Devices that can identify positive vs. negative charge

NASA Astrophysics Data System (ADS)

Lincoln, James

2017-10-01

When your clothes come out of the dryer, covered with static, do you know whether they are positively or negatively charged? In this article, I discuss a variety of devices that can determine sign of the charge on an insulator or conductor. Purposefully, none of these methods utilize comparison with a known charge. Some of these ideas have been previously published, and I am extending them, but many are original. These demonstrations provide students and teachers with an opportunity to contrast the actual flow of charge with conventional current and to compare the behavior of positive and negative charges with what we expect from protons and electrons.

Using quantum dynamics simulations to follow the competition between charge migration and charge transfer in polyatomic molecules

NASA Astrophysics Data System (ADS)

Spinlove, K. E.; Vacher, M.; Bearpark, M.; Robb, M. A.; Worth, G. A.

2017-01-01

Recent work, particularly by Cederbaum and co-workers, has identified the phenomenon of charge migration, whereby charge flow occurs over a static molecular framework after the creation of an electronic wavepacket. In a real molecule, this charge migration competes with charge transfer, whereby the nuclear motion also results in the re-distribution of charge. To study this competition, quantum dynamics simulations need to be performed. To break the exponential scaling of standard grid-based algorithms, approximate methods need to be developed that are efficient yet able to follow the coupled electronic-nuclear motion of these systems. Using a simple model Hamiltonian based on the ionisation of the allene molecule, the performance of different methods based on Gaussian Wavepackets is demonstrated.

Penetration and release studies of positively and negatively charged nanoemulsions--is there a benefit of the positive charge?

PubMed

Baspinar, Yücel; Borchert, Hans-Hubert

2012-07-01

The surface of all tissues, including the stratum corneum, carries a negative charge. Following that fact it is assumed that a positively charged topical formulation could lead to an enhanced penetration because of an increased interaction with the negative charge of the membrane. The intention of this study is to prove an enhanced penetration of a positively charged nanoemulsion compared to a negatively charged nanoemulsion, both containing prednicarbate. The release and penetration of these nanoemulsions, produced with the high pressure homogenization method, were investigated. Regarding these results reveals that the release of the negatively charged formulation is higher compared to the positively charged nanoemulsion, while the penetration of the positively charged nanoemulsion is enhanced compared to the negatively charged formulation. The results of the investigated positively charged nanoemulsion containing prednicarbate show that its topical use could be advantageous for the therapy of atopic dermatitis, especially regarding phytosphingosine, which was responsible for the positive charge. Copyright © 2012 Elsevier B.V. All rights reserved.

Optimization of microelectrophoresis to select highly negatively charged sperm.

PubMed

Simon, Luke; Murphy, Kristin; Aston, Kenneth I; Emery, Benjamin R; Hotaling, James M; Carrell, Douglas T

2016-06-01

The sperm membrane undergoes extensive surface remodeling as it matures in the epididymis. During this process, the sperm is encapsulated in an extensive glycocalyx layer, which provides the membrane with its characteristic negative electrostatic charge. In this study, we develop a method of microelectrophoresis and standardize the protocol to isolate sperm with high negative membrane charge. Under an electric field, the percentage of positively charged sperm (PCS), negatively charged sperm (NCS), and neutrally charged sperm was determined for each ejaculate prior to and following density gradient centrifugation (DGC), and evaluated for sperm DNA damage, and histone retention. Subsequently, PCS, NCS, and neutrally charged sperm were selected using an ICSI needle and directly analyzed for DNA damage. When raw semen was analyzed using microelectrophoresis, 94 % were NCS. In contrast, DGC completely or partially stripped the negative membrane charge from sperm resulting PCS and neutrally charged sperm, while the charged sperm populations are increased with an increase in electrophoretic current. Following DGC, high sperm DNA damage and abnormal histone retention were inversely correlated with percentage NCS and directly correlated with percentage PCS. NCS exhibited significantly lower DNA damage when compared with control (P < 0.05) and PCS (P < 0.05). When the charged sperm population was corrected for neutrally charged sperm, sperm DNA damage was strongly associated with NCS at a lower electrophoretic current. The results suggest that selection of NCS at lower current may be an important biomarker to select healthy sperm for assisted reproductive treatment.

Self-Optimized Biological Channels in Facilitating the Transmembrane Movement of Charged Molecules

PubMed Central

Huyen, V. T. N.; Lap, Vu Cong; Nguyen, V. Lien

2016-01-01

We consider an anisotropically two-dimensional diffusion of a charged molecule (particle) through a large biological channel under an external voltage. The channel is modeled as a cylinder of three structure parameters: radius, length, and surface density of negative charges located at the channel interior-lining. These charges induce inside the channel a potential that plays a key role in controlling the particle current through the channel. It was shown that to facilitate the transmembrane particle movement the channel should be reasonably self-optimized so that its potential coincides with the resonant one, resulting in a large particle current across the channel. Observed facilitation appears to be an intrinsic property of biological channels, regardless of the external voltage or the particle concentration gradient. This facilitation is very selective in the sense that a channel of definite structure parameters can facilitate the transmembrane movement of only particles of proper valence at corresponding temperatures. Calculations also show that the modeled channel is nonohmic with the ion conductance which exhibits a resonance at the same channel potential as that identified in the current. PMID:27022394

Adsorption of a cationic dye molecule on polystyrene microspheres in colloids: effect of surface charge and composition probed by second harmonic generation.

PubMed

Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung

2005-03-17

Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH < or = 5, on polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.

Modeling the Partial Atomic Charges in Inorganometallic Molecules and Solids and Charge Redistribution in Lithium-Ion Cathodes

DOE PAGES

Wang, Bo; Li, Shaohong L.; Truhlar, Donald G.

2014-10-30

Partial atomic charges are widely used for the description of charge distributions of molecules and solids. These charges are useful to indicate the extent of charge transfer and charge flow during chemical reactions in batteries, fuel cells, and catalysts and to characterize charge distributions in capacitors, liquid-phase electrolytes, and solids and at electrochemical interfaces. However, partial atomic charges given by various charge models differ significantly, especially for systems containing metal atoms. In the present study, we have compared various charge models on both molecular systems and extended systems, including Hirshfeld, CM5, MK, ChElPG, Mulliken, MBS, NPA, DDEC, LoProp, and Badermore » charges. Their merits and drawbacks are compared. The CM5 charge model is found to perform well on the molecular systems, with a mean unsigned percentage deviation of only 9% for the dipole moments. We therefore formulated it for extended systems and applied it to study charge flow during the delithiation process in lithium-containing oxides used as cathodes. Our calculations show that the charges given by the CM5 charge model are reasonable and that during the delithiation process, the charge flow can occur not only on the transition metal but also on the anions. The oxygen atoms can lose a significant density of electrons, especially for deeply delithiated materials. We also discuss other methods in current use to analyze the charge transfer and charge flow in batteries, in particular the use of formal charge, spin density, and orbital occupancy. Here, we conclude that CM5 charges provide useful information in describing charge distributions in various materials and are very promising for the study of charge transfer and charge flows in both molecules and solids.« less

Modeling the Partial Atomic Charges in Inorganometallic Molecules and Solids and Charge Redistribution in Lithium-Ion Cathodes.

PubMed

Wang, Bo; Li, Shaohong L; Truhlar, Donald G

2014-12-09

Partial atomic charges are widely used for the description of charge distributions of molecules and solids. These charges are useful to indicate the extent of charge transfer and charge flow during chemical reactions in batteries, fuel cells, and catalysts and to characterize charge distributions in capacitors, liquid-phase electrolytes, and solids and at electrochemical interfaces. However, partial atomic charges given by various charge models differ significantly, especially for systems containing metal atoms. In the present study, we have compared various charge models on both molecular systems and extended systems, including Hirshfeld, CM5, MK, ChElPG, Mulliken, MBS, NPA, DDEC, LoProp, and Bader charges. Their merits and drawbacks are compared. The CM5 charge model is found to perform well on the molecular systems, with a mean unsigned percentage deviation of only 9% for the dipole moments. We therefore formulated it for extended systems and applied it to study charge flow during the delithiation process in lithium-containing oxides used as cathodes. Our calculations show that the charges given by the CM5 charge model are reasonable and that during the delithiation process, the charge flow can occur not only on the transition metal but also on the anions. The oxygen atoms can lose a significant density of electrons, especially for deeply delithiated materials. We also discuss other methods in current use to analyze the charge transfer and charge flow in batteries, in particular the use of formal charge, spin density, and orbital occupancy. We conclude that CM5 charges provide useful information in describing charge distributions in various materials and are very promising for the study of charge transfer and charge flows in both molecules and solids.

Luminescent systems based on the isolation of conjugated PI systems and edge charge compensation with polar molecules on a charged nanostructured surface

DOEpatents

Ivanov, Ilia N.; Puretzky, Alexander A.; Zhao, Bin; Geohegan, David B.; Styers-Barnett, David J.; Hu, Hui

2014-07-15

A photoluminescent or electroluminescent system and method of making a non-luminescent nanostructured material into such a luminescent system is presented. The method of preparing the luminescent system, generally, comprises the steps of modifying the surface of a nanostructured material to create isolated regions to act as luminescent centers and to create a charge imbalance on the surface; applying more than one polar molecule to the charged surface of the nanostructured material; and orienting the polar molecules to compensate for the charge imbalance on the surface of the nanostructured material. The compensation of the surface charge imbalance by the polar molecules allows the isolated regions to exhibit luminescence.

Photoinduced charge transfer from vacuum-deposited molecules to single-layer transition metal dichalcogenides

NASA Astrophysics Data System (ADS)

Osada, Kazuki; Tanaka, Masatoshi; Ohno, Shinya; Suzuki, Takanori

2016-06-01

Variations of photoluminescence (PL) and Raman spectra of single-layer MoS2, MoSe2, WS2, and WSe2 due to the vacuum deposition of C60 or copper phthalocyanine (CuPc) molecules have been investigated. PL spectra are decomposed into two competitive components, an exciton and a charged exciton (trion), depending on carrier density. The variation of PL spectra is interpreted in terms of charge transfer across the interfaces between transition metal dichalcogenides (TMDs) and dopant molecules. We find that deposited C60 molecules inject photoexcited electrons into MoS2, MoSe2, and WS2 or holes into WSe2. CuPc molecules also inject electrons into MoS2, MoSe2, and WS2, while holes are depleted from WSe2 to CuPc. We then propose a band alignment between TMDs and dopant molecules. Peak shifts of Raman spectra and doped carrier density estimated using a three-level model also support the band alignment. We thus demonstrate photoinduced charge transfer from dopant molecules to single-layer TMDs.

Electrostatic Power Generation from Negatively Charged, Simulated Lunar Regolith

NASA Technical Reports Server (NTRS)

Choi, Sang H.; King, Glen C.; Kim, Hyun-Jung; Park, Yeonjoon

2010-01-01

Research was conducted to develop an electrostatic power generator for future lunar missions that facilitate the utilization of lunar resources. The lunar surface is known to be negatively charged from the constant bombardment of electrons and protons from the solar wind. The resulting negative electrostatic charge on the dust particles, in the lunar vacuum, causes them to repel each other minimizing the potential. The result is a layer of suspended dust about one meter above the lunar surface. This phenomenon was observed by both Clementine and Surveyor spacecrafts. During the Apollo 17 lunar landing, the charged dust was a major hindrance, as it was attracted to the astronauts' spacesuits, equipment, and the lunar buggies. The dust accumulated on the spacesuits caused reduced visibility for the astronauts, and was unavoidably transported inside the spacecraft where it caused breathing irritation [1]. In the lunar vacuum, the maximum charge on the particles can be extremely high. An article in the journal "Nature", titled "Moon too static for astronauts?" (Feb 2, 2007) estimates that the lunar surface is charged with up to several thousand volts [2]. The electrostatic power generator was devised to alleviate the hazardous effects of negatively charged lunar soil by neutralizing the charged particles through capacitive coupling and thereby simultaneously harnessing power through electric charging [3]. The amount of power generated or collected is dependent on the areal coverage of the device and hovering speed over the lunar soil surface. A thin-film array of capacitors can be continuously charged and sequentially discharged using a time-differentiated trigger discharge process to produce a pulse train of discharge for DC mode output. By controlling the pulse interval, the DC mode power can be modulated for powering devices and equipment. In conjunction with a power storage system, the electrostatic power generator can be a power source for a lunar rover or other

Ambipolar nature of dimethyl benzo difuran (DMBDF) molecule: A charge transport study

NASA Astrophysics Data System (ADS)

Sahoo, Smruti Ranjan; Sahu, Sridhar

2017-05-01

We describe a theoretical study of the charge transport properties of the organic dimethyl benzo difuran (DMBDF) molecule based on density functional theory (DFT). Reorganization energy, ionization potential (IP), electron affinity (EA), energy gaps, transfer integral (t) and charge mobility (μ) has been studied to depict the transport properties in the conjugated organic molecules. We computed, large homo transfer integral and IP value leading to high hole mobility (4.46 cm2/V sec). However, the electron reorganization energy (0.34 eV) and the electron mobility of 1.62 cm2/V sec, infers that the DMBDF organic molecule bears an ambipolar character.

Electrostatic plasma lens for focusing negatively charged particle beams.

PubMed

Goncharov, A A; Dobrovolskiy, A M; Dunets, S M; Litovko, I V; Gushenets, V I; Oks, E M

2012-02-01

We describe the current status of ongoing research and development of the electrostatic plasma lens for focusing and manipulating intense negatively charged particle beams, electrons, and negative ions. The physical principle of this kind of plasma lens is based on magnetic isolation electrons providing creation of a dynamical positive space charge cloud in shortly restricted volume propagating beam. Here, the new results of experimental investigations and computer simulations of wide-aperture, intense electron beam focusing by plasma lens with positive space charge cloud produced due to the cylindrical anode layer accelerator creating a positive ion stream towards an axis system is presented.

Specific formation of negative ions from leucine and isoleucine molecules

NASA Astrophysics Data System (ADS)

Papp, Peter; Shchukin, Pavel; Matejčík, Štefan

2010-01-01

Dissociative electron attachment (DEA) to gas phase leucine (Leu) and isoleucine (Ile) molecules was studied using experimental and quantum-chemical methods. The relative partial cross sections for DEA have been measured using crossed electron/molecular beams technique. Supporting ab initio calculations of the structure, energies of neutral molecules, fragments, and negative ions have been carried out at G3MP2 and B3LYP levels in order to interpret the experimental data. Leu and Ile exhibit several common features. The negative ionic fragments from both molecules are formed in the electron energy range from 0 to approximately 14 eV via three resonances (1.2, 5.5, and 8 eV). The relative partial cross sections for DEA Leu and Ile are very similar. The dominant negative ions formed were closed shell negative ions (M-H)- (m/z=130) formed preferentially via low electron energy resonance of 1.23 eV. Additional negative ions with m/z=115, 114, 113, 112, 84, 82, 74, 45, 26, and 17 have been detected.

AtomicChargeCalculator: interactive web-based calculation of atomic charges in large biomolecular complexes and drug-like molecules.

PubMed

Ionescu, Crina-Maria; Sehnal, David; Falginella, Francesco L; Pant, Purbaj; Pravda, Lukáš; Bouchal, Tomáš; Svobodová Vařeková, Radka; Geidl, Stanislav; Koča, Jaroslav

2015-01-01

Partial atomic charges are a well-established concept, useful in understanding and modeling the chemical behavior of molecules, from simple compounds, to large biomolecular complexes with many reactive sites. This paper introduces AtomicChargeCalculator (ACC), a web-based application for the calculation and analysis of atomic charges which respond to changes in molecular conformation and chemical environment. ACC relies on an empirical method to rapidly compute atomic charges with accuracy comparable to quantum mechanical approaches. Due to its efficient implementation, ACC can handle any type of molecular system, regardless of size and chemical complexity, from drug-like molecules to biomacromolecular complexes with hundreds of thousands of atoms. ACC writes out atomic charges into common molecular structure files, and offers interactive facilities for statistical analysis and comparison of the results, in both tabular and graphical form. Due to high customizability and speed, easy streamlining and the unified platform for calculation and analysis, ACC caters to all fields of life sciences, from drug design to nanocarriers. ACC is freely available via the Internet at http://ncbr.muni.cz/ACC.

Immediate estimation of correlation energy for molecular systems from the partial charges on atoms in the molecule

NASA Astrophysics Data System (ADS)

Kristyán, Sándor

1997-11-01

In the author's previous work (Chem. Phys. Lett. 247 (1995) 101 and Chem. Phys. Lett. 256 (1996) 229) a simple quasi-linear relationship was introduced between the number of electrons, N, participating in any molecular system and the correlation energy: -0.035 ( N - 1) > Ecorr[hartree] > - 0.045( N -1). This relationship was developed to estimate more accurately correlation energy immediately in ab initio calculations by using the partial charges of atoms in the molecule, easily obtained after Hartree-Fock self-consistent field (HF-SCF) calculations. The method is compared to the well-known B3LYP, MP2, CCSD and G2M methods. Correlation energy estimations for negatively (-1) charged atomic ions are also reported.

Charge mobility retrieval approach from apparent charge packet movements based on the negative differential resistance theory.

PubMed

Meng, Jia; Zhang, Yewen; Holé, Stéphane; Zheng, Feihu; An, Zhenlian

2018-04-12

Space charge migration characteristics play an important role in the evaluation of polymer insulation performance. However, an accurate description of charge carrier mobility in several typical insulating polymers such as polyethylene, polypropylene is currently not available. Recently, with the observation of a series of negative charge packet movements associated with the negative differential resistance characteristic of charge mobility in LDPE films, the extraction of charge mobility from the apparent charge packet movement has been attempted using appropriate methods. Based on the previous report of the successful derivation of charge mobility from experimental results using numerical methods, the present research improves the derivation accuracy and describes the details of the charge mobility derivation procedure. Back simulation results under several typical polarizing fields using the derived charge mobility are exhibited. The results indicate that both the NDR theory and the simulation models for the polyethylene materials are reasonable. A significant migration velocity difference between the charge carrier and the charge packet is observed. Back simulations of the charge packet under several typical polarizing fields using the obtained E-v curve show good agreement with the experimental results. The charge packet shapes during the migrations were also found to vary with the polarizing field.

Geoengineering with Charged Droplets

NASA Astrophysics Data System (ADS)

Gokturk, H.

2011-12-01

Water molecules in a droplet are held together by intermolecular forces generated by hydrogen bonding which has a bonding energy of only about 0.2 eV. One can create a more rugged droplet by using an ion as a condensation nucleus. In that case, water molecules are held together by the interaction between the ion and the dipole moments of the water molecules surrounding the ion, in addition to any hydrogen bonding. In this research, properties of such charged droplets were investigated using first principle quantum mechanical calculations. A molecule which exhibits positive electron affinity is a good candidate to serve as the ionic condensation nucleus, because addition of an electron to such a molecule creates an energetically more stable state than the neutral molecule. A good example is the oxygen molecule (O2) where energy of O2 negative (O2-) ion is lower than that of the neutral O2 by about 0.5 eV. Examples of other molecules which have positive electron affinity include ozone (O3), nitrogen dioxide (NO2) and sulfur oxides (SOx, x=1-3). Atomic models used in the calculations consisted of a negative ion of one of the molecules mentioned above surrounded by water molecules. Calculations were performed using the DFT method with B3LYP hybrid functional and Pople type basis sets with polarization and diffuse functions. Energy of interaction between O2- ion and the water molecule was found to be ~0.7 eV. This energy is an order of magnitude greater than the thermal energy of even the highest temperatures encountered in the atmosphere. Once created, charged rugged droplets can survive in hot and dry climates where they can be utilized to create humidity and precipitation. The ion which serves as the nucleus of the droplet can attract not only water molecules but also other dipolar gases in the atmosphere. Such dipolar gases include industrial pollutants, for example nitrogen dioxide (NO2) or sulfur dioxide (SO2). Energy of interaction between O2- ion and pollutant

Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

NASA Astrophysics Data System (ADS)

Teyssedre, G.; Vu, T. T. N.; Laurent, C.

2015-12-01

Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30-60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10-14-10-13 m2 V-1 s-1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

An analysis of five negative sprite-parent discharges and their associated thunderstorm charge structures

NASA Astrophysics Data System (ADS)

Boggs, Levi D.; Liu, Ningyu; Splitt, Michael; Lazarus, Steven; Glenn, Chad; Rassoul, Hamid; Cummer, Steven A.

2016-01-01

In this study we analyze the discharge morphologies of five confirmed negative sprite-parent discharges and the associated charge structures of the thunderstorms that produced them. The negative sprite-parent lightning took place in two thunderstorms that were associated with a tropical disturbance in east central and south Florida. The first thunderstorm, which moved onshore in east central Florida, produced four of the five negative sprite-parent discharges within a period of 17 min, as it made landfall from the Atlantic Ocean. These negative sprite-parents were composed of bolt-from-the-blue (BFB), hybrid intracloud-negative cloud-to-ground (IC-NCG), and multicell IC-NCGs discharges. The second thunderstorm, which occurred inland over south Florida, produced a negative sprite-parent that was a probable hybrid IC-NCG discharge and two negative gigantic jets (GJs). Weakened upper positive charge with very large midlevel negative charge was inferred for both convective cells that initiated the negative-sprite-parent discharges. Our study suggests tall, intense convective systems with high wind shear at the middle to upper regions of the cloud accompanied by low cloud-to-ground (CG) flash rates promote these charge structures. The excess amount of midlevel negative charge results in these CG discharges transferring much more charge to ground than typical negative CG discharges. We find that BFB discharges prefer an asymmetrical charge structure that brings the negative leader exiting the upper positive charge region closer to the lateral positive screening charge layer. This may be the main factor in determining whether a negative leader exiting the upper positive region of the thundercloud forms a BFB or GJ.

Bactericidal action mechanism of negatively charged food grade clove oil nanoemulsions.

PubMed

Majeed, Hamid; Liu, Fei; Hategekimana, Joseph; Sharif, Hafiz Rizwan; Qi, Jing; Ali, Barkat; Bian, Yuan-Yuan; Ma, Jianguo; Yokoyama, Wallace; Zhong, Fang

2016-04-15

Clove oil (CO) anionic nanoemulsions were prepared with varying ratios of CO to canola oil (CA), emulsified and stabilized with purity gum ultra (PGU), a newly developed succinylated waxy maize starch. Interfacial tension measurements showed that CO acted as a co-surfactant and there was a gradual decrease in interfacial tension which favored the formation of small droplet sizes on homogenization until a critical limit (5:5% v/v CO:CA) was reached. Antimicrobial activity of the negatively charged CO nanoemulsion was determined against Gram positive GPB (Listeria monocytogenes and Staphylococcus aureus) and Gram negative GNB (Escherichia coli) bacterial strains using minimum inhibitory concentration (MIC) and a time kill dynamic method. Negatively charged PGU emulsified CO nanoemulsion showed prolonged antibacterial activities against Gram positive bacterial strains. We concluded that negatively charged CO nanoemulsion droplets self-assemble with GPB cell membrane, and facilitated interaction with cellular components of bacteria. Moreover, no electrostatic interaction existed between negatively charged droplets and the GPB membrane. Copyright © 2015 Elsevier Ltd. All rights reserved.

Polypeptide multilayer film co-delivers oppositely-charged drug molecules in sustained manners.

PubMed

Jiang, Bingbing; Defusco, Elizabeth; Li, Bingyun

2010-12-13

The current state-of-the-art for drug-carrying biomedical devices is mostly limited to those that release a single drug. Yet there are many situations in which more than one therapeutic agent is needed. Also, most polyelectrolyte multilayer films intended for drug delivery are loaded with active molecules only during multilayer film preparation. In this paper, we present the integration of capsules as vehicles within polypeptide multilayer films for sustained release of multiple oppositely charged drug molecules using layer-by-layer nanoassembly technology. Calcium carbonate (CaCO(3)) particles were impregnated with polyelectrolytes, shelled with polyelectrolyte multilayers, and then assembled onto polypeptide multilayer films using glutaraldehyde. Capsule-integrated polypeptide multilayer films were obtained after decomposition of CaCO(3) templates. Two oppositely charged drugs were loaded into capsules within polypeptide multilayer films postpreparation based on electrostatic interactions between the drugs and the polyelectrolytes impregnated within capsules. We determined that the developed innovative capsule-integrated polypeptide multilayer films could be used to load multiple drugs of very different properties (e.g., opposite charges) any time postpreparation (e.g., minutes before surgical implantation inside an operating room), and such capsule-integrated films allowed simultaneous delivery of two oppositely charged drug molecules and a sustained (up to two weeks or longer) and sequential release was achieved.

Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

PubMed

Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

2017-08-02

The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules

PubMed Central

Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin

2017-01-01

The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-Mx (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-Mx complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS. PMID:28767053

Twistacene contained molecule for optical nonlinearity: Excited-state based negative refraction and optical limiting

NASA Astrophysics Data System (ADS)

Wu, Xingzhi; Xiao, Jinchong; Sun, Ru; Jia, Jidong; Yang, Junyi; Ao, Guanghong; Shi, Guang; Wang, Yuxiao; Zhang, Xueru; Song, Yinglin

2018-06-01

Spindle-type molecules containing twisted acenes (PyBTA-1 &PyBTA-2) are designed, synthesized characterized. Picosecond Z-scan experiments under 532 nm show reverse saturable absorption and negative nonlinear refraction, indicating large third-order optical nonlinearity in PyBTA-1. The mechanism of the optical nonlinearity is investigated and the results show that the nonlinear absorption and refraction in PyBTA-1 originates from a charge transfer (CT) state. Furthermore, relatively long lifetime and absorptive cross section of the CT state are measured. Based on the excited state absorption in PyBTA-1, strong optical limiting with ∼0.3 J/cm2 thresholds are obtained when excited by picoseconds and nanoseconds pulses. The findings on nonlinear optics suggest PyBTA-1 a promising material of all optical modulation and laser protection, which enrich the potential applications of these spindle-type molecules. Comparing to the previously reported spindle-type molecules with analogous structures, the introduction of ICT in PyBTA-1 &PyBTA-2 dramatically decreases the two-photon absorption while enhances the nonlinear refraction. The results could be used to selectively tailor the optical nonlinearity in such kind of compounds.

Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

DOE Office of Scientific and Technical Information (OSTI.GOV)

Teyssedre, G., E-mail: gilbert.teyssedre@laplace.univ-tlse.fr; Laurent, C.; CNRS, LAPLACE, F-31062 Toulouse

Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are modelmore » of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10{sup −14}–10{sup −13} m{sup 2} V{sup −1} s{sup −1} for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.« less

Aberration of a negative ion beam caused by space charge effect.

PubMed

Miyamoto, K; Wada, S; Hatayama, A

2010-02-01

Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

Polypeptide Multilayer Film Co-Delivers Oppositely-Charged Drug Molecules in Sustained Manners

PubMed Central

Jiang, Bingbing; DeFusco, Elizabeth; Li, Bingyun

2010-01-01

The current state-of-the-art for drug-carrying biomedical devices is mostly limited to those that release a single drug. Yet there are many situations in which more than one therapeutic agent is needed. Also, most polyelectrolyte multilayer films intending for drug delivery are loaded with active molecules only during multilayer film preparation. In this paper, we present the integration of capsules as vehicles within polypeptide multilayer films for sustained release of multiple oppositely-charged drug molecules using layer-by-layer nanoassembly technology. Calcium carbonate (CaCO3) particles were impregnated with polyelectrolytes, shelled with polyelectrolyte multilayers, and then assembled onto polypeptide multilayer films using glutaraldehyde. Capsule-integrated polypeptide multilayer films were obtained after decomposition of CaCO3 templates. Two oppositely-charged drugs were loaded into capsules within polypeptide multilayer films post-preparation based on electrostatic interactions between the drugs and the polyelectrolytes impregnated within capsules. We determined that the developed innovative capsule-integrated polypeptide multilayer films could be used to load multiple drugs of very different properties (e.g. opposite charges) any time post-preparation (e.g. minutes before surgical implantation inside an operating room), and such capsule-integrated films allowed simultaneous delivery of two oppositely-charged drug molecules and a sustained (up to two weeks or longer) and sequential release was achieved. PMID:21058719

Nanotribological Properties of Positively and Negatively charged nanodiamonds as additives to solutions

NASA Astrophysics Data System (ADS)

Liu, Zijian; Corley, Steven; Shenderova, Olga; Brenner, Donald; Krim, Jacqueline

2013-03-01

Nano-diamond (ND) particles are known to be beneficial for wear and friction reduction when used as additives in liquids, but the fundamental origins of the improvement in tribological properties has not been established. In order to explore this issue, we have investigated the nanotribological properties of ND coated with self-assembled monolayers (SAM) as additives to solutions, employing gold/chrome coated quartz crystal microbalances (QCM). Measurements were performed with the QCM initially immersed in deionized water. ND particles with positively and negatively charged SAM end groups were then added to the water, while the frequency and amplitude of the QCM were monitored. Negative shifts in both the QCM frequency and amplitude were observed when ND with positively charged SAM end groups were added, while positive shifts in both the QCM frequency and amplitude were observed when ND with negatively charged ND end groups were added. The results are consistent with a lubricating effect for the negatively charged ND, but were only observed for sufficiently small negative ND particle size. Experiments on QCM surfaces with differing textures and roughness are in progress, to determine the separate contributing effects of surface roughness charge-water interactions. Funding provided by NSF DMR.

Ordered adsorption of coagulation factor XII on negatively charged polymer surfaces probed by sum frequency generation vibrational spectroscopy.

PubMed

Chen, Xiaoyun; Wang, Jie; Paszti, Zoltan; Wang, Fulin; Schrauben, Joel N; Tarabara, Volodymyr V; Schmaier, Alvin H; Chen, Zhan

2007-05-01

Electrostatic interactions between negatively charged polymer surfaces and factor XII (FXII), a blood coagulation factor, were investigated by sum frequency generation (SFG) vibrational spectroscopy, supplemented by several analytical techniques including attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR), quartz crystal microbalance (QCM), zeta-potential measurement, and chromogenic assay. A series of sulfonated polystyrenes (sPS) with different sulfonation levels were synthesized as model surfaces with different surface charge densities. SFG spectra collected from FXII adsorbed onto PS and sPS surfaces with different surface charge densities showed remarkable differences in spectral features and especially in spectral intensity. Chromogenic assay experiments showed that highly charged sPS surfaces induced FXII autoactivation. ATR-FTIR and QCM results indicated that adsorption amounts on the PS and sPS surfaces were similar even though the surface charge densities were different. No significant conformational change was observed from FXII adsorbed onto surfaces studied. Using theoretical calculations, the possible contribution from the third-order nonlinear optical effect induced by the surface electric field was evaluated, and it was found to be unable to yield the SFG signal enhancement observed. Therefore it was concluded that the adsorbed FXII orientation and ordering were the main reasons for the remarkable SFG amide I signal increase on sPS surfaces. These investigations indicate that negatively charged surfaces facilitate or induce FXII autoactivation on the molecular level by imposing specific orientation and ordering on the adsorbed protein molecules.

Flame Atmospheric Pressure Chemical Ionization Coupled with Negative Electrospray Ionization Mass Spectrometry for Ion Molecule Reactions.

PubMed

Cheng, Sy-Chyi; Bhat, Suhail Muzaffar; Shiea, Jentaie

2017-07-01

Flame atmospheric pressure chemical ionization (FAPCI) combined with negative electrospray ionization (ESI) mass spectrometry was developed to detect the ion/molecule reactions (IMRs) products between nitric acid (HNO 3 ) and negatively charged amino acid, angiotensin I (AI) and angiotensin II (AII), and insulin ions. Nitrate and HNO 3 -nitrate ions were detected in the oxyacetylene flame, suggesting that a large quantity of nitric acid (HNO 3 ) was produced in the flame. The HNO 3 and negatively charged analyte ions produced by a negative ESI source were delivered into each arm of a Y-shaped stainless steel tube where they merged and reacted. The products were subsequently characterized with an ion trap mass analyzer attached to the exit of the Y-tube. HNO 3 showed the strongest affinity to histidine and formed (M histidine -H+HNO 3 ) - complex ions, whereas some amino acids did not react with HNO 3 at all. Reactions between HNO 3 and histidine residues in AI and AII resulted in the formation of dominant [M AI -H+(HNO 3 )] - and [M AII -H+(HNO 3 )] - ions. Results from analyses of AAs and insulin indicated that HNO 3 could not only react with basic amino acid residues, but also with disulfide bonds to form [M-3H+(HNO 3 ) n ] 3- complex ions. This approach is useful for obtaining information about the number of basic amino acid residues and disulfide bonds in peptides and proteins. Graphical Abstract ᅟ.

Flame Atmospheric Pressure Chemical Ionization Coupled with Negative Electrospray Ionization Mass Spectrometry for Ion Molecule Reactions

NASA Astrophysics Data System (ADS)

Cheng, Sy-Chyi; Bhat, Suhail Muzaffar; Shiea, Jentaie

2017-07-01

Flame atmospheric pressure chemical ionization (FAPCI) combined with negative electrospray ionization (ESI) mass spectrometry was developed to detect the ion/molecule reactions (IMRs) products between nitric acid (HNO3) and negatively charged amino acid, angiotensin I (AI) and angiotensin II (AII), and insulin ions. Nitrate and HNO3-nitrate ions were detected in the oxyacetylene flame, suggesting that a large quantity of nitric acid (HNO3) was produced in the flame. The HNO3 and negatively charged analyte ions produced by a negative ESI source were delivered into each arm of a Y-shaped stainless steel tube where they merged and reacted. The products were subsequently characterized with an ion trap mass analyzer attached to the exit of the Y-tube. HNO3 showed the strongest affinity to histidine and formed (Mhistidine-H+HNO3)- complex ions, whereas some amino acids did not react with HNO3 at all. Reactions between HNO3 and histidine residues in AI and AII resulted in the formation of dominant [MAI-H+(HNO3)]- and [MAII-H+(HNO3)]- ions. Results from analyses of AAs and insulin indicated that HNO3 could not only react with basic amino acid residues, but also with disulfide bonds to form [M-3H+(HNO3)n]3- complex ions. This approach is useful for obtaining information about the number of basic amino acid residues and disulfide bonds in peptides and proteins.

Elimination of Spurious Fractional Charges in Dissociating Molecules by Correcting the Shape of Approximate Kohn-Sham Potentials.

PubMed

Komsa, Darya N; Staroverov, Viktor N

2016-11-08

Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.

Brownian dynamics simulations of simplified cytochrome c molecules in the presence of a charged surface

NASA Astrophysics Data System (ADS)

Gorba, C.; Geyer, T.; Helms, V.

2004-07-01

Simulations were performed for up to 150 simplified spherical horse heart cytochrome c molecules in the presence of a charged surface, which serves as an approximate model for a lipid membrane. Screened electrostatic and short-ranged attractive as well as repulsive van der Waals forces for interparticle and particle-membrane interactions are utilized in the simulations. At a distance from the membrane, where particle-membrane interactions are negligible, the simulation is coupled to a noninteraction continuum analogous to a heat bath [Geyer et al., J. Chem. Phys. 120, 4573 (2004)]. From the particles' density profiles perpendicular to the planar surface binding isotherms are derived and compared to experimental results [Heimburg et al. (1999)]. Using a negatively charged structureless membrane surface a saturation effect was found for relatively large particle concentrations. Since biological membranes often contain membrane proteins, we also studied the influence of additional charges on our model membrane mimicking bacterial reaction centers. We find that the onset of the saturation occurs for much lower concentrations and is sensitive to the detailed implementation. Therefore we suggest that local distortion of membrane planarity (undulation), or lipid demixing, or the presence of charged integral membrane proteins create preferential binding sites on the membrane. Only then do we observe saturation at physiological concentrations.

Positive zeta potential of a negatively charged semi-permeable plasma membrane

NASA Astrophysics Data System (ADS)

Sinha, Shayandev; Jing, Haoyuan; Das, Siddhartha

2017-08-01

The negative charge of the plasma membrane (PM) severely affects the nature of moieties that may enter or leave the cells and controls a large number of ion-interaction-mediated intracellular and extracellular events. In this letter, we report our discovery of a most fascinating scenario, where one interface (e.g., membrane-cytosol interface) of the negatively charged PM shows a positive surface (or ζ) potential, while the other interface (e.g., membrane-electrolyte interface) still shows a negative ζ potential. Therefore, we encounter a completely unexpected situation where an interface (e.g., membrane-cytosol interface) that has a negative surface charge density demonstrates a positive ζ potential. We establish that the attainment of such a property by the membrane can be ascribed to an interplay of the nature of the membrane semi-permeability and the electrostatics of the electric double layer established on either side of the charged membrane. We anticipate that such a membrane property can lead to such capabilities of the cell (in terms of accepting or releasing certain kinds of moieties as well regulating cellular signaling) that was hitherto inconceivable.

Production of negatively charged radioactive ion beams

DOE PAGES

Liu, Y.; Stracener, D. W.; Stora, T.

2017-02-15

Beams of short-lived radioactive nuclei are needed for frontier experimental research in nuclear structure, reactions, and astrophysics. Negatively charged radioactive ion beams have unique advantages and allow for the use of a tandem accelerator for post-acceleration, which can provide the highest beam quality and continuously variable energies. Negative ion beams can be obtained with high intensity and some unique beam purification techniques based on differences in electronegativity and chemical reactivity can be used to provide beams with high purity. This article describes the production of negative radioactive ion beams at the former holifield radioactive ion beam facility at Oak Ridgemore » National Laboratory and at the CERN ISOLDE facility with emphasis on the development of the negative ion sources employed at these two facilities.« less

Tuning charge and correlation effects for a single molecule on a graphene device

DOE PAGES

Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; ...

2016-11-25

The ability to understand and control the electronic properties of individual molecules in a device environment is crucial for developing future technologies at the nanometre scale and below. Achieving this, however, requires the creation of three-terminal devices that allow single molecules to be both gated and imaged at the atomic scale. We have accomplished this by integrating a graphene field effect transistor with a scanning tunnelling microscope, thus allowing gate-controlled charging and spectroscopic interrogation of individual tetrafluoro-tetracyanoquinodimethane molecules. We observe a non-rigid shift in the molecule’s lowest unoccupied molecular orbital energy (relative to the Dirac point) as a function ofmore » gate voltage due to graphene polarization effects. Our results show that electron–electron interactions play an important role in how molecular energy levels align to the graphene Dirac point, and may significantly influence charge transport through individual molecules incorporated in graphene-based nanodevices.« less

Generalized Breit-Wigner treatment of molecular transport: Charging effects in a single decanedithiol molecule

NASA Astrophysics Data System (ADS)

Cabrera-Tinoco, Hugo Andres; Moreira, Augusto C. L.; de Melo, Celso P.

2018-05-01

We examine the relative contribution of ballistic and elastic cotunneling mechanisms to the charge transport through a single decanedithiol molecule linked to two terminal clusters of gold atoms. For this, we first introduced a conceptual model that permits a generalization of the Breit-Wigner scattering formalism where the cation, anion, and neutral forms of the molecule can participate with different probabilities of the charge transfer process, but in a simultaneous manner. We used a density functional theory treatment and considered the fixed geometry of each charge state to calculate the corresponding eigenvalues and eigenvectors of the extended system for different values of the external electric field. We have found that for the ballistic transport the HOMO and LUMO of the neutral species play a key role, while the charged states give a negligible contribution. On the other hand, an elastic cotunneling charge transfer can occur whenever a molecular orbital (MO) of the cation or anion species, even if localized in just one side of the molecule-gold clusters complex, has energy close to that of a delocalized MO of the neutral species. Under these conditions, a conduction channel is formed throughout the entire system, in a process that is controlled by the degree of resonance between the MOs involved. Our results indicate that while different charge transfer mechanisms contribute to the overall charge transport, quantum effects such as avoided-crossing situations between relevant frontier MOs can be of special importance. In these specific situations, the interchange of spatial localization of two MOs involved in the crossing can open a new channel of charge transfer that otherwise would not be available.

Negative differential conductance and super-Poissonian shot noise in single-molecule magnet junctions

PubMed Central

Xue, Hai-Bin; Liang, Jiu-Qing; Liu, Wu-Ming

2015-01-01

Molecular spintroinic device based on a single-molecule magnet is one of the ultimate goals of semiconductor nanofabrication technologies. It is thus necessary to understand the electron transport properties of a single-molecule magnet junction. Here we study the negative differential conductance and super-Poissonian shot noise properties of electron transport through a single-molecule magnet weakly coupled to two electrodes with either one or both of them being ferromagnetic. We predict that the negative differential conductance and super-Poissonian shot noise, which can be tuned by a gate voltage, depend sensitively on the spin polarization of the source and drain electrodes. In particular, the shot noise in the negative differential conductance region can be enhanced or decreased originating from the different formation mechanisms of negative differential conductance. The effective competition between fast and slow transport channels is responsible for the observed negative differential conductance and super-Poissonian shot noise. In addition, we further discuss the skewness and kurtosis properties of transport current in the super-Poissonian shot noise regions. Our findings suggest a tunable negative differential conductance molecular device, and the predicted properties of high-order current cumulants are very interesting for a better understanding of electron transport through single-molecule magnet junctions. PMID:25736094

Negative differential conductance and super-Poissonian shot noise in single-molecule magnet junctions.

PubMed

Xue, Hai-Bin; Liang, Jiu-Qing; Liu, Wu-Ming

2015-03-04

Molecular spintroinic device based on a single-molecule magnet is one of the ultimate goals of semiconductor nanofabrication technologies. It is thus necessary to understand the electron transport properties of a single-molecule magnet junction. Here we study the negative differential conductance and super-Poissonian shot noise properties of electron transport through a single-molecule magnet weakly coupled to two electrodes with either one or both of them being ferromagnetic. We predict that the negative differential conductance and super-Poissonian shot noise, which can be tuned by a gate voltage, depend sensitively on the spin polarization of the source and drain electrodes. In particular, the shot noise in the negative differential conductance region can be enhanced or decreased originating from the different formation mechanisms of negative differential conductance. The effective competition between fast and slow transport channels is responsible for the observed negative differential conductance and super-Poissonian shot noise. In addition, we further discuss the skewness and kurtosis properties of transport current in the super-Poissonian shot noise regions. Our findings suggest a tunable negative differential conductance molecular device, and the predicted properties of high-order current cumulants are very interesting for a better understanding of electron transport through single-molecule magnet junctions.

Quantum Theory of Atoms in Molecules Charge-Charge Transfer-Dipolar Polarization Classification of Infrared Intensities.

PubMed

Duarte, Leonardo J; Richter, Wagner E; Silva, Arnaldo F; Bruns, Roy E

2017-10-26

Fundamental infrared vibrational transition intensities of gas-phase molecules are sensitive probes of changes in electronic structure accompanying small molecular distortions. Models containing charge, charge transfer, and dipolar polarization effects are necessary for a successful classification of the C-H, C-F, and C-Cl stretching and bending intensities. C-H stretching and in-plane bending vibrations involving sp 3 carbon atoms have small equilibrium charge contributions and are accurately modeled by the charge transfer-counterpolarization contribution and its interaction with equilibrium charge movement. Large C-F and C═O stretching intensities have dominant equilibrium charge movement contributions compared to their charge transfer-dipolar polarization ones and are accurately estimated by equilibrium charge and the interaction contribution. The C-F and C-Cl bending modes have charge and charge transfer-dipolar polarization contribution sums that are of similar size but opposite sign to their interaction values resulting in small intensities. Experimental in-plane C-H bends have small average intensities of 12.6 ± 10.4 km mol -1 owing to negligible charge contributions and charge transfer-counterpolarization cancellations, whereas their average out-of-plane experimental intensities are much larger, 65.7 ± 20.0 km mol -1 , as charge transfer is zero and only dipolar polarization takes place. The C-F bending intensities have large charge contributions but very small intensities. Their average experimental out-of-plane intensity of 9.9 ± 12.6 km mol -1 arises from the cancellation of large charge contributions by dipolar polarization contributions. The experimental average in-plane C-F bending intensity, 5.8 ± 7.3 km mol -1 , is also small owing to charge and charge transfer-counterpolarization sums being canceled by their interaction contributions. Models containing only atomic charges and their fluxes are incapable of describing electronic structure

Recovery curves of the surface electric field after lightning discharges occurring between the positive charge pocket and negative charge centre in a thundercloud

NASA Astrophysics Data System (ADS)

Pawar, S. D.; Kamra, A. K.

2002-12-01

Surface observations of the electric field recovery curves of the lightning discharges occurring between the positive charge pocket and negative main charge centre in an overhead thundercloud are reported. Such recovery curves are observed to have an additional step of very slow field-change observed at an after-discharge value of electric field equal to 5-6 kV m-1. The behavior of recovery curves is explained in terms of the coronae charge and the relative efficiencies of the charge generating processes responsible for growth of positive charge pocket and main negative charge centre in the thundercloud. The charging currents responsible for the growth of charge in positive charge pockets is computed to be 2-4 times larger than that for the growth of the main negative charge. However, the charge destroyed in such a discharge is found to be comparable to that in a discharge between the main charge centres of the thundercloud.

Tuning Charge and Correlation Effects for a Single Molecule on a Graphene Device

NASA Astrophysics Data System (ADS)

Tsai, Hsin-Zon; Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; Omrani, Arash A.; Riss, Alexander; Karrasch, Christoph; Jung, Han Sae; Khajeh, Ramin; Wong, Dillon; Watanabe, Kenji; Taniguchi, Takashi; Zettl, Alex; Louie, Steven G.; Crommie, Michael F.

Controlling electronic devices down to the single molecule level is a grand challenge of nanotechnology. Single-molecules have been integrated into devices capable of tuning electronic response, but a drawback for these systems is that their microscopic structure remains unknown due to inability to image molecules in the junction region. Here we present a combined STM and nc-AFM study demonstrating gate-tunable control of the charge state of individual F4TCNQ molecules at the surface of a graphene field effect transistor. This is different from previous studies in that the Fermi level of the substrate was continuously tuned across the molecular orbital energy level. Using STS we have determined the resulting energy level evolution of the LUMO, its associated vibronic modes, and the graphene Dirac point (ED). We show that the energy difference between ED and the LUMO increases as EF is moved away from ED due to electron-electron interactions that renormalize the molecular quasiparticle energy. This is attributed to gate-tunable image-charge screening in graphene and corroborated by ab initio calculations.

Negative space charge effects in photon-enhanced thermionic emission solar converters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Segev, G.; Weisman, D.; Rosenwaks, Y.

2015-07-06

In thermionic energy converters, electrons in the gap between electrodes form a negative space charge and inhibit the emission of additional electrons, causing a significant reduction in conversion efficiency. However, in Photon Enhanced Thermionic Emission (PETE) solar energy converters, electrons that are reflected by the electric field in the gap return to the cathode with energy above the conduction band minimum. These electrons first occupy the conduction band from which they can be reemitted. This form of electron recycling makes PETE converters less susceptible to negative space charge loss. While the negative space charge effect was studied extensively in thermionicmore » converters, modeling its effect in PETE converters does not account for important issues such as this form of electron recycling, nor the cathode thermal energy balance. Here, we investigate the space charge effect in PETE solar converters accounting for electron recycling, with full coupling of the cathode and gap models, and addressing conservation of both electric and thermal energy. The analysis shows that the negative space charge loss is lower than previously reported, allowing somewhat larger gaps compared to previous predictions. For a converter with a specific gap, there is an optimal solar flux concentration. The optimal solar flux concentration, the cathode temperature, and the efficiency all increase with smaller gaps. For example, for a gap of 3 μm the maximum efficiency is 38% and the optimal flux concentration is 628, while for a gap of 5 μm the maximum efficiency is 31% and optimal flux concentration is 163.« less

Enhancing biocompatibility of D-oligopeptide hydrogels by negative charges.

PubMed

Hyland, Laura L; Twomey, Julianne D; Vogel, Savannah; Hsieh, Adam H; Yu, Y Bruce

2013-02-11

Oligopeptide hydrogels are emerging as useful matrices for cell culture with commercial products on the market, but L-oligopeptides are labile to proteases. An obvious solution is to create D-oligopeptide hydrogels, which lack enzymatic recognition. However, D-oligopeptide matrices do not support cell growth as well as L-oligopeptide matrices. In addition to chiral interactions, many cellular activities are strongly governed by charge-charge interactions. In this work, the effects of chirality and charge on human mesenchymal stem cell (hMSC) behavior were studied using hydrogels assembled from oppositely charged oligopeptides. It was found that negative charges significantly improved hMSC viability and proliferation in D-oligopeptide gels but had little effect on their interactions with L-oligopeptide gels. This result points to the possibility of using charge and other factors to engineer biomaterials whose chirality is distinct from that of natural biomaterials, but whose performance is close to that of natural biomaterials.

Charge-specific size-dependent separation of water-soluble organic molecules by fluorinated nanoporous networks

NASA Astrophysics Data System (ADS)

Byun, Jeehye; Patel, Hasmukh A.; Thirion, Damien; Yavuz, Cafer T.

2016-11-01

Molecular architecture in nanoscale spaces can lead to selective chemical interactions and separation of species with similar sizes and functionality. Substrate specific sorbent chemistry is well known through highly crystalline ordered structures such as zeolites, metal organic frameworks and widely available nanoporous carbons. Size and charge-dependent separation of aqueous molecular contaminants, on the contrary, have not been adequately developed. Here we report a charge-specific size-dependent separation of water-soluble molecules through an ultra-microporous polymeric network that features fluorines as the predominant surface functional groups. Treatment of similarly sized organic molecules with and without charges shows that fluorine interacts with charges favourably. Control experiments using similarly constructed frameworks with or without fluorines verify the fluorine-cation interactions. Lack of a σ-hole for fluorine atoms is suggested to be responsible for this distinct property, and future applications of this discovery, such as desalination and mixed matrix membranes, may be expected to follow.

Charge-specific size-dependent separation of water-soluble organic molecules by fluorinated nanoporous networks

PubMed Central

Byun, Jeehye; Patel, Hasmukh A.; Thirion, Damien; Yavuz, Cafer T.

2016-01-01

Molecular architecture in nanoscale spaces can lead to selective chemical interactions and separation of species with similar sizes and functionality. Substrate specific sorbent chemistry is well known through highly crystalline ordered structures such as zeolites, metal organic frameworks and widely available nanoporous carbons. Size and charge-dependent separation of aqueous molecular contaminants, on the contrary, have not been adequately developed. Here we report a charge-specific size-dependent separation of water-soluble molecules through an ultra-microporous polymeric network that features fluorines as the predominant surface functional groups. Treatment of similarly sized organic molecules with and without charges shows that fluorine interacts with charges favourably. Control experiments using similarly constructed frameworks with or without fluorines verify the fluorine-cation interactions. Lack of a σ-hole for fluorine atoms is suggested to be responsible for this distinct property, and future applications of this discovery, such as desalination and mixed matrix membranes, may be expected to follow. PMID:27830697

Charge transport with single molecules--an electrochemical approach.

