and thiosulfate, suggesting that the thiosulfate reduction plays a unique role in anaerobic energy conservation by S typhimurium. PMID:7751291
Feng, Youjun; Kumar, Ritesh; Ravcheev, Dmitry A; Zhang, Huimin
2015-08-01
Recently, we determined that BioR, the GntR family of transcription factor, acts as a repressor for biotin metabolism exclusively distributed in certain species of α-proteobacteria, including the zoonotic agent Brucella melitensis and the plant pathogen Agrobacterium tumefaciens. However, the scenario is unusual in Paracoccus denitrificans, another closely related member of the same phylum α-proteobacteria featuring with denitrification. Not only does it encode two BioR homologs Pden_1431 and Pden_2922 (designated as BioR1 and BioR2, respectively), but also has six predictive BioR-recognizable sites (the two bioR homolog each has one site, whereas the two bio operons (bioBFDAGC and bioYB) each contains two tandem BioR boxes). It raised the possibility that unexpected complexity is present in BioR-mediated biotin regulation. Here we report that this is the case. The identity of the purified BioR proteins (BioR1 and BioR2) was confirmed with LC-QToF-MS. Phylogenetic analyses combined with GC percentage raised a possibility that the bioR2 gene might be acquired by horizontal gene transfer. Gel shift assays revealed that the predicted BioR-binding sites are functional for the two BioR homologs, in much similarity to the scenario seen with the BioR site of A. tumefaciens bioBFDAZ. Using the A. tumefaciens reporter system carrying a plasmid-borne LacZ fusion, we revealed that the two homologs of P. denitrificans BioR are functional repressors for biotin metabolism. As anticipated, not only does the addition of exogenous biotin stimulate efficiently the expression of bioYB operon encoding biotin transport/uptake system BioY, but also inhibits the transcription of the bioBFDAGC operon resembling the de novo biotin synthetic pathway. EMSA-based screening failed to demonstrate that the biotin-related metabolite is involved in BioR-DNA interplay, which is consistent with our former observation with Brucella BioR. Our finding defined a complex regulatory network for biotin
Feng, Youjun; Kumar, Ritesh; Ravcheev, Dmitry A; Zhang, Huimin
2015-01-01
Recently, we determined that BioR, the GntR family of transcription factor, acts as a repressor for biotin metabolism exclusively distributed in certain species of α-proteobacteria, including the zoonotic agent Brucella melitensis and the plant pathogen Agrobacterium tumefaciens. However, the scenario is unusual in Paracoccus denitrificans, another closely related member of the same phylum α-proteobacteria featuring with denitrification. Not only does it encode two BioR homologs Pden_1431 and Pden_2922 (designated as BioR1 and BioR2, respectively), but also has six predictive BioR-recognizable sites (the two bioR homolog each has one site, whereas the two bio operons (bioBFDAGC and bioYB) each contains two tandem BioR boxes). It raised the possibility that unexpected complexity is present in BioR-mediated biotin regulation. Here we report that this is the case. The identity of the purified BioR proteins (BioR1 and BioR2) was confirmed with LC-QToF-MS. Phylogenetic analyses combined with GC percentage raised a possibility that the bioR2 gene might be acquired by horizontal gene transfer. Gel shift assays revealed that the predicted BioR-binding sites are functional for the two BioR homologs, in much similarity to the scenario seen with the BioR site of A. tumefaciens bioBFDAZ. Using the A. tumefaciens reporter system carrying a plasmid-borne LacZ fusion, we revealed that the two homologs of P. denitrificans BioR are functional repressors for biotin metabolism. As anticipated, not only does the addition of exogenous biotin stimulate efficiently the expression of bioYB operon encoding biotin transport/uptake system BioY, but also inhibits the transcription of the bioBFDAGC operon resembling the de novo biotin synthetic pathway. EMSA-based screening failed to demonstrate that the biotin-related metabolite is involved in BioR-DNA interplay, which is consistent with our former observation with Brucella BioR. Our finding defined a complex regulatory network for biotin
Calvio, Cinzia; Celandroni, Francesco; Ghelardi, Emilia; Amati, Giuseppe; Salvetti, Sara; Ceciliani, Fabrizio; Galizzi, Alessandro; Senesi, Sonia
2005-08-01
The number and disposition of flagella harbored by eubacteria are regulated by a specific trait successfully maintained over generations. The genes governing the number of flagella in Bacillus subtilis have never been identified, although the ifm locus has long been recognized to influence the motility phenotype of this microorganism. The characterization of a spontaneous ifm mutant of B. subtilis, displaying diverse degrees of cell flagellation in both liquid and solid media, raised the question of how the ifm locus governs the number and assembly of functional flagella. The major finding of this investigation is the characterization of a newly identified dicistronic operon, named swrA, that controls both swimming motility and swarming differentiation in B. subtilis. Functional analysis of the swrA operon allowed swrAA (previously named swrA [D. B. Kearns, F. Chu, R. Rudner, and R. Losick, Mol. Microbiol. 52:357-369, 2004]) to be the first gene identified in B. subtilis that controls the number of flagella in liquid environments and the assembly of flagella in response to cell contact with solid surfaces. Evidence is given that the second gene of the operon, swrAB, is essential for enabling the surface-adhering cells to undergo swarming differentiation. Preliminary data point to a molecular interaction between the two gene products.
Kant, Ravi; Palva, Airi; von Ossowski, Ingemar
2014-01-01
A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided
Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar
2014-01-01
A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided
Agarwal, Astha; Jain, Amita
2013-01-01
All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic) and high concentration of glucose, irrespective of presence or absence of ica operon. Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose). All isolates were tested for the presence of ica ADBC genes by PCR. Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.
Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M
2017-01-15
The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize
Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P.; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A.
2016-01-01
ABSTRACT The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum. The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. IMPORTANCE Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain
Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds
2011-01-01
Background The P27-P55 (lprG-Rv1410c) operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are functionally connected in
Eastman, Alexander W.; Yuan, Ze-Chun
2015-01-01
Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID
Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban
2017-07-17
Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway
Dokpikul, Thanittra; Chaoprasid, Paweena; Saninjuk, Kritsakorn; Sirirakphaisarn, Sirin; Johnrod, Jaruwan; Nookabkaew, Sumontha; Mongkolsuk, Skorn
2016-01-01
ABSTRACT The Agrobacterium tumefaciens C58 genome harbors an operon containing the dmeR (Atu0890) and dmeF (Atu0891) genes, which encode a transcriptional regulatory protein belonging to the RcnR/CsoR family and a metal efflux protein belonging to the cation diffusion facilitator (CDF) family, respectively. The dmeRF operon is specifically induced by cobalt and nickel, with cobalt being the more potent inducer. Promoter-lacZ transcriptional fusion, an electrophoretic mobility shift assay, and DNase I footprinting assays revealed that DmeR represses dmeRF transcription through direct binding to the promoter region upstream of dmeR. A strain lacking dmeF showed increased accumulation of intracellular cobalt and nickel and exhibited hypersensitivity to these metals; however, this strain displayed full virulence, comparable to that of the wild-type strain, when infecting a Nicotiana benthamiana plant model under the tested conditions. Cobalt, but not nickel, increased the expression of many iron-responsive genes and reduced the induction of the SoxR-regulated gene sodBII. Furthermore, control of iron homeostasis via RirA is important for the ability of A. tumefaciens to cope with cobalt and nickel toxicity. IMPORTANCE The molecular mechanism of the regulation of dmeRF transcription by DmeR was demonstrated. This work provides evidence of a direct interaction of apo-DmeR with the corresponding DNA operator site in vitro. The recognition site for apo-DmeR consists of 10-bp AT-rich inverted repeats separated by six C bases (5′-ATATAGTATACCCCCCTATAGTATAT-3′). Cobalt and nickel cause DmeR to dissociate from the dmeRF promoter, which leads to expression of the metal efflux gene dmeF. This work also revealed a connection between iron homeostasis and cobalt/nickel resistance in A. tumefaciens. PMID:27235438
Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M
2016-11-08
Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10
Jugder, Bat-Erdene; Welch, Jeffrey; Braidy, Nady
2016-01-01
Hydrogenases are metalloenzymes that reversibly catalyse the oxidation or production of molecular hydrogen (H2). Amongst a number of promising candidates for application in the oxidation of H2 is a soluble [Ni–Fe] uptake hydrogenase (SH) produced by Cupriavidus necator H16. In the present study, molecular characterisation of the SH operon, responsible for functional SH synthesis, was investigated by developing a green fluorescent protein (GFP) reporter system to characterise PSH promoter activity using several gene cloning approaches. A PSH promoter-gfp fusion was successfully constructed and inducible GFP expression driven by the PSH promoter under de-repressing conditions in heterotrophic growth media was demonstrated in the recombinant C. necator H16 cells. Here we report the first successful fluorescent reporter system to study PSH promoter activity in C. necator H16. The fusion construct allowed for the design of a simple screening assay to evaluate PSH activity. Furthermore, the constructed reporter system can serve as a model to develop a rapid fluorescent based reporter for subsequent small-scale process optimisation experiments for SH expression. PMID:27547572
2011-01-01
Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to
Thompson, John; Jakubovics, Nicholas; Abraham, Bindu; Hess, Sonja; Pikis, Andreas
2008-01-01
Inspection of the genome sequence of Lactobacillus casei ATCC 334 revealed two operons that might dissimilate the five isomers of sucrose. To test this hypothesis, cells of L. casei ATCC 334 were grown in a defined medium supplemented with various sugars, including each of the five isomeric disaccharides. Extracts prepared from cells grown on the sucrose isomers contained high levels of two polypeptides with Mrs of ∼50,000 and ∼17,500. Neither protein was present in cells grown on glucose, maltose or sucrose. Proteomic, enzymatic, and Western blot analyses identified the ∼50-kDa protein as an NAD+- and metal ion-dependent phospho-α-glucosidase. The oligomeric enzyme was purified, and a catalytic mechanism is proposed. The smaller polypeptide represented an EIIA component of the phosphoenolpyruvate-dependent sugar phosphotransferase system. Phospho-α-glucosidase and EIIA are encoded by genes at the LSEI_0369 (simA) and LSEI_0374 (simF) loci, respectively, in a block of seven genes comprising the sucrose isomer metabolism (sim) operon. Northern blot analyses provided evidence that three mRNA transcripts were up-regulated during logarithmic growth of L. casei ATCC 334 on sucrose isomers. Internal simA and simF gene probes hybridized to ∼1.5- and ∼1.3-kb transcripts, respectively. A 6.8-kb mRNA transcript was detected by both probes, which was indicative of cotranscription of the entire sim operon. PMID:18310337
Yoshino, Miho; Murayama, Somay Y.; Sunaoshi, Katsuhiko; Wajima, Takeaki; Takahashi, Miki; Masaki, Junko; Kurokawa, Iku; Ubukata, Kimiko
2010-01-01
Among nonhemolytic Streptococcus pyogenes (group A streptococcus) strains (n = 9) isolated from patients with pharyngitis or acute otitis media, we identified three deletions in the region from the epf gene, encoding the extracellular matrix binding protein, to the sag operon, mediating streptolysin S production. PMID:20018818
Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana
2018-04-16
Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for
Wang, Y L; Beach, M J; Rodwell, V W
1989-01-01
We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari
2012-01-01
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
A gene expression resource generated by genome-wide lacZ profiling in the mouse
Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.
2015-01-01
ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943
The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development
Rajagopalan, Ramya
2017-01-01
ABSTRACT Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI, a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT. We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and Dev
fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.
Khun, H H; Deved, V; Wong, H; Lee, B C
2000-12-01
The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.
fbpABC Gene Cluster in Neisseria meningitidis Is Transcribed as an Operon
Khun, Heng H.; Deved, Vinay; Wong, Howard; Lee, B. Craig
2000-01-01
The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR. PMID:11083849
Van Dyk, T K; Reed, T R; Vollmer, A C; LaRossa, R A
1995-01-01
Escherichia coli strains carrying transcriptional fusions of four sigma 32-controlled E. coli heat shock promoters to luxCDABE or lacZ reporter genes were stressed by chemicals added singly or in pairs. Much more than additive induction resulted from combinations of cadmium chloride, copper sulfate, ethanol, formamide, 4-nitrophenol, and pentachlorophenol. PMID:7592357
2013-01-01
Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and
Fischer, Ralf-Jörg; Oehmcke, Sonja; Meyer, Uta; Mix, Maren; Schwarz, Katrin; Fiedler, Tomas; Bahl, Hubert
2006-01-01
The pst operon of Clostridium acetobutylicum ATCC 824 comprises five genes, pstS, pstC, pstA, pstB, and phoU, and shows a gene architecture identical to that of Escherichia coli. Deduced proteins are predicted to represent a high-affinity phosphate-specific ABC (ATP-binding cassette) transport system (Pst) and a protein homologous to PhoU, a negative phosphate regulon regulator. We analyzed the expression patterns of the pst operon in Pi-limited chemostat cultures during acid production at pH 5.8 or solvent production at pH 4.5 and in response to Pi pulses. Specific mRNA transcripts were found only when external Pi concentrations had dropped below 0.2 mM. Two specific transcripts were detected, a 4.7-kb polycistronic mRNA spanning the whole operon and a quantitatively dominating 1.2-kb mRNA representing the first gene, pstS. The mRNA levels clearly differed depending on the external pH. The amounts of the full-length mRNA detected were about two times higher at pH 5.8 than at pH 4.5. The level of pstS mRNA increased by a factor of at least 8 at pH 5.8 compared to pH 4.5 results. Primer extension experiments revealed only one putative transcription start point 80 nucleotides upstream of pstS. Thus, additional regulatory sites are proposed in the promoter region, integrating two different extracellular signals, namely, depletion of inorganic phosphate and the pH of the environment. After phosphate pulses were applied to a phosphate-limited chemostat we observed faster phosphate consumption at pH 5.8 than at pH 4.5, although higher optical densities were recorded at pH 4.5. PMID:16855236
Boyd, David A.; Thevenot, Tracy; Gumbmann, Markus; Honeyman, Allen L.; Hamilton, Ian R.
2000-01-01
Transposon mutagenesis and marker rescue were used to isolate and identify an 8.5-kb contiguous region containing six open reading frames constituting the operon for the sorbitol P-enolpyruvate phosphotransferase transport system (PTS) of Streptococcus mutans LT11. The first gene, srlD, codes for sorbitol-6-phosphate dehydrogenase, followed downstream by srlR, coding for a transcriptional regulator; srlM, coding for a putative activator; and the srlA, srlE, and srlB genes, coding for the EIIC, EIIBC, and EIIA components of the sorbitol PTS, respectively. Among all sorbitol PTS operons characterized to date, the srlD gene is found after the genes coding for the EII components; thus, the location of the gene in S. mutans is unique. The SrlR protein is similar to several transcriptional regulators found in Bacillus spp. that contain PTS regulator domains (J. Stülke, M. Arnaud, G. Rapoport, and I. Martin-Verstraete, Mol. Microbiol. 28:865–874, 1998), and its gene overlaps the srlM gene by 1 bp. The arrangement of these two regulatory genes is unique, having not been reported for other bacteria. PMID:10639465
Álvarez, Ricardo; Frávega, Jorge; Rodas, Paula I.; Fuentes, Juan A.; Paredes-Sabja, Daniel; Calderón, Iván L.; Gil, Fernando
2015-01-01
H2S production has been proposed as a mechanism to explain bacterial resistance to antibiotics. In this work, we present evidence for the role of the cysJIH operon in resistance to ciprofloxacin mediated by H2S production with different sulfate as the only sulfur source. We found that the products of the cysJIH operon are involved in ciprofloxacin resistance by increasing both, the levels of H2S and reduced thiols apparently counteracting antimicrobial-induced reactive oxygen species (ROS). This protective effect was observed only when bacteria were cultured in the presence of sulfate, but not with cysteine, as the sole sulfur source.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Bistable Behavior of the Lac Operon in E. Coli When Induced with a Mixture of Lactose and TMG
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions. PMID:21423364
Torres, Alfredo G.; Giron, Jorge A.; Perna, Nicole T.; Burland, Valerie; Blattner, Fred R.; Avelino-Flores, Fabiola; Kaper, James B.
2002-01-01
The mechanisms underlying the adherence of Escherichia coli O157:H7 and other enterohemorrhagic E. coli (EHEC) strains to intestinal epithelial cells are poorly understood. We have identified a chromosomal region (designated lpfABCC′DE) in EHEC O157:H7 containing six putative open reading frames that was found to be closely related to the long polar (LP) fimbria operon (lpf) of Salmonella enterica serovar Typhimurium, both in gene order and in conservation of the deduced amino acid sequences. We show that lpfABCC′DE is organized as an operon and that its expression is induced during the exponential growth phase. The lpf genes from EHEC strain EDL933 were introduced into a nonfimbriated (Fim−) E. coli K-12 strain, and the transformed strain produced fimbriae as visualized by electron microscopy and adhered to tissue culture cells. Anti-LpfA antiserum recognized a ca. 16-kDa LpfA protein when expressed under regulation of the T7 promoter system. The antiserum also cross-reacted with the LP fimbriae in immunogold electron microscopy and Western blot experiments. Isogenic E. coli O157:H7 lpf mutants derived from strains 86-24 and AGT300 showed slight reductions in adherence to tissue culture cells and formed fewer microcolonies compared with their wild-type parent strains. The adherence and microcolony formation phenotypes were restored when the lpf operon was introduced on a plasmid. We propose that LP fimbriae participate in the interaction of E. coli O157:H7 with eukaryotic cells by assisting in microcolony formation. PMID:12228266
A source of artifact in the lacZ reversion assay in Escherichia coli.
Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I
2015-06-01
The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its
The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.
Rajagopalan, Ramya; Kroos, Lee
2017-05-15
Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent
Yang, Chun-Feng; Gou, Wei-Hui; Dai, Xin-Lun; Li, Yu-Mei
2018-06-01
Staphylococcus aureus (S. aureus) is a versatile pathogen found in many environments and can cause nosocomial infections in the community and hospitals. S. aureus infection is an increasingly serious threat to global public health that requires action across many government bodies, medical and health sectors, and scientific research institutions. In the present study, S. aureus N315 genes that have been shown in the literature to be pathogenic were extracted using a bibliometric method for functional enrichment analysis of pathways and operons to statistically discover novel pathogenic genes associated with S. aureus N315. A total of 383 pathogenic genes were mined from the literature using bibliometrics, and subsequently a few new pathogenic genes of S. aureus N315 were identified by functional enrichment analysis of pathways and operons. The discovery of these novel S. aureus N315 pathogenic genes is of great significance to treat S. aureus induced diseases and identify potential diagnostic markers, thus providing theoretical fundamentals for epidemiological prevention.
Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis.
Howery, Kristen E; Clemmer, Katy M; Şimşek, Emrah; Kim, Minsu; Rather, Philip N
2015-08-01
A key regulator of swarming in Proteus mirabilis is the Rcs phosphorelay, which represses flhDC, encoding the master flagellar regulator FlhD4C2. Mutants in rcsB, the response regulator in the Rcs phosphorelay, hyperswarm on solid agar and differentiate into swarmer cells in liquid, demonstrating that this system also influences the expression of genes central to differentiation. To gain a further understanding of RcsB-regulated genes involved in swarmer cell differentiation, transcriptome sequencing (RNA-Seq) was used to examine the RcsB regulon. Among the 133 genes identified, minC and minD, encoding cell division inhibitors, were identified as RcsB-activated genes. A third gene, minE, was shown to be part of an operon with minCD. To examine minCDE regulation, the min promoter was identified by 5' rapid amplification of cDNA ends (5'-RACE), and both transcriptional lacZ fusions and quantitative real-time reverse transcriptase (qRT) PCR were used to confirm that the minCDE operon was RcsB activated. Purified RcsB was capable of directly binding the minC promoter region. To determine the role of RcsB-mediated activation of minCDE in swarmer cell differentiation, a polar minC mutation was constructed. This mutant formed minicells during growth in liquid, produced shortened swarmer cells during differentiation, and exhibited decreased swarming motility. This work describes the regulation and role of the MinCDE cell division system in P. mirabilis swarming and swarmer cell elongation. Prior to this study, the mechanisms that inhibit cell division and allow swarmer cell elongation were unknown. In addition, this work outlines for the first time the RcsB regulon in P. mirabilis. Taken together, the data presented in this study begin to address how P. mirabilis elongates upon contact with a solid surface. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.
2015-01-01
ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans
Flores-Chavez, María; Cruz, Israel; Nieto, Javier; Gárate, Teresa; Navarro, Miriam; Pérez-Ayala, Ana; López-Vélez, Rogelio
2012-01-01
Trypanosoma cruzi infection is an imported parasitic disease in Spain, and the majority of infected individuals are in the chronic phase of the disease. This study evaluated the sensitivity and specificity of the Operon immunochromatographic test (ICT-Operon; Simple Stick Chagas and Simple Chagas WB [whole blood]; Operon S.A., Spain) for different biological samples. Well-characterized serum samples were obtained from chagasic patients (n = 63), nonchagasic individuals (n = 95), visceral leishmaniasis patients (n = 38), and malaria patients (n = 55). Noncharacterized specimens were obtained from Latin American immigrants and individuals at risk with a clinical and/or epidemiological background: these specimens were recovered serum or plasma samples (n = 450), whole peripheral blood (n = 94), and capillary blood (n = 282). The concordance of the results by enzyme-linked immunosorbent assay and indirect immunofluorescence test was considered to be the “gold standard” for diagnosis. Serum and plasma samples were analyzed by Stick Chagas, and whole blood was analyzed by Simple Chagas WB. The sensitivity and specificity of the ICT-Operon in well-characterized samples were 100% and 97.9%, respectively. No cross-reactivity was found with samples obtained from visceral leishmaniasis patients. In contrast, a false-positive result was obtained in 27.3% of samples from malaria patients. The sensitivities of the rapid test in noncharacterized serum or plasma, peripheral blood, and capillary blood samples were 100%, 92.1%, and 86.4%, respectively, while the specificities were 91.6%, 93.6%, and 95% in each case. ICT-Operon showed variable sensitivity, depending on the kind of sample, performing better when serum or plasma samples were used. It could therefore be used for serological screening combined with any other conventional test. PMID:22761296
Gambetta, Gregory A; Matthews, Mark A; Syvanen, Michael
2018-05-04
Xylella fastidiosa (Xf) is a gram negative bacterium inhabiting the plant vascular system. In most species this bacterium lives as a benign symbiote, but in several agriculturally important plants (e.g. coffee, citrus, grapevine) Xf is pathogenic. Xf has four loci encoding homologues to hemolysin RTX proteins, virulence factors involved in a wide range of plant pathogen interactions. We show that all four genes are expressed during pathogenesis in grapevine. The sequences from these four genes have a complex repetitive structure. At the C-termini, sequence diversity between strains is what would be expected from orthologous genes. However, within strains there is no N-terminal homology, indicating these loci encode RTXs of different functions and/or specificities. More striking is that many of the orthologous loci between strains share this extreme variation at the N-termini. Thus these RTX orthologues are most easily visualized as fusions between the orthologous C-termini and different N-termini. Further, the four genes are found in operons having a peculiar structure with an extensively duplicated module encoding a small protein with homology to the N-terminal region of the full length RTX. Surprisingly, some of these small peptides are most similar not to their corresponding full length RTX, but to the N-termini of RTXs from other Xf strains, and even other remotely related species. These results demonstrate that these genes are expressed in planta during pathogenesis. Their structure suggests extensive evolutionary restructuring through horizontal gene transfers and heterologous recombination mechanisms. The sum of the evidence suggests these repetitive modules are a novel kind of mobile genetic element.
Formighieri, Cinzia; Melis, Anastasios
2015-11-01
Cyanobacteria can be exploited as photosynthetic platforms for heterologous generation of terpene hydrocarbons with industrial applications. Transformation of Synechocystis and heterologous expression of the β-phellandrene synthase (PHLS) gene alone is necessary and sufficient to confer to Synechocystis the ability to divert intermediate terpenoid metabolites and to generate the monoterpene β-phellandrene during photosynthesis. However, terpene synthases, including the PHLS, have a slow Kcat (low Vmax) necessitating high levels of enzyme concentration to enable meaningful rates and yield of product formation. Here, a novel approach was applied to increase the PHLS protein expression alleviating limitations in the rate and yield of β-phellandrene product generation. Different PHLS fusion constructs were generated with the Synechocystis endogenous cpcB sequence, encoding for the abundant in cyanobacteria phycocyanin β-subunit, expressed under the native cpc operon promoter. In one of these constructs, the CpcB·PHLS fusion protein accumulated to levels approaching 20% of the total cellular protein, i.e., substantially higher than expressing the PHLS protein alone under the same endogenous cpc promoter. The CpcB·PHLS fusion protein retained the activity of the PHLS enzyme and catalyzed β-phellandrene synthesis, yielding an average of 3.2 mg product g(-1) dry cell weight (dcw) versus the 0.03 mg g(-1)dcw measured with low-expressing constructs, i.e., a 100-fold yield improvement. In conclusion, the terpene synthase fusion-protein approach is promising, as, in this case, it substantially increased the amount of the PHLS in cyanobacteria, and commensurately improved rates and yield of β-phellandrene hydrocarbons production in these photosynthetic microorganisms. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Sieira, Rodrigo; Comerci, Diego J.; Sánchez, Daniel O.; Ugalde, Rodolfo A.
2000-01-01
As part of a Brucella abortus 2308 genome project carried out in our laboratory, we identified, cloned, and sequenced a genomic DNA fragment containing a locus (virB) highly homologous to bacterial type IV secretion systems. The B. abortus virB locus is a collinear arrangement of 13 open reading frames (ORFs). Between virB1 and virB2 and downstream of ORF12, two degenerated, palindromic repeat sequences characteristic of Brucella intergenic regions were found. Gene reporter studies demonstrated that the B. abortus virB locus constitutes an operon transcribed from virB1 which is turned on during the stationary phase of growth. A B. abortus polar virB1 mutant failed to replicate in HeLa cells, indicating that the virB operon plays a critical role in intracellular multiplication. Mutants with polar and nonpolar mutations introduced in virB10 showed different behaviors in mice and in the HeLa cell infection assay, suggesting that virB10 per se is necessary for the correct function of this type IV secretion apparatus. Mouse infection assays demonstrated that the virB operon constitutes a major determinant of B. abortus virulence. It is suggested that putative effector molecules secreted by this type IV secretion system determine routing of B. abortus to an endoplasmic reticulum-related replication compartment. PMID:10940027
NASA Astrophysics Data System (ADS)
Kuhnert, Wendi Lee
1999-10-01
The oral microbe, Streptococcus mutans is known to be a primary contributor to the most common infection in humans, dental caries. In the plaque environment, resident bacteria metabolize dietary sucrose which results in the production of organic acids and a decrease in plaque pH. The proton-translocating ATPase (F-ATPase) protects the bacteria from acidification by extruding protons, at the expense of ATP, to maintain an internal pH which is more neutral than the external environment. Examination of this enzyme will help us to gain insight regarding its contribution to the aciduricity characteristics of oral bacteria. In this work, our goal was to begin the molecular dissection of the mechanism by which streptococcal ATPases are regulated and function enzymatically. Sequence analysis of the F-ATPase from the non-pathogenic S. sanguis revealed that the structural genes are homologous to S. mutans as well as other sequenced F-ATPases. Cloned subunits were functionally similar as shown by complementing E. coli ATPase mutants. S. sanguis/E. coli hybrid enzymes hydrolyzed ATP, but proton conduction was uncoupled as demonstrated with inhibition studies. Transcriptional regulation of the F-ATPase operon from S. mutans was examined using chloramphenicol acetyltransferase gene fusions. Fusions containing 136 bp of DNA upstream of the promoter showed higher levels of expression as compared to those with only 16 bp. Similar to ATPase enzymatic activity, CAT expression also increased during growth at low pH. Analysis of RNA demonstrated that ATPase mRNA levels were higher at low pH, which supported the CAT activity data. Therefore, the F-ATPase from S. mutans was regulated, at least partially, by both the DNA located upstream of the promoter as well as by pH. Examination of structural models of the F-ATPase from the pathogenic oral organisms S. mutans and Lactobacillus casei and the non- pathogenic S. sanguis showed that the differences noted in the sequence of the catalytic
Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E
2013-06-24
Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable
Mechanisms of iron regulation of luminescence in Vibrio fischeri.
Haygood, M G; Nealson, K H
1985-01-01
Synthesis of luciferase (an autoinducible enzyme) is repressed by iron in the symbiotic bioluminescent bacterium Vibrio fischeri. Possible mechanisms of iron regulation of luciferase synthesis were tested with V. fischeri and with Escherichia coli clones containing plasmids carrying V. fischeri luminescence genes. Experiments were conducted in complete medium with and without the synthetic iron chelator ethylenediamine-di(o-hydroxyphenyl acetic acid). Comparison of the effect of ethylenediamine-di(o-hydroxyphenyl acetic acid) and another growth inhibitor, (2-n-heptyl-4-hydroxyquinoline-N-oxide), showed that iron repression is not due to inhibition of growth. A quantitative bioassay for autoinducer was developed with E. coli HB101 containing pJE411, a plasmid carrying V. fischeri luminescence genes with a transcriptional fusion between luxI and E. coli lacZ. Bioassay experiments showed no effect of iron on either autoinducer activity or production (before induction) or transcription of the lux operon. Ethylenediamine-di(o-hydroxyphenyl acetic acid) did not affect luciferase induction in E. coli strains with wild-type iron assimilation (ED8654) or impaired iron assimilation (RW193) bearing pJE202 (a plasmid with functional V. fischeri lux genes), suggesting that the genes responsible for the iron effect are missing or substituted in these clones. Two models are consistent with the data: (i) iron represses autoinducer transport, and (ii) iron acts through an autoinduction-independent regulatory system (e.g., an iron repressor). PMID:3920202
Ueki, Toshiyuki; Inouye, Sumiko
2005-12-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
Erwin, Kyle N.; Nakano, Shunji; Zuber, Peter
2005-01-01
Oxidative stress in Bacillus subtilis results in the accumulation of Spx protein, which exerts both positive and negative transcriptional control over a genome-wide scale through its interaction with the RNA polymerase α subunit. Previous microarray transcriptome studies uncovered a unique class of genes that are controlled by Spx-RNA polymerase interaction under normal growth conditions that do not promote Spx overproduction. These genes were repressed by Spx when sulfate was present as a sole sulfur source. The genes include those of the ytmI, yxeI, and ssu operons, which encode products resembling proteins that function in the uptake and desulfurization of organic sulfur compounds. Primer extension and analysis of operon-lacZ fusion expression revealed that the operons are repressed by sulfate and cysteine; however, Spx functioned only in sulfate-dependent repression. Both the ytmI operon and the divergently transcribed ytlI, encoding a LysR-type regulator that positively controls ytmI operon transcription, are repressed by Spx in sulfate-containing media. The CXXC motif of Spx, which is necessary for redox sensitive control of Spx activity in response to oxidative stress, is not required for sulfate-dependent repression. The yxeL-lacZ and ssu-lacZ fusions were also repressed in an Spx-dependent manner in media containing sulfate as the sole sulfur source. This work uncovers a new role for Spx in the control of sulfur metabolism in a gram-positive bacterium under nonstressful growth conditions. PMID:15937167
Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion Centers
2010-03-01
bible ” for fusion center management, as evidenced by the theme of the 2009 National Fusion Center Conference; appropriately called “Achieving Baseline...NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS FUSION 2.0: THE NEXT GENERATION OF FUSION IN CALIFORNIA: ALIGNING STATE AND...Master’s Thesis 4. TITLE AND SUBTITLE Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion
Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.
Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C
1990-01-01
Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625
Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.
Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef
2016-10-15
Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is
RtcB is the RNA ligase component of an Escherichia coli RNA repair operon.
Tanaka, Naoko; Shuman, Stewart
2011-03-11
RNA 2',3'-cyclic phosphate ends play important roles in RNA metabolism as substrates for RNA ligases during tRNA restriction-repair and tRNA splicing. Diverse bacteria from multiple phyla encode a two-component RNA repair cassette, comprising Pnkp (polynucleotide kinase-phosphatase-ligase) and Hen1 (RNA 3'-terminal ribose 2'-O-methyltransferase), that heals and then seals broken tRNAs with 2',3'-cyclic phosphate and 5'-OH ends. The Pnkp-Hen1 repair operon is absent in the majority of bacterial species, thereby raising the prospect that other RNA repair systems might be extant. A candidate component is RNA 3'-phosphate cyclase, a widely distributed enzyme that transforms RNA 3'-monophosphate termini into 2',3'-cyclic phosphates but cannot seal the ends it produces. Escherichia coli RNA cyclase (RtcA) is encoded in a σ(54)-regulated operon with RtcB, a protein of unknown function. Taking a cue from Pnkp-Hen1, we purified E. coli RtcB and tested it for RNA ligase activity. We report that RtcB per se seals broken tRNA-like stem-loop structures with 2',3'-cyclic phosphate and 5'-OH ends to form a splice junction with a 2'-OH, 3',5'-phosphodiester. We speculate that: (i) RtcB might afford bacteria a means to recover from stress-induced RNA damage; and (ii) RtcB homologs might catalyze tRNA repair or splicing reactions in archaea and eukarya.
Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.
2011-01-01
The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596
Ueki, Toshiyuki; Inouye, Sumiko
2005-01-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956
Archana, G.; Naresh Kumar, G.
2014-01-01
Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024
Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan
2014-11-01
The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.
EDITORIAL: The Nuclear Fusion Award The Nuclear Fusion Award
NASA Astrophysics Data System (ADS)
Kikuchi, M.
2011-01-01
The Nuclear Fusion Award ceremony for 2009 and 2010 award winners was held during the 23rd IAEA Fusion Energy Conference in Daejeon. This time, both 2009 and 2010 award winners were celebrated by the IAEA and the participants of the 23rd IAEA Fusion Energy Conference. The Nuclear Fusion Award is a paper prize to acknowledge the best distinguished paper among the published papers in a particular volume of the Nuclear Fusion journal. Among the top-cited and highly-recommended papers chosen by the Editorial Board, excluding overview and review papers, and by analyzing self-citation and non-self-citation with an emphasis on non-self-citation, the Editorial Board confidentially selects ten distinguished papers as nominees for the Nuclear Fusion Award. Certificates are given to the leading authors of the Nuclear Fusion Award nominees. The final winner is selected among the ten nominees by the Nuclear Fusion Editorial Board voting confidentially. 2009 Nuclear Fusion Award nominees For the 2009 award, the papers published in the 2006 volume were assessed and the following papers were nominated, most of which are magnetic confinement experiments, theory and modeling, while one addresses inertial confinement. Sabbagh S.A. et al 2006 Resistive wall stabilized operation in rotating high beta NSTX plasmas Nucl. Fusion 46 635-44 La Haye R.J. et al 2006 Cross-machine benchmarking for ITER of neoclassical tearing mode stabilization by electron cyclotron current drive Nucl. Fusion 46 451-61 Honrubia J.J. et al 2006 Three-dimensional fast electron transport for ignition-scale inertial fusion capsules Nucl. Fusion 46 L25-8 Ido T. et al 2006 Observation of the interaction between the geodesic acoustic mode and ambient fluctuation in the JFT-2M tokamak Nucl. Fusion 46 512-20 Plyusnin V.V. et al 2006 Study of runaway electron generation during major disruptions in JET Nucl. Fusion 46 277-84 Pitts R.A. et al 2006 Far SOL ELM ion energies in JET Nucl. Fusion 46 82-98 Berk H.L. et al 2006
Lee, Inkyoung; Davies, Robert L.
