Science.gov

Sample records for negatively regulates human

  1. TET2 Negatively Regulates Nestin Expression in Human Melanoma.

    PubMed

    Gomes, Camilla B F; Zechin, Karina G; Xu, Shuyun; Stelini, Rafael F; Nishimoto, Ines N; Zhan, Qian; Xu, Ting; Qin, Gungwei; Treister, Nathaniel S; Murphy, George F; Lian, Christine G

    2016-06-01

    Although melanoma is an aggressive cancer, the understanding of the virulence-conferring pathways involved remains incomplete. We have demonstrated that loss of ten-eleven translocation methylcytosine dioxygenase (TET2)-mediated 5-hydroxymethylcytosine (5-hmC) is an epigenetic driver of melanoma growth and a biomarker of clinical virulence. We also have determined that the intermediate filament protein nestin correlates with tumorigenic and invasive melanoma growth. Here we examine the relationships between these two biomarkers. Immunohistochemistry staining of nestin and 5-hmC in 53 clinically annotated primary and metastatic patient melanomas revealed a significant negative correlation. Restoration of 5-hmC, as assessed in a human melanoma cell line by introducing full-length TET2 and TET2-mutated constructs, decreased nestin gene and protein expression in vitro. Genome-wide mapping using hydroxymethylated DNA immunoprecipitation sequencing disclosed significantly less 5-hmC binding in the 3' untranslated region of the nestin gene in melanoma compared to nevi, and 5-hmC binding in this region was significantly increased after TET2 overexpression in human melanoma cells in vitro. Our findings provide evidence suggesting that nestin regulation is negatively controlled epigenetically by TET2 via 5-hmC binding at the 3' untranslated region of the nestin gene, providing one potential pathway for understanding melanoma growth characteristics. Studies are now indicated to further define the interplay between 5-hmC, nestin expression, and melanoma virulence. PMID:27102770

  2. Human Discs Large Is a New Negative Regulator of Human Immunodeficiency Virus-1 Infectivity

    PubMed Central

    Perugi, Fabien; Muriaux, Delphine; Ramirez, Bertha Cecilia; Chabani, Sabah; Decroly, Etienne; Darlix, Jean-Luc; Blot, Vincent

    2009-01-01

    Human immunodeficiency virus (HIV)-1 replication is positively or negatively regulated through multiple interactions with host cell proteins. We report here that human Discs Large (Dlg1), a scaffold protein recruited beneath the plasma membrane and involved in the assembly of multiprotein complexes, restricts HIV-1 infectivity. The endogenous Dlg1 and HIV-1 Gag polyprotein spontaneously interact in HIV-1-chronically infected T cells. Depleting endogenous Dlg1 in either adherent cells or T cells does not affect Gag maturation, production, or release, but it enhances the infectivity of progeny viruses five- to sixfold. Conversely, overexpression of Dlg1 reduces virus infectivity by ∼80%. Higher virus infectivity upon Dlg1 depletion correlates with increased Env content in cells and virions, whereas the amount of virus-associated Gag or genomic RNA remains identical. Dlg1 knockdown is also associated with the redistribution and colocalization of Gag and Env toward CD63 and CD82 positive vesicle-like structures, including structures that seem to still be connected to the plasma membrane. This study identifies both a new negative regulator that targets the very late steps of the HIV-1 life cycle, and an assembly pathway that optimizes HIV-1 infectivity. PMID:18946087

  3. Small-Conductance Ca2+-Activated Potassium Channels Negatively Regulate Aldosterone Secretion in Human Adrenocortical Cells.

    PubMed

    Yang, Tingting; Zhang, Hai-Liang; Liang, Qingnan; Shi, Yingtang; Mei, Yan-Ai; Barrett, Paula Q; Hu, Changlong

    2016-09-01

    Aldosterone, which plays a key role in maintaining water and electrolyte balance, is produced by zona glomerulosa cells of the adrenal cortex. Autonomous overproduction of aldosterone from zona glomerulosa cells causes primary hyperaldosteronism. Recent clinical studies have highlighted the pathological role of the KCNJ5 potassium channel in primary hyperaldosteronism. Our objective was to determine whether small-conductance Ca(2+)-activated potassium (SK) channels may also regulate aldosterone secretion in human adrenocortical cells. We found that apamin, the prototypic inhibitor of SK channels, decreased membrane voltage, raised intracellular Ca(2+) and dose dependently increased aldosterone secretion from human adrenocortical H295R cells. By contrast, 1-Ethyl-2-benzimidazolinone, an agonist of SK channels, antagonized apamin's action and decreased aldosterone secretion. Commensurate with an increase in aldosterone production, apamin increased mRNA expression of steroidogenic acute regulatory protein and aldosterone synthase that control the early and late rate-limiting steps in aldosterone biosynthesis, respectively. In addition, apamin increased angiotensin II-stimulated aldosterone secretion, whereas 1-Ethyl-2-benzimidazolinone suppressed both angiotensin II- and high K(+)-stimulated production of aldosterone in H295R cells. These findings were supported by apamin-modulation of basal and angiotensin II-stimulated aldosterone secretion from acutely prepared slices of human adrenals. We conclude that SK channel activity negatively regulates aldosterone secretion in human adrenocortical cells. Genetic association studies are necessary to determine whether mutations in SK channel subtype 2 genes may also drive aldosterone excess in primary hyperaldosteronism. PMID:27432863

  4. Positive and negative regulation of the human heme oxygenase-1 gene expression in cultured cells.

    PubMed

    Takahashi, S; Takahashi, Y; Ito, K; Nagano, T; Shibahara, S; Miura, T

    1999-10-28

    To elucidate the regulation of the human heme oxygenase-1 (hHO-1) gene expression, we assessed approximately 4 kb of the 5'-flanking region of the hHO-1 gene for basal promoter activity and sequenced approximately 2 kb of the 5'-flanking region. A series of deletion mutants of the 5'-flanking region linked to the luciferase gene was constructed. Basal level expression of these constructs was tested in HepG2 human hepatoma cells and HeLa cervical cancer cells. By measuring luciferase activity, which was transiently expressed in the transfected cells, we found a positive regulatory region at position -1976 to -1655 bp. This region functions in HepG2 cells but not in HeLa cells. A negative regulatory region was also found at position -981 to -412 bp that functions in both HepG2 cells and HeLa cells. PMID:10542320

  5. Cardiovascular regulation in humans in response to oscillatory lower body negative pressure

    NASA Technical Reports Server (NTRS)

    Levenhagen, D. K.; Evans, J. M.; Wang, M.; Knapp, C. F.

    1994-01-01

    The frequency response characteristics of human cardiovascular regulation during hypotensive stress have not been determined. We therefore exposed 10 male volunteers to seven frequencies (0.004-0.1 Hz) of oscillatory lower body negative pressure (OLBNP; 0-50 mmHg). Fourier spectra of arterial pressure (AP), central venous pressure (CVP), stroke volume (SV), cardiac output (CO), heart rate (HR), and total peripheral resistance (TPR) were determined and first harmonic mean, amplitude, and phase angles with respect to OLBNP are presented. AP was relatively well regulated as demonstrated by small oscillations in half amplitude (3.5 mmHg) that were independent of OLBNP frequency and similar to unstressed control spectra. Due to the biomechanics of the system, the magnitudes of oscillations in calf circumference (CC) and CVP decreased with increasing frequency; therefore, we normalized responses by these indexes of the fluid volume shifted. The ratios of oscillations in AP to oscillations in CC increased by an order of magnitude, whereas oscillations in CVP to oscillations in CC and oscillations in AP to oscillations in CVP both tripled between 0.004 and 0.1 Hz. Therefore, even though the amount of fluid shifted by OLBNP decreased with increasing frequency, the magnitude of both CVP and AP oscillations per volume of fluid shifted increased (peaking at 0.08 Hz). The phase relationships between variables, particularly the increasing lags in SV and TPR, but not CVP, indicated that efferent responses with lags of 5-6 s could account for the observed responses. We conclude that, at frequencies below 0.02 Hz, the neural system of humans functioned optimally in regulating AP; OLBNP-induced decreases in SV (by as much as 50%) were counteracted by appropriate oscillations in HR and TPR responses. As OLBNP frequency increased, SV, TPR, and HR oscillations increasingly lagged the input and became less optimally timed for AP regulation.

  6. TNF-related apoptosis-inducing ligand (TRAIL) as a negative regulator of normal human erythropoiesis.

    PubMed

    Zamai, L; Secchiero, P; Pierpaoli, S; Bassini, A; Papa, S; Alnemri, E S; Guidotti, L; Vitale, M; Zauli, G

    2000-06-15

    The impact of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) on normal hematopoietic development was investigated using adult peripheral blood CD34(+) hematopoietic progenitor cells, induced to differentiate along the erythroid, megakaryocytic, granulocytic, and monocytic lineages by the addition of specific cytokine cocktails. TRAIL selectively reduced the number of erythroblasts, showing intermediate levels of glycophorin A (glycophorin A(interm)) surface expression, which appeared in liquid cultures supplemented with stem cell factor + interleukin 3 + erythropoietin at days 7-10. However, neither immature (day 4) glycophorin A(dim) erythroid cells nor mature (day 14) glycophorin A(bright) erythroblasts were sensitive to TRAIL-mediated apoptosis. Moreover, pre-exposure to TRAIL significantly decreased the number and size of erythroid colonies in semisolid assays. These adverse effects of TRAIL were selective for erythropoiesis, as TRAIL did not significantly influence the survival of cells differentiating along the megakaryocytic, granulocytic, or monocytic lineages. Furthermore, TRAIL was detected by Western blot analysis in lysates obtained from normal bone marrow mononuclear cells. These findings indicate that TRAIL acts in a lineage- and stage of differentiation-specific manner, as a negative regulator of normal erythropoiesis. (Blood. 2000;95:3716-3724) PMID:10845902

  7. LKB1 tumor suppressor and salt-inducible kinases negatively regulate human T-cell leukemia virus type 1 transcription

    PubMed Central

    2013-01-01

    Background Human T-cell leukemia virus type 1 (HTLV-1) causes adult T-cell leukemia (ATL). Treatment options are limited and prophylactic agents are not available. We have previously demonstrated an essential role for CREB-regulating transcriptional coactivators (CRTCs) in HTLV-1 transcription. Results In this study we report on the negative regulatory role of LKB1 tumor suppressor and salt-inducible kinases (SIKs) in the activation of HTLV-1 long terminal repeats (LTR) by the oncoprotein Tax. Activation of LKB1 and SIKs effectively blunted Tax activity in a phosphorylation-dependent manner, whereas compromising these kinases, but not AMP-dependent protein kinases, augmented Tax function. Activated LKB1 and SIKs associated with Tax and suppressed Tax-induced LTR activation by counteracting CRTCs and CREB. Enforced expression of LKB1 or SIK1 in cells transfected with HTLV-1 molecular clone pX1MT repressed proviral transcription. On the contrary, depletion of LKB1 in pX1MT-transfected cells and in HTLV-1-transformed T cells boosted the expression of Tax. Treatment of HTLV-1 transformed cells with metformin led to LKB1/SIK1 activation, reduction in Tax expression, and inhibition of cell proliferation. Conclusions Our findings revealed a new function of LKB1 and SIKs as negative regulators of HTLV-1 transcription. Pharmaceutical activation of LKB1 and SIKs might be considered as a new strategy in anti-HTLV-1 and anti-ATL therapy. PMID:23577667

  8. Let-7f microRNA negatively regulates hepatic differentiation of human adipose tissue-derived stem cells.

    PubMed

    Davoodian, Nahid; Lotfi, Abbas S; Soleimani, Masoud; Mola, Seyed Javad; Arjmand, Sare