PubMed

Li, Chen; Mishchenko, Artem; Pobelov, Ilya; Wandlowski, Thomas

2010-01-01

After an introduction and brief review of charge transport in nanoscale molecular systems we report on experimental studies in gold / (single) molecule / gold junctions at solid / liquid interfaces employing a scanning tunneling microscopy (STM)-based 'break junction' technique. We demonstrate attempts in developing basic relationships between molecular structure, conductance properties and nanoscale electrochemical concepts based on four case studies from our own work. In experiments with alpha, omega-alkanedithiol and biphenyldithiol molecular junctions we address the role of sulfur-gold couplings and molecular conformation, such as gauche defects in the alkyl chains and the torsion angle between two phenyl rings. Combination with quantum chemistry calculations enabled a detailed molecular-level understanding of the electronic structure and transport characteristics of both systems. Employing the concept of 'electrolyte gating' with redox-active molecules, such as thiol-terminated derivatives of viologens (HS-6V6-SH or (HS-6V6)) we demonstrate the construction of symmetric and asymmetric active molecular junctions with transistor- or diode-like behavior upon polarization in an electrochemical environment. The experimental data could be represented quantitatively by the Kutznetsov/Ulstrup model assuming a two-step electron transfer with partial vibration relaxation. Finally, we show that surface-immobilized gold nanoparticles with a diameter of (2.4 +/- 0.5) nm exhibit features of locally addressable multi-state electronic switching upon electrolyte gating, which appears to be reminiscent of a sequential charging through several 'oxidation/reduction states'.

Long-lived charge carrier generation in ordered films of a covalent perylenediimide–diketopyrrolopyrrole–perylenediimide molecule

DOE PAGES

Hartnett, Patrick E.; Dyar, Scott M.; Margulies, Eric A.; ...

2015-07-31

The photophysics of a covalently linked perylenediimide–diketopyrrolopyrrole–perylenediimide acceptor–donor–acceptor molecule (PDI–DPP–PDI, 1) were investigated and found to be markedly different in solution versus in unannealed and solvent annealed films. Photoexcitation of 1 in toluene results in quantitative charge separation in τ = 3.1 ± 0.2 ps, with charge recombination in τ = 340 ± 10 ps, while in unannealed/disordered films of 1, charge separation occurs in τ < 250 fs, while charge recombination displays a multiexponential decay in ~6 ns. The absence of long-lived, charge separation in the disordered film suggests that few free charge carriers are generated. In contrast, uponmore » CH₂Cl₂ vapor annealing films of 1, grazing-incidence X-ray scattering shows that the molecules form a more ordered structure. Photoexcitation of the ordered films results in initial formation of a spin-correlated radical ion pair (electron–hole pair) as indicated by magnetic field effects on the formation of free charge carriers which live for ~4 μs. This result has significant implications for the design of organic solar cells based on covalent donor–acceptor systems and shows that long-lived, charge-separated states can be achieved by controlling intramolecular charge separation dynamics in well-ordered systems.« less

Apparent electric charge of protein molecules. Human thyroxine - binding proteins.

PubMed

Hocman, G; Sadlon, J

1977-01-01

1. By comparison of electrophoretic mobilities of two different charged particles under the same conditions the net elementary electrostatic charge of one particle could be calculated when the charge of the other is known. 2. The electrophoretic mobility of human thyroxine - binding globulin does not depend upon the concentration of Tris - HCl buffer in the range 0.05 to 0.20 molar. The value of this mobility is 0.078 and 0.083 cm2 vol(-1) hour(-1) at pH 7.0 and 8.6, respectively. 3. The net elementary electrostatic charge of the human thyroxine - binding globulin appears to be approximately 22 negative elementary electrostatic units in mild alkaline solutions.

A simple model of solvent-induced symmetry-breaking charge transfer in excited quadrupolar molecules

NASA Astrophysics Data System (ADS)

Ivanov, Anatoly I.; Dereka, Bogdan; Vauthey, Eric

2017-04-01

A simple model has been developed to describe the symmetry-breaking of the electronic distribution of AL-D-AR type molecules in the excited state, where D is an electron donor and AL and AR are identical acceptors. The origin of this process is usually associated with the interaction between the molecule and the solvent polarization that stabilizes an asymmetric and dipolar state, with a larger charge transfer on one side than on the other. An additional symmetry-breaking mechanism involving the direct Coulomb interaction of the charges on the acceptors is proposed. At the same time, the electronic coupling between the two degenerate states, which correspond to the transferred charge being localised either on AL or AR, favours a quadrupolar excited state with equal amount of charge-transfer on both sides. Because of these counteracting effects, symmetry breaking is only feasible when the electronic coupling remains below a threshold value, which depends on the solvation energy and the Coulomb repulsion energy between the charges located on AL and AR. This model allows reproducing the solvent polarity dependence of the symmetry-breaking reported recently using time-resolved infrared spectroscopy.

Mechanism of charge transfer and its impacts on Fermi-level pinning for gas molecules adsorbed on monolayer WS2.

PubMed

Zhou, Changjie; Yang, Weihuang; Zhu, Huili

2015-06-07

Density functional theory calculations were performed to assess changes in the geometric and electronic structures of monolayer WS2 upon adsorption of various gas molecules (H2, O2, H2O, NH3, NO, NO2, and CO). The most stable configuration of the adsorbed molecules, the adsorption energy, and the degree of charge transfer between adsorbate and substrate were determined. All evaluated molecules were physisorbed on monolayer WS2 with a low degree of charge transfer and accept charge from the monolayer, except for NH3, which is a charge donor. Band structure calculations showed that the valence and conduction bands of monolayer WS2 are not significantly altered upon adsorption of H2, H2O, NH3, and CO, whereas the lowest unoccupied molecular orbitals of O2, NO, and NO2 are pinned around the Fermi-level when these molecules are adsorbed on monolayer WS2. The phenomenon of Fermi-level pinning was discussed in light of the traditional and orbital mixing charge transfer theories. The impacts of the charge transfer mechanism on Fermi-level pinning were confirmed for the gas molecules adsorbed on monolayer WS2. The proposed mechanism governing Fermi-level pinning is applicable to the systems of adsorbates on recently developed two-dimensional materials, such as graphene and transition metal dichalcogenides.

Anisotropic charge transport in large single crystals of π-conjugated organic molecules.

PubMed

Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent

2014-05-07

The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.

Electronegativity equalization method: parameterization and validation for organic molecules using the Merz-Kollman-Singh charge distribution scheme.

PubMed

Jirousková, Zuzana; Vareková, Radka Svobodová; Vanek, Jakub; Koca, Jaroslav

2009-05-01

The electronegativity equalization method (EEM) was developed by Mortier et al. as a semiempirical method based on the density-functional theory. After parameterization, in which EEM parameters A(i), B(i), and adjusting factor kappa are obtained, this approach can be used for calculation of average electronegativity and charge distribution in a molecule. The aim of this work is to perform the EEM parameterization using the Merz-Kollman-Singh (MK) charge distribution scheme obtained from B3LYP/6-31G* and HF/6-31G* calculations. To achieve this goal, we selected a set of 380 organic molecules from the Cambridge Structural Database (CSD) and used the methodology, which was recently successfully applied to EEM parameterization to calculate the HF/STO-3G Mulliken charges on large sets of molecules. In the case of B3LYP/6-31G* MK charges, we have improved the EEM parameters for already parameterized elements, specifically C, H, N, O, and F. Moreover, EEM parameters for S, Br, Cl, and Zn, which have not as yet been parameterized for this level of theory and basis set, we also developed. In the case of HF/6-31G* MK charges, we have developed the EEM parameters for C, H, N, O, S, Br, Cl, F, and Zn that have not been parameterized for this level of theory and basis set so far. The obtained EEM parameters were verified by a previously developed validation procedure and used for the charge calculation on a different set of 116 organic molecules from the CSD. The calculated EEM charges are in a very good agreement with the quantum mechanically obtained ab initio charges. 2008 Wiley Periodicals, Inc.

Theoretical study of negatively charged Fe(-)-(H2O)(n ≤ 6) clusters.

PubMed

Castro, Miguel

2012-06-14

Interactions of a singly negatively charged iron atom with water molecules, Fe(-)-(H(2)O)(n≤6), in the gas phase were studied by means of density functional theory. All-electron calculations were performed using the B3LYP functional and the 6-311++G(2d,2p) basis set for the Fe, O, and H atoms. In the lowest total energy states of Fe(-)-(H(2)O)(n), the metal-hydrogen bonding is stronger than the metal-oxygen one, producing low-symmetry structures because the water molecules are directly attached to the metal by basically one of their hydrogen atoms, whereas the other ones are involved in a network of hydrogen bonds, which together with the Fe(δ-)-H(δ+) bonding accounts for the nascent hydration of the Fe(-) anion. For Fe(-)-(H(2)O)(3≤n), three-, four-, five-, and six-membered rings of water molecules are bonded to the metal, which is located at the surface of the cluster in such a way as to reduce the repulsion with the oxygen atoms. Nevertheless, internal isomers appear also, lying less than 3 or 5 kcal/mol for n = 2-3 or n = 4-6. These results are in contrast with those of classical TM(+)-(H(2)O)(n) complexes, where the direct TM(+)-O bonding usually produces high symmetry structures with the metal defining the center of the complex. They show also that the Fe(-) anions, as the TM(+) ions, have great capability for the adsorption of water molecules, forming Fe(-)-(H(2)O)(n) structures stabilized by Fe(δ-)-H(δ+) and H-bond interactions.

Comparing Positively and Negatively Charged Distonic Radical Ions in Phenylperoxyl Forming Reactions.

PubMed

Williams, Peggy E; Marshall, David L; Poad, Berwyck L J; Narreddula, Venkateswara R; Kirk, Benjamin B; Trevitt, Adam J; Blanksby, Stephen J

2018-06-04

In the gas phase, arylperoxyl forming reactions play a significant role in low-temperature combustion and atmospheric processing of volatile organic compounds. We have previously demonstrated the application of charge-tagged phenyl radicals to explore the outcomes of these reactions using ion trap mass spectrometry. Here, we present a side-by-side comparison of rates and product distributions from the reaction of positively and negatively charge tagged phenyl radicals with dioxygen. The negatively charged distonic radical ions are found to react with significantly greater efficiency than their positively charged analogues. The product distributions of the anion reactions favor products of phenylperoxyl radical decomposition (e.g., phenoxyl radicals and cyclopentadienone), while the comparable fixed-charge cations yield the stabilized phenylperoxyl radical. Electronic structure calculations rationalize these differences as arising from the influence of the charged moiety on the energetics of rate-determining transition states and reaction intermediates within the phenylperoxyl reaction manifold and predict that this influence could extend to intra-molecular charge-radical separations of up to 14.5 Å. Experimental observations of reactions of the novel 4-(1-carboxylatoadamantyl)phenyl radical anion confirm that the influence of the charge on both rate and product distribution can be modulated by increasing the rigidly imposed separation between charge and radical sites. These findings provide a generalizable framework for predicting the influence of charged groups on polarizable radicals in gas phase distonic radical ions. Graphical Abstract.

Comparing Positively and Negatively Charged Distonic Radical Ions in Phenylperoxyl Forming Reactions

NASA Astrophysics Data System (ADS)

Williams, Peggy E.; Marshall, David L.; Poad, Berwyck L. J.; Narreddula, Venkateswara R.; Kirk, Benjamin B.; Trevitt, Adam J.; Blanksby, Stephen J.

2018-06-01

In the gas phase, arylperoxyl forming reactions play a significant role in low-temperature combustion and atmospheric processing of volatile organic compounds. We have previously demonstrated the application of charge-tagged phenyl radicals to explore the outcomes of these reactions using ion trap mass spectrometry. Here, we present a side-by-side comparison of rates and product distributions from the reaction of positively and negatively charge tagged phenyl radicals with dioxygen. The negatively charged distonic radical ions are found to react with significantly greater efficiency than their positively charged analogues. The product distributions of the anion reactions favor products of phenylperoxyl radical decomposition (e.g., phenoxyl radicals and cyclopentadienone), while the comparable fixed-charge cations yield the stabilized phenylperoxyl radical. Electronic structure calculations rationalize these differences as arising from the influence of the charged moiety on the energetics of rate-determining transition states and reaction intermediates within the phenylperoxyl reaction manifold and predict that this influence could extend to intra-molecular charge-radical separations of up to 14.5 Å. Experimental observations of reactions of the novel 4-(1-carboxylatoadamantyl)phenyl radical anion confirm that the influence of the charge on both rate and product distribution can be modulated by increasing the rigidly imposed separation between charge and radical sites. These findings provide a generalizable framework for predicting the influence of charged groups on polarizable radicals in gas phase distonic radical ions.

Recombination energy for negatively charged excitons inside type-II core/shell spherical quantum dots

NASA Astrophysics Data System (ADS)

Chafai, A.; Essaoudi, I.; Ainane, A.; Dujardin, F.; Ahuja, R.

2018-07-01

The recombination energy of isolated neutral exciton and that of isolated negatively charged exciton inside a type-II core/shell spherical quantum dot are studied. Our investigation considers the charge-carriers effective mass discontinuity at the surface contact between the core and shell materials. Although our model omits the effect of the surface polarization, the dielectric-constant mismatch at the nanodot boundaries was taken into account. In order to achieve the exciton and negative trion energies, we proceed by a variational calculation in the framework of the envelope approximation. Our results reveal a strong correlation between the nanodot morphology and the energy spectrum of the neutral and negatively charged exciton.

Formation mechanism of human serum albumin monolayers on positively charged polymer microparticles.

PubMed

Nattich-Rak, Małgorzata; Sadowska, Marta; Adamczyk, Zbigniew; Cieśla, Michał; Kąkol, Małgorzata

2017-11-01

Human serum albumin (HSA) adsorption on positively and negatively charged polystyrene microparticles was studied at various pHs and NaCl concentrations. Thorough electrophoretic mobility measurements were carried out that enabled to monitor in situ the progress of protein adsorption. The maximum coverage of irreversibly adsorbed HSA on microparticles was determined by different concentration depletion methods, one of them involving AFM imaging of residual molecules. An anomalous adsorption of HSA on the positive microparticles was observed at pH 3.5 where the maximum coverage attained 1.0mgm -2 for NaCl concentrations of 0.05M despite that the molecules were on average positively charged. For comparison, the maximum coverage of HSA on negatively charged microparticles was equal to 1.3mgm -2 at this pH and NaCl concentration. At pH 7.4 the maximum coverage on positive microparticles was equal to 2.1mgm -2 for 0.05M NaCl concentration. On the other hand, for negative microparticles, negligible adsorption of HSA was observed at pH 7.4 and 9.7. These experimental data were adequately interpreted in terms of the random sequential adsorption approach exploiting the bead model of the HSA molecule. Different orientations of adsorbed molecules, inert alia, the edge-on orientation prevailing for positively charged microparticles at pH 7.4, were confirmed. This was explained in terms of a heterogeneous charge distribution over the HSA molecule prevailing for a wide range of pHs. Copyright © 2017 Elsevier B.V. All rights reserved.

Presence of negative charge on the basal planes of New York talc.

PubMed

Burdukova, E; Becker, M; Bradshaw, D J; Laskowski, J S

2007-11-01

Potentiometric titration measurements as well as rheological measurements of talc aqueous suspensions indicate that the behavior of the New York talc particles is consistent with the presence of a negative charge on their basal planes. The possibility of the presence of a negative electrical charge on the basal planes of talc particles is analyzed in this paper. Samples of New York talc were studied using electron microprobe analysis and dehydration techniques and the exact chemical formula of New York talc was determined. It was found that there exists a deficiency of protons in the tetrahedral layers of talc, resulting from substitution of Si(4+) ions with Al(3+) and Ti(3+) ions. The comparison of the level of substitution of Si(4+) ions with ions of a lower valency was found to be of a similar order of magnitude as that found in other talc deposits. This strongly points to the presence of a negative charge on the talc basal planes.

Storage of charge carriers on emitter molecules in organic light-emitting diodes

NASA Astrophysics Data System (ADS)

Weichsel, Caroline; Burtone, Lorenzo; Reineke, Sebastian; Hintschich, Susanne I.; Gather, Malte C.; Leo, Karl; Lüssem, Björn

2012-08-01

Organic light-emitting diodes (OLEDs) using the red phosphorescent emitter iridium(III)bis(2-methyldibenzo[f,h]quinoxaline) (acetylacetonate) [Ir(MDQ)2(acac)] are studied by time-resolved electroluminescence measurements. A transient overshoot after voltage turn-off is found, which is attributed to electron accumulation on Ir(MDQ)2(acac) molecules. The mechanism is verified via impedance spectroscopy and by application of positive and negative off-voltages. We calculate the density of accumulated electrons and find that it scales linearly with the doping concentration of the emitter. Using thin quenching layers, we locate the position of the emission zone during normal OLED operation and after voltage turn-off. In addition, the transient overshoot is also observed in three-color white-emitting OLEDs. By time- and spectrally resolved measurements using a streak camera, we directly attribute the overshoot to electron accumulation on Ir(MDQ)2(acac). We propose that similar processes are present in many state-of-the-art OLEDs and believe that the quantification of charge carrier storage will help to improve the efficiency of OLEDs.

Negative charge emission due to excimer laser bombardment of sodium trisilicate glass

NASA Astrophysics Data System (ADS)

Langford, S. C.; Jensen, L. C.; Dickinson, J. T.; Pederson, L. R.

1990-10-01

We describe measurements of negative charge emission accompanying irradiation of sodium trisilicate glass (Na2Oṡ3SiO2) with 248-nm excimer laser light at fluences on the order of 2 J/cm2 per pulse, i.e., at the threshold for ablative etching of the glass surface. The negative charge emission consists of a very prompt photoelectron burst coincident with the laser pulse, followed by a much slower plume of electrons and negative ions traveling with a high density cloud of positive ions, previously identified as primarily Na+. Using combinations of E and B fields in conjunction with time-of-flight methods, the negative ions were successfully separated from the plume and tentatively identified as O-, Si-, NaO-, and perhaps NaSi-. These negative species are probably formed by gas phase collisions in the near-surface region which result in electron attachment.

Controlling the orbital sequence in individual Cu-phthalocyanine molecules.

PubMed

Uhlmann, C; Swart, I; Repp, J

2013-02-13

We report on the controlled change of the energetic ordering of molecular orbitals. Negatively charged copper(II)phthalocyanine on NaCl/Cu(100) undergoes a Jahn-Teller distortion that lifts the degeneracy of two frontier orbitals. The energetic order of the levels can be controlled by Au and Ag atoms in the vicinity of the molecule. As only one of the states is occupied, the control of the energetic order is accompanied by bistable changes of the charge distribution inside the molecule, rendering it a bistable switch.

Visualizing electron dynamics in organic materials: Charge transport through molecules and angular resolved photoemission

NASA Astrophysics Data System (ADS)

Kümmel, Stephan

Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.

Self-consistent field calculations of conductance through conjugated molecules at finite bias

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

2001-03-01

Conductance through conjugated molecules have previously been calculated for a large number of systems using the Landauer formula but only a few calculations have included charging effects. In this study we present calculations in the mean field approximation of the conductance of metal-molecule-metal systems using two different kinds of molecules for a large number of configurations and applied biases. The molecules are described in the Pariser-Parr Pople model. Current-voltage (I-V) characteristics and charge distribution of the molecule connected by one dimensional leads to reservoirs is solved within the Hartree-Fock approximation. Charging of the molecule occurs when the chemical potential of the reservoirs approach the resonant tunneling levels. The ensuing potential difference, due to the charging, shifts the tunneling peaks which affects the I-V curves considerably. Asymmetrical interaction with the metal leads, e.g. molecule on a metal surface contacted with an STM-tip, also give asymmetrical I-V curves where the potential of the molecule is shown to more closely follow the potential of the surface. Negative differential conductance is discussed in systems consisting of two weakly coupled molecules.

Apport de la microscopie a effet tunnel a la caracterisation d'interfaces molecule-metal a fort transfert de charge

NASA Astrophysics Data System (ADS)

Bedwani, Stephane

To assess the importance of charge-transfer on the interface properties, we studied the interaction of the tetracyanoethylene (TCNE) molecule with various copper surfaces. TCNE, a highly electrophilic molecule, appears as an ideal candidate to study the influence of high charge-transfer on the electronic and structural properties of molecule-surface interfaces. Indeed, various TCNE-transition metal complexes exhibit magnetism at room temperature, which is in agreement with a very significant change of the residual charge on the TCNE molecule. The adsorption of TCNE molecules on Cu(100) and Cu(111) surfaces was studied by scanning tunneling microscopy (STM) and by density functional theory (DFT) calculations with a local density approximation (LDA). DFT-LDA calculations were performed to determine the geometric and electronic structure of the studied interfaces. Mulliken analysis was used to evaluate the partial net charge on the adsorbed species. The density of states (DOS) diagrams provided informations on the nature of the frontier orbitals involved in the charge-transfer at molecule-metal interfaces. To validate the theoretical observations, a comparative study was conducted between our simulated STM images and experimental STM images provided by our collaborators. The theoretical STM images were obtained with the SPAGS-STM software using the Landauer-Buttiker formalism with a semi-empirical Hamiltonian based on the extended Huckel theory (EHT) and parameterized using DFT calculations. During the development of the SPAGS-STM software, we have created a discretization module allowing rapid generation of STM images. This module is based on an adaptive Delaunay meshing scheme to minimize the amount of tunneling current to be computed. The general idea consists into refining the mesh, and therefore the calculations, near large contrast zones rather than over the entire image. The adapted mesh provides an STM image resolution equivalent to that obtained with a

Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

PubMed Central

Boll, Rebecca; Erk, Benjamin; Coffee, Ryan; Trippel, Sebastian; Kierspel, Thomas; Bomme, Cédric; Bozek, John D.; Burkett, Mitchell; Carron, Sebastian; Ferguson, Ken R.; Foucar, Lutz; Küpper, Jochen; Marchenko, Tatiana; Miron, Catalin; Patanen, Minna; Osipov, Timur; Schorb, Sebastian; Simon, Marc; Swiggers, Michelle; Techert, Simone; Ueda, Kiyoshi; Bostedt, Christoph; Rolles, Daniel; Rudenko, Artem

2016-01-01

Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse. PMID:27051675

Self-consistent-field study of conduction through conjugated molecules

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

2001-07-01

Current-voltage (I-V) characteristics of individual molecules connected by metallic leads are studied theoretically. Using the Pariser-Parr-Pople quantum chemical method to model the molecule enables us to include electron-electron interactions in the Hartree approximation. The self-consistent-field method is used to calculate charging together with other properties for the total system under bias. Thereafter the Landauer formula is used to calculate the current from the transmission amplitudes. The most important parameter to understand charging is the position of the chemical potentials of the leads in relation to the molecular levels. At finite bias, the main part of the potential drop is located at the molecule-lead junctions. Also, the potential of the molecule is shown to partially follow the chemical potential closest to the highest occupied molecular orbital (HOMO). Therefore, the resonant tunneling steps in the I-V curves are smoothed giving a I-V resembling a ``Coulomb-gap.'' However, the charge of the molecule is not quantized since the molecule is small with quite strong interactions with the leads. The calculations predict an increase in the current at the bias corresponding to the energy gap of the molecule irrespective of the metals used in the leads. When the bias is increased further, charge is redistributed from the HOMO level to the lowest unoccupied molecular orbital of the molecule. This gives a step in the I-V curves and a corresponding change in the potential profile over the molecule. Calculations were mainly performed on polyene molecules. Molecules asymmetrically coupled to the leads model the I-V curves for molecules contacted by a scanning tunneling microscopy tip. I-V curves for pentapyrrole and another molecule that show negative differential conductance are also analyzed. The charging of these two systems depends on the shape of the molecular wave functions.

Single-molecule DNA detection with an engineered MspA protein nanopore

PubMed Central

Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

2008-01-01

Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

Molecules Without Atoms

NASA Astrophysics Data System (ADS)

Ruth, Anthony; Collins, Laura; Gomes, Kenjiro; Janko, Boldizsar

We present a real-space representation of molecules which results in the normal bonding rules and electronic structure of chemistry without atom-centered coulomb potentials. Using a simple mapping, we can generate atomless molecules from the structure of real molecules. Additionally, molecules without atoms show similar covalent bonding energies and transfer of charge in ionic bonds as real molecules. The atomless molecules contain only the valence and conduction electronic structure of the real molecule. Using the framework of the Atoms in Molecules (AIM) theory of Bader, we prove that the topological features of the valence charge distribution of molecules without atoms are identical to that of real molecules. In particular, the charge basins of atomless molecules show identical location and quantities of representative charge. We compare the accuracy, computational cost, and intuition gained from electronic structure calculations of molecules without atoms with the use of pseudopotentials to represent atomic cores in density functional theory. A. R. acknowledges support from a NASA Space Technology Research Fellowship.

Influence of charge on encapsulation and release behavior of small molecules in self-assembled layer-by-layer microcapsules.

PubMed

Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K

2014-12-01

The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.

Treatment of Gram-negative bacterial infections by potentiation of antibiotics.

PubMed

Zabawa, Thomas P; Pucci, Michael J; Parr, Thomas R; Lister, Troy

2016-10-01

Infections caused by antibiotic-resistant pathogens, particularly Gram-negative bacteria, represent significant treatment challenges for physicians resulting in high rates of morbidity and mortality. The outer membrane of Gram-negative bacteria acts as a permeability barrier to many compounds that would otherwise be effective antibacterial agents, including those effective against Gram-positive pathogens. Potentiator molecules disrupt this barrier allowing entry of otherwise impermeant molecules, thus providing a strategy to render multi-drug resistant pathogens susceptible to a broader range of antibiotics. Potentiator molecules are cationic and the mechanism of disruption involves interaction with the negatively charged outer membrane. This physical attribute, along with an often high degree of lipophilicity typically endears these molecules with unacceptable toxicity. Presented herein are examples of advanced potentiator molecules being evaluated for use in combination therapy for the treatment of resistant Gram-negative infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

Charge transfer in TATB and HMX under extreme conditions.

PubMed

Zhang, Chaoyang; Ma, Yu; Jiang, Daojian

2012-11-01

Charge transfer is usually accompanied by structural changes in materials under different conditions. However, the charge transfer in energetic materials that are subjected to extreme conditions has seldom been explored by researchers. In the work described here, the charge transfer in single molecules and unit cells of the explosives TATB and HMX under high temperatures and high pressures was investigated by performing static and dynamic calculations using three DFT methods, including the PWC functional of LDA, and the BLYP and PBE functionals of GGA. The results showed that negative charge is transferred from the nitro groups of molecular or crystalline TATB and HMX when they are heated. All DFT calculations for the compressed TATB unit cell indicate that, generally, negative charge transfer occurs to its nitro groups as the compression increases. PWC and PBE calculations for crystalline HMX show that negative charge is first transferred to the nitro groups but, as the compression increases, the negative charge is transferred from the nitro groups. However, the BLYP calculations indicated that there was gradual negative charge transfer to the nitro groups of HMX, similar to the case for TATB. The unrelaxed state of the uniformly compressed TATB causes negative charge to be transferred from its nitro groups, in contrast to what is seen in the relaxed state. Charge transfer in TATB is predicted to occur much more easily than in HMX.

General Method to Determine the Flux of Charged Molecules through Nanopores Applied to β-Lactamase Inhibitors and OmpF.

PubMed

Ghai, Ishan; Pira, Alessandro; Scorciapino, Mariano Andrea; Bodrenko, Igor; Benier, Lorraine; Ceccarelli, Matteo; Winterhalter, Mathias; Wagner, Richard

2017-03-16

A major challenge in the discovery of the new antibiotics against Gram-negative bacteria is to achieve sufficiently fast permeation in order to avoid high doses causing toxic side effects. So far, suitable assays for quantifying the uptake of charged antibiotics into bacteria are lacking. We apply an electrophysiological zero-current assay using concentration gradients of β-lactamase inhibitors combined with single-channel conductance to quantify their flux rates through OmpF. Molecular dynamic simulations provide in addition details on the interactions between the nanopore wall and the charged solutes. In particular, the interaction barrier for three β-lactamase inhibitors is surprisingly as low as 3-5 kcal/mol and only slightly above the diffusion barrier of ions such as chloride. Within our macroscopic constant field model, we determine that at a zero-membrane potential a concentration gradient of 10 μM of avibactam, sulbactam, or tazobactam can create flux rates of roughly 620 molecules/s per OmpF trimer.

Utilization of photoinduced charge-separated state of donor-acceptor-linked molecules for regulation of cell membrane potential and ion transport.

PubMed

Numata, Tomohiro; Murakami, Tatsuya; Kawashima, Fumiaki; Morone, Nobuhiro; Heuser, John E; Takano, Yuta; Ohkubo, Kei; Fukuzumi, Shunichi; Mori, Yasuo; Imahori, Hiroshi

2012-04-11

The control of ion transport across cell membranes by light is an attractive strategy that allows targeted, fast control of precisely defined events in the biological membrane. Here we report a novel general strategy for the control of membrane potential and ion transport by using charge-separation molecules and light. Delivery of charge-separation molecules to the plasma membrane of PC12 cells by a membranous nanocarrier and subsequent light irradiation led to depolarization of the membrane potential as well as inhibition of the potassium ion flow across the membrane. Photoregulation of the cell membrane potential and ion transport by using charge-separation molecules is highly promising for control of cell functions. © 2012 American Chemical Society

Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Shanlin

2014-11-16

Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest thatmore » the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single

Negative charge emission due to excimer laser bombardment of sodium trisilicate glass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langford, S.C.; Jensen, L.C.; Dickinson, J.T.

We describe measurements of negative charge emission accompanying irradiation of sodium trisilicate glass (Na{sub 2}O{center dot}3SiO{sub 2}) with 248-nm excimer laser light at fluences on the order of 2 J/cm{sup 2} per pulse, i.e., at the threshold for ablative etching of the glass surface. The negative charge emission consists of a very prompt photoelectron burst coincident with the laser pulse, followed by a much slower plume of electrons and negative ions traveling with a high density cloud of positive ions, previously identified as primarily Na{sup +}. Using combinations of {bold E} and {bold B} fields in conjunction with time-of-flight methods,more » the negative ions were successfully separated from the plume and tentatively identified as O{sup {minus}}, Si{sup {minus}}, NaO{sup {minus}}, and perhaps NaSi{sup {minus}}. These negative species are probably formed by gas phase collisions in the near-surface region which result in electron attachment.« less

Reorganization energy upon charging a single molecule on an insulator measured by atomic force microscopy

NASA Astrophysics Data System (ADS)

Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard

2018-05-01

Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.

Combinatorial effects of charge characteristics and hydrophobicity of silk fibroin on the sorption and release of charged dyes.

PubMed

Wongpanit, Panya; Rujiravanit, Ratana

2012-01-01

The present study was designed to examine the influence of the charge characteristics of silk fibroin on the sorption and release of charged dyes by varying the pH values of the sorption and release media as well as types of charged dyes. Negatively charged dyes (phenol red and chromotrope 2R) and positively charged dyes (crystal violet and indoine blue) were used as the model compounds. Silk fibroin films were prepared by using a solution casting technique. The prepared films were then treated with an aqueous methanol solution or annealed with water to control their conformation. The sorption behavior of the model compounds made by the methanol-treated and water-annealed silk fibroin films was investigated. Compared to the water- annealed silk fibroin films, a higher hydrophobicity of the methanol-treated silk fibroin films caused a higher sorption of the hydrophobic dyes. The dye molecules had a fairly high affinity to the silk fibroin film, even though the dye and the matrix possessed the same charge. However, in the presence of two charged groups in a single dye molecule, the electrostatic repulsion become more dominant. Stronger interaction was observed when the charges of the film and the dye were opposite. The results of dye sorption and release experiments showed that the degree of synergism or competition between electrostatic and hydrophobic interactions directly depended on the charges and chemical structure of the dye molecules and the environmental pH conditions of the existing silk fibroin film.

Borophene as a Promising Material for Charge-Modulated Switchable CO2 Capture.

PubMed

Tan, Xin; Tahini, Hassan A; Smith, Sean C

2017-06-14

Ideal carbon dioxide (CO 2 ) capture materials for practical applications should bind CO 2 molecules neither too weakly to limit good loading kinetics nor too strongly to limit facile release. Although charge-modulated switchable CO 2 capture has been proposed to be a controllable, highly selective, and reversible CO 2 capture strategy, the development of a practical gas-adsorbent material remains a great challenge. In this study, by means of density functional theory (DFT) calculations, we have examined the possibility of conductive borophene nanosheets as promising sorbent materials for charge-modulated switchable CO 2 capture. Our results reveal that the binding strength of CO 2 molecules on negatively charged borophene can be significantly enhanced by injecting extra electrons into the adsorbent. At saturation CO 2 capture coverage, the negatively charged borophene achieves CO 2 capture capacities up to 6.73 × 10 14 cm -2 . In contrast to the other CO 2 capture methods, the CO 2 capture/release processes on negatively charged borophene are reversible with fast kinetics and can be easily controlled via switching on/off the charges carried by borophene nanosheets. Moreover, these negatively charged borophene nanosheets are highly selective for separating CO 2 from mixtures with CH 4 , H 2 , and/or N 2 . This theoretical exploration will provide helpful guidance for identifying experimentally feasible, controllable, highly selective, and high-capacity CO 2 capture materials with ideal thermodynamics and reversibility.

Building better water models using the shape of the charge distribution of a water molecule

NASA Astrophysics Data System (ADS)

Dharmawardhana, Chamila Chathuranga; Ichiye, Toshiko

2017-11-01

The unique properties of liquid water apparently arise from more than just the tetrahedral bond angle between the nuclei of a water molecule since simple three-site models of water are poor at mimicking these properties in computer simulations. Four- and five-site models add partial charges on dummy sites and are better at modeling these properties, which suggests that the shape of charge distribution is important. Since a multipole expansion of the electrostatic potential describes a charge distribution in an orthogonal basis set that is exact in the limit of infinite order, multipoles may be an even better way to model the charge distribution. In particular, molecular multipoles up to the octupole centered on the oxygen appear to describe the electrostatic potential from electronic structure calculations better than four- and five-site models, and molecular multipole models give better agreement with the temperature and pressure dependence of many liquid state properties of water while retaining the computational efficiency of three-site models. Here, the influence of the shape of the molecular charge distribution on liquid state properties is examined by correlating multipoles of non-polarizable water models with their liquid state properties in computer simulations. This will aid in the development of accurate water models for classical simulations as well as in determining the accuracy needed in quantum mechanical/molecular mechanical studies and ab initio molecular dynamics simulations of water. More fundamentally, this will lead to a greater understanding of how the charge distribution of a water molecule leads to the unique properties of liquid water. In particular, these studies indicate that p-orbital charge out of the molecular plane is important.

Frequency-Dependent Capacitance of Hydrophobic Membranes Containing Fixed Negative Charges

PubMed Central

Ilani, Asher

1968-01-01

Filters containing fixed negative charges were saturated with hydrophobic solvent and interposed between aqueous solutions. The capacitance of such membranes was measured in the frequency range of 0.05-30 kc. The capacitance increased with decrease in frequency. The frequency dependence of the capacitance was sensitive to nature of the cation present and to salt concentration in the aqueous solution. It is suggested that variation of membrane resistivity in the space charge region of the membrane is responsible for this phenomenon. Possible effects of the potential and counterion concentration profiles at the membrane-water interface are discussed. PMID:5699796

Dissociation of methane on the surface of charged defective carbon nanotubes

NASA Astrophysics Data System (ADS)

Guo, Z. H.; Yan, X. H.; Xiao, Y.

2010-03-01

Based on the framework of density functional theory (CASTEP and DMOL 3 codes), we simulate the dissociation of methane (CH 4) molecule on the surface of charged defective carbon nanotubes (CNTs). The results display that a charged CNT with carbon (C) and molybdenum (Mo) dopants can effectively dissociate CH 4 molecule, and the adsorption strength of H and CH 3 can be controlled by the injected negative charges. Moreover, the barrier between the transition state (TS) and the reactant is 0.1014 eV, and a single imaginary frequency of -0.3 cm is found for the transition state structure.

Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

NASA Astrophysics Data System (ADS)

Gowda, Srivardhan Shivappa

Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

EUV emission spectra in collisions of highly charged tantalum ions with nitrogen and oxygen molecules

NASA Astrophysics Data System (ADS)

Tanuma, Hajime; Numadate, Naoki; Uchikura, Yoshiyuki; Shimada, Kento; Akutsu, Takuto; Long, Elaine; O'Sullivan, Gerry

2017-10-01

We have performed ion beam collision experiments using multiply charged tantalum ions and observed EUV (extreme ultra-violet) emission spectra in collisions of ions with molecular targets, N2 and O2. Broad UTAs (un-resolved transition arrays) from multiply charged Ta ions were observed, and the mean wavelengths of the UTAs shifted and became shorter at higher charge statea of Ta ions. These UTAs may be attributed to the 4f-5d and 4f-5g transitions. Not only the UTA emission from incident ions, but also the sharp emission lines from multiply charged fragment atomic ions were observed. Production of temporary highly charged molecular ions, their kinetic energy and fragmentation processes have been investigated with coincident detection technique. However, the observation of emission from the fragments might be for the first time. The formation mechanisms of the multiply charged fragment atomic ions from target molecules are discussed.

Positronium ions and molecules

NASA Technical Reports Server (NTRS)

Ho, Y. K.

1990-01-01

Recent theoretical studies on positronium ions and molecules are discussed. A positronium ion is a three particle system consisting of two electrons in singlet spin state, and a positron. Recent studies include calculations of its binding energy, positron annihilation rate, and investigations of its doubly excited resonant states. A positronium molecule is a four body system consisting of two positrons and two electrons in an overall singlet spin state. The recent calculations of its binding energy against the dissociation into two positronium atoms, and studies of auto-detaching states in positronium molecules are discussed. These auto-dissociating states, which are believed to be part of the Rydberg series as a result of a positron attaching to a negatively charged positronium ion, Ps-, would appear as resonances in Ps-Ps scattering.

Negatively Charged Lipid Membranes Promote a Disorder-Order Transition in the Yersinia YscU Protein

PubMed Central

Weise, Christoph F.; Login, Frédéric H.; Ho, Oanh; Gröbner, Gerhard; Wolf-Watz, Hans; Wolf-Watz, Magnus

2014-01-01

The inner membrane of Gram-negative bacteria is negatively charged, rendering positively charged cytoplasmic proteins in close proximity likely candidates for protein-membrane interactions. YscU is a Yersinia pseudotuberculosis type III secretion system protein crucial for bacterial pathogenesis. The protein contains a highly conserved positively charged linker sequence that separates membrane-spanning and cytoplasmic (YscUC) domains. Although disordered in solution, inspection of the primary sequence of the linker reveals that positively charged residues are separated with a typical helical periodicity. Here, we demonstrate that the linker sequence of YscU undergoes a largely electrostatically driven coil-to-helix transition upon binding to negatively charged membrane interfaces. Using membrane-mimicking sodium dodecyl sulfate micelles, an NMR derived structural model reveals the induction of three helical segments in the linker. The overall linker placement in sodium dodecyl sulfate micelles was identified by NMR experiments including paramagnetic relaxation enhancements. Partitioning of individual residues agrees with their hydrophobicity and supports an interfacial positioning of the helices. Replacement of positively charged linker residues with alanine resulted in YscUC variants displaying attenuated membrane-binding affinities, suggesting that the membrane interaction depends on positive charges within the linker. In vivo experiments with bacteria expressing these YscU replacements resulted in phenotypes displaying significantly reduced effector protein secretion levels. Taken together, our data identify a previously unknown membrane-interacting surface of YscUC that, when perturbed by mutations, disrupts the function of the pathogenic machinery in Yersinia. PMID:25418176

Negatively charged lipid membranes promote a disorder-order transition in the Yersinia YscU protein.

PubMed

Weise, Christoph F; Login, Frédéric H; Ho, Oanh; Gröbner, Gerhard; Wolf-Watz, Hans; Wolf-Watz, Magnus

2014-10-21

The inner membrane of Gram-negative bacteria is negatively charged, rendering positively charged cytoplasmic proteins in close proximity likely candidates for protein-membrane interactions. YscU is a Yersinia pseudotuberculosis type III secretion system protein crucial for bacterial pathogenesis. The protein contains a highly conserved positively charged linker sequence that separates membrane-spanning and cytoplasmic (YscUC) domains. Although disordered in solution, inspection of the primary sequence of the linker reveals that positively charged residues are separated with a typical helical periodicity. Here, we demonstrate that the linker sequence of YscU undergoes a largely electrostatically driven coil-to-helix transition upon binding to negatively charged membrane interfaces. Using membrane-mimicking sodium dodecyl sulfate micelles, an NMR derived structural model reveals the induction of three helical segments in the linker. The overall linker placement in sodium dodecyl sulfate micelles was identified by NMR experiments including paramagnetic relaxation enhancements. Partitioning of individual residues agrees with their hydrophobicity and supports an interfacial positioning of the helices. Replacement of positively charged linker residues with alanine resulted in YscUC variants displaying attenuated membrane-binding affinities, suggesting that the membrane interaction depends on positive charges within the linker. In vivo experiments with bacteria expressing these YscU replacements resulted in phenotypes displaying significantly reduced effector protein secretion levels. Taken together, our data identify a previously unknown membrane-interacting surface of YscUC that, when perturbed by mutations, disrupts the function of the pathogenic machinery in Yersinia.

The Holographic Electron Density Theorem, de-quantization, re-quantization, and nuclear charge space extrapolations of the Universal Molecule Model

NASA Astrophysics Data System (ADS)

Mezey, Paul G.

2017-11-01

Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.

High brilliance negative ion and neutral beam source

DOEpatents

Compton, Robert N.

1991-01-01

A high brilliance mass selected (Z-selected) negative ion and neutral beam source having good energy resolution. The source is based upon laser resonance ionization of atoms or molecules in a small gaseous medium followed by charge exchange through an alkali oven. The source is capable of producing microampere beams of an extremely wide variety of negative ions, and milliampere beams when operated in the pulsed mode.

Topology of charge density of flucytosine and related molecules and characteristics of their bond charge distributions.

PubMed

Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda

2006-08-24

The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.

Unconventional molecule-resolved current rectification in diamondoid–fullerene hybrids

PubMed Central

Randel, Jason C.; Niestemski, Francis C.; Botello-Mendez, Andrés R.; Mar, Warren; Ndabashimiye, Georges; Melinte, Sorin; Dahl, Jeremy E. P.; Carlson, Robert M. K.; Butova, Ekaterina D.; Fokin, Andrey A.; Schreiner, Peter R.; Charlier, Jean-Christophe; Manoharan, Hari C.

2014-01-01

The unimolecular rectifier is a fundamental building block of molecular electronics. Rectification in single molecules can arise from electron transfer between molecular orbitals displaying asymmetric spatial charge distributions, akin to p–n junction diodes in semiconductors. Here we report a novel all-hydrocarbon molecular rectifier consisting of a diamantane–C60 conjugate. By linking both sp3 (diamondoid) and sp2 (fullerene) carbon allotropes, this hybrid molecule opposingly pairs negative and positive electron affinities. The single-molecule conductances of self-assembled domains on Au(111), probed by low-temperature scanning tunnelling microscopy and spectroscopy, reveal a large rectifying response of the molecular constructs. This specific electronic behaviour is postulated to originate from the electrostatic repulsion of diamantane–C60 molecules due to positively charged terminal hydrogen atoms on the diamondoid interacting with the top electrode (scanning tip) at various bias voltages. Density functional theory computations scrutinize the electronic and vibrational spectroscopic fingerprints of this unique molecular structure and corroborate the unconventional rectification mechanism. PMID:25202942

Negative Ion CID Fragmentation of O-linked Oligosaccharide Aldoses—Charge Induced and Charge Remote Fragmentation

NASA Astrophysics Data System (ADS)

Doohan, Roisin A.; Hayes, Catherine A.; Harhen, Brendan; Karlsson, Niclas Göran

2011-06-01

Collision induced dissociation (CID) fragmentation was compared between reducing and reduced sulfated, sialylated, and neutral O-linked oligosaccharides. It was found that fragmentation of the [M - H]- ions of aldoses with acidic residues gave unique Z-fragmentation of the reducing end GalNAc containing the acidic C-6 branch, where the entire C-3 branch was lost. This fragmentation pathway, which is not seen in the alditols, showed that the process involved charge remote fragmentation catalyzed by a reducing end acidic anomeric proton. With structures containing sialic acid on both the C-3 and C-6 branch, the [M - H]- ions were dominated by the loss of sialic acid. This fragmentation pathway was also pronounced in the [M - 2H]2- ions revealing both the C-6 Z-fragment plus its complementary C-3 C-fragment in addition to glycosidic and cross ring fragmentation. This generation of the Z/C-fragment pairs from GalNAc showed that the charges were not participating in their generation. Fragmentation of neutral aldoses showed pronounced Z-fragmentation believed to be generated by proton migration from the C-6 branch to the negatively charged GalNAc residue followed by charge remote fragmentation similar to the acidic oligosaccharides. In addition, A-type fragments generated by charge induced fragmentation of neutral oligosaccharides were observed when the charge migrated from C-1 of the GalNAc to the GlcNAc residue followed by rearrangement to accommodate the 0,2A-fragmentation. LC-MS also showed that O-linked aldoses existed as interchangeable α/β pyranose anomers, in addition to a third isomer (25% of the total free aldose) believed to be the furanose form.

Numerical modelling of needle-grid electrodes for negative surface corona charging system

NASA Astrophysics Data System (ADS)

Zhuang, Y.; Chen, G.; Rotaru, M.

2011-08-01

Surface potential decay measurement is a simple and low cost tool to examine electrical properties of insulation materials. During the corona charging stage, a needle-grid electrodes system is often used to achieve uniform charge distribution on the surface of the sample. In this paper, a model using COMSOL Multiphysics has been developed to simulate the gas discharge. A well-known hydrodynamic drift-diffusion model was used. The model consists of a set of continuity equations accounting for the movement, generation and loss of charge carriers (electrons, positive and negative ions) coupled with Poisson's equation to take into account the effect of space and surface charges on the electric field. Four models with the grid electrode in different positions and several mesh sizes are compared with a model that only has the needle electrode. The results for impulse current and surface charge density on the sample clearly show the effect of the extra grid electrode with various positions.

Exploring Charge Transport in Guest Molecule Infiltrated Cu 3(BTC) 2 Metal Organic Framework

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leonard, Francois Leonard; Stavila, Vitalie; Allendorf, Mark D.

2014-09-01

The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu 3(BTC) 2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu 3(BTC) 2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holesmore » are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.« less

The effect of surface charge, negative and bipolar ionization on the deposition of airborne bacteria.

PubMed

Meschke, S; Smith, B D; Yost, M; Miksch, R R; Gefter, P; Gehlke, S; Halpin, H A

2009-04-01

A series of experiments were conducted to evaluate the effect of surface charge and air ionization on the deposition of airborne bacteria. The interaction between surface electrostatic potential and the deposition of airborne bacteria in an indoor environment was investigated using settle plates charged with electric potentials of 0, +/-2.5kV and +/-5kV. Results showed that bacterial deposition on the plates increased proportionally with increased potential to over twice the gravitational sedimentation rate at +5kV. Experiments were repeated under similar conditions in the presence of either negative or bipolar air ionization. Bipolar air ionization resulted in reduction of bacterial deposition onto the charged surfaces to levels nearly equal to gravitational sedimentation. In contrast, diffusion charging appears to have occurred during negative air ionization, resulting in an even greater deposition onto the oppositely charged surface than observed without ionization. Static charges on fomitic surfaces may attract bacteria resulting in deposition in excess of that expected by gravitational sedimentation or simple diffusion. Implementation of bipolar ionization may result in reduction of bacterial deposition. Fomitic surfaces are important vehicles for the transmission of infectious organisms. This study has demonstrated a simple strategy for minimizing charge related deposition of bacteria on surfaces.

Prominent dominant negative effect of a mutant Fas molecule lacking death domain on cell-mediated induction of apoptosis.

PubMed

Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata

2005-01-01

Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.

Gas-Phase Stability of Negatively Charged Organophosphate Metabolites Produced by Electrospray Ionization and Matrix-Assisted Laser Desorption/Ionization

NASA Astrophysics Data System (ADS)

Asakawa, Daiki; Mizuno, Hajime; Toyo'oka, Toshimasa

2017-12-01

The formation mechanisms of singly and multiply charged organophosphate metabolites by electrospray ionization (ESI) and their gas phase stabilities were investigated. Metabolites containing multiple phosphate groups, such as adenosine 5'-diphosphate (ADP), adenosine 5'-triphosphate (ATP), and D- myo-inositol-1,4,5-triphosphate (IP3) were observed as doubly deprotonated ions by negative-ion ESI mass spectrometry. Organophosphates with multiple negative charges were found to be unstable and often underwent loss of PO3 -, although singly deprotonated analytes were stable. The presence of fragments due to the loss of PO3 - in the negative-ion ESI mass spectra could result in the misinterpretation of analytical results. In contrast to ESI, matrix-assisted laser desorption ionization (MALDI) produced singly charged organophosphate metabolites with no associated fragmentation, since the singly charged anions are stable. The stability of an organophosphate metabolite in the gas phase strongly depends on its charge state. The fragmentations of multiply charged organophosphates were also investigated in detail through density functional theory calculations. [Figure not available: see fulltext.

X-ray Pump–Probe Investigation of Charge and Dissociation Dynamics in Methyl Iodine Molecule

DOE PAGES

Fang, Li; Xiong, Hui; Kukk, Edwin; ...

2017-05-19

Molecular dynamics is of fundamental interest in natural science research. The capability of investigating molecular dynamics is one of the various motivations for ultrafast optics. Here, we present our investigation of photoionization and nuclear dynamics in methyl iodine (CH 3I) molecule with an X-ray pump X-ray probe scheme. The pump–probe experiment was realized with a two-mirror X-ray split and delay apparatus. Time-of-flight mass spectra at various pump–probe delay times were recorded to obtain the time profile for the creation of high charge states via sequential ionization and for molecular dissociation. We observed high charge states of atomic iodine up tomore » 29+, and visualized the evolution of creating these high atomic ion charge states, including their population suppression and enhancement as the arrival time of the second X-ray pulse was varied. We also show the evolution of the kinetics of the high charge states upon the timing of their creation during the ionization-dissociation coupled dynamics. We demonstrate the implementation of X-ray pump–probe methodology for investigating X-ray induced molecular dynamics with femtosecond temporal resolution. The results indicate the footprints of ionization that lead to high charge states, probing the long-range potential curves of the high charge states.« less

The role of negatively charged lipids in lysosomal phospholipase A2 function

PubMed Central

Abe, Akira; Shayman, James A.

2009-01-01

Lysosomal phospholipase A2 (LPLA2) is characterized by increased activity toward zwitterionic phospholipid liposomes containing negatively charged lipids under acidic conditions. The effect of anionic lipids on LPLA2 activity was investigated. Mouse LPLA2 activity was assayed as C2-ceramide transacylation. Sulfatide incorporated into liposomes enhanced LPLA2 activity under acidic conditions and was weakened by NaCl or increased pH. Amiodarone, a cationic amphiphilic drug, reduced LPLA2 activity. LPLA2 exhibited esterase activity when p-nitro-phenylbutyrate (pNPB) was used as a substrate. Unlike the phospholipase A2 activity, the esterase activity was detected over wide pH range and not inhibited by NaCl or amiodarone. Presteady-state kinetics using pNPB were consistent with the formation of an acyl-enzyme intermediate. C2-ceramide was an acceptor for the acyl group of the acyl-enzyme but was not available as the acyl group acceptor when dispersed in liposomes containing amiodarone. Cosedimentation of LPLA2 with liposomes was enhanced in the presence of sulfatide and was reduced by raising NaCl, amiodarone, or pH in the reaction mixture. LPLA2 adsorption to negatively charged lipid membrane surfaces through an electrostatic attraction, therefore, enhances LPLA2 enzyme activity toward insoluble substrates. Thus, anionic lipids present within lipid membranes enhance the rate of phospholipid hydrolysis by LPLA2 at lipid-water interfaces.—Abe, A., and J. A. Shayman. The role of negatively charged lipids in lysosomal phospholipase A2 function. PMID:19321879

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Controlled synthesis and inclusion ability of a hyaluronic acid derivative bearing beta-cyclodextrin molecules.