2012-01-01
SUMMARY The tbpBA operon was sequenced in 42 representative isolates of Mannheimia haemolytica (32), Mannheimia glucosida (6) and Bibersteinia trehalosi (4). A total of 27 tbpB and 20 tbpA alleles were identified whilst the tbpBA operon was represented by 28 unique alleles that could be assigned to seven classes. There were 1566 (34.8% variation) polymorphic nucleotide sites and 482 (32.1% variation) variable inferred amino acid positions among the 42 tbpBA sequences. The tbpBA operons of serotype A2 M. haemolytica isolates are, with one exception, substantially more diverse than those of the other M. haemolytica serotypes and most likely have a different ancestral origin. The tbpBA phylogeny has been severely disrupted by numerous small- and large-scale intragenic recombination events. In addition, assortative (entire gene) recombination events, involving either the entire tbpBA operon or the individual tbpB and tbpA genes, have played a major role in shaping tbpBA structure and it’s distribution in the three species. Our findings indicate that a common gene pool exists for tbpBA in M. haemolytica, M. glucosida and B. trehalosi. In particular, B. trehalosi, M. glucosida and ovine M. haemolytica isolates share a large portion of the tbpA gene and this probably reflects selection for a conserved TbpA protein that provides effective iron-uptake in sheep. Bovine and ovine serotype A2 lineages have very different tbpBA alleles. Bovine-like tbpBA alleles have been partially, or completely, replaced by ovine-like tbpBA alleles in ovine serotype A2 isolates suggesting that different transferrin receptors are required by serotype A2 isolates for optimum iron uptake in cattle and sheep. Conversely, the tbpBA alleles of bovine-pathogenic serotype A1 and A6 isolates are very similar to those of closely related ovine isolates suggesting a recent and common evolutionary origin. PMID:20884693
NASA Astrophysics Data System (ADS)
Herman, Robin
1990-10-01
The book abounds with fascinating anecdotes about fusion's rocky path: the spurious claim by Argentine dictator Juan Peron in 1951 that his country had built a working fusion reactor, the rush by the United States to drop secrecy and publicize its fusion work as a propaganda offensive after the Russian success with Sputnik; the fortune Penthouse magazine publisher Bob Guccione sank into an unconventional fusion device, the skepticism that met an assertion by two University of Utah chemists in 1989 that they had created "cold fusion" in a bottle. Aimed at a general audience, the book describes the scientific basis of controlled fusion--the fusing of atomic nuclei, under conditions hotter than the sun, to release energy. Using personal recollections of scientists involved, it traces the history of this little-known international race that began during the Cold War in secret laboratories in the United States, Great Britain and the Soviet Union, and evolved into an astonishingly open collaboration between East and West.
Yoshida, Shogo; Okano, Kenji; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko
2011-10-01
In order to achieve efficient D-lactic acid fermentation from a mixture of xylose and glucose, the xylose-assimilating xylAB operon from Lactobacillus pentosus (PXylAB) was introduced into an L-lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum (ΔldhL1-xpk1::tkt-Δxpk2) strain in which the phosphoketolase 1 gene (xpk1) was replaced with the transketolase gene (tkt) from Lactococcus lactis, and the phosphoketolase 2 (xpk2) gene was deleted. Two copies of xylAB introduced into the genome significantly improved the xylose fermentation ability, raising it to the same level as that of ΔldhL1-xpk1::tkt-Δxpk2 harboring a xylAB operon-expressing plasmid. Using the two-copy xylAB integrated strain, successful homo-D-lactic acid production was achieved from a mixture of 25 g/l xylose and 75 g/l glucose without carbon catabolite repression. After 36-h cultivation, 74.2 g/l of lactic acid was produced with a high yield (0.78 g per gram of consumed sugar) and an optical purity of D-lactic acid of 99.5%. Finally, we successfully demonstrated homo-D-lactic acid fermentation from a mixture of three kinds of sugar: glucose, xylose, and arabinose. This is the first report that describes homo-D-lactic acid fermentation from mixed sugars without carbon catabolite repression using the xylose-assimilating pathway integrated into lactic acid bacteria.
cea-kil operon of the ColE1 plasmid.
Sabik, J F; Suit, J L; Luria, S E
1983-01-01
We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187
Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.
Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S
2006-03-01
Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.
Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.
Stone, D E; Craig, E A
1990-01-01
To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281
Export of the Virulence Factors from Shigella Flexneri and Characterization of the mxi loci
1992-07-20
steps in Shigella pathogenesis. To identify temperature-regulated virulence genes on the plasmid, lacZ protein fusions were randomly generated in S ...this locus conferred the Mxi- phenotype and was found to affect virulence of S . flexneri at the level of invasion, which correlated with reduced...excretion of IpaC. Protease protection experiments indicated the presence of high intracellular reservoirs of Ipa proteins in wild-type S . flexneri as
Pichery, Mélanie; Mirey, Emilie; Mercier, Pascale; Lefrancais, Emma; Dujardin, Arnaud; Ortega, Nathalie; Girard, Jean-Philippe
2012-04-01
IL-33 (previously known as NF from high endothelial venules) is an IL-1 family cytokine that signals through the ST2 receptor and drives cytokine production in mast cells, basophils, eosinophils, invariant NKT and NK cells, Th2 lymphocytes, and type 2 innate immune cells (natural helper cells, nuocytes, and innate helper 2 cells). Little is known about endogenous IL-33; for instance, the cellular sources of IL-33 in mouse tissues have not yet been defined. In this study, we generated an Il-33-LacZ gene trap reporter strain (Il-33(Gt/Gt)) and used this novel tool to analyze expression of endogenous IL-33 in vivo. We found that the Il-33 promoter exhibits constitutive activity in mouse lymphoid organs, epithelial barrier tissues, brain, and embryos. Immunostaining with anti-IL-33 Abs, using Il-33(Gt/Gt) (Il-33-deficient) mice as control, revealed that endogenous IL-33 protein is highly expressed in mouse epithelial barrier tissues, including stratified squamous epithelia from vagina and skin, as well as cuboidal epithelium from lung, stomach, and salivary gland. Constitutive expression of IL-33 was not detected in blood vessels, revealing the existence of species-specific differences between humans and mice. Importantly, IL-33 protein was always localized in the nucleus of producing cells with no evidence for cytoplasmic localization. Finally, strong expression of the Il-33-LacZ reporter was also observed in inflamed tissues, in the liver during LPS-induced endotoxin shock, and in the lung alveoli during papain-induced allergic airway inflammation. Together, our findings support the possibility that IL-33 may function as a nuclear alarmin to alert the innate immune system after injury or infection in epithelial barrier tissues.
Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575
Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J
2004-01-01
A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most
Kuritz, T; Bocanera, L V; Rivera, N S
1997-01-01
Nitrate is essential for lindane dechlorination by the cyanobacteria Anabaena sp. strain PCC7120 and Nostoc ellipsosporum, as it is for dechlorination of other organic compounds by heterotrophic microorganisms. Based on analyses of mutants and effects of environmental factors, we conclude that lindane dechlorination by Anabaena sp. requires a functional nir operon that encodes the enzymes for nitrate utilization. PMID:9150239
High Level Information Fusion (HLIF) with nested fusion loops
NASA Astrophysics Data System (ADS)
Woodley, Robert; Gosnell, Michael; Fischer, Amber
2013-05-01
Situation modeling and threat prediction require higher levels of data fusion in order to provide actionable information. Beyond the sensor data and sources the analyst has access to, the use of out-sourced and re-sourced data is becoming common. Through the years, some common frameworks have emerged for dealing with information fusion—perhaps the most ubiquitous being the JDL Data Fusion Group and their initial 4-level data fusion model. Since these initial developments, numerous models of information fusion have emerged, hoping to better capture the human-centric process of data analyses within a machine-centric framework. 21st Century Systems, Inc. has developed Fusion with Uncertainty Reasoning using Nested Assessment Characterizer Elements (FURNACE) to address challenges of high level information fusion and handle bias, ambiguity, and uncertainty (BAU) for Situation Modeling, Threat Modeling, and Threat Prediction. It combines JDL fusion levels with nested fusion loops and state-of-the-art data reasoning. Initial research has shown that FURNACE is able to reduce BAU and improve the fusion process by allowing high level information fusion (HLIF) to affect lower levels without the double counting of information or other biasing issues. The initial FURNACE project was focused on the underlying algorithms to produce a fusion system able to handle BAU and repurposed data in a cohesive manner. FURNACE supports analyst's efforts to develop situation models, threat models, and threat predictions to increase situational awareness of the battlespace. FURNACE will not only revolutionize the military intelligence realm, but also benefit the larger homeland defense, law enforcement, and business intelligence markets.
Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile
2000-01-01
A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln
Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S
2000-01-01
A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln
Lawley, Blair; Sims, Ian M.
2013-01-01
Lactobacillus ruminis is an inhabitant of human bowels and bovine rumens. None of 10 isolates (three from bovine rumen, seven from human feces) of L. ruminis that were tested could utilize barley β-glucan for growth. Seven of the strains of L. ruminis were, however, able to utilize tetrasaccharides (3-O-β-cellotriosyl-d-glucose [LDP4] or 4-O-β-laminaribiosyl-d-cellobiose [CDP4]) present in β-glucan hydrolysates for growth. The tetrasaccharides were generated by the use of lichenase or cellulase, respectively. To learn more about the utilization of tetrasaccharides by L. ruminis, whole-transcriptome shotgun sequencing (RNA-seq) was tested as a transcriptional screen to detect altered gene expression when an autochthonous human strain (L5) was grown in medium containing CDP4. RNA-seq results were confirmed and extended by reverse transcription-quantitative PCR assays of selected genes in two upregulated operons when cells were grown as batch cultures in medium containing either CDP4 or LDP4. The cellobiose utilization operon had increased transcription, particularly in early growth phase, whereas the chemotaxis/motility operon was upregulated in late growth phase. Phenotypic changes were seen in relation to upregulation of chemotaxis/flagellar operons: flagella were rarely seen by electron microscopy on glucose-grown cells but cells cultured in tetrasaccharide medium were commonly flagellated. Chemotactic movement toward tetrasaccharides was demonstrated in capillary cultures. L. ruminis utilized 3-O-β-cellotriosyl-d-glucose released by β-glucan hydrolysis due to bowel commensal Coprococcus sp., indicating that cross feeding of tetrasaccharide between bacteria could occur. Therefore, the RNA-seq screen and subsequent experiments had utility in revealing foraging attributes of gut commensal Lactobacillus ruminis. PMID:23851085
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moir, R.W.
1982-02-22
The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moir, R.W.
1982-04-20
The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu
2015-05-15
Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formedmore » draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.« less
Stratmann, Thomas; Madhusudan, S.; Schnetz, Karin
2008-01-01
The yjjQ and bglJ genes encode LuxR-type transcription factors conserved in several enterobacterial species. YjjQ is a potential virulence factor in avian pathogenic Escherichia coli. BglJ counteracts the silencing of the bgl (β-glucoside) operon by H-NS in E. coli K-12. Here we show that yjjQ and bglJ form an operon carried by E. coli K-12, whose expression is repressed by the histone-like nucleoid structuring (H-NS) protein. The LysR-type transcription factor LeuO counteracts this repression. Furthermore, the yjjP gene, encoding a membrane protein of unknown function and located upstream in divergent orientation to the yjjQ-bglJ operon, is likewise repressed by H-NS. Mapping of the promoters as well as the H-NS and LeuO binding sites within the 555-bp intergenic region revealed that H-NS binds to the center of the AT-rich regulatory region and distal to the divergent promoters. LeuO sites map to the center and to positions distal to the yjjQ promoters, while one LeuO binding site overlaps with the divergent yjjP promoter. This latter LeuO site is required for full derepression of the yjjQ promoters. The arrangement of regulatory sites suggests that LeuO restructures the nucleoprotein complex formed by H-NS. Furthermore, the data support the conclusion that LeuO, whose expression is likewise repressed by H-NS and which is a virulence factor in Salmonella enterica, is a master regulator that among other loci, also controls the yjjQ-bglJ operon and thus indirectly the presumptive targets of YjjQ and BglJ. PMID:18055596
Paramyxovirus fusion: Real-time measurement of parainfluenza virus 5 virus-cell fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Connolly, Sarah A.; Lamb, Robert A.
2006-11-25
Although cell-cell fusion assays are useful surrogate methods for studying virus fusion, differences between cell-cell and virus-cell fusion exist. To examine paramyxovirus fusion in real time, we labeled viruses with fluorescent lipid probes and monitored virus-cell fusion by fluorimetry. Two parainfluenza virus 5 (PIV5) isolates (W3A and SER) and PIV5 containing mutations within the fusion protein (F) were studied. Fusion was specific and temperature-dependent. Compared to many low pH-dependent viruses, the kinetics of PIV5 fusion was slow, approaching completion within several minutes. As predicted from cell-cell fusion assays, virus containing an F protein with an extended cytoplasmic tail (rSV5 F551)more » had reduced fusion compared to wild-type virus (W3A). In contrast, virus-cell fusion for SER occurred at near wild-type levels, despite the fact that this isolate exhibits a severely reduced cell-cell fusion phenotype. These results support the notion that virus-cell and cell-cell fusion have significant differences.« less
Jakomin, Marcello; Chessa, Daniela; Bäumler, Andreas J; Casadesús, Josep
2008-11-01
DNA adenine methylase (dam) mutants of Salmonella enterica serovar Typhimurium grown under laboratory conditions express the std fimbrial operon, which is tightly repressed in the wild type. Here, we show that uncontrolled production of Std fimbriae in S. enterica serovar Typhimurium dam mutants contributes to attenuation in mice, as indicated by the observation that an stdA dam strain is more competitive than a dam strain upon oral infection. Dam methylation appears to regulate std transcription, rather than std mRNA stability or turnover. A genetic screen for std regulators showed that the GATC-binding protein SeqA directly or indirectly represses std expression, while the poorly characterized yifA gene product serves as an std activator. YifA encodes a putative LysR-like protein and has been renamed HdfR, like its Escherichia coli homolog. Activation of std expression by HdfR is observed only in dam and seqA backgrounds. These data suggest that HdfR directly or indirectly activates std transcription. Since SeqA is unable to bind nonmethylated DNA, it is possible that std operon derepression in dam and seqA mutants may result from unconstrained HdfR-mediated activation of std transcription. Derepression of std in dam and seqA mutants of S. enterica occurs in only a fraction of the bacterial population, suggesting the occurrence of either bistable expression or phase variation.
Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier
2017-07-01
Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.
Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W
2011-12-01
Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.
Fiévet, Anouchka; My, Laetitia; Cascales, Eric; Ansaldi, Mireille; Pauleta, Sofia R.; Moura, Isabel; Dermoun, Zorah; Bernard, Christophe S.; Dolla, Alain; Aubert, Corinne
2011-01-01
Analysis of sequenced bacterial genomes revealed that the genomes encode more than 30% hypothetical and conserved hypothetical proteins of unknown function. Among proteins of unknown function that are conserved in anaerobes, some might be determinants of the anaerobic way of life. This study focuses on two divergent clusters specifically found in anaerobic microorganisms and mainly composed of genes encoding conserved hypothetical proteins. We show that the two gene clusters DVU2103-DVU2104-DVU2105 (orp2) and DVU2107-DVU2108-DVU2109 (orp1) form two divergent operons transcribed by the σ54-RNA polymerase. We further demonstrate that the σ54-dependent transcriptional regulator DVU2106, located between orp1 and orp2, collaborates with σ54-RNA polymerase to orchestrate the simultaneous expression of the divergent orp operons. DVU2106, whose structural gene is transcribed by the σ70-RNA polymerase, negatively retrocontrols its own expression. By using an endogenous pulldown strategy, we identify a physiological complex composed of DVU2103, DVU2104, DVU2105, DVU2108, and DVU2109. Interestingly, inactivation of DVU2106, which is required for orp operon transcription, induces morphological defects that are likely linked to the absence of the ORP complex. A putative role of the ORP proteins in positioning the septum during cell division is discussed. PMID:21531797
Marini, F C; Cannon, J P; Belmont, J W; Shillitoe, E J; Lapeyre, J N
1995-09-01
We evaluated the ability of a replication-deficient, recombinant adenoviral vector to transfer the bifunctional gene GAL-TEK, which expresses a marking/therapeutic gene product, to naturally occurring cat fibrosarcomas in situ. GAL-TEK contains an in-frame fusion of the bacterial LacZ gene for histochemical marking of tumors with beta-galactosidase (beta-Gal) and the HSV tk gene for enzyme-prodrug activation of the prodrug ganciclovir (GCV) to induce selective tumor cell killing. GAL-TEK bifunctional marking and cell killing activities were tested in vitro after adenoviral vector infection of HT1080 human fibrosarcoma cells. The tk activity of GAL-TEK is shown to be almost as potent as HSV tk to catalyze conversion of GCV to GCV nucleotides and promote selective cell killing. Using 8 cats with recurring 2.5-cm2 fibrosarcomas that either arose spontaneously or were induced by vaccine, we determined experimentally the administration routes and times required for optimum GAL-TEK gene transfer by beta-Gal histological staining and reverse transcriptase polymerase chain reaction to the multiple compartments of the growing fibrosarcomas consonant with minimizing collateral infection of neighboring tissues and other unwanted side effects.
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.
Burbank, Lindsey P; Van Horn, Christopher R
2017-11-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions
Van Horn, Christopher R.
2017-01-01
ABSTRACT The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 (X. fastidiosa subsp. fastidiosa) or Dixon (X. fastidiosa subsp. multiplex) as the donor strain and Temecula (X. fastidiosa subsp. fastidiosa) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa, possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa, or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence
Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P
2000-10-01
Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost < or =2 log(10) CFU/ml/24 h. The mutants had unchanged penicillin-binding proteins but contained increased amounts of two proteins with respective masses of ca. 50 and 45 kDa. One mutant (Tol1) was further characterized. The two proteins showing increased levels were homologous to the arginine deiminase and ornithine carbamoyl transferase of other gram-positive bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic
Sycz, Gabriela; Carrica, Mariela Carmen; Tseng, Tong-Seung; Bogomolni, Roberto A.; Briggs, Winslow R.; Goldbaum, Fernando A.; Paris, Gastón
2015-01-01
Brucella is the causative agent of the zoonotic disease brucellosis, and its success as an intracellular pathogen relies on its ability to adapt to the harsh environmental conditions that it encounters inside the host. The Brucella genome encodes a sensor histidine kinase containing a LOV domain upstream from the kinase, LOVHK, which plays an important role in light-regulated Brucella virulence. In this report we study the intracellular signaling pathway initiated by the light sensor LOVHK using an integrated biochemical and genetic approach. From results of bacterial two-hybrid assays and phosphotransfer experiments we demonstrate that LOVHK functionally interacts with two response regulators: PhyR and LovR, constituting a functional two-component signal-transduction system. LOVHK contributes to the activation of the General Stress Response (GSR) system in Brucella via PhyR, while LovR is proposed to be a phosphate-sink for LOVHK, decreasing its phosphorylation state. We also show that in the absence of LOVHK the expression of the virB operon is down-regulated. In conclusion, our results suggest that LOVHK positively regulates the GSR system in vivo, and has an effect on the expression of the virB operon. The proposed regulatory network suggests a similar role for LOVHK in other microorganisms. PMID:25993430
hisT is part of a multigene operon in Escherichia coli K-12.
Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E
1985-01-01
The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810
Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.
2006-07-05
The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1{sup V12} or Cdc42{sup V12} could increase cell-cell fusion promoted by the Hendra ormore » SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA{sup L63} decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia.« less
Tabata, Atsushi; Nakano, Kota; Ohkura, Kazuto; Tomoyasu, Toshifumi; Kikuchi, Ken; Whiley, Robert A.
2013-01-01
Streptococcus anginosus is a member of the anginosus group streptococci, which form part of the normal human oral flora. In contrast to the pyogenic group streptococci, our knowledge of the virulence factors of the anginosus group streptococci, including S. anginosus, is not sufficient to allow a clear understanding of the basis of their pathogenicity. Generally, hemolysins are thought to be important virulence factors in streptococcal infections. In the present study, a sag operon homologue was shown to be responsible for beta-hemolysis in S. anginosus strains by random gene knockout. Interestingly, contrary to pyogenic group streptococci, beta-hemolytic S. anginosus was shown to have two tandem sagA homologues, encoding streptolysin S (SLS)-like peptides, in the sag operon homologue. Gene deletion and complementation experiments revealed that both genes were functional, and these SLS-like peptides were essential for beta-hemolysis in beta-hemolytic S. anginosus. Furthermore, the amino acid sequence of these SLS-like peptides differed from that of the typical SLS of S. pyogenes, especially in their propeptide domain, and an amino acid residue indicated to be important for the cytolytic activity of SLS in S. pyogenes was deleted in both S. anginosus homologues. These data suggest that SLS-like peptides encoded by two sagA homologues in beta-hemolytic S. anginosus may be potential virulence factors with a different structure essential for hemolytic activity and/or the maturation process compared to the typical SLS present in pyogenic group streptococci. PMID:23292771
BIOLUMINESCENT SENSORS FOR DETECTION OF BIOAVAILABLE HG(II) IN THE ENVIRONMENT
Biosensors for the detection of pollutants in the environment can complement analytical methods by distinguishing bioavailable from inert unavailable forms of the contaminants. y using fusions of the well understood TN21 mercury resistance operon (mer) with promoterless luxCDABE ...
Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M
2001-04-01
We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.
The Fusion Gain Analysis of the Inductively Driven Liner Compression Based Fusion
NASA Astrophysics Data System (ADS)
Shimazu, Akihisa; Slough, John
2016-10-01
An analytical analysis of the fusion gain expected in the inductively driven liner compression (IDLC) based fusion is conducted to identify the fusion gain scaling at various operating conditions. The fusion based on the IDLC is a magneto-inertial fusion concept, where a Field-Reversed Configuration (FRC) plasmoid is compressed via the inductively-driven metal liner to drive the FRC to fusion conditions. In the past, an approximate scaling law for the expected fusion gain for the IDLC based fusion was obtained under the key assumptions of (1) D-T fuel at 5-40 keV, (2) adiabatic scaling laws for the FRC dynamics, (3) FRC energy dominated by the pressure balance with the edge magnetic field at the peak compression, and (4) the liner dwell time being liner final diameter divided by the peak liner velocity. In this study, various assumptions made in the previous derivation is relaxed to study the change in the fusion gain scaling from the previous result of G ml1 / 2 El11 / 8 , where ml is the liner mass and El is the peak liner kinetic energy. The implication from the modified fusion gain scaling on the performance of the IDLC fusion reactor system is also explored.
A major defect in mast cell effector functions in CRACM1-/- mice
Vig, Monika; Dehaven, Wayne I; Bird, Gary S; Billingsley, James M; Wang, Huiyun; Rao, Patricia E; Hutchings, Amy B; Jouvin, Marie-Hélène; Putney, James W; Kinet, Jean-Pierre
2008-01-01
CRACM1 (Orai1) constitutes the pore subunit of CRAC channels that are crucial for many physiological processes 1-6. A point mutation in CRACM1 has been associated with SCID disease in humans 2. We have generated CRACM1 deficient mice using gene trap, where β-galactosidase (LacZ) activity identifies CRACM1 expression in tissues. We show here that the homozygous CRACM1 deficient mice are considerably smaller in size and are grossly defective in mast cell degranulation and cytokine secretion. FcεRI-mediated in vivo allergic reactions were also inhibited in CRACM1-/- mice. Other tissues expressing truncated CRACM1-LacZ fusion protein include skeletal muscles, kidney and regions in the brain and heart. Surprisingly, no CRACM1 expression was seen in the lymphoid regions of thymus. Accordingly, we found no defect in T cell development. Thus, our data reveal novel crucial roles for CRAC channels including a putative role in excitable cells. PMID:18059270
Novel cooperative neural fusion algorithms for image restoration and image fusion.
Xia, Youshen; Kamel, Mohamed S
2007-02-01
To deal with the problem of restoring degraded images with non-Gaussian noise, this paper proposes a novel cooperative neural fusion regularization (CNFR) algorithm for image restoration. Compared with conventional regularization algorithms for image restoration, the proposed CNFR algorithm can relax need of the optimal regularization parameter to be estimated. Furthermore, to enhance the quality of restored images, this paper presents a cooperative neural fusion (CNF) algorithm for image fusion. Compared with existing signal-level image fusion algorithms, the proposed CNF algorithm can greatly reduce the loss of contrast information under blind Gaussian noise environments. The performance analysis shows that the proposed two neural fusion algorithms can converge globally to the robust and optimal image estimate. Simulation results confirm that in different noise environments, the proposed two neural fusion algorithms can obtain a better image estimate than several well known image restoration and image fusion methods.
Jahn, Courtney E; Selimi, Dija A; Barak, Jeri D; Charkowski, Amy O
2011-10-01
Dickeya dadantii is a plant-pathogenic bacterium that produces cellulose-containing biofilms, called pellicles, at the air-liquid interface of liquid cultures. D. dadantii pellicle formation appears to be an emergent property dependent upon at least three gene clusters, including cellulose synthesis, type III secretion system (T3SS) and flagellar genes. The D. dadantii cellulose synthesis operon is homologous to that of Gluconacetobacter xylinus, which is used for industrial cellulose production, and the cellulose nanofibres produced by D. dadantii were similar in diameter and branching pattern to those produced by G. xylinus. Salmonella enterica, an enterobacterium closely related to D. dadantii, encodes a second type of cellulose synthesis operon, and it produced biofilm strands that differed in width and branching pattern from those of D. dadantii and G. xylinus. Unlike any previously described cellulose fibre, the D. dadantii cellulose nanofibres were decorated with bead-like structures. Mutation of the cellulose synthesis operon genes resulted in loss of cellulose synthesis and production of a cellulase-resistant biofilm. Mutation of other genes required for pellicle formation, including those encoding FliA (a sigma factor that regulates flagella production), HrpL (a sigma factor that regulates the T3SS), and AdrA, a GGDEF protein, affected both biofilm and cell morphology. Mutation of the cellulose synthase bcsA or of bcsC resulted in decreased accumulation of the T3SS-secreted protein HrpN.
Dash, Hirak R; Basu, Subham; Das, Surajit
2017-04-01
Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.
NASA Astrophysics Data System (ADS)
Ongena, J.; Koch, R.; Wolf, R.; Zohm, H.
2016-05-01
Our modern society requires environmentally friendly solutions for energy production. Energy can be released not only from the fission of heavy nuclei but also from the fusion of light nuclei. Nuclear fusion is an important option for a clean and safe solution for our long-term energy needs. The extremely high temperatures required for the fusion reaction are routinely realized in several magnetic-fusion machines. Since the early 1990s, up to 16 MW of fusion power has been released in pulses of a few seconds, corresponding to a power multiplication close to break-even. Our understanding of the very complex behaviour of a magnetized plasma at temperatures between 150 and 200 million °C surrounded by cold walls has also advanced substantially. This steady progress has resulted in the construction of ITER, a fusion device with a planned fusion power output of 500 MW in pulses of 400 s. ITER should provide answers to remaining important questions on the integration of physics and technology, through a full-size demonstration of a tenfold power multiplication, and on nuclear safety aspects. Here we review the basic physics underlying magnetic fusion: past achievements, present efforts and the prospects for future production of electrical energy. We also discuss questions related to the safety, waste management and decommissioning of a future fusion power plant.
Gupta, S C; Siddique, H R; Saxena, D K; Chowdhuri, D Kar
2005-01-01
This study investigated the working hypothesis that two widely used organophosphate pesticides; Nuvan and Dimecron, exert toxic effects in Drosophila. Transgenic D. melanogaster (hsp70-lacZ) was used as a model for assaying stress gene expression and AchE activity as an endpoint for toxicity and also to evaluate whether stress gene expression is sufficient to protect against toxic insult of the chemicals and to prevent tissue damage. The study was extended to investigate the effect of the pesticides on the life cycle and reproduction of the organism. The study showed that Nuvan affected emergence of the exposed flies more drastically than Dimecron and the effect was lethal at the highest tested concentration (0.075 ppm). While Nuvan at 0.0075 and 0.015 ppm concentrations affected reproduction of the flies significantly, the effect of Dimecron was significant only at 0.015 and 0.075 ppm. Nuvan-exposed third-instar larvae exhibited a 1.2-fold to 1.5-fold greater hsp70 expression compared to Dimecron at concentrations ranging from 0.0075 to 0.075 ppm following 12 and 18 h exposure. While maximum expression of hsp70 was observed in Nuvan-exposed third-instar larval tissues following 18 h exposure at 0.075 ppm, Dimecron at the same dietary concentration induced a maximum expression of hsp70 following 24 h exposure. Further, concomitant with a significant induction of hsp70, significant inhibition of AchE was observed following chemical exposure and temperature shock. Concurrent with a significant decline in hsp70 expression in Nuvan-exposed larvae after 48 h at 0.075 ppm, tissue damage was evident. Dimecron-exposed larvae exhibited a plateau in hsp70 induction even after 48 h exposure and moderate tissue damage was observed in these larvae. The present study suggests that Nuvan is more cytotoxic than Dimecron in transgenic Drosophila melanogaster.
FuzzyFusion: an application architecture for multisource information fusion
NASA Astrophysics Data System (ADS)
Fox, Kevin L.; Henning, Ronda R.
2009-04-01
The correlation of information from disparate sources has long been an issue in data fusion research. Traditional data fusion addresses the correlation of information from sources as diverse as single-purpose sensors to all-source multi-media information. Information system vulnerability information is similar in its diversity of sources and content, and in the desire to draw a meaningful conclusion, namely, the security posture of the system under inspection. FuzzyFusionTM, A data fusion model that is being applied to the computer network operations domain is presented. This model has been successfully prototyped in an applied research environment and represents a next generation assurance tool for system and network security.
The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.
Ahn, Sang-Joon; Burne, Robert A
2006-10-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.
Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability
Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca
2017-01-01
Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726–35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. PMID:28213515
Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G.; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai
2015-01-01
We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. PMID:26040699
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
Zhu, Y; Lin, E C
1988-01-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341
NASA Technical Reports Server (NTRS)
Armour, Edward A.G.
2007-01-01
Muon catalyzed fusion is a process in which a negatively charged muon combines with two nuclei of isotopes of hydrogen, e.g, a proton and a deuteron or a deuteron and a triton, to form a muonic molecular ion in which the binding is so tight that nuclear fusion occurs. The muon is normally released after fusion has taken place and so can catalyze further fusions. As the muon has a mean lifetime of 2.2 microseconds, this is the maximum period over which a muon can participate in this process. This article gives an outline of the history of muon catalyzed fusion from 1947, when it was first realised that such a process might occur, to the present day. It includes a description of the contribution that Drachrnan has made to the theory of muon catalyzed fusion and the influence this has had on the author's research.
Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability.
Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca
2017-04-07
Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726-35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery
Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo
2012-01-01
Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2–ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data. PMID:22570408
FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery.
Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo
2012-09-01
Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2-ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data.
Weirather, Jason L; Afshar, Pegah Tootoonchi; Clark, Tyson A; Tseng, Elizabeth; Powers, Linda S; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai
2015-10-15
We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nuclear Fusion prize laudation Nuclear Fusion prize laudation
NASA Astrophysics Data System (ADS)
Burkart, W.
2011-01-01
Clean energy in abundance will be of critical importance to the pursuit of world peace and development. As part of the IAEA's activities to facilitate the dissemination of fusion related science and technology, the journal Nuclear Fusion is intended to contribute to the realization of such energy from fusion. In 2010, we celebrated the 50th anniversary of the IAEA journal. The excellence of research published in the journal is attested to by its high citation index. The IAEA recognizes excellence by means of an annual prize awarded to the authors of papers judged to have made the greatest impact. On the occasion of the 2010 IAEA Fusion Energy Conference in Daejeon, Republic of Korea at the welcome dinner hosted by the city of Daejeon, we celebrated the achievements of the 2009 and 2010 Nuclear Fusion prize winners. Steve Sabbagh, from the Department of Applied Physics and Applied Mathematics, Columbia University, New York is the winner of the 2009 award for his paper: 'Resistive wall stabilized operation in rotating high beta NSTX plasmas' [1]. This is a landmark paper which reports record parameters of beta in a large spherical torus plasma and presents a thorough investigation of the physics of resistive wall mode (RWM) instability. The paper makes a significant contribution to the critical topic of RWM stabilization. John Rice, from the Plasma Science and Fusion Center, MIT, Cambridge is the winner of the 2010 award for his paper: 'Inter-machine comparison of intrinsic toroidal rotation in tokamaks' [2]. The 2010 award is for a seminal paper that analyzes results across a range of machines in order to develop a universal scaling that can be used to predict intrinsic rotation. This paper has already triggered a wealth of experimental and theoretical work. I congratulate both authors and their colleagues on these exceptional papers. W. Burkart Deputy Director General Department of Nuclear Sciences and Applications International Atomic Energy Agency, Vienna
DOE Office of Scientific and Technical Information (OSTI.GOV)
Donovan, D. C.; Boris, D. R.; Kulcinski, G. L.
2013-03-15
A new diagnostic has been developed that uses the time of flight (TOF) of the products from a nuclear fusion reaction to determine the location where the fusion reaction occurred. The TOF diagnostic uses charged particle detectors on opposing sides of the inertial electrostatic confinement (IEC) device that are coupled to high resolution timing electronics to measure the spatial profile of fusion reactions occurring between the two charged particle detectors. This diagnostic was constructed and tested by the University of Wisconsin-Madison Inertial Electrostatic Confinement Fusion Group in the IEC device, HOMER, which accelerates deuterium ions to fusion relevant energies inmore » a high voltage ({approx}100 kV), spherically symmetric, electrostatic potential well [J. F. Santarius, G. L. Kulcinski, R. P. Ashley, D. R. Boris, B. B. Cipiti, S. K. Murali, G. R. Piefer, R. F. Radel, T. E. Radel, and A. L. Wehmeyer, Fusion Sci. Technol. 47, 1238 (2005)]. The TOF diagnostic detects the products of D(d,p)T reactions and determines where along a chord through the device the fusion event occurred. The diagnostic is also capable of using charged particle spectroscopy to determine the Doppler shift imparted to the fusion products by the center of mass energy of the fusion reactants. The TOF diagnostic is thus able to collect spatial profiles of the fusion reaction density along a chord through the device, coupled with the center of mass energy of the reactions occurring at each location. This provides levels of diagnostic detail never before achieved on an IEC device.« less
... concept of fusion is similar to that of welding in industry. Spinal fusion surgery, however, does not ... bone taken from the patient has a long history of use and results in predictable healing. Autograft ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fillo, J.A.
1980-01-01
Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. 40 to 60% and hydrogen production efficiencies by high-temperature electrolysis of approx. 50 to 65% are projected for fusion reactors using high-temperatures blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long term, there could be a gradual transition to an inexhaustible energy system based solely on fusion.
Arthroscopic partial wrist fusion.
Ho, Pak-Cheong
2008-12-01
The wide intraarticular exposure of the wrist joint under arthroscopic view provides an excellent ground for various forms of partial wrist fusion. Combining with percutaneous fixation technique, arthroscopic partial wrist fusion can potentially generate the best possible functional outcome by preserving the maximal motion pertained with each type of partial wrist fusion because the effect of extraarticular adhesion associated with open surgery can be minimized. From November 1997 to May 2008, the author had performed 12 cases of arthroscopic partial wrist fusion, including scaphotrapeziotrapezoid fusion in 3, scaphoidectomy and 4-corner fusion in 4, radioscapholunate fusion in 3, radiolunate fusion in 1, and lunotriquetral fusion in 1 case. Through the radiocarpal or midcarpal joint, the corresponding articular surfaces were denuded of cartilage using arthroscopic burr and curette. Carpal bones involved in the fusion process were then transfixed with K wires percutaneously after alignment corrected and confirmed under fluoroscopic control. Autogenous cancellous bone graft or bone substitute were inserted and impacted to the fusion site through cannula under direct arthroscopic view. Final fixation could be by multiple K wires or cannulated screw system. Early mobilization was encouraged. Surgical complications were minor, including pin tract infection, skin burn, and delay union in 1 case. Uneventful radiologic union was obtained in 9 cases, stable fibrous union in 2, and nonunion in 1. The average follow-up period was 70 months. Symptom was resolved or improved, and functional motion was gained in all cases. All surgical scars were almost invisible, and aesthetic outcome was excellent.
Wurden, G. A.; Hsu, S. C.; Intrator, T. P.; ...
2015-11-17
In this community white paper, we describe an approach to achieving fusion which employs a hybrid of elements from the traditional magnetic and inertial fusion concepts, called magneto-inertial fusion (MIF). Furthermore, the status of MIF research in North America at multiple institutions is summarized including recent progress, research opportunities, and future plans.
Membrane fusion and exocytosis.