    2014-09-01

    MicroRNAs (miRNAs) are noncoding RNAs involved in the regulation of the diverse biological processes such as metabolism, proliferation, and cell cycle, in addition to regulation of differentiation. So far, some miRNAs have been recognized to have important role in regulating hepatic functions. Statistically, let-7f has been revealed as a negative regulator of hepatic differentiation. In the present study, we investigated the effect of let-7f on hepatic differentiation of human adipose tissue-derived stem cells (hADSCs). hADSCs were transduced with recombinant lentivirus containing human inhibitor let-7 f. The expression of hepatocyte nuclear factors alpha (HNF4a), albumin (ALB), alpha fetoprotein (AFP), cytokeratin 18 (CK18), and cytokeratin 19 (CK19) was evaluated using quantitative real-time PCR (qRT-PCR). Immunocytochemistry was used to investigate the expression levels of the hepatocyte markers including ALB, AFP, and HNF4a, and biochemical analysis was implemented for hepatic function, glycogen deposition, and urea secretion. qRT-PCR showed significant upregulation in HNF4a, ALB, AFP, CK18, and CK19 expression in cells transduced with let-7f inhibitor lentiviruses. Moreover, positive staining was detected for ALB, AFP, and HNF4a using immunocytochemistry. Urea production and glycogen deposits were also found in the treated cells, the two specific features of the hepatic cells. Therefore, let-7f silencing led to the increased expression of the hepatocyte-specific factors and the accelerated hADSCs hepatic differentiation. Summing all these finding together, our present report has provided evidences that inhibition of let-7f would facilitate induction of hADSCs into hepatocyte-like cells and possibly in regenerative therapy of the liver disease in a wider spectrum. PMID:25077652

  9. Continuous time Bayesian networks identify Prdm1 as a negative regulator of TH17 cell differentiation in humans

    PubMed Central

    Acerbi, Enzo; Viganò, Elena; Poidinger, Michael; Mortellaro, Alessandra; Zelante, Teresa; Stella, Fabio

    2016-01-01

    T helper 17 (TH17) cells represent a pivotal adaptive cell subset involved in multiple immune disorders in mammalian species. Deciphering the molecular interactions regulating TH17 cell differentiation is particularly critical for novel drug target discovery designed to control maladaptive inflammatory conditions. Using continuous time Bayesian networks over a time-course gene expression dataset, we inferred the global regulatory network controlling TH17 differentiation. From the network, we identified the Prdm1 gene encoding the B lymphocyte-induced maturation protein 1 as a crucial negative regulator of human TH17 cell differentiation. The results have been validated by perturbing Prdm1 expression on freshly isolated CD4+ naïve T cells: reduction of Prdm1 expression leads to augmentation of IL-17 release. These data unravel a possible novel target to control TH17 polarization in inflammatory disorders. Furthermore, this study represents the first in vitro validation of continuous time Bayesian networks as gene network reconstruction method and as hypothesis generation tool for wet-lab biological experiments. PMID:26976045

  10. Bacterial LPS up-regulated TLR3 expression is critical for antiviral response in human monocytes: evidence for negative regulation by CYLD

    PubMed Central

    Fisher, Chris; Li, Jian-Dong; Jiang, Yong; Huang, Shuang; Chen, Ling-Yu

    2011-01-01

    In the host immune system, the leukocytes are often exposed to multiple pathogens including bacteria and viruses. The principal challenge for the host is to efficiently detect the invading pathogen and mount a rapid defensive response. Leukocytes recognize invading pathogens by directly interacting with pathogen-associated molecular patterns via Toll-like receptors (TLRs) expressed on the leukocyte surfaces. In this study, we provide direct evidence that bacterial LPS enhances the host antiviral response by up-regulating TLR3 expression in human peripheral blood monocytes and monocytic cell lines, THP1 cells. Moreover, LPS induces TLR3 expression via a TLR4-MyD88-IRAK-TRAF6-NF-κB-dependent signaling pathway. Interestingly, CYLD, an important deubiquitinase, acts as a negative regulator of TLR3 induction by LPS. Our study thus provides new insights into a novel role for bacterial infection in enhancing host antiviral response; furthermore, it identifies CYLD for the first time as a critical negative regulator of bacterial LPS-induced response. PMID:21498625

  11. A novel human aquaporin-4 splice variant exhibits a dominant-negative activity: a new mechanism to regulate water permeability

    PubMed Central

    De Bellis, Manuela; Pisani, Francesco; Mola, Maria Grazia; Basco, Davide; Catalano, Francesco; Nicchia, Grazia Paola; Svelto, Maria; Frigeri, Antonio

    2014-01-01

    Two major isoforms of aquaporin-4 (AQP4) have been described in human tissue. Here we report the identification and functional analysis of an alternatively spliced transcript of human AQP4, AQP4-Δ4, that lacks exon 4. In transfected cells AQP4-Δ4 is mainly retained in the endoplasmic reticulum and shows no water transport properties. When AQP4-Δ4 is transfected into cells stably expressing functional AQP4, the surface expression of the full-length protein is reduced. Furthermore, the water transport activity of the cotransfectants is diminished in comparison to transfectants expressing only AQP4. The observed down-regulation of both the expression and water channel activity of AQP4 is likely to originate from a dominant-negative effect caused by heterodimerization between AQP4 and AQP4-Δ4, which was detected in coimmunoprecipitation studies. In skeletal muscles, AQP4-Δ4 mRNA expression inversely correlates with the level of AQP4 protein and is physiologically associated with different types of skeletal muscles. The expression of AQP4-Δ4 may represent a new regulatory mechanism through which the cell-surface expression and therefore the activity of AQP4 can be physiologically modulated. PMID:24356448

  12. Negative growth regulation in a glioblastoma tumor cell line that conditionally expresses human wild-type p53

    SciTech Connect

    Mercer, W.E.; Shields, M.T.; Amin, M.; Sauve, G.J. ); Appella, E.; Romano, J.W.; Ullrich, S.J. )

    1990-08-01

    To investigate the effect that human wild-type p53 (wt-p53) expression has on cell proliferation the authors constructed a recombinant plasmid, pM47, in which wt-p53 cDNA is under transcriptional control of the hormone-inducible mouse mammary tumor virus promoter linked to the dominant biochemical selection marker gene Eco gpt. The pM47 plasmid was introduced into T98G cells derived from a human glioblastomas multiforme tumor, and a stable clonal cell line, GM47.23, was derived that conditionally expressed wt-p53 following exposure to dexamethasone. The authors show that induction of wt-p53 expression in exponentially growing cells inhibits cell cycle progression and that the inhibitory effect is reversible upon removal of the inducer or infection with simian virus 40. Moreover, when growth-arrested cells are stimulated to proliferate, induction of wt-p53 expression inhibits G{sub 0}/G{sub 1} progression into S phase and the cells accumulate with a DNA content equivalent to cells arrested in the G{sub 0}/G{sub 1} phase of the cell cycle. Taken together, these studies suggest that wt-p53 may play a negative role in growth regulation.

  13. CRNDE affects the malignant biological characteristics of human glioma stem cells by negatively regulating miR-186

    PubMed Central

    Zheng, Jian; Li, Xiao-dong; Wang, Ping; Liu, Xiao-bai; Xue, Yi-xue; Hu, Yi; Li, Zhen; Li, Zhi-qing; Wang, Zhen-hua; Liu, Yun-hui

    2015-01-01

    The long non-coding RNA Colorectal neoplasia differentially expressed (CRNDE) is a novel gene that activated early in colorectal neoplasia, but it is also up-regulated in many other solid tumors. Herein, the function and underlying mechanism of CRNDE in regulating glioma stem cells (GSCs) were investigated. We found that CRNDE expression was up-regulated while miR-186 expression was down-regulated in GSCs. Overexpression of CRNDE could promote the cellular proliferation, migration, invasion and inhibit the apoptosis in GSCs. Overexpression of miR-186 exerted functions of inhibiting the proliferation, migration and invasion of GSCs and promoting apoptosis. And CRNDE decreased the expression levels of XIAP and PAK7 by binding to miR-186 and negatively regulating it. In addition, miR-186 binded to XIAP and PAK7 3′UTR region, and decrease the expression of them, thus regulating the expression levels of downstream target proteins such as caspase 3, BAD, cyclin D1 and MARK2. The in vivo effect of CRNDE and miR-186 showed that the tumor formation rate was minimum in tumor-bearing nude mice with the knockdown of CRNDE and the overexpression of miR-186. In conclusion, CRNDE played an oncogenic role of GSCs through the negative regulation of miR-186. Both CRNDE and miR-186 could be regarded as potential targets in the glioma therapy. PMID:26231038

  14. Negative regulators of cell proliferation

    NASA Technical Reports Server (NTRS)

    Johnson, T. C.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Cell proliferation is governed by the influence of both mitogens and inhibitors. Although cell contact has long been thought to play a fundamental role in cell cycling regulation, and negative regulators have long been suspected to exist, their isolation and purification has been complicated by a variety of technical difficulties. Nevertheless, over recent years an ever-expanding list of putative negative regulators have emerged. In many cases, their biological inhibitory activities are consistent with density-dependent growth inhibition. Most likely their interactions with mitogenic agents, at an intracellular level, are responsible for either mitotic arrest or continued cell cycling. A review of naturally occurring cell growth inhibitors is presented with an emphasis on those factors shown to be residents of the cell surface membrane. Particular attention is focused on a cell surface sialoglycopeptide, isolated from intact bovine cerebral cortex cells, which has been shown to inhibit the proliferation of an unusually wide range of target cells. The glycopeptide arrest cells obtained from diverse species, both fibroblasts and epithelial cells, and a broad variety of transformed cells. Signal transduction events and a limited spectrum of cells that are refractory to the sialoglycopeptide have provided insight into the molecular events mediated by this cell surface inhibitor.

  15. Myostatin acts as an autocrine/paracrine negative regulator in myoblast differentiation from human induced pluripotent stem cells

    SciTech Connect

    Gao, Fei; Kishida, Tsunao; Ejima, Akika; Gojo, Satoshi; Mazda, Osam

    2013-02-08

    Highlights: ► iPS-derived cells express myostatin and its receptor upon myoblast differentiation. ► Myostatin inhibits myoblast differentiation by inhibiting MyoD and Myo5a induction. ► Silencing of myostatin promotes differentiation of human iPS cells into myoblasts. -- Abstract: Myostatin, also known as growth differentiation factor (GDF-8), regulates proliferation of muscle satellite cells, and suppresses differentiation of myoblasts into myotubes via down-regulation of key myogenic differentiation factors including MyoD. Recent advances in stem cell biology have enabled generation of myoblasts from pluripotent stem cells, but it remains to be clarified whether myostatin is also involved in regulation of artificial differentiation of myoblasts from pluripotent stem cells. Here we show that the human induced pluripotent stem (iPS) cell-derived cells that were induced to differentiate into myoblasts expressed myostatin and its receptor during the differentiation. An addition of recombinant human myostatin (rhMyostatin) suppressed induction of MyoD and Myo5a, resulting in significant suppression of myoblast differentiation. The rhMyostatin treatment also inhibited proliferation of the cells at a later phase of differentiation. RNAi-mediated silencing of myostatin promoted differentiation of human iPS-derived embryoid body (EB) cells into myoblasts. These results strongly suggest that myostatin plays an important role in regulation of myoblast differentiation from iPS cells of human origin. The present findings also have significant implications for potential regenerative medicine for muscular diseases.