PubMed

Charlot, Aurélia; Heyraud, Alain; Guenot, Pierre; Rinaudo, Marguerite; Auzély-Velty, Rachel

2006-03-01

A new synthetic route to beta-cyclodextrin-linked hyaluronic acid (HA-CD) was developed. This was based on the preparation of a HA derivative selectively modified with adipic dihydrazide (HA-ADH) and a beta-cyclodextrin derivative possessing an aldehyde function on the primary face, followed by their coupling by a reductive amination-type reaction. The CD-polysaccharide was fully characterized in terms of chemical integrity and purity by high-resolution NMR spectroscopy. The complexation ability of the grafted CD was further demonstrated by isothermal titration calorimetry using sodium adamantane acetate (ADAc) and Ibuprofen as model guest molecules. The thermodynamic parameters for the complexation of these negatively charged guest molecules by the beta-CD grafted on negatively charged HA were shown to be largely influenced by the ionic strength of the aqueous medium.

Excitation of Kelvin Helmholtz instability by an ion beam in a plasma with negatively charged dust grains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rani, Kavita; Sharma, Suresh C.

2015-02-15

An ion beam propagating through a magnetized dusty plasma drives Kelvin Helmholtz Instability (KHI) via Cerenkov interaction. The frequency of the unstable wave increases with the relative density of negatively charged dust grains. It is observed that the beam has stabilizing effect on the growth rate of KHI for low shear parameter, but for high shear parameter, the instability is destabilized with relative density of negatively charged dust grains.

Human fibrinogen adsorption on positively charged latex particles.

PubMed

Zeliszewska, Paulina; Bratek-Skicki, Anna; Adamczyk, Zbigniew; Cieśla, Michał

2014-09-23

Fibrinogen (Fb) adsorption on positively charged latex particles (average diameter of 800 nm) was studied using the microelectrophoretic and the concentration depletion methods based on AFM imaging. Monolayers on latex were adsorbed from diluted bulk solutions at pH 7.4 and an ionic strength in the range of 10(-3) to 0.15 M where fibrinogen molecules exhibited an average negative charge. The electrophoretic mobility of the latex after controlled fibrinogen adsorption was systematically measured. A monotonic decrease in the electrophoretic mobility of fibrinogen-covered latex was observed for all ionic strengths. The results of these experiments were interpreted according to the three-dimensional electrokinetic model. It was also determined using the concentration depletion method that fibrinogen adsorption was irreversible and the maximum coverage was equal to 0.6 mg m(-2) for ionic strength 10(-3) M and 1.3 mg m(-2) for ionic strength 0.15 M. The increase of the maximum coverage was confirmed by theoretical modeling based on the random sequential adsorption approach. Paradoxically, the maximum coverage of fibrinogen on positively charged latex particles was more than two times lower than the maximum coverage obtained for negative latex particles (3.2 mg m(-2)) at pH 7.4 and ionic strength of 0.15 M. This was interpreted as a result of the side-on adsorption of fibrinogen molecules with their negatively charged core attached to the positively charged latex surface. The stability and acid base properties of fibrinogen monolayers on latex were also determined in pH cycling experiments where it was observed that there were no irreversible conformational changes in the fibrinogen monolayers. Additionally, the zeta potential of monolayers was more positive than the zeta potential of fibrinogen in the bulk, which proves a heterogeneous charge distribution. These experimental data reveal a new, side-on adsorption mechanism of fibrinogen on positively charged surfaces and

High negative charge of a dust particle in a hot cathode discharge.

PubMed

Arnas, C; Mikikian, M; Doveil, F

1999-12-01

Dust particle levitation experiments in a plasma produced by a hot filament discharge, operating at low argon pressure, are presented. The basic characteristics of a dust grain trapped in a plate sheath edge in these experimental conditions are reported. Taking into account the sheath potential profiles measured with a differential emissive probe diagnostic, the forces applied to an isolated dust grain can be determined. Two different experimental methods yield approximately the same value for the dust charge. The observed high negative charge is mainly due to the contribution of the primary electrons emitted by the filaments as predicted by a simple model.

Diffusion of flexible, charged, nanoscopic molecules in solution: Size and pH dependence for PAMAM dendrimer

NASA Astrophysics Data System (ADS)

Maiti, Prabal K.; Bagchi, Biman

2009-12-01

In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.

Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules

PubMed Central

Nims, Robert J.; Maas, Steve; Weiss, Jeffrey A.

2014-01-01

Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio (www.febio.org). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the

Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules.

PubMed

Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A

2014-10-01

Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the

Ionization Efficiency of Doubly Charged Ions Formed from Polyprotic Acids in Electrospray Negative Mode

NASA Astrophysics Data System (ADS)

Liigand, Piia; Kaupmees, Karl; Kruve, Anneli

2016-07-01

The ability of polyprotic acids to give doubly charged ions in negative mode electrospray was studied and related to physicochemical properties of the acids via linear discriminant analysis (LDA). It was discovered that the compound has to be strongly acidic (low p K a1 and p K a2) and to have high hydrophobicity (log P ow) to become multiply charged. Ability to give multiply charged ions in ESI/MS cannot be directly predicted from the solution phase acidities. Therefore, for the first time, a quantitative model to predict the charge state of the analyte in ESI/MS is proposed and validated for small anions. Also, a model to predict ionization efficiencies of these analytes was developed. Results indicate that acidity of the analyte, its octanol-water partition coefficient, and charge delocalization are important factors that influence ionization efficiencies as well as charge states of the analytes. The pH of the solvent was also found to be an important factor influencing the ionization efficiency of doubly charged ions.

Influence of molecular shape, conformability, net surface charge, and tissue interaction on transscleral macromolecular diffusion.

PubMed

Srikantha, Nishanthan; Mourad, Fatma; Suhling, Klaus; Elsaid, Naba; Levitt, James; Chung, Pei Hua; Somavarapu, Satyanarayana; Jackson, Timothy L

2012-09-01

The purpose of this study was to investigate the influence of molecular shape, conformability, net surface charge and tissue interaction on transscleral diffusion. Unfixed, porcine sclera was clamped in an Ussing chamber. Fluorophore-labelled neutral albumin, neutral dextran, or neutral ficoll were placed in one hemi-chamber and the rate of transscleral diffusion was measured over 24 h using a spectrophotometer. Experiments were repeated using dextrans and ficoll with positive or negative net surface charges. Fluorescence recovery after photobleaching (FRAP) was undertaken to compare transscleral diffusion with diffusion through a solution. All molecules were 70 kDa. With FRAP, the diffusion coefficient (D) of neutral molecules was highest for albumin, followed by ficoll, then dextran (p < 0.0001). Positive dextrans diffused fastest, followed by negative, then neutral dextrans (p = 0.0004). Neutral ficoll diffused the fastest, followed by positive then negative ficoll (p = 0.5865). For the neutral molecules, transscleral D was highest for albumin, followed by dextran, then ficoll (p < 0.0001). D was highest for negative ficoll, followed by neutral, then positive ficoll (p < 0.0001). By contrast, D was highest for positive dextran, followed by neutral, then negative dextran (p = 0.0021). In conclusion, diffusion in free solution does not predict transscleral diffusion and the molecular-tissue interaction is important. Molecular size, shape, and charge may all markedly influence transscleral diffusion, as may conformability to a lesser degree, but their effects may be diametrically opposed in different molecules, and their influence on diffusion is more complex than previously thought. Each variable cannot be considered in isolation, and the interplay of all these variables needs to be tested, when selecting or designing drugs for transscleral delivery. Copyright © 2012 Elsevier Ltd. All rights reserved.

Atomic charge transfer-counter polarization effects determine infrared CH intensities of hydrocarbons: a quantum theory of atoms in molecules model.

PubMed

Silva, Arnaldo F; Richter, Wagner E; Meneses, Helen G C; Bruns, Roy E

2014-11-14

Atomic charge transfer-counter polarization effects determine most of the infrared fundamental CH intensities of simple hydrocarbons, methane, ethylene, ethane, propyne, cyclopropane and allene. The quantum theory of atoms in molecules/charge-charge flux-dipole flux model predicted the values of 30 CH intensities ranging from 0 to 123 km mol(-1) with a root mean square (rms) error of only 4.2 km mol(-1) without including a specific equilibrium atomic charge term. Sums of the contributions from terms involving charge flux and/or dipole flux averaged 20.3 km mol(-1), about ten times larger than the average charge contribution of 2.0 km mol(-1). The only notable exceptions are the CH stretching and bending intensities of acetylene and two of the propyne vibrations for hydrogens bound to sp hybridized carbon atoms. Calculations were carried out at four quantum levels, MP2/6-311++G(3d,3p), MP2/cc-pVTZ, QCISD/6-311++G(3d,3p) and QCISD/cc-pVTZ. The results calculated at the QCISD level are the most accurate among the four with root mean square errors of 4.7 and 5.0 km mol(-1) for the 6-311++G(3d,3p) and cc-pVTZ basis sets. These values are close to the estimated aggregate experimental error of the hydrocarbon intensities, 4.0 km mol(-1). The atomic charge transfer-counter polarization effect is much larger than the charge effect for the results of all four quantum levels. Charge transfer-counter polarization effects are expected to also be important in vibrations of more polar molecules for which equilibrium charge contributions can be large.

Controllable transition from positive space charge to negative space charge in an inverted cylindrical magnetron

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rane, R., E-mail: ramu@ipr.res.in; Ranjan, M.; Mukherjee, S.

2016-01-15

The combined effect of magnetic field (B), gas pressure (P), and the corresponding discharge voltage on the discharge properties of argon in inverted cylindrical magnetron has been investigated. In the experiment, anode is biased with continuous 10 ms sinusoidal half wave. It is observed that at a comparatively higher magnetic field (i.e., >200 gauss) and lower operating pressure (i.e., <1 × 10{sup −3} mbar), the discharge extinguishes and demands a high voltage to reignite. Discharge current increases with increase in magnetic field and starts reducing at sufficiently higher magnetic field for a particular discharge voltage due to restricted electron diffusion towards the anode.more » It is observed that B/P ratio plays an important role in sustaining the discharge and is constant for a discharge voltage. The discharge is transformed to negative space charge regime from positive space charge regime at certain B/P ratio and this ratio varies linearly with the discharge voltage. The space charge reversal is indicated by the radial profile of the floating potential and plasma potential in between two electrodes for different magnetic fields. At a particular higher magnetic field (beyond 100 gauss), the floating potential increases gradually with the radial distance from cathode, whereas it remains almost constant at lower magnetic field.« less

Single-molecule interfacial electron transfer dynamics in solar energy conversion

NASA Astrophysics Data System (ADS)

Dhital, Bharat

This dissertation work investigated the parameters affecting the interfacial electron transfer (ET) dynamics in dye-semiconductor nanoparticles (NPs) system by using single-molecule fluorescence spectroscopy and imaging combined with electrochemistry. The influence of the molecule-substrate electronic coupling, the molecular structure, binding geometry on the surface and the molecule-attachment surface chemistry on interfacial charge transfer processes was studied on zinc porphyrin-TiO2 NP systems. The fluorescence blinking measurement on TiO2 NP demonstrated that electronic coupling regulates dynamics of charge transfer processes at the interface depending on the conformation of molecule on the surface. Moreover, semiconductor surface charge induced electronic coupling of molecule which is electrostatically adsorbed on the semiconductor surface also predominantly alters the ET dynamics. Furthermore, interfacial electric field and electron accepting state density dependent ET dynamics has been dissected in zinc porphyrin-TiO2 NP system by observing the single-molecule fluorescence blinking dynamics and fluorescence lifetime with and without applied bias. The significant difference in fluorescence fluctuation and lifetime suggested the modulation of charge transfer dynamics at the interface with external electric field perturbation. Quasi-continuous distribution of fluorescence intensity with applied negative potential was attributed to the faster charge recombination due to reduced density of electron accepting states. The driving force and electron accepting state density ET dependent dynamics has also been probed in zinc porphyrin-TiO2 NP and zinc porphyrin-indium tin oxide (ITO) systems. Study of a molecule adsorbed on two different semiconductors (ITO and TiO2), with large difference in electron densities and distinct driving forces, allows us to observe the changes in rates of back electron transfer process reflected by the suppressed fluorescence blinking of

Single charging events on colloidal particles in a nonpolar liquid with surfactant

NASA Astrophysics Data System (ADS)

Schreuer, Caspar; Vandewiele, Stijn; Brans, Toon; Strubbe, Filip; Neyts, Kristiaan; Beunis, Filip

2018-01-01

Electrical charging of colloidal particles in nonpolar liquids due to surfactant additives is investigated intensively, motivated by its importance in a variety of applications. Most methods rely on average electrophoretic mobility measurements of many particles, which provide only indirect information on the charging mechanism. In the present work, we present a method that allows us to obtain direct information on the charging mechanism, by measuring the charge fluctuations on individual particles with a precision higher than the elementary charge using optical trapping electrophoresis. We demonstrate the capabilities of the method by studying the influence of added surfactant OLOA 11000 on the charging of single colloidal PMMA particles in dodecane. The particle charge and the frequency of charging events are investigated both below and above the critical micelle concentration (CMC) and with or without applying a DC offset voltage. It is found that at least two separate charging mechanisms are present below the critical micelle concentration. One mechanism is a process where the particle is stripped from negatively charged ionic molecules. An increase in the charging frequency with increased surfactant concentration suggests a second mechanism that involves single surfactant molecules. Above the CMC, neutral inverse micelles can also be involved in the charging process.

Positive and negative contribution to birefringence in a family of carbonates: A Born effective charges analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jing, Qun; Yang, Guang; Hou, Juan

It is an important topic to investigate the birefringence and reveal the contribution from ions to birefringence because it plays an important role in nonlinear optical materials. In this paper, the birefringence of carbonates with coplanar CO{sub 3} groups were investigated using the first-principles method. The results show that the lead carbonates exhibit relative large birefringence. After detailed investigate the electronic structures, and Born effective charges, the authors find out that anisotropic electron distribution in the CO{sub 3} groups and Pb atoms give positive contribution, while the negative contribution was found from fluorine atoms, meanwhile the Ca, Mg, and Cdmore » atoms give very small contribution to birefringence. - Graphical abstract: Using the DFT and Born effective charges, the birefringence and the contribution of ions were investigated, the positive and negative contribution was found from Pb and F ions, respectively. - Highlights: • Optical properties and Born effective charges of carbonates are investigated. • Lead carbonates exhibit relative large birefringence. • Coplanar CO{sub 3} groups and Pb atoms give positive contribution. • F atoms give negative contribution. • Ca, Mg, and Cd atoms give very small contribution.« less

Photodetachment and Doppler laser cooling of anionic molecules

NASA Astrophysics Data System (ADS)

Gerber, Sebastian; Fesel, Julian; Doser, Michael; Comparat, Daniel

2018-02-01

We propose to extend laser-cooling techniques, so far only achieved for neutral molecules, to molecular anions. A detailed computational study is performed for {{{C}}}2- molecules stored in Penning traps using GPU based Monte Carlo simulations. Two cooling schemes—Doppler laser cooling and photodetachment cooling—are investigated. The sympathetic cooling of antiprotons is studied for the Doppler cooling scheme, where it is shown that cooling of antiprotons to subKelvin temperatures could becomes feasible, with impacts on the field of antimatter physics. The presented cooling schemes also have applications for the generation of cold, negatively charged particle sources and for the sympathetic cooling of other molecular anions.

Optical pumping of electron and nuclear spin in a negatively-charged quantum dot

NASA Astrophysics Data System (ADS)

Bracker, Allan; Gershoni, David; Korenev, Vladimir

2005-03-01

We report optical pumping of electron and nuclear spins in an individual negatively-charged quantum dot. With a bias-controlled heterostructure, we inject one electron into the quantum dot. Intense laser excitation produces negative photoluminescence polarization, which is easily erased by the Hanle effect, demonstrating optical pumping of a long-lived resident electron. The electron spin lifetime is consistent with the influence of nuclear spin fluctuations. Measuring the Overhauser effect in high magnetic fields, we observe a high degree of nuclear spin polarization, which is closely correlated to electron spin pumping.

Fast and straightforward analysis approach of charge transport data in single molecule junctions.

PubMed

Zhang, Qian; Liu, Chenguang; Tao, Shuhui; Yi, Ruowei; Su, Weitao; Zhao, Cezhou; Zhao, Chun; Dappe, Yannick J; Nichols, Richard J; Yang, Li

2018-08-10

In this study, we introduce an efficient data sorting algorithm, including filters for noisy signals, conductance mapping for analyzing the most dominant conductance group and sub-population groups. The capacity of our data analysis process has also been corroborated on real experimental data sets of Au-1,6-hexanedithiol-Au and Au-1,8-octanedithiol-Au molecular junctions. The fully automated and unsupervised program requires less than one minute on a standard PC to sort the data and generate histograms. The resulting one-dimensional and two-dimensional log histograms give conductance values in good agreement with previous studies. Our algorithm is a straightforward, fast and user-friendly tool for single molecule charge transport data analysis. We also analyze the data in a form of a conductance map which can offer evidence for diversity in molecular conductance. The code for automatic data analysis is openly available, well-documented and ready to use, thereby offering a useful new tool for single molecule electronics.

Positively versus negatively charged moral emotion expectancies in adolescence: the role of situational context and the developing moral self.

PubMed

Krettenauer, Tobias; Johnston, Megan

2011-09-01

The study analyses adolescents' positively charged versus negatively charged moral emotion expectancies. Two hundred and five students (M= 14.83 years, SD= 2.21) participated in an interview depicting various situations in which a moral norm was either regarded or transgressed. Emotion expectancies were assessed for specific emotions (pride, guilt) as well as for overall strength and valence. In addition, self-importance of moral values was measured by a questionnaire. Results revealed that positively charged emotion expectancies were more pronounced in contexts of prosocial action than in the context of moral transgressions, whereas the opposite was true for negatively charged emotions. At the same time, expectations of guilt and pride were substantially related to the self-importance of moral values. ©2010 The British Psychological Society.

Adsorption of insulin peptide on charged single-walled carbon nanotubes: significant role of ordered water molecules.

PubMed

Shen, Jia-Wei; Wu, Tao; Wang, Qi; Kang, Yu; Chen, Xin

2009-06-02

Ordered hydration shells: The more ordered hydration shells outside the charged CNT surfaces prevent more compact adsorption of the peptide in the charged CNT systems [picture: see text], but peptide binding strengths on the charged CNT surfaces are stronger due to the electrostatic interaction.Studies of adsorption dynamics and stability for peptides/proteins on single-walled carbon nanotubes (SWNTs) are of great importance for a better understanding of the properties and nature of nanotube-based biosystems. Herein, the dynamics and mechanism of the adsorption of the insulin chain B peptide on different charged SWNTs are investigated by explicit solvent molecular dynamics simulations. The results show that all types of surfaces effectively attract the model peptide. Water molecules play a significant role in peptide adsorption on the surfaces of charged carbon nanotubes (CNTs). Compared to peptide adsorption on neutral CNT surfaces, the more ordered hydration shells outside the tube prevent more compact adsorption of the peptide in charged CNT systems. This shield effect leads to a smaller conformational change and van der Waals interaction between the peptide and surfaces, but peptide binding strengths on charged CNT surfaces are stronger than those on the neutral CNT surface due to the strong electrostatic interaction. The result of these simulations implies the possibility of improving the binding strength of peptides/proteins on CNT surfaces, as well as keeping the integrity of the peptide/protein conformation in peptide/protein-CNT complexes by charging the CNTs.

Charge transfer through amino groups-small molecules interface improving the performance of electroluminescent devices

NASA Astrophysics Data System (ADS)

Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık

2016-05-01

A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.

Negative Differential Resistance in Insulating Systems: From Molecules to Polymers

NASA Astrophysics Data System (ADS)

Pati, Swapan

2007-03-01

We have developed a microscopic theory to explain the negative differential resistance behavior in molecular bridges. This feature has been observed in many molecules with different on/off ratios, sharpness of the current peak and the critical bias. Our theory, based on simple dimer model (both Peierls and donor/acceptor) together with bias driven conformational/ electronic change, covers almost all the experimental characteristics for a large number of real molecular systems and encompasses all the theory that has been known till date. Similar argument is also extended to Mott insulator, where we find a large number of insulator/quasi-metal transitions in finite size chains and a thermodynamic insulator/metal transition in polymers due to the application of static electric field between two ends of the chain. The interplay between charge inhomogenities and electric field induced polarization will be discussed in a number of cases. We will also show that none of these transitions follow Landau-Zener mechanism. I shall also discuss our theoretical proposal for the experimental strategies to stabilize highly unstable and reactive metal clusters like Al4Li4 and their analogs. Reference: 1. S. Lakshmi and Swapan K. Pati, Phys. Rev. B 72, 193410 (2005). 2. S. Lakshmi, Ayan Datta and Swapan K. Pati, Phys. Rev. B 72, 045131 (2005). 3. S. Lakshmi and Swapan K. Pati, Spl on Nanosc and Tech, Pramana, 65, 593. (2005). 4. S. Sengupta, S. Lakshmi and Swapan K Pati, J. Phys. Cond. Mat. 18, 9189 (2006). 5. Swapan K. Pati and S. Ramasesha, J. Phys. Condens. Matter 16, 989 (2004). 6. S.Lakshmi and Swapan K. Pati, J. Chem. Phys. 121, 11998 (2004). 7. S. Dutta, S. Lakshmi and Swapan K Pati, Submitted (2006). 8. A. Datta and Swapan K. Pati, J. Am. Chem. Soc. 127, 3496 (2005). 9. Sairam S. M., A. Datta and Swapan K. Pati, J. Phys. Chem. B 110, 20098 (2006). 10. A. Datta, Sairam S. M. and Swapan K. Pati, Acc. Chem. Res. (to appear)

Electrophoretic separation of gold nanoparticles according to bifunctional molecules-induced charge and size.

PubMed

Kim, Jong-Yeob; Kim, Hyung-Bae; Jang, Du-Jeon

2013-03-01

Gold nanospheres modified with bifunctional molecules have been separated and characterized by using agarose gel electrophoresis as well as optical spectroscopy and electron microscopy. The electrophoretic mobility of a gold nanosphere capped with 11-mercaptoundecanoic acid (MUA) has been found to depend on the number of MUA molecules per gold nanosphere, indicating that it increases with the surface charge of the nanoparticle. The extinction spectrum of gold nanospheres capped with MUA at an MUA molecules per gold nanosphere value of 1000 and connected via 1,6-hexanedithiol (HDT) decreases by 33% in magnitude and shifts to the red as largely as 22 nm with the increase of the molar ratio of HDT to MUA (R(HM)). Gold nanospheres capped with MUA and connected via HDT have been separated successfully using gel electrophoresis and characterized by measuring reflectance spectra of discrete electrophoretic bands directly in the gel and by monitoring transmission electron microscope images of gold nanoparticles collected from the discrete bands. Electrophoretic mobility has been found to decrease substantially with the increment of HDT to MUA, indicating that the size of aggregated gold nanoparticles increases with the concentration of HDT. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MoleCoolQt – a molecule viewer for charge-density research

PubMed Central

Hübschle, Christian B.; Dittrich, Birger

2011-01-01

MoleCoolQt is a molecule viewer for charge-density research. Features include the visualization of local atomic coordinate systems in multipole refinements based on the Hansen and Coppens formalism as implemented, for example, in the XD suite. Residual peaks and holes from XDfft are translated so that they appear close to the nearest atom of the asymmetric unit. Critical points from a topological analysis of the charge density can also be visualized. As in the program MolIso, color-mapped isosurfaces can be generated with a simple interface. Apart from its visualization features the program interactively helps in assigning local atomic coordinate systems and local symmetry, which can be automatically detected and altered. Dummy atoms – as sometimes required for local atomic coordinate systems – are calculated on demand; XD system files are updated after changes. When using the invariom database, potential scattering factor assignment problems can be resolved by the use of an interactive dialog. The following file formats are supported: XD, MoPro, SHELX, GAUSSIAN (com, FChk, cube), CIF and PDB. MoleCoolQt is written in C++ using the Qt4 library, has a user-friendly graphical user interface, and is available for several flavors of Linux, Windows and MacOS. PMID:22477783

Cationic cell-penetrating peptide binds to planar lipid bilayers containing negatively charged lipids but does not induce conductive pores.

PubMed

Gurnev, Philip A; Yang, Sung-Tae; Melikov, Kamran C; Chernomordik, Leonid V; Bezrukov, Sergey M

2013-05-07

Using a cation-selective gramicidin A channel as a sensor of the membrane surface charge, we studied interactions of oligoarginine peptide R9C, a prototype cationic cell-penetrating peptide (CPP), with planar lipid membranes. We have found that R9C sorption to the membrane depends strongly on its lipid composition from virtually nonexistent for membranes made of uncharged lipids to very pronounced for membranes containing negatively charged lipids, with charge overcompensation at R9C concentrations exceeding 1 μM. The sorption was reversible as it was removed by addition of polyanionic dextran sulfate to the membrane bathing solution. No membrane poration activity of R9C (as would be manifested by increased bilayer conductance) was detected in the charged or neutral membranes, including those with asymmetric negative/neutral and negative/positive lipid leaflets. We conclude that interaction of R9C with planar lipid bilayers does not involve pore formation in all studied lipid combinations up to 20 μM peptide concentration. However, R9C induces leakage of negatively charged but not neutral liposomes in a process that involves lipid mixing between liposomes. Our findings suggest that direct traversing of CPPs through the uncharged outer leaflet of the plasma membrane bilayer is unlikely and that permeabilization necessarily involves both anionic lipids and CPP-dependent fusion between opposing membranes. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Communication: Charge-population based dispersion interactions for molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

2016-04-21

We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

Spectroscopy of Charged Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Stinaff, E. A.; Scheibner, M.; Bracker, A. S.; Ponomarev, I. V.; Ware, M. E.; Doty, M. F.; Reinecke, T. L.; Gammon, D.; Korenev, V. L.

2006-03-01

Spins of single charges in quantum dots are attractive for many quantum information and spintronic proposals. Scalable quantum information applications require the ability to entangle and operate on multiple spins in coupled quantum dots (CQDs). To further the understanding of these systems, we present detailed spectroscopic studies of InAs CQDs with control of the discrete electron or hole charging of the system. The optical spectrum reveals a pattern of energy anticrossings and crossings in the photoluminescence as a function of applied electric field. These features can be understood as a superposition of charge and spin configurations of the two dots and represent clear signatures of quantum mechanical coupling. The molecular resonance leading to these anticrossings is achieved at different electric fields for the optically excited (trion) states and the ground (hole) states allowing for the possibility of using the excited states for optically induced coupling of the qubits.

Engrailed negatively regulates the expression of cell adhesion molecules connectin and neuroglian in embryonic Drosophila nervous system.

PubMed

Siegler, M V; Jia, X X

1999-02-01

Engrailed is expressed in subsets of interneurons that do not express Connectin or appreciable Neuroglian, whereas other neurons that are Engrailed negative strongly express these adhesion molecules. Connectin and Neuroglian expression are virtually eliminated in interneurons when engrailed expression is driven ubiquitously in neurons, and greatly increased when engrailed genes are lacking in mutant embryos. The data suggest that Engrailed is normally a negative regulator of Connectin and neuroglian. These are the first two "effector" genes identified in the nervous system of Drosophila as regulatory targets for Engrailed. We argue that differential Engrailed expression is crucial in determining the pattern of expression of cell adhesion molecules and thus constitutes an important determinant of neuronal shape and perhaps connectivity.

Coarse-grained modeling of proline rich protein 1 (PRP-1) in bulk solution and adsorbed to a negatively charged surface.

PubMed

Skepö, Marie; Linse, Per; Arnebrant, Thomas

2006-06-22

Structural properties of the acidic proline rich protein PRP-1 of salivary origin in bulk solution and adsorbed onto a negatively charged surface have been studied by Monte Carlo simulations. A simple model system with focus on electrostatic interactions and short-ranged attractions among the uncharged amino acids has been used. In addition to PRP-1, some mutants were considered to assess the role of the interactions in the systems. Contrary to polyelectrolytes, the protein has a compact structure in salt-free bulk solutions, whereas at high salt concentration the protein becomes more extended. The protein adsorbs to a negatively charged surface, although its net charge is negative. The adsorbed protein displays an extended structure, which becomes more compact upon addition of salt. Hence, the conformational response upon salt addition in the adsorbed state is the opposite as compared to that in bulk solution. The conformational behavior of PRP-1 in bulk solution and at charged surfaces as well as its propensity to adsorb to surfaces with the same net charge are rationalized by the block polyampholytic character of the protein. The presence of a triad of positively charged amino acids in the C-terminal was found to be important for the adsorption of the protein.

Isolated effects of external bath osmolality, solute concentration, and electrical charge on solute transport across articular cartilage.

PubMed

Pouran, Behdad; Arbabi, Vahid; Zadpoor, Amir A; Weinans, Harrie

2016-12-01

The metabolic function of cartilage primarily depends on transport of solutes through diffusion mechanism. In the current study, we use contrast enhanced micro-computed tomography to determine equilibrium concentration of solutes through different cartilage zones and solute flux in the cartilage, using osteochondral plugs from equine femoral condyles. Diffusion experiments were performed with two solutes of different charge and approximately equal molecular weight, namely iodixanol (neutral) and ioxaglate (charge=-1) in order to isolate the effects of solute's charge on diffusion. Furthermore, solute concentrations as well as bath osmolality were changed to isolate the effects of steric hindrance on diffusion. Bath concentration and bath osmolality only had minor effects on the diffusion of the neutral solute through cartilage at the surface, middle and deep zones, indicating that the diffusion of the neutral solute was mainly Fickian. The negatively charged solute diffused considerably slower through cartilage than the neutral solute, indicating a large non-Fickian contribution in the diffusion of charged molecules. The numerical models determined maximum solute flux in the superficial zone up to a factor of 2.5 lower for the negatively charged solutes (charge=-1) as compared to the neutral solutes confirming the importance of charge-matrix interaction in diffusion of molecules across cartilage. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.

Optical pumping and negative luminescence polarization in charged GaAs quantum dots

NASA Astrophysics Data System (ADS)

Shabaev, Andrew; Stinaff, Eric A.; Bracker, Allan S.; Gammon, Daniel; Efros, Alexander L.; Korenev, Vladimir L.; Merkulov, Igor

2009-01-01

Optical pumping of electron spins and negative photoluminescence polarization are observed when interface quantum dots in a GaAs quantum well are excited nonresonantly by circularly polarized light. Both observations can be explained by the formation of long-lived dark excitons through hole spin relaxation in the GaAs quantum well prior to exciton capture. In this model, optical pumping of resident electron spins is caused by capture of dark excitons and recombination in charged quantum dots. Negative polarization results from accumulation of dark excitons in the quantum well and is enhanced by optical pumping. The dark exciton model describes the experimental results very well, including intensity and bias dependence of the photoluminescence polarization and the Hanle effect.

Thermal equilibrium concentrations and effects of negatively charged Ga vacancies in n-type GaAs

NASA Astrophysics Data System (ADS)

Tan, T. Y.; You, H.-M.; Gösele, U. M.

1993-03-01

We have calculated the thermal equilibrium concentrations of the various negatively charged Ga vacancy species in GaAs. The triply-negatively-charged Ga vacancy, V {Ga/3-}, has been emphasized, since it dominates Ga self-diffusion and Ga-Al interdiffusion under intrinsic and n-doping conditions, as well as the diffusion of Si donor atoms occupying Ga sites. Under strong n-doping conditions, the thermal equilibrium V {Ga/3-}concentration, C_{V_{_{Ga} }^{3 - } }^{eq} (n), has been found to exhibit a temperature independence or a negative temperature dependence, i.e., the C_{V_{_{Ga} }^{3 - } }^{eq} (n) value is either unchanged or increases as the temperature is lowered. This is quite contrary to the normal point defect behavior for which the point defect thermal equilibrium concentration decreases as the temperature is lowered. This C_{V_{_{Ga} }^{3 - } }^{eq} (n) property provides explanations to a number of outstanding experimental results, either requiring the interpretation that V {Ga/3-}has attained its thermal equilibrium concentration at the onset of each experiment, or requiring mechanisms involving point defect non-equilibrium phenomena.

Measurement of a linear free energy relationship one molecule at a time

PubMed Central

Rao, B. V.; Kwon, K.-Y.; Liu, A.; Bartels, L.

2004-01-01

A systematic study of the dehydrogenation of substituted thiophenols by controlled charge injection from the tip of a scanning tunneling microscope (STM) reveals a pronounced dependence of the reaction yield on the position and the chemical nature of the substituent. We evaluate the dehydrogenation rate of para-halo-substituted species within a linear free energy relationship, namely the Hammett equation. The resultant ρ value of 1.4 can faithfully predict the reaction rates of molecules that are meta-halo-substituted or para-methyl-substituted. The positive sign of ρ suggests a negatively charged transition state at the core of the STM-induced process, and the magnitude of the ρ value indicates that the presence of the substrate does not preclude substantial substituent effects. The applicability of the Hammett equation to single-molecule chemistry offers facile prediction of the rate of STM-based single-molecule chemistry in a field, which so far has been addressed by focusing on involved quantum-mechanical modeling of its underlying processes. PMID:15601774

Measurement of a linear free energy relationship one molecule at a time.

PubMed

Rao, B V; Kwon, K-Y; Liu, A; Bartels, L

2004-12-28

A systematic study of the dehydrogenation of substituted thiophenols by controlled charge injection from the tip of a scanning tunneling microscope (STM) reveals a pronounced dependence of the reaction yield on the position and the chemical nature of the substituent. We evaluate the dehydrogenation rate of para-halo-substituted species within a linear free energy relationship, namely the Hammett equation. The resultant rho value of 1.4 can faithfully predict the reaction rates of molecules that are meta-halo-substituted or para-methyl-substituted. The positive sign of rho suggests a negatively charged transition state at the core of the STM-induced process, and the magnitude of the rho value indicates that the presence of the substrate does not preclude substantial substituent effects. The applicability of the Hammett equation to single-molecule chemistry offers facile prediction of the rate of STM-based single-molecule chemistry in a field, which so far has been addressed by focusing on involved quantum-mechanical modeling of its underlying processes.

Free-standing few-layered graphene oxide films: selective, steady and lasting permeation of organic molecules with adjustable speeds

NASA Astrophysics Data System (ADS)

Huang, Tao; An, Qi; Luan, Xinglong; Zhang, Qian; Zhang, Yihe

2016-01-01

A variety of small molecules with diameters around 1 nm possess a range of functions, such as antibiotic, antimicrobic, anticoagulant, pesticidal and chemotherapy effects, making these molecules especially useful in various applications ranging from medical treatment to environmental microbiological control. However, the long-term steady delivery (release or permeation) of these small molecules with adjustable and controllable speeds has remained an especially challenging task. In this study, we prepared covalently cross-linked free-standing few-layered GO films using a layer-by-layer technique in combination with photochemical cross-linkages, and achieved a controlled release of positively charged, negatively charged, and zwitterionic small molecules with adjustable and controllable speeds. The steady delivery of the small molecule lasted up to 9 days. Other functionalities, such as graphene-enhanced Raman spectra and electrochemical properties that could also be integrated or employed in delivery systems, were also studied for our films. We expect the special molecular delivery properties of our films to lead to new possibilities in drug/fertilizer delivery and environmental microbiological control applications.A variety of small molecules with diameters around 1 nm possess a range of functions, such as antibiotic, antimicrobic, anticoagulant, pesticidal and chemotherapy effects, making these molecules especially useful in various applications ranging from medical treatment to environmental microbiological control. However, the long-term steady delivery (release or permeation) of these small molecules with adjustable and controllable speeds has remained an especially challenging task. In this study, we prepared covalently cross-linked free-standing few-layered GO films using a layer-by-layer technique in combination with photochemical cross-linkages, and achieved a controlled release of positively charged, negatively charged, and zwitterionic small molecules with

Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

DOE PAGES

Ha, Dong -Gwang; Kim, Jang -Joo; Baldo, Marc A.

2016-04-29

Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl) amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl) benzene (BmPyPb)more » mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. Furthermore, the analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ha, Dong-Gwang; Kim, Jang-Joo; Baldo, Marc A.

2016-04-01

Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl)amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl)benzene (BmPyPb) mixtures withmore » different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

Flight evidence of spacecraft surface contamination rate enhancement by spacecraft charging obtained with a quartz crystal microbalance

NASA Technical Reports Server (NTRS)

Clark, D. M.; Hall, D. F.

1980-01-01

The significance of the fraction of the mass outgassed by a negatively charged space vehicle which is ionized within the vehicle plasma sheath and electrostatically reattracted to the space vehicle was determined. The ML-12 retarding potential analyzer/temperature controlled quartz crystal microbalances (RPA/TQCMs) distinguishes between charged and neutral molecules and investigates contamination mass transport mechanism. Two long term, quick look flight data sets indicate that on the average a significant fraction of mass arriving at one RPA/TQCM is ionized. It is assumed that vehicle frame charging during these periods was approximately uniformly distributed in degree and frequency. It is shown that electrostatic reattraction of ionized molecules is an important contamination mechanism at and near geosynchronous altitudes.

On-Demand Generation of Neutral and Negatively Charged Silicon-Vacancy Centers in Diamond

NASA Astrophysics Data System (ADS)

Dhomkar, Siddharth; Zangara, Pablo R.; Henshaw, Jacob; Meriles, Carlos A.

2018-03-01

Point defects in wide-band-gap semiconductors are emerging as versatile resources for nanoscale sensing and quantum information science, but our understanding of the photoionization dynamics is presently incomplete. Here, we use two-color confocal microscopy to investigate the dynamics of charge in type 1b diamond hosting nitrogen-vacancy (NV) and silicon-vacancy (SiV) centers. By examining the nonlocal fluorescence patterns emerging from local laser excitation, we show that, in the simultaneous presence of photogenerated electrons and holes, SiV (NV) centers selectively transform into the negative (neutral) charge state. Unlike NVs, 532 nm illumination ionizes SiV- via a single-photon process, thus hinting at a comparatively shallower ground state. In particular, slower ionization rates at longer wavelengths suggest the latter lies approximately ˜1.9 eV below the conduction band minimum. Building on the above observations, we demonstrate on-demand SiV and NV charge initialization over large areas via green laser illumination of variable intensity.

Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.

PubMed

Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan

2018-05-07

Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.

Novel colorimetric assay for paraquat detection on-silica bead using negatively charged silver nanoparticles.

PubMed

Siangproh, Weena; Somboonsuk, Thachkorn; Chailapakul, Orawan; Songsrirote, Kriangsak

2017-11-01

A simple, rapid, sensitive, and economical method based on colorimetry for the determination of paraquat, a widely used herbicide, was developed. Citrate-coated silver nanoparticles (AgNPs) were synthesized as the colorimetric probe. The mechanism of the assay is related to the aggregation of negatively charged AgNPs as induced by positively-charged paraquat resulting from coulombic attraction which causes the color to change from a deep greenish yellow to pale yellow in accordance with the concentrations of paraquat. Silica gel was exploited as the paraquat adsorbent for purification and pre-concentration prior to the direct determination with negatively charged AgNPs without the requirement of the elution step. The validity of the proposed approach was evaluated by spiking standard paraquat in water and plant samples. Recoveries of paraquat in water samples were 93.6% and 95.4% for groundwater and canal water, respectively, while those in plant samples were 89.5% and 86.6% for Chinese cabbage and green apple, respectively,after using the optimized extraction procedure. The absorbance of AgNPs at 400nm was linearly related to the concentration of paraquat over the range of 0.05-50mgL -1 , with detection limits of 0.05mgL -1 for water samples, and 0.10mgL -1 for plant samples by naked eye determination. Copyright © 2017 Elsevier B.V. All rights reserved.

Charge Separation and Triplet Exciton Formation Pathways in Small-Molecule Solar Cells as Studied by Time-Resolved EPR Spectroscopy

DOE PAGES

Thomson, Stuart A. J.; Niklas, Jens; Mardis, Kristy L.; ...

2017-09-13

Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2) 2, DTS(F2BTTh 2) 2, DTS(PTTh 2) 2, DTG(FBTTh 2) 2 and DTG(F2BTTh 2) 2) with the fullerene derivative PCmore » 61BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. As a result, the higher BET triplet exciton population in the DTS(PTTh 2) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.« less

Charge Separation and Triplet Exciton Formation Pathways in Small Molecule Solar Cells as Studied by Time-resolved EPR Spectroscopy.

PubMed

Thomson, Stuart A J; Niklas, Jens; Mardis, Kristy L; Mallares, Christopher; Samuel, Ifor D W; Poluektov, Oleg G

2017-10-19

Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2 ) 2 , DTS(F 2 BTTh 2 ) 2 , DTS(PTTh 2 ) 2 , DTG(FBTTh 2 ) 2 and DTG(F 2 BTTh 2 ) 2 ) with the fullerene derivative PC 61 BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2 ) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2 ) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. The higher BET triplet exciton population in the DTS(PTTh 2 ) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.

Charge Separation and Triplet Exciton Formation Pathways in Small-Molecule Solar Cells as Studied by Time-Resolved EPR Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomson, Stuart A. J.; Niklas, Jens; Mardis, Kristy L.

Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2) 2, DTS(F2BTTh 2) 2, DTS(PTTh 2) 2, DTG(FBTTh 2) 2 and DTG(F2BTTh 2) 2) with the fullerene derivative PCmore » 61BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. As a result, the higher BET triplet exciton population in the DTS(PTTh 2) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.« less

Polymerization on the rocks: negatively-charged alpha-amino acids

NASA Technical Reports Server (NTRS)

Hill, A. R. Jr; Bohler, C.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1998-01-01

Oligomers of the negatively-charged amino acids, glutamic acid, aspartic acid, and O-phospho-L-serine are adsorbed by hydroxylapatite and illite with affinities that increase with oligomer length. In the case of oligo-glutamic acids adsorbed on hydroxylapatite, addition of an extra residue results in an approximately four-fold increase in the strength of adsorption. Oligomers much longer than the 7-mer are retained tenaciously by the mineral. Repeated incubation of short oligo-glutamic acids adsorbed on hydroxylapatite or illite with activated monomer leads to the accumulation of oligomers at least 45 units long. The corresponding reactions of aspartic acid and O-phospho-L-serine on hydroxylapatite are less effective in generating long oligomers, while illite fails to accumulate substantial amounts of long oligomers of aspartic acid or of O-phospho-L-serine.

Charge migration and charge transfer in molecular systems

PubMed Central

Wörner, Hans Jakob; Arrell, Christopher A.; Banerji, Natalie; Cannizzo, Andrea; Chergui, Majed; Das, Akshaya K.; Hamm, Peter; Keller, Ursula; Kraus, Peter M.; Liberatore, Elisa; Lopez-Tarifa, Pablo; Lucchini, Matteo; Meuwly, Markus; Milne, Chris; Moser, Jacques-E.; Rothlisberger, Ursula; Smolentsev, Grigory; Teuscher, Joël; van Bokhoven, Jeroen A.; Wenger, Oliver

2017-01-01

The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review. PMID:29333473

Differential effects of DEAE negative mode chromatography and gel-filtration chromatography on the charge status of Helicobacter pylori neutrophil-activating protein

PubMed Central

Pan, Timothy; Tzeng, Huey-Fen

2017-01-01

Helicobacter pylori neutrophil-activating protein (HP-NAP) is involved in H. pylori-associated gastric inflammation. HP-NAP is also a vaccine candidate, a possible drug target, and a potential diagnostic marker for H. pylori-associated diseases. Previously, we purified recombinant HP-NAP by one-step diethylaminoethyl (DEAE) negative mode chromatography by collecting the unbound fraction at pH 8.0 at 4°C. It remains unclear why HP-NAP does not bind to DEAE resins at the pH above its isoelectric point during the purification. To investigate how pH affects the surface net charge of HP-NAP and its binding to DEAE resins during the purification, recombinant HP-NAP expressed in Escherichia coli was subjected to DEAE negative mode chromatography at pH ranging from 7.0 to 9.0 at 25°C and the surface charge of purified HP-NAP was determined by capillary electrophoresis. A minimal amount of HP-NAP was detected in the elution fraction of DEAE Sepharose resin at pH 8.5, whereas recombinant HP-NAP was detected in the elution fraction of DEAE Sephadex resin only at pH 7.0 and 8.0. The purified recombinant HP-NAP obtained from the unbound fractions was not able to bind to DEAE resins at pH 7.0 to 9.0. In addition, the surface charge of the purified HP-NAP was neutral at pH 7.0 to 8.0 and was either neutral or slightly negative at pH 8.5 and 9.0. However, recombinant HP-NAP purified from gel-filtration chromatography was able to bind to DEAE Sepharose resin at pH 7.0 to 9.0 and DEAE Sephadex resin at pH 7.0. At pH 8.5 and 9.0, only the negatively charged species of HP-NAP were found. Thus, recombinant HP-NAP with different charge status can be differentially purified by DEAE negative mode chromatography and gel-filtration chromatography. Furthermore, the charge distribution on the surface of HP-NAP, the presence of impure proteins, and the overall net charge of the resins all affect the binding of HP-NAP to DEAE resins during the negative purification. PMID:28328957

Differential effects of DEAE negative mode chromatography and gel-filtration chromatography on the charge status of Helicobacter pylori neutrophil-activating protein.

PubMed

Hong, Zhi-Wei; Yang, Yu-Chi; Pan, Timothy; Tzeng, Huey-Fen; Fu, Hua-Wen

2017-01-01

Helicobacter pylori neutrophil-activating protein (HP-NAP) is involved in H. pylori-associated gastric inflammation. HP-NAP is also a vaccine candidate, a possible drug target, and a potential diagnostic marker for H. pylori-associated diseases. Previously, we purified recombinant HP-NAP by one-step diethylaminoethyl (DEAE) negative mode chromatography by collecting the unbound fraction at pH 8.0 at 4°C. It remains unclear why HP-NAP does not bind to DEAE resins at the pH above its isoelectric point during the purification. To investigate how pH affects the surface net charge of HP-NAP and its binding to DEAE resins during the purification, recombinant HP-NAP expressed in Escherichia coli was subjected to DEAE negative mode chromatography at pH ranging from 7.0 to 9.0 at 25°C and the surface charge of purified HP-NAP was determined by capillary electrophoresis. A minimal amount of HP-NAP was detected in the elution fraction of DEAE Sepharose resin at pH 8.5, whereas recombinant HP-NAP was detected in the elution fraction of DEAE Sephadex resin only at pH 7.0 and 8.0. The purified recombinant HP-NAP obtained from the unbound fractions was not able to bind to DEAE resins at pH 7.0 to 9.0. In addition, the surface charge of the purified HP-NAP was neutral at pH 7.0 to 8.0 and was either neutral or slightly negative at pH 8.5 and 9.0. However, recombinant HP-NAP purified from gel-filtration chromatography was able to bind to DEAE Sepharose resin at pH 7.0 to 9.0 and DEAE Sephadex resin at pH 7.0. At pH 8.5 and 9.0, only the negatively charged species of HP-NAP were found. Thus, recombinant HP-NAP with different charge status can be differentially purified by DEAE negative mode chromatography and gel-filtration chromatography. Furthermore, the charge distribution on the surface of HP-NAP, the presence of impure proteins, and the overall net charge of the resins all affect the binding of HP-NAP to DEAE resins during the negative purification.

Water organization between oppositely charged surfaces: Implications for protein sliding along DNA a)

NASA Astrophysics Data System (ADS)

Marcovitz, Amir; Naftaly, Aviv; Levy, Yaakov

2015-02-01

Water molecules are abundant in protein-DNA interfaces, especially in their nonspecific complexes. In this study, we investigated the organization and energetics of the interfacial water by simplifying the geometries of the proteins and the DNA to represent them as two equally and oppositely charged planar surfaces immersed in water. We found that the potential of mean force for bringing the two parallel surfaces into close proximity comprises energetic barriers whose properties strongly depend on the charge density of the surfaces. We demonstrated how the organization of the water molecules into discretized layers and the corresponding energetic barriers to dehydration can be modulated by the charge density on the surfaces, salt, and the structure of the surfaces. The 1-2 layers of ordered water are tightly bound to the charged surfaces representing the nonspecific protein-DNA complex. This suggests that water might mediate one-dimensional diffusion of proteins along DNA (sliding) by screening attractive electrostatic interactions between the positively charged molecular surface on the protein and the negatively charged DNA backbone and, in doing so, reduce intermolecular friction in a manner that smoothens the energetic landscape for sliding, and facilitates the 1D diffusion of the protein.

Establishment of cell lines from adult T-cell leukemia cells dependent on negatively charged polymers.

PubMed

Kagami, Yoshitoyo; Uchiyama, Susumu; Kato, Harumi; Okada, Yasutaka; Seto, Masao; Kinoshita, Tomohiro

2017-07-05

Growing adult T-cell leukemia/lymphoma (ATLL) cells in vitro is difficult. Here, we examined the effects of static electricity in the culture medium on the proliferation of ATLL cells. Six out of 10 ATLL cells did not proliferate in vitro and thus had to be cultured in a medium containing negatively charged polymers. In the presence of poly-γ-glutamic acid (PGA) or chondroitin sulfate (CDR), cell lines (HKOX3-PGA, HKOX3-CDR) were established from the same single ATLL case using interleukin (IL)-2, IL-4, and feeder cells expressing OX40L (OX40L + HK). Dextran sulfate inhibited growth in both HKOX3 cell lines. Both PGA and OX40L + HK were indispensable for HKOX3-PGA growth, but HKOX3-CDR could proliferate in the presence of CDR or OX40L + HK alone. Thus, the specific action of each negatively charged polymer promoted the growth of specific ATLL cells in vitro.

Both positive and negative effects on immune responses by expression of a second class II MHC molecule.