Jahn, R; Südhof, T C
1999-01-01
Membrane fusion involves the merger of two phospholipid bilayers in an aqueous environment. In artificial lipid bilayers, fusion proceeds by means of defined transition states, including hourglass-shaped intermediates in which the proximal leaflets of the fusing membranes are merged whereas the distal leaflets are separate (fusion stalk), followed by the reversible opening of small aqueous fusion pores. Fusion of biological membranes requires the action of specific fusion proteins. Best understood are the viral fusion proteins that are responsible for merging the viral with the host cell membrane during infection. These proteins undergo spontaneous and dramatic conformational changes upon activation. In the case of the paradigmatic fusion proteins of the influenza virus and of the human immunodeficiency virus, an amphiphilic fusion peptide is inserted into the target membrane. The protein then reorients itself, thus forcing the fusing membranes together and inducing lipid mixing. Fusion of intracellular membranes in eukaryotic cells involves several protein families including SNAREs, Rab proteins, and Sec1/Munc-18 related proteins (SM-proteins). SNAREs form a novel superfamily of small and mostly membrane-anchored proteins that share a common motif of about 60 amino acids (SNARE motif). SNAREs reversibly assemble into tightly packed helical bundles, the core complexes. Assembly is thought to pull the fusing membranes closely together, thus inducing fusion. SM-proteins comprise a family of soluble proteins that bind to certain types of SNAREs and prevent the formation of core complexes. Rab proteins are GTPases that undergo highly regulated GTP-GDP cycles. In their GTP form, they interact with specific proteins, the effector proteins. Recent evidence suggests that Rab proteins function in the initial membrane contact connecting the fusing membranes but are not involved in the fusion reaction itself.
Henke, Nadja A.; Heider, Sabine A. E.; Hannibal, Silvin; Wendisch, Volker F.; Peters-Wendisch, Petra
2017-01-01
Corynebacterium glutamicum is a natural producer of the C50 carotenoid decaprenoxanthin. The crtEcg0722crtBIYEb operon comprises most of its genes for terpenoid biosynthesis. The MarR-type regulator encoded upstream and in divergent orientation of the carotenoid biosynthesis operon has not yet been characterized. This regulator, named CrtR in this study, is encoded in many actinobacterial genomes co-occurring with terpenoid biosynthesis genes. CrtR was shown to repress the crt operon of C. glutamicum since DNA microarray experiments revealed that transcript levels of crt operon genes were increased 10 to 70-fold in its absence. Transcriptional fusions of a promoter-less gfp gene with the crt operon and crtR promoters confirmed that CrtR represses its own gene and the crt operon. Gel mobility shift assays with purified His-tagged CrtR showed that CrtR binds to a region overlapping with the −10 and −35 promoter sequences of the crt operon. Isoprenoid pyrophosphates interfered with binding of CrtR to its target DNA, a so far unknown mechanism for regulation of carotenogenesis. The molecular details of protein-ligand interactions remain to be studied. Decaprenoxanthin synthesis by C. glutamicum wild type was enhanced 10 to 30-fold upon deletion of crtR and was decreased 5 to 6-fold as result of crtR overexpression. Moreover, deletion of crtR was shown as metabolic engineering strategy to improve production of native and non-native carotenoids including lycopene, β-carotene, C.p. 450 and sarcinaxanthin. PMID:28484430
Choi, Kyoung-Hwa; Hwang, Sungmin
2013-01-01
A putative maltose/maltodextrin operon was found in the Sulfolobus acidocaldarius DSM639 genome. The gene cluster consisted of 7 genes (malA, trmB, amyA, malG, malF, malE, and malK). Here, we report the identification of MalA, which is responsible for the hydrolysis of maltose or maltodextrin to glucose in S. acidocaldarius. The transcription level of malA was increased 3-fold upon the addition of maltose or starch to the medium. Moreover, the α-glucosidase activity for maltose as a substrate in cell extracts of S. acidocaldarius DSM639 was also 11- and 10-fold higher during growth in YT medium (Brock's mineral salts, 0.1% [wt/vol] tryptone, and 0.005% [wt/vol] yeast extract) containing maltose or starch, respectively, than during growth on other sugars. The gene encoding MalA was cloned and expressed in S. acidocaldarius. The enzyme purified from the organism was a dodecamer in its active state and showed strong maltose-hydrolyzing activity at 100°C and pH 5.0. MalA was remarkably thermostable, with half-lives of 33.8 h, 10.6 h, and 1.8 h at 95°C, 100°C, and 105°C, respectively. Substrate specificity and kinetic studies of MalA with maltooligosaccharides indicated that MalA efficiently hydrolyzed maltose to maltopentaose, which is a typical characteristic of GH31-type α-glucosidases. However, glycogen or starch was not hydrolyzed. Reverse transcription-PCR, sugar uptake, and growth studies of the wild-type DSM639 and ΔmalEFG mutant on different sugars demonstrated that MalA located in the mal operon gene cluster is involved in maltose and starch metabolism in S. acidocaldarius. PMID:23396915
Review of the magnetic fusion program by the 1986 ERAB Fusion Panel
NASA Astrophysics Data System (ADS)
Davidson, Ronald C.
1987-09-01
The 1986 ERAB Fusion Panel finds that fusion energy continues to be an attractive energy source with great potential for the future, and that the magnetic fusion program continues to make substantial technical progress. In addition, fusion research advances plasma physics, a sophisticated and useful branch of applied science, as well as technologies important to industry and defense. These factors fully justify the substantial expenditures by the Department of Energy in fusion research and development (R&D). The Panel endorses the overall program direction, strategy, and plans, and recognizes the importance and timeliness of proceeding with a burning plasma experiment, such as the proposed Compact Ignition Tokamak (CIT) experiment.
The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton
2010-08-15
Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmicmore » tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger.« less
The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion
Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton; Moncman, Carole L.; Dutch, Rebecca Ellis; McCann, Richard O.
2010-01-01
Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmic tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger. PMID:20537366
Pang, Xiuhua; Samten, Buka; Cao, Guangxiang; Wang, Xisheng; Tvinnereim, Amy R; Chen, Xiu-Lan; Howard, Susan T
2013-01-01
The ESX-1 secretion system exports the immunomodulatory protein ESAT-6 and other proteins important in the pathogenesis of Mycobacterium tuberculosis. Components and substrates of ESX-1 are encoded at several loci, but the regulation of the encoding genes is only partially understood. In this study, we investigated the role of the MprAB two-component system in the regulation of ESX-1 activity. We determined that MprAB directly regulates the espA gene cluster, a locus necessary for ESX-1 function. Transcript mapping determined that the five genes in the cluster form an operon with two transcriptional start points, and several MprA binding sites were detected in the espA promoter. Expression analyses and promoter constructs indicated that MprAB represses the espA operon. However, the MprAB mutant Rv-D981 secreted lower levels of EspA, ESAT-6, and the ESX-1 substrate EspB than control strains. Secretion of CFP10, which is normally cosecreted with ESAT-6, was similar in Rv-D981 and control strains, further demonstrating aberrant ESX-1 activity in the mutant. ESAT-6 induces proinflammatory cytokines, and macrophages infected with Rv-D981 elicited lower levels of interleukin 1β (IL-1β) and tumor necrosis factor alpha (TNF-α), consistent with the reduced levels of ESAT-6. These findings indicate that MprAB modulates ESX-1 function and reveal a new role for MprAB in host-pathogen interactions.
Tabor, C W; Tabor, H
1987-11-25
We have previously shown that the gene (speD) for S-adenosylmethionine decarboxylase is part of an operon that also contains the gene (speE) for spermidine synthase (Tabor, C. W., Tabor, H., and Xie, Q.-W. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6040-6044). We have now determined the nucleotide sequence of this operon and have found that speD codes for a polypeptide of Mr = 30,400, which is considerably greater than the subunit size of the purified enzyme. Our studies show that S-adenosylmethionine decarboxylase is first formed as a Mr = 30,400 polypeptide and that this proenzyme is then cleaved at the Lys111-Ser112 peptide bond to form a Mr = 12,400 subunit and a Mr = 18,000 subunit. The latter subunit contains the pyruvoyl moiety that we previously showed is required for enzymatic activity. Both subunits are present in the purified enzyme. These conclusions are based on (i) pulse-chase experiments with a strain containing a speD+ plasmid which showed a precursor-product relationship between the proenzyme and the enzyme subunits, (ii) the amino acid sequence of the proenzyme form of S-adenosylmethionine decarboxylase (derived from the nucleotide sequence of the speD gene), and (iii) comparison of this sequence of the proenzyme with the N-terminal amino acid sequences of the two subunits of the purified enzyme reported by Anton and Kutny (Anton, D. L., and Kutny, R. (1987) J. Biol. Chem. 262, 2817-2822).
Ontological Issues in Higher Levels of Information Fusion: User Refinement of the Fusion Process
2003-01-01
fusion question, the thing that is separates the Greek We explore the higher-level purpose offusion systems by philosophical questions and modem day...the The Greeks focused on both data fusion and the Fusion02 conference there are common fusion questions philosophical questions of an ontology - the...data World of Visible Things Belief (pistis) fusion - user refinement. The rest of the paper is as Appearances follows: Section 2 details the Greek
Distinct Requirements for HIV-Cell Fusion and HIV-mediated Cell-Cell Fusion*
Kondo, Naoyuki; Marin, Mariana; Kim, Jeong Hwa; Desai, Tanay M.; Melikyan, Gregory B.
2015-01-01
Whether HIV-1 enters cells by fusing with the plasma membrane or with endosomes is a subject of active debate. The ability of HIV-1 to mediate fusion between adjacent cells, a process referred to as “fusion-from-without” (FFWO), shows that this virus can fuse with the plasma membrane. To compare FFWO occurring at the cell surface with HIV-cell fusion through a conventional entry route, we designed an experimental approach that enabled the measurements of both processes in the same sample. The following key differences were observed. First, a very small fraction of viruses fusing with target cells participated in FFWO. Second, whereas HIV-1 fusion with adherent cells was insensitive to actin inhibitors, post-CD4/coreceptor binding steps during FFWO were abrogated. A partial dependence of HIV-cell fusion on actin remodeling was observed in CD4+ T cells, but this effect appeared to be due to the actin dependence of virus uptake. Third, deletion of the cytoplasmic tail of HIV-1 gp41 dramatically enhanced the ability of the virus to promote FFWO, while having a modest effect on virus-cell fusion. Distinct efficiencies and actin dependences of FFWO versus HIV-cell fusion are consistent with the notion that, except for a minor fraction of particles that mediate fusion between the plasma membranes of adjacent cells, HIV-1 enters through an endocytic pathway. We surmise, however, that cell-cell contacts enabling HIV-1 fusion with the plasma membrane could be favored at the sites of high density of target cells, such as lymph nodes. PMID:25589785
Fulde, Marcus; Willenborg, Joerg; de Greeff, Astrid; Benga, Laurentiu; Smith, Hilde E; Valentin-Weigand, Peter; Goethe, Ralph
2011-02-01
Streptococcus suis is one of the most important pathogens in pigs and can also cause severe infections in humans. Despite its clinical relevance, very little is known about the factors that contribute to its virulence. Recently, we identified a new putative virulence factor in S. suis, the arginine deiminase system (ADS), an arginine catabolic enzyme system encoded by the arcABC operon, which enables S. suis to survive in an acidic environment. In this study, we focused on ArgR, an ADS-associated regulator belonging to the ArgR/AhrC arginine repressor family. Using an argR knockout strain we were able to show that ArgR is essential for arcABC operon expression and necessary for the biological fitness of S. suis. By cDNA expression microarray analyses and quantitative real-time RT-PCR we found that the arcABC operon is the only gene cluster regulated by ArgR, which is in contrast to the situation in many other bacteria. Reporter gene analysis with gfp under the control of the arcABC promoter demonstrated that ArgR is able to activate the arcABC promoter. Electrophoretic mobility shift assays with fragments of the arcABC promoter and recombinant ArgR, and chromatin immunoprecipitation with antibodies directed against ArgR, revealed that ArgR interacts with the arcABC promoter in vitro and in vivo by binding to a region from -147 to -72 bp upstream of the transcriptional start point. Overall, our results show that in S. suis, ArgR is an essential, system-specific transcriptional regulator of the ADS that interacts directly with the arcABC promoter in vivo.
Technologies for Army Knowledge Fusion
2004-09-01
interpret it in context and understand the implications (Alberts et al., 2002). Note that the knowledge / information fusion issue arises immediately here...Army Knowledge Fusion Richard Scherl Department of Computer Science Monmouth University Dana L. Ulery Computational and Information Sciences...civilian and military sources. Knowledge fusion, also called information fusion and multisensor data fusion, names the body of techniques needed to
Influence of incomplete fusion on complete fusion at energies above the Coulomb barrier
NASA Astrophysics Data System (ADS)
Shuaib, Mohd; Sharma, Vijay R.; Yadav, Abhishek; Sharma, Manoj Kumar; Singh, Pushpendra P.; Singh, Devendra P.; Kumar, R.; Singh, R. P.; Muralithar, S.; Singh, B. P.; Prasad, R.
2017-10-01
In the present work, excitation functions of several reaction residues in the system 19F+169Tm, populated via the complete and incomplete fusion processes, have been measured using off-line γ-ray spectroscopy. The analysis of excitation functions has been done within the framework of statistical model code pace4. The excitation functions of residues populated via xn and pxn channels are found to be in good agreement with those estimated by the theoretical model code, which confirms the production of these residues solely via complete fusion process. However, a significant enhancement has been observed in the cross-sections of residues involving α-emitting channels as compared to the theoretical predictions. The observed enhancement in the cross-sections has been attributed to the incomplete fusion processes. In order to have a better insight into the onset and strength of incomplete fusion, the incomplete fusion strength function has been deduced. At present, there is no theoretical model available which can satisfactorily explain the incomplete fusion reaction data at energies ≈4-6 MeV/nucleon. In the present work, the influence of incomplete fusion on complete fusion in the 19F+169Tm system has also been studied. The measured cross-section data may be important for the development of reactor technology as well. It has been found that the incomplete fusion strength function strongly depends on the α-Q value of the projectile, which is found to be in good agreement with the existing literature data. The analysis strongly supports the projectile-dependent mass-asymmetry systematics. In order to study the influence of Coulomb effect ({Z}{{P}}{Z}{{T}}) on incomplete fusion, the deduced strength function for the present work is compared with the nearby projectile-target combinations. The incomplete fusion strength function is found to increase linearly with {Z}{{P}}{Z}{{T}}, indicating a strong influence of Coulomb effect in the incomplete fusion reactions.
Cluster-impact fusion, or beam-contaminant fusion? (abstract)a),b)
NASA Astrophysics Data System (ADS)
Lo, Daniel H.; Petrasso, Richard D.; Wenzel, Kevin W.
1992-10-01
Beuhler, Friedlander, and Friedman (BFF) reported anomalously huge D-D fusion rates while bombarding deuterated targets with (D2O)N+ clusters (N˜25-1000) accelerated to ≊325 keV [R. J. Beuhler et al., Phys. Rev. Lett. 63, 1292 (1989); R. J. Beuhler et al., J. Phys. Chem. 94, 7665 (1990)] [i.e., ≊0.3 keV lab energy for D in (D2O)100+]. However, from our analysis of BFF's fusion product spectra, we conclude that their D lab energy was ˜50 keV. Therefore, no gross anomalies exist. Also, from our analysis of the BFF beam-ranging experiments through 500 μg/cm2 of Au, we conclude that light-ion-beam contaminants (e.g., D+ of order 100 keV) have not been ruled out, and are the probable cause of their fusion reactions. This work was supported by LLNL Subcontract B116798, Department of Energy (DOE) Grant No. DE-FG02-91ER54109, DOE Magnetic Fusion Energy Technology Fellowship Program (D. H. Lo), and DOE Fusion Energy Postdoctoral Research Program (Kevin W. Wenzel).
Fusion Science Education Outreach
NASA Astrophysics Data System (ADS)
Danielson, C. A.; DIII-D Education Group
1996-11-01
This presentation will focus on education outreach activities at General Atomics that have been expanded to include the general population on science education with a focus on fusion energy. Outreach materials are distributed upon request both nationally and internationally. These materials include a notebook containing copies of DIII--D tour panels, fusion poster, new fusion energy video, new fusion energy brochure, and the electromagnetic spectrum curriculum. The 1996 Fusion Forum (held in the House Caucus Room) included a student/ teacher lunch with Energy Secretary Hazel O'Leary and a private visit to the Forum exhibits. The continuing partnership with Kearny High School includes lectures, job shadowing, internship, equipment donations and an award-winning electric car-racing program. Development of distribution by CD of the existing interactive fusion energy kiosk and a virtual reality tour of the DIII--D facility are underway. The DIII--D fusion education WWW site includes e-mail addresses to ``Ask the Wizard,'' and/or receive GA's outreach materials. Steve Rodecker, a local science teacher, aided by DIII--D fusion staff, won his second Tapestry Award; he also was named the ``1995 National Science Teacher of the Year'' and will be present to share his experiences with the DIII--D educational outreach program.
NASA Astrophysics Data System (ADS)
Ogawa, Yuichi
2016-05-01
A new strategic energy plan decided by the Japanese Cabinet in 2014 strongly supports the steady promotion of nuclear fusion development activities, including the ITER project and the Broader Approach activities from the long-term viewpoint. Atomic Energy Commission (AEC) in Japan formulated the Third Phase Basic Program so as to promote an experimental fusion reactor project. In 2005 AEC has reviewed this Program, and discussed on selection and concentration among many projects of fusion reactor development. In addition to the promotion of ITER project, advanced tokamak research by JT-60SA, helical plasma experiment by LHD, FIREX project in laser fusion research and fusion engineering by IFMIF were highly prioritized. Although the basic concept is quite different between tokamak, helical and laser fusion researches, there exist a lot of common features such as plasma physics on 3-D magnetic geometry, high power heat load on plasma facing component and so on. Therefore, a synergetic scenario on fusion reactor development among various plasma confinement concepts would be important.
Fusion Rate and Clinical Outcomes in Two-Level Posterior Lumbar Interbody Fusion.
Aono, Hiroyuki; Takenaka, Shota; Nagamoto, Yukitaka; Tobimatsu, Hidekazu; Yamashita, Tomoya; Furuya, Masayuki; Iwasaki, Motoki
2018-04-01
Posterior lumbar interbody fusion (PLIF) has become a general surgical method for degenerative lumbar diseases. Although many reports have focused on single-level PLIF, few have focused on 2-level PLIF, and no report has covered the fusion status of 2-level PLIF. The purpose of this study is to investigate clinical outcomes and fusion for 2-level PLIF by using a combination of dynamic radiographs and multiplanar-reconstruction computed tomography scans. This study consisted of 48 consecutive patients who underwent 2-level PLIF for degenerative lumbar diseases. We assessed surgery duration, estimated blood loss, complications, clinical outcomes as measured by the Japanese Orthopaedic Association score, lumbar sagittal alignment as measured on standing lateral radiographs, and fusion status as measured by dynamic radiographs and multiplanar-reconstruction computed tomography. Patients were examined at a follow-up point of 4.8 ± 2.2 years after surgery. Thirty-eight patients who did not undergo lumbosacral fusion comprised the lumbolumbar group, and 10 patients who underwent lumbosacral fusion comprised the lumbosacral group. The mean Japanese Orthopaedic Association score improved from 12.1 to 22.4 points by the final follow-up examination. Sagittal alignment also was improved. All patients had fusion in the cranial level. Seven patients had nonunion in the caudal level, and the lumbosacral group (40%) had a significantly poorer fusion rate than the lumbolumbar group (97%) did. Surgical outcomes of 2-level PLIF were satisfactory. The fusion rate at both levels was 85%. All nonunion was observed at the caudal level and concentrated at L5-S level in L4-5-S PLIF. Copyright © 2018 Elsevier Inc. All rights reserved.
Control of mechanically activated polymersome fusion: Factors affecting fusion
Henderson, Ian M.; Paxton, Walter F.
2014-12-15
Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the sizemore » of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.« less
Repression of choline kinase by inositol and choline in Saccharomyces cerevisiae.
Hosaka, K; Murakami, T; Kodaki, T; Nikawa, J; Yamashita, S
1990-01-01
The regulation of choline kinase (EC 2.7.1.32), the initial enzyme in the CDP-choline pathway, was examined in Saccharomyces cerevisiae. The addition of myo-inositol to a culture of wild-type cells resulted in a significant decrease in choline kinase activity. Additional supplementation of choline caused a further reduction in the activity. The coding frame of the choline kinase gene, CK1, was joined to the carboxyl terminus of lacZ and expressed in Escherichia coli as a fusion protein, which was then used to prepare an anti-choline kinase antibody. Upon Western (immuno-) and Northern (RNA) blot analyses using the antibody and a CK1 probe, respectively, the decrease in the enzyme activity was found to be correlated with decreases in the enzyme amount and mRNA abundance. The molecular mass of the enzyme was estimated to be 66 kilodaltons, in agreement with the value predicted previously from the nucleotide sequence of the gene. The coding region of CK1 was replaced with that of lacZ, and CK1 expression was measured by assaying beta-galactosidase. The expression of beta-galactosidase from this fusion was repressed by myo-inositol and choline and derepressed in a time-dependent manner upon their removal. The present findings indicate that yeast choline kinase is regulated by myo-inositol and choline at the level of mRNA abundance. Images FIG. 3 FIG. 4 PMID:2156807
NASA Technical Reports Server (NTRS)
Pavel, M.
1993-01-01
The topics covered include the following: a system overview of the basic components of a system designed to improve the ability of a pilot to fly through low-visibility conditions such as fog; the role of visual sciences; fusion issues; sensor characterization; sources of information; image processing; and image fusion.
NASA Astrophysics Data System (ADS)
Meade, Dale
2010-01-01
Fusion energy research began in the early 1950s as scientists worked to harness the awesome power of the atom for peaceful purposes. There was early optimism for a quick solution for fusion energy as there had been for fission. However, this was soon tempered by reality as the difficulty of producing and confining fusion fuel at temperatures of 100 million °C in the laboratory was appreciated. Fusion research has followed two main paths—inertial confinement fusion and magnetic confinement fusion. Over the past 50 years, there has been remarkable progress with both approaches, and now each has a solid technical foundation that has led to the construction of major facilities that are aimed at demonstrating fusion energy producing plasmas.
Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A
2015-09-01
Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Linares, Daniel M.; del Rio, Beatriz; Redruello, Begoña; Martin, M. Cruz; de Jong, Anne; Kuipers, Oscar P.; Fernandez, Maria
2015-01-01
Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. PMID:26116671
NASA Technical Reports Server (NTRS)
Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)
2001-01-01
There is little doubt that humans will attempt to explore and develop the solar system in this century. A large amount of energy will be required for accomplishing this. The need for fusion propulsion is discussed. For a propulsion system, there are three important thermodynamical attributes: (1) The absolute amount of energy available, (2) the propellant exhaust velocity, and (3) the jet power per unit mass of the propulsion system (specific power). For human exploration and development of the solar system, propellant exhaust velocity in excess of 100 km/s and specific power in excess of 10 kW/kg are required. Chemical combustion can produce exhaust velocity up to about 5 km/s. Nuclear fission processes typically result in producing energy in the form of heat that needs to be manipulated at temperatures limited by materials to about 2,800 K. Using the energy to heat a hydrogen propellant increases the exhaust velocity by only a factor of about two. Alternatively the energy can be converted into electricity which is then used to accelerate particles to high exhaust velocity. The necessary power conversion and conditioning equipment, however, increases the mass of the propulsion system for the same jet power by more than two orders of magnitude over chemical system, thus greatly limits the thrust-to-weight ratio attainable. The principal advantage of the fission process is that its development is relatively mature and is available right now. If fusion can be developed, fusion appears to have the best of all worlds in terms of propulsion - it can provide the absolute amount, the propellant exhaust velocity, and the high specific jet power. An intermediate step towards pure fusion propulsion is a bimodal system in which a fission reactor is used to provide some of the energy to drive a fusion propulsion unit. The technical issues related to fusion for space propulsion are discussed. The technical priorities for developing and applying fusion for propulsion are
C-terminal tyrosine residues modulate the fusion activity of the Hendra virus fusion protein
Popa, Andreea; Pager, Cara Teresia; Dutch, Rebecca Ellis
2011-01-01
The paramyxovirus family includes important human pathogens such as measles, mumps, respiratory syncytial virus and the recently emerged, highly pathogenic Hendra and Nipah viruses. The viral fusion (F) protein plays critical roles in infection, promoting both the viral-cell membrane fusion events needed for viral entry as well as cell-cell fusion events leading to syncytia formation. We describe the surprising finding that addition of the short epitope HA tag to the cytoplasmic tail (CT) of the Hendra virus F protein leads to a significant increase in cell-cell membrane fusion. This increase was not due to alterations in surface expression, cleavage state, or association with lipid microdomains. Addition of a Myc tag of similar length did not alter Hendra F fusion activity, indicating that the observed stimulation was not solely a result of lengthening the CT. Three tyrosine residues within the HA tag were critical for the increase in fusion, suggesting C-terminal tyrosines may modulate Hendra fusion activity. The effects of HA tag addition varied with other fusion proteins, as parainfluenza virus 5 F-HA showed decreased surface expression and no stimulation in fusion. These results indicate that additions to the C-terminal end of the F protein CT can modulate protein function in a sequence specific manner, reinforcing the need for careful analysis of epitope tagged glycoproteins. In addition, our results implicate C-terminal tyrosine residues in modulation of the membrane fusion reaction promoted by these viral glycoproteins. PMID:21175223
Opioids delay healing of spinal fusion: a rabbit posterolateral lumbar fusion model.
Jain, Nikhil; Himed, Khaled; Toth, Jeffrey M; Briley, Karen C; Phillips, Frank M; Khan, Safdar N
2018-04-19
Opioid use is prevalent for management of pre- and post-operative pain in patients undergoing spinal fusion. There is evidence that opioids downregulate osteoblasts in-vitro, and one previous study found that morphine delays the maturation and remodeling of callus in a rat femur fracture model. However, the effect of opioids on healing of spinal fusion has not been investigated before. Isolating the effect of opioid exposure in humans would be limited by the numerous confounding factors that affect fusion healing. Therefore, we have used a well-established rabbit model to study the process of spinal fusion healing that closely mimics humans. To study the effect of systemic opioids on the process of healing of spinal fusion in a rabbit posterolateral spinal fusion model. Pre-clinical animal study. 24 adult New Zealand white rabbits were studied in two groups after approval from the Institutional Animal Care and Use Committee (IACUC). The opioid group (n=12) received four-weeks pre-operative and six-weeks post-operative transdermal fentanyl. Serum fentanyl levels were measured just before surgery and four-weeks post-operatively to ensure adequate levels. The control group (n=12) received only peri-operative pain control as necessary. All animals received a bilateral L5-L6 posterolateral spinal fusion using iliac crest autograft. Animals were euthanized at the six-week post-operative time point, and assessment of fusion was done by manual palpation, plain radiographs, micro-computed tomography (microCT), and histology. 12 animals in control group and 11 animals in the opioid group were available for analysis at the end of six weeks. The fusion scores on manual palpation, radiographs, and microCT were not statistically different. Three-dimensional microCT morphometry found that the fusion mass in the opioid group had a lower bone volume (p=0.09), lower trabecular number (p=0.02) and higher trabecular separation (p=0.02) as compared to control. Histological analysis
Systematic analysis of advanced fusion fuel in inertial fusion energy
NASA Astrophysics Data System (ADS)
Velarde, G.; Eliezer, S.; Henis, Z.; Piera, M.; Martinez-Val, J. M.
1997-04-01
Aneutronic fusion reactions can be considered as the cleanest way to exploit nuclear energy. However, these reactions present in general two main drawbacks.—very high temperatures are needed to reach relevant values of their cross sections—Moderate (and even low) energy yield per reaction. This value is still lower if measured in relation to the Z number of the reacting particles. It is already known that bremsstrahlung overruns the plasma reheating by fusion born charged-particles in most of the advanced fuels. This is for instance the case for proton-boron-11 fusion in a stoichiometric plasma and is also so in lithium isotopes fusion reactions. In this paper, the use of deuterium-tritium seeding is suggested to allow to reach higher burnup fractions of advanced fuels, starting at a lower ignition temperature. Of course, neutron production increases as DT contents does. Nevertheless, the ratio of neutron production to energy generation is much lower in DT-advanced fuel mixtures than in pure DT plasmas. One of the main findings of this work is that some natural resources (as D and Li-7) can be burned-up in a catalytic regime for tritium. In this case, neither external tritium breeding nor tritium storage are needed, because the tritium inventory after the fusion burst is the same as before it. The fusion reactor can thus operate on a pure recycling of a small tritium inventory.
Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.
2014-01-01
The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924
Panigrahi, Priyabrata; Jere, Abhay; Anamika, Krishanpal
2018-01-01
Gene fusion is a chromosomal rearrangement event which plays a significant role in cancer due to the oncogenic potential of the chimeric protein generated through fusions. At present many databases are available in public domain which provides detailed information about known gene fusion events and their functional role. Existing gene fusion detection tools, based on analysis of transcriptomics data usually report a large number of fusion genes as potential candidates, which could be either known or novel or false positives. Manual annotation of these putative genes is indeed time-consuming. We have developed a web platform FusionHub, which acts as integrated search engine interfacing various fusion gene databases and simplifies large scale annotation of fusion genes in a seamless way. In addition, FusionHub provides three ways of visualizing fusion events: circular view, domain architecture view and network view. Design of potential siRNA molecules through ensemble method is another utility integrated in FusionHub that could aid in siRNA-based targeted therapy. FusionHub is freely available at https://fusionhub.persistent.co.in.
Gene Fusion Markup Language: a prototype for exchanging gene fusion data.
Kalyana-Sundaram, Shanker; Shanmugam, Achiraman; Chinnaiyan, Arul M
2012-10-16
An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses.
Gene Fusion Markup Language: a prototype for exchanging gene fusion data
2012-01-01
Background An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Results Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. Conclusion The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses. PMID:23072312
Line tension at lipid phase boundaries as driving force for HIV fusion peptide-mediated fusion
NASA Astrophysics Data System (ADS)
Yang, Sung-Tae; Kiessling, Volker; Tamm, Lukas K.
2016-04-01
Lipids and proteins are organized in cellular membranes in clusters, often called `lipid rafts'. Although raft-constituent ordered lipid domains are thought to be energetically unfavourable for membrane fusion, rafts have long been implicated in many biological fusion processes. For the case of HIV gp41-mediated membrane fusion, this apparent contradiction can be resolved by recognizing that the interfaces between ordered and disordered lipid domains are the predominant sites of fusion. Here we show that line tension at lipid domain boundaries contributes significant energy to drive gp41-fusion peptide-mediated fusion. This energy, which depends on the hydrophobic mismatch between ordered and disordered lipid domains, may contribute tens of kBT to fusion, that is, it is comparable to the energy required to form a lipid stalk intermediate. Line-active compounds such as vitamin E lower line tension in inhomogeneous membranes, thereby inhibit membrane fusion, and thus may be useful natural viral entry inhibitors.
Shh pathway in wounds in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice treated with MAA beads.
Lisovsky, Alexandra; Sefton, Michael V
2016-09-01
Previously, poly(methacrylic acid-co-methyl methacrylate) (MAA) beads were shown to improve vessel formation with a concomitant increase in the expression of the sonic hedgehog (Shh) gene, a pleiotropic factor implicated in vascularization. The aim of this study was to follow up on this observation in the absence of the confounding factors of diabetes in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice; in this mouse, expression of GFP and β-Gal is consistent with the transcription patterns of Shh and its receptor patched 1 (Ptch1), respectively. In agreement with studies in diabetic males, MAA beads improved vascularization in large (15 mm × 15 mm) wounds in non-diabetic males at day 7. Shh pathway activation was suggested, as the numbers of GFP+ (Shh) and β-Gal+ (Ptch1, a target of the pathway) cells increased in the granulation tissue. Shh signaling pathway modulation was also suggested in the healthy skin surrounding the wound bed, as evidenced by an increase in the number of GFP+ and β-Gal+ cells in males at day 4. Gene expression analysis of the wounds confirmed increase in Ptch1 and showed the upregulation of a downstream transcription factor Gli3, involved in the vascular effect of the Shh pathway, implicating the pathway in the effect of MAA beads. The efficacy of MAA beads was also investigated in females; MAA beads modulated the Shh pathway within granulation tissue similarly as in males, but had no enhancement effect on the healthy skin and on vascularization. We believe that understanding the molecular and cellular mechanisms of MAA-based biomaterials and testing the efficacy of therapeutics in both sexes will inform the development of novel therapeutic biomaterials. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gradient-based multiresolution image fusion.
Petrović, Valdimir S; Xydeas, Costas S
2004-02-01
A novel approach to multiresolution signal-level image fusion is presented for accurately transferring visual information from any number of input image signals, into a single fused image without loss of information or the introduction of distortion. The proposed system uses a "fuse-then-decompose" technique realized through a novel, fusion/decomposition system architecture. In particular, information fusion is performed on a multiresolution gradient map representation domain of image signal information. At each resolution, input images are represented as gradient maps and combined to produce new, fused gradient maps. Fused gradient map signals are processed, using gradient filters derived from high-pass quadrature mirror filters to yield a fused multiresolution pyramid representation. The fused output image is obtained by applying, on the fused pyramid, a reconstruction process that is analogous to that of conventional discrete wavelet transform. This new gradient fusion significantly reduces the amount of distortion artefacts and the loss of contrast information usually observed in fused images obtained from conventional multiresolution fusion schemes. This is because fusion in the gradient map domain significantly improves the reliability of the feature selection and information fusion processes. Fusion performance is evaluated through informal visual inspection and subjective psychometric preference tests, as well as objective fusion performance measurements. Results clearly demonstrate the superiority of this new approach when compared to conventional fusion systems.
A Cell-Cell Fusion Assay to Assess Arenavirus Envelope Glycoprotein Membrane-Fusion Activity.
York, Joanne; Nunberg, Jack H
2018-01-01
For many viruses that enter their target cells through pH-dependent fusion of the viral and endosomal membranes, cell-cell fusion assays can provide an experimental platform for investigating the structure-function relationships that promote envelope glycoprotein membrane-fusion activity. Typically, these assays employ effector cells expressing the recombinant envelope glycoprotein on the cell surface and target cells engineered to quantitatively report fusion with the effector cell. In the protocol described here, Vero cells are transfected with a plasmid encoding the arenavirus envelope glycoprotein complex GPC and infected with the vTF7-3 vaccinia virus expressing the bacteriophage T7 RNA polymerase. These effector cells are mixed with target cells infected with the vCB21R-lacZ vaccinia virus encoding a β-galactosidase reporter under the control of the T7 promoter. Cell-cell fusion is induced upon exposure to low-pH medium (pH 5.0), and the resultant expression of the β-galactosidase reporter is quantitated using a chemiluminescent substrate. We have utilized this robust microplate cell-cell fusion assay extensively to study arenavirus entry and its inhibition by small-molecule fusion inhibitors.
Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions.
Römling, Ute; Galperin, Michael Y
2015-09-01
Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits - which differ among various taxa - affect the enzymatic activity and product yield in vivo by modulating (i) the expression of the biosynthesis apparatus, (ii) the export of the nascent β-D-glucan polymer to the cell surface, and (iii) the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of resulting biofilms, which is particularly important for the interactions of bacteria with higher organisms - leading to rhizosphere colonization and modulating the virulence of cellulose-producing bacterial pathogens inside and outside of host cells. We review the organization of four principal types of cellulose synthase operon found in various bacterial genomes, identify additional bcs genes that encode components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms and in the choice between acute infection and persistence in the host. Copyright © 2015 Elsevier Ltd. All rights reserved.
Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions
Römling, Ute; Galperin, Michael Y.
2015-01-01
Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867
Holtkamp, Norbert
2018-01-09
ITER (in Latin âthe wayâ) is designed to demonstrate the scientific and technological feasibility of fusion energy. Fusion is the process by which two light atomic nuclei combine to form a heavier over one and thus release energy. In the fusion process two isotopes of hydrogen â deuterium and tritium â fuse together to form a helium atom and a neutron. Thus fusion could provide large scale energy production without greenhouse effects; essentially limitless fuel would be available all over the world. The principal goals of ITER are to generate 500 megawatts of fusion power for periods of 300 to 500 seconds with a fusion power multiplication factor, Q, of at least 10. Q ? 10 (input power 50 MW / output power 500 MW). The ITER Organization was officially established in Cadarache, France, on 24 October 2007. The seven members engaged in the project â China, the European Union, India, Japan, Korea, Russia and the United States â represent more than half the worldâs population. The costs for ITER are shared by the seven members. The cost for the construction will be approximately 5.5 billion Euros, a similar amount is foreseen for the twenty-year phase of operation and the subsequent decommissioning.
Paramyxovirus F1 protein has two fusion peptides: implications for the mechanism of membrane fusion.