  16. Leukocyte-associated immunoglobulin-like receptor-1 is expressed on human megakaryocytes and negatively regulates the maturation of primary megakaryocytic progenitors and cell line

    SciTech Connect

    Xue, Jiangnan; Zhang, Xiaoshu; Zhao, Haiya; Fu, Qiang; Cao, Yanning; Wang, Yuesi; Feng, Xiaoying; Fu, Aili

    2011-02-04

    Research highlights: {yields} LAIR-1 is expressed on human megakaryocytes from an early stage. {yields} Up-regulation of LAIR-1 negatively regulates megakaryocytic differentiation of cell line. {yields} LAIR-1 negatively regulates the differentiation of primary megakaryocytic progenitors. -- Abstract: Leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) is an inhibitory collagen receptor which belongs to the immunoglobulin (Ig) superfamily. Although the inhibitory function of LAIR-1 has been extensively described in multiple leukocytes, its role in megakaryocyte (MK) has not been explored so far. Here, we show that LAIR-1 is expressed on human bone marrow CD34{sup +}CD41a{sup +} and CD41a{sup +}CD42b{sup +} cells. LAIR-1 is also detectable in a fraction of human cord blood CD34{sup +} cell-derived MK that has morphological characteristics of immature MK. In megakaryoblastic cell line Dami, the membrane protein expression of LAIR-1 is up-regulated significantly when cells are treated with phorbol ester phorbol 12-myristate 13-acetate (PMA). Furthermore, cross-linking of LAIR-1 in Dami cells with its natural ligand or anti-LAIR-1 antibody leads to the inhibition of cell proliferation and PMA-promoted differentiation when examined by the MK lineage-specific markers (CD41a and CD42b) and polyploidization. In addition, we also observed that cross-linking of LAIR-1 results in decreased MK generation from primary human CD34{sup +} cells cultured in a cytokines cocktail that contains TPO. These results suggest that LAIR-1 is a likely candidate for an early marker of MK differentiation, and provide initial evidence indicating that LAIR-1 serves as a negative regulator of megakaryocytopoiesis.

  17. GPER negatively regulates TNFα-induced IL-6 production in human breast cancer cells via NF-κB pathway.

    PubMed

    Okamoto, Mariko; Mizukami, Yoichi

    2016-05-31

    Estrogen is known to have anti-inflammatory effects, that are thought to be mediated by the classical estrogen receptors (ERs), ERα and ERβ. G protein coupled estrogen receptor1 (GPER) is a novel membrane-type estrogen receptor that can mediate non-genomic estrogenic responses. Although there have been several reports asserting that the participation of GPER in anti-inflammatory effects is induced by estrogen, the role of GPER remains poorly understood. In this study, we investigated the involvement of GPER in the regulation of a representative inflammatory cytokine, IL-6. We first examined the expression of IL-6 mRNA by TNFα stimulation in the transfection of GPER-expression plasmid into HeLa cells. Exogenous GPER significantly inhibited TNFα-induced IL-6 expression, and blocked NF-κB promoter activity inducing the expression of IL-6 in a dose-dependent manner. The promoter activity was restored almost to control level by transfection with the C-terminal deletion mutant of GPER. Similar results have been observed in endogenous GPER using SKBR3 cells which do not express the classical ERs. The data have been validated by treatment of GPER with siRNA. These findings indicate that GPER negatively regulates TNFα-induced IL-6 expression, probably through inhibition of NF-κB promoter activity by a signal(s) derived from the C-terminal region of GPER. PMID:26888479

  18. Basal and stress-inducible expression of HSPA6 in human keratinocytes is regulated by negative and positive promoter regions.

    PubMed

    Ramirez, Vincent P; Stamatis, Michael; Shmukler, Anastasia; Aneskievich, Brian J

    2015-01-01

    Epidermal keratinocytes serve as the primary barrier between the body and environmental stressors. They are subjected to numerous stress events and are likely to respond with a repertoire of heat shock proteins (HSPs). HSPA6 (HSP70B') is described in other cell types with characteristically low to undetectable basal expression, but is highly stress induced. Despite this response in other cells, little is known about its control in keratinocytes. We examined endogenous human keratinocyte HSPA6 expression and localized some responsible transcription factor sites in a cloned HSPA6 3 kb promoter. Using promoter 5' truncations and deletions, negative and positive regulatory regions were found throughout the 3 kb promoter. A region between -346 and -217 bp was found to be crucial to HSPA6 basal expression and stress inducibility. Site-specific mutations and DNA-binding studies show that a previously uncharacterized AP1 site contributes to the basal expression and maximal stress induction of HSPA6. Additionally, a new heat shock element (HSE) within this region was defined. While this element mediates increased transcriptional response in thermally stressed HaCaT keratinocytes, it preferentially binds a stress-inducible factor other than heat shock factor (HSF)1 or HSF2. Intriguingly, this newly characterized HSPA6 HSE competes HSF1 binding a consensus HSE and binds both HSF1 and HSF2 from other epithelial cells. Taken together, our results demonstrate that the HSPA6 promoter contains essential negative and positive promoter regions and newly identified transcription factor targets, which are key to the basal and stress-inducible expression of HSPA6. Furthermore, these results suggest that an HSF-like factor may preferentially bind this newly identified HSPA6 HSE in HaCaT cells. PMID:25073946

  19. G-CSF regulates macrophage phenotype and associates with poor overall survival in human triple-negative breast cancer

    PubMed Central

    Hollmén, Maija; Karaman, Sinem; Schwager, Simon; Lisibach, Angela; Christiansen, Ailsa J.; Maksimow, Mikael; Varga, Zsuzsanna; Jalkanen, Sirpa; Detmar, Michael

    2016-01-01

    ABSTRACT Tumor-associated macrophages (TAMs) have been implicated in the promotion of breast cancer growth and metastasis, and a strong infiltration by TAMs has been associated with estrogen receptor (ER)-negative tumors and poor prognosis. However, the molecular mechanisms behind these observations are unclear. We investigated macrophage activation in response to co-culture with several breast cancer cell lines (T47D, MCF-7, BT-474, SKBR-3, Cal-51 and MDA-MB-231) and found that high granulocyte colony-stimulating factor (G-CSF) secretion by the triple-negative breast cancer (TNBC) cell line MDA-MB-231 gave rise to immunosuppressive HLA-DRlo macrophages that promoted migration of breast cancer cells via secretion of TGF-α. In human breast cancer samples (n = 548), G-CSF was highly expressed in TNBC (p < 0.001) and associated with CD163+ macrophages (p < 0.0001), poorer overall survival (OS) (p = 0.021) and significantly increased numbers of TGF-α+ cells. While G-CSF blockade in the 4T1 mammary tumor model promoted maturation of MHCIIhi blood monocytes and TAMs and significantly reduced lung metastasis, anti-CSF-1R treatment promoted MHCIIloF4/80hiMRhi anti-inflammatory TAMs and enhanced lung metastasis in the presence of high G-CSF levels. Combined anti-G-CSF and anti-CSF-1R therapy significantly increased lymph node metastases, possibly via depletion of the so-called “gate-keeper” subcapsular sinus macrophages. These results indicate that G-CSF promotes the anti-inflammatory phenotype of tumor-induced macrophages when CSF-1R is inhibited and therefore caution against the use of M-CSF/CSF-1R targeting agents in tumors with high G-CSF expression. PMID:27141367

  20. Regulator of G Protein Signaling 17 as a Negative Modulator of GPCR Signaling in Multiple Human Cancers.

    PubMed

    Hayes, Michael P; Roman, David L

    2016-05-01

    Regulators of G protein signaling (RGS) proteins modulate G protein-coupled receptor (GPCR) signaling networks by terminating signals produced by active Gα subunits. RGS17, a member of the RZ subfamily of RGS proteins, is typically only expressed in appreciable amounts in the human central nervous system, but previous works have shown that RGS17 expression is selectively upregulated in a number of malignancies, including lung, breast, prostate, and hepatocellular carcinoma. In addition, this upregulation of RGS17 is associated with a more aggressive cancer phenotype, as increased proliferation, migration, and invasion are observed. Conversely, decreased RGS17 expression diminishes the response of ovarian cancer cells to agents commonly used during chemotherapy. These somewhat contradictory roles of RGS17 in cancer highlight the need for selective, high-affinity inhibitors of RGS17 to use as chemical probes to further the understanding of RGS17 biology. Based on current evidence, these compounds could potentially have clinical utility as novel chemotherapeutics in the treatment of lung, prostate, breast, and liver cancers. Recent advances in screening technologies to identify potential inhibitors coupled with increasing knowledge of the structural requirements of RGS-Gα protein-protein interaction inhibitors make the future of drug discovery efforts targeting RGS17 promising. This review highlights recent findings related to RGS17 as both a canonical and atypical RGS protein, its role in various human disease states, and offers insights on small molecule inhibition of RGS17. PMID:26928451

  1. A human microsatellite DNA-mimicking oligodeoxynucleotide with CCT repeats negatively regulates TLR7/9-mediated innate immune responses via selected TLR pathways.

    PubMed

    Sun, Ran; Sun, Luguo; Bao, Musheng; Zhang, Yongsheng; Wang, Li; Wu, Xiuli; Hu, Dali; Liu, Yongjun; Yu, Yongli; Wang, Liying

    2010-03-01

    A human microsatellite DNA-mimicking ODN (MS ODN) composed of CCT repeats, designated as SAT05f, has been studied for its capacity of negatively regulating innate immunity induced by TLR7/TLR9 agonists in vitro and in mice. The result showed that SAT05f could down-regulate TLR7/9-dependent IFN-alpha production in cultured human PBMC stimulated by inactivated Flu virus PR8 or HSV-1 or CpG ODN or imiquimod, protect d-GalN-treated mice from lethal shock induced by TLR9 agonist, not by TLR3/4 agonist. In addition, SAT05f significantly inhibit IFN-alpha production from purified human plasmacytoid cells (pDCs) stimulated by CpG ODN. Interestingly, SAT05f could up-regulate CD80, CD86, and HLA-DR on the pDCs in vitro, implying that SAT05f-mediated inhibition on IFN-alpha production could be related to the activation of pDCs. The data suggest that SAT05f could be developed as a candidate medicament for the treatment of TLR7/9 activation-associated diseases by inhibiting TLR7/9 signaling pathways. PMID:20034855

  2. Host response during Yersinia pestis infection of human bronchial epithelial cells involves negative regulation of autophagy and suggests a modulation of survival-related and cellular growth pathways

    PubMed Central

    Alem, Farhang; Yao, Kuan; Lane, Douglas; Calvert, Valerie; Petricoin, Emanuel F.; Kramer, Liana; Hale, Martha L.; Bavari, Sina; Panchal, Rekha G.; Hakami, Ramin M.