PubMed

Ni, Peggy P; Wang, Yaming; Allen, Paul M

2014-11-01

It is perplexing why vertebrates express a limited number of major histocompatibility complex (MHC) molecules when theoretically, having a greater repertoire of MHC molecules would increase the number of epitopes presented, thereby enhancing thymic selection and T cell response to pathogens. It is possible that any positive effects would either be neutralized or outweighed by negative selection restricting the T cell repertoire. We hypothesize that the limit on MHC number is due to negative consequences arising from expressing additional MHC. We compared T cell responses between B6 mice (I-A(+)) and B6.E(+) mice (I-A(+), I-E(+)), the latter expressing a second class II MHC molecule, I-E(b), due to a monomorphic Eα(k) transgene that pairs with the endogenous I-Eβ(b) chain. First, the naive T cell Vβ repertoire was altered in B6.E(+) thymi and spleens, potentially mediating different outcomes in T cell reactivity. Although the B6 and B6.E(+) responses to hen egg-white lysozyme (HEL) protein immunization remained similar, other immune models yielded differences. For viral infection, the quality of the T cell response was subtly altered, with diminished production of certain cytokines by B6.E(+) CD4(+) T cells. In alloreactivity, the B6.E(+) T cell response was significantly dampened. Finally, we observed markedly enhanced susceptibility to experimental autoimmune encephalomyelitis (EAE) in B6.E(+) mice. This correlated with decreased percentages of nTreg cells, supporting the concept of Tregs exhibiting differential susceptibility to negative selection. Altogether, our data suggest that expressing an additional class II MHC can produce diverse effects, with more severe autoimmunity providing a compelling explanation for limiting the expression of MHC molecules. Copyright © 2014 Elsevier Ltd. All rights reserved.

First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules

NASA Astrophysics Data System (ADS)

Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken

Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.

Characteristics of EMI generated by negative metal-positive dielectric voltage stresses due to spacecraft charging

NASA Technical Reports Server (NTRS)

Chaky, R. C.; Inouye, G. T.

1985-01-01

Charging of spacecraft surfaces by the environmental plasma can result in differential potentials between metallic structure and adjacent dielectric surfaces in which the relative polarity of the voltage stress is either negative dielectric/positive metal or negative metal/positive dielectric. Negative metal/positive dielectric is a stress condition that may arise if relatively large areas of spacecraft surface metals are shadowed from solar UV and/or if the UV intensity is reduced as in the situation in which the spacecraft is entering into or leaving eclipse. The results of experimental studies of negative metal/positive dielectric systems are given. Information is given on: enhanced electron emission I-V curves; e(3) corona noise vs e(3) steady-state current; the localized nature of e(3) and negative metal arc discharge currents; negative metal arc discharges at stress thresholds below 1 kilovolt; negative metal arc discharge characteristics; dependence of blowoff arc discharge current on spacecraft capacitance to space (linear dimension); and damage to second surface mirrors due to negative metal arcs.

The Negatively Charged Regions of Lactoferrin Binding Protein B, an Adaptation against Anti-Microbial Peptides

PubMed Central

Morgenthau, Ari; Beddek, Amanda; Schryvers, Anthony B.

2014-01-01

Lactoferrin binding protein B (LbpB) is a bi-lobed membrane bound lipoprotein that is part of the lactoferrin receptor complex in a variety of Gram-negative pathogens. Despite high sequence diversity among LbpBs from various strains and species, a cluster of negatively charged amino acids is invariably present in the protein’s C-terminal lobe in all species except Moraxella bovis. The function of LbpB in iron acquisition has yet to be experimentally demonstrated, whereas in vitro studies have shown that LbpB confers protection against lactoferricin, a short cationic antimicrobial peptide released from the N- terminus of lactoferrin. In this study we demonstrate that the negatively charged regions can be removed from the Neisseria meningitidis LbpB without compromising stability, and this results in the inability of LbpB to protect against the bactericidal effects of lactoferricin. The release of LbpB from the cell surface by the autotransporter NalP reduces the protection against lactoferricin in the in vitro killing assay, attributed to removal of LbpB during washing steps, but is unlikely to have a similar impact in vivo. The protective effect of the negatively charged polysaccharide capsule in the killing assay was less than the protection conferred by LbpB, suggesting that LbpB plays a major role in protection against cationic antimicrobial peptides in vivo. The selective release of LbpB by NalP has been proposed to be a mechanism for evading the adaptive immune response, by reducing the antibody binding to the cell surface, but may also provide insights into the primary function of LbpB in vivo. Although TbpB and LbpB have been shown to be major targets of the human immune response, the selective release of LbpB suggests that unlike TbpB, LbpB may not be essential for iron acquisition, but important for protection against cationic antimicrobial peptides. PMID:24465982

Gap state charge induced spin-dependent negative differential resistance in tunnel junctions

NASA Astrophysics Data System (ADS)

Jiang, Jun; Zhang, X.-G.; Han, X. F.

2016-04-01

We propose and demonstrate through first-principles calculation a new spin-dependent negative differential resistance (NDR) mechanism in magnetic tunnel junctions (MTJ) with cubic cation disordered crystals (CCDC) AlO x or Mg1-x Al x O as barrier materials. The CCDC is a class of insulators whose band gap can be changed by cation doping. The gap becomes arched in an ultrathin layer due to the space charge formed from metal-induced gap states. With an appropriate combination of an arched gap and a bias voltage, NDR can be produced in either spin channel. This mechanism is applicable to 2D and 3D ultrathin junctions with a sufficiently small band gap that forms a large space charge. It provides a new way of controlling the spin-dependent transport in spintronic devices by an electric field. A generalized Simmons formula for tunneling current through junction with an arched gap is derived to show the general conditions under which ultrathin junctions may exhibit NDR.

Charge-transfer complexes of 2,3-dichloro-5,6-dicyano-1,4-benzoquinone with amino molecules in polar solvents

NASA Astrophysics Data System (ADS)

Berto, Silvia; Chiavazza, Enrico; Ribotta, Valentina; Daniele, Pier Giuseppe; Barolo, Claudia; Giacomino, Agnese; Vione, Davide; Malandrino, Mery

2015-10-01

The charge-transfer complexes have scientific relevance because this type of molecular interaction is at the basis of the activity of pharmacological compounds and because the absorption bands of the complexes can be used for the quantification of electron donor molecules. This work aims to assess the stability of the charge-transfer complexes between the electron acceptor 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) and two drugs, procaine and atenolol, in acetonitrile and ethanol. The stability of DDQ in solution and the time required to obtain the maximum complex formation were evaluated. The stoichiometry and the stability of the complexes were determined, respectively, by Job's plot method and by the elaboration of UV-vis titrations data. The latter task was carried out by using the non-linear global analysis approach to determine the equilibrium constants. This approach to data elaboration allowed us to overcome the disadvantages of the classical linear-regression method, to obtain reliable values of the association constants and to calculate the entire spectra of the complexes. NMR spectra were recorded to identify the portion of the donor molecule that was involved in the interaction. The data support the participation of the aliphatic amino groups in complex formation and exclude the involvement of the aromatic amine present in the procaine molecule.

Metal-organic and supramolecular architectures based on mechanically interlocked molecules

NASA Astrophysics Data System (ADS)

Fernando, Isurika Rosini

The focus of this work is on mechanically interlocked molecules (MIMs), which have unusual physicochemical and mechanical properties with potential applications in nano-scale/molecular devices and high strength materials. Rotaxanes, for example, consist of an axle-like molecule threaded through a wheel-like molecule, with bulky groups at the two ends of the axle preventing the wheel from dissociating. The position of the wheel along the axle can be switched in a controllable and reversible manner by applying external stimuli, a feature that might lead to the next generation of computers. Molecularly woven materials (MWMs), another example of molecules with mechanically interlocked features, are predicted to be unprecedentedly strong while being lightweight and flexible. With the ultimate goal of achieving control over the functioning of molecular devices in the solid state, a variety of pseudorotaxane building blocks were prepared and characterized, including a novel, rare blue-colored motif. The temperature-dependent assembly/disassembly of pseudorotaxanes was exploited for the construction of single-wavelength colorimetric temperature sensors over a 100 °C window. Pseudorotaxanes based on aromatic crown ether wheels and disubstituted 4,4'-bipyridinium axles were converted into rotaxanes upon binding to metal complexes (zinc, cadmium, mercury, copper, cobalt), and the formation of ordered crystalline arrays was studied in the solid state. The columnar organization of pseudorotaxanes by Hg2X6 2-- complexes (X = Cl, Br, I), leading to unprecedented dichroic (blue/red) rotaxane crystals, was demonstrated for the first time. From the crystal structures studied it became apparent that negatively charged metal complexes are needed for successful assembly with the positively charged pseudorotaxane units. To be able to use the more common, positively charged metal ions for rotaxane framework construction, neutral and negatively charged pseudorotaxanes were synthesized

Photoelectron spectroscopy of color centers in negatively charged cesium iodide nanocrystals

NASA Astrophysics Data System (ADS)

Sarkas, Harry W.; Kidder, Linda H.; Bowen, Kit H.

1995-01-01

We present the photoelectron spectra of negatively charged cesium iodide nanocrystals recorded using 2.540 eV photons. The species examined were produced using an inert gas condensation cluster ion source, and they ranged in size from (CsI)-n=13 to nanocrystal anions comprised of 330 atoms. Nanocrystals showing two distinct types of photoemission behavior were observed. For (CsI)-n=13 and (CsI)-n=36-165, a plot of cluster anion photodetachment threshold energies vs n-1/3 gives a straight line extrapolating (at n-1/3=0, i.e., n=∞) to 2.2 eV, the photoelectric threshold energy for F centers in bulk cesium iodide. The linear extrapolation of the cluster anion data to the corresponding bulk property implies that the electron localization in these gas-phase nanocrystals is qualitatively similar to that of F centers in extended alkali halide crystals. These negatively charged cesium iodide nanocrystals are thus shown to support embryonic forms of F centers, which mature with increasing cluster size toward condensed phase impurity centers. Under an alternative set of source conditions, nanocrystals were produced which showed significantly lower photodetachment thresholds than the aforementioned F-center cluster anions. For these species, containing 83-131 atoms, a plot of their cluster anion photodetachment threshold energies versus n-1/3 gives a straight line which extrapolates to 1.4 eV. This value is in accord with the expected photoelectric threshold energy for F' centers in bulk cesium iodide, i.e., color centers with two excess electrons in a single defect site. These nanocrystals are interpreted to be the embryonic F'-center containing species, Cs(CsI)-n=41-65.

Learning from Synthetic Models of Extracellular Matrix; Differential Binding of Wild Type and Amyloidogenic Human Apolipoprotein A-I to Hydrogels Formed from Molecules Having Charges Similar to Those Found in Natural GAGs.

PubMed

Rosú, Silvana A; Toledo, Leandro; Urbano, Bruno F; Sanchez, Susana A; Calabrese, Graciela C; Tricerri, M Alejandra

2017-08-01

Among other components of the extracellular matrix (ECM), glycoproteins and glycosaminoglycans (GAGs) have been strongly associated to the retention or misfolding of different proteins inducing the formation of deposits in amyloid diseases. The composition of these molecules is highly diverse and a key issue seems to be the equilibrium between physiological and pathological events. In order to have a model in which the composition of the matrix could be finely controlled, we designed and synthesized crosslinked hydrophilic polymers, the so-called hydrogels varying the amounts of negative charges and hydroxyl groups that are prevalent in GAGs. We checked and compared by fluorescence techniques the binding of human apolipoprotein A-I and a natural mutant involved in amyloidosis to the hydrogel scaffolds. Our results indicate that both proteins are highly retained as long as the negative charge increases, and in addition it was shown that the mutant is more retained than the Wt, indicating that the retention of specific proteins in the ECM could be part of the pathogenicity. These results show the importance of the use of these polymers as a model to get deep insight into the studies of proteins within macromolecules.

DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

PubMed

Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

2015-09-16

Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

Quantum theory of atoms in molecules/charge-charge flux-dipole flux models for fundamental vibrational intensity changes on H-bond formation of water and hydrogen fluoride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silva, Arnaldo F.; Richter, Wagner E.; Bruns, Roy E., E-mail: bruns@iqm.unicamp.br

The Quantum Theory of Atoms In Molecules/Charge-Charge Flux-Dipole Flux (QTAIM/CCFDF) model has been used to investigate the electronic structure variations associated with intensity changes on dimerization for the vibrations of the water and hydrogen fluoride dimers as well as in the water-hydrogen fluoride complex. QCISD/cc-pVTZ wave functions applied in the QTAIM/CCFDF model accurately provide the fundamental band intensities of water and its dimer predicting symmetric and antisymmetric stretching intensity increases for the donor unit of 159 and 47 km mol{sup −1} on H-bond formation compared with the experimental values of 141 and 53 km mol{sup −1}. The symmetric stretching ofmore » the proton donor water in the dimer has intensity contributions parallel and perpendicular to its C{sub 2v} axis. The largest calculated increase of 107 km mol{sup −1} is perpendicular to this axis and owes to equilibrium atomic charge displacements on vibration. Charge flux decreases occurring parallel and perpendicular to this axis result in 42 and 40 km mol{sup −1} total intensity increases for the symmetric and antisymmetric stretches, respectively. These decreases in charge flux result in intensity enhancements because of the interaction contributions to the intensities between charge flux and the other quantities. Even though dipole flux contributions are much smaller than the charge and charge flux ones in both monomer and dimer water they are important for calculating the total intensity values for their stretching vibrations since the charge-charge flux interaction term cancels the charge and charge flux contributions. The QTAIM/CCFDF hydrogen-bonded stretching intensity strengthening of 321 km mol{sup −1} on HF dimerization and 592 km mol{sup −1} on HF:H{sub 2}O complexation can essentially be explained by charge, charge flux and their interaction cross term. Atomic contributions to the intensities are also calculated. The bridge hydrogen atomic contributions

Effects of negatively and positively charged Ti metal surfaces on ceramic coating adhesion and cell response.

PubMed

do Nascimento, Rodney Marcelo; de Carvalho, Vanessa Rafaela; Govone, José Silvio; Hernandes, Antônio Carlos; da Cruz, Nilson Cristino

2017-02-01

This manuscript reports an evaluation of the effects of simple chemical-heat treatments on the deposition of different ceramic coatings, i.e., TiO 2 , CaTiO 3 and CaP, on commercially pure titanium (cp-Ti) and Ti6Al4V and the influence of the coatings on cells interaction with the surfaces. The ceramic materials were prepared by the sol-gel method and the coating adhesion was analyzed by pull-off bending tests. The wettability of positively or negatively charged surfaces was characterized by contact angle measurements, which also enabled the calculation of the surface free energy through the polar-apolar liquids approach. Both acid and alkaline treatments activated the cp-Ti, whereas Ti6Al4V was only activated by the alkaline treatment. Such treatment led to increased hydrophilicity with inhibition of the fibroblastic response on Ti6Al4V. On the other hand, osteoblastic cells adhered to and proliferated on the positively and negatively charged surfaces. The maximum adhesion strength (~ 3400 N) was obtained with a negative Ti6Al4V-CaTiO 3 -CaP multilayer surface.

Charge transport in nanoscale junctions.

PubMed

Albrecht, Tim; Kornyshev, Alexei; Bjørnholm, Thomas

2008-09-03

the molecular level. Nanoscale charge transport experiments in ionic liquids extend the field to high temperatures and to systems with intriguing interfacial potential distributions. Other directions may include dye-sensitized solar cells, new sensor applications and diagnostic tools for the study of surface-bound single molecules. Another motivation for this special issue is thus to highlight activities across different research communities with nanoscale charge transport as a common denominator. This special issue gathers 27 articles by scientists from the United States, Germany, the UK, Denmark, Russia, France, Israel, Canada, Australia, Sweden, Switzerland, the Netherlands, Belgium and Singapore; it gives us a flavour of the current state-of-the-art of this diverse research area. While based on contributions from many renowned groups and institutions, it obviously cannot claim to represent all groups active in this very broad area. Moreover, a number of world-leading groups were unable to take part in this project within the allocated time limit. Nevertheless, we regard the current selection of papers to be representative enough for the reader to draw their own conclusions about the current status of the field. Each paper is original and has its own merit, as all papers in Journal of Physics: Condensed Matter special issues are subjected to the same scrutiny as regular contributions. The Guest Editors have deliberately not defined the specific subjects covered in this issue. These came out logically from the development of this area, for example: 'Traditional' solid state nanojunctions based on adsorbed layers, oxide films or nanowires sandwiched between two electrodes: effects of molecular structure (aromaticity, anchoring groups), symmetry, orientation, dynamics (noise patterns) and current-induced heating. Various 'physical effects': inelastic tunnelling and Coulomb blockade, polaron effects, switching modes, and negative differential resistance; the role of

Charge and Spin Currents in Open-Shell Molecules:  A Unified Description of NMR and EPR Observables.

PubMed

Soncini, Alessandro

2007-11-01

The theory of EPR hyperfine coupling tensors and NMR nuclear magnetic shielding tensors of open-shell molecules in the limit of vanishing spin-orbit coupling (e.g., for organic radicals) is analyzed in terms of spin and charge current density vector fields. The ab initio calculation of the spin and charge current density response has been implemented at the Restricted Open-Shell Hartree-Fock, Unrestricted Hartree-Fock, and unrestricted GGA-DFT level of theory. On the basis of this formalism, we introduce the definition of nuclear hyperfine coupling density, a scalar function of position providing a partition of the EPR observable over the molecular domain. Ab initio maps of spin and charge current density and hyperfine coupling density for small radicals are presented and discussed in order to illustrate the interpretative advantages of the newly introduced approach. Recent NMR experiments providing evidence for the existence of diatropic ring currents in the open-shell singlet pancake-bonded dimer of the neutral phenalenyl radical are directly assessed via the visualization of the induced current density.

Modeling light-induced charge transfer dynamics across a metal-molecule-metal junction: Bridging classical electrodynamics and quantum dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Zixuan; Ratner, Mark A.; Seideman, Tamar, E-mail: t-seideman@northwestern.edu

2014-12-14

We develop a numerical approach for simulating light-induced charge transport dynamics across a metal-molecule-metal conductance junction. The finite-difference time-domain method is used to simulate the plasmonic response of the metal structures. The Huygens subgridding technique, as adapted to Lorentz media, is used to bridge the vastly disparate length scales of the plasmonic metal electrodes and the molecular system, maintaining accuracy. The charge and current densities calculated with classical electrodynamics are transformed to an electronic wavefunction, which is then propagated through the molecular linker via the Heisenberg equations of motion. We focus mainly on development of the theory and exemplify ourmore » approach by a numerical illustration of a simple system consisting of two silver cylinders bridged by a three-site molecular linker. The electronic subsystem exhibits fascinating light driven dynamics, wherein the charge density oscillates at the driving optical frequency, exhibiting also the natural system timescales, and a resonance phenomenon leads to strong conductance enhancement.« less

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Quantum effects in the capture of charged particles by dipolar polarizable symmetric top molecules. I. General axially nonadiabatic channel treatment.

PubMed

Auzinsh, M; Dashevskaya, E I; Litvin, I; Nikitin, E E; Troe, J

2013-08-28

The rate coefficients for capture of charged particles by dipolar polarizable symmetric top molecules in the quantum collision regime are calculated within an axially nonadiabatic channel approach. It uses the adiabatic approximation with respect to rotational transitions of the target within first-order charge-dipole interaction and takes into account the gyroscopic effect that decouples the intrinsic angular momentum from the collision axis. The results are valid for a wide range of collision energies (from single-wave capture to the classical limit) and dipole moments (from the Vogt-Wannier and fly-wheel to the adiabatic channel limit).

Comprehensive approach to intrinsic charge carrier mobility in conjugated organic molecules, macromolecules, and supramolecular architectures.

PubMed

Saeki, Akinori; Koizumi, Yoshiko; Aida, Takuzo; Seki, Shu

2012-08-21

(-1) s(-1), based on a combination of flash-photolysis TRMC and transient absorption spectroscopy (TAS) measurements. Single-crystal rubrene showed an ambipolarity with anisotropic charge carrier transport along each crystal axis on the nanometer scale. Finally, we describe the charge carrier mobility of a self-assembled nanotube consisting of a large π-plane of hexabenzocoronene (HBC) partially appended with an electron acceptor. The local (intratubular) charge carrier mobility reached 3 cm(2) V(-1) s(-1) for the nanotubes that possessed well-ordered π-stacking, but it dropped to 0.7 cm(2) V(-1) s(-1) in regions that contained greater amounts of the electron acceptor because those molecules reduced the structural integrity of π-stacked HBC arrays. Interestingly, the long-range (intertubular) charge carrier mobility was on the order of 10(-4) cm(2) V(-1) s(-1) and monotonically decreased when the acceptor content was increased. These results suggest the importance of investigating charge carrier mobilities by frequency-dependent charge carrier motion for the development of more efficient organic electronic devices.

Theory of Charged Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.

2006-03-01

Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.

Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

NASA Astrophysics Data System (ADS)

Desai, R. T.; Coates, A. J.; Wellbrock, A.; Vuitton, V.; Crary, F. J.; González-Caniulef, D.; Shebanits, O.; Jones, G. H.; Lewis, G. R.; Waite, J. H.; Cordiner, M.; Taylor, S. A.; Kataria, D. O.; Wahlund, J.-E.; Edberg, N. J. T.; Sittler, E. C.

2017-08-01

Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q-1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950-1300 km. We report on detections consistently centered between 25.8 and 26.0 u q-1 and between 49.0-50.1 u q-1 which are identified as belonging to the carbon chain anions, CN-/C3N- and/or C2H-/C4H-, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73-74 u q-1 could be attributed to the further carbon chain anions C5N-/C6H- but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q-1) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.

Spatiotemporal dynamics of charged species in the afterglow of plasmas containing negative ions.

PubMed

Kaganovich, I D; Ramamurthi, B N; Economou, D J

2001-09-01

The spatiotemporal evolution of charged species densities and wall fluxes during the afterglow of an electronegative discharge has been investigated. The decay of a plasma with negative ions consists of two stages. During the first stage of the afterglow, electrons dominate plasma diffusion and negative ions are trapped inside the vessel by the static electric field; the flux of negative ions to the walls is nearly zero. During this stage, the electron escape frequency increases considerably in the presence of negative ions, and can eventually approach free electron diffusion. During the second stage of the afterglow, electrons have disappeared, and positive and negative ions diffuse to the walls with the ion-ion ambipolar diffusion coefficient. Theories for plasma decay have been developed for equal and strongly different ion (T(i)) and electron (T(e)) temperatures. In the case T(i)=T(e), the species spatial profiles are similar and an analytic solution exists. When detachment is important in the afterglow (weakly electronegative gases, e.g., oxygen) the plasma decay crucially depends on the product of negative ion detachment frequency (gamma(d)) and diffusion time (tau(d)). If gamma(d)tau(d)>2, negative ions convert to electrons during their diffusion towards the walls. The presence of detached electrons results in "self-trapping" of the negative ions, due to emerging electric fields, and the negative ion flux to the walls is extremely small. In the case T(i)negative ion density fronts. During the afterglow, although negative ions diffuse freely in the plasma core, the negative ion fronts propagate towards the chamber walls with a nearly constant velocity. The evolution of ion fronts in the afterglow of electronegative plasmas is important, since it determines the time needed for negative ions to reach the wall, and thus influence surface reactions in plasma processing.

DFT study of adsorption of picric acid molecule on the surface of single-walled ZnO nanotube; as potential new chemical sensor

NASA Astrophysics Data System (ADS)

Farmanzadeh, Davood; Tabari, Leila

2015-01-01

Using density functional theory (DFT), we have investigated the adsorption of picric acid (PA) molecule on the surface of (8,0) single-walled ZnO nanotube (ZnONT). The results show that the PA molecule can be chemisorbed on the surface of ZnONT with adsorption energies of -82.01 and -75.26 kJ/mol in gas and aqueous phase, respectively. Frontier molecular orbital analysis show that HOMO/LUMO gap of ZnONT reduces from 1.66 and 1.75 eV in the pristine nanotube to 0.83 and 0.72 eV in PA-adsorbed form in gas and aqueous phase, respectively. It suggests that the process can affect the electronic properties of the studied nanotube which would lead to its conductance change upon the adsorption of PA molecule. The modifying effect on the electrical conductance of ZnONT underlies the working mechanism of gas sensors for detecting the PA molecules. Analyses of the adsorption behavior of the electrically charged ZnONT toward PA molecule in the gas phase show that the PA molecule can be strongly adsorbed on the negatively charged ZnONT surface with significant adsorption energy (-135.1 kJ/mol). However, from the HOMO/LUMO gap changes, it can be concluded that the positive ZnONT might sensitively detect the PA molecule in comparison to the negative tube. These results can provide helpful information for experimental investigation to develop novel nanotube-based sensors.

Charge transport network dynamics in molecular aggregates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Nicholas E.; Chen, Lin X.; Ratner, Mark A.

2016-07-20

Due to the nonperiodic nature of charge transport in disordered systems, generating insight into static charge transport networks, as well as analyzing the network dynamics, can be challenging. Here, we apply time-dependent network analysis to scrutinize the charge transport networks of two representative molecular semiconductors: a rigid n-type molecule, perylenediimide, and a flexible p-type molecule, bBDT(TDPP)2. Simulations reveal the relevant timescale for local transfer integral decorrelation to be ~100 fs, which is shown to be faster than that of a crystalline morphology of the same molecule. Using a simple graph metric, global network changes are observed over timescales competitive withmore » charge carrier lifetimes. These insights demonstrate that static charge transport networks are qualitatively inadequate, whereas average networks often overestimate network connectivity. Finally, a simple methodology for tracking dynamic charge transport properties is proposed.« less

Probe-based measurement of lateral single-electron transfer between individual molecules

PubMed Central

Steurer, Wolfram; Fatayer, Shadi; Gross, Leo; Meyer, Gerhard

2015-01-01

The field of molecular electronics aims at using single molecules as functional building blocks for electronics components, such as switches, rectifiers or transistors. A key challenge is to perform measurements with atomistic control over the alignment of the molecule and its contacting electrodes. Here we use atomic force microscopy to examine charge transfer between weakly coupled pentacene molecules on insulating films with single-electron sensitivity and control over the atomistic details. We show that, in addition to the imaging capability, the probe tip can be used to control the charge state of individual molecules and to detect charge transfers to/from the tip, as well as between individual molecules. Our approach represents a novel route for molecular charge transfer studies with a host of opportunities, especially in combination with single atom/molecule manipulation and nanopatterning techniques. PMID:26387533

Mechanism of How Salt-Gradient-Induced Charges Affect the Translocation of DNA Molecules through a Nanopore

PubMed Central

He, Yuhui; Tsutsui, Makusu; Scheicher, Ralph H.; Fan, Chun; Taniguchi, Masateru; Kawai, Tomoji

2013-01-01

Experiments using nanopores demonstrated that a salt gradient enhances the capture rate of DNA and reduces its translocation speed. These two effects can help to enable electrical DNA sequencing with nanopores. Here, we provide a quantitative theoretical evaluation that shows the positive net charges, which accumulate around the pore entrance due to the salt gradient, are responsible for the two observed effects: they reinforce the electric capture field, resulting in promoted molecule capture rate; and they induce cationic electroosmotic flow through the nanopore, thus significantly retarding the motion of the anionic DNA through the nanopore. Our multiphysical simulation results show that, during the polymer trapping stage, the former effect plays the major role, thus resulting in promoted DNA capture rate, while during the nanopore-penetrating stage the latter effect dominates and consequently reduces the DNA translocation speed significantly. Quantitative agreement with experimental results has been reached by further taking nanopore wall surface charges into account. PMID:23931325

Retrieval of charge mobility from apparent charge packet movements in LDPE thin films

NASA Astrophysics Data System (ADS)

Meng, Jia; Zhang, Yewen; Holé, Stéphane; Zheng, Feihu; An, Zhenlian

2017-03-01

The charge packet phenomenon observed in polyethylene materials has been reported extensively during the last decades. To explain its movement, Negative Differential Mobility (NDM) theory is a competitive model among several proposed mechanisms. However, as a key concept of this theory, a sufficiently acute relationship between charge mobility and electric field has never been reported until now, which makes it hard to precisely describe the migration of charge packets with this theory. Based on the substantial negative-charge packet observations with a sufficiently by wide electric field range from 15 kV/mm to 50 kV/mm, the present contribution successfully retrieved the negative-charge mobility from the apparent charge packet movements, which reveals a much closer relationship between the NDM theory and charge packet migrations. Back simulations of charge packets with the retrieved charge mobility offer a good agreement with the experimental data.

High flux and antifouling properties of negatively charged membrane for dyeing wastewater treatment by membrane distillation.

PubMed

An, Alicia Kyoungjin; Guo, Jiaxin; Jeong, Sanghyun; Lee, Eui-Jong; Tabatabai, S Assiyeh Alizadeh; Leiknes, TorOve

2016-10-15

This study investigated the applicability of membrane distillation (MD) to treat dyeing wastewater discharged by the textile industry. Four different dyes containing methylene blue (MB), crystal violet (CV), acid red 18 (AR18), and acid yellow 36 (AY36) were tested. Two types of hydrophobic membranes made of polytetrafluoroethylene (PTFE) and polyvinylidene fluoride (PVDF) were used. The membranes were characterized by testing against each dye (foulant-foulant) and the membrane-dye (membrane-foulant) interfacial interactions and their mechanisms were identified. The MD membranes possessed negative charges, which facilitated the treatment of acid and azo dyes of the same charge and showed higher fluxes. In addition, PTFE membrane reduced the wettability with higher hydrophobicity of the membrane surface. The PTFE membrane evidenced especially its resistant to dye absorption, as its strong negative charge and chemical structure caused a flake-like (loose) dye-dye structure to form on the membrane surface rather than in the membrane pores. This also enabled the recovery of flux and membrane properties by water flushing (WF), thereby direct-contact MD with PTFE membrane treating 100 mg/L of dye mixtures showed stable flux and superior color removal during five days operation. Thus, MD shows a potential for stable long-term operation in conjunction with a simple membrane cleaning process, and its suitability in dyeing wastewater treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Visualizing the Positive-Negative Interface of Molecular Electrostatic Potentials as an Educational Tool for Assigning Chemical Polarity

ERIC Educational Resources Information Center

Schonborn, Konrad; Host, Gunnar; Palmerius, Karljohan

2010-01-01

To help in interpreting the polarity of a molecule, charge separation can be visualized by mapping the electrostatic potential at the van der Waals surface using a color gradient or by indicating positive and negative regions of the electrostatic potential using different colored isosurfaces. Although these visualizations capture the molecular…

Manipulating the dipole layer of polar organic molecules on metal surfaces via different charge-transfer channels

NASA Astrophysics Data System (ADS)

Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.

The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.

Models for Cometary Comae Containing Negative Ions

NASA Technical Reports Server (NTRS)

Cordiner, M. A.; Charnley, S. B.

2012-01-01

The presence of negative ions (anions) in cometary comae is known from Giotto mass spectrometry of IP/Halley. The anions O(-), OH(-), C(-), CH(-) and CN(-) have been detected, as well as unidentified anions with masses 22-65 and 85-110 amu [I]. Organic molecular anions such as C4H(-) and C6H(-) are known to have a significant impact on the charge balance of interstellar clouds and circumstellar envelopes and have been shown to act as catalysts for the gas phase synthesis of larger hydrocarbon molecules in the ISM, but their importance in cometary comae has not yet been fully explored. We present details of our new models for the chemistry of cometary comae that include atomic and molecular anions. We calculate the impact of these anions on the charge balance and examine their importance for cometary coma chemistry.

Preface: Charge transport in nanoscale junctions

NASA Astrophysics Data System (ADS)

Albrecht, Tim; Kornyshev, Alexei; Bjørnholm, Thomas

2008-09-01

the molecular level. Nanoscale charge transport experiments in ionic liquids extend the field to high temperatures and to systems with intriguing interfacial potential distributions. Other directions may include dye-sensitized solar cells, new sensor applications and diagnostic tools for the study of surface-bound single molecules. Another motivation for this special issue is thus to highlight activities across different research communities with nanoscale charge transport as a common denominator. This special issue gathers 27 articles by scientists from the United States, Germany, the UK, Denmark, Russia, France, Israel, Canada, Australia, Sweden, Switzerland, the Netherlands, Belgium and Singapore; it gives us a flavour of the current state-of-the-art of this diverse research area. While based on contributions from many renowned groups and institutions, it obviously cannot claim to represent all groups active in this very broad area. Moreover, a number of world-leading groups were unable to take part in this project within the allocated time limit. Nevertheless, we regard the current selection of papers to be representative enough for the reader to draw their own conclusions about the current status of the field. Each paper is original and has its own merit, as all papers in Journal of Physics: Condensed Matter special issues are subjected to the same scrutiny as regular contributions. The Guest Editors have deliberately not defined the specific subjects covered in this issue. These came out logically from the development of this area, for example: 'Traditional' solid state nanojunctions based on adsorbed layers, oxide films or nanowires sandwiched between two electrodes: effects of molecular structure (aromaticity, anchoring groups), symmetry, orientation, dynamics (noise patterns) and current-induced heating. Various 'physical effects': inelastic tunnelling and Coulomb blockade, polaron effects, switching modes, and negative differential resistance; the role of

Intermolecular Interaction between Phosphatidylcholine and Sulfobetaine Lipid: A Combination of Lipids with Antiparallel Arranged Headgroup Charge.

PubMed

Aikawa, Tatsuo; Yokota, Keisuke; Kondo, Takeshi; Yuasa, Makoto

2016-10-05

Intermolecular interactions between lipid molecules are important when designing lipid bilayer interfaces, which have many biomedical applications such as in drug delivery vehicles and biosensors. Phosphatidylcholine, a naturally occurring lipid, is the most common lipid found in organisms. Its chemical structure has a negatively charged phosphate linkage, adjacent to an ester linkage in a glycerol moiety, and a positively charged choline group, placed at the terminus of the molecule. Recently, several types of synthetic lipids that have headgroups with the opposite charge to that of phosphatidylcholine have emerged; that is, a positively charged ammonium group is present adjacent to the ester linkage in their glycerol moiety and a negatively charged group is placed at their terminus. These types of lipids constitute a new class of soft material. The aim of this study was to determine how such lipids, with antiparallel arranged headgroup charge, interact with naturally occurring phosphatidylcholines. We synthesized 1,2-dipalmitoyl-sn-glycero-3-sulfobetaine (DPSB) to represent a reversed-head lipid; 1,2-dipalmitoyl-sn-glycero-3-phosphatidylcholine (DPPC) was used to represent a naturally occurring phospholipid. The intermolecular interaction between these lipids was investigated using surface pressure-area (π-A) isotherms of the lipid monolayer at the air/water interface. We found that the extrapolated area and excess free energy of the mixed monolayer deviated negatively when compared with the ideal values from additivity. Moreover, differential scanning calorimetry of the lipid mixture in aqueous dispersion showed that the gel-to-liquid crystal transition temperature increased compared with that of each pure lipid composition. These results clearly indicate that DPSB preferably interacts with DPPC in the mixture. We believe that the attraction between the oppositely charged headgroups of these lipids reinforces the intermolecular interaction. Our results provide

Negative Charge Neutralization in the Loops and Turns of Outer Membrane Phospholipase A Impacts Folding Hysteresis at Neutral pH.

PubMed

McDonald, Sarah K; Fleming, Karen G

2016-11-08

Hysteresis in equilibrium protein folding titrations is an experimental barrier that must be overcome to extract meaningful thermodynamic quantities. Traditional approaches to solving this problem involve testing a spectrum of solution conditions to find ones that achieve path independence. Through this procedure, a specific pH of 3.8 was required to achieve path independence for the water-to-bilayer equilibrium folding of outer membrane protein OmpLA. We hypothesized that the neutralization of negatively charged side chains (Asp and Glu) at pH 3.8 could be the physical basis for path-independent folding at this pH. To test this idea, we engineered variants of OmpLA with Asp → Asn and Glu → Gln mutations to neutralize the negative charges within various regions of the protein and tested for reversible folding at neutral pH. Although not fully resolved, our results show that these mutations in the periplasmic turns and extracellular loops are responsible for 60% of the hysteresis in wild-type folding. Overall, our study suggests that negative charges impact the folding hysteresis in outer membrane proteins and their neutralization may aid in protein engineering applications.

Hydration of excess electrons trapped in charge pockets on molecular surfaces

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Del Castillo, R.; Adamowicz, Ludwik

2007-01-01

In this work we strive to design a novel electron trap located on a molecular surface. The process of electron trapping involves hydration of the trapped electron. Previous calculations on surface electron trapping revealed that clusters of OH groups can form stable hydrogen-bonded networks on one side of a hydrocarbon surface (i.e. cyclohexane sheets), while the hydrogen atoms on the opposite side of the surface form pockets of positive charge that can attract extra negative charge. The excess electron density on such surfaces can be further stabilized by interactions with water molecules. Our calculations show that these anionic systems are stable with respect to vertical electron detachment (VDE).

Sensing small molecule interactions with lipid membranes by local pH modulation.

PubMed

Huang, Da; Zhao, Tao; Xu, Wei; Yang, Tinglu; Cremer, Paul S

2013-11-05

Herein, we utilized a label-free sensing platform based on pH modulation to detect the interactions between tetracaine, a positively charged small molecule used as a local anesthetic, and planar supported lipid bilayers (SLBs). The SLBs were patterned inside a flow cell, allowing for various concentrations of tetracaine to be introduced over the surface in a buffer solution. Studies with membranes containing POPC (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) yielded an equilibrium dissociation constant value of Kd = 180 ± 47 μm for this small molecule-membrane interaction. Adding cholesterol to the SLBs decreased the affinity between tetracaine and the bilayers, while this interaction tightened when POPE (1-hexadecanoyl-2-(9-Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine) was added. Studies were also conducted with three negatively charged membrane lipids, POPG (1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium salt)), POPS (1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-l-serine (sodium salt)), and ganglioside GM1. All three measurements gave rise to a similar tightening of the apparent Kd value compared with pure POPC membranes. The lack of chemical specificity with the identity of the negatively charged lipid indicated that the tightening was largely electrostatic. Through a direct comparison with ITC measurements, it was found that the pH modulation sensor platform offers a facile, inexpensive, highly sensitive, and rapid method for the detection of interactions between putative drug candidates and lipid bilayers. As such, this technique may potentially be exploited as a screen for drug development and analysis.

Dissociative charge transfer of H/+/ ions with H2 and D2 molecules from 78 to 330 K

NASA Technical Reports Server (NTRS)

Johnsen, R.; Chen, A.; Biondi, M. A.

1980-01-01

The dissociative charge transfer of He(+) ions with H2 and D2 molecules has been studied using a temperature-variable drift-tube mass-spectrometer apparatus over the temperature range 78 to 330 K. The binary rate coefficients are small at 300 K, approximately 10 to the -13th to 10 to the -14th cu cm/sec, and only slightly larger at 78 K. Termolecular contributions to the binary rate coefficients are found to be small at 330 K but increase substantially with decreasing temperature. Two-body charge transfer with D2 is found to be slower than with H2 by a factor of 10, in good agreement with recent theoretical predictions, although the measured values of the rate coefficients are larger by a factor of about 4 than the predicted values.

A modified electronegativity equalization method for fast and accurate calculation of atomic charges in large biological molecules.

PubMed

Ouyang, Yongzhong; Ye, Fei; Liang, Yizeng

2009-08-07

To further extend the EEM approach to improve its accuracy, a new approach, in which the different connectivities and hybridized states are introduced to represent the different chemical environments, has been developed. The C, O and N atoms are distinguished between different hybridized states. Different states of hydrogen atoms are defined according to their different connectivities. Furthermore, the sp(2) carbons in the aromatic rings are also separated from the other sp(2) carbons. Geometries and NPA charges are calculated at the B3LYP/6-31G* level, and the effective electronegativity and hardness values could be calibrated with the help of a training set of 141 organic molecules using the Differential Evolution (DE) algorithm. The quality of the modified EEM charges is evaluated by comparison with the B3LYP/6-31G* charges calculated for a series of polypeptides, not contained in the training set. For further comparison, the atomic parameters of the original EEM without including chemical environments are recalibrated under the same conditions. It is found that the accuracy of the modified EEM method improves significantly as compared to that of the original EEM method.

Single-Molecule Electronics: Chemical and Analytical Perspectives.

PubMed

Nichols, Richard J; Higgins, Simon J

2015-01-01

It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.

Agglutination of like-charged red blood cells induced by binding of beta2-glycoprotein I to outer cell surface.

PubMed

Lokar, Marusa; Urbanija, Jasna; Frank, Mojca; Hägerstrand, Henry; Rozman, Blaz; Bobrowska-Hägerstrand, Malgorzata; Iglic, Ales; Kralj-Iglic, Veronika

2008-08-01

Plasma protein-mediated attractive interaction between membranes of red blood cells (RBCs) and phospholipid vesicles was studied. It is shown that beta(2)-glycoprotein I (beta(2)-GPI) may induce RBC discocyte-echinocyte-spherocyte shape transformation and subsequent agglutination of RBCs. Based on the observed beta(2)-GPI-induced RBC cell shape transformation it is proposed that the hydrophobic portion of beta(2)-GPI molecule protrudes into the outer lipid layer of the RBC membrane and increases the area of this layer. It is also suggested that the observed agglutination of RBCs is at least partially driven by an attractive force which is of electrostatic origin and depends on the specific molecular shape and internal charge distribution of membrane-bound beta(2)-GPI molecules. The suggested beta(2)-GPI-induced attractive electrostatic interaction between like-charged RBC membrane surfaces is qualitatively explained by using a simple mathematical model within the functional density theory of the electric double layer, where the electrostatic attraction between the positively charged part of the first domains of bound beta(2)-GPI molecules and negatively charged glycocalyx of the adjacent RBC membrane is taken into account.

Increasing binding density of yeast cells by control of surface charge with allylamine grafting to ion modified polymer surfaces.

PubMed

Tran, Clara T H; Kondyurin, Alexey; Chrzanowski, Wojciech; Bilek, Marcela M M; McKenzie, David R

2014-10-01

Plasma immersion ion implantation (PIII) treatment of polymers creates a biointerface capable of direct covalent immobilization of biomolecules. The immobilization of protein molecules is achieved by covalent bonds formed between embedded radicals on the treated surface and amino acid side chains and cells can be immobilized through cell-wall proteins. The attachment density of negatively charged entities on a PIII treated surface is inhibited by its negative surface charge at neutral pH. To reduce the negative charge of PIII treated surfaces in phosphate buffer (pH 7.4, 11mM), we develop an effective approach of grafting allylamine monomers onto the treated surface. The results reveal reactions between allylamine and radicals on the PIII treated surface. One of these triggers polymerization, increasing the number of amine groups grafted. As a consequence, the PIII treated polystyrene surface after allylamine exposure becomes more hydrophobic and less negatively charged in phosphate buffer. Using yeast cells as an example, we have shown a significant improvement (6-15 times) of cell density immobilized on the PIII treated surface after exposure to allylamine. Copyright © 2014 Elsevier B.V. All rights reserved.

Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desai, R. T.; Coates, A. J.; Wellbrock, A.

Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q{sup −1}. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q{sup −1} and between 49.0–50.1 u q{sup −1} which are identified as belonging to the carbon chain anions, CN{sup −}/C{sub 3}N{sup −} and/or C{sub 2}H{sup −}/C{sub 4}H{sup −},more » in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q{sup −1} could be attributed to the further carbon chain anions C{sub 5}N{sup −}/C{sub 6}H{sup −} but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q{sup −1}) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.« less

Multi-Excitonic Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

2006-03-01

With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.

Enhancing SERS by Means of Supramolecular Charge Transfer

NASA Technical Reports Server (NTRS)

Wong, Eric; Flood, Amar; Morales, Alfredo

2009-01-01

In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.

The role of highly oxygenated molecules (HOMs) in determining the composition of ambient ions in the boreal forest

NASA Astrophysics Data System (ADS)

Bianchi, Federico; Garmash, Olga; He, Xucheng; Yan, Chao; Iyer, Siddharth; Rosendahl, Ida; Xu, Zhengning; Rissanen, Matti P.; Riva, Matthieu; Taipale, Risto; Sarnela, Nina; Petäjä, Tuukka; Worsnop, Douglas R.; Kulmala, Markku; Ehn, Mikael; Junninen, Heikki

2017-11-01

In order to investigate the negative ions in the boreal forest we have performed measurements to chemically characterise the composition of negatively charged clusters containing highly oxygenated molecules (HOMs). Additionally, we compared this information with the chemical composition of the neutral gas-phase molecules detected in the ambient atmosphere during the same period. The chemical composition of the ions was retrieved using an atmospheric pressure interface time-of-flight mass spectrometer (APi-TOF-MS) while the gas-phase neutral molecules (mainly sulfuric acid and HOMs) were characterised using the same mass spectrometer coupled to a nitrate-based chemical ionisation unit (CI-APi-TOF). Overall, we divided the identified HOMs in two classes: HOMs containing only carbon, hydrogen and oxygen and nitrogen-containing HOMs or organonitrates (ONs). During the day, among the ions, in addition to the well-known pure sulfuric acid clusters, we found a large number of HOMs clustered with nitrate (NO3-) or bisulfate (HSO4-), with the first one being more abundant. During the night, the distribution of ions, mainly composed of HOM clustered with NO3-, was very similar to the neutral compounds that are detected in the CI-APi-TOF as adducts with the artificially introduced primary ion (NO3-). For the first time, we identified several clusters containing up to 40 carbon atoms. These ions are formed by up to four oxidised α-pinene units clustered with NO3-. While we know that dimers (16-20 carbon atoms) are probably formed by a covalent bond between two α-pinene oxidised units, it is still unclear what bonding formed larger clusters. Finally, diurnal profiles of the negative ions were consistent with the neutral compounds revealing that ONs peak during the day while HOMs are more abundant at night-time. However, during the day, a large fraction of the negative charge is taken up by the pure sulfuric acid clusters causing differences between ambient ions and neutral

Electromagnetic Radiation in the Atmosphere Generated by Excess Negative Charge in a Nuclear-Electromagnetic Cascade

NASA Astrophysics Data System (ADS)

Malyshevsky, V. S.; Fomin, G. V.

2017-01-01

On the basis of the analytical model "PARMA" (PHITS-based Analytical Radiation Model in the Atmosphere), developed to model particle fluxes of secondary cosmic radiation in the Earth's atmosphere, we have calculated the characteristics of radio waves emitted by excess negative charge in an electromagnetic cascade. The results may be of use in an analysis of experimental data on radio emission of electron-photon showers in the atmosphere.

Transport model of controlled molecular rectifier showing unusual negative differential resistance effect.

PubMed

Granhen, Ewerton Ramos; Reis, Marcos Allan Leite; Souza, Fabrício M; Del Nero, Jordan

2010-12-01

We investigate theoretically the charge accumulated Q in a three-terminal molecular device in the presence of an external electric field. Our approach is based on ab initio Hartree-Fock and density functional theory methodology contained in Gaussian package. Our main finding is a negative differential resistance (NDR) in the charge Q as a function of an external electric field. To explain this NDR effect we apply a phenomenological capacitive model based on a quite general system composed of many localized levels (that can be LUMOs of a molecule) coupled to source and drain. The capacitance accounts for charging effects that can result in Coulomb blockade (CB) in the transport. We show that this CB effect gives rise to a NDR for a suitable set of phenomenological parameters, like tunneling rates and charging energies. The NDR profile obtained in both ab initio and phenomenological methodologies are in close agreement.

Second harmonic generation study of malachite green adsorption at the interface between air and an electrolyte solution: observing the effect of excess electrical charge density at the interface.

PubMed

Song, Jinsuk; Kim, Mahn Won

2010-03-11

Understanding the differential adsorption of ions at the interface of an electrolyte solution is very important because it is closely related, not only to the fundamental aspects of biological systems, but also to many industrial applications. We have measured the excess interfacial negative charge density at air-electrolyte solution interfaces by using resonant second harmonic generation of oppositely charged probe molecules. The excess charge density increased with the square root of the bulk electrolyte concentration. A new adsorption model that includes the electrostatic interaction between adsorbed molecules is proposed to explain the measured adsorption isotherm, and it is in good agreement with the experimental results.

Host-guest chemistry of dendrimer-drug complexes: 7. Formation of stable inclusions between acetylated dendrimers and drugs bearing multiple charges.

PubMed

Fang, Min; Zhang, Jiahai; Wu, Qinglin; Xu, Tongwen; Cheng, Yiyun

2012-03-15

Drug molecules bearing multiple charges usually form precipitates with cationic dendrimers, which presents a challenge during the preparation of dendrimer inclusions for these drugs. In the present study, fully acetylated polyamidoamine (PAMAM) dendrimers were proposed as stable vehicles for drug molecules bearing two negative charges such as Congo red and indocyanine green. NMR techniques including (1)H NMR and (1)H-(1)H NOESY were used to characterize the host-guest chemistry of acetylated dendrimer and these guest molecules. The cationic PAMAM dendrimer was found to form a precipitate with Congo red and indocyanine green, but the acetylated one avoided the formation of cross-linking structures in aqueous solutions. NOESY studies revealed the encapsulation of Congo red and indocyanine green within the interior cavities of PAMAM dendrimers at mild acidic conditions and acetylated dendrimers show much stronger ability to encapsulate the guest molecules than cationic ones. Also, UV-vis-NIR studies suggest that acetylated dendrimers significantly improve the photostability of indocyanine green and prevent the formation of indocyanine green J-aggregates in aqueous solutions. The present study provides a new insight into dendrimer-based host-guest systems, especially for those guest molecules bearing multiple charges. © 2012 American Chemical Society

Electric-field controlled capture or release of phosgene molecule on graphene-based materials: First principles calculations

NASA Astrophysics Data System (ADS)

Zhang, Tong; Sun, Hao; Wang, Fengdi; Zhang, Wanqiao; Ma, Junmei; Tang, Shuwei; Gong, Hongwei; Zhang, Jingping

2018-01-01

Phosgene, one of the common chemicals in many industry areas, is extremely harmful to human and the environment. Thus, it is necessary to design the advanced materials to detect or remove phosgene effectively. In fact, detection or adsorption of some small gas molecules are not the most difficult to actualize. Whereas, one of the primary challenges is the gas molecules desorption from the adsorbent for the purpose of recycling of substrate materials since the small gas molecules interacts strongly with the substrates. In this work, the interaction between the phosgene molecule and pristine or Mn-doped graphene sheets with different electric field and charge state are investigated by using first-principles simulations. Our results show that the adsorption energy of phosgene on Mn-doped graphene is dramatically weakened by applying an external negative electric field but is obviously enhanced by introducing a positive electric field. These processes can be easily controlled by transform the direction of the electric field. Thus, introducing an external electric field or charge in the system may be an excellent method to control the phosgene molecule adsorption and desorption on Mn-doped graphene sheet. All energy needed is just a small quantity of electricity, which satisfies well the requirement of green chemistry and sustainable development. The mechanism and reason of reversible adsorption/desorption is also revealed in terms of energy, charge distribution and orbital analysis. Such spontaneous adsorption or desorption makes Mn-doped graphene to be used as an excellent reusable scavenger of phosgene.

Effect of incorporation of nitrogen atoms in Al2O3 gate dielectric of wide-bandgap-semiconductor MOSFET on gate leakage current and negative fixed charge

NASA Astrophysics Data System (ADS)

Kojima, Eiji; Chokawa, Kenta; Shirakawa, Hiroki; Araidai, Masaaki; Hosoi, Takuji; Watanabe, Heiji; Shiraishi, Kenji

2018-06-01

We performed first-principle calculations to investigate the effect of incorporation of N atoms into Al2O3 gate dielectrics. Our calculations show that the defect levels generated by VO in Al2O3 are the origin of the stress-induced gate leakage current and that VOVAl complexes in Al2O3 cause negative fixed charge. We revealed that the incorporation of N atoms into Al2O3 eliminates the VO defect levels, reducing the stress-induced gate leakage current. Moreover, this suppresses the formation of negatively charged VOVAl complexes. Therefore, AlON can reduce both stress-induced gate leakage current and negative fixed charge in wide-bandgap-semiconductor MOSFETs.