Peisajovich, S G; Samuel, O; Shai, Y
2000-03-10
Viral fusion proteins contain a highly hydrophobic segment, named the fusion peptide, which is thought to be responsible for the merging of the cellular and viral membranes. Paramyxoviruses are believed to contain a single fusion peptide at the N terminus of the F1 protein. However, here we identified an additional internal segment in the Sendai virus F1 protein (amino acids 214-226) highly homologous to the fusion peptides of HIV-1 and RSV. A synthetic peptide, which includes this region, was found to induce membrane fusion of large unilamellar vesicles, at concentrations where the known N-terminal fusion peptide is not effective. A scrambled peptide as well as several peptides from other regions of the F1 protein, which strongly bind to membranes, are not fusogenic. The functional and structural characterization of this active segment suggest that the F1 protein has an additional internal fusion peptide that could participate in the actual fusion event. The presence of homologous regions in other members of the same family suggests that the concerted action of two fusion peptides, one N-terminal and the other internal, is a general feature of paramyxoviruses. Copyright 2000 Academic Press.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruther, Rose E.; Sun, Che -Nan; Holliday, Adam
A simple electrolyte consisting of NaPF 6 salt in 1,2-dimethoxyethane (DME) can extend the voltage window of electric double-layer capacitors (EDLCs) to >3.5 V. DME does not passivate carbon electrodes at very negative potentials (near Na/Na +), extending the practical voltage window by about 1.0 V compared to standard, non-aqueous electrolytes based on acetonitrile. The voltage window is demonstrated in two- and three-electrode cells using a combination of electrochemical impedance spectroscopy (EIS), charge-discharge cycling, and measurements of leakage current. DME-based electrolytes cannot match the high conductivity of acetonitrile solutions, but they can satisfy applications that demand high energy density atmore » moderate power. The conductivity of NaPF 6 in DME is comparable to commercial lithium-ion battery electrolytes and superior to most ionic liquids. Lastly, factors that limit the voltage window and EDLC energy density are discussed, and strategies to further boost energy density are proposed.« less
Stable electrolyte for high voltage electrochemical double-layer capacitors
Ruther, Rose E.; Sun, Che -Nan; Holliday, Adam; ...
2016-12-28
A simple electrolyte consisting of NaPF 6 salt in 1,2-dimethoxyethane (DME) can extend the voltage window of electric double-layer capacitors (EDLCs) to >3.5 V. DME does not passivate carbon electrodes at very negative potentials (near Na/Na +), extending the practical voltage window by about 1.0 V compared to standard, non-aqueous electrolytes based on acetonitrile. The voltage window is demonstrated in two- and three-electrode cells using a combination of electrochemical impedance spectroscopy (EIS), charge-discharge cycling, and measurements of leakage current. DME-based electrolytes cannot match the high conductivity of acetonitrile solutions, but they can satisfy applications that demand high energy density atmore » moderate power. The conductivity of NaPF 6 in DME is comparable to commercial lithium-ion battery electrolytes and superior to most ionic liquids. Lastly, factors that limit the voltage window and EDLC energy density are discussed, and strategies to further boost energy density are proposed.« less
Cell fusion and nuclear fusion in plants.
Maruyama, Daisuke; Ohtsu, Mina; Higashiyama, Tetsuya
2016-12-01
Eukaryotic cells are surrounded by a plasma membrane and have a large nucleus containing the genomic DNA, which is enclosed by a nuclear envelope consisting of the outer and inner nuclear membranes. Although these membranes maintain the identity of cells, they sometimes fuse to each other, such as to produce a zygote during sexual reproduction or to give rise to other characteristically polyploid tissues. Recent studies have demonstrated that the mechanisms of plasma membrane or nuclear membrane fusion in plants are shared to some extent with those of yeasts and animals, despite the unique features of plant cells including thick cell walls and intercellular connections. Here, we summarize the key factors in the fusion of these membranes during plant reproduction, and also focus on "non-gametic cell fusion," which was thought to be rare in plant tissue, in which each cell is separated by a cell wall. Copyright © 2016 Elsevier Ltd. All rights reserved.
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp
Investigations of image fusion
NASA Astrophysics Data System (ADS)
Zhang, Zhong
1999-12-01
The objective of image fusion is to combine information from multiple images of the same scene. The result of image fusion is a single image which is more suitable for the purpose of human visual perception or further image processing tasks. In this thesis, a region-based fusion algorithm using the wavelet transform is proposed. The identification of important features in each image, such as edges and regions of interest, are used to guide the fusion process. The idea of multiscale grouping is also introduced and a generic image fusion framework based on multiscale decomposition is studied. The framework includes all of the existing multiscale-decomposition- based fusion approaches we found in the literature which did not assume a statistical model for the source images. Comparisons indicate that our framework includes some new approaches which outperform the existing approaches for the cases we consider. Registration must precede our fusion algorithms. So we proposed a hybrid scheme which uses both feature-based and intensity-based methods. The idea of robust estimation of optical flow from time- varying images is employed with a coarse-to-fine multi- resolution approach and feature-based registration to overcome some of the limitations of the intensity-based schemes. Experiments show that this approach is robust and efficient. Assessing image fusion performance in a real application is a complicated issue. In this dissertation, a mixture probability density function model is used in conjunction with the Expectation- Maximization algorithm to model histograms of edge intensity. Some new techniques are proposed for estimating the quality of a noisy image of a natural scene. Such quality measures can be used to guide the fusion. Finally, we study fusion of images obtained from several copies of a new type of camera developed for video surveillance. Our techniques increase the capability and reliability of the surveillance system and provide an easy way to obtain 3-D
Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta
2014-03-01
Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.
Murphy, Samantha; Martin, Sally; Parton, Robert G.
2010-01-01
Lipid droplets (LDs) are dynamic cytoplasmic organelles containing neutral lipids and bounded by a phospholipid monolayer. Previous studies have suggested that LDs can undergo constitutive homotypic fusion, a process linked to the inhibitory effects of fatty acids on glucose transporter trafficking. Using strict quantitative criteria for LD fusion together with refined light microscopic methods and real-time analysis, we now show that LDs in diverse cell types show low constitutive fusogenic activity under normal growth conditions. To investigate the possible modulation of LD fusion, we screened for agents that can trigger fusion. A number of pharmacological agents caused homotypic fusion of lipid droplets in a variety of cell types. This provided a novel cell system to study rapid regulated fusion between homotypic phospholipid monolayers. LD fusion involved an initial step in which the two adjacent membranes became continuous (<10 s), followed by the slower merging (100 s) of the neutral lipid cores to produce a single spherical LD. These fusion events were accompanied by changes to the LD surface organization. Measurements of LDs undergoing homotypic fusion showed that fused LDs maintained their initial volume, with a corresponding decrease in surface area suggesting rapid removal of membrane from the fused LD. This study provides estimates for the level of constitutive LD fusion in cells and questions the role of LD fusion in vivo. In addition, it highlights the extent of LD restructuring which occurs when homotypic LD fusion is triggered in a variety of cell types. PMID:21203462
Enhanced image capture through fusion
NASA Technical Reports Server (NTRS)
Burt, Peter J.; Hanna, Keith; Kolczynski, Raymond J.
1993-01-01
Image fusion may be used to combine images from different sensors, such as IR and visible cameras, to obtain a single composite with extended information content. Fusion may also be used to combine multiple images from a given sensor to form a composite image in which information of interest is enhanced. We present a general method for performing image fusion and show that this method is effective for diverse fusion applications. We suggest that fusion may provide a powerful tool for enhanced image capture with broad utility in image processing and computer vision.
Positional effects of fusion partners on the yield and solubility of MBP fusion proteins
Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S.
2015-01-01
Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that 1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and 2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. PMID:25782741
Fusion or confusion: knowledge or nonsense?
NASA Astrophysics Data System (ADS)
Rothman, Peter L.; Denton, Richard V.
1991-08-01
The terms 'data fusion,' 'sensor fusion,' multi-sensor integration,' and 'multi-source integration' have been used widely in the technical literature to refer to a variety of techniques, technologies, systems, and applications which employ and/or combine data derived from multiple information sources. Applications of data fusion range from real-time fusion of sensor information for the navigation of mobile robots to the off-line fusion of both human and technical strategic intelligence data. The Department of Defense Critical Technologies Plan lists data fusion in the highest priority group of critical technologies, but just what is data fusion? The DoD Critical Technologies Plan states that data fusion involves 'the acquisition, integration, filtering, correlation, and synthesis of useful data from diverse sources for the purposes of situation/environment assessment, planning, detecting, verifying, diagnosing problems, aiding tactical and strategic decisions, and improving system performance and utility.' More simply states, sensor fusion refers to the combination of data from multiple sources to provide enhanced information quality and availability over that which is available from any individual source alone. This paper presents a survey of the state-of-the- art in data fusion technologies, system components, and applications. A set of characteristics which can be utilized to classify data fusion systems is presented. Additionally, a unifying mathematical and conceptual framework within which to understand and organize fusion technologies is described. A discussion of often overlooked issues in the development of sensor fusion systems is also presented.
Dicentric breakage at telomere fusions
Pobiega, Sabrina; Marcand, Stéphane
2010-01-01
Nonhomologous end-joining (NHEJ) inhibition at telomeres ensures that native chromosome ends do not fuse together. But the occurrence and consequences of rare telomere fusions are not well understood. It is notably unclear whether a telomere fusion could be processed to restore telomere ends. Here we address the behavior of individual dicentrics formed by telomere fusion in the yeast Saccharomyces cerevisiae. Our approach was to first stabilize and amplify fusions between two chromosomes by temporarily inactivating one centromere. Next we analyzed dicentric breakage following centromere reactivation. Unexpectedly, dicentrics often break at the telomere fusions during progression through mitosis, a process that restores the parental chromosomes. This unforeseen result suggests a rescue pathway able to process telomere fusions and to back up NHEJ inhibition at telomeres. PMID:20360388
Jans, Christoph; Follador, Rainer; Hochstrasser, Mira; Lacroix, Christophe; Meile, Leo; Stevens, Marc J A
2013-03-22
Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC.We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ.Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the
NASA Technical Reports Server (NTRS)
Griffin, Steven T.
2002-01-01
Magnetized target fusion (MTF) is under consideration as a means of building a low mass, high specific impulse, and high thrust propulsion system for interplanetary travel. This unique combination is the result of the generation of a high temperature plasma by the nuclear fusion process. This plasma can then be deflected by magnetic fields to provide thrust. Fusion is initiated by a small traction of the energy generated in the magnetic coils due to the plasma's compression of the magnetic field. The power gain from a fusion reaction is such that inefficiencies due to thermal neutrons and coil losses can be overcome. Since the fusion reaction products are directly used for propulsion and the power to initiate the reaction is directly obtained from the thrust generation, no massive power supply for energy conversion is required. The result should be a low engine mass, high specific impulse and high thrust system. The key is to successfully initiate fusion as a proof-of-principle for this application. Currently MSFC is implementing MTF proof-of-principle experiments. This involves many technical details and ancillary investigations. Of these, selected pertinent issues include the properties, orientation and timing of the plasma guns and the convergence and interface development of the "pusher" plasma. Computer simulations of the target plasma's behavior under compression and the convergence and mixing of the gun plasma are under investigation. This work is to focus on the gun characterization and development as it relates to plasma initiation and repeatability.
Xu, Kai; Chan, Yee-Peng; Bradel-Tretheway, Birgit; Akyol-Ataman, Zeynep; Zhu, Yongqun; Dutta, Somnath; Yan, Lianying; Feng, YanRu; Wang, Lin-Fa; Skiniotis, Georgios; Lee, Benhur; Zhou, Z Hong; Broder, Christopher C; Aguilar, Hector C; Nikolov, Dimitar B
2015-12-01
Nipah virus (NiV) is a paramyxovirus that infects host cells through the coordinated efforts of two envelope glycoproteins. The G glycoprotein attaches to cell receptors, triggering the fusion (F) glycoprotein to execute membrane fusion. Here we report the first crystal structure of the pre-fusion form of the NiV-F glycoprotein ectodomain. Interestingly this structure also revealed a hexamer-of-trimers encircling a central axis. Electron tomography of Nipah virus-like particles supported the hexameric pre-fusion model, and biochemical analyses supported the hexamer-of-trimers F assembly in solution. Importantly, structure-assisted site-directed mutagenesis of the interfaces between F trimers highlighted the functional relevance of the hexameric assembly. Shown here, in both cell-cell fusion and virus-cell fusion systems, our results suggested that this hexamer-of-trimers assembly was important during fusion pore formation. We propose that this assembly would stabilize the pre-fusion F conformation prior to cell attachment and facilitate the coordinated transition to a post-fusion conformation of all six F trimers upon triggering of a single trimer. Together, our data reveal a novel and functional pre-fusion architecture of a paramyxoviral fusion glycoprotein.
Fusion Power measurement at ITER
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bertalot, L.; Barnsley, R.; Krasilnikov, V.
2015-07-01
Nuclear fusion research aims to provide energy for the future in a sustainable way and the ITER project scope is to demonstrate the feasibility of nuclear fusion energy. ITER is a nuclear experimental reactor based on a large scale fusion plasma (tokamak type) device generating Deuterium - Tritium (DT) fusion reactions with emission of 14 MeV neutrons producing up to 700 MW fusion power. The measurement of fusion power, i.e. total neutron emissivity, will play an important role for achieving ITER goals, in particular the fusion gain factor Q related to the reactor performance. Particular attention is given also tomore » the development of the neutron calibration strategy whose main scope is to achieve the required accuracy of 10% for the measurement of fusion power. Neutron Flux Monitors located in diagnostic ports and inside the vacuum vessel will measure ITER total neutron emissivity, expected to range from 1014 n/s in Deuterium - Deuterium (DD) plasmas up to almost 10{sup 21} n/s in DT plasmas. The neutron detection systems as well all other ITER diagnostics have to withstand high nuclear radiation and electromagnetic fields as well ultrahigh vacuum and thermal loads. (authors)« less
A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang
2010-01-22
To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
A Bacillus subtilis Gene Induced by Cold Shock Encodes a Membrane Phospholipid Desaturase
Aguilar, Pablo S.; Cronan, John E.; de Mendoza, Diego
1998-01-01
Bacillus subtilis grown at 37°C synthesizes saturated fatty acids with only traces of unsaturated fatty acids (UFAs). However, when cultures growing at 37°C are transferred to 20°C, UFA synthesis is induced. We report the identification and characterization of the gene encoding the fatty acid desaturase of B. subtilis. This gene, called des, was isolated by complementation of Escherichia coli strains with mutations in either of two different genes of UFA synthesis. The des gene encodes a polypeptide of 352 amino acid residues containing the three conserved histidine cluster motifs and two putative membrane-spanning domains characteristic of the membrane-bound desaturases of plants and cyanobacteria. Expression of the des gene in E. coli resulted in desaturation of palmitic acid moieties of the membrane phospholipids to give the novel mono-UFA cis-5-hexadecenoic acid, indicating that the B. subtilis des gene product is a Δ5 acyl-lipid desaturase. The des gene was disrupted, and the resulting null mutant strains were unable to synthesize UFAs upon a shift to low growth temperatures. The des null mutant strain grew as well as its congenic parent at 20 or 37°C but showed severely reduced survival during stationary phase. Analysis of operon fusions in which the des promoter directed the synthesis of a lacZ reporter gene showed that des expression is repressed at 37°C, but a shift of cultures from 37 to 20°C resulted in a 10- to 15-fold increase in transcription. This is the first report of a membrane phospholipid desaturase in a nonphotosynthetic organism and the first direct evidence for cold induction of a desaturase. PMID:9555904
Structure of Salmonella FlhE, conserved member of a flagellar Type III secretion operon
Lee, Jaemin; Monzingo, Arthur F.; Keatinge-Clay, Adrian T.; ...
2014-12-26
In this paper, the bacterial flagellum is assembled by a multicomponent transport apparatus categorized as a type III secretion system. The secretion of proteins that assemble into the flagellum is driven by the proton motive force. The periplasmic protein FlhE is a member of the flhBAE operon in the majority of bacteria where FlhE is found. FlhA and FlhB are established components of the flagellar type III secretion system. The absence of FlhE results in a proton leak through the flagellar system, inappropriate secretion patterns, and cell death, indicating that FlhE regulates an important aspect of proper flagellar biosynthesis. Wemore » isolated FlhE from the periplasm of Salmonella and solved its structure to 1.5 Å resolution. The structure reveals a β-sandwich fold, with no close structural homologs. Finally, possible roles of FlhE, including that of a chaperone, are discussed.« less
Structure of Salmonella FlhE, conserved member of a flagellar Type III secretion operon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jaemin; Monzingo, Arthur F.; Keatinge-Clay, Adrian T.
In this paper, the bacterial flagellum is assembled by a multicomponent transport apparatus categorized as a type III secretion system. The secretion of proteins that assemble into the flagellum is driven by the proton motive force. The periplasmic protein FlhE is a member of the flhBAE operon in the majority of bacteria where FlhE is found. FlhA and FlhB are established components of the flagellar type III secretion system. The absence of FlhE results in a proton leak through the flagellar system, inappropriate secretion patterns, and cell death, indicating that FlhE regulates an important aspect of proper flagellar biosynthesis. Wemore » isolated FlhE from the periplasm of Salmonella and solved its structure to 1.5 Å resolution. The structure reveals a β-sandwich fold, with no close structural homologs. Finally, possible roles of FlhE, including that of a chaperone, are discussed.« less
Fusion of Enveloped Viruses in Endosomes
White, Judith M.; Whittaker, Gary R.
2016-01-01
Ari Helenius launched the field of enveloped virus fusion in endosomes with a seminal paper in the Journal of Cell Biology in 1980. In the intervening years a great deal has been learned about the structures and mechanisms of viral membrane fusion proteins as well as about the endosomes in which different enveloped viruses fuse and the endosomal cues that trigger fusion. We now recognize three classes of viral membrane fusion proteins based on structural criteria and four mechanisms of fusion triggering. After reviewing general features of viral membrane fusion proteins and viral fusion in endosomes, we delve into three characterized mechanisms for viral fusion triggering in endosomes: by low pH, by receptor binding plus low pH, and by receptor binding plus the action of a protease. We end with a discussion of viruses that may employ novel endosomal fusion triggering mechanisms. A key take home message is that enveloped viruses that enter cells by fusing in endosomes traverse the endocytic pathway until they reach an endosome that has all of the environmental conditions (pH, proteases, ions, intracellular receptors, and lipid composition) to (if needed) prime and (in all cases) trigger the fusion protein and to support membrane fusion. PMID:26935856
USDA-ARS?s Scientific Manuscript database
The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) odv-e56 gene encodes an occlusion-derived virus (ODV)-specific envelope protein, ODV-E56. To determine the role of ODV-E56 in oral infectivity, we produced recombinant EGFP-expressing AcMNPV clones (Ac69GFP-e56lacZ and AcIEGFP-e56lac...
Feasibility study on sensor data fusion for the CP-140 aircraft: fusion architecture analyses
NASA Astrophysics Data System (ADS)
Shahbazian, Elisa
1995-09-01
Loral Canada completed (May 1995) a Department of National Defense (DND) Chief of Research and Development (CRAD) contract, to study the feasibility of implementing a multi- sensor data fusion (MSDF) system onboard the CP-140 Aurora aircraft. This system is expected to fuse data from: (a) attributed measurement oriented sensors (ESM, IFF, etc.); (b) imaging sensors (FLIR, SAR, etc.); (c) tracking sensors (radar, acoustics, etc.); (d) data from remote platforms (data links); and (e) non-sensor data (intelligence reports, environmental data, visual sightings, encyclopedic data, etc.). Based on purely theoretical considerations a central-level fusion architecture will lead to a higher performance fusion system. However, there are a number of systems and fusion architecture issues involving fusion of such dissimilar data: (1) the currently existing sensors are not designed to provide the type of data required by a fusion system; (2) the different types (attribute, imaging, tracking, etc.) of data may require different degree of processing, before they can be used within a fusion system efficiently; (3) the data quality from different sensors, and more importantly from remote platforms via the data links must be taken into account before fusing; and (4) the non-sensor data may impose specific requirements on the fusion architecture (e.g. variable weight/priority for the data from different sensors). This paper presents the analyses performed for the selection of the fusion architecture for the enhanced sensor suite planned for the CP-140 aircraft in the context of the mission requirements and environmental conditions.
Karataev, G I; Sinyashina, L N; Medkova, A Yu; Semin, E G; Shevtsova, Z V; Matua, A Z; Kondzariya, I G; Amichba, A A; Kubrava, D T; Mikvabia, Z Ya
2016-04-01
Avirulent B. pertussis bacteria containing IS elements in the bvgAS operon were detected during the study of whooping cough patients and bacilli carriers. The present work is devoted to the study of the accumulation dynamics and the mechanisms of generation of persistent forms of the B. pertussis bacteria in lower monkeys as the most adequate model for extrapolation ofthe experiment results to humans. By means of the real-time PCR method, it was established that the B. pertussis bacteria lived more than three months in the upper respiratory tract after a single intranasal monkey infection; the period was reduced to 14-28 days during repeated infection. An increase in the portion of B. pertussis Bvg mutants in the population to tens of percent from the total number of registered bacteria was registered. The experimental confirmation ofthe development and accumulation of avirulent B. pertussis Bvg mutants during the development of the infectious process was obtained. Further study of the composition of the B. pertussis persistent bacteria population at different stages of the disease will make it possible to formulate new approaches to the whooping cough diagnostics and prevention and creation of fundamentally new drugs.
Gene position in a long operon governs motility development in Bacillus subtilis
Cozy, Loralyn M.; Kearns, Daniel B.
2010-01-01
Growing cultures of Bacillus subtilis bifurcate into subpopulations of motile individuals and non-motile chains of cells that are differentiated at the level of gene expression. The motile cells are ON and the chaining cells are OFF for transcription that depends on RNA polymerase and the alternative sigma factor σD. Here we show that chaining cells were OFF for σD-dependent gene expression because σD levels fell below a threshold, and σD activity was inhibited by the anti-sigma factor FlgM. The probability that σD exceeded the threshold was governed by the position of the sigD genes. The proportion of ON cells increased when sigD was artificially moved forward in the 27kb fla/che operon. In addition, we identified a new σD-dependent promoter that increases sigD expression and may provide positive feedback to stabilize the ON state. Finally, we demonstrate that ON/OFF motility states in B. subtilis are a form of development because mosaics of stable and differentiated epigenotypes were evident when the normally dispersed bacteria were forced to grow in one dimension. PMID:20233303
Positional effects of fusion partners on the yield and solubility of MBP fusion proteins.
Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S
2015-06-01
Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that (1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and (2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. Published by Elsevier Inc.
Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D
2011-04-01
An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.
Exo-endo cellulase fusion protein
Bower, Benjamin S [Palo Alto, CA; Larenas, Edmund A [Palo Alto, CA; Mitchinson, Colin [Palo Alto, CA
2012-01-17
The present invention relates to a heterologous exo-endo cellulase fusion construct, which encodes a fusion protein having cellulolytic activity comprising a catalytic domain derived from a fungal exo-cellobiohydrolase and a catalytic domain derived from an endoglucanase. The invention also relates to vectors and fungal host cells comprising the heterologous exo-endo cellulase fusion construct as well as methods for producing a cellulase fusion protein and enzymatic cellulase compositions.
Two Strategic Decisions Facing Fusion
NASA Astrophysics Data System (ADS)
Baldwin, D. E.
1998-06-01
Two strategic decisions facing the U.S. fusion program are described. The first decision deals with the role and rationale of the tokamak within the U. S. fusion program, and it underlies the debate over our continuing role in the evolving ITER collaboration (mid-1998). The second decision concerns how to include Inertial Fusion Energy (IFE) as a viable part of the national effort to harness fusion energy.
Frontier of Fusion Research: Path to the Steady State Fusion Reactor by Large Helical Device
NASA Astrophysics Data System (ADS)
Motojima, Osamu
2006-12-01
The ITER, the International Thermonuclear Experimental Reactor, which will be built in Cadarache in France, has finally started this year, 2006. Since the thermal energy produced by fusion reactions divided by the external heating power, i.e., the Q value, will be larger than 10, this is a big step of the fusion research for half a century trying to tame the nuclear fusion for the 6.5 Billion people on the Earth. The source of the Sun's power is lasting steadily and safely for 8 Billion years. As a potentially safe environmentally friendly and economically competitive energy source, fusion should provide a sustainable future energy supply for all mankind for ten thousands of years. At the frontier of fusion research important milestones are recently marked on a long road toward a true prototype fusion reactor. In its own merits, research into harnessing turbulent burning plasmas and thereby controlling fusion reaction, is one of the grand challenges of complex systems science. After a brief overview of a status of world fusion projects, a focus is given on fusion research at the National Institute for Fusion Science (NIFS) in Japan, which is playing a role of the Inter University Institute, the coordinating Center of Excellence for academic fusion research and by the Large Helical Device (LHD), the world's largest superconducting heliotron device, as a National Users' facility. The current status of LHD project is presented focusing on the experimental program and the recent achievements in basic parameters and in steady state operations. Since, its start in a year 1998, a remarkable progress has presently resulted in the temperature of 140 Million degree, the highest density of 500 Thousand Billion/cc with the internal density barrier (IDB) and the highest steady average beta of 4.5% in helical plasma devices and the largest total input energy of 1.6 GJ, in all magnetic confinement fusion devices. Finally, a perspective is given of the ITER Broad Approach program
The dengue virus type 2 envelope protein fusion peptide is essential for membrane fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Claire Y.-H., E-mail: CHuang1@cdc.go; Butrapet, Siritorn; Moss, Kelly J.
The flaviviral envelope (E) protein directs virus-mediated membrane fusion. To investigate membrane fusion as a requirement for virus growth, we introduced 27 unique mutations into the fusion peptide of an infectious cDNA clone of dengue 2 virus and recovered seven stable mutant viruses. The fusion efficiency of the mutants was impaired, demonstrating for the first time the requirement for specific FP AAs in optimal fusion. Mutant viruses exhibited different growth kinetics and/or genetic stabilities in different cell types and adult mosquitoes. Virus particles could be recovered following RNA transfection of cells with four lethal mutants; however, recovered viruses could notmore » re-infect cells. These viruses could enter cells, but internalized virus appeared to be retained in endosomal compartments of infected cells, thus suggesting a fusion blockade. Mutations of the FP also resulted in reduced virus reactivity with flavivirus group-reactive antibodies, confirming earlier reports using virus-like particles.« less
Nighttime images fusion based on Laplacian pyramid
NASA Astrophysics Data System (ADS)
Wu, Cong; Zhan, Jinhao; Jin, Jicheng
2018-02-01
This paper expounds method of the average weighted fusion, image pyramid fusion, the wavelet transform and apply these methods on the fusion of multiple exposures nighttime images. Through calculating information entropy and cross entropy of fusion images, we can evaluate the effect of different fusion. Experiments showed that Laplacian pyramid image fusion algorithm is suitable for processing nighttime images fusion, it can reduce the halo while preserving image details.
Fusion of disubstituted benzenes.
Martin, E; Yalkowsky, S H; Wells, J E
1979-05-01
The entropy of fusion of 84 disubstituted benzenes was essentially constant and independent of the participation of the compounds in intramolecular or intermolecular hydrogen bonding. It was also independent of the shapes, sizes, and dipole moments of the rigid molecules studied. While the entropy of fusion was independent of these parameters, the melting point and the heat of fusion showed a direct dependence on molecular properties.
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
Madan, S S; Boeree, N R
2003-12-01
Posterior lumbar interbody fusion (PLIF) restores disc height, the load bearing ability of anterior ligaments and muscles, root canal dimensions, and spinal balance. It immobilizes the painful degenerate spinal segment and decompresses the nerve roots. Anterior lumbar interbody fusion (ALIF) does the same, but could have complications of graft extrusion, compression and instability contributing to pseudarthrosis in the absence of instrumentation. The purpose of this study was to assess and compare the outcome of instrumented circumferential fusion through a posterior approach [PLIF and posterolateral fusion (PLF)] with instrumented ALIF using the Hartshill horseshoe cage, for comparable degrees of internal disc disruption and clinical disability. It was designed as a prospective study, comparing the outcome of two methods of instrumented interbody fusion for internal disc disruption. Between April 1994 and June 1998, the senior author (N.R.B.) performed 39 instrumented ALIF procedures and 35 instrumented circumferential fusion with PLIF procedures. The second author, an independent assessor (S.M.), performed the entire review. Preoperative radiographic assessment included plain radiographs, magnetic resonance imaging (MRI) and provocative discography in all the patients. The outcome in the two groups was compared in terms of radiological improvement and clinical improvement, measured on the basis of improvement of back pain and work capacity. Preoperatively, patients were asked to fill out a questionnaire giving their demographic details, maximum walking distance and current employment status in order to establish the comparability of the two groups. Patient assessment was with the Oswestry Disability Index, quality of life questionnaire (subjective), pain drawing, visual analogue scale, disability benefit, compensation status, and psychological profile. The results of the study showed a satisfactory outcome (score< or =30) on the subjective (quality of life
Pathria, Saurav; Rolando, Mandy; Lieman, Karen; Hayes, Shirley; Hardies, Stephen; Serwer, Philip
2012-01-01
We investigate genes of lytic, Bacillus thuringiensis bacteriophage 0305ϕ8-36 that are non-essential for laboratory propagation, but might have a function in the wild. We isolate deletion mutants to identify these genes. The non-permutation of the genome (218.948 Kb, with a 6.479 Kb terminal repeat and 247 identified orfs) simplifies isolation of deletion mutants. We find two islands of non-essential genes. The first island (3.01% of the genomic DNA) has an informatically identified DNA translocation operon. Deletion causes no detectable growth defect during propagation in a dilute agarose overlay. Identification of the DNA translocation operon begins with a DNA relaxase and continues with a translocase and membrane-binding anchor proteins. The relaxase is in a family, first identified here, with homologs in other bacteriophages. The second deleted island (3.71% of the genome) has genes for two metallo-protein chaperonins and two tRNAs. Deletion causes a significant growth defect. In addition, (1) we find by “in situ” (in-plaque) single-particle fluorescence microscopy that adsorption to the host occurs at the tip of the 486 nm long tail, (2) we develop a procedure of 0305ϕ8-36 purification that does not cause tail contraction, and (3) we then find by electron microscopy that 0305ϕ8-36 undergoes tail tip-tail tip dimerization that potentially blocks adsorption to host cells, presumably with effectiveness that increases as the bacteriophage particle concentration increases. These observations provide an explanation of the previous observation that 0305ϕ8-36 does not lyse liquid cultures, even though 0305ϕ8-36 is genomically lytic. PMID:22666654
Preparation of GST Fusion Proteins.
Einarson, Margret B; Pugacheva, Elena N; Orlinick, Jason R
2007-04-01
INTRODUCTIONThis protocol describes the preparation of glutathione-S-transferase (GST) fusion proteins, which have had a wide range of applications since their introduction as tools for synthesis of recombinant proteins in bacteria. GST was originally selected as a fusion moiety because of several desirable properties. First and foremost, when expressed in bacteria alone, or as a fusion, GST is not sequestered in inclusion bodies (in contrast to previous fusion protein systems). Second, GST can be affinity-purified without denaturation because it binds to immobilized glutathione, which provides the basis for simple purification. Consequently, GST fusion proteins are routinely used for antibody generation and purification, protein-protein interaction studies, and biochemical analysis.
Bistability of the lac operon during growth of Escherichia coli on lactose and lactose+glucose.
Narang, Atul; Pilyugin, Sergei S
2008-05-01
The lac operon of Escherichia coli can exhibit bistability. Early studies showed that bistability occurs during growth on TMG/succinate and lactose+glucose, but not during growth on lactose. More recently, studies with lacGFP-transfected cells show bistability during growth on TMG/succinate, but not during growth on lactose and lactose+glucose. In the literature, these results are invariably attributed to variations in the destabilizing effect of the positive feedback generated by induction. Specifically, during growth on TMG/succinate, lac induction generates strong positive feedback because the permease stimulates the accumulation of intracellular TMG, which in turn, promotes the synthesis of even more permease. This positive feedback is attenuated during growth on lactose because hydrolysis of intracellular lactose by beta-galactosidase suppresses the stimulatory effect of the permease. It is attenuated even more during growth on lactose + glucose because glucose inhibits the uptake of lactose. But it is clear that the stabilizing effect of dilution also changes dramatically as a function of the medium composition. For instance, during growth on TMG/succinate, the dilution rate of lac permease is proportional to its activity, e, because the specific growth rate is independent of e (it is completely determined by the concentration of succinate). However, during growth on lactose, the dilution rate of the permease is proportional to e2 because the specific growth rate is proportional to the specific lactose uptake rate, which in turn, proportional to e. We show that: (a) This dependence on e2 creates such a strong stabilizing effect that bistability is virtually impossible during growth on lactose, even in the face of the intense positive feedback generated by induction. (b) This stabilizing effect is weakened during growth on lactose+glucose because the specific growth rate on glucose is independent of e, so that the dilution rate once again contains a term that
Whiteside, T S; Hilal, S H; Brenner, A; Carreira, L A
2016-08-01
The entropy of fusion, enthalpy of fusion, and melting point of organic compounds can be estimated through three models developed using the SPARC (SPARC Performs Automated Reasoning in Chemistry) platform. The entropy of fusion is modelled through a combination of interaction terms and physical descriptors. The enthalpy of fusion is modelled as a function of the entropy of fusion, boiling point, and flexibility of the molecule. The melting point model is the enthalpy of fusion divided by the entropy of fusion. These models were developed in part to improve SPARC's vapour pressure and solubility models. These models have been tested on 904 unique compounds. The entropy model has a RMS of 12.5 J mol(-1) K(-1). The enthalpy model has a RMS of 4.87 kJ mol(-1). The melting point model has a RMS of 54.4°C.
Progress in gene targeting and gene therapy for retinitis pigmentosa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farrar, G.J.; Humphries, M.M.; Erven, A.
1994-09-01
Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Kinetic advantage of controlled intermediate nuclear fusion
NASA Astrophysics Data System (ADS)
Guo, Xiaoming
2012-09-01
The dominated process of controlled fusion is to let nuclei gain enough kinetic energy to overcome Coulomb barrier. As a result, a fusion scheme can consider two factors in its design: to increase kinetic energy of nuclei and to alter the Coulomb barrier. Cold Fusion and Hot fusion are all one-factor schemes while Intermediate Fusion is a twofactors scheme. This made CINF kinetically superior. Cold Fusion reduces deuteron-deuteron distance, addressing Coulomb barrier, and Hot Fusion heat up plasma into extreme high temperature, addressing kinetic energy. Without enough kinetic energy made Cold Fusion skeptical. Extreme high temperature made Hot Fusion very difficult to engineer. Because CIFN addresses both factors, CIFN is a more promising technique to be industrialized.
NASA Astrophysics Data System (ADS)
Emmerman, Philip J.
2005-05-01
Teams of robots or mixed teams of warfighters and robots on reconnaissance and other missions can benefit greatly from a local fusion station. A local fusion station is defined here as a small mobile processor with interfaces to enable the ingestion of multiple heterogeneous sensor data and information streams, including blue force tracking data. These data streams are fused and integrated with contextual information (terrain features, weather, maps, dynamic background features, etc.), and displayed or processed to provide real time situational awareness to the robot controller or to the robots themselves. These blue and red force fusion applications remove redundancies, lessen ambiguities, correlate, aggregate, and integrate sensor information with context such as high resolution terrain. Applications such as safety, team behavior, asset control, training, pattern analysis, etc. can be generated or enhanced by these fusion stations. This local fusion station should also enable the interaction between these local units and a global information world.
Kariyawasam, Subhashinie; Johnson, Timothy J.; Nolan, Lisa K.