    2015-01-01

    Yersinia pestis (Yp) causes the re-emerging disease plague, and is classified by the CDC and NIAID as a highest priority (Category A) pathogen. Currently, there is no approved human vaccine available and advances in early diagnostics and effective therapeutics are urgently needed. A deep understanding of the mechanisms of host response to Yp infection can significantly advance these three areas. We employed the Reverse Phase Protein Microarray (RPMA) technology to reveal the dynamic states of either protein level changes or phosphorylation changes associated with kinase-driven signaling pathways during host cell response to Yp infection. RPMA allowed quantitative profiling of changes in the intracellular communication network of human lung epithelial cells at different times post infection and in response to different treatment conditions, which included infection with the virulent Yp strain CO92, infection with a derivative avirulent strain CO92 (Pgm-, Pst-), treatment with heat inactivated CO92, and treatment with LPS. Responses to a total of 111 validated antibodies were profiled, leading to discovery of 12 novel protein hits. The RPMA analysis also identified several protein hits previously reported in the context of Yp infection. Furthermore, the results validated several proteins previously reported in the context of infection with other Yersinia species or implicated for potential relevance through recombinant protein and cell transfection studies. The RPMA results point to strong modulation of survival/apoptosis and cell growth pathways during early host response and also suggest a model of negative regulation of the autophagy pathway. We find significant cytoplasmic localization of p53 and reduced LC3-I to LC3-II conversion in response to Yp infection, consistent with negative regulation of autophagy. These studies allow for a deeper understanding of the pathogenesis mechanisms and the discovery of innovative approaches for prevention, early diagnosis, and

  3. Rho GTPase/Rho Kinase Negatively Regulates Endothelial Nitric Oxide Synthase Phosphorylation through the Inhibition of Protein Kinase B/Akt in Human Endothelial Cells

    PubMed Central

    Ming, Xiu-Fen; Viswambharan, Hema; Barandier, Christine; Ruffieux, Jean; Kaibuchi, Kozo; Rusconi, Sandro; Yang, Zhihong

    2002-01-01

    Endothelial nitric oxide synthase (eNOS) is an important regulator of cardiovascular homeostasis by production of nitric oxide (NO) from vascular endothelial cells. It can be activated by protein kinase B (PKB)/Akt via phosphorylation at Ser-1177. We are interested in the role of Rho GTPase/Rho kinase (ROCK) pathway in regulation of eNOS expression and activation. Using adenovirus-mediated gene transfer in human umbilical vein endothelial cells (HUVECs), we show here that both active RhoA and ROCK not only downregulate eNOS gene expression as reported previously but also inhibit eNOS phosphorylation at Ser-1177 and cellular NO production with concomitant suppression of PKB activation. Moreover, coexpression of a constitutive active form of PKB restores the phosphorylation but not gene expression of eNOS in the presence of active RhoA. Furthermore, we show that thrombin inhibits eNOS phosphorylation, as well as expression via Rho/ROCK pathway. Expression of the active PKB reverses eNOS phosphorylation but has no effect on downregulation of eNOS expression induced by thrombin. Taken together, these data demonstrate that Rho/ROCK pathway negatively regulates eNOS phosphorylation through inhibition of PKB, whereas it downregulates eNOS expression independent of PKB. PMID:12446767

  4. Schistosoma mansoni Soluble Egg Antigens Induce Expression of the Negative Regulators SOCS1 and SHP1 in Human Dendritic Cells via Interaction with the Mannose Receptor

    PubMed Central

    Klaver, Elsenoor J.; Kuijk, Loes M.; Lindhorst, Thisbe K.; Cummings, Richard D.; van Die, Irma

    2015-01-01

    Schistosomiasis is a common debilitating human parasitic disease in (sub)tropical areas, however, schistosome infections can also protect against a variety of inflammatory diseases. This has raised broad interest in the mechanisms by which Schistosoma modulate the immune system into an anti-inflammatory and regulatory state. Human dendritic cells (DCs) show many phenotypic changes upon contact with Schistosoma mansoni soluble egg antigens (SEA). We here show that oxidation of SEA glycans, but not heat-denaturation, abrogates the capacity of SEA to suppress both LPS-induced cytokine secretion and DC proliferation, indicating an important role of SEA glycans in these processes. Remarkably, interaction of SEA glycans with DCs results in a strongly increased expression of Suppressor Of Cytokine Signalling1 (SOCS1) and SH2-containing protein tyrosine Phosphatase-1 (SHP1), important negative regulators of TLR4 signalling. In addition, SEA induces the secretion of transforming growth factor β (TGF-β), and the surface expression of the costimulatory molecules Programmed Death Ligand-1 (PD-L1) and OX40 ligand (OX40L), which are known phenotypic markers for the capacity of DCs to polarize naïve T cells into Th2/Treg cell subsets. Inhibition of mannose receptor (MR)-mediated internalization of SEA into DCs by blocking with allyl α-D-mannoside or anti-MR antibodies, significantly reduced SOCS1 and SHP1 expression. In conclusion, we demonstrate that SEA glycans are essential for induction of enhanced SOCS1 and SHP1 levels in DCs via the MR. Our data provide novel mechanistic evidence for the potential of S. mansoni SEA glycans to modulate human DCs, which may contribute to the capacity of SEA to down-regulate inflammatory responses. PMID:25897665

  5. Angiotensin II regulates phosphoinositide 3 kinase/Akt cascade via a negative crosstalk between AT1 and AT2 receptors in skin fibroblasts of human hypertrophic scars.

    PubMed

    Liu, Hong-Wei; Cheng, Biao; Yu, Wen-Lin; Sun, Rui-Xia; Zeng, Dong; Wang, Jie; Liao, Yuan-Xing; Fu, Xiao-Bing

    2006-06-27

    Angiotensin II (Ang II) stimulation has been shown to regulate proliferation of skin fibroblasts and production of extracellular matrix, which are very important process in skin wound healing and scarring; however, the signaling pathways involved in this process, especially in humans, are less explored. In the present study, we used skin fibroblasts of human hypertrophic scar, which expressed both AT1 and AT2 receptors, and observed that Ang II increased Akt phosphorylation and phosphoinositide 3 kinase (PI 3-K) activity. In addition, the Ang II-induced Akt phosphorylation was blocked by wortmannin, a PI 3-K inhibitor. This Ang II-activated PI 3-K/Akt cascade was markedly inhibited by valsartan, an AT(1) receptor-specific blocker, whereas it was enhanced by PD123319, an AT(2) receptor antagonist. On the other hand, the Ang II- or EGF-induced activation of PI 3-K/Akt was strongly attenuated by AG1478, an inhibitor of epidermal growth factor (EGF) receptor kinase. Moreover, Ang II stimulated tyrosine phosphorylation of EGF receptor and p85alpha subunit of PI 3-K accompanied by an increase in their association, which was inhibited by valsartan, and enhanced by PD123319. The Ang II-induced transactivation of EGF receptor resulted in activation of extracellular signal-regulated kinase (ERK) that was also inhibited by valsartan, and enhanced by PD123319. Taken together, our results showed that AT(1) receptor-mediated activation of PI 3-K/Akt cascades occurs at least partially via the transactivation of EGF receptor, which is under a negative control by AT(2) receptor in hypertrophic scar fibroblasts. These findings contribute to understanding the molecular mechanism of human hypertrophic scar formation. PMID:16522324

  6. The Bel1 protein of human foamy virus contains one positive and two negative control regions which regulate a distinct activation domain of 30 amino acids.

    PubMed Central

    Lee, C W; Chang, J; Lee, K J; Sung, Y C

    1994-01-01

    The Bel1 transactivator is essential for the replication of human foamy virus (HFV). To define the functional domains of HFV Bel1, we generated random missense mutations throughout the entire coding sequence of Bel1. Functional analyses of 24 missense mutations have revealed the presence of at least two functional domains in Bel1. One domain corresponds to a basic amino acid-rich motif which acts as a bipartite nuclear targeting sequence. A second, central domain corresponds to a presumed effector region which, when mutated, leads to dominant-negative mutants and/or lacks transactivating ability. In addition, deletion analyses and domain-swapping experiments further showed that Bel1 protein contains a strong carboxy-terminal activation domain. The activating region is also capable of functioning as a transcription-activating domain in yeast cells, although it does not bear any significant sequence homology to the well-characterized acidic activation domain which is known to function only in yeast and mammalian cells. We also demonstrated that the regions of Bel1 from residues 1 to 76 and from residues 153 to 225 repressed transcriptional activation exerted by the Bel1 activation domain. In contrast, the region from residues 82 to 150 appears to overcome an inhibitory effect. These results indicate that Bel1 contains one positive and two negative regulatory domains that modulate a distinct activation domain of Bel1. These regulatory domains of Bel1 cannot affect the function of the VP16 activation domain, suggesting that these domains specifically regulate the activation domain of Bel1. Furthermore, in vivo competition experiments showed that the positive regulatory domain acts in trans. Thus, our results demonstrate that Bel1-mediated transactivation appears to undergo a complex regulatory pathway which provides a novel mode of regulation for a transcriptional activation domain. Images PMID:8139046

  7. Negative regulation of human immunodeficiency virus type 1 expression in monocytes: role of the 65-kDa plus 50-kDa NF-kappa B dimer.

    PubMed

    Raziuddin; Mikovits, J A; Calvert, I; Ghosh, S; Kung, H F; Ruscetti, F W

    1991-11-01

    Although monocytic cells can provide a reservoir for viral production in vivo, their regulation of human immunodeficiency virus type 1 (HIV-1) transcription can be either latent, restricted, or productive. These differences in gene expression have not been molecularly defined. In THP-1 cells with restricted HIV expression, there is an absence of DNA-protein binding complex formation with the HIV-1 promoter-enhancer associated with markedly less viral RNA production. This absence of binding was localized to the NF-kappa B region of the HIV-1 enhancer; the 65-kDa plus 50-kDa NF-kappa B heterodimer was preferentially lost. Adding purified NF-kappa B protein to nuclear extracts from cells with restricted expression overcomes this lack of binding. In addition, treatment of these nuclear extracts with sodium deoxycholate restored their ability to form the heterodimer, suggesting the presence of an inhibitor of NF-kappa B activity. Furthermore, treatment of nuclear extracts from these cells that had restricted expression with lipopolysaccharide increased viral production and NF-kappa B activity. Antiserum specific for NF-kappa B binding proteins, but not c-rel-specific antiserum, disrupted heterodimer complex formation. Thus, both NF-kappa B-binding complexes are needed for optimal viral transcription. Binding of the 65-kDa plus 50-kDa heterodimer to the HIV-1 enhancer can be negatively regulated in monocytes, providing one mechanism restricting HIV-1 gene expression. PMID:1946356

  8. Placental endoplasmic reticulum stress negatively regulates transcription of placental growth factor via ATF4 and ATF6β: implications for the pathophysiology of human pregnancy complications

    PubMed Central

    Mizuuchi, Masahito; Cindrova‐Davies, Tereza; Olovsson, Matts; Charnock‐Jones, D Stephen; Burton, Graham J

    2016-01-01

    Abstract Low maternal circulating concentrations of placental growth factor (PlGF) are one of the hallmarks of human pregnancy complications, including fetal growth restriction (FGR) and early‐onset pre‐eclampsia (PE). Currently, PlGF is used clinically with other biomarkers to screen for high‐risk cases, although the mechanisms underlying its regulation are largely unknown. Placental endoplasmic reticulum (ER) stress has recently been found to be elevated in cases of FGR, and to an even greater extent in early‐onset PE complicated with FGR. ER stress activates the unfolded protein response (UPR); attenuation of protein translation and a reduction in cell growth and proliferation play crucial roles in the pathophysiology of these complications of pregnancy. In this study, we further identified that ER stress regulates release of PlGF. We first observed that down‐regulation of PlGF protein was associated with nuclear localization of ATF4, ATF6α and ATF6β in the syncytiotrophoblast of placentae from PE patients. Transcript analysis showed a decrease of PlGF mRNA, and an increase from genes encoding those UPR transcription factors in placentae from cases of early‐onset PE, but not of late‐onset (>34 weeks) PE, compared to term controls. Further investigations indicated a strong correlation between ATF4 and PlGF mRNA levels only (r = − 0.73, p < 0.05). These results could be recapitulated in trophoblast‐like cells exposed to chemical inducers of ER stress or hypoxia–reoxygenation. The stability of PlGF transcripts was unchanged. The use of small interfering RNA specific for transcription factors in the UPR pathways revealed that ATF4 and ATF6β, but not ATF6α, modulate PlGF transcription. To conclude, ATF4 and ATF6β act synergistically in the negative regulation of PlGF mRNA expression, resulting in reduced PlGF secretion by the trophoblast in response to stress. Therefore, these results further support the targeting of placental ER stress as a

  9. SIGIRR, a negative regulator of colon tumorigenesis

    PubMed Central

    Zhao, Junjie; Zepp, Jarod; Bulek, Katarzyna; Li, Xiaoxia

    2012-01-01

    Inappropriate activation of the Toll-IL-1R (TL-IL-1) signaling by commensal bacteria contributes to the pathogenesis of inflammatory bowel diseases and colitis-associated cancer. Recent studies have identified SIGIRR as a negative regulator of TL-IL-1 signaling. It dampens intestinal inflammation and tumorigenesis in the colon. In this review, we will discuss the role of SIGIRR in different cell types and the mechanisms underlying its tumor suppressor function. PMID:22529873