Direct analysis of samples under ambient condition by high-voltage-assisted laser desorption ionization mass spectrometry in both positive and negative ion mode.

PubMed

Ren, Xinxin; Liu, Jia; Zhang, Chengsen; Luo, Hai

2013-03-15

With the rapid development of ambient mass spectrometry, the hybrid laser-based ambient ionization methods which can generate multiply charged ions of large biomolecules and also characterize small molecules with good signal-to-noise in both positive and negative ion modes are of particular interest. An ambient ionization method termed high-voltage-assisted laser desorption ionization (HALDI) is developed, in which a 1064 nm laser is used to desorb various liquid samples from the sample target biased at a high potential without the need for an organic matrix. The pre-charged liquid samples are desorbed by the laser to form small charged droplets which may undergo an electrospray-like ionization process to produce multiply charged ions of large biomolecules. Various samples including proteins, oligonucleotides (ODNs), drugs, whole milk and chicken eggs have been analyzed by HALDI-MS in both positive and negative ion mode with little or no sample preparation. In addition, HALDI can generate intense signals with better signal-to-noise in negative ion mode than laser desorption spay post-ionization (LDSPI) from the same samples, such as ODNs and some carboxylic-group-containing small drug molecules. HALDI-MS can directly analyze a variety of liquid samples including proteins, ODNs, pharmaceuticals and biological fluids in both positive and negative ion mode without the use of an organic matrix. This technique may be further developed into a useful tool for rapid analysis in many different fields such as pharmaceutical, food, and biological sciences. Copyright © 2013 John Wiley & Sons, Ltd.

The role of charge and multiple faces of the CD8 alpha/alpha homodimer in binding to major histocompatibility complex class I molecules: support for a bivalent model.

PubMed

Giblin, P A; Leahy, D J; Mennone, J; Kavathas, P B

1994-03-01

The CD8 dimer interacts with the alpha 3 domain of major histocompatibility complex class I molecules through two immunoglobulin variable-like domains. In this study a crystal structure-informed mutational analysis has been performed to identify amino acids in the CD8 alpha/alpha homodimer that are likely to be involved in binding to class I. Several key residues are situated on the top face of the dimer within loops analogous to the complementarity-determining regions (CDRs) of immunoglobulin. In addition, other important amino acids are located in the A and B beta-strands on the sides of the dimer. The potential involvement of amino acids on both the top and the side faces of the molecule is consistent with a bivalent model for the interaction between a single CD8 alpha/alpha homodimer and two class I molecules and may have important implications for signal transduction in class I-expressing cells. This study also demonstrates a role for the positive surface potential of CD8 in class I binding and complements previous work demonstrating the importance of a negatively charged loop on the alpha 3 domain of class I for CD8 alpha/alpha-class I interaction. We propose a model whereby residues located on the CDR-like loops of the CD8 homodimer interact with the alpha 3 domain of MHC class I while amino acids on the side of the molecule containing the A and B beta-strands contact the alpha 2 domain of class I.

Negative differential conductance in InAs wire based double quantum dot induced by a charged AFM tip

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukov, A. A., E-mail: azhukov@issp.ac.ru; Volk, Ch.; Winden, A.

We investigate the conductance of an InAs nanowire in the nonlinear regime in the case of low electron density where the wire is split into quantum dots connected in series. The negative differential conductance in the wire is initiated by means of a charged atomic force microscope tip adjusting the transparency of the tunneling barrier between two adjoining quantum dots. We confirm that the negative differential conductance arises due to the resonant tunneling between these two adjoining quantum dots. The influence of the transparency of the blocking barriers and the relative position of energy states in the adjoining dots onmore » a decrease of the negative differential conductance is investigated in detail.« less

Dispersion interactions with linear scaling DFT: a study of planar molecules on charged polar surfaces

NASA Astrophysics Data System (ADS)

Andrinopoulos, Lampros; Hine, Nicholas; Haynes, Peter; Mostofi, Arash

2010-03-01

The placement of organic molecules such as CuPc (copper phthalocyanine) on wurtzite ZnO (zinc oxide) charged surfaces has been proposed as a way of creating photovoltaic solar cellsfootnotetextG.D. Sharma et al., Solar Energy Materials & Solar Cells 90, 933 (2006) ; optimising their performance may be aided by computational simulation. Electronic structure calculations provide high accuracy at modest computational cost but two challenges are encountered for such layered systems. First, the system size is at or beyond the limit of traditional cubic-scaling Density Functional Theory (DFT). Second, traditional exchange-correlation functionals do not account for van der Waals (vdW) interactions, crucial for determining the structure of weakly bonded systems. We present an implementation of recently developed approachesfootnotetextP.L. Silvestrelli, P.R.L. 100, 102 (2008) to include vdW in DFT within ONETEPfootnotetextC.-K. Skylaris, P.D. Haynes, A.A. Mostofi and M.C. Payne, J.C.P. 122, 084119 (2005) , a linear-scaling package for performing DFT calculations using a basis of localised functions. We have applied this methodology to simple planar organic molecules, such as benzene and pentacene, on ZnO surfaces.

Iodide uptake by negatively charged clay interlayers?

PubMed

Miller, Andrew; Kruichak, Jessica; Mills, Melissa; Wang, Yifeng

2015-09-01

Understanding iodide interactions with clay minerals is critical to quantifying risk associated with nuclear waste disposal. Current thought assumes that iodide does not interact directly with clay minerals due to electrical repulsion between the iodide and the negatively charged clay layers. However, a growing body of work indicates a weak interaction between iodide and clays. The goal of this contribution is to report a conceptual model for iodide interaction with clays by considering clay mineral structures and emergent behaviors of chemical species in confined spaces. To approach the problem, a suite of clay minerals was used with varying degrees of isomorphic substitution, chemical composition, and mineral structure. Iodide uptake experiments were completed with each of these minerals in a range of swamping electrolyte identities (NaCl, NaBr, KCl) and concentrations. Iodide uptake behaviors form distinct trends with cation exchange capacity and mineral structure. These trends change substantially with electrolyte composition and concentration, but do not appear to be affected by solution pH. The experimental results suggest that iodide may directly interact with clays by forming ion-pairs (e.g., NaI(aq)) which may concentrate within the interlayer space as well as the thin areas surrounding the clay particle where water behavior is more structured relative to bulk water. Ion pairing and iodide concentration in these zones is probably driven by the reduced dielectric constant of water in confined space and by the relatively high polarizability of the iodide species. Copyright © 2015 Elsevier Ltd. All rights reserved.

Design of organic ternary blends and small-molecule bulk heterojunctions: photophysical considerations

NASA Astrophysics Data System (ADS)

Rajesh, Kallarakkal Ramakrishnan; Paudel, Keshab; Johnson, Brian; Hallani, Rawad; Anthony, John; Ostroverkhova, Oksana

2015-01-01

We explored relationships between photophysical processes and solar cell characteristics in solution-processable bulk heterojunctions (BHJs), in particular: (1) polymer donor:fullerene acceptor:small-molecule (SM) nonfullerene acceptor, (2) polymer donor:SM donor:SM nonfullerene acceptor, and (3) SM donor:SM nonfullerene or fullerene acceptor. Addition of a nonfullerene SM acceptor to "efficient" polymer:fullerene BHJs led to a reduction in power conversion efficiency (PCE), mostly due to decreased charge photogeneration efficiency and increased disorder. By contrast, addition of an SM donor to "inefficient" polymer:SM nonfullerene acceptor BHJs led to a factor of two to three improvement in the PCE, due to improved charge photogeneration efficiency and transport. In most blends, exciplex formation was observed and correlated with a reduced short-circuit current (Jsc) without negatively impacting the open-circuit voltage (Voc). A factor of ˜5 higher PCE was observed in SM donor:fullerene acceptor BHJs as compared to SMBHJs with the same SM donor but nonfullerene acceptor, due to enhanced charge carrier photogeneration in the blend with fullerene. Our study revealed that the HOMO and LUMO energies of molecules comprising a blend are not reliable parameters for predicting Voc of the blend, and an understanding of the photophysics is necessary for interpreting solar cell characteristics and improving the molecular design of BHJs.

Critical evaluation of dipolar, acid-base and charge interactions I. Electron displacement within and between molecules, liquids and semiconductors.

PubMed

Rosenholm, Jarl B

2017-09-01

Specific dipolar, acid-base and charge interactions involve electron displacements. For atoms, single bonds and molecules electron displacement is characterized by electronic potential, absolute hardness, electronegativity and electron gap. In addition, dissociation, bonding, atomization, formation, ionization, affinity and lattice enthalpies are required to quantify the electron displacement in solids. Semiconductors are characterized by valence and conduction band energies, electron gaps and average Fermi energies which in turn determine Galvani potentials of the bulk, space charge layer and surface states. Electron displacement due to interaction between (probe) molecules, liquids and solids are characterized by parameters such as Hamaker constant, solubility parameter, exchange energy density, surface tension, work of adhesion and immersion. They are determined from permittivity, refractive index, enthalpy of vaporization, molar volume, surface pressure and contact angle. Moreover, acidic and basic probes may form adducts which are adsorbed on target substrates in order to establish an indirect measure of polarity, acidity, basicity or hydrogen bonding. Acidic acceptor numbers (AN), basic donor numbers (DN), acidic and basic "electrostatic" (E) and "covalent" (C) parameters determined by enthalpy of adduct formation are considered as general acid-base scales. However, the formal grounds for assignments as dispersive, Lifshitz-van der Waals, polar, acid, base and hydrogen bond interactions are inconsistent. Although correlations are found no of the parameters are mutually fully compatible and moreover the enthalpies of acid-base interaction do not correspond to free energies. In this review the foundations of different acid-base parameters relating to electron displacement within and between (probe) molecules, liquids and (semiconducting) solids are thoroughly investigated and their mutual relationships are evaluated. Copyright © 2017 Elsevier B.V. All rights

Hydration of a Large Anionic Charge Distribution - Naphthalene-Water Cluster Anions

NASA Astrophysics Data System (ADS)

Weber, J. Mathias; Adams, Christopher L.

2010-06-01

We report the infrared spectra of anionic clusters of naphthalene with up to three water molecules. Comparison of the experimental infrared spectra with theoretically predicted spectra from quantum chemistry calculations allow conclusions regarding the structures of the clusters under study. The first water molecule forms two hydrogen bonds with the π electron system of the naphthalene moiety. Subsequent water ligands interact with both the naphthalene and the other water ligands to form hydrogen bonded networks, similar to other hydrated anion clusters. Naphthalene-water anion clusters illustrate how water interacts with negative charge delocalized over a large π electron system. The clusters are interesting model systems that are discussed in the context of wetting of graphene surfaces and polyaromatic hydrocarbons.

Functionalized organic semiconductor molecules to enhance charge carrier injection in electroluminescent cell

NASA Astrophysics Data System (ADS)

Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk

2017-07-01

Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.

Single-Molecule Electronic Measurements with Metal Electrodes

ERIC Educational Resources Information Center

Lindsay, Stuart

2005-01-01

A review of concepts like tunneling through a metal-molecule-metal-junction, contrast with electrochemical and optical-charge injection, strong-coupling limit, calculations of tunnel transport, electron transfer through Redox-active molecules is presented. This is followed by a discussion of experimental approaches for single-molecule measurements.

Electronic structure of Fe- vs. Ru-based dye molecules

NASA Astrophysics Data System (ADS)

Johnson, Phillip S.; Cook, Peter L.; Zegkinoglou, Ioannis; García-Lastra, J. M.; Rubio, Angel; Ruther, Rose E.; Hamers, Robert J.; Himpsel, F. J.

2013-01-01

In order to explore whether Ru can be replaced by inexpensive Fe in dye molecules for solar cells, the differences in the electronic structure of Fe- and Ru-based dyes are investigated by X-ray absorption spectroscopy and first-principles calculations. Molecules with the metal in a sixfold, octahedral N cage, such as tris(bipyridines) and tris(phenanthrolines), exhibit a systematic downward shift of the N 1s-to-π* transition when Ru is replaced by Fe. This shift is explained by an extra transfer of negative charge from the metal to the N ligands in the case of Fe, which reduces the binding energy of the N 1s core level. The C 1s-to-π* transitions show the opposite trend, with an increase in the transition energy when replacing Ru by Fe. Molecules with the metal in a fourfold, planar N cage (porphyrins) exhibit a more complex behavior due to a subtle competition between the crystal field, axial ligands, and the 2+ vs. 3+ oxidation states.

DBDA as a Novel Matrix for the Analyses of Small Molecules and Quantification of Fatty Acids by Negative Ion MALDI-TOF MS

NASA Astrophysics Data System (ADS)

Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua

2018-01-01

Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H]-) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. [Figure not available: see fulltext.

DBDA as a Novel Matrix for the Analyses of Small Molecules and Quantification of Fatty Acids by Negative Ion MALDI-TOF MS.

PubMed

Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua

2018-04-01

Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H] - ) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. Graphical Abstract ᅟ.

Repulsive guidance molecule B (RGMB) plays negative roles in breast cancer by coordinating BMP signaling.

PubMed

Li, Jin; Ye, Lin; Sanders, Andrew J; Jiang, Wen G

2012-07-01

Repulsive guidance molecules (RGMs) coordinate axon formation and iron homestasis. These molecules are also known as co-receptors of bone morphogenetic proteins (BMPs). However, the role played by RGMs in breast cancer remains unclear. The present study investigated the impact of RGMB on functions of breast cancer cells and corresponding mechanisms. RGMB was knocked down in breast cancer cells by way of an anti-RGMB ribozyme transgene. Knockdown of RGMB resulted in enhanced capacities of proliferation, adhesion, and migration in breast cancer cells. Further investigations demonstrated RGMB knockdown resulted in a reduced expression and activity of Caspase-3, accompanied with better survival in RGMB knockdown cells under serum starvation, which might be induced by its repression on MAPK JNK pathway. Up-regulations of Snai1, Twist, FAK, and Paxillin via enhanced Smad dependent sigaling led to increased capacities of adhesion and migration. Our current data firstly revealed that RGMB may act as a negative regulator in breast cancer through BMP signaling. Copyright © 2012 Wiley Periodicals, Inc.

A method to obtain static potential for electron-molecule scattering

NASA Astrophysics Data System (ADS)

Srivastava, Rajesh; Das, Tapasi; Stauffer, Allan

2014-05-01

Electron scattering from molecules is complicated by the fact that molecules are a multi-centered target with the nuclei of the constituent atoms being a center of charge. One of the most important parts of a scattering calculation is to obtain the static potential which represents the interaction of the incident electron with the unperturbed charge distribution of the molecule. A common way to represent the charge distribution of molecules is with Gaussian orbitals centered on the various nuclei. We have derived a way to calculate spherically-averaged molecular static potentials using this form of molecular wave function which is mostly analytic. This method has been applied to elastic electron scattering from water molecules and we obtained differential cross sections which are compared with previous experimental and theoretical results. The method can be extended to more complex molecules. One of us (RS) is thankful to IAEA, Vienna, Austria and DAE-BRNS, Mumbai, India for financial support.

Polarized Fine Structure in the Photoluminescence Excitation Spectrum of a Negatively Charged Quantum Dot

NASA Astrophysics Data System (ADS)

Ware, M. E.; Stinaff, E. A.; Gammon, D.; Doty, M. F.; Bracker, A. S.; Gershoni, D.; Korenev, V. L.; Bădescu, Ş. C.; Lyanda-Geller, Y.; Reinecke, T. L.

2005-10-01

We report polarized photoluminescence excitation spectroscopy of the negative trion in single charge-tunable InAs/GaAs quantum dots. The spectrum exhibits a p-shell resonance with polarized fine structure arising from the direct excitation of the electron spin triplet states. The energy splitting arises from the axially symmetric electron-hole exchange interaction. The magnitude and sign of the polarization are understood from the spin character of the triplet states and a small amount of quantum dot asymmetry, which mixes the wave functions through asymmetric e-e and e-h exchange interactions.

Polarized fine structure in the photoluminescence excitation spectrum of a negatively charged quantum dot.

PubMed

Ware, M E; Stinaff, E A; Gammon, D; Doty, M F; Bracker, A S; Gershoni, D; Korenev, V L; Bădescu, S C; Lyanda-Geller, Y; Reinecke, T L

2005-10-21

We report polarized photoluminescence excitation spectroscopy of the negative trion in single charge-tunable quantum dots. The spectrum exhibits a p-shell resonance with polarized fine structure arising from the direct excitation of the electron spin triplet states. The energy splitting arises from the axially symmetric electron-hole exchange interaction. The magnitude and sign of the polarization are understood from the spin character of the triplet states and a small amount of quantum dot asymmetry, which mixes the wave functions through asymmetric e-e and e-h exchange interactions.

The influence of charge and the distribution of charge in the polar region of phospholipids on the activity of UDP-glucuronosyltransferase.

PubMed

Zakim, D; Eibl, H

1992-07-05

Studies of the mechanism of lipid-induced regulation of the microsomal enzyme UDP-glucuronosyltransferase have been extended by examining the influence of charge within the polar region on the ability of lipids to activate delipidated pure enzyme. The effects of net negative charge, of charge separation in phosphocholine, and of the distribution of charge in the polar region of lipids were studied using the GT2p isoform isolated from pig liver. Prior experiments have shown that lipids with net negative charge inhibit the enzyme (Zakim, D., Cantor, M., and Eibl, H. (1988) J. Biol. Chem. 263, 5164-5169). The current experiments show that the extent of inhibition on a molar basis increases as the net negative charge increases from -1 to -2. The inhibitory effect of negatively charged lipids is on the functional state of the enzyme and is not due to electrostatic repulsion of negatively charged substrates of the enzyme. Although the inhibitory effect of net negative charge is removed when negative charge is balanced by a positive charge due to a quaternary nitrogen, neutrality of the polar region is not a sufficient condition for activation of the enzyme. In addition to a balance of charge between Pi and the quaternary nitrogen, the distance between the negative and positive charges and the orientation of the dipole created by them are critical for activation of GT2p. The negative and positive charges must be separated by the equivalent of three -CH2- groups for optimal activation by a lipid. Shortening this distance by one -CH2- unit leads to a lipid that is ineffective in activating the enzyme. Reversal of the orientation of the dipole in which the negative charge is on the polymethylene side of the lipid-water interface and the positive charge extends into water also produces a lipid that is not effective for activating GT2p. On the other hand, lipids with phosphoserine as the polar region, which has the "normal" P-N distance but carries a net negative charge, do

Role of protein surface charge in monellin sweetness.

PubMed

Xue, Wei-Feng; Szczepankiewicz, Olga; Thulin, Eva; Linse, Sara; Carey, Jannette

2009-03-01

A small number of proteins have the unusual property of tasting intensely sweet. Despite many studies aimed at identifying their sweet taste determinants, the molecular basis of protein sweetness is not fully understood. Recent mutational studies of monellin have implicated positively charged residues in sweetness. In the present work, the effect of overall net charge was investigated using the complementary approach of negative charge alterations. Multiple substitutions of Asp/Asn and Glu/Gln residues radically altered the surface charge of single-chain monellin by removing six negative charges or adding four negative charges. Biophysical characterization using circular dichroism, fluorescence, and two-dimensional NMR demonstrates that the native fold of monellin is preserved in the variant proteins under physiological solution conditions although their stability toward chemical denaturation is altered. A human taste test was employed to determine the sweetness detection threshold of the variants. Removal of negative charges preserves monellin sweetness, whereas added negative charge has a large negative impact on sweetness. Meta-analysis of published charge variants of monellin and other sweet proteins reveals a general trend toward increasing sweetness with increasing positive net charge. Structural mapping of monellin variants identifies a hydrophobic surface predicted to face the receptor where introduced positive or negative charge reduces sweetness, and a polar surface where charges modulate long-range electrostatic complementarity.

Solvation effects on like-charge attraction.

PubMed

Ghanbarian, Shahzad; Rottler, Jörg

2013-02-28

We present results of molecular dynamics simulations of the electrostatic interaction between two parallel charged rods in the presence of divalent counterions. Such polyelectrolytes have been considered as a simple model for understanding electrostatic interactions in highly charged biomolecules such as DNA. Since there are correlations between the free charge carriers, the phenomenon of like charge attraction appears for specific parameters. We explore the role of solvation effects and the resulting deviations from Coulomb's law on the nanoscale on this peculiar phenomenon. The behavior of the force between the charged rods in a simulation with atomistic representation of water molecules is completely different from a model in which water is modeled as a continuum dielectric. By calculating counterion-rodion pair correlation functions, we find that the presence of water molecules changes the structure of the counterion cloud and results in both qualitative and quantitative changes of the force between highly charged polyelectrolytes.

Pore Polarity and Charge Determine Differential Block of Kir1.1 and Kir7.1 Potassium Channels by Small-Molecule Inhibitor VU590.

PubMed

Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S

2017-09-01

VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

Nanoparticle coagulation in fractionally charged and charge fluctuating dusty plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nunomura, Shota; Kondo, Michio; Shiratani, Masaharu

2008-08-15

The kinetics of nanoparticle coagulation has been studied in fractionally charged and charge fluctuating dusty plasmas. The coagulation occurs when the mutual collision frequency among nanoparticles exceeds their charging and decharging/neutralization frequency. Interestingly, the coagulation is suppressed while a fraction (several percent) of nanoparticles are negatively charged in a plasma, in which stochastic charging plays an important role. A model is developed to predict a phase diagram of the coagulation and its suppression.

Reshaping and linking of molecules in ion-pair traps

NASA Astrophysics Data System (ADS)

Cochrane, Bryce; Naumkin, Fedor Y.

2016-01-01

A series of insertion complexes of small molecules trapped between alkali-halide counter-ions are investigated ab initio. The molecular shape is altered inside the complexes and varies in corresponding anions. Stabilities and charge distributions are investigated. Strong charge-transfer in the alkali-halide component effectively through the almost neutral molecule results in very large dipole moments. The most stable species is used to construct a dimer significantly bound via dipole-dipole interaction. Another complex with two alkali-halide diatoms trapping the molecule represents a unit of corresponding longer oligomer. This completes the array of systems with the molecule effectively in ion-pair, ion-dipole, dipole-pair electric fields.

Space charge characteristics of fluorinated polyethylene: Different effects of fluorine and oxygen

NASA Astrophysics Data System (ADS)

Zhao, Ni; Nie, Yongjie; Li, Shengtao

2018-04-01

Direct fluorination are proved having obvious effect on space charge characteristics of polyethylene. It is believed that fluorine has a positive effect on suppressing space charge injection while oxygen impurity has a negative effect. However, the mechanism for the opposite effect of fluorine and oxygen is still not clear. In this paper, the different effects of fluorine and oxygen on space charge characteristics of fluorinated low density polyethylene (LDPE) are investigated on the basis of dielectric property, chemical constitutes and trap performance of surface fluorinated layers. The results show that direct fluorination has obvious effect on chemical constitutes and dielectric properties of surface fluorinated layer. Introduced fluorine is the main factor for suppressing charge injection from the electrodes, because it seriously changes the chemical constitutes and further the trap properties of the surface fluorinated layer. While introduction of oxygen results in heterocharges and makes space charge distribution complex, due to the ionization of generated small groups like C=O containing groups. Moreover, direct fluorination will result in cleavage of some LDPE molecules whatever there is oxygen impurity or not.

Expression of a Broad Array of Negative Costimulatory Molecules and Blimp-1 in T Cells following Priming by HIV-1 Pulsed Dendritic Cells

PubMed Central

Shankar, Esaki Muthu; Che, Karlhans Fru; Messmer, Davorka; Lifson, Jeffrey D; Larsson, Marie

2011-01-01

Accumulating evidence indicates that immune impairment in persistent viral infections could lead to T-cell exhaustion. To evaluate the potential contribution of induction of negative costimulatory molecules to impaired T-cell responses, we primed naïve T cells with mature monocyte-derived dendritic cells (MDDCs) pulsed with HIV-1 in vitro. We used quantitative real-time polymerase chain reaction and flow cytometry, respectively, to compare the gene and surface-protein expression profiles of naïve T cells primed with HIV-pulsed or mock-pulsed DCs. We detected elevated expressions of negative costimulatory molecules, including lymphocyte activation gene-3 (LAG-3), CD160, cytolytic T-lymphocyte antigen-4 (CTLA-4), T-cell immunoglobulin mucin-containing domain-3 (TIM-3), programmed death-1 (PD-1) and TRAIL (tumor necrosis-factor–related apoptosis-inducing ligand) in T cells primed by HIV-pulsed DCs. The PD-1+ T-cell population also coexpressed TIM-3, LAG-3, and CTLA-4. Interestingly, we also found an increase in gene expression of the transcriptional repressors Blimp-1 (B-lymphocyte–induced maturation protein-1) and Foxp3 (forkhead transcription factor) in T-cells primed by HIV-pulsed DCs; Blimp-1 expression was directly proportional to the expression of the negative costimulatory molecules. Furthermore, levels of the effector cytokines interleukin-2, tumor necrosis factor-α and interferon-γ, and perforin and granzyme B were decreased in T-cell populations primed by HIV-pulsed DCs. In conclusion, in vitro priming of naïve T-cells with HIV-pulsed DC leads to expansion of T cells with coexpression of a broad array of negative costimulatory molecules and Blimp-1, with potential deleterious consequences for T-cell responses. PMID:21103670

Redesign of negatively charged 111In-DTPA-octreotide derivative to reduce renal radioactivity.

PubMed

Oshima, Nobuhiro; Akizawa, Hiromichi; Kawashima, Hidekazu; Zhao, Songji; Zhao, Yan; Nishijima, Ken-Ichi; Kitamura, Yoji; Arano, Yasushi; Kuge, Yuji; Ohkura, Kazue

2017-05-01

Radiolabeled octreotide derivatives have been studied as diagnostic and therapeutic agents for somatostatin receptor-positive tumors. To prevent unnecessary radiation exposure during their clinical application, the present study aimed to develop radiolabeled peptides which could reduce radioactivity levels in the kidney at both early and late post-injection time points by introducing a negative charge with an acidic amino acid such as L-aspartic acid (Asp) at a suitable position in 111 In-DTPA-conjugated octreotide derivatives. Biodistribution of the radioactivity was evaluated in normal mice after administration of a novel radiolabeled peptide by a counting method. The radiolabeled species remaining in the kidney were identified by comparing their HPLC data with those obtained by alternative synthesis. The designed and synthesized radiolabeled peptide 111 In-DTPA-d-Phe -1 -Asp 0 -d-Phe 1 -octreotide exhibited significantly lower renal radioactivity levels than those of the known 111 In-DTPA-d-Phe 1 -octreotide at 3 and 24h post-injection. The radiolabeled species in the kidney at 24h after the injection of new octreotide derivative represented 111 In-DTPA-d-Phe-OH and 111 In-DTPA-d-Phe-Asp-OH as the metabolites. Their radiometabolites and intact 111 In-DTPA-conjugated octreotide derivative were observed in urine within 24h post-injection. The present study provided a new example of an 111 In-DTPA-conjugated octreotide derivative having the characteristics of both reduced renal uptake and shortened residence time of radioactivity in the kidney. It is considered that this kinetic control was achieved by introducing a negative charge on the octreotide derivative thereby suppressing the reabsorption in the renal tubules and affording the radiometabolites with appropriate lipophilicity. Copyright © 2017 Elsevier Inc. All rights reserved.

A rocket-borne mass analyzer for charged aerosol particles in the mesosphere

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knappmiller, Scott; Robertson, Scott; Sternovsky, Zoltan

2008-10-15

An electrostatic mass spectrometer for nanometer-sized charged aerosol particles in the mesosphere has been developed and tested. The analyzer is mounted on the forward end of a rocket and has a slit opening for admitting a continuous sample of air that is exhausted through ports at the sides. Within the instrument housing are two sets of four collection plates that are biased with positive and negative voltages for the collection of negative and positive aerosol particles, respectively. Each collection plate spans about an order of magnitude in mass which corresponds to a factor of 2 in radius. The number densitymore » of the charge is calculated from the current collected by the plates. The mean free path for molecular collisions in the mesosphere is comparable to the size of the instrument opening; thus, the analyzer performance is modeled by a Monte Carlo computer code that finds the aerosol particles trajectories within the instrument including both the electrostatic force and the forces from collisions of the aerosol particles with air molecules. Mass sensitivity curves obtained using the computer models are near to those obtained in the laboratory using an ion source. The first two flights of the instrument returned data showing the charge number densities of both positive and negative aerosol particles in four mass ranges.« less

Transport of the highly charged myo-inositol hexakisphosphate molecule across the red blood cell membrane: a phase transfer and biological study.

PubMed

Vincent, Stéphane P; Lehn, Jean-Marie; Lazarte, Jaime; Nicolau, Claude

2002-09-01

To address the problem of delivering highly charged small molecules, such as phytic acid (InsP(6) or IHP), across biological membranes, we investigated an approach based on a non-covalent interaction between transport molecule(s) and IHP. Thus, we synthesized a collection of compounds containing IHP ionically bound to lipophilic (but non-lipidic) ammonium or poly-ammonium cations. First, we assessed the ability of these water-soluble salts to cross a biological membrane by measuring the partition coefficients between human serum and 1-octanol. In view of the ability of IHP to act as potent effector for oxygen release, the O(2)-hemoglobin dissociation curves were then measured for the most efficient salts on whole blood. From both the biological and the physical properties of IHP-ammonium salts we determined that cycloalkylamines (or poly-amines) were the best transport molecules, especially cycloheptyl- and cyclooctylamine. Indeed, the octanol/serum partition coefficient of IHP undecacyclooctylammonium salt, is superior to 1, which is very favorable for potential uptake into the red blood cell membrane. A qualitative correlation was found between the partitioning experiments and the biological evaluations performed on whole blood.

Internal transitions of neutral (X) and negatively charged (X(-)) magneto-excitons investigated by optically detected resonance (ODR) spectroscopy

NASA Astrophysics Data System (ADS)

Nickel, Hans Andreas

Optically detected resonance (ODR) spectroscopy, an experimental technique combining spectroscopy in the far-infrared and visible regimes of the spectrum, has been applied to non-intentionally- and modulation-doped, quasi-2D GaAs/AlGaAs heterostructures at low temperatures and high magnetic fields to study internal transitions of neutral (X) and negatively charged (X--) magneto-excitons. In quasi-2D GaAs/AlGaAs heterostructures with a low density of free carriers, such as undoped multiple-quantum-wells, the ground state of optical excitations is the neutral exciton. This hydrogenic system was studied by far-infrared ODR spectroscopy, and internal excitonic transitions (IETs) 1s → np+/- from the ground state (1s) to excited states (np+/-) were found. Three samples of different well widths were studied systematically, and the behavior of the observed transitions as a function of the sample well-width was as expected. A predicted consequence of an inherent symmetry to the system was verified experimentally for the first time by the simultaneous observation of IETs and electron and hole cyclotron resonance in one sample in one experiment. In addition, it was also found, that the observability of IETs is destroyed as soon as there is a sign of X---recombination in the photoluminescence spectrum. In quantum wells with a small number of excess electrons the ground state of the system under optical excitation is the negatively charged exciton, X--. This mobile system of a hole binding two electrons differs significantly in certain aspects from its immobile impurity analogue, the negatively charged donor ion D-- . The mobility of the charged complex is tied to a hidden symmetry of magnetic translations, which leads to a new selection rule, that forbids X-- bound-to-bound transitions, in contrast to the D -- system, in which these transitions are dominant. In this dissertation, several samples that show X-- recombination in photoluminescence measurements were studied with

Radiation transport codes for potential applications related to radiobiology and radiotherapy using protons, neutrons, and negatively charged pions

NASA Technical Reports Server (NTRS)

Armstrong, T. W.

1972-01-01

Several Monte Carlo radiation transport computer codes are used to predict quantities of interest in the fields of radiotherapy and radiobiology. The calculational methods are described and comparisions of calculated and experimental results are presented for dose distributions produced by protons, neutrons, and negatively charged pions. Comparisons of calculated and experimental cell survival probabilities are also presented.

New effects of a long-lived negatively charged massive particle on big bang nucleosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakabe, Motohiko; Kim, K. S.; Cheoun, Myung-Ki

Primordial {sup 7}Li abundance inferred from observations of metal-poor stars is a factor of about 3 lower than the theoretical value of standard big bang nucleosynthesis (BBN) model. One of the solutions to the Li problem is {sup 7}Be destruction during the BBN epoch caused by a long-lived negatively charged massive particle, X{sup −}. The particle can bind to nuclei, and X-bound nuclei (X-nuclei) can experience new reactions. The radiative X{sup −} capture by {sup 7}Be nuclei followed by proton capture of the bound state of {sup 7}Be and X{sup −} ({sup 7}Be{sub x}) is a possible {sup 7}Be destructionmore » reaction. Since the primordial abundance of {sup 7}Li originates mainly from {sup 7}Li produced via the electron capture of {sup 7}Be after BBN, the {sup 7}Be destruction provides a solution to the {sup 7}Li problem. We suggest a new route of {sup 7}Be{sub x} formation, that is the {sup 7}Be charge exchange at the reaction of {sup 7}Be{sup 3+} ion and X{sup −}. The formation rate depends on the ionization fraction of {sup 7}Be{sup 3+} ion, the charge exchange cross section of {sup 7}Be{sup 3+}, and the probability that excited states {sup 7}Be{sub x}* produced at the charge exchange are converted to the ground state. We find that this reaction can be equally important as or more important than ordinary radiative recombination of {sup 7}Be and X{sup −}. The effect of this new route is shown in a nuclear reaction network calculation.« less

Conformational Transitions and Stop-and-Go Nanopore Transport of Single Stranded DNA on Charged Graphene

PubMed Central

Shankla, Manish; Aksimentiev, Aleksei

2014-01-01

Control over interactions with biomolecules holds the key to applications of graphene in biotechnology. One such application is nanopore sequencing, where a DNA molecule is electrophoretically driven through a graphene nanopore. Here, we investigate how interactions of single-stranded DNA and a graphene membrane can be controlled by electrically biasing the membrane. The results of our molecular dynamics simulations suggest that electric charge on graphene can force a DNA homopolymer to adopt a range of strikingly different conformations. The conformational response is sensitive to even very subtle nucleotide modifications, such as DNA methylation. The speed of DNA motion through a graphene nanopore is strongly affected by the graphene charge: a positive charge accelerates the motion whereas a negative charge arrests it. As a possible application of the effect, we demonstrate stop-and-go transport of DNA controlled by the charge of graphene. Such on-demand transport of DNA is essential for realizing nanopore sequencing. PMID:25296960

Conformational transitions and stop-and-go nanopore transport of single-stranded DNA on charged graphene

NASA Astrophysics Data System (ADS)

Shankla, Manish; Aksimentiev, Aleksei

2014-10-01

Control over interactions with biomolecules holds the key to applications of graphene in biotechnology. One such application is nanopore sequencing, where a DNA molecule is electrophoretically driven through a graphene nanopore. Here we investigate how interactions of single-stranded DNA and a graphene membrane can be controlled by electrically biasing the membrane. The results of our molecular dynamics simulations suggest that electric charge on graphene can force a DNA homopolymer to adopt a range of strikingly different conformations. The conformational response is sensitive to even very subtle nucleotide modifications, such as DNA methylation. The speed of DNA motion through a graphene nanopore is strongly affected by the graphene charge: a positive charge accelerates the motion, whereas a negative charge arrests it. As a possible application of the effect, we demonstrate stop-and-go transport of DNA controlled by the charge of graphene. Such on-demand transport of DNA is essential for realizing nanopore sequencing.

The effects of electric fields on charged molecules and particles in individual microenvironments

NASA Astrophysics Data System (ADS)

Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.

Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.

Novel Effects of Compressed CO 2 Molecules on Structural Ordering and Charge Transport in Conjugated Poly(3-hexylthiophene) Thin Films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Naisheng; Sendogdular, Levent; Sen, Mani

We report the effects of compressed CO 2 molecules as a novel plasticization agent for poly(3- hexylthiophene) (P3HT) conjugated polymer thin films. In-situ neutron reflectivity experiment demonstrated the excess sorption of CO 2 molecules in the P3HT thin films (about 40 nm in thickness) at low pressure (P = 8.2 MPa) under the isothermal condition of T = 36 °C, which is far below the polymer bulk melting point. The results evidenced that these CO 2 molecules accelerated the crystallization process of the polymer on the basis of ex-situ grazing incidence Xray diffraction measurements after drying the films via rapidmore » depressurization to atmospheric pressure: not only the out-of-plane lamellar ordering of the backbone chains but also intra-plane π-π stacking of the side chains were significantly improved, when compared to those in the control P3HT films subjected to conventional thermal annealing (at T = 170 °C). Electrical measurements elucidated that the CO 2-annealed P3HT thin films exhibited enhanced charge carrier mobility along with decreased background charge carrier concentration and trap density compared to those in the thermally annealed counterpart. This is attributed to the CO 2-induced increase in polymer chain mobility that can drive the detrapping of molecular oxygen and healing of conformational defects in the polymer thin film. Given the universality of the excess sorption of CO 2regardless of the type of polymers, the present findings suggest that the CO 2 annealing near the critical point can be useful as a robust processing strategy for improving structural and electrical characteristics of other semiconducting conjugated polymers and related systems such as polymer: fullerene bulk heterojunction films.tion films.« less

Novel Effects of Compressed CO 2 Molecules on Structural Ordering and Charge Transport in Conjugated Poly(3-hexylthiophene) Thin Films

DOE PAGES

Jiang, Naisheng; Sendogdular, Levent; Sen, Mani; ...

2016-10-06

We report the effects of compressed CO 2 molecules as a novel plasticization agent for poly(3- hexylthiophene) (P3HT) conjugated polymer thin films. In-situ neutron reflectivity experiment demonstrated the excess sorption of CO 2 molecules in the P3HT thin films (about 40 nm in thickness) at low pressure (P = 8.2 MPa) under the isothermal condition of T = 36 °C, which is far below the polymer bulk melting point. The results evidenced that these CO 2 molecules accelerated the crystallization process of the polymer on the basis of ex-situ grazing incidence Xray diffraction measurements after drying the films via rapidmore » depressurization to atmospheric pressure: not only the out-of-plane lamellar ordering of the backbone chains but also intra-plane π-π stacking of the side chains were significantly improved, when compared to those in the control P3HT films subjected to conventional thermal annealing (at T = 170 °C). Electrical measurements elucidated that the CO 2-annealed P3HT thin films exhibited enhanced charge carrier mobility along with decreased background charge carrier concentration and trap density compared to those in the thermally annealed counterpart. This is attributed to the CO 2-induced increase in polymer chain mobility that can drive the detrapping of molecular oxygen and healing of conformational defects in the polymer thin film. Given the universality of the excess sorption of CO 2regardless of the type of polymers, the present findings suggest that the CO 2 annealing near the critical point can be useful as a robust processing strategy for improving structural and electrical characteristics of other semiconducting conjugated polymers and related systems such as polymer: fullerene bulk heterojunction films.tion films.« less

Physicochemical properties of surface charge-modified ZnO nanoparticles with different particle sizes

PubMed Central

Kim, Kyoung-Min; Choi, Mun-Hyoung; Lee, Jong-Kwon; Jeong, Jayoung; Kim, Yu-Ri; Kim, Meyoung-Kon; Paek, Seung-Min; Oh, Jae-Min

2014-01-01

In this study, four types of standardized ZnO nanoparticles were prepared for assessment of their potential biological risk. Powder-phased ZnO nanoparticles with different particle sizes (20 nm and 100 nm) were coated with citrate or L-serine to induce a negative or positive surface charge, respectively. The four types of coated ZnO nanoparticles were subjected to physicochemical evaluation according to the guidelines published by the Organisation for Economic Cooperation and Development. All four samples had a well crystallized Wurtzite phase, with particle sizes of ∼30 nm and ∼70 nm after coating with organic molecules. The coating agents were determined to have attached to the ZnO surfaces through either electrostatic interaction or partial coordination bonding. Electrokinetic measurements showed that the surface charges of the ZnO nanoparticles were successfully modified to be negative (about −40 mV) or positive (about +25 mV). Although all the four types of ZnO nanoparticles showed some agglomeration when suspended in water according to dynamic light scattering analysis, they had clearly distinguishable particle size and surface charge parameters and well defined physicochemical properties. PMID:25565825

π-π Interaction among violanthrone molecules: observation, enhancement, and resulting charge transport properties.

PubMed

Shi, Min-Min; Chen, Yi; Nan, Ya-Xiong; Ling, Jun; Zuo, Li-Jian; Qiu, Wei-Ming; Wang, Mang; Chen, Hong-Zheng

2011-02-03

To investigate the relationship between π-π stacking and charge transport property of organic semiconductors, a highly soluble violanthrone derivative, 16,17-bis(2-ethylhexyloxy)anthra[9,1,2-cde-]benzo[rst]pentaphene-5,10-dione (3), is designed and synthesized. The π-π stacking behavior and the aggregation of compound 3 in both solution and thin film were studied in detail by (1)H nuclear magnetic resonance (NMR) spectroscopy, ultraviolet-visible (UV-vis) absorption, X-ray diffraction (XRD), and atomic force microscopy (AFM). When (1)H NMR spectroscopy and theoretical modeling results were combined, the arrangements of compound 3 molecules in the aggregates are demonstrated, where the dipole moments of the two adjacent molecules are nearly reversed to achieve efficient intermolecular π-π overlapping. Furthermore, it is interesting to find that the π-π stacking of compound 3, in both solution and thin films, can be enhanced by introducing a poor solvent n-hexane into the dilute chloroform solution. The resulting film exhibits more red-shifted absorption and higher crystallinity than the film made from pure chloroform solvent, suggesting that π-π interactions in the solid state are intensified by the poor solvent. Organic field-effect transistors (OFETs) with compound 3 film as the transportation layer were fabricated. It is disclosed that the compound 3 film obtained from the chloroform/n-hexane mixed solvents exhibits 1 order of magnitude higher hole mobility than that from the pure chloroform solvent because of the enhanced π-π interactions and the higher crystallinity in the former film. This work provided us valuable information in the improvement of electronic and optoelectronic performances of organic semiconductors by tuning their aggregate structures.

Molecules on si: electronics with chemistry.

PubMed

Vilan, Ayelet; Yaffe, Omer; Biller, Ariel; Salomon, Adi; Kahn, Antoine; Cahen, David

2010-01-12

Basic scientific interest in using a semiconducting electrode in molecule-based electronics arises from the rich electrostatic landscape presented by semiconductor interfaces. Technological interest rests on the promise that combining existing semiconductor (primarily Si) electronics with (mostly organic) molecules will result in a whole that is larger than the sum of its parts. Such a hybrid approach appears presently particularly relevant for sensors and photovoltaics. Semiconductors, especially Si, present an important experimental test-bed for assessing electronic transport behavior of molecules, because they allow varying the critical interface energetics without, to a first approximation, altering the interfacial chemistry. To investigate semiconductor-molecule electronics we need reproducible, high-yield preparations of samples that allow reliable and reproducible data collection. Only in that way can we explore how the molecule/electrode interfaces affect or even dictate charge transport, which may then provide a basis for models with predictive power.To consider these issues and questions we will, in this Progress Report, review junctions based on direct bonding of molecules to oxide-free Si.describe the possible charge transport mechanisms across such interfaces and evaluate in how far they can be quantified.investigate to what extent imperfections in the monolayer are important for transport across the monolayer.revisit the concept of energy levels in such hybrid systems.

Highly efficient bioinspired molecular Ru water oxidation catalysts with negatively charged backbone ligands.

PubMed

Duan, Lele; Wang, Lei; Li, Fusheng; Li, Fei; Sun, Licheng

2015-07-21

The oxygen evolving complex (OEC) of the natural photosynthesis system II (PSII) oxidizes water to produce oxygen and reducing equivalents (protons and electrons). The oxygen released from PSII provides the oxygen source of our atmosphere; the reducing equivalents are used to reduce carbon dioxide to organic products, which support almost all organisms on the Earth planet. The first photosynthetic organisms able to split water were proposed to be cyanobacteria-like ones appearing ca. 2.5 billion years ago. Since then, nature has chosen a sustainable way by using solar energy to develop itself. Inspired by nature, human beings started to mimic the functions of the natural photosynthesis system and proposed the concept of artificial photosynthesis (AP) with the view to creating energy-sustainable societies and reducing the impact on the Earth environments. Water oxidation is a highly energy demanding reaction and essential to produce reducing equivalents for fuel production, and thereby effective water oxidation catalysts (WOCs) are required to catalyze water oxidation and reduce the energy loss. X-ray crystallographic studies on PSII have revealed that the OEC consists of a Mn4CaO5 cluster surrounded by oxygen rich ligands, such as oxyl, oxo, and carboxylate ligands. These negatively charged, oxygen rich ligands strongly stabilize the high valent states of the Mn cluster and play vital roles in effective water oxidation catalysis with low overpotential. This Account describes our endeavors to design effective Ru WOCs with low overpotential, large turnover number, and high turnover frequency by introducing negatively charged ligands, such as carboxylate. Negatively charged ligands stabilized the high valent states of Ru catalysts, as evidenced by the low oxidation potentials. Meanwhile, the oxygen production rates of our Ru catalysts were improved dramatically as well. Thanks to the strong electron donation ability of carboxylate containing ligands, a seven

Crystallochromy of perylene pigments: Interference between Frenkel excitons and charge-transfer states

NASA Astrophysics Data System (ADS)

Gisslén, Linus; Scholz, Reinhard

2009-09-01

The optical properties of perylene-based pigments are arising from the interplay between neutral molecular excitations and charge transfer between adjacent molecules. In the crystalline phase, these excitations are coupled via electron and hole transfer, two quantities relating directly to the width of the conduction and valence band in the crystalline phase. Based on the crystal structure determined by x-ray diffraction, density-functional theory (DFT) and Hartree-Fock are used for the calculation of the electronic states of a dimer of stacked molecules. The resulting transfer parameters for electron and hole are used in an exciton model for the coupling between Frenkel excitons and charge-transfer states. The deformation of the positively or negatively charged molecular ions with respect to the neutral ground state is calculated with DFT and the geometry in the optically excited state is deduced from time-dependent DFT and constrained DFT. All of these deformations are interpreted in terms of the elongation of an effective internal vibration which is used subsequently in the exciton model for the crystalline phase. A comparison between the calculated dielectric function and the observed optical spectra allows to deduce the relative energetic position of Frenkel excitons and the charge-transfer state involving stack neighbors, a key parameter for various electronic and optoelectronic device applications. For five out of six perylene pigments studied in the present work, this exciton model results in excellent agreement between calculated and observed optical properties.

Investigation of N-acyl homoserine lactone (AHL) molecule production in Gram-negative bacteria isolated from cooling tower water and biofilm samples.

PubMed

Haslan, Ezgi; Kimiran-Erdem, Ayten

2013-09-01

In this study, 99 Gram-negative rod bacteria were isolated from cooling tower water, and biofilm samples were examined for cell-to-cell signaling systems, N-acyl homoserine lactone (AHL) signal molecule types, and biofilm formation capacity. Four of 39 (10 %) strains isolated from water samples and 14 of 60 (23 %) strains isolated from biofilm samples were found to be producing a variety of AHL signal molecules. It was determined that the AHL signal molecule production ability and the biofilm formation capacity of sessile bacteria is higher than planktonic bacteria, and there was a statistically significant difference between the AHL signal molecule production of these two groups (p < 0.05). In addition, it was found that bacteria belonging to the same species isolated from cooling tower water and biofilm samples produced different types of AHL signal molecules and that there were different types of AHL signal molecules in an AHL extract of bacteria. In the present study, it was observed that different isolates of the same strains did not produce the same AHLs or did not produce AHL molecules, and bacteria known as AHL producers did not produce AHL. These findings suggest that detection of signal molecules in bacteria isolated from cooling towers may contribute to prevention of biofilm formation, elimination of communication among bacteria in water systems, and blockage of quorum-sensing controlled virulence of these bacteria.

Spectroscopic and calorimetric investigations on the influence of calcium ions on the polyamine negatively charged phospholipid molecular interactions

NASA Astrophysics Data System (ADS)

Bertoluzza, Alessandro; Bonora, S.; Fini, G.; Morelli, M. A.

1993-06-01

Polyamines do not interact with neutral phospholipids (phosphatidylcholines) but they do interact in the presence of bivalent and trivalent cations. The effect of polyvalent cations is explained in terms of dehydration of the bilayer surface. Polyamines interact strongly with negatively charged phospholipids; the presence of bivalent and trivalent cations do not change sensitively the type of interaction between polyamines and phosphatidic acids.

Three chamber negative ion source

DOEpatents

Leung, Ka-Ngo; Ehlers, Kenneth W.; Hiskes, John R.

1985-01-01

A negative ion vessel is divided into an excitation chamber, a negative ionization chamber and an extraction chamber by two magnetic filters. Input means introduces neutral molecules into a first chamber where a first electron discharge means vibrationally excites the molecules which migrate to a second chamber. In the second chamber a second electron discharge means ionizes the molecules, producing negative ions which are extracted into or by a third chamber. A first magnetic filter prevents high energy electrons from entering the negative ionization chamber from the excitation chamber. A second magnetic filter prevents high energy electrons from entering the extraction chamber from the negative ionizing chamber. An extraction grid at the end of the negative ion vessel attracts negative ions into the third chamber and accelerates them. Another grid, located adjacent to the extraction grid, carries a small positive voltage in order to inhibit positive ions from migrating into the extraction chamber and contour the plasma potential. Additional electrons can be suppressed from the output flux using ExB forces provided by magnetic field means and the extractor grid electric potential.

Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.

PubMed

Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi

2018-02-27

In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.

N-(1-Naphthyl) Ethylenediamine Dinitrate: A New Matrix for Negative Ion MALDI-TOF MS Analysis of Small Molecules

NASA Astrophysics Data System (ADS)

Chen, Rui; Chen, Suming; Xiong, Caiqiao; Ding, Xunlei; Wu, Chih-Che; Chang, Huan-Cheng; Xiong, Shaoxiang; Nie, Zongxiu

2012-09-01

An organic salt, N-(1-naphthyl) ethylenediamine dinitrate (NEDN), with rationally designed properties of a strong UV absorbing chromophore, hydrogen binding and nitrate anion donors, has been employed as a matrix to analyze small molecules ( m/z < 1000) such as oligosaccharides, peptides, metabolites and explosives using negative ion matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Compared with conventional matrixes such as α-cyano-4-hydroxycinnamic acid (CCA) and 2,5-dihydroxybenzoic acid (DHB), NEDN provides a significant improvement in detection sensitivity and yields very few matrix-associated fragment and cluster ions interfering with MS analysis. For low-molecular-weight saccharides, the lowest detection limit achieved ranges from 500 amol to 5 pmol, depending on the molecular weight and the structure of the analytes. Additionally, the mass spectra in the lower mass range ( m/z < 200) consist of only nitrate and nitric acid cluster ions, making the matrix particularly useful for structural identification of oligosaccharides by post-source decay (PSD) MALDI-MS. Such a characteristic is illustrated by using maltoheptaose as a model system. This work demonstrates that NEDN is a novel negative ion-mode matrix for MALDI-MS analysis of small molecules with nitrate anion attachment.