2006-01-01
We have identified a 56-kb pathogenicity island (PAI) in avian pathogenic Escherichia coli strain O1:K1 (APEC-O1). This PAI, termed PAI IAPEC-O1, is integrated adjacent to the 3′ end of the pheV tRNA gene. It carries putative virulence genes of APEC (pap operon), other E. coli genes (tia and ireA), and a 1.5-kb region unique to APEC-O1. The kps gene cluster required for the biosynthesis of polysialic acid capsule was mapped to a location immediately downstream of this PAI. PMID:16369033
NASA Astrophysics Data System (ADS)
Medley, S. S.; Cecil, F. E.; Cole, D.; Conway, M. A.; Wilkinson, F. J., III
1985-05-01
Nuclear reactions of interest in fusion research often possess a branch yielding prompt emission of gamma radiation in excess of 15 MeV which can be exploited to provide a new fusion reaction diagnostic having applications similar to conventional neutron emission measurements. Conceptual aspects of fusion gamma diagnostics are discussed with emphasis on application to the Tokamak Fusion Test Reactor (TFTR) during deuterium neutral beam heating of D-T and D-3He plasmas. Recent measurements of the D (T, γ)5He, D(3He, γ)5Li, and D(D, γ)4He branching ratios at low center-of-mass energy (30-100 keV) and of the response of a large volume Ne226 detector for gamma detection in high neutron backgrounds are presented. Using a well-shielded Ne226 detector during 20 MW-120 kV deuterium beam heating of a tritium plasma in TFTR, the D(T, γ)5He gamma signal level is estimated to be 3.5×105 cps.
Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J
2015-03-01
Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. © 2015. Published by The Company of Biologists Ltd.
Inertial-confinement fusion with lasers
NASA Astrophysics Data System (ADS)
Betti, R.; Hurricane, O. A.
2016-05-01
The quest for controlled fusion energy has been ongoing for over a half century. The demonstration of ignition and energy gain from thermonuclear fuels in the laboratory has been a major goal of fusion research for decades. Thermonuclear ignition is widely considered a milestone in the development of fusion energy, as well as a major scientific achievement with important applications in national security and basic sciences. The US is arguably the world leader in the inertial confinement approach to fusion and has invested in large facilities to pursue it, with the objective of establishing the science related to the safety and reliability of the stockpile of nuclear weapons. Although significant progress has been made in recent years, major challenges still remain in the quest for thermonuclear ignition via laser fusion. Here, we review the current state of the art in inertial confinement fusion research and describe the underlying physical principles.
La Rosa, Giovanni; Conti, Alfredo; Cacciola, Fabio; Cardali, Salvatore; La Torre, Domenico; Gambadauro, Nicola Maria; Tomasello, Francesco
2003-09-01
Posterolateral fusion involving instrumentation-assisted segmental fixation represents a valid procedure in the treatment of lumbar instability. In cases of anterior column failure, such as in isthmic spondylolisthesis, supplemental posterior lumbar interbody fusion (PLIF) may improve the fusion rate and endurance of the construct. Posterior lumbar interbody fusion is, however, a more demanding procedure and increases costs and risks of the intervention. The advantages of this technique must, therefore, be weighed against those of a simple posterior lumbar fusion. Thirty-five consecutive patients underwent pedicle screw fixation for isthmic spondylolisthesis. In 18 patients posterior lumbar fusion was performed, and in 17 patients PLIF was added. Clinical, economic, functional, and radiographic data were assessed to determine differences in clinical and functional results and biomechanical properties. At 2-year follow-up examination, the correction of subluxation, disc height, and foraminal area were maintained in the group in which a PLIF procedure was performed, but not in the posterolateral fusion-only group (p < 0.05). Nevertheless, no statistical intergroup differences were demonstrated in terms of neurological improvement (p = 1), economic (p = 0.43), or functional (p = 0.95) outcome, nor in terms of fusion rate (p = 0.49). The authors' findings support the view that an interbody fusion confers superior mechanical strength to the spinal construct; when posterolateral fusion is the sole intervention, progressive loss of the extreme correction can be expected. Such mechanical insufficiency, however, did not influence clinical outcome.
Lee, Michael J; Dumonski, Mark; Phillips, Frank M; Voronov, Leonard I; Renner, Susan M; Carandang, Gerard; Havey, Robert M; Patwardhan, Avinash G
2011-11-01
A cadaveric biomechanical study. To investigate the biomechanical behavior of the cervical spine after cervical total disc replacement (TDR) adjacent to a fusion as compared to a two-level fusion. There are concerns regarding the biomechanical effects of cervical fusion on the mobile motion segments. Although previous biomechanical studies have demonstrated that cervical disc replacement normalizes adjacent segment motion, there is a little information regarding the function of a cervical disc replacement adjacent to an anterior cervical decompression and fusion, a potentially common clinical application. Nine cadaveric cervical spines (C3-T1, age: 60.2 ± 3.5 years) were tested under load- and displacement-control testing. After intact testing, a simulated fusion was performed at C4-C5, followed by C6-C7. The simulated fusion was then reversed, and the response of TDR at C5-C6 was measured. A hybrid construct was then tested with the TDR either below or above a single-level fusion and contrasted with a simulated two-level fusion (C4-C6 and C5-C7). The external fixator device used to simulate fusion significantly reduced range of motion (ROM) at C4-C5 and C6-C7 by 74.7 ± 8.1% and 78.1 ± 11.5%, respectively (P < 0.05). Removal of the fusion construct restored the motion response of the spinal segments to their intact state. Arthroplasty performed at C5-C6 using the porous-coated motion disc prosthesis maintained the total flexion-extension ROM to the level of the intact controls when used as a stand-alone procedure or when implanted adjacent to a single-level fusion (P > 0.05). The location of the single-level fusion, whether above or below the arthroplasty, did not significantly affect the motion response of the arthroplasty in the hybrid construct. Performing a two-level fusion significantly increased the motion demands on the nonoperated segments as compared to a hybrid TDR-plus fusion construct when the spine was required to reach the same motion end points
ERIC Educational Resources Information Center
Glasstone, Samuel
This publication is one of a series of information booklets for the general public published by The United States Atomic Energy Commission. Among the topics discussed are: Importance of Fusion Energy; Conditions for Nuclear Fusion; Thermonuclear Reactions in Plasmas; Plasma Confinement by Magnetic Fields; Experiments With Plasmas; High-Temperature…
Fusion Simulation Project Workshop Report
NASA Astrophysics Data System (ADS)
Kritz, Arnold; Keyes, David
2009-03-01
The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved 46 physicists, applied mathematicians and computer scientists, from 21 institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a 3-day workshop in May 2007.
Alternative approaches to fusion. [reactor design and reactor physics for Tokamak fusion reactors
NASA Technical Reports Server (NTRS)
Roth, R. J.
1976-01-01
The limitations of the Tokamak fusion reactor concept are discussed and various other fusion reactor concepts are considered that employ the containment of thermonuclear plasmas by magnetic fields (i.e., stellarators). Progress made in the containment of plasmas in toroidal devices is reported. Reactor design concepts are illustrated. The possibility of using fusion reactors as a power source in interplanetary space travel and electric power plants is briefly examined.
Nam, Woo Dong; Cho, Jae Hwan
2015-03-01
There are few studies about risk factors for poor outcomes from multi-level lumbar posterolateral fusion limited to three or four level lumbar posterolateral fusions. The purpose of this study was to analyze the outcomes of multi-level lumbar posterolateral fusion and to search for possible risk factors for poor surgical outcomes. We retrospectively analyzed 37 consecutive patients who underwent multi-level lumbar or lumbosacral posterolateral fusion with posterior instrumentation. The outcomes were deemed either 'good' or 'bad' based on clinical and radiological results. Many demographic and radiological factors were analyzed to examine potential risk factors for poor outcomes. Student t-test, Fisher exact test, and the chi-square test were used based on the nature of the variables. Multiple logistic regression analysis was used to exclude confounding factors. Twenty cases showed a good outcome (group A, 54.1%) and 17 cases showed a bad outcome (group B, 45.9%). The overall fusion rate was 70.3%. The revision procedures (group A: 1/20, 5.0%; group B: 4/17, 23.5%), proximal fusion to L2 (group A: 5/20, 25.0%; group B: 10/17, 58.8%), and severity of stenosis (group A: 12/19, 63.3%; group B: 3/11, 27.3%) were adopted as possible related factors to the outcome in univariate analysis. Multiple logistic regression analysis revealed that only the proximal fusion level (superior instrumented vertebra, SIV) was a significant risk factor. The cases in which SIV was L2 showed inferior outcomes than those in which SIV was L3. The odds ratio was 6.562 (95% confidence interval, 1.259 to 34.203). The overall outcome of multi-level lumbar or lumbosacral posterolateral fusion was not as high as we had hoped it would be. Whether the SIV was L2 or L3 was the only significant risk factor identified for poor outcomes in multi-level lumbar or lumbosacral posterolateral fusion in the current study. Thus, the authors recommend that proximal fusion levels be carefully determined when
Di Silvestre, Mario; Lolli, Francesco; Bakaloudis, Georgios
2014-01-01
Posterolateral fusion with pedicle screw instrumentation is currently the most widely accepted technique for degenerative lumbar scoliosis in elderly patients. However, a high incidence of complications has been reported in most series. Dynamic stabilization without fusion in patients older than 60 years has not previously been compared with the use of posterior fusion in degenerative lumbar scoliosis. To compare dynamic stabilization without fusion and posterior instrumented fusion in the treatment of degenerative lumbar scoliosis in elderly patients, in terms of perioperative findings, clinical outcomes, and adverse events. A retrospective study. Fifty-seven elderly patients were included. There were 45 women (78%) and 12 men (22%) with a mean age of 68.1 years (range, 61-78 years). All patients had degenerative de novo lumbar scoliosis, associated with vertebral canal stenosis in 51 cases (89.4%) and degenerative spondylolisthesis in 24 patients (42.1%). Clinical (Oswestry Disability Index, visual analog scale, Roland-Morris Disability Questionnaire) and radiological (scoliosis and lordosis corrections) outcomes as well as incidence of complications. Patients were divided into two groups: 32 patients (dynamic group) had dynamic stabilization without fusion and 25 patients (fusion group) underwent posterior instrumented fusion. All the patients' medical records and X-rays were reviewed. Preoperative, postoperative, and follow-up questionnaires were obtained to evaluate clinical outcomes. At an average follow-up of 64 months (range, 42-90 months), clinical results improved similarly in both groups of patients. Statistically superior scoliosis and final lordosis corrections were achieved with posterior fusion (56.9% vs. 37.3% and -46.8° vs. -35.8°, respectively). However, in the dynamic group, incidence of overall complications was lower (25% vs. 44%), and fewer patients required revision surgery (6.2% vs. 16%). Furthermore, lower average values of operative
Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices
NASA Astrophysics Data System (ADS)
Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The
2018-01-01
ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.
Morrison, T; McQuain, C; McGinnes, L
1991-01-01
The cDNA derived from the fusion gene of the virulent AV strain of Newcastle disease virus (NDV) was expressed in chicken embryo cells by using a retrovirus vector. The fusion protein expressed in this system was transported to the cell surface and was efficiently cleaved into the disulfide-linked F1-F2 form found in infectious virions. The cells expressing the fusion gene grew normally and could be passaged many times. Monolayers of these cells would plaque, in the absence of trypsin, avirulent NDV strains (strains which encode a fusion protein which is not cleaved in tissue culture). Fusion protein-expressing cells would not fuse if mixed with uninfected cells or uninfected cells expressing the hemagglutinin-neuraminidase (HN) protein. However, the fusion protein-expressing cells, if infected with avirulent strains of NDV, would fuse with uninfected cells, suggesting that fusion requires both the fusion protein and another viral protein expressed in the same cell. Fusion was also seen after transfection of the HN protein gene into fusion protein-expressing cells. Thus, the expressed fusion protein gene is capable of complementing the virus infection, providing an active cleaved fusion protein required for the spread of infection. However, the fusion protein does not mediate cell fusion unless the cell also expresses the HN protein. Fusion protein-expressing cells would not plaque influenza virus in the absence of trypsin, nor would influenza virus-infected fusion protein-expressing cells fuse with uninfected cells. Thus, the influenza virus HA protein will not substitute for the NDV HN protein in cell-to-cell fusion. Images PMID:1987376
Lappala, Anna; Nishima, Wataru; Miner, Jacob; Fenimore, Paul; Fischer, Will; Hraber, Peter; Zhang, Ming; McMahon, Benjamin; Tung, Chang-Shung
2018-05-10
Membrane fusion proteins are responsible for viral entry into host cells—a crucial first step in viral infection. These proteins undergo large conformational changes from pre-fusion to fusion-initiation structures, and, despite differences in viral genomes and disease etiology, many fusion proteins are arranged as trimers. Structural information for both pre-fusion and fusion-initiation states is critical for understanding virus neutralization by the host immune system. In the case of Ebola virus glycoprotein (EBOV GP) and Zika virus envelope protein (ZIKV E), pre-fusion state structures have been identified experimentally, but only partial structures of fusion-initiation states have been described. While the fusion-initiation structure is in an energetically unfavorable state that is difficult to solve experimentally, the existing structural information combined with computational approaches enabled the modeling of fusion-initiation state structures of both proteins. These structural models provide an improved understanding of four different neutralizing antibodies in the prevention of viral host entry.
Miyamoto, Takeshi
2013-07-01
Macrophages play a pivotal role in host defense against multiple foreign materials such as bacteria, parasites and artificial devices. Some macrophage lineage cells, namely osteoclasts and foreign body giant cells (FBGCs), form multi-nuclear giant cells by the cell-cell fusion of mono-nuclear cells. Osteoclasts are bone-resorbing cells, and are formed in the presence of RANKL on the surface of bones, while FBGCs are formed in the presence of IL-4 or IL-13 on foreign materials such as artificial joints, catheters and parasites. Recently, fusiogenic mechanisms and the molecules required for the cell-cell fusion of these macrophage lineage cells were, at least in part, clarified. Dendritic cell specific transmembrane protein (DC-STAMP) and osteoclast stimulatory transmembrane protein (OC-STAMP), both of which comprise seven transmembrane domains, are required for both osteoclast and FBGC cell-cell fusion. STAT6 was demonstrated to be required for the cell-cell fusion of FBGCs but not osteoclasts. In this review, advances in macrophage cell-cell fusion are discussed.
Liu, Yanjie; Misamore, Michael J; Snell, William J
2010-05-01
The plasma membranes of gametes are specialized for fusion, yet, once fusion occurs, in many organisms the new zygote becomes incapable of further membrane fusion reactions. The molecular mechanisms that underlie this loss of fusion capacity (block to polygamy) remain unknown. During fertilization in the green alga Chlamydomonas, the plus gamete-specific membrane protein FUS1 is required for adhesion between the apically localized sites on the plasma membranes of plus and minus gametes that are specialized for fusion, and the minus-specific membrane protein HAP2 is essential for completion of the membrane fusion reaction. HAP2 (GCS1) family members are also required for fertilization in Arabidopsis, and for the membrane fusion reaction in the malaria organism Plasmodium berghei. Here, we tested whether Chlamydomonas gamete fusion triggers alterations in FUS1 and HAP2 and renders the plasma membranes of the cells incapable of subsequent fusion. We find that, even though the fusogenic sites support multi-cell adhesions, triploid zygotes are rare, indicating a fusion-triggered block to the membrane fusion reaction. Consistent with the extinction of fusogenic capacity, both FUS1 and HAP2 are degraded upon fusion. The rapid, fusion-triggered cleavage of HAP2 in zygotes is distinct from degradation occurring during constitutive turnover in gametes. Thus, gamete fusion triggers specific degradation of fusion-essential proteins and renders the zygote incapable of fusion. Our results provide the first molecular explanation for a membrane block to polygamy in any organism.
Magnetized Target Fusion: Prospects for Low-Cost Fusion Energy
NASA Technical Reports Server (NTRS)
Siemon, Richard E.; Turchi, Peter J.; Barnes, Daniel C.; Degnan, James; Parks, Paul; Ryutov, Dmitri D.; Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)
2001-01-01
Magnetized Target Fusion (MTF) has attracted renewed interest in recent years because it has the potential to resolve one of the major problems with conventional fusion energy research - the high cost of facilities to do experiments and in general develop practical fusion energy. The requirement for costly facilities can be traced to fundamental constraints. The Lawson condition implies large system size in the case of conventional magnetic confinement, or large heating power in the case of conventional inertial confinement. The MTF approach is to use much higher fuel density than with conventional magnetic confinement (corresponding to megabar pressures), which results in a much-reduced system size to achieve Lawson conditions. Intrinsically the system must be pulsed because the pressures exceed the strength of any known material. To facilitate heating the fuel (or "target") to thermonuclear conditions with a high-power high-intensity source of energy, magnetic fields are used to insulate the high-pressure fuel from material surroundings (thus "magnetized target"). Because of magnetic insulation, the required heating power intensity is reduced by many orders of magnitude compared to conventional inertial fusion, even with relatively poor energy confinement in the magnetic field, such as that characterized by Bohm diffusion. In this paper we show semi-quantitatively why MTF-should allow fusion energy production without costly facilities within the same generally accepted physical constraints used for conventional magnetic and inertial fusion. We also briefly discuss potential applications of this technology ranging from nuclear rockets for space propulsion to a practical commercial energy system. Finally, we report on the exploratory research underway, and the interesting physics issues that arise in the MTF regime of parameters. Experiments at Los Alamos are focused on formation of a suitable plasma target for compression, utilizing the knowledge base for compact
Haudenschild, Dominik R.; Wegner, Adam M.; Klineberg, Eric O.
2017-01-01
Study Design: Review of literature. Objectives: This review of literature investigates the application of mesenchymal stem cells (MSCs) in spinal fusion, highlights potential uses in the development of bone grafts, and discusses limitations based on both preclinical and clinical models. Methods: A review of literature was conducted looking at current studies using stem cells for augmentation of spinal fusion in both animal and human models. Results: Eleven preclinical studies were found that used various animal models. Average fusion rates across studies were 59.8% for autograft and 73.7% for stem cell–based grafts. Outcomes included manual palpation and stressing of the fusion, radiography, micro–computed tomography (μCT), and histological analysis. Fifteen clinical studies, 7 prospective and 8 retrospective, were found. Fusion rates ranged from 60% to 100%, averaging 87.1% in experimental groups and 87.2% in autograft control groups. Conclusions: It appears that there is minimal clinical difference between commercially available stem cells and bone marrow aspirates indicating that MSCs may be a good choice in a patient with poor marrow quality. Overcoming morbidity and limitations of autograft for spinal fusion, remains a significant problem for spinal surgeons and further studies are needed to determine the efficacy of stem cells in augmenting spinal fusion. PMID:29238646
Endler, Peter; Ekman, Per; Möller, Hans; Gerdhem, Paul
2017-05-03
Various methods for the treatment of isthmic spondylolisthesis are available. The aim of this study was to compare outcomes after posterolateral fusion without instrumentation, posterolateral fusion with instrumentation, and interbody fusion. The Swedish Spine Register was used to identify 765 patients who had been operated on for isthmic spondylolisthesis and had at least preoperative and 2-year outcome data; 586 of them had longer follow-up (a mean of 6.9 years). The outcome measures were a global assessment of leg and back pain, the Oswestry Disability Index (ODI), the EuroQol-5 Dimensions (EQ-5D) Questionnaire, the Short Form-36 (SF-36), a visual analog scale (VAS) for back and leg pain, and satisfaction with treatment. Data on additional lumbar spine surgery was searched for in the register, with the mean duration of follow-up for this variable being 10.6 years after the index procedure. Statistical analyses were performed with analysis of covariance or competing-risks proportional hazards regression, adjusted for baseline differences in the studied variables, smoking, employment status, and level of fusion. Posterolateral fusion without instrumentation was performed in 102 patients; posterolateral fusion with instrumentation, in 452; and interbody fusion, in 211. At 1 year, improvement was reported in the global assessment for back pain by 54% of the patients who had posterolateral fusion without instrumentation, 68% of those treated with posterolateral fusion with instrumentation, and 70% of those treated with interbody fusion (p = 0.009). The VAS for back pain and reported satisfaction with treatment showed similar patterns (p = 0.003 and p = 0.017, respectively), whereas other outcomes did not differ among the treatment groups at 1 year. At 2 years, the global assessment for back pain indicated improvement in 57% of the patients who had undergone posterolateral fusion without instrumentation, 70% of those who had posterolateral fusion with instrumentation
Induction of cell-cell fusion by ectromelia virus is not inhibited by its fusion inhibitory complex.
Erez, Noam; Paran, Nir; Maik-Rachline, Galia; Politi, Boaz; Israely, Tomer; Schnider, Paula; Fuchs, Pinhas; Melamed, Sharon; Lustig, Shlomo
2009-09-29
Ectromelia virus, a member of the Orthopox genus, is the causative agent of the highly infectious mousepox disease. Previous studies have shown that different poxviruses induce cell-cell fusion which is manifested by the formation of multinucleated-giant cells (polykaryocytes). This phenomenon has been widely studied with vaccinia virus in conditions which require artificial acidification of the medium. We show that Ectromelia virus induces cell-cell fusion under neutral pH conditions and requires the presence of a sufficient amount of viral particles on the plasma membrane of infected cells. This could be achieved by infection with a replicating virus and its propagation in infected cells (fusion "from within") or by infection with a high amount of virus particles per cell (fusion "from without"). Inhibition of virus maturation or inhibition of virus transport on microtubules towards the plasma membrane resulted in a complete inhibition of syncytia formation. We show that in contrast to vaccinia virus, Ectromelia virus induces cell-cell fusion irrespectively of its hemagglutination properties and cell-surface expression of the orthologs of the fusion inhibitory complex, A56 and K2. Additionally, cell-cell fusion was also detected in mice lungs following lethal respiratory infection. Ectromelia virus induces spontaneous cell-cell fusion in-vitro and in-vivo although expressing an A56/K2 fusion inhibitory complex. This syncytia formation property cannot be attributed to the 37 amino acid deletion in ECTV A56.
The continuum fusion theory of signal detection applied to a bi-modal fusion problem
NASA Astrophysics Data System (ADS)
Schaum, A.
2011-05-01
A new formalism has been developed that produces detection algorithms for model-based problems, in which one or more parameter values is unknown. Continuum Fusion can be used to generate different flavors of algorithm for any composite hypothesis testing problem. The methodology is defined by a fusion logic that can be translated into max/min conditions. Here it is applied to a simple sensor fusion model, but one for which the generalized likelihood ratio test is intractable. By contrast, a fusion-based response to the same problem can be devised that is solvable in closed form and represents a good approximation to the GLR test.
Line-Tension Controlled Mechanism for Influenza Fusion
Risselada, Herre Jelger; Smirnova, Yuliya G.; Grubmüller, Helmut; Marrink, Siewert Jan; Müller, Marcus
2012-01-01
Our molecular simulations reveal that wild-type influenza fusion peptides are able to stabilize a highly fusogenic pre-fusion structure, i.e. a peptide bundle formed by four or more trans-membrane arranged fusion peptides. We rationalize that the lipid rim around such bundle has a non-vanishing rim energy (line-tension), which is essential to (i) stabilize the initial contact point between the fusing bilayers, i.e. the stalk, and (ii) drive its subsequent evolution. Such line-tension controlled fusion event does not proceed along the hypothesized standard stalk-hemifusion pathway. In modeled influenza fusion, single point mutations in the influenza fusion peptide either completely inhibit fusion (mutants G1V and W14A) or, intriguingly, specifically arrest fusion at a hemifusion state (mutant G1S). Our simulations demonstrate that, within a line-tension controlled fusion mechanism, these known point mutations either completely inhibit fusion by impairing the peptide’s ability to stabilize the required peptide bundle (G1V and W14A) or stabilize a persistent bundle that leads to a kinetically trapped hemifusion state (G1S). In addition, our results further suggest that the recently discovered leaky fusion mutant G13A, which is known to facilitate a pronounced leakage of the target membrane prior to lipid mixing, reduces the membrane integrity by forming a ‘super’ bundle. Our simulations offer a new interpretation for a number of experimentally observed features of the fusion reaction mediated by the prototypical fusion protein, influenza hemagglutinin, and might bring new insights into mechanisms of other viral fusion reactions. PMID:22761674
Nam, Woo Dong
2015-01-01
Background There are few studies about risk factors for poor outcomes from multi-level lumbar posterolateral fusion limited to three or four level lumbar posterolateral fusions. The purpose of this study was to analyze the outcomes of multi-level lumbar posterolateral fusion and to search for possible risk factors for poor surgical outcomes. Methods We retrospectively analyzed 37 consecutive patients who underwent multi-level lumbar or lumbosacral posterolateral fusion with posterior instrumentation. The outcomes were deemed either 'good' or 'bad' based on clinical and radiological results. Many demographic and radiological factors were analyzed to examine potential risk factors for poor outcomes. Student t-test, Fisher exact test, and the chi-square test were used based on the nature of the variables. Multiple logistic regression analysis was used to exclude confounding factors. Results Twenty cases showed a good outcome (group A, 54.1%) and 17 cases showed a bad outcome (group B, 45.9%). The overall fusion rate was 70.3%. The revision procedures (group A: 1/20, 5.0%; group B: 4/17, 23.5%), proximal fusion to L2 (group A: 5/20, 25.0%; group B: 10/17, 58.8%), and severity of stenosis (group A: 12/19, 63.3%; group B: 3/11, 27.3%) were adopted as possible related factors to the outcome in univariate analysis. Multiple logistic regression analysis revealed that only the proximal fusion level (superior instrumented vertebra, SIV) was a significant risk factor. The cases in which SIV was L2 showed inferior outcomes than those in which SIV was L3. The odds ratio was 6.562 (95% confidence interval, 1.259 to 34.203). Conclusions The overall outcome of multi-level lumbar or lumbosacral posterolateral fusion was not as high as we had hoped it would be. Whether the SIV was L2 or L3 was the only significant risk factor identified for poor outcomes in multi-level lumbar or lumbosacral posterolateral fusion in the current study. Thus, the authors recommend that proximal fusion
The entropies of fusion, enthalies of fusion, and melting points of organic compounds can be estimated through three models developed using the SPARC (SPARC Performs Automated Reasoning in Chemistry) platform. The entropy of fusion is modeled through a combination of interaction ...
Telomeres and mechanisms of Robertsonian fusion.
Slijepcevic, P
1998-05-01
The Robertsonian (Rb) fusion, a chromosome rearrangement involving centric fusion of two acro-(telo)centric chromosomes to form a single metacentric, is one of the most frequent events in mammalian karyotype evolution. Since one of the functions of telomeres is to preserve chromosome integrity, a prerequisite for the formation of Rb fusions should be either telomere loss or telomere inactivation. Possible mechanisms underlying the formation of various types of Rb fusion are discussed here. For example, Rb fusion in wild mice involves complete loss of p-arm telomeres by chromosome breakage within minor satellite sequences. By contrast, interstitial telomeric sites are found in the pericentromeric regions of chromosomes originating from a number of vertebrate species, suggesting the occurrence of Rb-like fusion without loss of telomeres, a possibility consistent with some form of telomere inactivation. Finally, a recent study suggests that telomere shortening induced by the deletion of the telomerase RNA gene in the mouse germ-line leads to telomere loss and high frequencies of Rb fusion in mouse somatic cells. Thus, at least three mechanisms in mammalian cells lead to the formation of Rb fusions.
Cell fusion in the liver, revisited
Lizier, Michela; Castelli, Alessandra; Montagna, Cristina; Lucchini, Franco; Vezzoni, Paolo; Faggioli, Francesca
2018-01-01
There is wide agreement that cell fusion is a physiological process in cells in mammalian bone, muscle and placenta. In other organs, such as the cerebellum, cell fusion is controversial. The liver contains a considerable number of polyploid cells: They are commonly believed to originate by genome endoreplication, although the contribution of cell fusion to polyploidization has not been excluded. Here, we address the topic of cell fusion in the liver from a historical point of view. We discuss experimental evidence clearly supporting the hypothesis that cell fusion occurs in the liver, specifically when bone marrow cells were injected into mice and shown to rescue genetic hepatic degenerative defects. Those experiments-carried out in the latter half of the last century-were initially interpreted to show “transdifferentiation”, but are now believed to demonstrate fusion between donor macrophages and host hepatocytes, raising the possibility that physiologically polyploid cells, such as hepatocytes, could originate, at least partially, through homotypic cell fusion. In support of the homotypic cell fusion hypothesis, we present new data generated using a chimera-based model, a much simpler model than those previously used. Cell fusion as a road to polyploidization in the liver has not been extensively investigated, and its contribution to a variety of conditions, such as viral infections, carcinogenesis and aging, remains unclear. PMID:29527257
Bhanjadeo, Madhabi M.; Rath, Kalyani; Gupta, Dhirendra; Pradhan, Nilotpala; Biswal, Surendra K.; Mishra, Barada K.
2018-01-01
Since the sulfur specific cleavage is vital for the organic sulfur removal from fossil fuel, we explored potential bacterial strains of MTCC (Microbial Type Culture Collection) to desulfurize the Dibenzothiophene (DBT) through C-S bond cleavage (4-S pathway). MTCC strains Rhodococcus rhodochrous (3552), Arthrobacter sulfureus (3332), Gordonia rubropertincta (289), and Rhodococcus erythropolis (3951) capable of growing in 0.5 mM DBT were examined for their desulfurization ability. The presence of dsz genes as well as the metabolites was screened by polymerase chain reaction (PCR) and HPLC, respectively. All these strains showed > 99% DBT desulfurization with 10 days of incubation in minimal salt medium. From the HPLC analysis it was further revealed that these MTCC strains show differences in the end metabolites and desulfurize DBT differently following a variation in the regular 4-S pathway. These findings are also well corroborating with their respective organization of dszABC operons and their relative abundance. The above MTCC strains are capable of desulfurizing DBT efficiently and hence can be explored for biodesulfurization of petrochemicals and coal with an eco-friendly and energy economical process. PMID:29518089
Introduction to Nuclear Fusion Power and the Design of Fusion Reactors. An Issue-Oriented Module.
ERIC Educational Resources Information Center
Fillo, J. A.
This three-part module focuses on the principles of nuclear fusion and on the likely nature and components of a controlled-fusion power reactor. The physical conditions for a net energy release from fusion and two approaches (magnetic and inertial confinement) which are being developed to achieve this goal are described. Safety issues associated…
Kim, Dae Hwan; Lee, Nam; Shin, Dong Ah; Yi, Seong; Kim, Keung Nyun; Ha, Yoon
2016-07-01
To compare the fusion rate of a hydroxyapatite demineralized bone matrix (DBM) with post-laminectomy acquired autograft in lumbar interbody fusion surgery and to evaluate the correlation between fusion rate and clinical outcome. From January 2013 to April 2014, 98 patients underwent lumbar interbody fusion surgery with hydroxyapatite DBM (HA-DBM group) in our institute. Of those patients, 65 received complete CT scans for 12 months postoperatively in order to evaluate fusion status. For comparison with autograft, we selected another 65 patients who underwent lumbar interbody fusion surgery with post-laminectomy acquired autograft (Autograft group) during the same period. Both fusion material groups were matched in terms of age, sex, body mass index (BMI), and bone mineral density (BMD). To evaluate the clinical outcomes, we analyzed the results of visual analogue scale (VAS), Oswestry Disability Index (ODI), and Short Form Health Survey (SF-36). We reviewed the CT scans of 149 fusion levels in 130 patients (HA-DBM group, 75 levels/65 patients; Autograft group, 74 levels/65 patients). Age, sex, BMI, and BMD were not significantly different between the groups (p=0.528, p=0.848, p=0.527, and p=0.610, respectively). The HA-DBM group showed 39 of 75 fused levels (52%), and the Autograft group showed 46 of 74 fused levels (62.2%). This difference was not statistically significant (p=0.21). In the HA-DBM group, older age and low BMD were significantly associated with non-fusion (61.24 vs. 66.68, p=0.027; -1.63 vs. -2.29, p=0.015, respectively). VAS and ODI showed significant improvement after surgery when fusion was successfully achieved in both groups (p=0.004, p=0.002, HA-DBM group; p=0.012, p=0.03, Autograft group). The fusion rates of the hydroxyapatite DBM and Autograft groups were not significantly different. In addition, clinical outcomes were similar between the groups. However, older age and low BMD are risk factors that might induce non-union after surgery with
Kim, Dae Hwan; Lee, Nam; Shin, Dong Ah; Yi, Seong; Kim, Keung Nyun
2016-01-01
Objective To compare the fusion rate of a hydroxyapatite demineralized bone matrix (DBM) with post-laminectomy acquired autograft in lumbar interbody fusion surgery and to evaluate the correlation between fusion rate and clinical outcome. Methods From January 2013 to April 2014, 98 patients underwent lumbar interbody fusion surgery with hydroxyapatite DBM (HA-DBM group) in our institute. Of those patients, 65 received complete CT scans for 12 months postoperatively in order to evaluate fusion status. For comparison with autograft, we selected another 65 patients who underwent lumbar interbody fusion surgery with post-laminectomy acquired autograft (Autograft group) during the same period. Both fusion material groups were matched in terms of age, sex, body mass index (BMI), and bone mineral density (BMD). To evaluate the clinical outcomes, we analyzed the results of visual analogue scale (VAS), Oswestry Disability Index (ODI), and Short Form Health Survey (SF-36). Results We reviewed the CT scans of 149 fusion levels in 130 patients (HA-DBM group, 75 levels/65 patients; Autograft group, 74 levels/65 patients). Age, sex, BMI, and BMD were not significantly different between the groups (p=0.528, p=0.848, p=0.527, and p=0.610, respectively). The HA-DBM group showed 39 of 75 fused levels (52%), and the Autograft group showed 46 of 74 fused levels (62.2%). This difference was not statistically significant (p=0.21). In the HA-DBM group, older age and low BMD were significantly associated with non-fusion (61.24 vs. 66.68, p=0.027; -1.63 vs. -2.29, p=0.015, respectively). VAS and ODI showed significant improvement after surgery when fusion was successfully achieved in both groups (p=0.004, p=0.002, HA-DBM group; p=0.012, p=0.03, Autograft group). Conclusion The fusion rates of the hydroxyapatite DBM and Autograft groups were not significantly different. In addition, clinical outcomes were similar between the groups. However, older age and low BMD are risk factors that might
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soldan, Samantha S., E-mail: sssoldan@mail.med.upenn.ed; Hollidge, Bradley S.; Department of Neuroscience Graduate Group, University of Pennsylvania School of Medicine, Philadelphia, PA 19104-4283
La Crosse virus is a leading cause of pediatric encephalitis in the Midwestern United States and an emerging pathogen in the American South. The LACV glycoprotein Gc plays a critical role in entry as the virus attachment protein. A 22 amino acid hydrophobic region within Gc (1066-1087) was recently identified as the LACV fusion peptide. To further define the role of Gc (1066-1087) in virus entry, fusion, and neuropathogenesis, a panel of recombinant LACV (rLACV) fusion peptide mutant viruses was generated. Replication of mutant rLACVs was significantly reduced. In addition, the fusion peptide mutants demonstrated decreased fusion phenotypes relative tomore » LACV-WT. Interestingly, these viruses maintained their ability to cause neuronal loss in culture, suggesting that the fusion peptide of LACV Gc is a determinant of properties associated with neuroinvasion (growth to high titer in muscle cells and a robust fusion phenotype), but not necessarily of neurovirulence.« less
Inertial-confinement fusion with lasers
Betti, R.; Hurricane, O. A.