  10. Rhizobial gibberellin negatively regulates host nodule number.

    PubMed

    Tatsukami, Yohei; Ueda, Mitsuyoshi

    2016-01-01

    In legume-rhizobia symbiosis, the nodule number is controlled to ensure optimal growth of the host. In Lotus japonicus, the nodule number has been considered to be tightly regulated by host-derived phytohormones and glycopeptides. However, we have discovered a symbiont-derived phytohormonal regulation of nodule number in Mesorhizobium loti. In this study, we found that M. loti synthesized gibberellic acid (GA) under symbiosis. Hosts inoculated with a GA-synthesis-deficient M. loti mutant formed more nodules than those inoculated with the wild-type form at four weeks post inoculation, indicating that GA from already-incorporated rhizobia prevents new nodule formation. Interestingly, the genes for GA synthesis are only found in rhizobial species that inhabit determinate nodules. Our findings suggest that the already-incorporated rhizobia perform GA-associated negative regulation of nodule number to prevent delayed infection by other rhizobia. PMID:27307029

  11. Rhizobial gibberellin negatively regulates host nodule number

    PubMed Central

    Tatsukami, Yohei; Ueda, Mitsuyoshi

    2016-01-01

    In legume–rhizobia symbiosis, the nodule number is controlled to ensure optimal growth of the host. In Lotus japonicus, the nodule number has been considered to be tightly regulated by host-derived phytohormones and glycopeptides. However, we have discovered a symbiont-derived phytohormonal regulation of nodule number in Mesorhizobium loti. In this study, we found that M. loti synthesized gibberellic acid (GA) under symbiosis. Hosts inoculated with a GA-synthesis-deficient M. loti mutant formed more nodules than those inoculated with the wild-type form at four weeks post inoculation, indicating that GA from already-incorporated rhizobia prevents new nodule formation. Interestingly, the genes for GA synthesis are only found in rhizobial species that inhabit determinate nodules. Our findings suggest that the already-incorporated rhizobia perform GA-associated negative regulation of nodule number to prevent delayed infection by other rhizobia. PMID:27307029

  12. Baicalin Downregulates Porphyromonas gingivalis Lipopolysaccharide-Upregulated IL-6 and IL-8 Expression in Human Oral Keratinocytes by Negative Regulation of TLR Signaling

    PubMed Central

    Luo, Wei; Wang, Cun-Yu; Jin, Lijian

    2012-01-01

    Periodontal (gum) disease is one of the main global oral health burdens and severe periodontal disease (periodontitis) is a leading cause of tooth loss in adults globally. It also increases the risk of cardiovascular disease and diabetes mellitus. Porphyromonas gingivalis lipopolysaccharide (LPS) is a key virulent attribute that significantly contributes to periodontal pathogenesis. Baicalin is a flavonoid from Scutellaria radix, an herb commonly used in traditional Chinese medicine for treating inflammatory diseases. The present study examined the modulatory effect of baicalin on P. gingivalis LPS-induced expression of IL-6 and IL-8 in human oral keratinocytes (HOKs). Cells were pre-treated with baicalin (0–80 µM) for 24 h, and subsequently treated with P. gingivalis LPS at 10 µg/ml with or without baicalin for 3 h. IL-6 and IL-8 transcripts and proteins were detected by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of nuclear factor-κB (NF-κB), p38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) proteins was analyzed by western blot. A panel of genes related to toll-like receptor (TLR) signaling was examined by PCR array. We found that baicalin significantly downregulated P. gingivalis LPS-stimulated expression of IL-6 and IL-8, and inhibited P. gingivalis LPS-activated NF-κB, p38 MAPK and JNK. Furthermore, baicalin markedly downregulated P. gingivalis LPS-induced expression of genes associated with TLR signaling. In conclusion, the present study shows that baicalin may significantly downregulate P. gingivalis LPS-upregulated expression of IL-6 and IL-8 in HOKs via negative regulation of TLR signaling. PMID:23239998

  13. Negative regulation and developmental competence in Aspergillus

    PubMed Central

    Lee, Mi-Kyung; Kwon, Nak-Jung; Lee, Im-Soon; Jung, Seunho; Kim, Sun-Chang; Yu, Jae-Hyuk

    2016-01-01

    Asexual development (conidiation) in the filamentous fungus Aspergillus nidulans is governed by orchestrated gene expression. The three key negative regulators of conidiation SfgA, VosA, and NsdD act at different control point in the developmental genetic cascade. Here, we have revealed that NsdD is a key repressor affecting the quantity of asexual spores in Aspergillus. Moreover, nullifying both nsdD and vosA results in abundant formation of the development specific structure conidiophores even at 12 h of liquid culture, and near constitutive activation of conidiation, indicating that acquisition of developmental competence involves the removal of negative regulation exerted by both NsdD and VosA. NsdD’s role in repressing conidiation is conserved in other aspergilli, as deleting nsdD causes enhanced and precocious activation of conidiation in Aspergillus fumigatus or Aspergillus flavus. In vivo NsdD-DNA interaction analyses identify three NsdD binding regions in the promoter of the essential activator of conidiation brlA, indicating a direct repressive role of NsdD in conidiation. Importantly, loss of flbC or flbD encoding upstream activators of brlA in the absence of nsdD results in delayed activation of brlA, suggesting distinct positive roles of FlbC and FlbD in conidiation. A genetic model depicting regulation of conidiation in A. nidulans is presented. PMID:27364479

  14. Negative regulation and developmental competence in Aspergillus.

    PubMed

    Lee, Mi-Kyung; Kwon, Nak-Jung; Lee, Im-Soon; Jung, Seunho; Kim, Sun-Chang; Yu, Jae-Hyuk

    2016-01-01

    Asexual development (conidiation) in the filamentous fungus Aspergillus nidulans is governed by orchestrated gene expression. The three key negative regulators of conidiation SfgA, VosA, and NsdD act at different control point in the developmental genetic cascade. Here, we have revealed that NsdD is a key repressor affecting the quantity of asexual spores in Aspergillus. Moreover, nullifying both nsdD and vosA results in abundant formation of the development specific structure conidiophores even at 12 h of liquid culture, and near constitutive activation of conidiation, indicating that acquisition of developmental competence involves the removal of negative regulation exerted by both NsdD and VosA. NsdD's role in repressing conidiation is conserved in other aspergilli, as deleting nsdD causes enhanced and precocious activation of conidiation in Aspergillus fumigatus or Aspergillus flavus. In vivo NsdD-DNA interaction analyses identify three NsdD binding regions in the promoter of the essential activator of conidiation brlA, indicating a direct repressive role of NsdD in conidiation. Importantly, loss of flbC or flbD encoding upstream activators of brlA in the absence of nsdD results in delayed activation of brlA, suggesting distinct positive roles of FlbC and FlbD in conidiation. A genetic model depicting regulation of conidiation in A. nidulans is presented. PMID:27364479

  15. Weight Loss Upregulates the Small GTPase DIRAS3 in Human White Adipose Progenitor Cells, Which Negatively Regulates Adipogenesis and Activates Autophagy via Akt-mTOR Inhibition.

    PubMed

    Ejaz, Asim; Mitterberger, Maria C; Lu, Zhen; Mattesich, Monika; Zwierzina, Marit E; Hörl, Susanne; Kaiser, Andreas; Viertler, Hans-Peter; Rostek, Ursula; Meryk, Andreas; Khalid, Sana; Pierer, Gerhard; Bast, Robert C; Zwerschke, Werner

    2016-04-01

    Long-term weight-loss (WL) interventions reduce insulin serum levels, protect from obesity, and postpone age-associated diseases. The impact of long-term WL on adipose-derived stromal/progenitor cells (ASCs) is unknown. We identified DIRAS3 and IGF-1 as long-term WL target genes up-regulated in ASCs in subcutaneous white adipose tissue of formerly obese donors (WLDs). We show that DIRAS3 negatively regulates Akt, mTOR and ERK1/2 signaling in ASCs undergoing adipogenesis and acts as a negative regulator of this pathway and an activator of autophagy. Studying the IGF-1-DIRAS3 interaction in ASCs of WLDs, we demonstrate that IGF-1, although strongly up-regulated in these cells, hardly activates Akt, while ERK1/2 and S6K1 phosphorylation is activated by IGF-1. Overexpression of DIRAS3 in WLD ASCs completely inhibits Akt phosphorylation also in the presence of IGF-1. Phosphorylation of ERK1/2 and S6K1 is lesser reduced under these conditions. In conclusion, our key findings are that DIRAS3 down-regulates Akt-mTOR signaling in ASCs of WLDs. Moreover, DIRAS3 inhibits adipogenesis and activates autophagy in these cells. PMID:27211557

  16. Weight Loss Upregulates the Small GTPase DIRAS3 in Human White Adipose Progenitor Cells, Which Negatively Regulates Adipogenesis and Activates Autophagy via Akt–mTOR Inhibition

    PubMed Central

    Ejaz, Asim; Mitterberger, Maria C.; Lu, Zhen; Mattesich, Monika; Zwierzina, Marit E.; Hörl, Susanne; Kaiser, Andreas; Viertler, Hans-Peter; Rostek, Ursula; Meryk, Andreas; Khalid, Sana; Pierer, Gerhard; Bast, Robert C.; Zwerschke, Werner

    2016-01-01

    Long-term weight-loss (WL) interventions reduce insulin serum levels, protect from obesity, and postpone age-associated diseases. The impact of long-term WL on adipose-derived stromal/progenitor cells (ASCs) is unknown. We identified DIRAS3 and IGF-1 as long-term WL target genes up-regulated in ASCs in subcutaneous white adipose tissue of formerly obese donors (WLDs). We show that DIRAS3 negatively regulates Akt, mTOR and ERK1/2 signaling in ASCs undergoing adipogenesis and acts as a negative regulator of this pathway and an activator of autophagy. Studying the IGF-1–DIRAS3 interaction in ASCs of WLDs, we demonstrate that IGF-1, although strongly up-regulated in these cells, hardly activates Akt, while ERK1/2 and S6K1 phosphorylation is activated by IGF-1. Overexpression of DIRAS3 in WLD ASCs completely inhibits Akt phosphorylation also in the presence of IGF-1. Phosphorylation of ERK1/2 and S6K1 is lesser reduced under these conditions. In conclusion, our key findings are that DIRAS3 down-regulates Akt–mTOR signaling in ASCs of WLDs. Moreover, DIRAS3 inhibits adipogenesis and activates autophagy in these cells. PMID:27211557

  17. Nitric oxide negatively regulates mammalian adult neurogenesis

    NASA Astrophysics Data System (ADS)

    Packer, Michael A.; Stasiv, Yuri; Benraiss, Abdellatif; Chmielnicki, Eva; Grinberg, Alexander; Westphal, Heiner; Goldman, Steven A.; Enikolopov, Grigori

    2003-08-01

    Neural progenitor cells are widespread throughout the adult central nervous system but only give rise to neurons in specific loci. Negative regulators of neurogenesis have therefore been postulated, but none have yet been identified as subserving a significant role in the adult brain. Here we report that nitric oxide (NO) acts as an important negative regulator of cell proliferation in the adult mammalian brain. We used two independent approaches to examine the function of NO in adult neurogenesis. In a pharmacological approach, we suppressed NO production in the rat brain by intraventricular infusion of an NO synthase inhibitor. In a genetic approach, we generated a null mutant neuronal NO synthase knockout mouse line by targeting the exon encoding active center of the enzyme. In both models, the number of new cells generated in neurogenic areas of the adult brain, the olfactory subependyma and the dentate gyrus, was strongly augmented, which indicates that division of neural stem cells in the adult brain is controlled by NO and suggests a strategy for enhancing neurogenesis in the adult central nervous system.