Resolving metal-molecule interfaces at single-molecule junctions

NASA Astrophysics Data System (ADS)

Komoto, Yuki; Fujii, Shintaro; Nakamura, Hisao; Tada, Tomofumi; Nishino, Tomoaki; Kiguchi, Manabu

2016-05-01

Electronic and structural detail at the electrode-molecule interface have a significant influence on charge transport across molecular junctions. Despite the decisive role of the metal-molecule interface, a complete electronic and structural characterization of the interface remains a challenge. This is in no small part due to current experimental limitations. Here, we present a comprehensive approach to obtain a detailed description of the metal-molecule interface in single-molecule junctions, based on current-voltage (I-V) measurements. Contrary to conventional conductance studies, this I-V approach provides a correlated statistical description of both, the degree of electronic coupling across the metal-molecule interface, and the energy alignment between the conduction orbital and the Fermi level of the electrode. This exhaustive statistical approach was employed to study single-molecule junctions of 1,4-benzenediamine (BDA), 1,4-butanediamine (C4DA), and 1,4-benzenedithiol (BDT). A single interfacial configuration was observed for both BDA and C4DA junctions, while three different interfacial arrangements were resolved for BDT. This multiplicity is due to different molecular adsorption sites on the Au surface namely on-top, hollow, and bridge. Furthermore, C4DA junctions present a fluctuating I-V curve arising from the greater conformational freedom of the saturated alkyl chain, in sharp contrast with the rigid aromatic backbone of both BDA and BDT.

Lactoferricin B causes depolarization of the cytoplasmic membrane of Escherichia coli ATCC 25922 and fusion of negatively charged liposomes.

PubMed

Ulvatne, H; Haukland, H H; Olsvik, O; Vorland, L H

2001-03-09

Antimicrobial peptides have been extensively studied in order to elucidate their mode of action. Most of these peptides have been shown to exert a bactericidal effect on the cytoplasmic membrane of bacteria. Lactoferricin is an antimicrobial peptide with a net positive charge and an amphipatic structure. In this study we examine the effect of bovine lactoferricin (lactoferricin B; Lfcin B) on bacterial membranes. We show that Lfcin B neither lyses bacteria, nor causes a major leakage from liposomes. Lfcin B depolarizes the membrane of susceptible bacteria, and induces fusion of negatively charged liposomes. Hence, Lfcin B may have additional targets responsible for the antibacterial effect.

Predicting p Ka values from EEM atomic charges

PubMed Central

2013-01-01

The acid dissociation constant p Ka is a very important molecular property, and there is a strong interest in the development of reliable and fast methods for p Ka prediction. We have evaluated the p Ka prediction capabilities of QSPR models based on empirical atomic charges calculated by the Electronegativity Equalization Method (EEM). Specifically, we collected 18 EEM parameter sets created for 8 different quantum mechanical (QM) charge calculation schemes. Afterwards, we prepared a training set of 74 substituted phenols. Additionally, for each molecule we generated its dissociated form by removing the phenolic hydrogen. For all the molecules in the training set, we then calculated EEM charges using the 18 parameter sets, and the QM charges using the 8 above mentioned charge calculation schemes. For each type of QM and EEM charges, we created one QSPR model employing charges from the non-dissociated molecules (three descriptor QSPR models), and one QSPR model based on charges from both dissociated and non-dissociated molecules (QSPR models with five descriptors). Afterwards, we calculated the quality criteria and evaluated all the QSPR models obtained. We found that QSPR models employing the EEM charges proved as a good approach for the prediction of p Ka (63% of these models had R2 > 0.9, while the best had R2 = 0.924). As expected, QM QSPR models provided more accurate p Ka predictions than the EEM QSPR models but the differences were not significant. Furthermore, a big advantage of the EEM QSPR models is that their descriptors (i.e., EEM atomic charges) can be calculated markedly faster than the QM charge descriptors. Moreover, we found that the EEM QSPR models are not so strongly influenced by the selection of the charge calculation approach as the QM QSPR models. The robustness of the EEM QSPR models was subsequently confirmed by cross-validation. The applicability of EEM QSPR models for other chemical classes was illustrated by a case study focused on

Surface charge sensing by altering the phase transition in VO2

NASA Astrophysics Data System (ADS)

Kumar, S.; Esfandyarpour, R.; Davis, R.; Nishi, Y.

2014-08-01

Detection of surface charges has various applications in medicine, electronics, biotechnology, etc. The source of surface charge induction may range from simple charge-polarized molecules like water to complicated proteins. It was recently discovered that surface charge accumulation can alter the temperature at which VO2 undergoes a Mott transition. Here, we deposited polar molecules onto the surface of two-terminal thin-film VO2 lateral devices and monitored the joule-heating-driven Mott transition, or conductance switching. We observed that the power required to induce the conductance switching reduced upon treatment with polar molecules and, using in-situ blackbody-emission direct measurement of local temperature, we show that this reduction in power was accompanied by reduction in the Mott transition temperature. Further evidence suggested that this effect has specificity to the nature of the species used to induce surface charges. Using x-ray absorption spectroscopy, we also show that there is no detectable change in oxidation state of vanadium or structural phase in the bulk of the 40 nm VO2 thin-film even as the phase transition temperature is reduced by up to 20 K by the polar molecules. The ability to alter the phase transition parameters by depositing polar molecules suggests a potential application in sensing surface charges of different origins and this set of results also highlights interesting aspects of the phase transition in VO2.

Charge density distribution and the electrostatic moments of CTPB in the active site of p300 enzyme: a DFT and charge density study.

PubMed

Devipriya, B; Kumaradhas, P

2013-10-21

A molecular docking and charge density analysis have been carried out to understand the conformational change, charge distribution and electrostatic properties of N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-6-pentadecyl-benzamide (CTPB) in the active site of p300. The nearest neighbors, shortest intermolecular contacts between CTPB-p300 and the lowest binding energy of CTPB have been analyzed from the docking analysis. Further, a charge density analysis has been carried out for the molecule in gas phase and for the corresponding molecule lifted from the active site of p300. Due to the intermolecular interaction between CTPB and the amino acids of active site, the conformation of the CTPB has been significantly altered (particularly the pentadecyl chain). CTPB forms strong interaction with the amino acid residues Tyr1397 and Trp1436 at the distance 2.12 and 2.72Å, respectively. However, the long pentadecyl alkyl chain of CTPB produces a barrier and reducing the chance of forming hydrogen bonding with p300. The electron density ρbcp(r) of the polar bonds (C-O, C-N, C-F and C-Cl) of CTPB are increased when it present in the active site. The dipole moment of CTPB in the active site is significantly less (5.73D) when compared with the gas phase (8.16D) form. In the gas phase structure, a large region of negative electrostatic potential (ESP) is found at the vicinity of O(2) and CF3 group, which is less around the O(1) atom. Whereas, in the active site, the negative ESP around the CF3 group is decreased and increased at the O(1) and O(2)-atoms. The ESP modifications of CTPB in the active site are mainly attributed to the effect of intermolecular interaction. The gas phase and active site study insights the molecular flexibility and the electrostatic properties of CTPB in the active site. © 2013 Elsevier Ltd. All rights reserved.

The surface charge of trypanosomatids.

PubMed

Souto-Padrón, Thaïs

2002-12-01

The surface charge of trypanosomatids was evaluated by means of the binding of cationic particles, as visualized by electron microscopy and by direct measurements of the electrophoretic mobility of cells. The results obtained indicate that most of the trypanosomatids exhibit a negatively charged surface whose value is species specific and varies according to the developmental stages. Sialic acids associated with glycoproteins, glycolipids and phosphate groups are the major components responsible for the net negative surface charge of the trypanosomatids.

Interpreting anomalies observed in oxide semiconductor TFTs under negative and positive bias stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Jong Woo; Nathan, Arokia, E-mail: an299@cam.ac.uk; Barquinha, Pedro

2016-08-15

Oxide semiconductor thin-film transistors can show anomalous behavior under bias stress. Two types of anomalies are discussed in this paper. The first is the shift in threshold voltage (V{sub TH}) in a direction opposite to the applied bias stress, and highly dependent on gate dielectric material. We attribute this to charge trapping/detrapping and charge migration within the gate dielectric. We emphasize the fundamental difference between trapping/detrapping events occurring at the semiconductor/dielectric interface and those occurring at gate/dielectric interface, and show that charge migration is essential to explain the first anomaly. We model charge migration in terms of the non-instantaneous polarizationmore » density. The second type of anomaly is negative V{sub TH} shift under high positive bias stress, with logarithmic evolution in time. This can be argued as electron-donating reactions involving H{sub 2}O molecules or derived species, with a reaction rate exponentially accelerated by positive gate bias and exponentially decreased by the number of reactions already occurred.« less

Contact and Length Dependent Effects in Single-Molecule Electronics

NASA Astrophysics Data System (ADS)

Hines, Thomas

Understanding charge transport in single molecules covalently bonded to electrodes is a fundamental goal in the field of molecular electronics. In the past decade, it has become possible to measure charge transport on the single-molecule level using the STM break junction method. Measurements on the single-molecule level shed light on charge transport phenomena which would otherwise be obfuscated by ensemble measurements of groups of molecules. This thesis will discuss three projects carried out using STM break junction. In the first project, the transition between two different charge transport mechanisms is reported in a set of molecular wires. The shortest wires show highly length dependent and temperature invariant conductance behavior, whereas the longer wires show weakly length dependent and temperature dependent behavior. This trend is consistent with a model whereby conduction occurs by coherent tunneling in the shortest wires and by incoherent hopping in the longer wires. Measurements are supported with calculations and the evolution of the molecular junction during the pulling process is investigated. The second project reports controlling the formation of single-molecule junctions by means of electrochemically reducing two axial-diazonium terminal groups on a molecule, thereby producing direct Au-C covalent bonds in-situ between the molecule and gold electrodes. Step length analysis shows that the molecular junction is significantly more stable, and can be pulled over a longer distance than a comparable junction created with amine anchoring bonds. The stability of the junction is explained by the calculated lower binding energy associated with the direct Au-C bond compared with the Au-N bond. Finally, the third project investigates the role that molecular conformation plays in the conductance of oligothiophene single-molecule junctions. Ethyl substituted oligothiophenes were measured and found to exhibit temperature dependent conductance and transition

Improved levitation and trapping of particles by negative dielectrophoresis by the addition of amphoteric molecules

NASA Astrophysics Data System (ADS)

Flores-Rodriguez, Neftali; Markx, Gerard H.

2004-02-01

Addition of amphoteres could be used to improve the levitation and trapping of particles by negative dielectrophoresis. Addition of amphoteric molecules to electromanipulation media increases not only the permittivity of the medium and its viscosity but also its density. To investigate the effect of addition of amphoteres on levitation and trapping by negative dielectrophoresis, the electrokinetic behaviour of latex beads and viable yeast cells (Saccharomyces cerevisiae) was investigated in concentrated solutions of the amphoteric molecules N-[2-hydroxyethyl] piperazine-N'-[2-ethanesulfonic acid] (HEPES) and egr -aminocaproic acid (EACA) using different frequencies and voltages of the applied electrical signal and microelectrodes of different sizes. When using interdigitated electrodes without castellations, latex beads levitated an average of 43% higher when 0.67 M EACA solutions were used and a 54% higher after adding 0.67 M HEPES compared with the levitation heights when no amphoteres were added. Under the same conditions, yeast levitated 78% and 86% higher, respectively. At low voltages and low HEPES/EACA concentrations, the latex particles accumulated in bands between or above the electrodes. However, at the highest voltages and HEPES/EACA concentrations used, the particles formed a network of pearl chains above the electrode arrays. When using electrodes of the interdigitated castellated type of characteristic size 30 µm, latex particles levitated 32% and 40% higher when 0.67 M EACA and HEPES solutions were used in comparison with when no amphoteres were added. At these concentrations, the flow rate needed to dislodge the latex particles from the traps formed by the electric field pattern between the castellations of the interdigitated castellated electrodes was increased by 46% compared with the flow rate needed to achieve this when no amphoteres were added.

Insight into acid-base nucleation experiments by comparison of the chemical composition of positive, negative, and neutral clusters.

PubMed

Bianchi, Federico; Praplan, Arnaud P; Sarnela, Nina; Dommen, Josef; Kürten, Andreas; Ortega, Ismael K; Schobesberger, Siegfried; Junninen, Heikki; Simon, Mario; Tröstl, Jasmin; Jokinen, Tuija; Sipilä, Mikko; Adamov, Alexey; Amorim, Antonio; Almeida, Joao; Breitenlechner, Martin; Duplissy, Jonathan; Ehrhart, Sebastian; Flagan, Richard C; Franchin, Alessandro; Hakala, Jani; Hansel, Armin; Heinritzi, Martin; Kangasluoma, Juha; Keskinen, Helmi; Kim, Jaeseok; Kirkby, Jasper; Laaksonen, Ari; Lawler, Michael J; Lehtipalo, Katrianne; Leiminger, Markus; Makhmutov, Vladimir; Mathot, Serge; Onnela, Antti; Petäjä, Tuukka; Riccobono, Francesco; Rissanen, Matti P; Rondo, Linda; Tomé, António; Virtanen, Annele; Viisanen, Yrjö; Williamson, Christina; Wimmer, Daniela; Winkler, Paul M; Ye, Penglin; Curtius, Joachim; Kulmala, Markku; Worsnop, Douglas R; Donahue, Neil M; Baltensperger, Urs

2014-12-02

We investigated the nucleation of sulfuric acid together with two bases (ammonia and dimethylamine), at the CLOUD chamber at CERN. The chemical composition of positive, negative, and neutral clusters was studied using three Atmospheric Pressure interface-Time Of Flight (APi-TOF) mass spectrometers: two were operated in positive and negative mode to detect the chamber ions, while the third was equipped with a nitrate ion chemical ionization source allowing detection of neutral clusters. Taking into account the possible fragmentation that can happen during the charging of the ions or within the first stage of the mass spectrometer, the cluster formation proceeded via essentially one-to-one acid-base addition for all of the clusters, independent of the type of the base. For the positive clusters, the charge is carried by one excess protonated base, while for the negative clusters it is carried by a deprotonated acid; the same is true for the neutral clusters after these have been ionized. During the experiments involving sulfuric acid and dimethylamine, it was possible to study the appearance time for all the clusters (positive, negative, and neutral). It appeared that, after the formation of the clusters containing three molecules of sulfuric acid, the clusters grow at a similar speed, independent of their charge. The growth rate is then probably limited by the arrival rate of sulfuric acid or cluster-cluster collision.

Insulator charging limits direct current across tunneling metal-insulator-semiconductor junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilan, Ayelet

Molecular electronics studies how the molecular nature affects the probability of charge carriers to tunnel through the molecules. Nevertheless, transport is also critically affected by the contacts to the molecules, an aspect that is often overlooked. Specifically, the limited ability of non-metallic contacts to maintain the required charge balance across the fairly insulating molecule often have dramatic effects. This paper shows that in the case of lead/organic monolayer-silicon junctions, a charge balance is responsible for an unusual current scaling, with the junction diameter (perimeter), rather than its area. This is attributed to the balance between the 2D charging at themore » metal/insulator interface and the 3D charging of the semiconductor space-charge region. A derivative method is developed to quantify transport across tunneling metal-insulator-semiconductor junctions; this enables separating the tunneling barrier from the space-charge barrier for a given current-voltage curve, without complementary measurements. The paper provides practical tools to analyze specific molecular junctions compatible with existing silicon technology, and demonstrates the importance of contacts' physics in modeling charge transport across molecular junctions.« less

Activation energy of negative fixed charges in thermal ALD Al{sub 2}O{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kühnhold-Pospischil, S.; Institute of Physical Chemistry, Albert-Ludwigs-Universität Freiburg, Albertstr. 21, 79104 Freiburg; Freiburg Materials Research Center FMF, Albert-Ludwigs-Universität Freiburg, Stefan-Meier-Str. 21, 79104 Freiburg

2016-08-08

A study of the thermally activated negative fixed charges Q{sub tot} and the interface trap densities D{sub it} at the interface between Si and thermal atomic-layer-deposited amorphous Al{sub 2}O{sub 3} layers is presented. The thermal activation of Q{sub tot} and D{sub it} was conducted at annealing temperatures between 220 °C and 500 °C for durations between 3 s and 38 h. The temperature-induced differences in Q{sub tot} and D{sub it} were measured using the characterization method called corona oxide characterization of semiconductors. Their time dependency were fitted using stretched exponential functions, yielding activation energies of E{sub A} = (2.2 ± 0.2) eV and E{submore » A} = (2.3 ± 0.7) eV for Q{sub tot} and D{sub it}, respectively. For annealing temperatures from 350 °C to 500 °C, the changes in Q{sub tot} and D{sub it} were similar for both p- and n-type doped Si samples. In contrast, at 220 °C the charging process was enhanced for p-type samples. Based on the observations described in this contribution, a charging model leading to Q{sub tot} based on an electron hopping process between the silicon and Al{sub 2}O{sub 3} through defects is proposed.« less

Vertical Charge Transport and Negative Transconductance in Multilayer Molybdenum Disulfides.

PubMed

Liu, Yuan; Guo, Jian; He, Qiyuan; Wu, Hao; Cheng, Hung-Chieh; Ding, Mengning; Shakir, Imran; Gambin, Vincent; Huang, Yu; Duan, Xiangfeng

2017-09-13

Negative transconductance (NTC) devices have been heavily investigated for their potential in low power logical circuit, memory, oscillating, and high-speed switching applications. Previous NTC devices are largely attributed to two working mechanisms: quantum mechanical tunneling, and mobility degradation at high electrical field. Herein we report a systematic investigation of charge transport in multilayer two-dimensional semiconductors (2DSCs) with optimized van der Waals contact and for the first time demonstrate NTC and antibipolar characteristics in multilayer 2DSCs (such as MoS 2 , WSe 2 ). By varying the measurement temperature, bias voltage, and body thickness, we found the NTC behavior can be attributed to a vertical potential barrier in the multilayer 2DSCs and the competing mechanisms between intralayer lateral transport and interlayer vertical transport, thus representing a new working mechanism for NTC operation. Importantly, this vertical potential barrier arises from inhomogeneous carrier distribution in 2DSC from the near-substrate region to the bulk region, which is in contrast to conventional semiconductors with homogeneous doping defined by bulk dopants. We further show that the unique NTC behavior can be explored for creating frequency doublers and phase shift keying circuits with only one transistor, greatly simplifying the circuit design compared to conventional technology.

Specificity and mechanism of action of alpha-helical membrane-active peptides interacting with model and biological membranes by single-molecule force spectroscopy.

PubMed

Sun, Shiyu; Zhao, Guangxu; Huang, Yibing; Cai, Mingjun; Shan, Yuping; Wang, Hongda; Chen, Yuxin

2016-07-01

In this study, to systematically investigate the targeting specificity of membrane-active peptides on different types of cell membranes, we evaluated the effects of peptides on different large unilamellar vesicles mimicking prokaryotic, normal eukaryotic, and cancer cell membranes by single-molecule force spectroscopy and spectrum technology. We revealed that cationic membrane-active peptides can exclusively target negatively charged prokaryotic and cancer cell model membranes rather than normal eukaryotic cell model membranes. Using Acholeplasma laidlawii, 3T3-L1, and HeLa cells to represent prokaryotic cells, normal eukaryotic cells, and cancer cells in atomic force microscopy experiments, respectively, we further studied that the single-molecule targeting interaction between peptides and biological membranes. Antimicrobial and anticancer activities of peptides exhibited strong correlations with the interaction probability determined by single-molecule force spectroscopy, which illustrates strong correlations of peptide biological activities and peptide hydrophobicity and charge. Peptide specificity significantly depends on the lipid compositions of different cell membranes, which validates the de novo design of peptide therapeutics against bacteria and cancers.

Modeling the Electric Potential and Surface Charge Density Near Charged Thunderclouds

NASA Astrophysics Data System (ADS)

Neel, Matthew Stephen

2018-03-01

Thundercloud charge separation, or the process by which the bottom portion of a cloud gathers charge and the top portion of the cloud gathers the opposite charge, is still not thoroughly understood. Whatever the mechanism, though, a charge separation definitely exists and can lead to electrostatic discharge via cloud-to-cloud lightning and cloud-to-ground lightning. We wish to examine the latter form, in which upward leaders from Earth connect with downward leaders from the cloud to form a plasma channel and produce lightning. Much of the literature indicates that the lower part of a thundercloud becomes negatively charged while the upper part becomes positively charged via convective charging, although the opposite polarity can certainly exist along with various, complex intra-cloud currents. It is estimated that >90% of cloud-to-ground lightning is "negative lightning," or the flow of charges from the bottom of the cloud, while the remaining <10% of lightning strikes is "positive lightning," or the flow of charges from the top of the cloud. We wish to understand the electric potential surrounding charged thunderclouds as well as the resulting charge density on the surface of Earth below them. In this paper we construct a simple and adaptable model that captures the very basic features of the cloud/ground system and that exhibits conditions favorable for both forms of lightning. In this way, we provide a practical application of electrostatic dipole physics as well as the method of images that can serve as a starting point for further modeling and analysis by students.

Inserting Thienyl Linkers into Conjugated Molecules for Efficient Multilevel Electronic Memory: A New Understanding of Charge-Trapping in Organic Materials.

PubMed

Li, Yang; Li, Hua; He, Jinghui; Xu, Qingfeng; Li, Najun; Chen, Dongyun; Lu, Jianmei

2016-03-18

The practical application of organic memory devices requires low power consumption and reliable device quality. Herein, we report that inserting thienyl units into D-π-A molecules can improve these parameters by tuning the texture of the film. Theoretical calculations revealed that introducing thienyl π bridges increased the planarity of the molecular backbone and extended the D-A conjugation. Thus, molecules with more thienyl spacers showed improved stacking and orientation in the film state relative to the substrates. The corresponding sandwiched memory devices showed enhanced ternary memory behavior, with lower threshold voltages and better repeatability. The conductive switching and variation in the performance of the memory devices were interpreted by using an extended-charge-trapping mechanism. Our study suggests that judicious molecular engineering can facilitate control of the orientation of the crystallite in the solid state to achieve superior multilevel memory performance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Atomic charges of sulfur in ionic liquids: experiments and calculations.

PubMed

Fogarty, Richard M; Rowe, Rebecca; Matthews, Richard P; Clough, Matthew T; Ashworth, Claire R; Brandt, Agnieszka; Corbett, Paul J; Palgrave, Robert G; Smith, Emily F; Bourne, Richard A; Chamberlain, Thomas W; Thompson, Paul B J; Hunt, Patricia A; Lovelock, Kevin R J

2017-12-14

Experimental near edge X-ray absorption fine structure (NEXAFS) spectra, X-ray photoelectron (XP) spectra and Auger electron spectra are reported for sulfur in ionic liquids (ILs) with a range of chemical structures. These values provide experimental measures of the atomic charge in each IL and enable the evaluation of the suitability of NEXAFS spectroscopy and XPS for probing the relative atomic charge of sulfur. In addition, we use Auger electron spectroscopy to show that when XPS binding energies differ by less than 0.5 eV, conclusions on atomic charge should be treated with caution. Our experimental data provides a benchmark for calculations of the atomic charge of sulfur obtained using different methods. Atomic charges were computed for lone ions and ion pairs, both in the gas phase (GP) and in a solvation model (SMD), with a wide range of ion pair conformers considered. Three methods were used to compute the atomic charges: charges from the electrostatic potential using a grid based method (ChelpG), natural bond orbital (NBO) population analysis and Bader's atoms in molecules (AIM) approach. By comparing the experimental and calculated measures of the atomic charge of sulfur, we provide an order for the sulfur atoms, ranging from the most negative to the most positive atomic charge. Furthermore, we show that both ChelpG and NBO are reasonable methods for calculating the atomic charge of sulfur in ILs, based on the agreement with both the XPS and NEXAFS spectroscopy results. However, the atomic charges of sulfur derived from ChelpG are found to display significant, non-physical conformational dependence. Only small differences in individual atomic charge of sulfur were observed between lone ion (GP) and ion pair IL(SMD) model systems, indicating that ion-ion interactions do not strongly influence individual atomic charges.

Redox-Active Star Molecules Incorporating the 4-Benzoylpyridinium Cation - Implications for the Charge Transfer Along Branches vs. Across the Perimeter in Dendrimer

NASA Technical Reports Server (NTRS)

Leventis, Nicholas; Yang, Jinua; Fabrizio,Even F.; Rawashdeh, Abdel-Monem M.; Oh, Woon Su; Sotiriou-Leventis, Chariklia

2004-01-01

Dendrimers are self-repeating globular branched star molecules, whose fractal structure continues to fascinate, challenge, and inspire. Functional dendrimers may incorporate redox centers, and potential applications include antennae molecules for light harvesting, sensors, mediators, and artificial biomolecules. We report the synthesis and redox properties of four star systems incorporating the 4-benzoyl-N-alkylpyridinium cation; the redox potential varies along the branches but remains constant at fixed radii. Bulk electrolysis shows that at a semi-infinite time scale all redox centers are electrochemically accessible. However, voltammetric analysis (cyclic voltammetry and differential pulse voltammetry) shows that on1y two of the three redox-active centers in the perimeter are electrochemically accessible during potential sweeps as slow as 20 mV/s and as fast as 10 V/s. On the contrary, both redox centers along branches are accessible electrochemically within the same time frame. These results are explained in terms of slow through-space charge transfer and the globular 3-D folding of the molecules and are discussed in terms of their implications on the design of efficient redox functional dendrimers.

Negatively Charged Hydrogen Production in a Multicusp Microwave Plasma

NASA Astrophysics Data System (ADS)

Trow, John Robert

1985-06-01

High energy neutral beams are necessary for the continued development of magnetically confined fusion plasma devices. Neutral beams based on positive ions are not efficient at beam energies of 100 keV or above, however negative ion based neutral beam systems are efficient, even at high beam energies. Volume production of H('-) has many advantages over the other methods, chiefly: simplicity of design and operation, and no need for alkalai metals. Since volume production requires a low electron temperature ((TURN)1 eV) but also requires molecular intermediates only formed by more energetic electrons (>20 eV), double plasma devices with a separate hot electron region are desirable. Therefore an experiment was undertaken to examine H('-) production by volume processes in a multicusp microwave discharge, part of the cusp field being enhanced to produce an ECR (electron cyclotron resonance), that would also isolate the hotter plasma formed there. This arrangement is analogous to the "magnetic filters" used in some other negative ion sources. This work describes the experiment set up and the results obtained, which are a survey of the behavior of this type of device. Also included is a discussion of the volume processes associated with H('-) production including numerical estimates, based on the experimental measurements, which indicate H('-) production is by dissociative attachment of cold electrons to vibrationally excited hydrogen molecules, and loss is by mutual neutralization with positive ions. The experimental observations are consistent with this model. These are also the same mechanisms used in the models of Bacal and Hiskes. Since magnetic fields generated by samarium cobalt permanent magnets were an important part of this experiment a set of field calculations was undertaken and is included here as a separate chapter. This device is shown to be a viable scheme of H('-) (or D('-)) produc- tion and is worthy of further development. There are several more

First-Principles Study of Charge Diffusion between Proximate Solid-State Qubits and Its Implications on Sensor Applications

NASA Astrophysics Data System (ADS)

Chou, Jyh-Pin; Bodrog, Zoltán; Gali, Adam

2018-03-01

Solid-state qubits from paramagnetic point defects in solids are promising platforms to realize quantum networks and novel nanoscale sensors. Recent advances in materials engineering make it possible to create proximate qubits in solids that might interact with each other, leading to electron spin or charge fluctuation. Here we develop a method to calculate the tunneling-mediated charge diffusion between point defects from first principles and apply it to nitrogen-vacancy (NV) qubits in diamond. The calculated tunneling rates are in quantitative agreement with previous experimental data. Our results suggest that proximate neutral and negatively charged NV defect pairs can form a NV-NV molecule. A tunneling-mediated model for the source of decoherence of the near-surface NV qubits is developed based on our findings on the interacting qubits in diamond.

Quantifying reactivity for electrophilic aromatic substitution reactions with Hirshfeld charge.

PubMed

Liu, Shubin

2015-03-26

An electrophilic aromatic substitution is a process where one atom or group on an aromatic ring is replaced by an incoming electrophile. The reactivity and regioselectivity of this category of reactions is significantly impacted by the group that is already attached to the aromatic ring. Groups promoting substitution at the ortho/para and meta position are called ortho/para and meta directing groups, respectively. Earlier, we have shown that regioselectivity of the electrophilic aromatic substitution is dictated by the nucleophilicity of the substituted aromatic ring, which is proportional to the Hirshfeld charge on the regioselective site. Ortho/para directing groups have the largest negative charge values at the ortho/para positions, whereas meta directing groups often have the largest negative charge value at the meta position. The electron donation or acceptance feature of a substitution group is irrelevant to the regioselectivity. In this contribution, we extend our previous study by quantifying the reactivity for this kind of reactions. To that end, we examine the transition-state structure and activation energy of an identity reaction for a series of monosubstituted-benzene molecules reacting with hydrogen fluoride using BF3 as the catalyst in the gas phase. A total of 18 substitution groups will be considered, nine of which are ortho/para directing and the other nine groups meta directing. From this study, we found that the barrier height of these reactions strongly correlates with the Hirshfeld charge on the regioselective site for both ortho/para and meta directing groups, with the correlation coefficient R(2) both better than 0.96. We also discovered a less accurate correlation between the barrier height and HOMO energy. These results reconfirm the validity and effectiveness of employing the Hirshfeld charge as a reliable descriptor of both reactivity and regioselectivity for this vastly important category of chemical transformations.

Charge exchange in cometary coma: Discovery of H− ions in the solar wind close to comet 67P/Churyumov‐Gerasimenko

PubMed Central

Cravens, T. E.; Llera, K.; Goldstein, R.; Mokashi, P.; Tzou, C.‐Y.; Broiles, T.

2015-01-01

Abstract As Rosetta was orbiting comet 67P/Churyumov‐Gerasimenko, the Ion and Electron Sensor detected negative particles with angular distributions like those of the concurrently measured solar wind protons but with fluxes of only about 10% of the proton fluxes and energies of about 90% of the proton energies. Using well‐known cross sections and energy‐loss data, it is determined that the fluxes and energies of the negative particles are consistent with the production of H− ions in the solar wind by double charge exchange with molecules in the coma. PMID:27656008

Charge exchange in cometary coma: Discovery of H- ions in the solar wind close to comet 67P/Churyumov-Gerasimenko.

PubMed

Burch, J L; Cravens, T E; Llera, K; Goldstein, R; Mokashi, P; Tzou, C-Y; Broiles, T

2015-07-16

As Rosetta was orbiting comet 67P/Churyumov-Gerasimenko, the Ion and Electron Sensor detected negative particles with angular distributions like those of the concurrently measured solar wind protons but with fluxes of only about 10% of the proton fluxes and energies of about 90% of the proton energies. Using well-known cross sections and energy-loss data, it is determined that the fluxes and energies of the negative particles are consistent with the production of H - ions in the solar wind by double charge exchange with molecules in the coma.

Theoretical evidence of charge transfer interaction between SO₂ and deep eutectic solvents formed by choline chloride and glycerol.

PubMed

Li, Hongping; Chang, Yonghui; Zhu, Wenshuai; Wang, Changwei; Wang, Chao; Yin, Sheng; Zhang, Ming; Li, Huaming

2015-11-21

The nature of the interaction between deep eutectic solvents (DESs), formed by ChCl and glycerol, and SO2 has been systematically investigated using the M06-2X density functional combined with cluster models. Block-localized wave function energy decomposition (BLW-ED) analysis shows that the interaction between SO2 and DESs is dominated by a charge transfer interaction. After this interaction, the SO2 molecule becomes negatively charged, whereas the ChCl-glycerol molecule is positively charged, which is the result of Lewis acid-base interaction. The current result affords a theoretical proof that it is highly useful and efficient to manipulate the Lewis acidity of absorbents for SO2 capture. Moreover, hydrogen bonding as well as electrostatic interactions may also contribute to the stability of the complex. Structure analysis shows that solvent molecules will adjust their geometries to interact with SO2. In addition, the structure of SO2 is barely changed after interaction. The interaction energy between different cluster models and SO2 ranges from -6.8 to -14.4 kcal mol(-1). It is found that the interaction energy is very sensitive to the solvent structure. The moderate interaction between ChCl-glycerol and SO2 is consistent with the concept that highly efficient solvents for SO2 absorption should not only be solvable but also regenerable.

Charge exchange molecular ion source

DOEpatents

Vella, Michael C.

2003-06-03

Ions, particularly molecular ions with multiple dopant nucleons per ion, are produced by charge exchange. An ion source contains a minimum of two regions separated by a physical barrier and utilizes charge exchange to enhance production of a desired ion species. The essential elements are a plasma chamber for production of ions of a first species, a physical separator, and a charge transfer chamber where ions of the first species from the plasma chamber undergo charge exchange or transfer with the reactant atom or molecules to produce ions of a second species. Molecular ions may be produced which are useful for ion implantation.

Triphenylamine-Based Push–Pull Molecule for Photovoltaic Applications: From Synthesis to Ultrafast Device Photophysics

PubMed Central

2017-01-01

Small push–pull molecules attract much attention as prospective donor materials for organic solar cells (OSCs). By chemical engineering, it is possible to combine a number of attractive properties such as broad absorption, efficient charge separation, and vacuum and solution processabilities in a single molecule. Here we report the synthesis and early time photophysics of such a molecule, TPA-2T-DCV-Me, based on the triphenylamine (TPA) donor core and dicyanovinyl (DCV) acceptor end group connected by a thiophene bridge. Using time-resolved photoinduced absorption and photoluminescence, we demonstrate that in blends with [70]PCBM the molecule works both as an electron donor and hole acceptor, thereby allowing for two independent channels of charge generation. The charge-generation process is followed by the recombination of interfacial charge transfer states that takes place on the subnanosecond time scale as revealed by time-resolved photoluminescence and nongeminate recombination as follows from the OSC performance. Our findings demonstrate the potential of TPA-DCV-based molecules as donor materials for both solution-processed and vacuum-deposited OSCs. PMID:28413568

WITHDRAWN: Fragmentation of charged aqueous nanodroplets

NASA Astrophysics Data System (ADS)

Ichiki, Kengo

2005-11-01

The whole evaporating process of charged aqueous nanodroplets is studied by systematic molecular dynamics simulations until most of the solvent molecules are evaporated. % The solvent evaporation makes the droplet smaller and smaller, and at a certain point the repulsive force among ions causes an instability, where typically single ion and 10 to 20 water molecules are disintegrated from the main droplet. % This ion fragmentation occurs around 70 to 80% of the charge predicted by the Rayleigh theory [Lord Rayleigh, Phil. Mag. 14, 184 (1882)]. % The numerical results are summarized in the function R(z) which is the fragmentation radius at the charge z. From the fitting by the power law Rz^β, we find that at lower temperature T=350 and 370 K the result is close to the Rayleigh theory β= 2/3, while at higher temperature T=400 and 450 K it is like β= 1/2. % Another fitting on R(z) by the extended ion evaporation mechanism [M. Gamero-Castaño and J. Fern'andez de la Mora, Anal. Chim. Acta 406, 67 (2000)] works well for both cases. % The final state of the evaporation process is typically a single ion with several water molecules. If we put an alanine dipeptide in zwitterionic form at the beginning, two charges remain in some cases.

Negatively charged silver nanoparticles with potent antibacterial activity and reduced toxicity for pharmaceutical preparations.

PubMed

Salvioni, Lucia; Galbiati, Elisabetta; Collico, Veronica; Alessio, Giulia; Avvakumova, Svetlana; Corsi, Fabio; Tortora, Paolo; Prosperi, Davide; Colombo, Miriam

2017-01-01

The discovery of new solutions with antibacterial activity as efficient and safe alternatives to common preservatives (such as parabens) and to combat emerging infections and drug-resistant bacterial pathogens is highly expected in cosmetics and pharmaceutics. Colloidal silver nanoparticles (NPs) are attracting interest as novel effective antimicrobial agents for the prevention of several infectious diseases. Water-soluble, negatively charged silver nanoparticles (AgNPs) were synthesized by reduction with citric and tannic acid and characterized by transmission electron microscopy, dynamic light scattering, zeta potential, differential centrifuge sedimentation, and ultraviolet-visible spectroscopy. AgNPs were tested with model Gram-negative and Gram-positive bacteria in comparison to two different kinds of commercially available AgNPs. In this work, AgNPs with higher antibacterial activity compared to the commercially available colloidal silver solutions were prepared and investigated. Bacteria were plated and the antibacterial activity was tested at the same concentration of silver ions in all samples. The AgNPs did not show any significant reduction in the antibacterial activity for an acceptable time period. In addition, AgNPs were transferred to organic phase and retained their antibacterial efficacy in both aqueous and nonaqueous media and exhibited no toxicity in eukaryotic cells. We developed AgNPs with a 20 nm diameter and negative zeta potential with powerful antibacterial activity and low toxicity compared to currently available colloidal silver, suitable for cosmetic preservatives and pharmaceutical preparations administrable to humans and/or animals as needed.

Negatively charged silver nanoparticles with potent antibacterial activity and reduced toxicity for pharmaceutical preparations

PubMed Central

Salvioni, Lucia; Galbiati, Elisabetta; Collico, Veronica; Alessio, Giulia; Avvakumova, Svetlana; Corsi, Fabio; Tortora, Paolo; Prosperi, Davide; Colombo, Miriam

2017-01-01

Background The discovery of new solutions with antibacterial activity as efficient and safe alternatives to common preservatives (such as parabens) and to combat emerging infections and drug-resistant bacterial pathogens is highly expected in cosmetics and pharmaceutics. Colloidal silver nanoparticles (NPs) are attracting interest as novel effective antimicrobial agents for the prevention of several infectious diseases. Methods Water-soluble, negatively charged silver nanoparticles (AgNPs) were synthesized by reduction with citric and tannic acid and characterized by transmission electron microscopy, dynamic light scattering, zeta potential, differential centrifuge sedimentation, and ultraviolet–visible spectroscopy. AgNPs were tested with model Gram-negative and Gram-positive bacteria in comparison to two different kinds of commercially available AgNPs. Results In this work, AgNPs with higher antibacterial activity compared to the commercially available colloidal silver solutions were prepared and investigated. Bacteria were plated and the antibacterial activity was tested at the same concentration of silver ions in all samples. The AgNPs did not show any significant reduction in the antibacterial activity for an acceptable time period. In addition, AgNPs were transferred to organic phase and retained their antibacterial efficacy in both aqueous and nonaqueous media and exhibited no toxicity in eukaryotic cells. Conclusion We developed AgNPs with a 20 nm diameter and negative zeta potential with powerful antibacterial activity and low toxicity compared to currently available colloidal silver, suitable for cosmetic preservatives and pharmaceutical preparations administrable to humans and/or animals as needed. PMID:28408822

Electronic structure of negative charge transfer CaFeO3 across the metal-insulator transition

NASA Astrophysics Data System (ADS)

Rogge, Paul C.; Chandrasena, Ravini U.; Cammarata, Antonio; Green, Robert J.; Shafer, Padraic; Lefler, Benjamin M.; Huon, Amanda; Arab, Arian; Arenholz, Elke; Lee, Ho Nyung; Lee, Tien-Lin; Nemšák, Slavomír; Rondinelli, James M.; Gray, Alexander X.; May, Steven J.

2018-01-01

We investigated the metal-insulator transition for epitaxial thin films of the perovskite CaFeO3, a material with a significant oxygen ligand hole contribution to its electronic structure. We find that biaxial tensile and compressive strain suppress the metal-insulator transition temperature. By combining hard x-ray photoelectron spectroscopy, soft x-ray absorption spectroscopy, and density functional calculations, we resolve the element-specific changes to the electronic structure across the metal-insulator transition. We demonstrate that the Fe sites undergo no observable spectroscopic change between the metallic and insulating states, whereas the O electronic configuration undergoes significant changes. This strongly supports the bond-disproportionation model of the metal-insulator transition for CaFeO3 and highlights the importance of ligand holes in its electronic structure. By sensitively measuring the ligand hole density, however, we find that it increases by ˜5 -10 % in the insulating state, which we ascribe to a further localization of electron charge on the Fe sites. These results provide detailed insight into the metal-insulator transition of negative charge transfer compounds and should prove instructive for understanding metal-insulator transitions in other late transition metal compounds such as the nickelates.

Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

PubMed Central

Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

2010-01-01

We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than

The influence of size and charge of chitosan/polyglutamic acid hollow spheres on cellular internalization, viability and blood compatibility.

PubMed

Dash, Biraja C; Réthoré, Gildas; Monaghan, Michael; Fitzgerald, Kathleen; Gallagher, William; Pandit, Abhay

2010-11-01

Polymeric hollow spheres can be tailored as efficient carriers of various therapeutic molecules due to their tunable properties. However, the entry of these synthetic vehicles into cells, their cell viability and blood compatibility depend on their physical and chemical properties e.g. size, surface charge. Herein, we report the effect of size and surface charge on cell viability and cellular internalization behaviour and their effect on various blood components using chitosan/polyglutamic acid hollow spheres as a model system. Negatively charged chitosan/polyglutamic acid hollow spheres of various sizes 100, 300, 500 and 1000 nm were fabricated using a template based method and covalently surface modified using linear polyethylene glycol and methoxyethanol amine to create a gradient of surface charge from negative to neutrally charged spheres respectively. The results here suggest that both size and surface charge have a significant influence on the sphere's behaviour, most prominently on haemolysis, platelet activation, plasma recalcification time, cell viability and internalization over time. Additionally, cellular internalization behaviour and viability was found to vary with different cell types. These results are in agreement with those of inorganic spheres and liposomes, and can serve as guidelines for tailoring polymeric solid spheres for specific desired applications in biological and pharmaceutical fields, including the design of nanometer to submicron-sized delivery vehicles. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Particle transport through hydrogels is charge asymmetric.

PubMed

Zhang, Xiaolu; Hansing, Johann; Netz, Roland R; DeRouchey, Jason E

2015-02-03

Transport processes within biological polymer networks, including mucus and the extracellular matrix, play an important role in the human body, where they serve as a filter for the exchange of molecules and nanoparticles. Such polymer networks are complex and heterogeneous hydrogel environments that regulate diffusive processes through finely tuned particle-network interactions. In this work, we present experimental and theoretical studies to examine the role of electrostatics on the basic mechanisms governing the diffusion of charged probe molecules inside model polymer networks. Translational diffusion coefficients are determined by fluorescence correlation spectroscopy measurements for probe molecules in uncharged as well as cationic and anionic polymer solutions. We show that particle transport in the charged hydrogels is highly asymmetric, with diffusion slowed down much more by electrostatic attraction than by repulsion, and that the filtering capability of the gel is sensitive to the solution ionic strength. Brownian dynamics simulations of a simple model are used to examine key parameters, including interaction strength and interaction range within the model networks. Simulations, which are in quantitative agreement with our experiments, reveal the charge asymmetry to be due to the sticking of particles at the vertices of the oppositely charged polymer networks. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The effect of polymer size and charge of molecules on permeation through synovial membrane and accumulation in hyaline articular cartilage.

PubMed

Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M

2016-04-01

The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.

Plantaricin A, a cationic peptide produced by Lactobacillus plantarum, permeabilizes eukaryotic cell membranes by a mechanism dependent on negative surface charge linked to glycosylated membrane proteins.

PubMed

Sand, Sverre L; Nissen-Meyer, Jon; Sand, Olav; Haug, Trude M

2013-02-01

Lactobacillus plantarum C11 releases plantaricin A (PlnA), a cationic peptide pheromone that has a membrane-permeabilizing, antimicrobial effect. We have previously shown that PlnA may also permeabilize eukaryotic cells, with a potency that differs between cell types. It is generally assumed that cationic antimicrobial peptides exert their effects through electrostatic attraction to negatively charged phospholipids in the membrane. The aim of the present study was to investigate if removal of the negative charge linked to glycosylated proteins at the cell surface reduces the permeabilizing potency of PlnA. The effects of PlnA were tested on clonal rat anterior pituitary cells (GH(4) cells) using patch clamp and microfluorometric techniques. In physiological extracellular solution, GH(4) cells are highly sensitive to PlnA, but the sensitivity was dramatically reduced in solutions that partly neutralize the negative surface charge of the cells, in agreement with the notion that electrostatic interactions are probably important for the PlnA effects. Trypsination of cells prior to PlnA exposure also rendered the cells less sensitive to the peptide, suggesting that negative charges linked to membrane proteins are involved in the permeabilizing action. Finally, pre-exposure of cells to a mixture of enzymes that split carbohydrate residues from the backbone of glycosylated proteins also impeded the PlnA-induced membrane permeabilization. We conclude that electrostatic attraction between PlnA and glycosylated membrane proteins is probably an essential first step before PlnA can interact with membrane phospholipids. Deviating glycosylation patterns may contribute to the variation in PlnA sensitivity of different cell types, including cancerous cells and their normal counterparts. Copyright © 2012 Elsevier B.V. All rights reserved.

A small-molecule activator induces ULK1-modulating autophagy-associated cell death in triple negative breast cancer.

PubMed

Ouyang, Liang; Zhang, Lan; Fu, Leilei; Liu, Bo

2017-04-03

ULK1 (unc-51 like autophagy activating kinase 1) is well known to be required to initiate the macroautophagy/autophagy process, and thus activation of ULK1-modulating autophagy/autophagy-associated cell death (ACD) may be a possible therapeutic strategy in triple negative breast cancer (TNBC). Here, our integrated The Cancer Genome Atlas (TCGA) data set, tissue microarray-based analyses and multiple biologic evaluations together demonstrate a new small-molecule activator of ULK1 for better understanding of how ULK1, the mammalian homolog of yeast Atg1, as a potential drug target can regulate ACD by the ULK complex (ULK1-ATG13-RB1CC1/FIP200-ATG101), as well as other possible ULK1 interactors, including ATF3, RAD21 and CASP3/caspase3 in TNBC. Moreover, such new inspiring findings may help us discover that this activator of ULK1 (LYN-1604) with its anti-tumor activity and ACD-modulating mechanisms can be further exploited as a small-molecule candidate drug for future TNBC therapy.

Preparation and chromatographic evaluation of zwitterionic stationary phases with controllable ratio of positively and negatively charged groups.

PubMed

Cheng, Xiao-Dong; Hao, Yan-Hong; Peng, Xi-Tian; Yuan, Bi-Feng; Shi, Zhi-Guo; Feng, Yu-Qi

2015-08-15

The present study described the preparation and application of zwitterionic stationary phases (ACS) with controllable ratio of positively charged tertiary amine groups and negatively charged carboxyl groups. Various parameters, including water content, pH values and ionic strength of the mobile phase, were investigated to study the chromatographic characteristics of ACS columns. The prepared ACS columns demonstrated a mix-mode retention mechanism composed of surface adsorption, partitioning and electrostatic interactions. The elemental analysis of different batches of the ACS phases demonstrated good reproducibility of the preparation strategy. Additionally, various categories of compounds, including nucleosides, water-soluble vitamins, benzoic acid derivatives and basic compounds were successively employed to evaluate the separation selectivity of the prepared ACS stationary phases. These ACS phases exhibited entirely different selectivity and retention behavior from each other for various polar analytes, demonstrating the excellent application potential in the analysis of polar compounds in HILIC. Copyright © 2015 Elsevier B.V. All rights reserved.

Ground-state oxygen holes and the metal–insulator transition in the negative charge-transfer rare-earth nickelates

PubMed Central

Bisogni, Valentina; Catalano, Sara; Green, Robert J.; Gibert, Marta; Scherwitzl, Raoul; Huang, Yaobo; Strocov, Vladimir N.; Zubko, Pavlo; Balandeh, Shadi; Triscone, Jean-Marc; Sawatzky, George; Schmitt, Thorsten

2016-01-01

The metal–insulator transition and the intriguing physical properties of rare-earth perovskite nickelates have attracted considerable attention in recent years. Nonetheless, a complete understanding of these materials remains elusive. Here we combine X-ray absorption and resonant inelastic X-ray scattering (RIXS) spectroscopies to resolve important aspects of the complex electronic structure of rare-earth nickelates, taking NdNiO3 thin film as representative example. The unusual coexistence of bound and continuum excitations observed in the RIXS spectra provides strong evidence for abundant oxygen holes in the ground state of these materials. Using cluster calculations and Anderson impurity model interpretation, we show that distinct spectral signatures arise from a Ni 3d8 configuration along with holes in the oxygen 2p valence band, confirming suggestions that these materials do not obey a conventional positive charge-transfer picture, but instead exhibit a negative charge-transfer energy in line with recent models interpreting the metal–insulator transition in terms of bond disproportionation. PMID:27725665

Charge renormalization and inversion of a highly charged lipid bilayer: effects of dielectric discontinuities and charge correlations.

PubMed

Taheri-Araghi, Sattar; Ha, Bae-Yeun

2005-08-01

We reexamine the problem of charge renormalization and inversion of a highly charged surface of a low dielectric constant immersed in ionic solutions. To be specific, we consider an asymmetrically charged lipid bilayer, in which only one layer is negatively charged. In particular, we study how dielectric discontinuities and charge correlations (among lipid charges and condensed counterions) influence the effective charge of the surface. When counterions are monovalent (e.g., Na+), our mean-field approach implies that dielectric discontinuities can enhance counterion condensation. A simple scaling picture shows how the effects of dielectric discontinuities and surface-charge distributions are intertwined: Dielectric discontinuities diminish condensation if the backbone charge is uniformly smeared out while counterions are localized in space; they can, however, enhance condensation when the backbone charge is discrete. In the presence of asymmetric salts such as CaCl2 , we find that the correlation effect, treated at the Gaussian level, is more pronounced when the surface has a lower dielectric constant, inverting the sign of the charge at a smaller value of Ca2+ concentration.

An Analysis of Two Thunderstorms Producing Five Negative Sprites on 12 September 2014

NASA Astrophysics Data System (ADS)

Boggs, L.; Liu, N.; Splitt, M. E.; Lazarus, S. M.; Cummer, S. A.; Rassoul, H.

2015-12-01

We present a detailed analysis of the thunderstorms and the parent lightning discharge morphologies of five confirmed negative sprites taking place in two different thunderstorms. These two thunderstorms took place in east-central and south Florida on 12 September 2014. We utilized several lightning location networks, remote magnetic field measurements, dual polarization radar, and balloon borne soundings in our analysis. Each parent discharge was immediately preceded by intra-cloud (IC) discharges between the mid-level negative and upper positive charge regions. This either allowed a second upward negative leader to escape the upper positive charge region, or encouraged a downward negative leader to be initiated and connect with ground. The discharges found in this study support the findings of Lu et al., 2012 [JGR,117, D04212, 2012] that negative sprite-parent lightning consists primarily of hybrid intra-cloud negative cloud-to-ground (IC-NCG) and bolt-from-the-blue (BFB) lightning. Our work finds these unique discharges form in thunderstorms that have an excess of mid-level negative charge and weakened upper positive charge. Due to this charge structure, these unusual discharges transfer more charge to the ground than typical negative cloud-to-ground discharges. Our study suggests that the key difference separating bolt-from-the-blue and gigantic jet discharges is an asymmetric charge structure. This acts to bring the negative leader exiting the thundercloud closer to the lateral positive screening layer, encouraging the negative leader to turn towards ground. This investigation reveals IC discharges that involve multiple convective cells and come to ground as a negative CG discharge, a breed of hybrid IC-NCG discharges, also transfer more negative charge to ground than typical negative CG discharges and are able to initiate negative sprites. From this work, the charge structures mentioned above resulted from tall, intense convective cells with low CG flash

Thermally induced charge current through long molecules

NASA Astrophysics Data System (ADS)

Zimbovskaya, Natalya A.; Nitzan, Abraham

2018-01-01

In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

Energy of charged states in the acetanilide crystal: Trapping of charge-transfer states at vacancies as a possible mechanism for optical damage

NASA Astrophysics Data System (ADS)

Tsiaousis, D.; Munn, R. W.