2016-05-03
The quest for controlled fusion energy has been ongoing for over a half century. The demonstration of ignition and energy gain from thermonuclear fuels in the laboratory has been a major goal of fusion research for decades. Thermonuclear ignition is widely considered a milestone in the development of fusion energy, as well as a major scientific achievement with important applications to national security and basic sciences. The U.S. is arguably the world leader in the inertial con fment approach to fusion and has invested in large facilities to pursue it with the objective of establishing the science related to themore » safety and reliability of the stockpile of nuclear weapons. Even though significant progress has been made in recent years, major challenges still remain in the quest for thermonuclear ignition via laser fusion.« less
Adjoint affine fusion and tadpoles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Urichuk, Andrew, E-mail: andrew.urichuk@uleth.ca; Walton, Mark A., E-mail: walton@uleth.ca; International School for Advanced Studies
2016-06-15
We study affine fusion with the adjoint representation. For simple Lie algebras, elementary and universal formulas determine the decomposition of a tensor product of an integrable highest-weight representation with the adjoint representation. Using the (refined) affine depth rule, we prove that equally striking results apply to adjoint affine fusion. For diagonal fusion, a coefficient equals the number of nonzero Dynkin labels of the relevant affine highest weight, minus 1. A nice lattice-polytope interpretation follows and allows the straightforward calculation of the genus-1 1-point adjoint Verlinde dimension, the adjoint affine fusion tadpole. Explicit formulas, (piecewise) polynomial in the level, are writtenmore » for the adjoint tadpoles of all classical Lie algebras. We show that off-diagonal adjoint affine fusion is obtained from the corresponding tensor product by simply dropping non-dominant representations.« less
Glycoprotein interactions in paramyxovirus fusion
Iorio, Ronald M; Melanson, Vanessa R; Mahon, Paul J
2009-01-01
The Paramyxoviridae are enveloped, negative-stranded RNA viruses, some of which recognize sialic acid-containing receptors, while others recognize specific proteinaceous receptors. The major cytopathic effect of paramyxovirus infection is membrane fusion-induced syncytium formation. Paramyxoviruses are unusual in that the receptor-binding and fusion-promoting activities reside on two different spike structures, the attachment and fusion glycoproteins, respectively. For most paramyxoviruses, this distribution of functions requires a mechanism by which the two processes can be linked for the promotion of fusion. This is accomplished by a virus-specific interaction between the two proteins. An increasing body of evidence supports the notion that members of this family of viruses utilize this glycoprotein interaction in different ways in order to mediate the regulation of the fusion protein activation, depending on the type of receptor utilized by the virus. PMID:20161127
Multiscale Medical Image Fusion in Wavelet Domain
Khare, Ashish
2013-01-01
Wavelet transforms have emerged as a powerful tool in image fusion. However, the study and analysis of medical image fusion is still a challenging area of research. Therefore, in this paper, we propose a multiscale fusion of multimodal medical images in wavelet domain. Fusion of medical images has been performed at multiple scales varying from minimum to maximum level using maximum selection rule which provides more flexibility and choice to select the relevant fused images. The experimental analysis of the proposed method has been performed with several sets of medical images. Fusion results have been evaluated subjectively and objectively with existing state-of-the-art fusion methods which include several pyramid- and wavelet-transform-based fusion methods and principal component analysis (PCA) fusion method. The comparative analysis of the fusion results has been performed with edge strength (Q), mutual information (MI), entropy (E), standard deviation (SD), blind structural similarity index metric (BSSIM), spatial frequency (SF), and average gradient (AG) metrics. The combined subjective and objective evaluations of the proposed fusion method at multiple scales showed the effectiveness and goodness of the proposed approach. PMID:24453868
Hamilton, Brian S.; Whittaker, Gary R.; Daniel, Susan
2012-01-01
Hemagglutinin (HA) is the viral protein that facilitates the entry of influenza viruses into host cells. This protein controls two critical aspects of entry: virus binding and membrane fusion. In order for HA to carry out these functions, it must first undergo a priming step, proteolytic cleavage, which renders it fusion competent. Membrane fusion commences from inside the endosome after a drop in lumenal pH and an ensuing conformational change in HA that leads to the hemifusion of the outer membrane leaflets of the virus and endosome, the formation of a stalk between them, followed by pore formation. Thus, the fusion machinery is an excellent target for antiviral compounds, especially those that target the conserved stem region of the protein. However, traditional ensemble fusion assays provide a somewhat limited ability to directly quantify fusion partly due to the inherent averaging of individual fusion events resulting from experimental constraints. Inspired by the gains achieved by single molecule experiments and analysis of stochastic events, recently-developed individual virion imaging techniques and analysis of single fusion events has provided critical information about individual virion behavior, discriminated intermediate fusion steps within a single virion, and allowed the study of the overall population dynamics without the loss of discrete, individual information. In this article, we first start by reviewing the determinants of HA fusogenic activity and the viral entry process, highlight some open questions, and then describe the experimental approaches for assaying fusion that will be useful in developing the most effective therapies in the future. PMID:22852045
A Review of Data Fusion Techniques
2013-01-01
The integration of data and knowledge from several sources is known as data fusion. This paper summarizes the state of the data fusion field and describes the most relevant studies. We first enumerate and explain different classification schemes for data fusion. Then, the most common algorithms are reviewed. These methods and algorithms are presented using three different categories: (i) data association, (ii) state estimation, and (iii) decision fusion. PMID:24288502
A review of data fusion techniques.
Castanedo, Federico
2013-01-01
The integration of data and knowledge from several sources is known as data fusion. This paper summarizes the state of the data fusion field and describes the most relevant studies. We first enumerate and explain different classification schemes for data fusion. Then, the most common algorithms are reviewed. These methods and algorithms are presented using three different categories: (i) data association, (ii) state estimation, and (iii) decision fusion.
Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya
2015-01-01
Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.
Varmanen, P; Rantanen, T; Palva, A
1996-12-01
A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.
Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J
2015-06-19
The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and
Fusion barrier characteristics of actinides
NASA Astrophysics Data System (ADS)
Manjunatha, H. C.; Sridhar, K. N.
2018-03-01
We have studied fusion barrier characteristics of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations. After the calculation of fusion barrier heights and positions, we have searched for their parameterization. We have achieved the empirical formula for fusion barrier heights (VB), positions (RB), curvature of the inverted parabola (ħω) of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations (6
HEDP and new directions for fusion energy
NASA Astrophysics Data System (ADS)
Kirkpatrick, Ronald C.
2010-06-01
Magnetic-confinement fusion energy and inertia-confinement fusion energy (IFE) represent two extreme approaches to the quest for the application of thermonuclear fusion to electrical energy generation. Blind pursuit of these extreme approaches has long delayed the achievement of their common goal. We point out the possibility of an intermediate approach that promises cheaper, and consequently more rapid development of fusion energy. For example, magneto-inertial fusion appears to be possible over a broad range of parameter space. It is further argued that imposition of artificial constraints impedes the discovery of physics solutions for the fusion energy problem.
INTRODUCTION: Status report on fusion research
NASA Astrophysics Data System (ADS)
Burkart, Werner
2005-10-01
A major milestone on the path to fusion energy was reached in June 2005 on the occasion of the signing of the joint declaration of all parties to the ITER negotiations, agreeing on future arrangements and on the construction site at Cadarache in France. The International Atomic Energy Agency has been promoting fusion activities since the late 1950s; it took over the auspices of the ITER Conceptual Design Activities in 1988, and of the ITER Engineering and Design Activities in 1992. The Agency continues its support to Member States through the organization of consultancies, workshops and technical meetings, the most prominent being the series of International Fusion Energy Conferences (formerly called the International Conference on Plasma Physics and Controlled Nuclear Fusion Research). The meetings serve as a platform for experts from all Member States to have open discussions on their latest accomplishments as well as on their problems and eventual solutions. The papers presented at the meetings and conferences are routinely published, many being sent to the journal it Nuclear Fusion, co-published monthly by Institute of Physics Publishing, Bristol, UK. The journal's reputation is reflected in the fact that it is a world-renowned publication, and the International Fusion Research Council has used it for the publication of a Status Report on Controlled Thermonuclear Fusion in 1978 and 1990. This present report marks the conclusion of the preparatory phases of ITER activities. It provides background information on the progress of fusion research within the last 15 years. The International Fusion Research Council (IFRC), which initiated the report, was fully aware of the complexities of including all scientific results in just one paper, and so decided to provide an overview and extensive references for the interested reader who need not necessarily be a fusion specialist. Professor Predhiman K. Kaw, Chairman, prepared the report on behalf of the IFRC, reflecting
76 FR 49757 - Fusion Energy Sciences Advisory Committee
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-11
... DEPARTMENT OF ENERGY Fusion Energy Sciences Advisory Committee AGENCY: Office of Science... Services Administration, notice is hereby given that the Fusion Energy Sciences Advisory Committee will be... science, fusion science, and fusion technology related to the Fusion Energy Sciences program. Additionally...
NASA Technical Reports Server (NTRS)
Thio, Y. C. Francis; Schmidt, George R.; Santarius, John F.; Turchi, Peter J.; Siemon, Richard E.; Rodgers, Stephen L. (Technical Monitor)
2002-01-01
The need for fusion propulsion for interplanetary flights is discussed. For a propulsion system, there are three important system attributes: (1) The absolute amount of energy available, (2) the propellant exhaust velocity, and (3) the jet power per unit mass of the propulsion system (specific power). For efficient and affordable human exploration of the solar system, propellant exhaust velocity in excess of 100 km/s and specific power in excess of 10 kW/kg are required. Chemical combustion obviously cannot meet the requirement in propellant exhaust velocity. Nuclear fission processes typically result in producing energy in the form of heat that needs to be manipulated at temperatures limited by materials to about 2,800 K. Using the fission energy to heat a low atomic weight propellant produces propellant velocity of the order of 10 kinds. Alternatively the fission energy can be converted into electricity that is used to accelerate particles to high exhaust velocity. However, the necessary power conversion and conditioning equipment greatly increases the mass of the propulsion system. Fundamental considerations in waste heat rejection and power conditioning in a fission electric propulsion system place a limit on its jet specific power to the order of about 0.2 kW/kg. If fusion can be developed for propulsion, it appears to have the best of all worlds - it can provide the largest absolute amount of energy, the propellant exhaust velocity (> 100 km/s), and the high specific jet power (> 10 kW/kg). An intermediate step towards fusion propulsion might be a bimodal system in which a fission reactor is used to provide some of the energy to drive a fusion propulsion unit. There are similarities as well as differences between applying fusion to propulsion and to terrestrial electrical power generation. The similarities are the underlying plasma and fusion physics, the enabling component technologies, the computational and the diagnostics capabilities. These physics and
Parajón, Avelino; Alimi, Marjan; Navarro-Ramirez, Rodrigo; Christos, Paul; Torres-Campa, Jose M; Moriguchi, Yu; Lang, Gernot; Härtl, Roger
2017-12-01
Minimally invasive transforaminal lumbar interbody fusion (MIS-TLIF) is an increasingly popular procedure with several potential advantages over traditional open TLIF. The current study aimed to compare fusion rates of different graft materials used in MIS-TLIF, via meta-analysis of the published literature. A Medline search was performed and a database was created including patient's type of graft, clinical outcome, fusion rate, fusion assessment modality, and duration of follow-up. Meta-analysis of the fusion rate was performed using StatsDirect software (StatsDirect Ltd, Cheshire, United Kingdom). A total of 1533 patients from 40 series were included. Fusion rates were high, ranging from 91.8% to 99%. The imaging modalities used to assess fusion were computed tomography scans (30%) and X-rays (70%). Comparison of all recombinant human bone morphogenetic protein (rhBMP) series with all non-rhBMP series showed fusion rates of 96.6% and 92.5%, respectively. The lowest fusion rate was seen with isolated use of autologous local bone (91.8%). The highest fusion rate was observed with combination of autologous local bone with bone extender and rhBMP (99.1%). The highest fusion rate without the use of BMP was seen with autologous local bone + bone extender (93.1%). The reported complication rate ranged from 0% to 35.71%. Clinical improvement was observed in all studies. Fusion rates are generally high with MIS-TLIF regardless of the graft material used. Given the potential complications of iliac bone harvesting and rhBMP, use of other bone graft options for MIS-TLIF is reasonable. The highest fusion rate without the use of rhBMP was seen with autologous local bone plus bone extender (93.1%). Published by Oxford University Press on behalf of Congress of Neurological Surgeons 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.
PI(4,5)P2 regulates myoblast fusion through Arp2/3 regulator localization at the fusion site
Bothe, Ingo; Deng, Su; Baylies, Mary
2014-01-01
Cell-cell fusion is a regulated process that requires merging of the opposing membranes and underlying cytoskeletons. However, the integration between membrane and cytoskeleton signaling during fusion is not known. Using Drosophila, we demonstrate that the membrane phosphoinositide PI(4,5)P2 is a crucial regulator of F-actin dynamics during myoblast fusion. PI(4,5)P2 is locally enriched and colocalizes spatially and temporally with the F-actin focus that defines the fusion site. PI(4,5)P2 enrichment depends on receptor engagement but is upstream or parallel to actin remodeling. Regulators of actin branching via Arp2/3 colocalize with PI(4,5)P2 in vivo and bind PI(4,5)P2 in vitro. Manipulation of PI(4,5)P2 availability leads to impaired fusion, with a reduction in the F-actin focus size and altered focus morphology. Mechanistically, the changes in the actin focus are due to a failure in the enrichment of actin regulators at the fusion site. Moreover, improper localization of these regulators hinders expansion of the fusion interface. Thus, PI(4,5)P2 enrichment at the fusion site encodes spatial and temporal information that regulates fusion progression through the localization of activators of actin polymerization. PMID:24821989
Magnetized Target Fusion At General Fusion: An Overview
NASA Astrophysics Data System (ADS)
Laberge, Michel; O'Shea, Peter; Donaldson, Mike; Delage, Michael; Fusion Team, General
2017-10-01
Magnetized Target Fusion (MTF) involves compressing an initial magnetically confined plasma on a timescale faster than the thermal confinement time of the plasma. If near adiabatic compression is achieved, volumetric compression of 350X or more of a 500 eV target plasma would achieve a final plasma temperature exceeding 10 keV. Interesting fusion gains could be achieved provided the compressed plasma has sufficient density and dwell time. General Fusion (GF) is developing a compression system using pneumatic pistons to collapse a cavity formed in liquid metal containing a magnetized plasma target. Low cost driver, straightforward heat extraction, good tritium breeding ratio and excellent neutron protection could lead to a practical power plant. GF (65 employees) has an active plasma R&D program including both full scale and reduced scale plasma experiments and simulation of both. Although pneumatic driven compression of full scale plasmas is the end goal, present compression studies use reduced scale plasmas and chemically accelerated aluminum liners. We will review results from our plasma target development, motivate and review the results of dynamic compression field tests and briefly describe the work to date on the pneumatic driver front.
Fusion technologies for Laser Inertial Fusion Energy (LIFE)
NASA Astrophysics Data System (ADS)
Kramer, K. J.; Latkowski, J. F.; Abbott, R. P.; Anklam, T. P.; Dunne, A. M.; El-Dasher, B. S.; Flowers, D. L.; Fluss, M. J.; Lafuente, A.; Loosmore, G. A.; Morris, K. R.; Moses, E.; Reyes, S.
2013-11-01
The Laser Inertial Fusion-based Energy (LIFE) engine design builds upon on going progress at the National Ignition Facility (NIF) and offers a near-term pathway to commercial fusion. Fusion technologies that are critical to success are reflected in the design of the first wall, blanket and tritium separation subsystems. The present work describes the LIFE engine-related components and technologies. LIFE utilizes a thermally robust indirect-drive target and a chamber fill gas. Coolant selection and a large chamber solid-angle coverage provide ample tritium breeding margin and high blanket gain. Target material selection eliminates the need for aggressive chamber clearing, while enabling recycling. Demonstrated tritium separation and storage technologies limit the site tritium inventory to attractive levels. These key technologies, along with the maintenance and advanced materials qualification program have been integrated into the LIFE delivery plan. This describes the development of components and subsystems, through prototyping and integration into a First Of A Kind power plant. This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Z-Pinch Fusion for Energy Applications
DOE Office of Scientific and Technical Information (OSTI.GOV)
SPIELMAN,RICK B.
2000-01-01
Z pinches, the oldest fusion concept, have recently been revisited in light of significant advances in the fields of plasma physics and pulsed power engineering. The possibility exists for z-pinch fusion to play a role in commercial energy applications. We report on work to develop z-pinch fusion concepts, the result of an extensive literature search, and the output for a congressionally-mandated workshop on fusion energy held in Snowmass, Co July 11-23,1999.
Bydon, Mohamad; Macki, Mohamed; Abt, Nicholas B; Witham, Timothy F; Wolinsky, Jean-Paul; Gokaslan, Ziya L; Bydon, Ali; Sciubba, Daniel M
2015-03-01
Reimbursements for interbody fusions have declined recently because of their questionable cost-effectiveness. A Markov model was adopted to compare the cost-effectiveness of posterior lumbar interbody fusion (PLIF) or transforaminal lumbar interbody fusion (/TLIF) versus noninterbody fusion and posterolateral fusion (PLF) in patients with lumbar spondylolisthesis. Decision model analysis based on retrospective data from a single institutional series. One hundred thirty-seven patients underwent first-time instrumented lumbar fusions for degenerative or isthmic spondylolisthesis. Quality of life adjustments and expenditures were assigned to each short-term complication (durotomy, surgical site infection, and medical complication) and long-term outcome (bowel/bladder dysfunction and paraplegia, neurologic deficit, and chronic back pain). Patients were divided into a PLF cohort and a PLF plus PLIF/TLIF cohort. Anterior techniques and multilevel interbody fusions were excluded. Each short-term complication and long-term outcome was assigned a numerical quality-adjusted life-year (QALY), based on time trade-off values in the Beaver Dam Health Outcomes Study. The cost data for short-term complications were calculated from charges accrued by the institution's finance sector, and the cost data for long-term outcomes were estimated from the literature. The difference in cost of PLF plus PLIF/TLIF from the cost of PLF alone divided by the difference in QALY equals the cost-effectiveness ratio (CER). We do not report any study funding sources or any study-specific appraisal of potential conflict of interest-associated biases in this article. Of 137 first-time lumbar fusions for spondylolisthesis, 83 patients underwent PLF and 54 underwent PLIF/TLIF. The average time to reoperation was 3.5 years. The mean QALY over 3.5 years was 2.81 in the PLF cohort versus 2.66 in the PLIFo/TLIF cohort (p=.110). The mean 3.5-year costs of $54,827.05 after index interbody fusion were
Lunar Helium-3 and Fusion Power
NASA Technical Reports Server (NTRS)
1988-01-01
The NASA Office of Exploration sponsored the NASA Lunar Helium-3 and Fusion Power Workshop. The meeting was held to understand the potential of using He-3 from the moon for terrestrial fusion power production. It provided an overview, two parallel working sessions, a review of sessions, and discussions. The lunar mining session concluded that mining, beneficiation, separation, and return of He-3 from the moon would be possible but that a large scale operation and improved technology is required. The fusion power session concluded that: (1) that He-3 offers significant, possibly compelling, advantages over fusion of tritium, principally increased reactor life, reduced radioactive wastes, and high efficiency conversion, (2) that detailed assessment of the potential of the D/He-3 fuel cycle requires more information, and (3) D/He-3 fusion may be best for commercial purposes, although D/T fusion is more near term.
Multispectral image fusion for target detection
NASA Astrophysics Data System (ADS)
Leviner, Marom; Maltz, Masha
2009-09-01
Various different methods to perform multi-spectral image fusion have been suggested, mostly on the pixel level. However, the jury is still out on the benefits of a fused image compared to its source images. We present here a new multi-spectral image fusion method, multi-spectral segmentation fusion (MSSF), which uses a feature level processing paradigm. To test our method, we compared human observer performance in an experiment using MSSF against two established methods: Averaging and Principle Components Analysis (PCA), and against its two source bands, visible and infrared. The task that we studied was: target detection in the cluttered environment. MSSF proved superior to the other fusion methods. Based on these findings, current speculation about the circumstances in which multi-spectral image fusion in general and specific fusion methods in particular would be superior to using the original image sources can be further addressed.
Septer, Alecia N.; Stabb, Eric V.
2012-01-01
Bacterial pheromone signaling is often governed both by environmentally responsive regulators and by positive feedback. This regulatory combination has the potential to coordinate a group response among distinct subpopulations that perceive key environmental stimuli differently. We have explored the interplay between an environmentally responsive regulator and pheromone-mediated positive feedback in intercellular signaling by Vibrio fischeri ES114, a bioluminescent bacterium that colonizes the squid Euprymna scolopes. Bioluminescence in ES114 is controlled in part by N-(3-oxohexanoyl)-L-homoserine lactone (3OC6), a pheromone produced by LuxI that together with LuxR activates transcription of the luxICDABEG operon, initiating a positive feedback loop and inducing luminescence. The lux operon is also regulated by environmentally responsive regulators, including the redox-responsive ArcA/ArcB system, which directly represses lux in culture. Here we show that inactivating arcA leads to increased 3OC6 accumulation to initiate positive feedback. In the absence of positive feedback, arcA-mediated control of luminescence was only ∼2-fold, but luxI-dependent positive feedback contributed more than 100 fold to the net induction of luminescence in the arcA mutant. Consistent with this overriding importance of positive feedback, 3OC6 produced by the arcA mutant induced luminescence in nearby wild-type cells, overcoming their ArcA repression of lux. Similarly, we found that artificially inducing ArcA could effectively repress luminescence before, but not after, positive feedback was initiated. Finally, we show that 3OC6 produced by a subpopulation of symbiotic cells can induce luminescence in other cells co-colonizing the host. Our results suggest that even transient loss of ArcA-mediated regulation in a sub-population of cells can induce luminescence in a wider community. Moreover, they indicate that 3OC6 can communicate information about both cell density and the state of
Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.
Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M
2016-09-12
The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .
Two heretical thoughts on fusion and climate
NASA Astrophysics Data System (ADS)
Manheimer, Wallace
2016-10-01
This presents and explores 2 heretical thoughts regarding controlled fusion and climate. First, the only way that fusion can contribute to midcentury power is by switching its goal from pure fusion, to fusion breeding. Fusion breeding makes many fewer demands on the fusion device than does pure fusion. Fusion breeding could lead to a sustainable, carbon free, environmentally and economically viable, midcentury infrastructure, with little or no proliferation risk, which could provide terawatts of power for the world. The second involves climate. We are all inundated by media warnings, not only of warming from CO2 in the atmosphere, but all sorts of other environmental disasters. For instance there will be more intense storms, rising sea levels, wild fires, retreating glaciers, droughts, loss of agricultural productivity... These assertions are very easy to check out. Such a search shows that we are nowhere near any sort of environmental crisis. The timing could be serendipitous; the time necessary to develop fusion breeding could well match up to the time when it is needed so as to avoid harm to the earth's climate and/or depletion of finite energy resources.
Spherical torus fusion reactor
Martin Peng, Y.K.M.
1985-10-03
The object of this invention is to provide a compact torus fusion reactor with dramatic simplification of plasma confinement design. Another object of this invention is to provide a compact torus fusion reactor with low magnetic field and small aspect ratio stable plasma confinement. In accordance with the principles of this invention there is provided a compact toroidal-type plasma confinement fusion reactor in which only the indispensable components inboard of a tokamak type of plasma confinement region, mainly a current conducting medium which carries electrical current for producing a toroidal magnet confinement field about the toroidal plasma region, are retained.
Fusion Propulsion Z-Pinch Engine Concept
NASA Technical Reports Server (NTRS)
Miernik, J.; Statham, G.; Fabisinski, L.; Maples, C. D.; Adams, R.; Polsgrove, T.; Fincher, S.; Cassibry, J.; Cortez, R.; Turner, M.;
2011-01-01
Fusion-based nuclear propulsion has the potential to enable fast interplanetary transportation. Due to the great distances between the planets of our solar system and the harmful radiation environment of interplanetary space, high specific impulse (Isp) propulsion in vehicles with high payload mass fractions must be developed to provide practical and safe vehicles for human spaceflight missions. The Z-Pinch dense plasma focus method is a Magneto-Inertial Fusion (MIF) approach that may potentially lead to a small, low cost fusion reactor/engine assembly1. Recent advancements in experimental and theoretical understanding of this concept suggest favorable scaling of fusion power output yield 2. The magnetic field resulting from the large current compresses the plasma to fusion conditions, and this process can be pulsed over short timescales (10(exp -6 sec). This type of plasma formation is widely used in the field of Nuclear Weapons Effects testing in the defense industry, as well as in fusion energy research. A Decade Module 2 (DM2), approx.500 KJ pulsed-power is coming to the RSA Aerophysics Lab managed by UAHuntsville in January, 2012. A Z-Pinch propulsion concept was designed for a vehicle based on a previous fusion vehicle study called "Human Outer Planet Exploration" (HOPE), which used Magnetized Target Fusion (MTF) 3 propulsion. The reference mission is the transport of crew and cargo to Mars and back, with a reusable vehicle.
Novel kinase fusion transcripts found in endometrial cancer
Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G. W.; Enomoto, Takayuki
2015-01-01
Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts. PMID:26689674
Novel kinase fusion transcripts found in endometrial cancer.
Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G W; Enomoto, Takayuki
2015-12-22
Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts.
A local approach for focussed Bayesian fusion
NASA Astrophysics Data System (ADS)
Sander, Jennifer; Heizmann, Michael; Goussev, Igor; Beyerer, Jürgen
2009-04-01
Local Bayesian fusion approaches aim to reduce high storage and computational costs of Bayesian fusion which is separated from fixed modeling assumptions. Using the small world formalism, we argue why this proceeding is conform with Bayesian theory. Then, we concentrate on the realization of local Bayesian fusion by focussing the fusion process solely on local regions that are task relevant with a high probability. The resulting local models correspond then to restricted versions of the original one. In a previous publication, we used bounds for the probability of misleading evidence to show the validity of the pre-evaluation of task specific knowledge and prior information which we perform to build local models. In this paper, we prove the validity of this proceeding using information theoretic arguments. For additional efficiency, local Bayesian fusion can be realized in a distributed manner. Here, several local Bayesian fusion tasks are evaluated and unified after the actual fusion process. For the practical realization of distributed local Bayesian fusion, software agents are predestinated. There is a natural analogy between the resulting agent based architecture and criminal investigations in real life. We show how this analogy can be used to improve the efficiency of distributed local Bayesian fusion additionally. Using a landscape model, we present an experimental study of distributed local Bayesian fusion in the field of reconnaissance, which highlights its high potential.
Fusomorphogenesis: cell fusion in organ formation.
Shemer, G; Podbilewicz, B
2000-05-01
Cell fusion is a universal process that occurs during fertilization and in the formation of organs such as muscles, placenta, and bones. Very little is known about the molecular and cellular mechanisms of cell fusion during pattern formation. Here we review the dynamic anatomy of all cell fusions during embryonic and postembryonic development in an organism. Nearly all the cell fates and cell lineages are invariant in the nematode C. elegans and one third of the cells that are born fuse to form 44 syncytia in a reproducible and stereotyped way. To explain the function of cell fusion in organ formation we propose the fusomorphogenetic model as a simple cellular mechanism to efficiently redistribute membranes using a combination of cell fusion and polarized membrane recycling during morphogenesis. Thus, regulated intercellular and intracellular membrane fusion processes may drive elongation of the embryo as well as postembryonic organ formation in C. elegans. Finally, we use the fusomorphogenetic hypothesis to explain the role of cell fusion in the formation of organs like muscles, bones, and placenta in mammals and other species and to speculate on how the intracellular machinery that drive fusomorphogenesis may have evolved.
Selwood, T; Sinnott, M L
1990-06-01
1. Michaelis-Menten parameters for the hydrolysis of 4-nitrophenyl beta-D-galactopyranoside and 3,4-dinitrophenyl beta-D-galactopyranoside Escherichia coli (lacZ) beta-galactosidase were measured as a function of pH or pD (pL) in both 1H2O and 2H2O. 2. For hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-free enzyme, V is pL-independent below pL 9, but the V/Km-pL profile is sigmoid, the pK values shifting from 7.6 +/- 0.1 in 1H2O to 8.2 +/- 0.1 in 2H2O, and solvent kinetic isotope effects are negligible, in accord with the proposal [Sinnott, Withers & Viratelle (1978) Biochem. J. 175, 539-546] that glycone-aglycone fission without acid catalysis governs both V and V/Km. 3. V for hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme varies sigmoidally with pL, the pK value shifting from 9.19 +/- 0.09 to 9.70 +/- 0.07; V/Km shows both a low-pL fall, probably due to competition between Mg2+ and protons [Tenu, Viratelle, Garnier & Yon (1971) Eur. J. Biochem. 20, 363-370], and a high-pL fall, governed by a pK that shifts from 8.33 +/- 0.08 to 8.83 +/- 0.08. There is a negligible solvent kinetic isotope effect on V/Km, but one of 1.7 on V, which a linear proton inventory shows to arise from one transferred proton. 4. The variation of V and V/Km with pL is sigmoid for hydrolysis of 3,4-dinitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme, with pK values showing small shifts, from 8.78 +/- 0.09 to 8.65 +/- 0.08 and from 8.7 +/- 0.1 to 8.9 +/- 0.1 respectively. There is no solvent isotope effect on V or V/Km for 3,4-dinitrophenyl beta-D-galactopyranoside, despite hydrolysis of the galactosyl-enzyme intermediate governing V. 5. Identification of the 'conformation change' in the hydrolysis of aryl galactosides proposed by Sinnott & Souchard [(1973) Biochem. J. 133, 89-98] with the protolysis of the magnesium phenoxide arising from the action of enzyme-bound Mg2+ as an electrophilic catalyst rationalizes these data and also resolves the
URREF Reliability Versus Credibility in Information Fusion
2013-07-01
Fusion, Vol. 3, No. 2, December, 2008. [31] E. Blasch, J. Dezert, and P. Valin , “DSMT Applied to Seismic and Acoustic Sensor Fusion,” Proc. IEEE Nat...44] E. Blasch, P. Valin , E. Bossé, “Measures of Effectiveness for High- Level Fusion,” Int. Conference on Information Fusion, 2010. [45] X. Mei, H...and P. Valin , “Information Fusion Measures of Effectiveness (MOE) for Decision Support,” Proc. SPIE 8050, 2011. [49] Y. Zheng, W. Dong, and E
López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat
2004-07-09
The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.
Accelerators for Fusion Materials Testing
NASA Astrophysics Data System (ADS)
Knaster, Juan; Okumura, Yoshikazu
Fusion materials research is a worldwide endeavor as old as the parallel one working toward the long term stable confinement of ignited plasma. In a fusion reactor, the preservation of the required minimum thermomechanical properties of the in-vessel components exposed to the severe irradiation and heat flux conditions is an indispensable factor for safe operation; it is also an essential goal for the economic viability of fusion. Energy from fusion power will be extracted from the 14 MeV neutron freed as a product of the deuterium-tritium fusion reactions; thus, this kinetic energy must be absorbed and efficiently evacuated and electricity eventually generated by the conventional methods of a thermal power plant. Worldwide technological efforts to understand the degradation of materials exposed to 14 MeV neutron fluxes >1018 m-2s-1, as expected in future fusion power plants, have been intense over the last four decades. Existing neutron sources can reach suitable dpa (“displacement-per-atom”, the figure of merit to assess materials degradation from being exposed to neutron irradiation), but the differences in the neutron spectrum of fission reactors and spallation sources do not allow one to unravel the physics and to anticipate the degradation of materials exposed to fusion neutrons. Fusion irradiation conditions can be achieved through Li (d, xn) nuclear reactions with suitable deuteron beam current and energy, and an adequate flowing lithium screen. This idea triggered in the late 1970s at Los Alamos National Laboratory (LANL) a campaign working toward the feasibility of continuous wave (CW) high current linacs framed by the Fusion Materials Irradiation Test (FMIT) project. These efforts continued with the Low Energy Demonstrating Accelerator (LEDA) (a validating prototype of the canceled Accelerator Production of Tritium (APT) project), which was proposed in 2002 to the fusion community as a 6.7MeV, 100mA CW beam injector for a Li (d, xn) source to bridge
Accelerators for Fusion Materials Testing
NASA Astrophysics Data System (ADS)
Knaster, Juan; Okumura, Yoshikazu
Fusion materials research is a worldwide endeavor as old as the parallel one working toward the long term stable confinement of ignited plasma. In a fusion reactor, the preservation of the required minimum thermomechanical properties of the in-vessel components exposed to the severe irradiation and heat flux conditions is an indispensable factor for safe operation; it is also an essential goal for the economic viability of fusion. Energy from fusion power will be extracted from the 14 MeV neutron freed as a product of the deuterium-tritium fusion reactions; thus, this kinetic energy must be absorbed and efficiently evacuated and electricity eventually generated by the conventional methods of a thermal power plant. Worldwide technological efforts to understand the degradation of materials exposed to 14 MeV neutron fluxes > 1018 m-2s-1, as expected in future fusion power plants, have been intense over the last four decades. Existing neutron sources can reach suitable dpa ("displacement-per-atom", the figure of merit to assess materials degradation from being exposed to neutron irradiation), but the differences in the neutron spectrum of fission reactors and spallation sources do not allow one to unravel the physics and to anticipate the degradation of materials exposed to fusion neutrons. Fusion irradiation conditions can be achieved through Li (d, xn) nuclear reactions with suitable deuteron beam current and energy, and an adequate flowing lithium screen. This idea triggered in the late 1970s at Los Alamos National Laboratory (LANL) a campaign working toward the feasibility of continuous wave (CW) high current linacs framed by the Fusion Materials Irradiation Test (FMIT) project. These efforts continued with the Low Energy Demonstrating Accelerator (LEDA) (a validating prototype of the canceled Accelerator Production of Tritium (APT) project), which was proposed in 2002 to the fusion community as a 6.7MeV, 100mA CW beam injector for a Li (d, xn) source to bridge
Dynamic Information Collection and Fusion
2015-12-02
AFRL-AFOSR-VA-TR-2016-0069 DYNAMIC INFORMATION COLLECTION AND FUSION Venugopal Veeravalli UNIVERSITY OF ILLINOIS CHAMPAIGN Final Report 12/02/2015...TITLE AND SUBTITLE Dynamic Information Collection and Fusion 5a. CONTRACT NUMBER FA9550-10-1-0458 5b. GRANT NUMBER AF FA9550-10-1-0458 5c. PROGRAM...information collection, fusion , and inference from diverse modalities Our research has been organized under three inter-related thrusts. The first thrust
Sensor fusion for synthetic vision
NASA Technical Reports Server (NTRS)
Pavel, M.; Larimer, J.; Ahumada, A.
1991-01-01
Display methodologies are explored for fusing images gathered by millimeter wave sensors with images rendered from an on-board terrain data base to facilitate visually guided flight and ground operations in low visibility conditions. An approach to fusion based on multiresolution image representation and processing is described which facilitates fusion of images differing in resolution within and between images. To investigate possible fusion methods, a workstation-based simulation environment is being developed.
Popov, Georgy; Majhi, Bharat Bhusan; Sessa, Guido
2018-05-21
The type III effector XopAE from the Xanthomonas euvesicatoria strain 85-10 ( Xe 85-10) was previously shown to inhibit plant immunity and enhance pathogen-induced disease symptoms. Evolutionary analysis of 60 xopAE alleles ( AEal ) revealed that the xopAE locus is conserved in multiple Xanthomonas species. The majority of xopAE alleles (55 out of 60) encodes a single ORF ( xopAE ), while in 5 alleles, including AEal 37 of the Xe 85-10 strain, a frame-shift splits the locus into two ORFs ( hpaF and a truncated xopAE ). To test whether the second ORF of AEal 37 ( xopAE 85-10 ) is translated, we examined expression of YFP fused downstream to truncated or mutant forms of the locus in Xanthomonas bacteria. YFP fluorescence was detected at maximal levels when the reporter was in proximity of an internal ribosome-binding site upstream to a rare ATT start codon in the xopAE 85-10 ORF, but severely reduced when these elements were abolished. In agreement with the notion that xopAE 85- 10 is a functional gene, its protein product was translocated into plant cells by the type III secretion system and translocation was dependent on its upstream ORF hpaF. Homology modeling predicted that XopAE 85-10 contains an E3 ligase XL-box domain at the C-terminus, and in vitro assays demonstrated that this domain displays mono-ubiquitination activity. Remarkably, the XL-box was essential for XopAE 85-10 to inhibit PAMP-induced gene expression in Arabidopsis protoplasts. Together, these results indicate that the xopAE 85-10 gene resides in a functional operon, which utilizes the alternative start codon ATT, and encodes a novel XL-box E3 ligase. Importance Xanthomonas bacteria utilize a type III secretion system to cause disease in many crops. This study provides insights into evolution, translocation and biochemical function of the XopAE type III secreted effector contributing to the understanding of Xanthomonas-host interactions. We establish XopAE as core effector of seven Xanthomonas
Osteoclasts and giant cells: macrophage–macrophage fusion mechanism
Vignery, Agnès
2000-01-01
Membrane fusion is a ubiquitous event that occurs in a wide range of biological processes. While intracellular membrane fusion mediating organelle trafficking is well understood, much less is known about cell–cell fusion mediating sperm cell–oocyte, myoblast–myoblast and macrophage–macrophage fusion. In the case of mononuclear phagocytes, their fusion is not only associated with the differentiation of osteoclasts, cells which play a key role in the pathogenesis of osteoporosis, but also of giant cells that are present in chronic inflammatory reactions and in tumours. Despite the biological and pathophysiological importance of intercellular fusion events, the actual molecular mechanism of macrophage fusion is still unclear. One of the main research themes in my laboratory has been to investigate the molecular mechanism of mononuclear phagocyte fusion. Our hypothesis has been that macrophage–macrophage fusion, similar to virus–cell fusion, is mediated by specific cell surface proteins. But, in contrast with myoblasts and sperm cells, macrophage fusion is a rare event that occurs in specific instances. To test our hypothesis, we established an in vitro cell–cell fusion assay as a model system which uses alveolar macrophages. Upon multinucleation, these macrophages acquire the osteoclast phenotype. This indicates that multinucleation of macrophages leads to a specific and novel functional phenotype in macrophages. To identify the components of the fusion machinery, we generated four monoclonal antibodies (mAbs) which block the fusion of alveolar macrophages and purified the unique antigen recognized by these mAbs. This led us to the cloning of MFR (Macrophage Fusion Receptor). MFR was cloned simultaneously as P84/SHPS-1/SIRPα/BIT by other laboratories. We subsequently showed that the recombinant extracellular domain of MFR blocks fusion. Most recently, we identified a lower molecular weight form of MFR that is missing two extracellular immunoglobulin (Ig
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Magnetized Target Fusion in Advanced Propulsion Research
NASA Technical Reports Server (NTRS)
Cylar, Rashad
2003-01-01
The Magnetized Target Fusion (MTF) Propulsion lab at NASA Marshall Space Flight Center in Huntsville, Alabama has a program in place that has adopted to attempt to create a faster, lower cost and more reliable deep space transportation system. In this deep space travel the physics and development of high velocity plasma jets must be understood. The MTF Propulsion lab is also in attempt to open up the solar system for human exploration and commercial use. Fusion, as compared to fission, is just the opposite. Fusion involves the light atomic nuclei combination to produce denser nuclei. In the process, the energy is created by destroying the mass according to the distinguished equation: E = mc2 . Fusion energy development is being pursued worldwide as a very sustainable form of energy that is environmentally friendly. For the purposes of space exploration fusion reactions considered include the isotopes of hydrogen-deuterium (D2) and tritium (T3). Nuclei have an electrostatic repulsion between them and in order for the nuclei to fuse this repulsion must be overcome. One technique to bypass repulsion is to heat the nuclei to very high temperatures. The temperatures vary according to the type of reactions. For D-D reactions, one billion degrees Celsius is required, and for D-T reactions, one hundred million degrees is sufficient. There has to be energy input for useful output to be obtained form the fusion To make fusion propulsion practical, the mass, the volume, and the cost of the equipment to produce the reactions (generally called the reactor) need to be reduced by an order of magnitude or two from the state-of-the-art fusion machines. Innovations in fusion schemes are therefore required, especially for obtaining thrust for propulsive applications. Magnetized target fusion (MTF) is one of the innovative fusion concepts that have emerged over the last several years. MSFC is working with Los Alamos National Laboratory and other research groups in studying the
Paramyxovirus Glycoproteins and the Membrane Fusion Process.