  18. Forkhead box protein O3 transcription factor negatively regulates autophagy in human cancer cells by inhibiting forkhead box protein O1 expression and cytosolic accumulation.

    PubMed

    Zhu, Wan Long; Tong, Honglian; Teh, Jing Tsong; Wang, Mei

    2014-01-01

    FoxO proteins are important regulators in cellular metabolism and are recognized to be nodes in multiple signaling pathways, most notably those involving PI3K/AKT and mTOR. FoxO proteins primarily function as transcription factors, but recent study suggests that cytosolic FoxO1 participates in the regulation of autophagy. In the current study, we find that cytosolic FoxO1 indeed stimulates cellular autophagy in multiple cancer cell lines, and that it regulates not only basal autophagy but also that induced by rapamycin and that in response to nutrient deprivation. These findings illustrate the importance of FoxO1 in cell metabolism regulation independent of its transcription factor function. In contrast to FoxO1, we find the closely related FoxO3a is a negative regulator of autophagy in multiple cancer cell lines, a previously unrecognized function for this protein, different from its function in benign fibroblast and muscle cells. The induction of autophagy by the knockdown of FoxO3a was found not to be mediated through the suppression of mTORC1 signaling; rather, the regulatory role of FoxO3a on autophagy was determined to be through its ability to transcriptionally suppress FoxO1. This complicated interplay of FoxO1 and FoxO3a suggests a complex checks- and balances-relationship between FoxO3a and FoxO1 in regulating autophagy and cell metabolism. PMID:25546383

  19. FOXM1 regulates expression of eukaryotic elongation factor 2 kinase and promotes proliferation, invasion and tumorgenesis of human triple negative breast cancer cells

    PubMed Central

    Hamurcu, Zuhal; Ashour, Ahmed; Kahraman, Nermin; Ozpolat, Bulent

    2016-01-01

    Eukaryotic elongation factor 2 kinase (eEF2K), an emerging molecular target for cancer therapy, contributes to cancer proliferation, cell survival, tumorigenesis, and invasion, disease progression and drug resistance. Although eEF2K is highly up-regulated in various cancers, the mechanism of gene regulation has not been elucidated. In this study, we examined the role of Forkhead Box M1 (FOXM1) proto-oncogenic transcription factor in triple negative breast cancer (TNBC) cells and the regulation of eEF2K. We found that FOXM1 is highly upregulated in TNBC and its knockdown by RNA interference (siRNA) significantly inhibited eEF2K expression and suppressed cell proliferation, colony formation, migration, invasion and induced apoptotic cell death, recapitulating the effects of eEF2K inhibition. Knockdown of FOXM1 inhibited regulators of cell cycle, migration/invasion and survival, including cyclin D1, Src and MAPK-ERK signaling pathways, respectively. We also demonstrated that FOXM1 (1B and 1C isoforms) directly binds to and transcriptionally regulates eEF2K gene expression by chromatin immunoprecipitation (ChIP) and luciferase gene reporter assays. Furthermore, in vivo inhibition of FOXM1 by liposomal siRNA-nanoparticles suppressed growth of MDA-MB-231 TNBC tumor xenografts in orthotopic models. In conclusion, our study provides the first evidence about the transcriptional regulation of eEF2K in TNBC and the role of FOXM1 in mediating breast cancer cell proliferation, survival, migration/invasion, progression and tumorgenesis and highlighting the potential of FOXM1/eEF2K axis as a molecular target in breast and other cancers. PMID:26918606

  20. A negative cis-acting G-fer element participates in the regulation of expression of the human H-ferritin-encoding gene (FERH).

    PubMed

    Barresi, R; Sirito, M; Karsenty, G; Ravazzolo, R

    1994-03-25

    Ferritin (Fer) is the major iron storage protein in man. Its synthesis is regulated both at the translational and transcriptional levels. In previous studies on transcriptional regulation of the human H-ferritin-encoding gene (FERH), a 160-bp promoter segment was analyzed [Bevilacqua et al., Gene 111 (1992) 255-260]. In order to obtain a more complete view of the elements involved in the transcriptional regulation of FERH, we have studied, in a further upstream region of the human FERH promoter (pFERH), a sequence between -272 and -291, named G-fer, because it contains a stretch of ten G, which binds a nuclear factor present in different cell types. DNA-binding assays and competition experiments suggest that the factor binding to G-fer has binding properties very similar to inhibitory factor-1 (IF-1), an ubiquitous factor that interacts with G-rich elements in the promoters of the mouse type-I collagen genes. DNA transfection experiments in HeLa cells, using either a wild-type or mutated pFERH fused to a reporter gene, showed that a 3-bp substitution mutation, that abolished the binding of the specific factor to G-fer, increased the promoter activity, thus suggesting an inhibitory role for the G-fer element and its cognate trans-acting factor. PMID:8144027

  1. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  2. Acquisition of negative complement regulators by the saprophyte Leptospira biflexa expressing LigA or LigB confers enhanced survival in human serum.

    PubMed

    Castiblanco-Valencia, Mónica M; Fraga, Tatiana R; Breda, Leandro C D; Vasconcellos, Sílvio A; Figueira, Cláudio P; Picardeau, Mathieu; Wunder, Elsio; Ko, Albert I; Barbosa, Angela S; Isaac, Lourdes

    2016-05-01

    Leptospiral immunoglobulin-like (Lig) proteins are surface exposed molecules present in pathogenic but not in saprophytic Leptospira species. We have previously shown that Lig proteins interact with the soluble complement regulators Factor H (FH), FH like-1 (FHL-1), FH related-1 (FHR-1) and C4b Binding Protein (C4BP). In this study, we used the saprophyte L. biflexa serovar Patoc as a surrogate host to address the specific role of LigA and LigB proteins in leptospiral complement evasion. L. biflexa expressing LigA or LigB was able to acquire FH and C4BP. Bound complement regulators retained their cofactor activities of FI in the proteolytic cleavage of C3b and C4b. Moreover, heterologous expression of ligA and ligB genes in the saprophyte L. biflexa enhanced bacterial survival in human serum. Complement deposition on lig-transformed L. biflexa was assessed by flow cytometry analysis. With regard to MAC deposition, L. biflexa expressing LigA or LigB presented an intermediate profile: MAC deposition levels were greater than those found in the pathogenic L. interrogans, but lower than those observed for L. biflexa wildtype. In conclusion, Lig proteins contribute to in vitro control of complement activation on the leptospiral surface, promoting an increased bacterial survival in human serum. PMID:26976804

  3. The protein kinase CK2 phosphorylates SNAP190 to negatively regulate SNAPC DNA binding and human U6 transcription by RNA polymerase III.

    PubMed

    Gu, Liping; Husain-Ponnampalam, Rhonda; Hoffmann-Benning, Susanne; Henry, R William

    2007-09-21

    Human U6 small nuclear RNA gene transcription by RNA polymerase III requires the general transcription factor SNAP(C), which binds to human small nuclear RNA core promoter elements and nucleates pre-initiation complex assembly with the Brf2-TFIIIB complex. Multiple components in this pathway are phosphorylated by the protein kinase CK2, including the Bdp1 subunit of the Brf2-TFIIIB complex, and RNA polymerase III, with negative and positive outcomes for U6 transcription, respectively. However, a role for CK2 phosphorylation of SNAP(C) in U6 transcription has not been defined. In this report, we investigated the role of CK2 in modulating the transcriptional properties of SNAP(C) and demonstrate that within SNAP(C), CK2 phosphorylates the N-terminal half of the SNAP190 subunit at two regions (amino acids 20-63 and 514-545) that each contain multiple CK2 consensus sites. SNAP190 phosphorylation by CK2 inhibits both SNAP(C) DNA binding and U6 transcription activity. Mutational analyses of SNAP190 support a model wherein CK2 phosphorylation triggers an allosteric inhibition of the SNAP190 Myb DNA binding domain. PMID:17670747

  4. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  5. Cultural differences in hedonic emotion regulation after a negative event.

    PubMed

    Miyamoto, Yuri; Ma, Xiaoming; Petermann, Amelia G

    2014-08-01

    Beliefs about emotions can influence how people regulate their emotions. The present research examined whether Eastern dialectical beliefs about negative emotions lead to cultural differences in how people regulate their emotions after experiencing a negative event. We hypothesized that, because of dialectical beliefs about negative emotions prevalent in Eastern culture, Easterners are less motivated than Westerners to engage in hedonic emotion regulation-up-regulation of positive emotions and down-regulation of negative emotions. By assessing online reactions to a recent negative event, Study 1 found that European Americans are more motivated to engage in hedonic emotion regulation. Furthermore, consistent with the reported motivation to regulate emotion hedonically, European Americans show a steeper decline in negative emotions 1 day later than do Asians. By examining retrospective memory of reactions to a past negative event, Study 2 further showed that cultural differences in hedonic emotion regulation are mediated by cultural differences in dialectical beliefs about motivational and cognitive utility of negative emotions, but not by personal deservingness or self-efficacy beliefs. These findings demonstrate the role of cultural beliefs in shaping emotion regulation and emotional experiences. PMID:24708499

  6. miR-29b negatively regulates human osteoclastic cell differentiation and function: implications for the treatment of multiple myeloma-related bone disease.

    PubMed

    Rossi, Marco; Pitari, Maria Rita; Amodio, Nicola; Di Martino, Maria Teresa; Conforti, Francesco; Leone, Emanuela; Botta, Cirino; Paolino, Francesco Maria; Del Giudice, Teresa; Iuliano, Eleonora; Caraglia, Michele; Ferrarini, Manlio; Giordano, Antonio; Tagliaferri, Pierosandro; Tassone, Pierfrancesco

    2013-07-01

    Skeletal homeostasis relies upon a fine tuning of osteoclast (OCL)-mediated bone resorption and osteoblast (OBL)-dependent bone formation. This balance is unsettled by multiple myeloma (MM) cells, which impair OBL function and stimulate OCLs to generate lytic lesions. Emerging experimental evidence is disclosing a key regulatory role of microRNAs (miRNAs) in the regulation of bone homeostasis suggesting the miRNA network as potential novel target for the treatment of MM-related bone disease (BD). Here, we report that miR-29b expression decreases progressively during human OCL differentiation in vitro. We found that lentiviral transduction of miR-29b into OCLs, even in the presence of MM cells, significantly impairs tartrate acid phosphatase (TRAcP) expression, lacunae generation, and collagen degradation, which are relevant hallmarks of OCL activity. Accordingly, expression of cathepsin K and metalloproteinase 9 (MMP9) as well as actin ring rearrangement were impaired in the presence of miR-29b. Moreover, we found that canonical targets C-FOS and metalloproteinase 2 are suppressed by constitutive miR-29b expression which also downregulated the master OCL transcription factor, NAFTc-1. Overall, these data indicate that enforced expression of miR-29b impairs OCL differentiation and overcomes OCL activation triggered by MM cells, providing a rationale for miR-29b-based treatment of MM-related BD. PMID:23254643

  7. RelA-Induced Interferon Response Negatively Regulates Proliferation.

    PubMed

    Kochupurakkal, Bose S; Wang, Zhigang C; Hua, Tony; Culhane, Aedin C; Rodig, Scott J; Rajkovic-Molek, Koraljka; Lazaro, Jean-Bernard; Richardson, Andrea L; Biswas, Debajit K; Iglehart, J Dirk