2004-04-01

Calculations for the acetanilide crystal yield the effective polarizability (16.6 Å3), local electric field tensor, effective dipole moment (5.41 D), and dipole-dipole energy (-12.8 kJ/mol). Fourier-transform techniques are used to calculate the polarization energy P for a single charge in the perfect crystal (-1.16 eV); the charge-dipole energy WD is zero if the crystal carries no bulk dipole moment. Polarization energies for charge-transfer (CT) pairs combine with the Coulomb energy EC to give the screened Coulomb energy Escr; screening is nearly isotropic, with Escr≈EC/2.7. For CT pairs WD reduces to a term δWD arising from the interaction of the charge on each ion with the change in dipole moment on the other ion relative to the neutral molecule. The dipole moments calculated by density-functional theory methods with the B3LYP functional at the 6-311++G** level are 3.62 D for the neutral molecule, changing to 7.13 D and 4.38 D for the anion and cation, relative to the center of mass. Because of the large change in the anion, δWD reaches -0.9 eV and modifies the sequence of CT energies markedly from that of Escr, giving the lowest two CT pairs at -1.98 eV and -1.41 eV. The changes in P and WD near a vacancy are calculated; WD changes for the individual charges because the vacancy removes a dipole moment and modifies the crystal dielectric response, but δWD and EC do not change. A vacancy yields a positive change ΔP that scatters a charge or CT pair, but the change ΔWD can be negative and large enough to outweigh ΔP, yielding traps with depths that can exceed 150 meV for single charges and for CT pairs. Divacancies yield traps with depths nearly equal to the sum of those produced by the separate vacancies and so they can exceed 300 meV. These results are consistent with a mechanism of optical damage in which vacancies trap optically generated CT pairs that recombine and release energy; this can disrupt the lattice around the vacancy, thereby favoring

Detecting negative ions on board small satellites

NASA Astrophysics Data System (ADS)

Lepri, S. T.; Raines, J. M.; Gilbert, J. A.; Cutler, J.; Panning, M.; Zurbuchen, T. H.

2017-04-01

Recent measurements near comets, planets, and their satellites have shown that heavy ions, energetic neutral atoms, molecular ions, and charged dust contain a wealth of information about the origin, evolution, and interaction of celestial bodies with their space environment. Using highly sensitive plasma instruments, positively charged heavy ions have been used to trace exospheric and surface composition of comets, planets, and satellites as well as the composition of interplanetary and interstellar dust. While positive ions dominate throughout the heliosphere, negative ions are also produced from surface interactions. In fact, laboratory experiments have shown that oxygen released from rocky surfaces is mostly negatively charged. Negative ions and negatively charged nanograins have been detected with plasma electron analyzers in several different environments (e.g., by Cassini and Rosetta), though more extensive studies have been challenging without instrumentation dedicated to negative ions. We discuss an adaptation of the Fast Imaging Plasma Spectrometer (FIPS) flown on MErcury Surface, Space ENvironment, GEochemistry and Ranging (MESSENGER) for the measurement of negatively charged particles. MESSENGER/FIPS successfully measured the plasma environment of Mercury from 2011 until 2015, when the mission ended, and has been used to map multiple ion species (H+ through Na+ and beyond) throughout Mercury's space environment. Modifications to the existing instrument design fits within a 3U CubeSat volume and would provide a low mass, low power instrument, ideal for future CubeSat or distributed sensor missions seeking, for the first time, to characterize the contribution of negative particles in the heliospheric plasmas near the planets, moons, comets, and other sources.

Spontaneous Charge Separation and Sublimation Processes are Ubiquitous in Nature and in Ionization Processes in Mass Spectrometry

NASA Astrophysics Data System (ADS)

Trimpin, Sarah; Lu, I.-Chung; Rauschenbach, Stephan; Hoang, Khoa; Wang, Beixi; Chubatyi, Nicholas D.; Zhang, Wen-Jing; Inutan, Ellen D.; Pophristic, Milan; Sidorenko, Alexander; McEwen, Charles N.

2018-02-01

Ionization processes have been discovered by which small and large as well as volatile and nonvolatile compounds are converted to gas-phase ions when associated with a matrix and exposed to sub-atmospheric pressure. Here, we discuss experiments further defining these simple and unexpected processes. Charge separation is found to be a common process for small molecule chemicals, solids and liquids, passed through an inlet tube from a higher to a lower pressure region, with and without heat applied. This charge separation process produces positively- and negatively-charged particles with widely different efficiencies depending on the compound and its physical state. Circumstantial evidence is presented suggesting that in the new ionization process, charged particles carry analyte into the gas phase, and desolvation of these particles produce the bare ions similar to electrospray ionization, except that solid particles appear likely to be involved. This mechanistic proposition is in agreement with previous theoretical work related to ion emission from ice.

Deciphering the "chemical" nature of the exotic isotopes of hydrogen by the MC-QTAIM analysis: the positively charged muon and the muonic helium as new members of the periodic table.

PubMed

Goli, Mohammad; Shahbazian, Shant

2014-04-14

This report is a primarily survey on the chemical nature of some exotic species containing the positively charged muon and the muonic helium, i.e., the negatively charged muon plus helium nucleus, as exotic isotopes of hydrogen, using the newly developed multi-component quantum theory of atoms in molecules (MC-QTAIM) analysis, employing ab initio non-Born-Oppenhiemer wavefunctions. Accordingly, the "atoms in molecules" analysis performed on various asymmetric exotic isotopomers of the hydrogen molecule, recently detected experimentally [Science, 2011, 331, 448], demonstrates that both the exotic isotopes are capable of forming atoms in molecules and retaining the identity of hydrogen atoms. Various derived properties of atomic basins containing the muonic helium cast no doubt that apart from its short life time, it is a heavier isotope of hydrogen while the properties of basins containing the positively charged muon are more remote from those of the orthodox hydrogen basins, capable of appreciable donation of electrons as well as large charge polarization. However, with some tolerance, they may also be categorized as hydrogen basins though with a smaller electronegativity. All in all, the present study also clearly demonstrates that the MC-QTAIM analysis is an efficient approach to decipher the chemical nature of species containing exotic constituents, which are difficult to elucidate by experimental and/or alternative theoretical schemes.

The role of charge in the surfactant-assisted stabilization of the natural product curcumin.

PubMed

Wang, Zifan; Leung, Mandy H M; Kee, Tak W; English, Douglas S

2010-04-20

Colloidal solutions of surfactants that form micelles or vesicles are useful for solubilizing and stabilizing hydrophobic molecules that are otherwise sparingly soluble in aqueous solutions. In this paper we investigate the use of micelles and vesicles prepared from ionic surfactants for solubilizing and stabilizing curcumin, a medicinal natural product that undergoes alkaline hydrolysis in water. We identify spectroscopic signatures to evaluate curcumin partitioning and deprotonation in surfactant mixtures containing micelles or vesicles. These spectroscopic signatures allow us to monitor the interaction of curcumin with charged surfactants over a wide range of pH values. Titration data are presented to show the pH dependence of curcumin interactions with negatively and positively charged micelles and vesicles. In solutions of cationic micelles or positively charged vesicles, strong interaction between the Cur(-1) phenoxide ion and the positively charged surfactants results in a change in the acidity of the phenolic hydrogen and a lowering of the apparent lowest pK(a) value for curcumin. In the microenvironments formed by anionic micelles or negatively charged bilayers, our data indicates that curcumin partitions as the Cur(0) species, which is stabilized by interactions with the respective surfactant aggregates, and this leads to an increase in the apparent pK(a) values. Our results may explain some of the discrepancies within the literature with respect to reported pK(a) values and the acidity of the enolic versus phenolic protons. Hydrolysis rates, quantum yields, and molar absorption coefficients are reported for curcumin in a variety of solutions.

Intermetallic negative electrodes for non-aqueous lithium cells and batteries

DOEpatents

Thackeray, Michael M.; Vaughey, John T.; Johnson, Christopher S.; Fransson, Linda M.; Edstrom, Ester Kristina; Henriksen, Gary

2004-05-04

A method of operating an electrochemical cell is disclosed. The cell has an intermetallic negative electrode of Cu.sub.6-x M.sub.x Sn.sub.5, wherein x is .ltoreq.3 and M is one or more metals including Si and a positive electrode containing Li in which Li is shuttled between the positive electrode and the negative electrode during charge and discharge to form a lithiated intermetallic negative electrode during charge. The voltage of the electrochemical cell is controlled during the charge portion of the charge-discharge cycles so that the potential of the lithiated intermetallic negative electrode in the fully charged electrochemical cell is less than 0.2 V but greater than 0 V versus metallic lithium.

Understanding charge transport in molecular electronics.

PubMed

Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R

2003-12-01

For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.

Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.

PubMed

Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing

2017-04-01

The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.

Ground-State Charge-Density Distribution in a Crystal of the Luminescent ortho-Phenylenediboronic Acid Complex with 8-Hydroxyquinoline.

PubMed

Jarzembska, Katarzyna N; Kamiński, Radosław; Durka, Krzysztof; Woźniak, Krzysztof

2018-05-10

This contribution is devoted to the first electron density studies of a luminescent oxyquinolinato boron complex in the solid state. ortho-Phenylenediboronic acid mixed with 8-hydroxyquinoline in dioxane forms high-quality single crystals via slow solvent evaporation, which allows successful high resolution data collection (sin θ/λ = 1.2 Å -1 ) and charge density distribution modeling. Particular attention has been paid to the boron-oxygen fragment connecting the two parts of the complex, and to the solvent species exhibiting anharmonic thermal motion. The experiment and theory compared rather well in terms of atomic charges and volumes, except for the boron centers. Boron atoms, as expected, constitute the most electron-deficient species in the complex molecule, whereas the neighboring oxygen and carbon atoms are the most significantly negatively charged ones. This part of the molecule appears to be very much involved in the charge transfer occurring between the acid fragment and oxyquinoline moiety leading to the observed fluorescence, as supported by the time-dependent density functional theory (TDDFT) results and the generated transition density maps. TDDFT calculations indicated that p-type atomic orbitals contributing to the HOMO-1, HOMO, and LUMO play the major role in the lowest energy transitions, and enabled further comparison with the charge density features, which is discussed in details. Furthermore, the results confirmed the known fact the Q ligand character is most important for the spectroscopic properties of this class of complexes.

Theoretical study of the BeLi, BeNa, MgLi, MgNa, and AlBe molecules and their negative ions

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Langhoff, Stephen R.; Partridge, Harry

1992-01-01

The alkaline earth-alkali diatomics are found to have weak bonds, because the diffuse alkali valence s orbitals cannot form a bond of sufficient strength to pay the promotion energy of the alkaline-earth atoms. This leads to van der Waals bonding in the neutrals as well as the negative ions. In fact, the negative ions have larger binding energies than the neutrals as a result of the much larger polarizability of the negative ion. The binding energy of AlBe is significantly larger than the Be-alkali molecules, due to a covalent contribution to the bonding. The binding energy in AlBe(-) is considerably larger than AlBe; the binding energy of the X 3Sigma(-) state of AlBe(-) is computed to be 1.36 eV, as compared with 0.57 eV for the X 2Pi state of AlBe.

Calculating Henry’s Constants of Charged Molecules Using SPARC

EPA Science Inventory

SPARC Performs Automated Reasoning in Chemistry is a computer program designed to model physical and chemical properties of molecules solely based on thier chemical structure. SPARC uses a toolbox of mechanistic perturbation models to model intermolecular interactions. SPARC has ...

Toward Understanding the Outer Membrane Uptake of Small Molecules by Pseudomonas aeruginosa*

PubMed Central

Eren, Elif; Parkin, Jamie; Adelanwa, Ayodele; Cheneke, Belete; Movileanu, Liviu; Khalid, Syma; van den Berg, Bert

2013-01-01

Because small molecules enter Gram-negative bacteria via outer membrane (OM) channels, understanding OM transport is essential for the rational design of improved and new antibiotics. In the human pathogen Pseudomonas aeruginosa, most small molecules are taken up by outer membrane carboxylate channel (Occ) proteins, which can be divided into two distinct subfamilies, OccD and OccK. Here we characterize substrate transport mediated by Occ proteins belonging to both subfamilies. Based on the determination of the OccK2-glucuronate co-crystal structure, we identify the channel residues that are essential for substrate transport. We further show that the pore regions of the channels are rigid in the OccK subfamily and highly dynamic in the OccD subfamily. We also demonstrate that the substrate carboxylate group interacts with central residues of the basic ladder, a row of arginine and lysine residues that leads to and away from the binding site at the channel constriction. Moreover, the importance of the basic ladder residues corresponds to their degree of conservation. Finally, we apply the generated insights by converting the archetype of the entire family, OccD1, from a basic amino acid-specific channel into a channel with a preference for negatively charged amino acids. PMID:23467408

Recovery of tritium from tritiated molecules

DOEpatents

Swansiger, W.A.

1984-10-17

This invention relates to the recovery of tritium from various tritiated molecules by reaction with uranium. More particularly, the invention relates to the recovery of tritium from tritiated molecules by reaction with uranium wherein the reaction is conducted in a reactor which permits the reaction to occur as a moving front reaction from the point where the tritium enters the reactor charged with uranium down the reactor until the uranium is exhausted.

Interplay between efficiency and device architecture for small molecule organic solar cells.

PubMed

Williams, Graeme; Sutty, Sibi; Aziz, Hany

2014-06-21

Small molecule organic solar cells (OSCs) have experienced a resurgence of interest over their polymer solar cell counterparts, owing to their improved batch-to-batch (thus, cell-to-cell) reliability. In this systematic study on OSC device architecture, we investigate five different small molecule OSC structures, including the simple planar heterojunction (PHJ) and bulk heterojunction (BHJ), as well as several planar-mixed structures. The different OSC structures are studied over a wide range of donor:acceptor mixing concentrations to gain a comprehensive understanding of their charge transport behavior. Transient photocurrent decay measurements provide crucial information regarding the interplay between charge sweep-out and charge recombination, and ultimately hint toward space charge effects in planar-mixed structures. Results show that the BHJ/acceptor architecture, comprising a BHJ layer with high C60 acceptor content, generates OSCs with the highest performance by balancing charge generation with charge collection. The performance of other device architectures is largely limited by hole transport, with associated hole accumulation and space charge effects.

ESI-MS of Cucurbituril Complexes Under Negative Polarity.

PubMed

Rodrigues, Maria A A; Mendes, Débora C; Ramamurthy, Vaidhyanathan; Da Silva, José P

2017-11-01

Electrospray ionization mass spectrometry (ESI-MS) is a powerful tool to study host-guest supramolecular interactions. ESI-MS can be used for detailed gas-phase reactivity studies, to clarify the structure, or simply to verify the formation of complexes. Depending on the structure of the host and of the guest, negative and/or positive ESI are used. Here we report the unexpected formation of host-guest complexes between cucurbit[n]urils (n = 7, 8, CB[n]) and amine, styryl pyridine, and styryl pyridine dimer cations, under negative ESI. Non-complexed CB[n] form double charged halide (Br - , Cl - , F - ) adducts. Under negative ESI, halide ions interact with CB[n] outer surface hydrogen atoms. One to one host-guest complexes (1:1) of CB[n] with positive charged guests were also observed as single and double charged ions under negative ESI. The positive charge of guests is neutralized by ion-pairing with halide anions. Depending on the number of positive charges guests retain in the gas phase, one or two additional halide ions are required for neutralization. Complexes 1:2 of CB[8] with styryl pyridines retain two halide ions in the gas phase, one per guest. Styryl pyridine dimers form 1:1 complexes possessing a single extra halide ion and therefore a single positive charge. Negative ESI is sensitive to small structural differences between complexes, distinguishing between 1:2 complexes of styryl pyridine-CB[8] and corresponding 1:1 complexes with the dimer. Negative ESI gives simpler spectra than positive ESI and allows the determination of guest charge state of CB[n] complexes in the gas phase. Graphical Abstract ᅟ.

Electrical control of optical orientation of neutral and negatively charged excitons in an n -type semiconductor quantum well

NASA Astrophysics Data System (ADS)

Dzhioev, R. I.; Korenev, V. L.; Lazarev, M. V.; Sapega, V. F.; Gammon, D.; Bracker, A. S.

2007-01-01

We report electric field induced increase of spin orientation of negatively charged excitons (trions) localized in n -type GaAs/AlGaAs quantum well. Under resonant excitation of free neutral heavy-hole excitons, the polarization of trions increases dramatically with electrical injection of electrons. The polarization enhancement correlates strongly with trion/exciton luminescence intensity ratio. This effect results from a very efficient trapping of free neutral excitons by the quantum well interfacial fluctuations (“natural” quantum dots) containing resident electrons.

Control of the dipole layer of polar organic molecules adsorbed on metal surfaces via different charge-transfer channels

NASA Astrophysics Data System (ADS)

Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Su, Kai-Jun; Wang, Chin-Yung; Pi, Tun-Wen; Metz, Sebastian; Papadopoulos, Theodoros A.; Chiang, T.-C.; Ishii, Hisao; Tang, S.-J.

2017-02-01

Organic molecules with a permanent electric dipole moment have been widely used as a template for further growth of molecular layers in device structures. Key properties of the resulting organic films such as energy level alignment (ELA), work function, and injection/collection barrier are linked to the magnitude and direction of the dipole moment at the interface. Using angle-resolved photoemission spectroscopy (ARPES), we have systematically investigated the coverage-dependent work function and spectral line shapes of occupied molecular energy states (MESs) of chloroaluminium-phthalocyanine (ClAlPc) grown on Ag(111). We demonstrate that the dipole orientation of the first ClAlPc layer can be controlled by adjusting the deposition rate and postannealing conditions, and we find that the ELA at the interface differs by ˜0.4 eV between the Cl up and down configurations of the adsorbed ClAlPc molecules. These observations are rationalized by density functional theory (DFT) calculations based on a realistic model of the ClAlPc/Ag(111) interface, which reveal that the different orientations of the ClAlPc dipole layer lead to different charge-transfer channels between the adsorbed ClAlPc and Ag(111) substrate. Our findings provide a useful framework toward method development for ELA tuning.

Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

NASA Astrophysics Data System (ADS)

Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

2018-05-01

An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

Influence of thermocleavable functionality on organic field-effect transistor performance of small molecules

NASA Astrophysics Data System (ADS)

Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay

2017-06-01

Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.

Receptor-Mediated Melanoma Targeting with Radiolabeled α-Melanocyte-Stimulating Hormone: Relevance of the Net Charge of the Ligand.

PubMed

Bapst, Jean-Philippe; Eberle, Alex N

2017-01-01

A majority of melanotic and amelanotic melanomas overexpress melanocortin type 1 receptors (MC1Rs) for α-melanocyte-stimulating hormone. Radiolabeled linear or cyclic analogs of α-MSH have a great potential as diagnostic or therapeutic tools for the management of malignant melanoma. Compounds such as [ 111 In]DOTA-NAP-amide exhibit high affinity for the MC1R in vitro , good tumor uptake in vivo , but they may suffer from relatively high kidney uptake and retention in vivo . We have shown previously that the introduction of negative charges into radiolabeled DOTA-NAP-amide peptide analogs may enhance their excretion and reduce kidney retention. To address the question of where to place negative charges within the ligand, we have extended these studies by designing two novel peptides, Ac-Nle-Asp-His-d-Phe-Arg-Trp-Gly-Lys(DOTA)-d-Asp-d-Asp-OH (DOTA-NAP-d-Asp-d-Asp) with three negative charges at the C -terminal end (overall net charge of the molecule -2) and DOTA-Gly-Tyr(P)-Nle-Asp-His-d-Phe-Arg-Trp-NH 2 (DOTA-Phospho-MSH 2-9 ) with two negative charges in the N -terminal region (net charge -1). The former peptide showed markedly reduced receptor affinity and biological activity by >10-fold compared to DOTA-NAP-amide as reference compound, and the latter peptide displayed similar bioactivity and receptor affinity as the reference compound. The uptake by melanoma tumor tissue of [ 111 In]DOTA-Phospho-MSH 2-9 was 7.33 ± 0.47 %ID/g 4 h after injection, i.e., almost equally high as with [ 111 In]DOTA-NAP-amide. The kidney retention was 2.68 ± 0.18 %ID/g 4 h after injection and hence 44% lower than that of [ 111 In]DOTA-NAP-amide. Over an observation period from 4 to 48 h, the tumor-to-kidney ratio of [ 111 In]DOTA-Phospho-MSH 2-9 was 35% more favorable than that of the reference compound. In a comparison of DOTA-NAP-d-Asp-d-Asp, DOTA-Phospho-MSH 2-9 and DOTA-NAP-amide with five previously published analogs of DOTA-NAP-amide that altogether cover a

Receptor-Mediated Melanoma Targeting with Radiolabeled α-Melanocyte-Stimulating Hormone: Relevance of the Net Charge of the Ligand

PubMed Central

Bapst, Jean-Philippe; Eberle, Alex N.

2017-01-01

A majority of melanotic and amelanotic melanomas overexpress melanocortin type 1 receptors (MC1Rs) for α-melanocyte-stimulating hormone. Radiolabeled linear or cyclic analogs of α-MSH have a great potential as diagnostic or therapeutic tools for the management of malignant melanoma. Compounds such as [111In]DOTA-NAP-amide exhibit high affinity for the MC1R in vitro, good tumor uptake in vivo, but they may suffer from relatively high kidney uptake and retention in vivo. We have shown previously that the introduction of negative charges into radiolabeled DOTA-NAP-amide peptide analogs may enhance their excretion and reduce kidney retention. To address the question of where to place negative charges within the ligand, we have extended these studies by designing two novel peptides, Ac-Nle-Asp-His-d-Phe-Arg-Trp-Gly-Lys(DOTA)-d-Asp-d-Asp-OH (DOTA-NAP-d-Asp-d-Asp) with three negative charges at the C-terminal end (overall net charge of the molecule −2) and DOTA-Gly-Tyr(P)-Nle-Asp-His-d-Phe-Arg-Trp-NH2 (DOTA-Phospho-MSH2-9) with two negative charges in the N-terminal region (net charge −1). The former peptide showed markedly reduced receptor affinity and biological activity by >10-fold compared to DOTA-NAP-amide as reference compound, and the latter peptide displayed similar bioactivity and receptor affinity as the reference compound. The uptake by melanoma tumor tissue of [111In]DOTA-Phospho-MSH2-9 was 7.33 ± 0.47 %ID/g 4 h after injection, i.e., almost equally high as with [111In]DOTA-NAP-amide. The kidney retention was 2.68 ± 0.18 %ID/g 4 h after injection and hence 44% lower than that of [111In]DOTA-NAP-amide. Over an observation period from 4 to 48 h, the tumor-to-kidney ratio of [111In]DOTA-Phospho-MSH2-9 was 35% more favorable than that of the reference compound. In a comparison of DOTA-NAP-d-Asp-d-Asp, DOTA-Phospho-MSH2-9 and DOTA-NAP-amide with five previously published analogs of DOTA-NAP-amide that altogether cover a range of peptides

Exploring the effect of hole localization on the charge-phonon dynamics of hole doped delafossite

NASA Astrophysics Data System (ADS)

Mazumder, Nilesh; Mandal, Prasanta; Roy, Rajarshi; Ghorai, Uttam Kumar; Saha, Subhajit; Chattopadhyay, Kalyan Kumar

2017-09-01

For weak or moderate doping, electrical measurement is not suitable for detecting changes in the charge localization inside a semiconductor. Here, to investigate the nature of charge-phonon coupling in the presence of gradually delocalized holes within a weak doping regime (~1016 cm-3), we examine the temperature dependent Raman spectra (303-817 K) of prototype hole doped delafossite CuC{{r}1-x}M{{g}x}{{O}2-y}{{S}y} (x  =  0/0.03, y  =  0/0.01). For both {{E}g} and {{A}1g} phonons, negative lineshape asymmetry and relative thermal hardening are distinctly observed upon SO× and (MgCr\\bullet+SO×) doping. Using Allen formalism, charge density of states at the Fermi level per spin and molecule, and charge delocalization associated to a - b plane, are estimated to increase appreciably upon codoping compared to the c -axis. We delineate the interdependence between charge-phonon coupling constant (λ ) and anharmonic phonon lifetime ({τanh} ), and deduce that excitation of delocalized holes weakly coupled with phonons of larger {τanh} is the governing feature of observed Fano asymmetry (q ) reversal.

On charging of snow particles in blizzard

NASA Technical Reports Server (NTRS)

Shio, Hisashi

1991-01-01

The causes of the charge polarity on the blizzard, which consisted of fractured snow crystals and ice particles, were investigated. As a result, the charging phenomena showed that the characteristics of the blizzard are as follows: (1) In the case of the blizzard with snowfall, the fractured snow particles drifting near the surface of snow field (lower area: height 0.3 m) had positive charge, while those drifting at higher area (height 2 m) from the surface of snow field had negative charge. However, during the series of blizzards two kinds of particles positively and negatively charged were collected in equal amounts in a Faraday Cage. It may be considered that snow crystals with electrically neutral properties were separated into two kinds of snow flakes (charged positively and negatively) by destruction of the snow crystals. (2) In the case of the blizzard which consisted of irregularly formed ice drops (generated by peeling off the hardened snow field), the charge polarity of these ice drops salting over the snow field was particularly controlled by the crystallographic characteristics of the surface of the snow field hardened by the powerful wind pressure.

Fetuin mediates hepatic uptake of negatively charged nanoparticles via scavenger receptor.

PubMed

Nagayama, Susumu; Ogawara, Ken-ichi; Minato, Keiko; Fukuoka, Yoshiko; Takakura, Yoshinobu; Hashida, Mitsuru; Higaki, Kazutaka; Kimura, Toshikiro

2007-02-01

We tried to evaluate the possible involvement of fetuin in the scavenger receptors (SRs)-mediated hepatic uptake of polystyrene nanospheres with the size of 50 nm (NS-50), which has surface negative charge (zeta potential=-21.8+/-2.3 mV). The liver perfusion studies in rats revealed that the hepatic uptake of NS-50 pre-coated with fetuin (NS-50-fetuin) was significantly inhibited by poly inosinic acid (poly I), a typical inhibitor of SRs, whereas that of plain NS-50 or NS-50 pre-coated with BSA (NS-50-BSA) was not. The uptake of NS-50-fetuin by cultured Kupffer cells was also significantly inhibited by poly I, and anti-class A scavenger receptors (SR-A) antibody, suggesting that fetuin on NS-50 mediated the recognition and internalization of NS-50 by Kupffer cells and at least SR-A would be responsible for the uptake. Taken that Western blot analysis confirmed that fetuin certainly adsorbed on the surface of NS-50 after the incubation of NS-50 with serum, the results obtained in the present study indicate that fetuin would be one of the serum proteins that were substantially involved in the hepatic uptake of NS-50 via SRs.

Single-molecule dynamics in nanofabricated traps

NASA Astrophysics Data System (ADS)

Cohen, Adam

2009-03-01

The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

Visualizing Chemical Bonds in Synthetic Molecules

NASA Astrophysics Data System (ADS)

Collins, Laura C.; Ruth, Anthony; Green, David B.; Janko, Boldizsar; Gomes, Kenjiro K.

The use of synthetic quantum systems makes it possible to study phenomena that cannot be probed by conventional experiments. We created synthetic molecules using atomic manipulation and directly imaged the chemical bonds using tunneling spectroscopy. These synthetic systems allow us to probe the structure and electronic properties of chemical bonds in molecules, including those that would be unstable in nature, with unprecedented detail. The experimental images of electronic states in our synthetic molecules show a remarkable match to the charge distribution predicted by density functional theory calculations. The statistical analysis of the spectroscopy of these molecules can be adapted in the future to quantify aromaticity, which has been difficult to quantify universally thus far due to vague definitions. We can also study anti-aromatic molecules which are unstable naturally, to illuminate the electronic consequences of antiaromaticity.

Electrostatic Charging and Particle Interactions in Microscopic Insulating Grains

NASA Astrophysics Data System (ADS)

Lee, Victor

In this thesis, we experimentally investigate the electrostatic charging as well as the particle interactions in microscopic insulating grains. First, by tracking individual grains accelerated in an electric field, we quantitatively demonstrate that tribocharging of same-material grains depends on particle size. Large grains tend to charge positively, and small ones tend to charge negatively. Theories based on the transfer of trapped electrons can explain this tendency but have not been validated. Here we show that the number of trapped electrons, measured independently by a thermoluminescence technique, is orders of magnitude too small to be responsible for the amount of charge transferred. This result reveals that trapped electrons are not responsible for same-material tribocharging of dielectric particles. Second, same-material tribocharging in grains can result in important long-range electrostatic interactions. However, how these electrostatic interactions contribute to particle clustering remains elusive, primarily due to the lack of direct, detailed observations. Using a high-speed camera that falls with a stream charged grains, we observe for the first time how charged grains can undergo attractive as well as repulsive Kepler-like orbits. Charged particles can be captured in their mutual electrostatic potential and form clusters via multiple bounces. Dielectric polarization effects are directly observed, which lead to additional attractive forces and stabilize "molecule-like" arrangements of charged particles. Third, we have developed a new method to study the charge transfer of microscopic particles based on acoustic levitation techniques. This method allows us to narrow the complex problem of many-particle charging down to precise charge measurements of a single sub-millimeter particle colliding with a target plate. By simply attaching nonpolar groups onto glass surfaces, we show that the contact charging of a particle is highly dependent on

Apparatus and method of determining molecular weight of large molecules

DOEpatents

Fuerstenau, S.; Benner, W.H.; Madden, N.M.; Searles, W.

1998-06-23

A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e{sup {minus}} are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation. 14 figs.

Apparatus and method of determining molecular weight of large molecules

DOEpatents

Fuerstenau, Stephen; Benner, W. Henry; Madden, Norman; Searles, William

1998-01-01

A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e.sup.- are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation.

Simple and advanced ferromagnet/molecule spinterfaces

NASA Astrophysics Data System (ADS)

Gruber, M.; Ibrahim, F.; Djedhloul, F.; Barraud, C.; Garreau, G.; Boukari, S.; Isshiki, H.; Joly, L.; Urbain, E.; Peter, M.; Studniarek, M.; Da Costa, V.; Jabbar, H.; Bulou, H.; Davesne, V.; Halisdemir, U.; Chen, J.; Xenioti, D.; Arabski, J.; Bouzehouane, K.; Deranlot, C.; Fusil, S.; Otero, E.; Choueikani, F.; Chen, K.; Ohresser, P.; Bertran, F.; Le Fèvre, P.; Taleb-Ibrahimi, A.; Wulfhekel, W.; Hajjar-Garreau, S.; Wetzel, P.; Seneor, P.; Mattana, R.; Petroff, F.; Scheurer, F.; Weber, W.; Alouani, M.; Beaurepaire, E.; Bowen, M.

2016-10-01

Spin-polarized charge transfer between a ferromagnet and a molecule can promote molecular ferromagnetism 1, 2 and hybridized interfacial states3, 4. Observations of high spin-polarization of Fermi level states at room temperature5 designate such interfaces as a very promising candidate toward achieving a highly spin-polarized, nanoscale current source at room temperature, when compared to other solutions such as half-metallic systems and solid-state tunnelling over the past decades. We will discuss three aspects of this research. 1) Does the ferromagnet/molecule interface, also called an organic spinterface, exhibit this high spin-polarization as a generic feature? Spin-polarized photoemission experiments reveal that a high spin-polarization of electronics states at the Fermi level also exist at the simple interface between ferromagnetic cobalt and amorphous carbon6. Furthermore, this effect is general to an array of ferromagnetic and molecular candidates7. 2) Integrating molecules with intrinsic properties (e.g. spin crossover molecules) into a spinterface toward enhanced functionality requires lowering the charge transfer onto the molecule8 while magnetizing it1,2. We propose to achieve this by utilizing interlayer exchange coupling within a more advanced organic spinterface architecture. We present results at room temperature across the fcc Co(001)/Cu/manganese phthalocyanine (MnPc) system9. 3) Finally, we discuss how the Co/MnPc spinterface's ferromagnetism stabilizes antiferromagnetic ordering at room temperature onto subsequent molecules away from the spinterface, which in turn can exchange bias the Co layer at low temperature10. Consequences include tunnelling anisotropic magnetoresistance across a CoPc tunnel barrier11. This augurs new possibilities to transmit spin information across organic semiconductors using spin flip excitations12.

Broad bandwidth vibration energy harvester based on thermally stable wavy fluorinated ethylene propylene electret films with negative charges

NASA Astrophysics Data System (ADS)

Zhang, Xiaoqing; Sessler, Gerhard M.; Ma, Xingchen; Xue, Yuan; Wu, Liming

2018-06-01

Wavy fluorinated ethylene propylene (FEP) electret films with negative charges were prepared by a patterning method followed by a corona charging process. The thermal stability of these films was characterized by the surface potential decay with annealing time at elevated temperatures. The results show that thermally stable electret films can be made by corona charging followed by pre-aging treatment. Vibration energy harvesters having a very simple sandwich structure, consisting of a central wavy FEP electret film and two outside metal plates, were designed and their performance, including the resonance frequency, output power, half power bandwidth, and device stability, was investigated. These harvesters show a broad bandwidth as well as high output power. Their performance can be further improved by using a wavy-shaped counter electrode. For an energy harvester with an area of 4 cm2 and a seismic mass of 80 g, the output power referred to 1 g (g is the gravity of the earth), the resonance frequency, and the 3 dB bandwidth are 1.85 mW, 90 Hz, and 24 Hz, respectively. The output power is sufficient to power some electronic devices. Such devices may be embedded in shoe soles, carpets or seat cushions where the flexibility is required and large force is available.

Nonlinearity, resonance, charging, and motion at the atomic scale studied with scanning tunneling microscopes

NASA Astrophysics Data System (ADS)

Tu, Xiuwen

2008-10-01

Several novel phenomena at the single-atom and single-molecule level occurring on the surfaces of single crystals were studied with home-built low temperature scanning tunneling microscopes. The results revealed intriguing properties of single atoms and single molecules, including nonlinearity, resonance, charging, and motion. First, negative differential resistance (NDR) was observed in the dI/dV spectra for single copper-phthalocyanine (CuPc) molecules adsorbed on one- and two-layer sodium bromide (NaBr), but not for single CuPc molecules adsorbed on three-layer NaBr, all grown on a NiAl(110) surface. This transition from NDR to the absence of NDR was explained as the result of competing effects in the double-barrier tunnel junction (DBTJ) and was reproduced in a calculation based on a resonant-tunneling model. Second, the nonlinearity of the STM junction due to a single manganese (Mn) atom or MnCO molecule adsorbed on a NiAl(110) surface was used to rectify microwave irradiation. The resulting rectification current was shown to be sensitive to the spin-splitting of the electronic states of the Mn atom and to the vibrations of the MnCO molecule. Next, the ordering of cesium (Cs) atoms adsorbed on a Au(111) surface and a NiAl(110) surface was imaged in real space. Because of charge transfer to the substrates, Cs adatoms were positively charged on both surfaces. Even at 12 K, Cs adatoms were able to move and adjust according to coverage. On Au(111), the Cs first layer had a quasi-hexagonal lattice and islands of the second Cs layer did not appear until the first was completed. On NiAl(110), a locally disordered Cs first layer was observed before a locally ordered layer appeared at higher coverages. The cation-pi interactions were then studied at the single molecular level. We were able to form cation-pi complexes such as Cs···DSB, Cs···DSB···Cs, Rb···DSB, and Rb···ZnEtiol controllably by manipulation with the STM tip. We could also separate these

Novel Polymyxin Derivatives Carrying Only Three Positive Charges Are Effective Antibacterial Agents ▿

PubMed Central

Vaara, Martti; Fox, John; Loidl, Günther; Siikanen, Osmo; Apajalahti, Juha; Hansen, Frank; Frimodt-Møller, Niels; Nagai, Junya; Takano, Mikihisa; Vaara, Timo

2008-01-01

The lack of novel antibiotics against gram-negative bacteria has reinstated polymyxins as the drugs of last resort to treat serious infections caused by extremely multiresistant gram-negative organisms. However, polymyxins are nephrotoxic, and this feature may complicate therapy or even require its discontinuation. Like that of aminoglycosides, the nephrotoxicity of polymyxins might be related to the highly cationic nature of the molecule. Colistin and polymyxin B carry five positive charges. Here we show that novel polymyxin derivatives carrying only three positive charges are effective antibacterial agents. NAB739 has a cyclic peptide portion identical to that of polymyxin B, but in the linear portion of the peptide, it carries the threonyl-d-serinyl residue (no cationic charges) instead of the diaminobutyryl-threonyl-diaminobutyryl residue (two cationic charges). The MICs of NAB739 for 17 strains of Escherichia coli were identical, or very close, to those of polymyxin B. Furthermore, NAB739 was effective against other polymyxin-susceptible strains of Enterobacteriaceae and against Acinetobacter baumannii. At subinhibitory concentrations, it dramatically sensitized A. baumannii to low concentrations of antibiotics such as rifampin, clarithromycin, vancomycin, fusidic acid, and meropenem. NAB739 methanesulfonate was a prodrug analogous to colistin methanesulfonate. NAB740 was the most active derivative against Pseudomonas aeruginosa. NAB7061 (linear portion of the peptide, threonyl-aminobutyryl) lacked direct antibacterial activity but sensitized the targets to hydrophobic antibiotics by factors up to 2,000. The affinities of the NAB compounds for isolated rat kidney brush border membrane were significantly lower than that of polymyxin B. PMID:18591267

Accuracy of free energies of hydration using CM1 and CM3 atomic charges.

PubMed

Udier-Blagović, Marina; Morales De Tirado, Patricia; Pearlman, Shoshannah A; Jorgensen, William L

2004-08-01

Absolute free energies of hydration (DeltaGhyd) have been computed for 25 diverse organic molecules using partial atomic charges derived from AM1 and PM3 wave functions via the CM1 and CM3 procedures of Cramer, Truhlar, and coworkers. Comparisons are made with results using charges fit to the electrostatic potential surface (EPS) from ab initio 6-31G* wave functions and from the OPLS-AA force field. OPLS Lennard-Jones parameters for the organic molecules were used together with the TIP4P water model in Monte Carlo simulations with free energy perturbation theory. Absolute free energies of hydration were computed for OPLS united-atom and all-atom methane by annihilating the solutes in water and in the gas phase, and absolute DeltaGhyd values for all other molecules were computed via transformation to one of these references. Optimal charge scaling factors were determined by minimizing the unsigned average error between experimental and calculated hydration free energies. The PM3-based charge models do not lead to lower average errors than obtained with the EPS charges for the subset of 13 molecules in the original study. However, improvement is obtained by scaling the CM1A partial charges by 1.14 and the CM3A charges by 1.15, which leads to average errors of 1.0 and 1.1 kcal/mol for the full set of 25 molecules. The scaled CM1A charges also yield the best results for the hydration of amides including the E/Z free-energy difference for N-methylacetamide in water. Copyright 2004 Wiley Periodicals, Inc.

Ground-state oxygen holes and the metal–insulator transition in the negative charge-transfer rare-earth nickelates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bisogni, Valentina; Catalano, Sara; Green, Robert J.

The metal-insulator transitions and the intriguing physical properties of rare-earth perovskite nickelates have attracted considerable attention in recent years. However, a complete understanding of these materials remains elusive. Here, taking a NdNiO 3 thin film as a representative example, we utilize a combination of x-ray absorption (XAS) and resonant inelastic x-ray scattering (RIXS) spectroscopies to resolve important aspects of the complex electronic structure of the rare-earth nickelates. The unusual coexistence of bound and continuum excitations observed in the RIXS spectra provides strong evidence for the abundance of oxygen 2p holes in the ground state of these materials. Using cluster calculationsmore » and Anderson impurity model interpretation, we show that these distinct spectral signatures arise from a Ni 3d 8 configuration along with holes in the oxygen 2p valence band, confirming suggestions that these materials do not obey a “conventional” positive charge-transfer picture, but instead exhibit a negative charge-transfer energy, in line with recent models interpreting the metal to insulator transition in terms of bond disproportionation.« less

Ground-state oxygen holes and the metal–insulator transition in the negative charge-transfer rare-earth nickelates

DOE PAGES

Bisogni, Valentina; Catalano, Sara; Green, Robert J.; ...

2016-10-11

The metal-insulator transitions and the intriguing physical properties of rare-earth perovskite nickelates have attracted considerable attention in recent years. However, a complete understanding of these materials remains elusive. Here, taking a NdNiO 3 thin film as a representative example, we utilize a combination of x-ray absorption (XAS) and resonant inelastic x-ray scattering (RIXS) spectroscopies to resolve important aspects of the complex electronic structure of the rare-earth nickelates. The unusual coexistence of bound and continuum excitations observed in the RIXS spectra provides strong evidence for the abundance of oxygen 2p holes in the ground state of these materials. Using cluster calculationsmore » and Anderson impurity model interpretation, we show that these distinct spectral signatures arise from a Ni 3d 8 configuration along with holes in the oxygen 2p valence band, confirming suggestions that these materials do not obey a “conventional” positive charge-transfer picture, but instead exhibit a negative charge-transfer energy, in line with recent models interpreting the metal to insulator transition in terms of bond disproportionation.« less

Nanowires formed by the co-assembly of a negatively charged low-molecular weight gelator and a zwitterionic polythiophene.

PubMed

Li, Feng; Palaniswamy, Ganesan; de Jong, Menno R; Aslund, Andreas; Konradsson, Peter; Marcelis, Antonius T M; Sudhölter, Ernst J R; Stuart, Martien A Cohen; Leermakers, Frans A M

2010-06-21

Conjugated organic nanowires have been prepared by co-assembling a carboxylate containing low-molecular weight gelator (LMWG) and an amino acid substituted polythiophene derivative (PTT). Upon introducing the zwitterionic polyelectrolyte PTT to a basic molecular solution of the organogelator, the negative charges on the LMWG are compensated by the positive charges of the PTT. As a result, nanowires form through co-assembly. These nanowires are visualized by both transmission electron microscopy (TEM) and atomic force microscopy (AFM). Depending on the concentration and ratio of the components these nanowires can be micrometers long. These measurements further suggest that the aggregates adopt a helical conformation. The morphology of these nanowires are studied with fluorescent confocal laser scanning microscopy (CLSM). The interactions between LMWG and PTT are characterized by steady-state and time-resolved fluorescence spectroscopy studies. The steady-state spectra indicate that the backbone of the PTT adopts a more planar and more aggregated conformation when interacting with LMWG. The time- resolved fluorescence decay studies confirm this interpretation.

A study of the small-molecule system used to investigate the effect of arginine on antibody elution in hydrophobic charge-induction chromatography.

PubMed

Hirano, Atsushi; Maruyama, Takuya; Shiraki, Kentaro; Arakawa, Tsutomu; Kameda, Tomoshi

2017-01-01

Hydrophobic charge-induction chromatography (HCIC) using 4-mercaptoethylpyridine (4-MEP) as the ligand is used to purify antibodies. The 4-MEP resin ligand has high affinity for antibodies, which makes it difficult to optimize the elution conditions. Recent studies showed that arginine is effective at eluting and purifying antibodies using the HCIC with 4-MEP. In the present study, we investigated the mechanism of the action of arginine on the interaction between butyl gallate (BG) and the 4-MEP resin as a model system for protein-4-MEP interactions. Equilibrium adsorption experiments showed that arginine has a significant effect on the desorption of BG from the 4-MEP resin and, in fact, is found to exhibit a greater effectiveness than guanidine and urea, which are known denaturants. The calculated binding free energy between a BG molecule and a 4-MEP resin ligand molecule using molecular dynamics simulations was qualitatively consistent with the experimental results. A principal component analysis of the simulations showed that arginine molecules intervene in the interaction between the BG and 4-MEP molecules at a distance of 8.5 Å by entering the space between the phenol and pyridine planes. The present results suggest that arginine has a unique mechanism of interaction with the phenol-pyridine system, which should be associated with the effects of arginine on the protein-4-MEP systems. Copyright © 2016 Elsevier Inc. All rights reserved.

Formation and fragmentation of quadruply charged molecular ions by intense femtosecond laser pulses.

PubMed

Yatsuhashi, Tomoyuki; Nakashima, Nobuaki

2010-07-22

We investigated the formation and fragmentation of multiply charged molecular ions of several aromatic molecules by intense nonresonant femtosecond laser pulses of 1.4 mum with a 130 fs pulse duration (up to 2 x 10(14) W cm(-2)). Quadruply charged states were produced for 2,3-benzofluorene and triphenylene molecular ion in large abundance, whereas naphthalene and 1,1'-binaphthyl resulted only in up to triply charged molecular ions. The laser wavelength was nonresonant with regard to the electronic transitions of the neutral molecules, and the degree of fragmentation was strongly correlated with the absorption of the singly charged cation radical. Little fragmentation was observed for naphthalene (off-resonant with cation), whereas heavy fragmentation was observed in the case of 1,1'-binaphthyl (resonant with cation). The degree of H(2) (2H) and 2H(2) (4H) elimination from molecular ions increased as the charge states increased in all the molecules examined. A striking difference was found between triply and quadruply charged 2,3-benzofluorene: significant suppression of molecular ions with loss of odd number of hydrogen was observed in the quadruply charged ions. The Coulomb explosion of protons in the quadruply charged state and succeeding fragmentation resulted in the formation of triply charged molecular ions with an odd number of hydrogens. The hydrogen elimination mechanism in the highly charged state is discussed.

Layered Double Hydroxide Nanotransporter for Molecule Delivery to Intact Plant Cells

PubMed Central

Bao, Wenlong; Wang, Junya; Wang, Qiang; O’Hare, Dermot; Wan, Yinglang

2016-01-01

Here we report a powerful method that facilitates the transport of biologically active materials across the cell wall barrier in plant cells. Positively charged delaminated layered double hydroxide lactate nanosheets (LDH-lactate-NS) with a 0.5‒2 nm thickness and 30‒60 nm diameter exhibit a high adsorptive capacity for negatively charged biomolecules, including fluorescent dyes such as tetramethyl rhodamine isothiocyanate (TRITC), fluorescein isothiocyanate isomer I(FITC) and DNA molecules, forming neutral LDH-nanosheet conjugates. These neutral conjugates can shuttle the bound fluorescent dye into the cytosol of intact plant cell very efficiently. Furthermore, typical inhibitors of endocytosis and low temperature incubation did not prevent LDH-lactate-NS internalization, suggesting that LDH-lactate-NS penetrated the plasma membrane via non-endocytic pathways, which will widen the applicability to a variety of plant cells. Moreover, the absence of unwanted side effects in our cytological studies, and the nuclear localization of ssDNA-FITC suggest that nano-LDHs have potential application as a novel gene carrier to plants. PMID:27221055

On contribution of known atomic partial charges of protein backbone in electrostatic potential density maps.

PubMed

Wang, Jimin

2017-06-01

Partial charges of atoms in a molecule and electrostatic potential (ESP) density for that molecule are known to bear a strong correlation. In order to generate a set of point-field force field parameters for molecular dynamics, Kollman and coworkers have extracted atomic partial charges for each of all 20 amino acids using restrained partial charge-fitting procedures from theoretical ESP density obtained from condensed-state quantum mechanics. The magnitude of atomic partial charges for neutral peptide backbone they have obtained is similar to that of partial atomic charges for ionized carboxylate side chain atoms. In this study, the effect of these known atomic partial charges on ESP is examined using computer simulations and compared with the experimental ESP density recently obtained for proteins using electron microscopy. It is found that the observed ESP density maps are most consistent with the simulations that include atomic partial charges of protein backbone. Therefore, atomic partial charges are integral part of atomic properties in protein molecules and should be included in model refinement. © 2017 The Protein Society.

Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

PubMed

Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

2002-06-25

A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

Structure of the Dominant Negative S17N Mutant of Ras

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nassar, N.; Singh, K; Garcia-Diaz, M

2010-01-01

The use of the dominant negative mutant of Ras has been crucial in elucidating the cellular signaling of Ras in response to the activation of various membrane-bound receptors. Although several point mutants of Ras exhibit a dominant negative effect, the asparagine to serine mutation at position 17 (S17N) remains the most popular and the most effective at inhibiting the activation of endogenous Ras. It is now widely accepted that the dominant negative effect is due to the ability of the mutant to sequester upstream activators and its inability to activate downstream effectors. Here, we present the crystal structure of RasS17Nmore » in the GDP-bound form. In the three molecules that populate the asymmetric unit, the Mg{sup 2+} ion that normally coordinates the {beta}-phosphate is absent because of steric hindrance from the Asn17 side chain. Instead, a Ca{sup 2+} ion is coordinating the {alpha}-phosphate. Also absent from one molecule is electron density for Phe28, a conserved residue that normally stabilizes the nucleotide's guanine base. Except for Phe28, the nucleotide makes conserved interactions with Ras. Combined, the inability of Phe28 to stabilize the guanine base and the absence of a Mg{sup 2+} ion to neutralize the negative charges on the phosphates explain the weaker affinity of GDP for Ras. Our data suggest that the absence of the Mg{sup 2+} should also dramatically affect GTP binding to Ras and the proper positioning of Thr35 necessary for the activation of switch 1 and the binding to downstream effectors, a prerequisite for the triggering of signaling pathways.« less

Single molecule transistor based nanopore for the detection of nicotine

NASA Astrophysics Data System (ADS)

Ray, S. J.

2014-12-01

A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.

Single molecule transistor based nanopore for the detection of nicotine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ray, S. J., E-mail: ray.sjr@gmail.com

A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realisedmore » from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.« less

Electric field changes on Au nanoparticles on semiconductor supports--the molecular voltmeter and other methods to observe adsorbate-induced charge-transfer effects in Au/TiO2 nanocatalysts.