Aguilar, Hector C; Henderson, Bryce A; Zamora, J Lizbeth; Johnston, Gunner P
2016-09-01
The family Paramyxoviridae includes many viruses that significantly affect human and animal health. An essential step in the paramyxovirus life cycle is viral entry into host cells, mediated by virus-cell membrane fusion. Upon viral entry, infection results in expression of the paramyxoviral glycoproteins on the infected cell surface. This can lead to cell-cell fusion (syncytia formation), often linked to pathogenesis. Thus membrane fusion is essential for both viral entry and cell-cell fusion and an attractive target for therapeutic development. While there are important differences between viral-cell and cell-cell membrane fusion, many aspects are conserved. The paramyxoviruses generally utilize two envelope glycoproteins to orchestrate membrane fusion. Here, we discuss the roles of these glycoproteins in distinct steps of the membrane fusion process. These findings can offer insights into evolutionary relationships among Paramyxoviridae genera and offer future targets for prophylactic and therapeutic development.
Paramyxovirus Glycoproteins and the Membrane Fusion Process
Aguilar, Hector C.; Henderson, Bryce A.; Zamora, J. Lizbeth; Johnston, Gunner P.
2016-01-01
The family Paramyxoviridae includes many viruses that significantly affect human and animal health. An essential step in the paramyxovirus life cycle is viral entry into host cells, mediated by virus-cell membrane fusion. Upon viral entry, infection results in expression of the paramyxoviral glycoproteins on the infected cell surface. This can lead to cell-cell fusion (syncytia formation), often linked to pathogenesis. Thus membrane fusion is essential for both viral entry and cell-cell fusion and an attractive target for therapeutic development. While there are important differences between viral-cell and cell-cell membrane fusion, many aspects are conserved. The paramyxoviruses generally utilize two envelope glycoproteins to orchestrate membrane fusion. Here, we discuss the roles of these glycoproteins in distinct steps of the membrane fusion process. These findings can offer insights into evolutionary relationships among Paramyxoviridae genera and offer future targets for prophylactic and therapeutic development. PMID:28138419
ERIC Educational Resources Information Center
Lo, Mun Ling; Chik, Pakey Pui Man
2016-01-01
In this paper, we aim to differentiate the internal and external horizons of "fusion." "Fusion" in the internal horizon relates to the structure and meaning of the object of learning as experienced by the learner. It clarifies the interrelationships among an object's critical features and aspects. It also illuminates the…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Kai; The State Key Laboratory Breeding Base of Basic Science of Stomatology; Song, Yong
Most previous studies have linked cancer–macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed thatmore » SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. - Highlights: • The fusion events between oral cancer and endothelial cells undergo nuclear fusion. • The resulting hybrid cells acquire a new property of drug resistance. • The resulting hybrid cells express the markers of both parental cells (i.e. vimentin and cytokeratin 18). • The hybrid cells contribute to tumor repopulation in vivo.« less
Assessment of NDE Methods to Detect Lack of Fusion in HDPE Butt Fusion Joints
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crawford, Susan L.; Doctor, Steven R.; Cinson, Anthony D.
2011-07-31
Studies at the Pacific Northwest National Laboratory (PNNL) in Richland, Washington, were conducted to evaluate nondestructive examinations (NDE) coupled with mechanical testing of butt fusion joints in high-density polyethylene (HDPE) pipe for assessing lack of fusion. The work provided information to the United States Nuclear Regulatory Commission (NRC) on the effectiveness of volumetric inspection techniques of HDPE butt fusion joints in Section III, Division 1, Class 3, buried piping systems in nuclear power plants. This paper describes results from assessments using ultrasonic and microwave nondestructive techniques and mechanical testing with the high-speed tensile impact test and the side-bend test formore » determining joint integrity. A series of butt joints were fabricated in 3408, 12-inch (30.5-cm) IPS DR-11 HDPE material by varying the fusion parameters to create good joints and joints containing a range of lack-of-fusion conditions. Six of these butt joints were volumetrically examined with time-of-flight diffraction (TOFD), phased-array (PA) ultrasound, and the Evisive microwave system. The outer diameter (OD) weld beads were removed for microwave evaluation and the pipes ultrasonically re-evaluated. In two of the six pipes, both the outer and inner diameter (ID) weld beads were removed and the pipe joints re-evaluated. Some of the pipes were sectioned and the joints destructively evaluated with the high-speed tensile test and the side-bend test. The fusion parameters, nondestructive and destructive evaluation results have been correlated to validate the effectiveness of what each NDE technology detects and what each does not detect. There was no single NDE method that detected all of the lack-of-fusion flaws but a combination of NDE methods did detect most of the flaws.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haralalka, Shruti; Abmayr, Susan M., E-mail: sma@stowers.org; Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160
2010-11-01
The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral sidemore » of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.« less
NASA Technical Reports Server (NTRS)
Orth, Charles D.; Klein, Gail; Sercel, Joel; Hoffman, Nate; Murray, Kathy; Chang-Diaz, Franklin
1987-01-01
Inertial Confinement Fusion (ICF) is an attractive engine power source for interplanetary manned spacecraft, especially for near-term missions requiring minimum flight duration, because ICF has inherent high power-to-mass ratios and high specific impulses. We have developed a new vehicle concept called VISTA that uses ICF and is capable of round-trip manned missions to Mars in 100 days using A.D. 2020 technology. We describe VISTA's engine operation, discuss associated plasma issues, and describe the advantages of DT fuel for near-term applications. Although ICF is potentially superior to non-fusion technologies for near-term interplanetary transport, the performance capabilities of VISTA cannot be meaningfully compared with those of magnetic-fusion systems because of the lack of a comparable study of the magnetic-fusion systems. We urge that such a study be conducted.
NASA Astrophysics Data System (ADS)
Ngatchou, Annita
2010-01-01
Pheochromocytoma is a tumor of the adrenal gland which originates from chromaffin cells and is characterized by the secretion of excessive amounts of neurotransmitter which lead to high blood pressure and palpitations. Pheochromocytoma contain membrane bound granules that store neurotransmitter. The release of these stored molecules into the extracellular space occurs by fusion of the granule membrane with the cell plasma membrane, a process called exocytosis. The molecular mechanism of this membrane fusion is not well understood. It is proposed that the so called SNARE proteins [1] are the pillar of vesicle fusion as their cleavage by clostridial toxin notably, Botulinum neurotoxin and Tetanus toxin abrogate the secretion of neurotransmitter [2]. Here, I describe how physical principles are applied to a biological cell to explore the role of the vesicle SNARE protein synaptobrevin-2 in easing granule fusion. The data presented here suggest a paradigm according to which the movement of the C-terminal of synaptobrevin-2 disrupts the lipid bilayer to form a fusion pore through which molecules can exit.
Myoblast fusion: lessons from flies and mice
Abmayr, Susan M.; Pavlath, Grace K.
2012-01-01
The fusion of myoblasts into multinucleate syncytia plays a fundamental role in muscle function, as it supports the formation of extended sarcomeric arrays, or myofibrils, within a large volume of cytoplasm. Principles learned from the study of myoblast fusion not only enhance our understanding of myogenesis, but also contribute to our perspectives on membrane fusion and cell-cell fusion in a wide array of model organisms and experimental systems. Recent studies have advanced our views of the cell biological processes and crucial proteins that drive myoblast fusion. Here, we provide an overview of myoblast fusion in three model systems that have contributed much to our understanding of these events: the Drosophila embryo; developing and regenerating mouse muscle; and cultured rodent muscle cells. PMID:22274696
Farzan, Shohreh F; Palermo, Laura M; Yokoyama, Christine C; Orefice, Gianmarco; Fornabaio, Micaela; Sarkar, Aurijit; Kellogg, Glen E; Greengard, Olga; Porotto, Matteo; Moscona, Anne
2011-11-04
Paramyxoviruses, including the childhood pathogen human parainfluenza virus type 3, enter host cells by fusion of the viral and target cell membranes. This fusion results from the concerted action of its two envelope glycoproteins, the hemagglutinin-neuraminidase (HN) and the fusion protein (F). The receptor-bound HN triggers F to undergo conformational changes that render it competent to mediate fusion of the viral and cellular membranes. We proposed that, if the fusion process could be activated prematurely before the virion reaches the target host cell, infection could be prevented. We identified a small molecule that inhibits paramyxovirus entry into target cells and prevents infection. We show here that this compound works by an interaction with HN that results in F-activation prior to receptor binding. The fusion process is thereby prematurely activated, preventing fusion of the viral membrane with target cells and precluding viral entry. This first evidence that activation of a paramyxovirus F can be specifically induced before the virus contacts its target cell suggests a new strategy with broad implications for the design of antiviral agents.
Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.
2011-01-01
An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565
Cu(I)-mediated Allosteric Switching in a Copper-sensing Operon Repressor (CsoR)*
Chang, Feng-Ming James; Coyne, H. Jerome; Cubillas, Ciro; Vinuesa, Pablo; Fang, Xianyang; Ma, Zhen; Ma, Dejian; Helmann, John D.; García-de los Santos, Alejandro; Wang, Yun-Xing; Dann, Charles E.; Giedroc, David P.
2014-01-01
The copper-sensing operon repressor (CsoR) is representative of a major Cu(I)-sensing family of bacterial metalloregulatory proteins that has evolved to prevent cytoplasmic copper toxicity. It is unknown how Cu(I) binding to tetrameric CsoRs mediates transcriptional derepression of copper resistance genes. A phylogenetic analysis of 227 DUF156 protein members, including biochemically or structurally characterized CsoR/RcnR repressors, reveals that Geobacillus thermodenitrificans (Gt) CsoR characterized here is representative of CsoRs from pathogenic bacilli Listeria monocytogenes and Bacillus anthracis. The 2.56 Å structure of Cu(I)-bound Gt CsoR reveals that Cu(I) binding induces a kink in the α2-helix between two conserved copper-ligating residues and folds an N-terminal tail (residues 12–19) over the Cu(I) binding site. NMR studies of Gt CsoR reveal that this tail is flexible in the apo-state with these dynamics quenched upon Cu(I) binding. Small angle x-ray scattering experiments on an N-terminally truncated Gt CsoR (Δ2–10) reveal that the Cu(I)-bound tetramer is hydrodynamically more compact than is the apo-state. The implications of these findings for the allosteric mechanisms of other CsoR/RcnR repressors are discussed. PMID:24831014
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wendt, Amy; Callis, Richard; Efthimion, Philip
Since the 1950s, scientists and engineers in the U.S. and around the world have worked hard to make an elusive goal to be achieved on Earth: harnessing the reaction that fuels the stars, namely fusion. Practical fusion would be a source of energy that is unlimited, safe, environmentally benign, available to all nations and not dependent on climate or the whims of the weather. Significant resources, most notably from the U.S. Department of Energy (DOE) Office of Fusion Energy Sciences (FES), have been devoted to pursuing that dream, and significant progress is being made in turning it into a reality.more » However, that is only part of the story. The process of creating a fusion-based energy supply on Earth has led to technological and scientific achievements of far-reaching impact that touch every aspect of our lives. Those largely unanticipated advances, spanning a wide variety of fields in science and technology, are the focus of this report. There are many synergies between research in plasma physics (the study of charged particles and fluids interacting with self-consistent electric and magnetic fields), high-energy physics, and condensed matter physics dating back many decades. For instance, the formulation of a mathematical theory of solitons, solitary waves which are seen in everything from plasmas to water waves to Bose-Einstein Condensates, has led to an equal span of applications, including the fields of optics, fluid mechanics and biophysics. Another example, the development of a precise criterion for transition to chaos in Hamiltonian systems, has offered insights into a range of phenomena including planetary orbits, two-person games and changes in the weather. Seven distinct areas of fusion energy sciences were identified and reviewed which have had a recent impact on fields of science, technology and engineering not directly associated with fusion energy: Basic plasma science; Low temperature plasmas; Space and astrophysical plasmas; High energy
Fusion energy: Status and prospects
NASA Astrophysics Data System (ADS)
Salomaa, Rainer
A review of the present state of the international fusion research is given. In the largest tokamak devices (JET, TFTR, JT-60) fusion relevant temperatures are routinely obtained and the scientific feasibility of plasma confinement has been demonstrated. Plans concerning the next step are described. A critical view is presented on questions as to what extent the generic advantages of fusion (availability, sufficiency, safety, environmental acceptability, etc.) can be exploited in a practical power reactor where the formidable technological problems call for compromises.
Fc-fusion Proteins in Therapy: An Updated View.
Jafari, Reza; Zolbanin, Naime M; Rafatpanah, Houshang; Majidi, Jafar; Kazemi, Tohid
2017-01-01
Fc-fusion proteins are composed of Fc region of IgG antibody (Hinge-CH2-CH3) and a desired linked protein. Fc region of Fc-fusion proteins can bind to neonatal Fc receptor (FcRn) thereby rescuing it from degradation. The first therapeutic Fc-fusion protein was introduced for the treatment of AIDS. The molecular designing is the first stage in production of Fc-fusion proteins. The amino acid residues in the Fc region and linked protein are very important in the bioactivity and affinity of the fusion proteins. Although, therapeutic monoclonal antibodies are the top selling biologics but the application of therapeutic Fc-fusion proteins in clinic is in progress and among these medications Etanercept is the most effective in therapy. At present, eleven Fc-fusion proteins have been approved by FDA. There are novel Fc-fusion proteins which are in pre-clinical and clinical development. In this article, we review the molecular and biological characteristics of Fc-fusion proteins and then further discuss the features of novel therapeutic Fc-fusion proteins. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
The transition zone above a lumbosacral fusion.
Hambly, M F; Wiltse, L L; Raghavan, N; Schneiderman, G; Koenig, C
1998-08-15
The clinical and radiographic effect of a lumbar or lumbosacral fusion was studied in 42 patients who had undergone a posterolateral fusion with an average follow-up of 22.6 years. To examine the long-term effects of posterolateral lumbar or lumbosacral fusion on the cephalad two motion segments (transition zone). It is commonly held that accelerated degeneration occurs in the motion segments adjacent to a fusion. Most studies are of short-term, anecdotal, uncontrolled reports that pay particular attention only to the first motion segment immediately cephalad to the fusion. Forty-two patients who had previously undergone a posterolateral lumbar or lumbosacral fusion underwent radiographic and clinical evaluation. Rate of fusion, range of motion, osteophytes, degenerative spondylolisthesis, retrolisthesis, facet arthrosis, disc ossification, dynamic instability, and disc space height were all studied and statistically compared with an age- and gender-matched control group. The patient's self-reported clinical outcome was also recorded. Degenerative changes occurred at the second level above the fused levels with a frequency equal to those occurring in the first level. There was no statistical difference between the study group and the cohort group in the presence of radiographic changes within the transition zone. In those patients undergoing fusion for degenerative processes, 75% reported a good to excellent outcome, whereas 84% of those undergoing fusion for spondylolysis or spondylolisthesis reported a good to excellent outcome. Radiographic changes occur within the transition zone cephalad to a lumbar or lumbosacral fusion. However, these changes are also seen in control subjects who have had no surgery.
Magnetized Target Fusion Driven by Plasma Liners
NASA Technical Reports Server (NTRS)
Thio, Y. C. Francis; Kirkpatrick, Ronald C.; Knapp, Charles E.; Rodgers, Stephen L. (Technical Monitor)
2002-01-01
Magnetized target fusion is an emerging, relatively unexplored approach to fusion for electrical power and propulsion application. The physical principles of the concept are founded upon both inertial confinement fusion (ICF) and magnetic confinement fusion (MCF). It attempts to combine the favorable attributes of both these orthogonal approaches to fusion, but at the same time, avoiding the extreme technical challenges of both by exploiting a fusion regime intermediate between them. It uses a material liner to compress, heat and contain the fusion reacting plasma (the target plasma) mentally. By doing so, the fusion burn could be made to occur at plasma densities as high as six orders of magnitude higher than conventional MCF such as tokamak, thus leading to an approximately three orders of magnitude reduction in the plasma energy required for ignition. It also uses a transient magnetic field, compressed to extremely high intensity (100's T to 1000T) in the target plasma, to slow down the heat transport to the liner and to increase the energy deposition of charged-particle fusion products. This has several compounding beneficial effects. It leads to longer energy confinement time compared with conventional ICF without magnetized target, and thus permits the use of much lower plasma density to produce reasonable burn-up fraction. The compounding effects of lower plasma density and the magneto-insulation of the target lead to greatly reduced compressional heating power on the target. The increased energy deposition rate of charged-particle fusion products also helps to lower the energy threshold required for ignition and increasing the burn-up fraction. The reduction in ignition energy and the compressional power compound to lead to reduced system size, mass and R&D cost. It is a fusion approach that has an affordable R&D pathway, and appears attractive for propulsion application in the nearer term.
Intense fusion neutron sources
NASA Astrophysics Data System (ADS)
Kuteev, B. V.; Goncharov, P. R.; Sergeev, V. Yu.; Khripunov, V. I.
2010-04-01
The review describes physical principles underlying efficient production of free neutrons, up-to-date possibilities and prospects of creating fission and fusion neutron sources with intensities of 1015-1021 neutrons/s, and schemes of production and application of neutrons in fusion-fission hybrid systems. The physical processes and parameters of high-temperature plasmas are considered at which optimal conditions for producing the largest number of fusion neutrons in systems with magnetic and inertial plasma confinement are achieved. The proposed plasma methods for neutron production are compared with other methods based on fusion reactions in nonplasma media, fission reactions, spallation, and muon catalysis. At present, intense neutron fluxes are mainly used in nanotechnology, biotechnology, material science, and military and fundamental research. In the near future (10-20 years), it will be possible to apply high-power neutron sources in fusion-fission hybrid systems for producing hydrogen, electric power, and technological heat, as well as for manufacturing synthetic nuclear fuel and closing the nuclear fuel cycle. Neutron sources with intensities approaching 1020 neutrons/s may radically change the structure of power industry and considerably influence the fundamental and applied science and innovation technologies. Along with utilizing the energy produced in fusion reactions, the achievement of such high neutron intensities may stimulate wide application of subcritical fast nuclear reactors controlled by neutron sources. Superpower neutron sources will allow one to solve many problems of neutron diagnostics, monitor nano-and biological objects, and carry out radiation testing and modification of volumetric properties of materials at the industrial level. Such sources will considerably (up to 100 times) improve the accuracy of neutron physics experiments and will provide a better understanding of the structure of matter, including that of the neutron itself.
Fusion Imaging for Procedural Guidance.
Wiley, Brandon M; Eleid, Mackram F; Thaden, Jeremy J
2018-05-01
The field of percutaneous structural heart interventions has grown tremendously in recent years. This growth has fueled the development of new imaging protocols and technologies in parallel to help facilitate these minimally-invasive procedures. Fusion imaging is an exciting new technology that combines the strength of 2 imaging modalities and has the potential to improve procedural planning and the safety of many commonly performed transcatheter procedures. In this review we discuss the basic concepts of fusion imaging along with the relative strengths and weaknesses of static vs dynamic fusion imaging modalities. This review will focus primarily on echocardiographic-fluoroscopic fusion imaging and its application in commonly performed transcatheter structural heart procedures. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.
High-gain magnetized inertial fusion.
Slutz, Stephen A; Vesey, Roger A
2012-01-13
Magnetized inertial fusion (MIF) could substantially ease the difficulty of reaching plasma conditions required for significant fusion yields, but it has been widely accepted that the gain is not sufficient for fusion energy. Numerical simulations are presented showing that high-gain MIF is possible in cylindrical liner implosions based on the MagLIF concept [S. A. Slutz et al Phys. Plasmas 17, 056303 (2010)] with the addition of a cryogenic layer of deuterium-tritium (DT). These simulations show that a burn wave propagates radially from the magnetized hot spot into the surrounding much denser cold DT given sufficient hot-spot areal density. For a drive current of 60 MA the simulated gain exceeds 100, which is more than adequate for fusion energy applications. The simulated gain exceeds 1000 for a drive current of 70 MA.
Information Fusion - Methods and Aggregation Operators
NASA Astrophysics Data System (ADS)
Torra, Vicenç
Information fusion techniques are commonly applied in Data Mining and Knowledge Discovery. In this chapter, we will give an overview of such applications considering their three main uses. This is, we consider fusion methods for data preprocessing, model building and information extraction. Some aggregation operators (i.e. particular fusion methods) and their properties are briefly described as well.
Z-Pinch fusion-based nuclear propulsion
NASA Astrophysics Data System (ADS)
Miernik, J.; Statham, G.; Fabisinski, L.; Maples, C. D.; Adams, R.; Polsgrove, T.; Fincher, S.; Cassibry, J.; Cortez, R.; Turner, M.; Percy, T.
2013-02-01
Fusion-based nuclear propulsion has the potential to enable fast interplanetary transportation. Due to the great distances between the planets of our solar system and the harmful radiation environment of interplanetary space, high specific impulse (Isp) propulsion in vehicles with high payload mass fractions must be developed to provide practical and safe vehicles for human space flight missions. The Z-Pinch dense plasma focus method is a Magneto-Inertial Fusion (MIF) approach that may potentially lead to a small, low cost fusion reactor/engine assembly [1]. Recent advancements in experimental and theoretical understanding of this concept suggest favorable scaling of fusion power output yield [2]. The magnetic field resulting from the large current compresses the plasma to fusion conditions, and this process can be pulsed over short timescales (10-6 s). This type of plasma formation is widely used in the field of Nuclear Weapons Effects testing in the defense industry, as well as in fusion energy research. A Z-Pinch propulsion concept was designed for a vehicle based on a previous fusion vehicle study called "Human Outer Planet Exploration" (HOPE), which used Magnetized Target Fusion (MTF) [3] propulsion. The reference mission is the transport of crew and cargo to Mars and back, with a reusable vehicle. The analysis of the Z-Pinch MIF propulsion system concludes that a 40-fold increase of Isp over chemical propulsion is predicted. An Isp of 19,436 s and thrust of 3812 N s/pulse, along with nearly doubling the predicted payload mass fraction, warrants further development of enabling technologies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hedrick, J.; Buchholtz, B.; Ward, P.
1991-01-01
Fusion Propulsion has an enormous potential for space exploration in the near future. In the twenty-first century, a usable and efficient fusion rocket will be developed and in use. Because of the great distance between other planets and Earth, efficient use of time, fuel, and payload is essential. A nuclear spaceship would provide greater fuel efficiency, less travel time, and a larger payload. Extended missions would give more time for research, experiments, and data acquisition. With the extended mission time, a need for an artificial environment exists. The topics of magnetic fusion propulsion, living modules, artificial gravity, mass distribution, spacemore » connection, and orbital transfer to Mars are discussed. The propulsion system is a magnetic fusion reactor based on a tandem mirror design. This allows a faster, shorter trip time and a large thrust to weight ratio. The fuel proposed is a mixture of deuterium and helium. Helium can be obtained from lunar mining. There will be minimal external radiation from the reactor resulting in a safe, efficient propulsion system.« less
NASA Technical Reports Server (NTRS)
Hedrick, James; Buchholtz, Brent; Ward, Paul; Freuh, Jim; Jensen, Eric
1991-01-01
Fusion Propulsion has an enormous potential for space exploration in the near future. In the twenty-first century, a usable and efficient fusion rocket will be developed and in use. Because of the great distance between other planets and Earth, efficient use of time, fuel, and payload is essential. A nuclear spaceship would provide greater fuel efficiency, less travel time, and a larger payload. Extended missions would give more time for research, experiments, and data acquisition. With the extended mission time, a need for an artificial environment exists. The topics of magnetic fusion propulsion, living modules, artificial gravity, mass distribution, space connection, and orbital transfer to Mars are discussed. The propulsion system is a magnetic fusion reactor based on a tandem mirror design. This allows a faster, shorter trip time and a large thrust to weight ratio. The fuel proposed is a mixture of deuterium and helium-3. Helium-3 can be obtained from lunar mining. There will be minimal external radiation from the reactor resulting in a safe, efficient propulsion system.
Gardner, Amanda E.; Dutch, Rebecca E.
2007-01-01
Paramyxoviruses utilize both an attachment protein and a fusion (F) protein to drive virus-cell and cell-cell fusion. F exists functionally as a trimer of two disulfide-linked subunits: F1 and F2. Alignment and analysis of a set of paramyxovirus F protein sequences identified three conserved blocks (CB): one in the fusion peptide/heptad repeat A domain, known to play important roles in fusion promotion, one in the region between the heptad repeats of F1 (CBF1) (A. E. Gardner, K. L. Martin, and R. E. Dutch, Biochemistry 46:5094-5105, 2007), and one in the F2 subunit (CBF2). To analyze the functions of CBF2, alanine substitutions at conserved positions were created in both the simian virus 5 (SV5) and Hendra virus F proteins. A number of the CBF2 mutations resulted in folding and expression defects. However, the CBF2 mutants that were properly expressed and trafficked had altered fusion promotion activity. The Hendra virus CBF2 Y79A and P89A mutants showed significantly decreased levels of fusion, whereas the SV5 CBF2 I49A mutant exhibited greatly increased cell-cell fusion relative to that for wild-type F. Additional substitutions at SV5 F I49 suggest that both side chain volume and hydrophobicity at this position are important in the folding of the metastable, prefusion state and the subsequent triggering of membrane fusion. The recently published prefusogenic structure of parainfluenza virus 5/SV5 F (H. S. Yin et al., Nature 439:38-44, 2006) places CBF2 in direct contact with heptad repeat A. Our data therefore indicate that this conserved region plays a critical role in stabilizing the prefusion state, likely through interactions with heptad repeat A, and in triggering membrane fusion. PMID:17507474
SNARE-mediated membrane fusion in autophagy
Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie
2016-01-01
Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. PMID:27422330
Estrada, Beatriz; Maeland, Anne D; Gisselbrecht, Stephen S; Bloor, James W; Brown, Nicholas H; Michelson, Alan M
2007-07-15
Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where--as in myoblast fusion--membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells are unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.
Integrated Data Analysis for Fusion: A Bayesian Tutorial for Fusion Diagnosticians
NASA Astrophysics Data System (ADS)
Dinklage, Andreas; Dreier, Heiko; Fischer, Rainer; Gori, Silvio; Preuss, Roland; Toussaint, Udo von
2008-03-01
Integrated Data Analysis (IDA) offers a unified way of combining information relevant to fusion experiments. Thereby, IDA meets with typical issues arising in fusion data analysis. In IDA, all information is consistently formulated as probability density functions quantifying uncertainties in the analysis within the Bayesian probability theory. For a single diagnostic, IDA allows the identification of faulty measurements and improvements in the setup. For a set of diagnostics, IDA gives joint error distributions allowing the comparison and integration of different diagnostics results. Validation of physics models can be performed by model comparison techniques. Typical data analysis applications benefit from IDA capabilities of nonlinear error propagation, the inclusion of systematic effects and the comparison of different physics models. Applications range from outlier detection, background discrimination, model assessment and design of diagnostics. In order to cope with next step fusion device requirements, appropriate techniques are explored for fast analysis applications.
Forecasting Chronic Diseases Using Data Fusion.
Acar, Evrim; Gürdeniz, Gözde; Savorani, Francesco; Hansen, Louise; Olsen, Anja; Tjønneland, Anne; Dragsted, Lars Ove; Bro, Rasmus
2017-07-07
Data fusion, that is, extracting information through the fusion of complementary data sets, is a topic of great interest in metabolomics because analytical platforms such as liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance (NMR) spectroscopy commonly used for chemical profiling of biofluids provide complementary information. In this study, with a goal of forecasting acute coronary syndrome (ACS), breast cancer, and colon cancer, we jointly analyzed LC-MS, NMR measurements of plasma samples, and the metadata corresponding to the lifestyle of participants. We used supervised data fusion based on multiple kernel learning and exploited the linearity of the models to identify significant metabolites/features for the separation of healthy referents and the cases developing a disease. We demonstrated that (i) fusing LC-MS, NMR, and metadata provided better separation of ACS cases and referents compared with individual data sets, (ii) NMR data performed the best in terms of forecasting breast cancer, while fusion degraded the performance, and (iii) neither the individual data sets nor their fusion performed well for colon cancer. Furthermore, we showed the strengths and limitations of the fusion models by discussing their performance in terms of capturing known biomarkers for smoking and coffee. While fusion may improve performance in terms of separating certain conditions by jointly analyzing metabolomics and metadata sets, it is not necessarily always the best approach as in the case of breast cancer.
Chimera: a Bioconductor package for secondary analysis of fusion products.
Beccuti, Marco; Carrara, Matteo; Cordero, Francesca; Lazzarato, Fulvio; Donatelli, Susanna; Nadalin, Francesca; Policriti, Alberto; Calogero, Raffaele A
2014-12-15
Chimera is a Bioconductor package that organizes, annotates, analyses and validates fusions reported by different fusion detection tools; current implementation can deal with output from bellerophontes, chimeraScan, deFuse, fusionCatcher, FusionFinder, FusionHunter, FusionMap, mapSplice, Rsubread, tophat-fusion and STAR. The core of Chimera is a fusion data structure that can store fusion events detected with any of the aforementioned tools. Fusions are then easily manipulated with standard R functions or through the set of functionalities specifically developed in Chimera with the aim of supporting the user in managing fusions and discriminating false-positive results. © The Author 2014. Published by Oxford University Press.
2013-01-01
Background One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Results Transient continuous cultures with a dilution rate of 0.023 h-1 at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. Conclusion This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Status and problems of fusion reactor development.
Schumacher, U
2001-03-01
Thermonuclear fusion of deuterium and tritium constitutes an enormous potential for a safe, environmentally compatible and sustainable energy supply. The fuel source is practically inexhaustible. Further, the safety prospects of a fusion reactor are quite favourable due to the inherently self-limiting fusion process, the limited radiologic toxicity and the passive cooling property. Among a small number of approaches, the concept of toroidal magnetic confinement of fusion plasmas has achieved most impressive scientific and technical progress towards energy release by thermonuclear burn of deuterium-tritium fuels. The status of thermonuclear fusion research activity world-wide is reviewed and present solutions to the complicated physical and technological problems are presented. These problems comprise plasma heating, confinement and exhaust of energy and particles, plasma stability, alpha particle heating, fusion reactor materials, reactor safety and environmental compatibility. The results and the high scientific level of this international research activity provide a sound basis for the realisation of the International Thermonuclear Experimental Reactor (ITER), whose goal is to demonstrate the scientific and technological feasibility of a fusion energy source for peaceful purposes.
[Metapneumovirus expands the understanding of Paramyxovirus cell fusion--a review].
Liu, Xiaoyu; Zhang, Xiaodong; Wei, Yongwei
2014-04-04
For most viruses in Paramyxoviridae, cell fusion requires both attachment protein and fusion protein. The attachment protein is responsible for the binding to its cognate receptors, while the interaction between fusion protein and attachment protein triggers the fusion protein which is responsible for the fusion. However, the Metapneumovirus fusion in Pneumovirinae subfamily displayed different mechanism where the attachment protein is not required. The cell fusion is accomplished by fusion protein alone without the help of the attachment protein. Recent studies indicate that low pH is required for cell fusion promoted by some hMPV strains. The fusion protein of aMPV type A is highly fusogenic, whereas that of type B is low. The original fusion models for Paramyxovirus cannot explain the phenomenon above. The mechanism to regulate the cell fusion of Metapneumovirus is poorly understood. It is becoming a hot spot for the study of cell fusion triggered by Paramyxovirus where it enlarged the traditional scope of Paramyxovirus fusion. In this review, we discuss the new achievements and advances in the understanding of cell fusion triggered by Metapneumovirus.
Fusion plasma theory project summaries
NASA Astrophysics Data System (ADS)
1993-10-01
This Project Summary book is a published compilation consisting of short descriptions of each project supported by the Fusion Plasma Theory and Computing Group of the Advanced Physics and Technology Division of the Department of Energy, Office of Fusion Energy. The summaries contained in this volume were written by the individual contractors with minimal editing by the Office of Fusion Energy. Previous summaries were published in February of 1982 and December of 1987. The Plasma Theory program is responsible for the development of concepts and models that describe and predict the behavior of a magnetically confined plasma. Emphasis is given to the modelling and understanding of the processes controlling transport of energy and particles in a toroidal plasma and supporting the design of the International Thermonuclear Experimental Reactor (ITER). A tokamak transport initiative was begun in 1989 to improve understanding of how energy and particles are lost from the plasma by mechanisms that transport them across field lines. The Plasma Theory program has actively participated in this initiative. Recently, increased attention has been given to issues of importance to the proposed Tokamak Physics Experiment (TPX). Particular attention has been paid to containment and thermalization of fast alpha particles produced in a burning fusion plasma as well as control of sawteeth, current drive, impurity control, and design of improved auxiliary heating. In addition, general models of plasma behavior are developed from physics features common to different confinement geometries. This work uses both analytical and numerical techniques. The Fusion Theory program supports research projects at U.S. government laboratories, universities and industrial contractors. Its support of theoretical work at universities contributes to the office of Fusion Energy mission of training scientific manpower for the U.S. Fusion Energy Program.
Steff, Ann-Muriel; Monroe, James; Friedrich, Kristian; Chandramouli, Sumana; Nguyen, Thi Lien-Anh; Tian, Sai; Vandepaer, Sarah; Toussaint, Jean-François; Carfi, Andrea
2017-10-20
Human respiratory syncytial virus (hRSV) is responsible for serious lower respiratory tract disease in infants and in older adults, and remains an important vaccine need. RSV fusion (F) glycoprotein is a key target for neutralizing antibodies. RSV F stabilized in its pre-fusion conformation (DS-Cav1 F) induces high neutralizing antibody titers in naïve animals, but it remains unknown to what extent pre-fusion F can boost pre-existing neutralizing responses in RSV seropositive adults. We here assess DS-Cav1 F immunogenicity in seropositive cattle pre-exposed to bovine RSV, a virus closely related to hRSV. A single immunization with non-adjuvanted DS-Cav1 F strongly boosts RSV neutralizing responses, directed towards pre-fusion F-specific epitopes, whereas a post-fusion F is unable to do so. Vaccination with pre-fusion F thus represents a promising strategy for maternal immunization and for other RSV vaccine target populations such as older adults.