    2015-01-01

    Both oncogenic and tumor-suppressor activities are attributed to the Nuclear Factor kappa B (NF-kB) pathway. Moreover, NF-kB may positively or negatively regulate proliferation. The molecular determinants of these opposing roles of NF-kB are unclear. Using primary human mammary epithelial cells (HMEC) as a model, we show that increased RelA levels and consequent increase in basal transcriptional activity of RelA induces IRF1, a target gene. Induced IRF1 upregulates STAT1 and IRF7, and in consort, these factors induce the expression of interferon response genes. Activation of the interferon pathway down-regulates CDK4 and up-regulates p27 resulting in Rb hypo-phosphorylation and cell cycle arrest. Stimulation of HMEC with IFN-γ elicits similar phenotypic and molecular changes suggesting that basal activity of RelA and IFN-γ converge on IRF1 to regulate proliferation. The anti-proliferative RelA-IRF1-CDK4 signaling axis is retained in ER+/HER2- breast tumors analyzed by The Cancer Genome Atlas (TCGA). Using immuno-histochemical analysis of breast tumors, we confirm the negative correlation between RelA levels and proliferation rate in ER+/HER2- breast tumors. These findings attribute an anti-proliferative tumor-suppressor role to basal RelA activity. Inactivation of Rb, down-regulation of RelA or IRF1, or upregulation of CDK4 or IRF2 rescues the RelA-IRF1-CDK4 induced proliferation arrest in HMEC and are points of disruption in aggressive tumors. Activity of the RelA-IRF1-CDK4 axis may explain favorable response to CDK4/6 inhibition observed in patients with ER+ Rb competent tumors. PMID:26460486

  8. RelA-Induced Interferon Response Negatively Regulates Proliferation

    PubMed Central

    Kochupurakkal, Bose S.; Wang, Zhigang C.; Hua, Tony; Culhane, Aedin C.; Rodig, Scott J.; Rajkovic-Molek, Koraljka; Lazaro, Jean-Bernard; Richardson, Andrea L.; Biswas, Debajit K.; Iglehart, J. Dirk

    2015-01-01

    Both oncogenic and tumor-suppressor activities are attributed to the Nuclear Factor kappa B (NF-kB) pathway. Moreover, NF-kB may positively or negatively regulate proliferation. The molecular determinants of these opposing roles of NF-kB are unclear. Using primary human mammary epithelial cells (HMEC) as a model, we show that increased RelA levels and consequent increase in basal transcriptional activity of RelA induces IRF1, a target gene. Induced IRF1 upregulates STAT1 and IRF7, and in consort, these factors induce the expression of interferon response genes. Activation of the interferon pathway down-regulates CDK4 and up-regulates p27 resulting in Rb hypo-phosphorylation and cell cycle arrest. Stimulation of HMEC with IFN-γ elicits similar phenotypic and molecular changes suggesting that basal activity of RelA and IFN-γ converge on IRF1 to regulate proliferation. The anti-proliferative RelA-IRF1-CDK4 signaling axis is retained in ER+/HER2- breast tumors analyzed by The Cancer Genome Atlas (TCGA). Using immuno-histochemical analysis of breast tumors, we confirm the negative correlation between RelA levels and proliferation rate in ER+/HER2- breast tumors. These findings attribute an anti-proliferative tumor-suppressor role to basal RelA activity. Inactivation of Rb, down-regulation of RelA or IRF1, or upregulation of CDK4 or IRF2 rescues the RelA-IRF1-CDK4 induced proliferation arrest in HMEC and are points of disruption in aggressive tumors. Activity of the RelA-IRF1-CDK4 axis may explain favorable response to CDK4/6 inhibition observed in patients with ER+ Rb competent tumors. PMID:26460486

  9. NRF2 Signaling Negatively Regulates Phorbol-12-Myristate-13-Acetate (PMA)-Induced Differentiation of Human Monocytic U937 Cells into Pro-Inflammatory Macrophages

    PubMed Central

    Choi, Hye-young; Choi, Bo-hyun; Kim, Sang-Tae; Heo, Tae-Hwe; Lee, Joo Young; Park, Pil-Hoon; Kwak, Mi-Kyoung

    2015-01-01

    Blood monocytes are recruited to injured tissue sites and differentiate into macrophages, which protect against pathogens and repair damaged tissues. Reactive oxygen species (ROS) are known to be an important contributor to monocytes’ differentiation and macrophages’ function. NF-E2-related factor 2 (NRF2), a transcription factor regulating cellular redox homeostasis, is known to be a critical modulator of inflammatory responses. We herein investigated the role of NRF2 in macrophage differentiation using the human monocytic U937 cell line and phorbol-12-myristate-13-acetate (PMA). In U937 cells with NRF2 silencing, PMA-stimulated cell adherence was significantly facilitated when compared to control U937 cells. Both transcript and protein levels for pro-inflammatory cytokines, including interleukine-1β (IL-1β), IL-6, and tumor necrosis factor-α (TNFα) were highly elevated in PMA-stimulated NRF2-silenced U937 compared to the control. In addition, PMA-inducible secretion of monocyte chemotactic protein 1 (MCP-1) was significantly high in NRF2-silenced U937. As an underlying mechanism, we showed that NRF2-knockdown U937 retained high levels of cellular ROS and endoplasmic reticulum (ER) stress markers expression; and subsequently, PMA-stimulated levels of Ca2+ and PKCα were greater in NRF2-knockdown U937 cells, which caused enhanced nuclear accumulation of nuclear factor-ҡB (NFҡB) p50 and extracellular signal-regulated kinase (ERK)-1/2 phosphorylation. Whereas the treatment of NRF2-silenced U937 cells with pharmacological inhibitors of NFҡB or ERK1/2 largely blocked PMA-induced IL-1β and IL-6 expression, indicating that these pathways are associated with cell differentiation. Taken together, our results suggest that the NRF2 system functions to suppress PMA-stimulated U937 cell differentiation into pro-inflammatory macrophages and provide evidence that the ROS-PKCα-ERK-NFҡB axis is involved in PMA-facilitated differentiation of NRF2-silenced U937 cells

  10. Class 3 semaphorins negatively regulate dermal lymphatic network formation

    PubMed Central

    Uchida, Yutaka; James, Jennifer M.; Suto, Fumikazu; Mukouyama, Yoh-suke

    2015-01-01

    ABSTRACT The development of a patterned lymphatic vascular network is essential for proper lymphatic functions during organ development and homeostasis. Here we report that class 3 semaphorins (SEMA3s), SEMA3F and SEMA3G negatively regulate lymphatic endothelial cell (LEC) growth and sprouting to control dermal lymphatic network formation. Neuropilin2 (NRP2) functions as a receptor for SEMA3F and SEMA3G, as well as vascular endothelial growth factor C (VEGFC). In culture, Both SEMA3F and SEMA3G inhibit VEGFC-mediated sprouting and proliferation of human dermal LECs. In the developing mouse skin, Sema3f is expressed in the epidermis and Sema3g expression is restricted to arteries, whereas their receptor Nrp2 is preferentially expressed by lymphatic vessels. Both Sema3f;Sema3g double mutants and Nrp2 mutants exhibit increased LEC growth in the skin. In contrast, Sema3f;Sema3g double mutants display increased lymphatic branching, while Nrp2 mutants exhibit reduced lymphatic branching. A targeted mutation in PlexinA1 or PlexinA2, signal transducers forming a receptor complex with NRP2 for SEMA3s, exhibits an increase in LEC growth and lymphatic branching as observed in Sema3f;Sema3g double mutants. Our results provide the first evidence that SEMA3F and SEMA3G function as a negative regulator for dermal lymphangiogenesis in vivo. The reciprocal phenotype in lymphatic branching between Sema3f;Sema3g double mutants and Nrp2 mutants suggest a complex NRP2 function that regulates LEC behavior both positively and negatively, through a binding with VEGFC or SEMA3s. PMID:26319580

  11. Class 3 semaphorins negatively regulate dermal lymphatic network formation.

    PubMed

    Uchida, Yutaka; James, Jennifer M; Suto, Fumikazu; Mukouyama, Yoh-Suke

    2015-01-01

    The development of a patterned lymphatic vascular network is essential for proper lymphatic functions during organ development and homeostasis. Here we report that class 3 semaphorins (SEMA3s), SEMA3F and SEMA3G negatively regulate lymphatic endothelial cell (LEC) growth and sprouting to control dermal lymphatic network formation. Neuropilin2 (NRP2) functions as a receptor for SEMA3F and SEMA3G, as well as vascular endothelial growth factor C (VEGFC). In culture, Both SEMA3F and SEMA3G inhibit VEGFC-mediated sprouting and proliferation of human dermal LECs. In the developing mouse skin, Sema3f is expressed in the epidermis and Sema3g expression is restricted to arteries, whereas their receptor Nrp2 is preferentially expressed by lymphatic vessels. Both Sema3f;Sema3g double mutants and Nrp2 mutants exhibit increased LEC growth in the skin. In contrast, Sema3f;Sema3g double mutants display increased lymphatic branching, while Nrp2 mutants exhibit reduced lymphatic branching. A targeted mutation in PlexinA1 or PlexinA2, signal transducers forming a receptor complex with NRP2 for SEMA3s, exhibits an increase in LEC growth and lymphatic branching as observed in Sema3f;Sema3g double mutants. Our results provide the first evidence that SEMA3F and SEMA3G function as a negative regulator for dermal lymphangiogenesis in vivo. The reciprocal phenotype in lymphatic branching between Sema3f;Sema3g double mutants and Nrp2 mutants suggest a complex NRP2 function that regulates LEC behavior both positively and negatively, through a binding with VEGFC or SEMA3s. PMID:26319580

  12. TRIM32 is a novel negative regulator of p53.

    PubMed

    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui

    2015-01-01

    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  13. TRIM32 is a novel negative regulator of p53

    PubMed Central

    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui

    2015-01-01

    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  14. Negative Emotion Regulation in Patients with Posttraumatic Stress Disorder

    PubMed Central

    Qiu, Mingguo; Zhang, Jingna; Sang, Linqiong; Wang, Li; Xie, Bing; Wang, Jian; Li, Min

    2013-01-01

    Objective To explore the neural mechanisms of negative emotion regulation in patients with post-traumatic stress disorder (PTSD). Methods Twenty PTSD patients and 20 healthy subjects were recruited. Event-related functional magnetic resonance imaging (fMRI) was used to investigate the modification of emotional responses to negative stimuli. Participants were required to regulate their emotional reactions according to the auditory regulation instructions via headphones, to maintain, enhance or diminish responses to negative stimuli during fMRI scans. Results The PTSD group showed poorer modification performance than the control group when diminishing responses to negative stimuli. On fMRI, the PTSD group showed decreased activation in the inferior frontal cortex, inferior parietal lobule, insula and putamen, and increased activation in posterior cingulate cortex and amygdala during up-regulation of negative emotion. Similar decreased activation regions were found during down-regulation of negative emotion, but no increased activation was found. Conclusion Trauma exposure might impair the ability to down-regulate negative emotion. The present findings will improve our understanding of the neural mechanisms of emotion regulation underlying PTSD. PMID:24349161

  15. ITSN2L Interacts with and Negatively Regulates RABEP1

    PubMed Central

    Yang, Xiaoxu; Yan, Feng; He, Zhicheng; Liu, Shan; Cheng, Yeqing; Wei, Ke; Gan, Shiquan; Yuan, Jing; Wang, Shang; Xiao, Ye; Ren, Kaiqun; Liu, Ning; Hu, Xiang; Ding, Xiaofeng; Hu, Xingwang; Xiang, Shuanglin

    2015-01-01

    Intersectin-2Long (ITSN2L) is a multi-domain protein participating in endocytosis and exocytosis. In this study, RABEP1 was identified as a novel ITSN2L interacting protein using a yeast two-hybrid screen from a human brain cDNA library and this interaction, specifically involving the ITSN2L CC domain and RABEP1 CC3 regions, was further confirmed by in vitro GST (glutathione-S-transferase) pull-down and in vivo co-immunoprecipitation assays. Corroboratively, we observed that these two proteins co-localize in the cytoplasm of mammalian cells. Furthermore, over-expression of ITSN2L promotes RABEP1 degradation and represses RABEP1-enhanced endosome aggregation, indicating that ITSN2L acts as a negative regulator of RABEP1. Finally, we showed that ITSN2L and RABEP1 play opposite roles in regulating endocytosis. Taken together, our results indicate that ITSN2L interacts with RABEP1 and stimulates its degradation in regulation of endocytosis. PMID:26633357