PubMed

McEntee, Monica; Stevanovic, Ana; Tang, Wenjie; Neurock, Matthew; Yates, John T

2015-02-11

Infrared (IR) studies of Au/TiO2 catalyst particles indicate that charge transfer from van der Waals-bound donor or acceptor molecules on TiO2 to or from Au occurs via transport of charge carriers in the semiconductor TiO2 support. The ΔνCO on Au is shown to be proportional to the polarizability of the TiO2 support fully covered with donor or acceptor molecules, producing a proportional frequency shift in νCO. Charge transfer through TiO2 is associated with the population of electron trap sites in the bandgap of TiO2 and can be independently followed by changes in photoluminescence intensity and by shifts in the broad IR absorbance region for electron trap sites, which is also proportional to the polarizability of donors by IR excitation. Density functional theory calculations show that electron transfer from the donor molecules to TiO2 and to supported Au particles produces a negative charge on the Au, whereas the transfer from the Au particles to the TiO2 support into acceptor molecules results in a positive charge on the Au. These changes along with the magnitudes of the shifts are consistent with the Stark effect. A number of experiments show that the ∼3 nm Au particles act as "molecular voltmeters" in influencing ΔνCO. Insulator particles, such as SiO2, do not display electron-transfer effects to Au particles on their surface. These studies are preliminary to doping studies of semiconductor-oxide particles by metal ions which modify Lewis acid/base oxide properties and possibly strongly modify the electron-transfer and catalytic activity of supported metal catalyst particles.

Adsorption of different amphiphilic molecules onto polystyrene latices.

PubMed

Jódar-Reyes, A B; Ortega-Vinuesa, J L; Martín-Rodríguez, A

2005-02-15

In order to know the influence of the surface characteristics and the chain properties on the adsorption of amphiphilic molecules onto polystyrene latex, a set of experiments to study the adsorption of ionic surfactants, nonionic surfactants and an amphiphilic synthetic peptide on different latex dispersions was performed. The adsorbed amount versus the equilibrium surfactant concentration was determined. The main adsorption mechanism was the hydrophobic attraction between the nonpolar tail of the molecule and the hydrophobic regions of the latex surface. This attraction overcame the electrostatic repulsion between chains and latex surface with identical charge sign. However, the electrostatic interactions chain-surface and chain-chain also played a role. General patterns for the adsorption of ionic chains on charged latex surfaces could be established. Regarding the shape, the isotherms presented different plateaus corresponding to electrostatic effects and conformational changes. The surfactant size also affects the adsorption results: the higher the hydrophilic moiety in the surfactant molecule the lower the adsorbed amount.

A simple model for electrical charge in globular macromolecules and linear polyelectrolytes in solution

NASA Astrophysics Data System (ADS)

Krishnan, M.

2017-05-01

We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or

Fabrication and characterization of controllable grain boundary arrays in solution-processed small molecule organic semiconductor films

NASA Astrophysics Data System (ADS)

Wo, Songtao; Headrick, Randall L.; Anthony, John E.

2012-04-01

We have produced solution-processed thin films of 6,13-bis(tri-isopropyl-silylethynyl) pentacene with grain sizes from a few micrometers up to millimeter scale by lateral crystallization from a rectangular stylus. Grains are oriented along the crystallization direction, and the grain size transverse to the crystallization direction depends inversely on the writing speed, hence forming a regular array of oriented grain boundaries with controllable spacing. We utilize these controllable arrays to systematically study the role of large-angle grain boundaries in carrier transport and charge trapping in thin film transistors. The effective mobility scales with the grain size, leading to an estimate of the potential drop at individual large-angle grain boundaries of more than 1 volt. This result indicates that the structure of grain boundaries is not molecularly abrupt, which may be a general feature of solution-processed small molecule organic semiconductor thin films, where relatively high energy grain boundaries are typically formed. Transient measurements after switching from positive to negative gate bias or between large and small negative gate bias reveal reversible charge trapping, with time constants on the order of 10 s and trap densities that are correlated with grain boundary density. We suggest that charge diffusion along grain boundaries and other defects is the rate-determining mechanism of the reversible trapping.

Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge

NASA Astrophysics Data System (ADS)

Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

2018-04-01

Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm2, the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.

PubMed

Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

2018-04-19

Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

Enhanced adsorption of Ca-ATPase containing vesicles on a negatively charged solid-supported-membrane for the investigation of membrane transporters.

PubMed

Sacconi, Alessio; Moncelli, Maria Rosa; Margheri, Giancarlo; Tadini-Buoninsegni, Francesco

2013-11-12

A convenient model system for a biological membrane is a solid-supported membrane (SSM), which consists of a gold-supported alkanethiol|phospholipid bilayer. In combination with a concentration jump method, SSMs have been used for the investigation of several membrane transporters. Vesicles incorporating sarcoplasmic reticulum Ca-ATPase (SERCA) were adsorbed on a negatively charged SSM (octadecanethiol|phosphatidylserine bilayer). The current signal generated by the adsorbed vesicles following an ATP concentration jump was compared to that produced by SERCA-containing vesicles adsorbed on a conventional SSM (octadecanethiol|phosphatidylcholine bilayer). A significantly higher current amplitude was recorded on the serine-based SSM. The adsorption of SERCA-incorporating vesicles on the SSM was then characterized by surface plasmon resonance (SPR). The SPR measurements clearly indicate that in the presence of Ca(2+) and Mg(2+), the amount of adsorbed vesicles on the serine-based SSM is about twice that obtained using the conventional SSM, thereby demonstrating that the higher current amplitude recorded on the negatively charged SSM is correlated with a greater quantity of adsorbed vesicles. The enhanced adsorption of membrane vesicles on the PS-based SSM may be useful to study membrane preparations with a low concentration of transport protein generating small current signals, as in the case of various recombinantly expressed proteins.

Oppositely charged colloids out of equilibrium

NASA Astrophysics Data System (ADS)

Vissers, T.

2010-11-01

Colloids are particles with a size in the range of a few nanometers up to several micrometers. Similar to atomic and molecular systems, they can form gases, liquids, solids, gels and glasses. Colloids can be used as model systems because, unlike molecules, they are sufficiently large to be studied directly with light microscopy and move sufficiently slow to study their dynamics. In this thesis, we study binary systems of polymethylmethacrylate (PMMA) colloidal particles suspended in low-polar solvent mixtures. Since the ions can still partially dissociate, a surface charge builds up which causes electrostatic interactions between the colloids. By carefully tuning the conditions inside the suspension, we make two kinds of particles oppositely charged. To study our samples, we use Confocal Laser Scanning Microscopy (CLSM). The positively and negatively charged particles can be distinguished by a different fluorescent dye. Colloids constantly experience a random motion resulting from random kicks of surrounding solvent molecules. When the attractions between the oppositely charged particles are weak, the particles can attach and detach many times and explore a lot of possible configurations and the system can reach thermodynamic equilibrium. For example, colloidal ‘ionic’ crystals consisting of thousands to millions of particles can form under the right conditions. When the attractions are strong, the system can become kinetically trapped inside a gel-like state. We observe that when the interactions change again, crystals can even emerge again from this gel-like phase. By using local order parameters, we quantitatively study the crystallization of colloidal particles and identify growth defects inside the crystals. We also study the effect of gravity on the growth of ionic crystals by using a rotating stage. We find that sedimentation can completely inhibit crystal growth and plays an important role in crystallization from the gel-like state. The surface

Energy of charged states in the acetanilide crystal: trapping of charge-transfer states at vacancies as a possible mechanism for optical damage.

PubMed

Tsiaousis, D; Munn, R W

2004-04-15

Calculations for the acetanilide crystal yield the effective polarizability (16.6 A(3)), local electric field tensor, effective dipole moment (5.41 D), and dipole-dipole energy (-12.8 kJ/mol). Fourier-transform techniques are used to calculate the polarization energy P for a single charge in the perfect crystal (-1.16 eV); the charge-dipole energy W(D) is zero if the crystal carries no bulk dipole moment. Polarization energies for charge-transfer (CT) pairs combine with the Coulomb energy E(C) to give the screened Coulomb energy E(scr); screening is nearly isotropic, with E(scr) approximately E(C)/2.7. For CT pairs W(D) reduces to a term deltaW(D) arising from the interaction of the charge on each ion with the change in dipole moment on the other ion relative to the neutral molecule. The dipole moments calculated by density-functional theory methods with the B3LYP functional at the 6-311++G(**) level are 3.62 D for the neutral molecule, changing to 7.13 D and 4.38 D for the anion and cation, relative to the center of mass. Because of the large change in the anion, deltaW(D) reaches -0.9 eV and modifies the sequence of CT energies markedly from that of E(scr), giving the lowest two CT pairs at -1.98 eV and -1.41 eV. The changes in P and W(D) near a vacancy are calculated; W(D) changes for the individual charges because the vacancy removes a dipole moment and modifies the crystal dielectric response, but deltaW(D) and E(C) do not change. A vacancy yields a positive change DeltaP that scatters a charge or CT pair, but the change DeltaW(D) can be negative and large enough to outweigh DeltaP, yielding traps with depths that can exceed 150 meV for single charges and for CT pairs. Divacancies yield traps with depths nearly equal to the sum of those produced by the separate vacancies and so they can exceed 300 meV. These results are consistent with a mechanism of optical damage in which vacancies trap optically generated CT pairs that recombine and release energy; this can

Formation of multiply charged ions from large molecules using massive-cluster impact.

PubMed

Mahoney, J F; Cornett, D S; Lee, T D

1994-05-01

Massive-cluster impact is demonstrated to be an effective ionization technique for the mass analysis of proteins as large as 17 kDa. The design of the cluster source permits coupling to both magnetic-sector and quadrupole mass spectrometers. Mass spectra are characterized by the almost total absence of chemical background and a predominance of multiply charged ions formed from 100% glycerol matrix. The number of charge states produced by the technique is observed to range from +3 to +9 for chicken egg lysozyme (14,310 Da). The lower m/z values provided by higher charge states increase the effective mass range of analyses performed with conventional ionization by fast-atom bombardment or liquid secondary ion mass spectrometry.

Spectrally resolved single-molecule electrometry

NASA Astrophysics Data System (ADS)

Ruggeri, F.; Krishnan, M.

2018-03-01

Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.

Binding of cationic pentapeptides with modified side chain lengths to negatively charged lipid membranes: Complex interplay of electrostatic and hydrophobic interactions.

PubMed

Hoernke, Maria; Schwieger, Christian; Kerth, Andreas; Blume, Alfred

2012-07-01

Basic amino acids play a key role in the binding of membrane associated proteins to negatively charged membranes. However, side chains of basic amino acids like lysine do not only provide a positive charge, but also a flexible hydrocarbon spacer that enables hydrophobic interactions. We studied the influence of hydrophobic contributions to the binding by varying the side chain length of pentapeptides with ammonium groups starting with lysine to lysine analogs with shorter side chains, namely omithine (Orn), alpha, gamma-diaminobutyric acid (Dab) and alpha, beta-diaminopropionic acid (Dap). The binding to negatively charged phosphatidylglycerol (PG) membranes was investigated by calorimetry, FT-infrared spectroscopy (FT-IR) and monolayer techniques. The binding was influenced by counteracting and sometimes compensating contributions. The influence of the bound peptides on the lipid phase behavior depends on the length of the peptide side chains. Isothermal titration calorimetry (ITC) experiments showed exothermic and endothermic effects compensating to a different extent as a function of side chain length. The increase in lipid phase transition temperature was more significant for peptides with shorter side chains. FTIR-spectroscopy revealed changes in hydration of the lipid bilayer interface after peptide binding. Using monolayer techniques, the contributions of electrostatic and hydrophobic effects could clearly be observed. Peptides with short side chains induced a pronounced decrease in surface pressure of PG monolayers whereas peptides with additional hydrophobic interactions decreased the surface pressure much less or even lead to an increase, indicating insertion of the hydrophobic part of the side chain into the lipid monolayer.

Polarization and charge transfer in the hydration of chloride ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao Zhen; Rogers, David M.; Beck, Thomas L.

2010-01-07

A theoretical study of the structural and electronic properties of the chloride ion and water molecules in the first hydration shell is presented. The calculations are performed on an ensemble of configurations obtained from molecular dynamics simulations of a single chloride ion in bulk water. The simulations utilize the polarizable AMOEBA force field for trajectory generation and MP2-level calculations are performed to examine the electronic structure properties of the ions and surrounding waters in the external field of more distant waters. The ChelpG method is employed to explore the effective charges and dipoles on the chloride ions and first-shell waters.more » The quantum theory of atoms in molecules (QTAIM) is further utilized to examine charge transfer from the anion to surrounding water molecules. The clusters extracted from the AMOEBA simulations exhibit high probabilities of anisotropic solvation for chloride ions in bulk water. From the QTAIM analysis, 0.2 elementary charges are transferred from the ion to the first-shell water molecules. The default AMOEBA model overestimates the average dipole moment magnitude of the ion compared to the quantum mechanical value. The average magnitude of the dipole moment of the water molecules in the first shell treated at the MP2-level, with the more distant waters handled with an AMOEBA effective charge model, is 2.67 D. This value is close to the AMOEBA result for first-shell waters (2.72 D) and is slightly reduced from the bulk AMOEBA value (2.78 D). The magnitude of the dipole moment of the water molecules in the first solvation shell is most strongly affected by the local water-water interactions and hydrogen bonds with the second solvation shell, rather than by interactions with the ion.« less

Electronegativity Equalization Method: Parameterization and Validation for Large Sets of Organic, Organohalogene and Organometal Molecule

PubMed Central

Vařeková, Radka Svobodová; Jiroušková, Zuzana; Vaněk, Jakub; Suchomel, Šimon; Koča, Jaroslav

2007-01-01

The Electronegativity Equalization Method (EEM) is a fast approach for charge calculation. A challenging part of the EEM is the parameterization, which is performed using ab initio charges obtained for a set of molecules. The goal of our work was to perform the EEM parameterization for selected sets of organic, organohalogen and organometal molecules. We have performed the most robust parameterization published so far. The EEM parameterization was based on 12 training sets selected from a database of predicted 3D structures (NCI DIS) and from a database of crystallographic structures (CSD). Each set contained from 2000 to 6000 molecules. We have shown that the number of molecules in the training set is very important for quality of the parameters. We have improved EEM parameters (STO-3G MPA charges) for elements that were already parameterized, specifically: C, O, N, H, S, F and Cl. The new parameters provide more accurate charges than those published previously. We have also developed new parameters for elements that were not parameterized yet, specifically for Br, I, Fe and Zn. We have also performed crossover validation of all obtained parameters using all training sets that included relevant elements and confirmed that calculated parameters provide accurate charges.

Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

PubMed

Modesto-Costa, Lucas; Borges, Itamar

2018-08-05

The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

Charge Storage, Conductivity and Charge Profiles of Insulators as Related to Spacecraft Charging

NASA Technical Reports Server (NTRS)

Dennison, J. R.; Swaminathan, Prasanna; Frederickson, A. R.

2004-01-01

Dissipation of charges built up near the surface of insulators due to space environment interaction is central to understanding spacecraft charging. Conductivity of insulating materials is key to determine how accumulated charge will distribute across the spacecraft and how rapidly charge imbalance will dissipate. To understand these processes requires knowledge of how charge is deposited within the insulator, the mechanisms for charge trapping and charge transport within the insulator, and how the profile of trapped charge affects the transport and emission of charges from insulators. One must consider generation of mobile electrons and holes, their trapping, thermal de-trapping, mobility and recombination. Conductivity is more appropriately measured for spacecraft charging applications as the "decay" of charge deposited on the surface of an insulator, rather than by flow of current across two electrodes around the sample. We have found that conductivity determined from charge storage decay methods is 102 to 104 smaller than values obtained from classical ASTM and IEC methods for a variety of thin film insulating samples. For typical spacecraft charging conditions, classical conductivity predicts decay times on the order of minutes to hours (less than typical orbit periods); however, the higher charge storage conductivities predict decay times on the order of weeks to months leading to accumulation of charge with subsequent orbits. We found experimental evidence that penetration profiles of radiation and light are exceedingly important, and that internal electric fields due to charge profiles and high-field conduction by trapped electrons must be considered for space applications. We have also studied whether the decay constants depend on incident voltage and flux or on internal charge distributions and electric fields; light-activated discharge of surface charge to distinguish among differing charge trapping centers; and radiation-induced conductivity. Our

On contribution of known atomic partial charges of protein backbone in electrostatic potential density maps

PubMed Central

2017-01-01

Abstract Partial charges of atoms in a molecule and electrostatic potential (ESP) density for that molecule are known to bear a strong correlation. In order to generate a set of point‐field force field parameters for molecular dynamics, Kollman and coworkers have extracted atomic partial charges for each of all 20 amino acids using restrained partial charge‐fitting procedures from theoretical ESP density obtained from condensed‐state quantum mechanics. The magnitude of atomic partial charges for neutral peptide backbone they have obtained is similar to that of partial atomic charges for ionized carboxylate side chain atoms. In this study, the effect of these known atomic partial charges on ESP is examined using computer simulations and compared with the experimental ESP density recently obtained for proteins using electron microscopy. It is found that the observed ESP density maps are most consistent with the simulations that include atomic partial charges of protein backbone. Therefore, atomic partial charges are integral part of atomic properties in protein molecules and should be included in model refinement. PMID:28370507

The interstitial distribution of macromolecules in rat tumours is influenced by the negatively charged matrix components

PubMed Central

Wiig, Helge; Gyenge, Christina C; Tenstad, Olav

2005-01-01

Knowledge of macromolecular distribution volumes is essential in understanding fluid transport within normal and pathological tissues. In this study in vivo we determined the distribution volumes of several macromolecules, including one monoclonal antibody, in tumours and tested whether charges associated with the tumour extracellular matrix influence their available volumes. Steady state levels of the monoclonal antibody trastuzumab (Herceptin) (pI = 9.2), IgG (pI = 7.6) as well as native (pI = 5.0) and cationized albumin (pI = 7.6) were established in rats bearing dimethylbenzanthracene (DMBA)-induced mammary tumours by continuous infusion using osmotic minipumps. After a 5–7 day infusion period, the rats were nephrectomized and the extracellular volume was determined with 51Cr-labelled EDTA. Plasma volumes were measured with 125I-labelled human serum albumin or rat IgM in a separate series. Steady state concentrations of probes were determined in the interstitial fluid that was isolated by centrifugation from tumours or by post mortem wick implantation in the back skin. Calculations were made for interstitial fluid volume (Vi), along with the available (Va/Vi) and excluded (Ve/Vi) relative interstitial volume fractions. The Ve/Vi for the positively charged trastuzumab in tumours averaged 0.29 ± 0.03 (n = 16), a value which was significantly lower than the corresponding one for IgG of 0.36 ± 0.02 (n = 16). Native albumin was excluded from 38% of the tumour interstitial fluid, whereas cationization of albumin reduced the excluded volume by ∼50%. Our experiments suggest that the tumour interstitium acts as a negatively charged matrix and is an important factor in determining the macromolecular distribution volume. PMID:15994186

The interstitial distribution of macromolecules in rat tumours is influenced by the negatively charged matrix components.

PubMed

Wiig, Helge; Gyenge, Christina C; Tenstad, Olav

2005-09-01

Knowledge of macromolecular distribution volumes is essential in understanding fluid transport within normal and pathological tissues. In this study in vivo we determined the distribution volumes of several macromolecules, including one monoclonal antibody, in tumours and tested whether charges associated with the tumour extracellular matrix influence their available volumes. Steady state levels of the monoclonal antibody trastuzumab (Herceptin) (pI = 9.2), IgG (pI = 7.6) as well as native (pI = 5.0) and cationized albumin (pI = 7.6) were established in rats bearing dimethylbenzanthracene (DMBA)-induced mammary tumours by continuous infusion using osmotic minipumps. After a 5-7 day infusion period, the rats were nephrectomized and the extracellular volume was determined with 51Cr-labelled EDTA. Plasma volumes were measured with 125I-labelled human serum albumin or rat IgM in a separate series. Steady state concentrations of probes were determined in the interstitial fluid that was isolated by centrifugation from tumours or by post mortem wick implantation in the back skin. Calculations were made for interstitial fluid volume (Vi), along with the available (Va/Vi) and excluded (Ve/Vi) relative interstitial volume fractions. The Ve/Vi for the positively charged trastuzumab in tumours averaged 0.29 +/- 0.03 (n = 16), a value which was significantly lower than the corresponding one for IgG of 0.36 +/- 0.02 (n = 16). Native albumin was excluded from 38% of the tumour interstitial fluid, whereas cationization of albumin reduced the excluded volume by approximately 50%. Our experiments suggest that the tumour interstitium acts as a negatively charged matrix and is an important factor in determining the macromolecular distribution volume.

Using a water-confined carbon nanotube to probe the electricity of sequential charged segments of macromolecules

NASA Astrophysics Data System (ADS)

Wang, Yu; Zhao, Yan-Jiao; Huang, Ji-Ping

2012-07-01

The detection of macromolecular conformation is particularly important in many physical and biological applications. Here we theoretically explore a method for achieving this detection by probing the electricity of sequential charged segments of macromolecules. Our analysis is based on molecular dynamics simulations, and we investigate a single file of water molecules confined in a half-capped single-walled carbon nanotube (SWCNT) with an external electric charge of +e or -e (e is the elementary charge). The charge is located in the vicinity of the cap of the SWCNT and along the centerline of the SWCNT. We reveal the picosecond timescale for the re-orientation (namely, from one unidirectional direction to the other) of the water molecules in response to a switch in the charge signal, -e → +e or +e → -e. Our results are well understood by taking into account the electrical interactions between the water molecules and between the water molecules and the external charge. Because such signals of re-orientation can be magnified and transported according to Tu et al. [2009 Proc. Natl. Acad. Sci. USA 106 18120], it becomes possible to record fingerprints of electric signals arising from sequential charged segments of a macromolecule, which are expected to be useful for recognizing the conformations of some particular macromolecules.

R.E.D. Server: a web service for deriving RESP and ESP charges and building force field libraries for new molecules and molecular fragments.

PubMed

Vanquelef, Enguerran; Simon, Sabrina; Marquant, Gaelle; Garcia, Elodie; Klimerak, Geoffroy; Delepine, Jean Charles; Cieplak, Piotr; Dupradeau, François-Yves

2011-07-01

R.E.D. Server is a unique, open web service, designed to derive non-polarizable RESP and ESP charges and to build force field libraries for new molecules/molecular fragments. It provides to computational biologists the means to derive rigorously molecular electrostatic potential-based charges embedded in force field libraries that are ready to be used in force field development, charge validation and molecular dynamics simulations. R.E.D. Server interfaces quantum mechanics programs, the RESP program and the latest version of the R.E.D. tools. A two step approach has been developed. The first one consists of preparing P2N file(s) to rigorously define key elements such as atom names, topology and chemical equivalencing needed when building a force field library. Then, P2N files are used to derive RESP or ESP charges embedded in force field libraries in the Tripos mol2 format. In complex cases an entire set of force field libraries or force field topology database is generated. Other features developed in R.E.D. Server include help services, a demonstration, tutorials, frequently asked questions, Jmol-based tools useful to construct PDB input files and parse R.E.D. Server outputs as well as a graphical queuing system allowing any user to check the status of R.E.D. Server jobs.

Single Molecule Enzymology via Nanoelectronic Circuits

NASA Astrophysics Data System (ADS)

Collins, Philip

Traditional single-molecule techniques rely on fluorescence or force transduction to monitor conformational changes and biochemical activity. Recent demonstrations of single-molecule monitoring with electronic transistors are poised to add to the single-molecule research toolkit. The transistor-based technique is sensitive to the motion of single charged side chain residues and can transduce those motions with microsecond resolution, opening the doors to single-molecule enzymology with unprecedented resolution. Furthermore, the solid-state platform provides opportunities for parallelization in arrays and long-duration monitoring of one molecule's activity or processivity, all without the limitations caused by photo-oxidation or mutagenic fluorophore incorporation. This presentation will review some of these advantages and their particular application to DNA polymerase I processing single-stranded DNA templates. This research was supported financially by the NIH NCI (R01 CA133592-01), the NIH NIGMS (1R01GM106957-01) and the NSF (DMR-1104629 and ECCS-1231910).

A surprising way to control the charge transport in molecular electronics: the subtle impact of the coverage of self-assembled monolayers of floppy molecules adsorbed on metallic electrodes.

PubMed

Bâldea, Ioan

2017-10-26

Inspired by earlier attempts in organic electronics aiming at controlling charge injection from metals into organic materials by manipulating the Schottky energy barrier using self-assembled monolayers (SAMs), recent experimental and theoretical work in molecular electronics showed that metal-organic interfaces can be controlled via changes in the metal work function that are induced by SAMs. In this paper we indicate a different route to achieve interface-driven control over the charge transfer/transport at the molecular scale. It is based on the fact that, in floppy molecule based SAMs, the molecular conformation can be tuned by varying the coverage of the adsorbate. We demonstrate this effect with the aid of benchmark molecules that are often used to fabricate nanojunctions and consist of two rings that can easily rotate relative to each other. We show that, by varying the coverage of the SAM, the twisting angle φ of the considered molecular species can be modified by a factor of two. Given the fact that the low bias conductance G scales as cos 2  φ, this results in a change in G of over one order of magnitude for the considered molecular species. Tuning the twisting angle by controlling the SAM coverage may be significant, e.g., for current efforts to fabricate molecular switches. Conversely, the lack of control over the local SAM coverage may be problematic for the reproducibility and interpretation of the STM (scanning tunneling microscope) measurements on repeatedly forming single molecule break junctions.

Mapping the Transmission Functions of Single-Molecule Junctions.

PubMed

Capozzi, Brian; Low, Jonathan Z; Xia, Jianlong; Liu, Zhen-Fei; Neaton, Jeffrey B; Campos, Luis M; Venkataraman, Latha

2016-06-08

Charge transport phenomena in single-molecule junctions are often dominated by tunneling, with a transmission function dictating the probability that electrons or holes tunnel through the junction. Here, we present a new and simple technique for measuring the transmission functions of molecular junctions in the coherent tunneling limit, over an energy range of 1.5 eV around the Fermi energy. We create molecular junctions in an ionic environment with electrodes having different exposed areas, which results in the formation of electric double layers of dissimilar density on the two electrodes. This allows us to electrostatically shift the molecular resonance relative to the junction Fermi levels in a manner that depends on the sign of the applied bias, enabling us to map out the junction's transmission function and determine the dominant orbital for charge transport in the molecular junction. We demonstrate this technique using two groups of molecules: one group having molecular resonance energies relatively far from EF and one group having molecular resonance energies within the accessible bias window. Our results compare well with previous electrochemical gating data and with transmission functions computed from first principles. Furthermore, with the second group of molecules, we are able to examine the behavior of a molecular junction as a resonance shifts into the bias window. This work provides a new, experimentally simple route for exploring the fundamentals of charge transport at the nanoscale.

The influence of space charge shielding on dielectric multipactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, C.; Liu, G. Z.; Tang, C. X.

2009-05-15

A model of space charge influenced by multipactor electrons and plasma has been established. The positive space charge potential/field for vacuum dielectric multipactor is analytically studied. After considering the plasma, the positive space charge field is further shielded, and multipactor saturates at higher surface accumulated field, compared with that for only considering multipactor electrons. The negative space charge potential/field for dielectric breakdown at high pressure is analyzed. It is found that the negative potential can be nonmonotonously varied, forming a minimum potential well.

Profiles of equilibrium constants for self-association of aromatic molecules

NASA Astrophysics Data System (ADS)

Beshnova, Daria A.; Lantushenko, Anastasia O.; Davies, David B.; Evstigneev, Maxim P.

2009-04-01

Analysis of the noncovalent, noncooperative self-association of identical aromatic molecules assumes that the equilibrium self-association constants are either independent of the number of molecules (the EK-model) or change progressively with increasing aggregation (the AK-model). The dependence of the self-association constant on the number of molecules in the aggregate (i.e., the profile of the equilibrium constant) was empirically derived in the AK-model but, in order to provide some physical understanding of the profile, it is proposed that the sources for attenuation of the equilibrium constant are the loss of translational and rotational degrees of freedom, the ordering of molecules in the aggregates and the electrostatic contribution (for charged units). Expressions are derived for the profiles of the equilibrium constants for both neutral and charged molecules. Although the EK-model has been widely used in the analysis of experimental data, it is shown in this work that the derived equilibrium constant, KEK, depends on the concentration range used and hence, on the experimental method employed. The relationship has also been demonstrated between the equilibrium constant KEK and the real dimerization constant, KD, which shows that the value of KEK is always lower than KD.

Effect of pH buffer molecules on the light-induced currents from oriented purple membrane.

PubMed Central

Liu, S Y; Kono, M; Ebrey, T G

1991-01-01

The effect of pH buffers on the microsecond photocurrent component, B2, of oriented purple membranes has been studied. We found that under low salt conditions (less than 10 mM monovalent cationic salt) pH buffers can dramatically alter the waveform of the B2 component. The effect is induced by the protonation process of the buffer molecules by protons expelled from the membrane. These effects can be classified according to the charge transition upon protonation of the buffer. Buffers that carry two positive charges in their protonated form add a negative current component (N component) to B2. Almost all of the other buffers add a positive current component (P component) to B2, which is essentially a mirror image of the N component. Buffers with a pK less than 5.5 have only a small positive buffer component. The pH dependence of the buffer effect is closely related to the pK of the buffer; it requires that the buffer be in its unprotonated form. The rise time of the buffer component increases with the concentration of the buffer molecules. All the buffer effects can be inhibited by the addition of 5 mM of a divalent cation such as Ca2+. Reducing the surface potential slows down the N component but accelerates the P component without affecting the amplitude of the buffer effect significantly. Many of the buffer effects can be explained if we assume that upon protonation of the buffer by a proton expelled from the membrane by light, the buffer molecules move toward the membrane. This backward movement of buffer molecules forms a counter current very similar to that due to cations discussed in Liu, S. Y., R. Govindjee, and T. G. Ebrey. (1990. Biophys. J. 57:951-963). PMID:1883939

Confinement of water molecule inside (2, 2) graphyne nanotube

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deb, Jyotirmoy; Bhattacharya, Barnali; Sarkar, Utpal, E-mail: utpalchemiitkgp@yahoo.com

2016-05-23

Using density functional theory (DFT) calculations with generalized gradient approximation, the interaction between H{sub 2}O molecule and (2, 2) graphyne nanotube (GNT) has been investigated. The stable configuration due to the insertion of H{sub 2}O molecule inside (2, 2) GNT is determined on the basis of binding energy. The band gap of the GNT decreases due to the confinement of H{sub 2}O molecule. The charge analysis reveals that electrons are shifted from the H{sub 2}O molecule to the GNT. The electronic property of the GNT is highly influenced by the presence of H{sub 2}O molecule; thus, we may design amore » GNT based sensor for the detection of water molecule.« less

[Diffusion and diffusion-osmosis models of the charged macromolecule transfer in barriers of biosystems].

PubMed

Varakin, A I; Mazur, V V; Arkhipova, N V; Serianov, Iu V

2009-01-01

Mathematical models of the transfer of charged macromolecules have been constructed on the basis of the classical equations of electromigration diffusion of Helmholtz-Smolukhovskii, Goldman, and Goldman-Hodgkin-Katz. It was shown that ion transfer in placental (mimicking lipid-protein barriers) and muscle barriers occurs by different mechanisms. In placental barriers, the electromigration diffusion occurs along lipid-protein channels formed due to the conformational deformation of phospholipid and protein molecules with the coefficients of diffusion D = (2.6-3.6) x 10(-8) cm2/s. The transfer in muscle barriers is due to the migration across charged interfibrillar channels with the negative diffusion activation energy, which is explained by changes in the structure of muscle fibers and expenditures of thermal energy for the extrusion of Cl- from channel walls with the diffusion coefficient D = (6.0-10.0) x 10(-6) cm2/s.

Geometry-dependent distributed polarizability models for the water molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loboda, Oleksandr; Ingrosso, Francesca; Ruiz-López, Manuel F.

2016-01-21

Geometry-dependent distributed polarizability models have been constructed by fits to ab initio calculations at the coupled cluster level of theory with up to noniterative triple excitations in an augmented triple-zeta quality basis set for the water molecule in the field of a point charge. The investigated models include (i) charge-flow polarizabilities between chemically bonded atoms, (ii) isotropic or anisotropic dipolar polarizabilities on oxygen atom or on all atoms, and (iii) combinations of models (i) and (ii). For each model, the polarizability parameters have been optimized to reproduce the induction energy of a water molecule polarized by a point charge successivelymore » occupying a grid of points surrounding the molecule. The quality of the models is ascertained by examining their ability to reproduce these induction energies as well as the molecular dipolar and quadrupolar polarizabilities. The geometry dependence of the distributed polarizability models has been explored by changing bond lengths and HOH angle to generate 125 molecular structures (reduced to 75 symmetry-unique ones). For each considered model, the distributed polarizability components have been fitted as a function of the geometry by a Taylor expansion in monomer coordinate displacements up to the sum of powers equal to 4.« less

Adsorption and transport of charged vs. neutral hydrophobic molecules at the membrane of murine erythroleukemia (MEL) cells.

PubMed

Zeng, Jia; Eckenrode, Heather M; Dai, Hai-Lung; Wilhelm, Michael J

2015-03-01

The adsorption and transport of hydrophobic molecules at the membrane surface of pre- and post-DMSO induced differentiated murine erythroleukemia (MEL) cells were examined by time- and wavelength-resolved second harmonic light scattering. Two medium (<600 Da) hydrophobic molecules, cationic malachite green (MG) and neutral bromocresol purple (BCP), were investigated. While it was observed that the MG cation adsorbs onto the surface of the MEL cell, neutral BCP does not. It is suggested that an electrostatic interaction between the opposite charges of the cation and the MEL cell surface is the primary driving force for adsorption. Comparisons of adsorption density and free energy, measured at different pH and cell morphology, indicate that the interaction is predominantly through sialic acid carboxyl groups. MG cation adsorption densities have been determined as (0.6±0.3)×10(6) μm(-2) on the surface of undifferentiated MEL cells, and (1.8±0.5)×10(7) μm(-2) on differentiated MEL cells, while the deduced adsorption free energies are effectively identical (ca. -10.9±0.1 and -10.8±0.1 kcal mol(-1), respectively). The measured MG densities indicate that the total number of surface carboxyl groups is largely conserved following differentiation, and therefore the density of carboxylic groups is much larger on the differentiated cell surface than the undifferentiated one. Finally, in contrast to synthetic liposomes and bacterial membranes, surface adsorbed MG cations are unable to traverse the MEL cell membrane. Copyright © 2015 Elsevier B.V. All rights reserved.

Kinetic Energy Release of the Singly and Doubly Charged Methylene Chloride Molecule: The Role of Fast Dissociation.

PubMed

Alcantara, K F; Rocha, A B; Gomes, A H A; Wolff, W; Sigaud, L; Santos, A C F

2016-09-01

The center of mass kinetic energy release distribution (KERD) spectra of selected ionic fragments, formed through dissociative single and double photoionization of CH2Cl2 at photon energies around the Cl 2p edge, were extracted from the shape and width of the experimentally obtained time-of-flight (TOF) distributions. The KERD spectra exhibit either smooth profiles or structures, depending on the moiety and photon energy. In general, the heavier the ionic fragments, the lower their average KERDs are. In contrast, the light H(+) fragments are observed with kinetic energies centered around 4.5-5.5 eV, depending on the photon energy. It was observed that the change in the photon energy involves a change in the KERDs, indicating different processes or transitions taking place in the breakup process. In the particular case of double ionization with the ejection of two charged fragments, the KERDs present have characteristics compatible with the Coulombic fragmentation model. Intending to interpret the experimental data, singlet and triplet states at Cl 2p edge of the CH2Cl2 molecule, corresponding to the Cl (2p → 10a1*) and Cl (2p → 4b1*) transitions, were calculated at multiconfigurational self-consistent field (MCSCF) level and multireference configuration interaction (MRCI). These states were selected to form the spin-orbit coupling matrix elements, which after diagonalization result in a spin-orbit manifold. Minimum energy pathways for dissociation of the molecule were additionally calculated aiming to give support to the presence of the ultrafast dissociation mechanism in the molecular breakup.

Imaging prototypical aromatic molecules on insulating surfaces: a review

NASA Astrophysics Data System (ADS)

Hoffmann-Vogel, R.

2018-01-01

Insulating substrates allow for in-plane contacted molecular electronics devices where the molecule is in contact with the insulator. For the development of such devices it is important to understand the interaction of molecules with insulating surfaces. As substrates, ionic crystals such as KBr, KCl, NaCl and CaF2 are discussed. The surface energies of these substrates are small and as a consequence intrinsic properties of the molecules, such as molecule–molecule interaction, become more important relative to interactions with the substrates. As prototypical molecules, three variants of graphene-related molecules are used, pentacene, C60 and PTCDA. Pentacene is a good candidate for molecular electronics applications due to its high charge carrier mobility. It shows mainly an upright standing growth mode and the morphology of the islands is strongly influenced by dewetting. A new second flat-lying phase of the molecule has been observed. Studying the local work function using the Kelvin method reveals details such as line defects in the center of islands. The local work function differences between the upright-standing and flat-lying phase can only be explained by charge transfer that is unusual on ionic crystalline surfaces. C60 nucleation and growth is explained by loosely bound molecules at kink sites as nucleation sites. The stability of C60 islands as a function of magic numbers is investigated. Peculiar island shapes are obtained from unusual dewetting processes already at work during growth, where molecules ‘climb’ to the second molecular layer. PTCDA is a prototypical semiconducting molecule with strong quadrupole moment. It grows in the form of elongated islands where the top and the facets can be molecularly resolved. In this way the precise molecular arrangement in the islands is revealed.

Collisional charging of individual submillimeter particles: Using ultrasonic levitation to initiate and track charge transfer

NASA Astrophysics Data System (ADS)

Lee, Victor; James, Nicole M.; Waitukaitis, Scott R.; Jaeger, Heinrich M.

2018-03-01

Electrostatic charging of insulating fine particles can be responsible for numerous phenomena ranging from lightning in volcanic plumes to dust explosions. However, even basic aspects of how fine particles become charged are still unclear. Studying particle charging is challenging because it usually involves the complexities associated with many-particle collisions. To address these issues, we introduce a method based on acoustic levitation, which makes it possible to initiate sequences of repeated collisions of a single submillimeter particle with a flat plate, and to precisely measure the particle charge in situ after each collision. We show that collisional charge transfer between insulators is dependent on the hydrophobicity of the contacting surfaces. We use glass, which we modify by attaching nonpolar molecules to the particle, the plate, or both. We find that hydrophilic surfaces develop significant positive charges after contacting hydrophobic surfaces. Moreover, we demonstrate that charging between a hydrophilic and a hydrophobic surface is suppressed in an acidic environment and enhanced in a basic one. Application of an electric field during each collision is found to modify the charge transfer, again depending on surface hydrophobicity. We discuss these results within the context of contact charging due to ion transfer, and we show that they lend strong support to O H- ions as the charge carriers.

Enhancement of IR and VCD intensities due to charge transfer.

PubMed

Nicu, Valentin Paul; Autschbach, Jochen; Baerends, Evert Jan

2009-03-14

Donor-acceptor interactions such as the one between the Cl(-) base and the N-H sigma* acceptor orbitals encountered in the complexation of Cl(-) counterions to the [Co(en)(3)](3+) transition metal complex, have been shown to cause huge enhancement (between 1 and 2 orders of magnitude) of the VCD intensities of N-H stretching modes. This effect has been fully analyzed, and could be attributed to increased charge flow from the Cl(-) donors when the N-H bonds become stretched. The transfer of charge counteracts the movement of negative electronic charge that happens along with the motion of the H nuclei, effectively reversing the electronic part of the electric dipole transition moment (EDTM) in the direction of the charge flow (z, say), and of the magnetic transition dipole moment (MDTM) in the perpendicular direction. The consequences for the IR and VCD intensity follow: IR intensity is strongly increased if the EDTM is polarized in the z direction, e.g. in A(2) modes, but not so much if it is polarized in the xy plane (E modes), the VCD is strongly enhanced if the EDTM and MTDM are polarized in the xy plane (in E modes), but less so when they are polarized in the z direction (in A(2) modes). The explanation holds generally for complexation phenomena of this sort, including the donor-acceptor part of hydrogen bonding interactions, e.g. with solvent molecules.

Entropy and charge in molecular evolution--the case of phosphate

NASA Technical Reports Server (NTRS)

Arrhenius, G.; Sales, B.; Mojzsis, S.; Lee, T.; Bada, J. L. (Principal Investigator)

1997-01-01

Biopoesis, the creation of life, implies molecular evolution from simple components, randomly distributed and in a dilute state, to form highly organized, concentrated systems capable of metabolism, replication and mutation. This chain of events must involve environmental processes that can locally lower entropy in several steps; by specific selection from an indiscriminate mixture, by concentration from dilute solution, and in the case of the mineral-induced processes, by particular effectiveness in ordering and selective reaction, directed toward formation of functional biomolecules. Numerous circumstances provide support for the notion that negatively charged molecules were functionally required and geochemically available for biopoesis. Sulfite ion may have been important in bisulfite complex formation with simple aldehydes, facilitating the initial concentration by sorption of aldehydes in positively charged surface active minerals. Borate ion may have played a similar, albeit less investigated role in forming charged sugar complexes. Among anionic species, oligophosphate ions and charged phosphate esters are likely to have been of even more wide ranging importance, reflected in the continued need for phosphate in a proposed RNA world, and extending its central role to evolved biochemistry. Phosphorylation is shown to result in selective concentration by surface sorption of compounds, otherwise too dilute to support condensation reactions. It provides protection against rapid hydrolysis of sugars and, by selective concentration, induces the oligomerization of aldehydes. As a manifestation of life arisen, phosphate already appears in an organic context in the oldest preserved sedimentary record.

Theoretical characterization of photoinduced electron transfer in rigidly linked donor-acceptor molecules: the fragment charge difference and the generalized Mulliken-Hush schemes

NASA Astrophysics Data System (ADS)

Lee, Sheng-Jui; Chen, Hung-Cheng; You, Zhi-Qiang; Liu, Kuan-Lin; Chow, Tahsin J.; Chen, I.-Chia; Hsu, Chao-Ping

2010-10-01

We calculate the electron transfer (ET) rates for a series of heptacyclo[6.6.0.02,6.03,13.014,11.05,9.010,14]-tetradecane (HCTD) linked donor-acceptor molecules. The electronic coupling factor was calculated by the fragment charge difference (FCD) [19] and the generalized Mulliken-Hush (GMH) schemes [20]. We found that the FCD is less prone to problems commonly seen in the GMH scheme, especially when the coupling values are small. For a 3-state case where the charge transfer (CT) state is coupled with two different locally excited (LE) states, we tested with the 3-state approach for the GMH scheme [30], and found that it works well with the FCD scheme. A simplified direct diagonalization based on Rust's 3-state scheme was also proposed and tested. This simplified scheme does not require a manual assignment of the states, and it yields coupling values that are largely similar to those from the full Rust's approach. The overall electron transfer (ET) coupling rates were also calculated.

Polarization spectroscopy of positive and negative trions in an InAs quantum dot

NASA Astrophysics Data System (ADS)

Ware, Morgan E.; Bracker, Allan S.; Stinaff, Eric; Gammon, Daniel; Gershoni, David; Korenev, Vladimir L.

2005-02-01

Using polarization-sensitive photoluminescence and photoluminescence excitation spectroscopy, we study single InAs/GaAs self-assembled quantum dots. The dots were embedded in an n-type, Schottky diode structure allowing for control of the charge state. We present here the exciton, singly charged exciton (positive and negative trions), and the twice negatively charged exciton. For non-resonant excitation below the wetting layer, we observed a large degree of polarization memory from the radiative recombination of both the positive and negative trions. In excitation spectra, through the p-shell, we have found several sharp resonances in the emission from the s-shell recombination of the dot in all charged states. Some of these excitation resonances exhibit strong coulomb shifts upon addition of charges into the quantum dot. One particular resonance of the negatively charged trion was found to exhibit a fine structure doublet under circular polarization. This observation is explained in terms of resonant absorption into the triplet states of the negative trion.

Rational Design of Diketopyrrolopyrrole-Based Small Molecules as Donating Materials for Organic Solar Cells

PubMed Central

Jin, Ruifa; Wang, Kai

2015-01-01

A series of diketopyrrolopyrrole-based small molecules have been designed to explore their optical, electronic, and charge transport properties as organic solar cell (OSCs) materials. The calculation results showed that the designed molecules can lower the band gap and extend the absorption spectrum towards longer wavelengths. The designed molecules own the large longest wavelength of absorption spectra, the oscillator strength, and absorption region values. The optical, electronic, and charge transport properties of the designed molecules are affected by the introduction of different π-bridges and end groups. We have also predicted the mobility of the designed molecule with the lowest total energies. Our results reveal that the designed molecules are expected to be promising candidates for OSC materials. Additionally, the designed molecules are expected to be promising candidates for electron and/or hole transport materials. On the basis of our results, we suggest that molecules under investigation are suitable donors for [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) and its derivatives as acceptors of OSCs. PMID:26343640

Charge Transport Processes in Molecular Junctions

NASA Astrophysics Data System (ADS)

Smith, Christopher Eugene

Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (<4 nm) conjugated molecular wires, and 3) quantitatively extract interfacial properties characteristic to macroscopic junctions, such as energy level alignment and molecule-contact electronic coupling from experimental I-V curves. Here, we lay ground work for creating a more complete picture of charge transport in macroscopically ordered molecular junctions of controlled architecture, length and charge carrier. The polaronic nature of hopping transport has been predicted in long, conjugated molecular wires

Point Charges Optimally Placed to Represent the Multipole Expansion of Charge Distributions

PubMed Central

Onufriev, Alexey V.

2013-01-01

We propose an approach for approximating electrostatic charge distributions with a small number of point charges to optimally represent the original charge distribution. By construction, the proposed optimal point charge approximation (OPCA) retains many of the useful properties of point multipole expansion, including the same far-field asymptotic behavior of the approximate potential. A general framework for numerically computing OPCA, for any given number of approximating charges, is described. We then derive a 2-charge practical point charge approximation, PPCA, which approximates the 2-charge OPCA via closed form analytical expressions, and test the PPCA on a set of charge distributions relevant to biomolecular modeling. We measure the accuracy of the new approximations as the RMS error in the electrostatic potential relative to that produced by the original charge distribution, at a distance the extent of the charge distribution–the mid-field. The error for the 2-charge PPCA is found to be on average 23% smaller than that of optimally placed point dipole approximation, and comparable to that of the point quadrupole approximation. The standard deviation in RMS error for the 2-charge PPCA is 53% lower than that of the optimal point dipole approximation, and comparable to that of the point quadrupole approximation. We also calculate the 3-charge OPCA for representing the gas phase quantum mechanical charge distribution of a water molecule. The electrostatic potential calculated by the 3-charge OPCA for water, in the mid-field (2.8 Å from the oxygen atom), is on average 33.3% more accurate than the potential due to the point multipole expansion up to the octupole order. Compared to a 3 point charge approximation in which the charges are placed on the atom centers, the 3-charge OPCA is seven times more accurate, by RMS error. The maximum error at the oxygen-Na distance (2.23 Å ) is half that of the point multipole expansion up to the octupole order. PMID

Inner-shell excitation and ionic fragmentation of molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hitchcock, A.P.; Tyliszczak, T.; Cavell, R.G.

1997-04-01

Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can revealmore » cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF{sub 6} and CO{sub 2}. Their work is illustrated using results from the carborane and PF{sub 3} studies.« less

What Is the Structure of the Naphthalene-Benzene Heterodimer Radical Cation? Binding Energy, Charge Delocalization, and Unexpected Charge-Transfer Interaction in Stacked Dimer and Trimer Radical Cations.

PubMed

Attah, Isaac K; Platt, Sean P; Meot-Ner Mautner, Michael; El-Shall, M Samy; Peverati, Roberto; Head-Gordon, Martin

2015-04-02

The binding energy of the naphthalene(+•)(benzene) heterodimer cation has been determined to be 7.9 ± 1 kcal/mol for C10H8(+•)(C6H6) and 8.1 ± 1 kcal/mol for C10H8(+•)(C6D6) by equilibrium thermochemical measurements using the mass-selected drift cell technique. A second benzene molecule binds to the C10H8(+•)(C6D6) dimer with essentially the same energy (8.4 ± 1 kcal/mol), suggesting that the two benzene molecules are stacked on opposite sides of the naphthalene cation in the (C6D6)C10H8(+•)(C6D6) heterotrimer. The lowest-energy isomers of the C10H8(+•)(C6D6) and (C6D6)C10H8(+•)(C6D6) dimer and trimer calculated using the M11/cc-pVTZ method have parallel stacked structures with enthalpies of binding (-ΔH°) of 8.4 and 9.0 kcal/mol, respectively, in excellent agreement with the experimental values. The stacked face-to-face class of isomers is calculated to have substantial charge-transfer stabilization of about 45% of the total interaction energy despite the large difference between the ionization energies of benzene and naphthalene. Similarly, significant delocalization of the positive charge is found among all three fragments of the (C6D6)C10H8(+•)(C6D6) heterotrimer, thus leaving only 46% of the total charge on the central naphthalene moiety. This unexpectedly high charge-transfer component results in activating two benzene molecules in the naphthalene(+•)(benzene)2 heterotrimer cation to associate with a third benzene molecule at 219 K to form a benzene trimer cation and a neutral naphthalene molecule. The global minimum of the C10H8(+•)(C6H6)2 heterotrimer is found to be the one where the naphthalene cation is sandwiched between two benzene molecules. It is remarkable, and rather unusual, that the binding energy of the second benzene molecule is essentially the same as that of the first. This is attributed to the enhanced charge-transfer interaction in the stacked trimer radical cation.

Molecules for organic electronics studied one by one.

PubMed

Meyer, Jörg; Wadewitz, Anja; Lokamani; Toher, Cormac; Gresser, Roland; Leo, Karl; Riede, Moritz; Moresco, Francesca; Cuniberti, Gianaurelio

2011-08-28

The electronic and geometrical structure of single difluoro-bora-1,3,5,7-tetraphenyl-aza-dipyrromethene (aza-BODIPY) molecules adsorbed on the Au(111) surface is investigated by low temperature scanning tunneling microscopy and spectroscopy in conjunction with ab initio density functional theory simulations of the density of states and of the interaction with the substrate. Our DFT calculations indicate that the aza-bodipy molecule forms a chemical bond with the Au(111) substrate, with distortion of the molecular geometry and significant charge transfer between the molecule and the substrate. Nevertheless, most likely due to the low corrugation of the Au(111) surface, diffusion of the molecule is observed for applied bias in excess of 1 V.

Charge Modulation in Graphitic Carbon Nitride as a Switchable Approach to High-Capacity Hydrogen Storage.

PubMed

Tan, Xin; Kou, Liangzhi; Tahini, Hassan A; Smith, Sean C

2015-11-01

Electrical charging of graphitic carbon nitride nanosheets (g-C4 N3 and g-C3 N4 ) is proposed as a strategy for high-capacity and electrocatalytically switchable hydrogen storage. Using first-principle calculations, we found that the adsorption energy of H2 molecules on graphitic carbon nitride nanosheets is dramatically enhanced by injecting extra electrons into the adsorbent. At full hydrogen coverage, the negatively charged graphitic carbon nitride achieves storage capacities up to 6-7 wt %. In contrast to other hydrogen storage approaches, the storage/release occurs spontaneously once extra electrons are introduced or removed, and these processes can be simply controlled by switching on/off the charging voltage. Therefore, this approach promises both facile reversibility and tunable kinetics without the need of specific catalysts. Importantly, g-C4 N3 has good electrical conductivity and high electron mobility, which can be a very good candidate for electron injection/release. These predictions may prove to be instrumental in searching for a new class of high-capacity hydrogen storage materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.