Helium Find Thaws the Cold Fusion Trail.
ERIC Educational Resources Information Center
Pennisi, E.
1991-01-01
Reported is a study of cold fusion in which trace amounts of helium, possible evidence of an actual fusion reaction, were found. Research methodology is detailed. The controversy over the validity of experimental results with cold fusion are reviewed. (CW)
Semiotic foundation for multisensor-multilook fusion
NASA Astrophysics Data System (ADS)
Myler, Harley R.
1998-07-01
This paper explores the concept of an application of semiotic principles to the design of a multisensor-multilook fusion system. Semiotics is an approach to analysis that attempts to process media in a united way using qualitative methods as opposed to quantitative. The term semiotic refers to signs, or signatory data that encapsulates information. Semiotic analysis involves the extraction of signs from information sources and the subsequent processing of the signs into meaningful interpretations of the information content of the source. The multisensor fusion problem predicated on a semiotic system structure and incorporating semiotic analysis techniques is explored and the design for a multisensor system as an information fusion system is explored. Semiotic analysis opens the possibility of using non-traditional sensor sources and modalities in the fusion process, such as verbal and textual intelligence derived from human observers. Examples of how multisensor/multimodality data might be analyzed semiotically is shown and discussion on how a semiotic system for multisensor fusion could be realized is outlined. The architecture of a semiotic multisensor fusion processor that can accept situational awareness data is described, although an implementation has not as yet been constructed.
SNARE-mediated membrane fusion in autophagy.
Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie
2016-12-01
Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. Copyright © 2016 Elsevier Ltd. All rights reserved.
Multifocus image fusion using phase congruency
NASA Astrophysics Data System (ADS)
Zhan, Kun; Li, Qiaoqiao; Teng, Jicai; Wang, Mingying; Shi, Jinhui
2015-05-01
We address the problem of fusing multifocus images based on the phase congruency (PC). PC provides a sharpness feature of a natural image. The focus measure (FM) is identified as strong PC near a distinctive image feature evaluated by the complex Gabor wavelet. The PC is more robust against noise than other FMs. The fusion image is obtained by a new fusion rule (FR), and the focused region is selected by the FR from one of the input images. Experimental results show that the proposed fusion scheme achieves the fusion performance of the state-of-the-art methods in terms of visual quality and quantitative evaluations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Friedman, A.; Grote, D. P.; Vay, J. L.
2015-05-29
The Fusion Energy Sciences Advisory Committee’s subcommittee on non-fusion applications (FESAC NFA) is conducting a survey to obtain information from the fusion community about non-fusion work that has resulted from their DOE-funded fusion research. The subcommittee has requested that members of the community describe recent developments connected to the activities of the DOE Office of Fusion Energy Sciences. Two questions in particular were posed by the subcommittee. This document contains the authors’ responses to those questions.
Spherical torus fusion reactor
Peng, Yueng-Kay M.
1989-04-04
A fusion reactor is provided having a near spherical-shaped plasma with a modest central opening through which straight segments of toroidal field coils extend that carry electrical current for generating a toroidal magnet plasma confinement fields. By retaining only the indispensable components inboard of the plasma torus, principally the cooled toroidal field conductors and in some cases a vacuum containment vessel wall, the fusion reactor features an exceptionally small aspect ratio (typically about 1.5), a naturally elongated plasma cross section without extensive field shaping, requires low strength magnetic containment fields, small size and high beta. These features combine to produce a spherical torus plasma in a unique physics regime which permits compact fusion at low field and modest cost.
Spherical torus fusion reactor
Peng, Yueng-Kay M.
1989-01-01
A fusion reactor is provided having a near spherical-shaped plasma with a modest central opening through which straight segments of toroidal field coils extend that carry electrical current for generating a toroidal magnet plasma confinement fields. By retaining only the indispensable components inboard of the plasma torus, principally the cooled toroidal field conductors and in some cases a vacuum containment vessel wall, the fusion reactor features an exceptionally small aspect ratio (typically about 1.5), a naturally elongated plasma cross section without extensive field shaping, requires low strength magnetic containment fields, small size and high beta. These features combine to produce a spherical torus plasma in a unique physics regime which permits compact fusion at low field and modest cost.
Holland, Chris [UC San Diego, San Diego, California, United States
2017-12-09
The upcoming ITER experiment (www.iter.org) represents the next major milestone in realizing the promise of using nuclear fusion as a commercial energy source, by moving into the âburning plasmaâ regime where the dominant heat source is the internal fusion reactions. As part of its support for the ITER mission, the US fusion community is actively developing validated predictive models of the behavior of magnetically confined plasmas. In this talk, I will describe how the plasma community is using the latest high performance computing facilities to develop and refine our models of the nonlinear, multiscale plasma dynamics, and how recent advances in experimental diagnostics are allowing us to directly test and validate these models at an unprecedented level.
The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis
Kessler, Peter S.; Blank, Carrine; Leigh, John A.
1998-01-01
Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920
Statistical algorithms improve accuracy of gene fusion detection
Hsieh, Gillian; Bierman, Rob; Szabo, Linda; Lee, Alex Gia; Freeman, Donald E.; Watson, Nathaniel; Sweet-Cordero, E. Alejandro
2017-01-01
Abstract Gene fusions are known to play critical roles in tumor pathogenesis. Yet, sensitive and specific algorithms to detect gene fusions in cancer do not currently exist. In this paper, we present a new statistical algorithm, MACHETE (Mismatched Alignment CHimEra Tracking Engine), which achieves highly sensitive and specific detection of gene fusions from RNA-Seq data, including the highest Positive Predictive Value (PPV) compared to the current state-of-the-art, as assessed in simulated data. We show that the best performing published algorithms either find large numbers of fusions in negative control data or suffer from low sensitivity detecting known driving fusions in gold standard settings, such as EWSR1-FLI1. As proof of principle that MACHETE discovers novel gene fusions with high accuracy in vivo, we mined public data to discover and subsequently PCR validate novel gene fusions missed by other algorithms in the ovarian cancer cell line OVCAR3. These results highlight the gains in accuracy achieved by introducing statistical models into fusion detection, and pave the way for unbiased discovery of potentially driving and druggable gene fusions in primary tumors. PMID:28541529
Ratnayake, Punsisi U.; Ekanayaka, E. A. Prabodha; Komanduru, Sweta S.; Weliky, David P.
2015-01-01
Influenza virus is a Class I enveloped virus which is initially endocytosed into a host respiratory epithelial cell. Subsequent reduction of the pH to the 5–6 range triggers a structural change of the viral hemagglutinin II (HA2) protein, fusion of the viral and endosomal membranes, and release of the viral nucleocapsid into the cytoplasm. HA2 contains fusion peptide (FP), soluble ectodomain (SE), transmembrane (TM), and intraviral domains with respective lengths of ~25, ~160, ~25, and ~10 residues. The present work provides a straightforward protocol for producing and purifying mg quantities of full-length HA2 from expression in bacteria. Biophysical and structural comparisons are made between full-length HA2 and shorter constructs including SHA2 ≡ SE, FHA2 ≡ FP + SE, and SHA2-TM ≡ SE + TM constructs. The constructs are helical in detergent at pH 7.4 and the dominant trimer species. The proteins are highly thermostable in decylmaltoside detergent with Tm > 90 °C for HA2 with stabilization provided by the SE, FP, and TM domains. The proteins are likely in a trimer-of-hairpins structure, the final protein state during fusion. All constructs induce fusion of negatively-charged vesicles at pH 5.0 with much less fusion at pH 7.4. Attractive protein/vesicle electrostatics play a role in fusion, as the proteins are positively-charged at pH 5.0 and negatively-charged at pH 7.4 and the pH-dependence of fusion is reversed for positively-charged vesicles. Comparison of fusion between constructs supports significant contributions to fusion from the SE and the FP with little effect from the TM. PMID:26297995
Ratnayake, Punsisi U; Prabodha Ekanayaka, E A; Komanduru, Sweta S; Weliky, David P
2016-01-01
Influenza virus is a class I enveloped virus which is initially endocytosed into a host respiratory epithelial cell. Subsequent reduction of the pH to the 5-6 range triggers a structural change of the viral hemagglutinin II (HA2) protein, fusion of the viral and endosomal membranes, and release of the viral nucleocapsid into the cytoplasm. HA2 contains fusion peptide (FP), soluble ectodomain (SE), transmembrane (TM), and intraviral domains with respective lengths of ∼ 25, ∼ 160, ∼ 25, and ∼ 10 residues. The present work provides a straightforward protocol for producing and purifying mg quantities of full-length HA2 from expression in bacteria. Biophysical and structural comparisons are made between full-length HA2 and shorter constructs including SHA2 ≡ SE, FHA2 ≡ FP+SE, and SHA2-TM ≡ SE+TM constructs. The constructs are helical in detergent at pH 7.4 and the dominant trimer species. The proteins are highly thermostable in decylmaltoside detergent with Tm>90 °C for HA2 with stabilization provided by the SE, FP, and TM domains. The proteins are likely in a trimer-of-hairpins structure, the final protein state during fusion. All constructs induce fusion of negatively-charged vesicles at pH 5.0 with much less fusion at pH 7.4. Attractive protein/vesicle electrostatics play a role in fusion, as the proteins are positively-charged at pH 5.0 and negatively-charged at pH 7.4 and the pH-dependence of fusion is reversed for positively-charged vesicles. Comparison of fusion between constructs supports significant contributions to fusion from the SE and the FP with little effect from the TM. Copyright © 2015 Elsevier Inc. All rights reserved.
Tensor functors between Morita duals of fusion categories
NASA Astrophysics Data System (ADS)
Galindo, César; Plavnik, Julia Yael
2017-03-01
Given a fusion category C and an indecomposable C -module category M , the fusion category C^*_{_{M}} of C-module endofunctors of M is called the (Morita) dual fusion category of C with respect to M . We describe tensor functors between two arbitrary duals C^*_{_{M}} and D^*_N in terms of data associated to C and D . We apply the results to G-equivariantizations of fusion categories and group-theoretical fusion categories. We describe the orbits of the action of the Brauer-Picard group on the set of module categories and we propose a categorification of the Rosenberg-Zelinsky sequence for fusion categories.
EDITORIAL: Plasma Surface Interactions for Fusion
NASA Astrophysics Data System (ADS)
2006-05-01
Because plasma-boundary physics encompasses some of the most important unresolved issues for both the International Thermonuclear Experimental Reactor (ITER) project and future fusion power reactors, there is a strong interest in the fusion community for better understanding and characterization of plasma wall interactions. Chemical and physical sputtering cause the erosion of the limiters/divertor plates and vacuum vessel walls (made of C, Be and W, for example) and degrade fusion performance by diluting the fusion fuel and excessively cooling the core, while carbon redeposition could produce long-term in-vessel tritium retention, degrading the superior thermo-mechanical properties of the carbon materials. Mixed plasma-facing materials are proposed, requiring optimization for different power and particle flux characteristics. Knowledge of material properties as well as characteristics of the plasma material interaction are prerequisites for such optimizations. Computational power will soon reach hundreds of teraflops, so that theoretical and plasma science expertise can be matched with new experimental capabilities in order to mount a strong response to these challenges. To begin to address such questions, a Workshop on New Directions for Advanced Computer Simulations and Experiments in Fusion-Related Plasma Surface Interactions for Fusion (PSIF) was held at the Oak Ridge National Laboratory from 21 to 23 March, 2005. The purpose of the workshop was to bring together researchers in fusion related plasma wall interactions in order to address these topics and to identify the most needed and promising directions for study, to exchange opinions on the present depth of knowledge of surface properties for the main fusion-related materials, e.g., C, Be and W, especially for sputtering, reflection, and deuterium (tritium) retention properties. The goal was to suggest the most important next steps needed for such basic computational and experimental work to be facilitated
Revisions to the JDL data fusion model
NASA Astrophysics Data System (ADS)
Steinberg, Alan N.; Bowman, Christopher L.; White, Franklin E.
1999-03-01
The Data Fusion Model maintained by the Joint Directors of Laboratories (JDL) Data Fusion Group is the most widely-used method for categorizing data fusion-related functions. This paper discusses the current effort to revise the expand this model to facilitate the cost-effective development, acquisition, integration and operation of multi- sensor/multi-source systems. Data fusion involves combining information - in the broadest sense - to estimate or predict the state of some aspect of the universe. These may be represented in terms of attributive and relational states. If the job is to estimate the state of a people, it can be useful to include consideration of informational and perceptual states in addition to the physical state. Developing cost-effective multi-source information systems requires a method for specifying data fusion processing and control functions, interfaces, and associate databases. The lack of common engineering standards for data fusion systems has been a major impediment to integration and re-use of available technology: current developments do not lend themselves to objective evaluation, comparison or re-use. This paper reports on proposed revisions and expansions of the JDL Data FUsion model to remedy some of these deficiencies. This involves broadening the functional model and related taxonomy beyond the original military focus, and integrating the Data Fusion Tree Architecture model for system description, design and development.
Selwood, T; Sinnott, M L
1990-01-01
1. Michaelis-Menten parameters for the hydrolysis of 4-nitrophenyl beta-D-galactopyranoside and 3,4-dinitrophenyl beta-D-galactopyranoside Escherichia coli (lacZ) beta-galactosidase were measured as a function of pH or pD (pL) in both 1H2O and 2H2O. 2. For hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-free enzyme, V is pL-independent below pL 9, but the V/Km-pL profile is sigmoid, the pK values shifting from 7.6 +/- 0.1 in 1H2O to 8.2 +/- 0.1 in 2H2O, and solvent kinetic isotope effects are negligible, in accord with the proposal [Sinnott, Withers & Viratelle (1978) Biochem. J. 175, 539-546] that glycone-aglycone fission without acid catalysis governs both V and V/Km. 3. V for hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme varies sigmoidally with pL, the pK value shifting from 9.19 +/- 0.09 to 9.70 +/- 0.07; V/Km shows both a low-pL fall, probably due to competition between Mg2+ and protons [Tenu, Viratelle, Garnier & Yon (1971) Eur. J. Biochem. 20, 363-370], and a high-pL fall, governed by a pK that shifts from 8.33 +/- 0.08 to 8.83 +/- 0.08. There is a negligible solvent kinetic isotope effect on V/Km, but one of 1.7 on V, which a linear proton inventory shows to arise from one transferred proton. 4. The variation of V and V/Km with pL is sigmoid for hydrolysis of 3,4-dinitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme, with pK values showing small shifts, from 8.78 +/- 0.09 to 8.65 +/- 0.08 and from 8.7 +/- 0.1 to 8.9 +/- 0.1 respectively. There is no solvent isotope effect on V or V/Km for 3,4-dinitrophenyl beta-D-galactopyranoside, despite hydrolysis of the galactosyl-enzyme intermediate governing V. 5. Identification of the 'conformation change' in the hydrolysis of aryl galactosides proposed by Sinnott & Souchard [(1973) Biochem. J. 133, 89-98] with the protolysis of the magnesium phenoxide arising from the action of enzyme-bound Mg2+ as an electrophilic catalyst rationalizes these data and also resolves the
A New Approach to Image Fusion Based on Cokriging
NASA Technical Reports Server (NTRS)
Memarsadeghi, Nargess; LeMoigne, Jacqueline; Mount, David M.; Morisette, Jeffrey T.
2005-01-01
We consider the image fusion problem involving remotely sensed data. We introduce cokriging as a method to perform fusion. We investigate the advantages of fusing Hyperion with ALI. The evaluation is performed by comparing the classification of the fused data with that of input images and by calculating well-chosen quantitative fusion quality metrics. We consider the Invasive Species Forecasting System (ISFS) project as our fusion application. The fusion of ALI with Hyperion data is studies using PCA and wavelet-based fusion. We then propose utilizing a geostatistical based interpolation method called cokriging as a new approach for image fusion.
NASA Astrophysics Data System (ADS)
Tabak, M.
2016-10-01
There is a need to develop alternate energy sources in the coming century because fossil fuels will become depleted and their use may lead to global climate change. Inertial fusion can become such an energy source, but significant progress must be made before its promise is realized. The high-density approach to inertial fusion suggested by Nuckolls et al. leads reaction chambers compatible with civilian power production. Methods to achieve the good control of hydrodynamic stability and implosion symmetry required to achieve these high fuel densities will be discussed. Fast Ignition, a technique that achieves fusion ignition by igniting fusion fuel after it is assembled, will be described along with its gain curves. Fusion costs of energy for conventional hotspot ignition will be compared with those of Fast Ignition and their capital costs compared with advanced fission plants. Finally, techniques that may improve possible Fast Ignition gains by an order of magnitude and reduce driver scales by an order of magnitude below conventional ignition requirements are described.
Smith, T M; Jiang, Y F; Shipley, P; Floss, H G
1995-10-16
A common approach to identify and clone biosynthetic gene from an antibiotic-producing streptomycete is to clone the resistance gene for the antibiotic of interest and then use that gene to clone DNA that is linked to it. As a first step toward cloning the genes responsible for the biosynthesis of thiostrepton (Th) in Streptomyces laurentii (Sl), the Th resistance-encoding gene (tsnR) was cloned as a 1.5-kb BamHI-PvuII fragment in Escherichia coli (Ec), and shown to confer Th resistance when introduced into S. lividans TK24. The tsnR-containing DNA fragment was used as a probe to isolate clones from cosmid libraries of DNA in the Ec cosmid vector SuperCos, and pOJ446 (an Ec/streptomycete) cosmid vector. Sequence and genetic analysis of the DNA flanking the tsnR indicates that the Sl tsnR is not closely linked to biosynthetic genes. Instead it is located within a cluster of ribosomal protein operons.
Thomas, Kenneth C.; Jones, Eric D.; McBride, Marvin A.
1983-01-01
A process for the fusion welding of nickel alloy steel members wherein a ferrite containing pellet is inserted into a cavity in one member and melted by a welding torch. The resulting weld nugget, a fusion of the nickel containing alloy from the members to be welded and the pellet, has a composition which is sufficiently low in nickel content such that ferrite phases occur within the weld nugget, resulting in improved weld properties. The steel alloys encompassed also include alloys containing carbon and manganese, considered nickel equivalents.
Porotto, Matteo; DeVito, Ilaria; Palmer, Samantha G.; Jurgens, Eric M.; Yee, Jia L.; Yokoyama, Christine C.; Pessi, Antonello; Moscona, Anne
2011-01-01
During paramyxovirus entry into a host cell, receptor engagement by a specialized binding protein triggers conformational changes in the adjacent fusion protein (F), leading to fusion between the viral and cell membranes. According to the existing paradigm of paramyxovirus membrane fusion, the initial activation of F by the receptor binding protein sets off a spring-loaded mechanism whereby the F protein progresses independently through the subsequent steps in the fusion process, ending in membrane merger. For human parainfluenza virus type 3 (HPIV3), the receptor binding protein (hemagglutinin-neuraminidase [HN]) has three functions: receptor binding, receptor cleaving, and activating F. We report that continuous receptor engagement by HN activates F to advance through the series of structural rearrangements required for fusion. In contrast to the prevailing model, the role of HN-receptor engagement in the fusion process is required beyond an initiating step, i.e., it is still required even after the insertion of the fusion peptide into the target cell membrane, enabling F to mediate membrane merger. We also report that for Nipah virus, whose receptor binding protein has no receptor-cleaving activity, the continuous stimulation of the F protein by a receptor-engaged binding protein is key for fusion. We suggest a general model for paramyxovirus fusion activation in which receptor engagement plays an active role in F activation, and the continued engagement of the receptor binding protein is essential to F protein function until the onset of membrane merger. This model has broad implications for the mechanism of paramyxovirus fusion and for strategies to prevent viral entry. PMID:21976650
Porotto, Matteo; Devito, Ilaria; Palmer, Samantha G; Jurgens, Eric M; Yee, Jia L; Yokoyama, Christine C; Pessi, Antonello; Moscona, Anne
2011-12-01
During paramyxovirus entry into a host cell, receptor engagement by a specialized binding protein triggers conformational changes in the adjacent fusion protein (F), leading to fusion between the viral and cell membranes. According to the existing paradigm of paramyxovirus membrane fusion, the initial activation of F by the receptor binding protein sets off a spring-loaded mechanism whereby the F protein progresses independently through the subsequent steps in the fusion process, ending in membrane merger. For human parainfluenza virus type 3 (HPIV3), the receptor binding protein (hemagglutinin-neuraminidase [HN]) has three functions: receptor binding, receptor cleaving, and activating F. We report that continuous receptor engagement by HN activates F to advance through the series of structural rearrangements required for fusion. In contrast to the prevailing model, the role of HN-receptor engagement in the fusion process is required beyond an initiating step, i.e., it is still required even after the insertion of the fusion peptide into the target cell membrane, enabling F to mediate membrane merger. We also report that for Nipah virus, whose receptor binding protein has no receptor-cleaving activity, the continuous stimulation of the F protein by a receptor-engaged binding protein is key for fusion. We suggest a general model for paramyxovirus fusion activation in which receptor engagement plays an active role in F activation, and the continued engagement of the receptor binding protein is essential to F protein function until the onset of membrane merger. This model has broad implications for the mechanism of paramyxovirus fusion and for strategies to prevent viral entry.
Russell, Charles J.; Jardetzky, Theodore S.; Lamb, Robert A.
2004-01-01
Hydrophobic fusion peptides (FPs) are the most highly conserved regions of class I viral fusion-mediating glycoproteins (vFGPs). FPs often contain conserved glycine residues thought to be critical for forming structures that destabilize target membranes. Unexpectedly, a mutation of glycine residues in the FP of the fusion (F) protein from the paramyxovirus simian parainfluenza virus 5 (SV5) resulted in mutant F proteins with hyperactive fusion phenotypes (C. M. Horvath and R. A. Lamb, J. Virol. 66:2443-2455, 1992). Here, we constructed G3A and G7A mutations into the F proteins of SV5 (W3A and WR isolates), Newcastle disease virus (NDV), and human parainfluenza virus type 3 (HPIV3). All of the mutant F proteins, except NDV G7A, caused increased cell-cell fusion despite having slight to moderate reductions in cell surface expression compared to those of wild-type F proteins. The G3A and G7A mutations cause SV5 WR F, but not NDV F or HPIV3 F, to be triggered to cause fusion in the absence of coexpression of its homotypic receptor-binding protein hemagglutinin-neuraminidase (HN), suggesting that NDV and HPIV3 F have stricter requirements for homotypic HN for fusion activation. Dye transfer assays show that the G3A and G7A mutations decrease the energy required to activate F at a step in the fusion cascade preceding prehairpin intermediate formation and hemifusion. Conserved glycine residues in the FP of paramyxovirus F appear to have a primary role in regulating the activation of the metastable native form of F. Glycine residues in the FPs of other class I vFGPs may also regulate fusion activation. PMID:15564482
Feature level fusion of hand and face biometrics
NASA Astrophysics Data System (ADS)
Ross, Arun A.; Govindarajan, Rohin
2005-03-01
Multibiometric systems utilize the evidence presented by multiple biometric sources (e.g., face and fingerprint, multiple fingers of a user, multiple matchers, etc.) in order to determine or verify the identity of an individual. Information from multiple sources can be consolidated in several distinct levels, including the feature extraction level, match score level and decision level. While fusion at the match score and decision levels have been extensively studied in the literature, fusion at the feature level is a relatively understudied problem. In this paper we discuss fusion at the feature level in 3 different scenarios: (i) fusion of PCA and LDA coefficients of face; (ii) fusion of LDA coefficients corresponding to the R,G,B channels of a face image; (iii) fusion of face and hand modalities. Preliminary results are encouraging and help in highlighting the pros and cons of performing fusion at this level. The primary motivation of this work is to demonstrate the viability of such a fusion and to underscore the importance of pursuing further research in this direction.
ERIC Educational Resources Information Center
Dingee, David A.
1979-01-01
Discusses the extraordinary potential, the technical difficulties, and the financial problems that are associated with research and development of fusion power plants as a major source of energy. (GA)
Local electrostatic interactions determine the diameter of fusion pores
Guček, Alenka; Jorgačevski, Jernej; Górska, Urszula; Rituper, Boštjan; Kreft, Marko; Zorec, Robert
2015-01-01
In regulated exocytosis vesicular and plasma membranes merge to form a fusion pore in response to stimulation. The nonselective cation HCN channels are involved in the regulation of unitary exocytotic events by at least 2 mechanisms. They can affect SNARE-dependent exocytotic activity indirectly, via the modulation of free intracellular calcium; and/or directly, by altering local cation concentration, which affects fusion pore geometry likely via electrostatic interactions. By monitoring membrane capacitance, we investigated how extracellular cation concentration affects fusion pore diameter in pituitary cells and astrocytes. At low extracellular divalent cation levels predominantly transient fusion events with widely open fusion pores were detected. However, fusion events with predominately narrow fusion pores were present at elevated levels of extracellular trivalent cations. These results show that electrostatic interactions likely help determine the stability of discrete fusion pore states by affecting fusion pore membrane composition. PMID:25835258
pH-Sensitive Liposomes: Acid-Induced Liposome Fusion
NASA Astrophysics Data System (ADS)
Connor, Jerome; Yatvin, Milton B.; Huang, Leaf
1984-03-01
Sonicated unilamellar liposomes containing phosphatidylethanolamine and palmitoylhomocysteine fuse rapidly when the medium pH is lowered from 7 to 5. Liposome fusion was demonstrated by (i) mixing of the liposomal lipids as shown by resonance energy transfer, (ii) gel filtration, and (iii) electron microscopy. The pH-sensitive fusion of liposomes was observed only when palmitoylhomocysteine (>= 20 mol%) was present in the liposomes. The presence of phosphatidyl-ethanolamine in the liposomes greatly enhanced fusion whereas the presence of phosphatidylcholine inhibited fusion. During fusion of liposomes containing phosphatidylethanolamine and palmitoylhomocysteine (8:2, mol/mol), almost all of the encapsulated calcein was released. Inclusion of cholesterol (40 mol%) in the liposomes substantially decreased leakage without impairing fusion.
Possible application of electromagnetic guns to impact fusion
NASA Astrophysics Data System (ADS)
Kostoff, R. N.; Peaslee, A. T., Jr.; Ribe, F. L.
1982-01-01
The possible application of electromagnetic guns to impact fusion for the generation of electric power is discussed, and advantages of impact fusion over the more conventional inertial confinement fusion concepts are examined. It is shown that impact fusion can achieve the necessary high yields, of the order of a few gigajoules, which are difficult to achieve with lasers except at unrealistically high target gains. The rail gun accelerator is well adapted to the delivery of some 10-100 megajoules of energy to the fusion target, and the electrical technology involved is relatively simple: inductive storage or rotating machinery and capacitors. It is concluded that the rail gun has the potential of developing into an impact fusion macroparticle accelerator.
History of Nuclear Fusion Research in Japan
NASA Astrophysics Data System (ADS)
Iguchi, Harukazu; Matsuoka, Keisuke; Kimura, Kazue; Namba, Chusei; Matsuda, Shinzaburo
In the late 1950s just after the atomic energy research was opened worldwide, there was a lively discussion among scientists on the strategy of nuclear fusion research in Japan. Finally, decision was made that fusion research should be started from the basic, namely, research on plasma physics and from cultivation of human resources at universities under the Ministry of Education, Science and Culture (MOE). However, an endorsement was given that construction of an experimental device for fusion research would be approved sooner or later. Studies on toroidal plasma confinement started at Japan Atomic Energy Research Institute (JAERI) under the Science and Technology Agency (STA) in the mid-1960s. Dualistic fusion research framework in Japan was established. This structure has lasted until now. Fusion research activities over the last 50 years are described by the use of a flowchart, which is convenient to glance the historical development of fusion research in Japan.
Neutron diffraction studies of viral fusion peptides
NASA Astrophysics Data System (ADS)
Bradshaw, Jeremy P.; J. M. Darkes, Malcolm; Katsaras, John; Epand, Richard M.
2000-03-01
Membrane fusion plays a vital role in a large and diverse number of essential biological processes. Despite this fact, the precise molecular events that occur during fusion are still not known. We are currently engaged on a study of membrane fusion as mediated by viral fusion peptides. These peptides are the N-terminal regions of certain viral envelope proteins that mediate the process of fusion between the viral envelope and the membranes of the host cell during the infection process. As part of this study, we have carried out neutron diffraction measurements at the ILL, BeNSC and Chalk River, on a range of viral fusion peptides. The peptides, from simian immunodeficiency virus (SIV), influenza A and feline leukaemia virus (FeLV), were incorporated into stacked phospholipid bilayers. Some of the peptides had been specifically deuterated at key amino acids. Lamellar diffraction data were collected and analysed to yield information on the peptide conformation, location and orientation relative to the bilayer.
Heavy ion fusion reactions in stars
NASA Astrophysics Data System (ADS)
Tang, X. D.
2018-04-01
Heavy ion fusion reactions play important roles in a wide variety of stellar burning scenarios. 12C+12C, 12C+16O and 16O+16O are the principle reactions during the advance burning stages of massive star. 12C+12C also triggers the happening of superburst and Type Ia supernovae. The heavy ion fusion reactions of the neutron-rich isotopes such as 24O are the major heating source in the crust of neutron star. In this talk, I will review the challenges and the recent progress in the study of these heavy ion fusion reactions at stellar energies. The outlook for the studies of the astrophysical heavy-ion fusion reactions will also be presented.
Smith, Chris Llewellyn; Cowley, Steve
2010-01-01
The promise, status and challenges of developing fusion power are outlined. The key physics and engineering principles are described and recent progress quantified. As the successful demonstration of 16 MW of fusion in 1997 in the Joint European Torus showed, fusion works. The central issue is therefore to make it work reliably and economically on the scale of a power station. We argue that to meet this challenge in 30 years we must follow the aggressive programme known as the ‘Fast Track to Fusion’. This programme is described in some detail. PMID:20123748
Direct current stimulation of titanium interbody fusion devices in primates.
Cook, Stephen D; Patron, Laura P; Christakis, Petros M; Bailey, Kirk J; Banta, Charles; Glazer, Paul A
2004-01-01
The fusion rate for anterior lumbar interbody fusion (ALIF) varies widely with the use of different interbody devices and bone graft options. Adjunctive techniques such as electrical stimulation may improve the rate of bony fusion. To determine if direct current (DC) electrical stimulation of a metallic interbody fusion device enhanced the incidence or extent of anterior bony fusion. ALIF was performed using titanium alloy interbody fusion devices with and without adjunctive DC electrical stimulation in nonhuman primates. ALIF was performed through an anterolateral approach in 35 macaques with autogenous bone graft and either a titanium alloy (Ti-6Al-4V) fusion device or femoral allograft ring. The fusion devices of 19 animals received high (current density 19.6 microA/cm2) or low (current density 5.4 microA/cm2) DC electrical stimulation using an implanted generator for a 12- or 26-week evaluation period. Fusion sites were studied using serial radiographs, computed tomography imaging, nondestructive mechanical testing and qualitative and semiquantitative histology. Fusion was achieved with the titanium fusion device and autogenous bone graft. At 12 weeks, the graft was consolidating and early to moderate bridging callus was observed in and around the device. By 26 weeks, the anterior callus formation was more advanced with increased evidence of bridging trabeculations and early bone remodeling. The callus formation was not as advanced or abundant for the allograft ring group. Histology revealed the spinal fusion device had an 86% incidence of bony fusion at 26 weeks compared with a 50% fusion rate for the allograft rings. DC electrical stimulation of the fusion device had a positive effect on anterior interbody fusion by increasing both the presence and extent of bony fusion in a current density-dependent manner. Adjunctive DC electrical stimulation of the fusion device improved the rate and extent of bony fusion compared with a nonstimulated device. The fusion
Kube, Richard A.; Muir, Jeffrey M.
2016-01-01
Background: Recalcitrant sacroiliac joint pain responds well to minimally-invasive surgical (MIS) techniques, although long-term radiographic and fusion data are limited. Objective: To evaluate the one-year clinical results from a cohort of patients with chronic sacroiliac (SI) joint pain unresponsive to conservative therapies who have undergone minimally invasive SI joint fusion. Methods: SI joint fusion was performed between May 2011 and January 2014. Outcomes included radiographic assessment of fusion status, leg and back pain severity via visual analog scale (VAS), disability via Oswestry Disability Index (ODI) and complication rate. Outcomes were measured at baseline and at follow-up appointments 6 months and 12 months post-procedure. Results: Twenty minimally invasive SI joint fusion procedures were performed on 18 patients (mean age: 47.2 (14.2), mean BMI: 29.4 (5.3), 56% female). At 12 months, the overall fusion rate was 88%. Back and leg pain improved from 81.7 to 44.1 points (p<0.001) and from 63.6 to 27.7 points (p=0.001), respectively. Disability scores improved from 61.0 to 40.5 (p=0.009). Despite a cohort containing patients with multiple comorbidities and work-related injuries, eight patients (50%) achieved the minimal clinically important difference (MCID) in back pain at 12 months, with 9 (69%) patients realizing this improvement in leg pain and 8 (57%) realizing the MCID in ODI scores at 12 months. No major complications were reported. Conclusion: Minimally invasive SI joint surgery is a safe and effective procedure, with a high fusion rate, a satisfactory safety profile and significant improvements in pain severity and disability reported through 12 months post-procedure. PMID:28144378
Kube, Richard A; Muir, Jeffrey M
2016-01-01
Recalcitrant sacroiliac joint pain responds well to minimally-invasive surgical (MIS) techniques, although long-term radiographic and fusion data are limited. To evaluate the one-year clinical results from a cohort of patients with chronic sacroiliac (SI) joint pain unresponsive to conservative therapies who have undergone minimally invasive SI joint fusion. SI joint fusion was performed between May 2011 and January 2014. Outcomes included radiographic assessment of fusion status, leg and back pain severity via visual analog scale (VAS), disability via Oswestry Disability Index (ODI) and complication rate. Outcomes were measured at baseline and at follow-up appointments 6 months and 12 months post-procedure. Twenty minimally invasive SI joint fusion procedures were performed on 18 patients (mean age: 47.2 (14.2), mean BMI: 29.4 (5.3), 56% female). At 12 months, the overall fusion rate was 88%. Back and leg pain improved from 81.7 to 44.1 points (p<0.001) and from 63.6 to 27.7 points (p=0.001), respectively. Disability scores improved from 61.0 to 40.5 (p=0.009). Despite a cohort containing patients with multiple comorbidities and work-related injuries, eight patients (50%) achieved the minimal clinically important difference (MCID) in back pain at 12 months, with 9 (69%) patients realizing this improvement in leg pain and 8 (57%) realizing the MCID in ODI scores at 12 months. No major complications were reported. Minimally invasive SI joint surgery is a safe and effective procedure, with a high fusion rate, a satisfactory safety profile and significant improvements in pain severity and disability reported through 12 months post-procedure.
A small molecule fusion inhibitor of dengue virus.
Poh, Mee Kian; Yip, Andy; Zhang, Summer; Priestle, John P; Ma, Ngai Ling; Smit, Jolanda M; Wilschut, Jan; Shi, Pei-Yong; Wenk, Markus R; Schul, Wouter
2009-12-01
The dengue virus envelope protein plays an essential role in viral entry by mediating fusion between the viral and host membranes. The crystal structure of the envelope protein shows a pocket (located at a "hinge" between Domains I and II) that can be occupied by ligand n-octyl-beta-D-glucoside (betaOG). Compounds blocking the betaOG pocket are thought to interfere with conformational changes in the envelope protein that are essential for fusion. Two fusion assays were developed to examine the anti-fusion activities of compounds. The first assay measures the cellular internalization of propidium iodide upon membrane fusion. The second assay measures the protease activity of trypsin upon fusion between dengue virions and trypsin-containing liposomes. We performed an in silico virtual screening for small molecules that can potentially bind to the betaOG pocket and tested these candidate molecules in the two fusion assays. We identified one compound that inhibits dengue fusion in both assays with an IC(50) of 6.8 microM and reduces viral titers with an EC(50) of 9.8 microM. Time-of-addition experiments showed that the compound was only active when present during viral infection but not when added 1h later, in agreement with a mechanism of action through fusion inhibition.