  16. ITSN2L Interacts with and Negatively Regulates RABEP1.

    PubMed

    Yang, Xiaoxu; Yan, Feng; He, Zhicheng; Liu, Shan; Cheng, Yeqing; Wei, Ke; Gan, Shiquan; Yuan, Jing; Wang, Shang; Xiao, Ye; Ren, Kaiqun; Liu, Ning; Hu, Xiang; Ding, Xiaofeng; Hu, Xingwang; Xiang, Shuanglin

    2015-01-01

    Intersectin-2Long (ITSN2L) is a multi-domain protein participating in endocytosis and exocytosis. In this study, RABEP1 was identified as a novel ITSN2L interacting protein using a yeast two-hybrid screen from a human brain cDNA library and this interaction, specifically involving the ITSN2L CC domain and RABEP1 CC3 regions, was further confirmed by in vitro GST (glutathione-S-transferase) pull-down and in vivo co-immunoprecipitation assays. Corroboratively, we observed that these two proteins co-localize in the cytoplasm of mammalian cells. Furthermore, over-expression of ITSN2L promotes RABEP1 degradation and represses RABEP1-enhanced endosome aggregation, indicating that ITSN2L acts as a negative regulator of RABEP1. Finally, we showed that ITSN2L and RABEP1 play opposite roles in regulating endocytosis. Taken together, our results indicate that ITSN2L interacts with RABEP1 and stimulates its degradation in regulation of endocytosis. PMID:26633357

  17. Negative Regulation of p21Waf1/Cip1 by Human INO80 Chromatin Remodeling Complex Is Implicated in Cell Cycle Phase G2/M Arrest and Abnormal Chromosome Stability

    PubMed Central

    Cao, Lingling; Ding, Jian; Dong, Liguo; Zhao, Jiayao; Su, Jiaming; Wang, Lingyao; Sui, Yi; Zhao, Tong; Wang, Fei; Jin, Jingji; Cai, Yong

    2015-01-01

    We previously identified an ATP-dependent human Ino80 (INO80) chromatin remodeling complex which shares a set of core subunits with yeast Ino80 complex. Although research evidence has suggested that INO80 complex functions in gene transcription and genome stability, the precise mechanism remains unclear. Herein, based on gene expression profiles from the INO80 complex-knockdown in HeLa cells, we first demonstrate that INO80 complex negatively regulates the p21Waf1/Cip1 (p21) expression in a p53-mediated mechanism. In chromatin immunoprecipitation (ChIP) and a sequential ChIP (Re-ChIP) assays, we determined that the INO80 complex and p53 can bind to the same promoter region of p21 gene (-2.2kb and -1.0kb upstream of the p21 promoter region), and p53 is required for the recruitment of the INO80 complex to the p21 promoter. RNAi knockdown strategies of INO80 not only led to prolonged progression of cell cycle phase G2/M to G1, but it also resulted in abnormal chromosome stability. Interestingly, high expression of p21 was observed in most morphologically-changed cells, suggesting that negative regulation of p21 by INO80 complex might be implicated in maintaining the cell cycle process and chromosome stability. Together, our findings will provide a theoretical basis to further elucidate the cellular mechanisms of the INO80 complex. PMID:26340092

  18. How does the brain regulate negative bias to stigma?

    PubMed Central

    Kensinger, Elizabeth A.; Ambady, Nalini

    2012-01-01

    The current study uses functional magnetic resonance imaging (fMRI) to examine whether regulating negative bias to stigmatized individuals has a unique neural activity profile from general emotion regulation. Participants were presented with images of stigmatized (e.g. homeless people) or non-stigmatized (e.g. a man holding a gun) social targets while undergoing fMRI and were asked either to maintain or regulate their emotional response. Their implicit bias toward these stigmatized group members was also measured. Analyses were conducted in both, an event-related fashion, considering the event to be the onset of regulation, and in a blocked-design fashion, considering the sustained activity throughout the 8-s regulatory period. In the event-related (onset) analyses, participants showed more activity throughout the prefrontal cortex when initiating a regulatory response to stigmatized as compared with non-stigmatized images. This neural activity was positively correlated with their implicit bias. Interestingly, in the block (sustained) analyses, general emotion regulation elicited a more widespread pattern of neural activity as compared with stigma regulation. This activity was largely posterior, suggesting that general emotion regulation may engage more visuo-spatial processing as compared with stigma regulation. These findings suggest that regulating negative affect toward stigmatized targets may occur relatively more quickly than regulating negative affect toward non-stigmatized targets. PMID:21896496

  19. Negative regulation of Vps34 by Cdk mediated phosphorylation

    PubMed Central

    Furuya, Tsuyoshi; Kim, Minsu; Lipinski, Marta; Li, Juying; Kim, Dohoon; Lu, Tao; Shen, Yong; Rameh, Lucia; Yankner, Bruce; Tsai, Li-Huei; Yuan, Junying

    2010-01-01

    Summary Vps34 (vacuolar protein sorting 34) complexes, the class III PtdIns3 kinase, specifically phosphorylate the D3-position of PtdIns to produce PtdIns3P. Vps34 is involved in the control of multiple key intracellular membrane trafficking pathways including endocytic sorting and autophagy. In mammalian cells, Vps34 interacts with Beclin 1, an orthologue of Atg6 in yeast, to regulate the production of PtdIns3P and autophagy. We show that Vps34 is phosphorylated on Thr159 by Cdk1, which negatively regulates its interaction with Beclin1 during mitosis. Cdk5/p25, a neuronal cdk shown to play a role in Alzheimer’s disease, can also phosphorylate Thr159 of Vps34. Phosphorylation of Vps34 on Thr159 inhibits its interaction with Beclin 1. We propose that phosphorylation of Thr159 in Vps34 is a key regulatory mechanism that controls the class III PtdIns3 kinase activity in cell cycle progression, development and human diseases including neurodegeneration and cancers. PMID:20513426

  20. The Novel Small Leucine-Rich Repeat Protein Podocan is a Negative Regulator of Migration and Proliferation of Smooth Muscle Cells, Modulates Neointima Formation and is Expressed in Human Atheroma

    PubMed Central

    Hutter, Randolph; Huang, Li; Speidl, Walter S.; Giannarelli, Chiara; Trubin, Paul; Bauriedel, Gerhard; Klotman, Mary E.; Fuster, Valentin; Badimon, Juan J.; Klotman, Paul E.

    2014-01-01

    Background SMC migration and proliferation critically influence the clinical course of vascular disease. We tested the effect of the novel small leucine-rich repeat protein podocan on SMC migration and proliferation using a podocan deficient mouse in combination with a model of arterial injury and aortic explant SMC culture. In addition, we examined the effect of overexpression of the human form of podocan on human SMC and tested for podocan expression in human atherosclerosis. In all these conditions we evaluated concomitantly the Wnt-TCF-pathway. Methods and Results Podocan was strongly and selectively expressed in arteries of WT mice after injury. Podocan−/− mice showed increased arterial lesion formation as compared to WT littermates in response to injury (P<0.05). Also, SMC proliferation was increased in arteries of podocan −/− mice compared to WT (P<0.05). In vitro, migration and proliferation were increased in podocan−/− SMC and were normalized by transfection with the WT podocan gene (P<0.05). In addition, upregulation of the Wnt-TCF-pathway was found in SMC of podocan−/− mice both in vitro and in vivo. On the other hand, podocan overexpression in human SMC significantly reduced SMC migration and proliferation inhibiting the Wnt-TCF-pathway. Podocan and a Wnt-TCF-pathway marker were differently expressed in human coronary restenotic versus primary lesions. Conclusions Podocan appears to be a potent negative regulator of the migration and proliferation of both murine and human SMC. The lack of podocan results in excessive arterial repair and prolonged SMC proliferation, which likely is mediated by the Wnt-TCF-pathway. PMID:24043300

  1. NF-{kappa}B p50 promotes tumor cell invasion through negative regulation of invasion suppressor gene CRMP-1 in human lung adenocarcinoma cells

    SciTech Connect

    Gao Ming; Yeh, P.Y.; Lu, Y.-S.; Chang, W.C.; Kuo, M.-L.; Cheng, A.-L.

    2008-11-14

    Lung adenocarcinoma Cl1-5 cells were selected from parental Cl1-0 cells based on their high metastatic potential. In a previous study, CRMP-1, an invasion suppressor gene, was shown to be suppressed in Cl1-5 cells. However, the regulation of CRMP-1 expression has not been explored. In this study, we showed nuclear factor-{kappa}B controls CRMP-1 expression. The electromobility shift assay showed that while Cl1-0 cells exhibited low NF-{kappa}B activity in response to TNF-{alpha}, an abundance of basal and TNF-{alpha}-induced NF-{kappa}B-DNA complex was detected in Cl1-5 cells. Supershift-coupled EMSA and Western blotting of nuclear proteins, however, revealed p50 protein, but not classic p65/p50 heterodimer in the complex. ChIP and EMSA demonstrated that p50 binds to a {kappa}B site residing between -1753 and -1743 of the CRMP-1 promoter region. Transfection of antisense p50 gene into Cl1-5 cells increased the CRMP-1 protein level and decreased the invasive activity of Cl1-5 cells.

  2. Berberine Decreased Inducible Nitric Oxide Synthase mRNA Stability through Negative Regulation of Human Antigen R in Lipopolysaccharide-Induced Macrophages.

    PubMed

    Shin, Ji-Sun; Choi, Hye-Eun; Seo, SeungHwan; Choi, Jung-Hye; Baek, Nam-In; Lee, Kyung-Tae

    2016-07-01

    Berberine, a major isoquinoline alkaloid found in medicinal herbs, has been reported to possess anti-inflammatory effects; however, the underlying mechanisms responsible for its actions are poorly understood. In the present study, we investigated the inhibitory effects of berberine and the molecular mechanisms involved in lipopolysaccharide (LPS)-treated RAW 264.7 and THP-1 macrophages and its effects in LPS-induced septic shock in mice. In both macrophage cell types, berberine inhibited the LPS-induced nitric oxide (NO) production and inducible NO synthase (iNOS) protein expression, but it had no effect on iNOS mRNA transcription. Suppression of LPS-induced iNOS protein expression by berberine occurred via a human antigen R (HuR)-mediated reduction of iNOS mRNA stability. Molecular data revealed that the suppression on the LPS-induced HuR binding to iNOS mRNA by berberine was accompanied by a reduction in nucleocytoplasmic HuR shuttling. Pretreatment with berberine reduced LPS-induced iNOS protein expression and the cytoplasmic translocation of HuR in liver tissues and increased the survival rate of mice with LPS-induced endotoxemia. These results show that the suppression of iNOS protein expression by berberine under LPS-induced inflammatory conditions is associated with a reduction in iNOS mRNA stability resulting from inhibition of the cytoplasmic translocation of HuR. PMID:27189969

  3. Ribosomal protein S14 negatively regulates c-Myc activity.

    PubMed

    Zhou, Xiang; Hao, Qian; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2013-07-26

    The ribosomal gene RPS14 is associated with the cancer-prone 5q-syndrome, which is caused by an interstitial deletion of the long arm of human chromosome 5. Previously, we found that ribosomal protein S14 (RPS14) binds to and inactivates MDM2, consequently leading to p53-dependent cell-cycle arrest and growth inhibition. However, it remains elusive whether RPS14 regulates cell proliferation in a p53-independent manner. Here, we show that RPS14 interacts with the Myc homology box II (MBII) and the C-terminal basic helix-loop-helix leucine zipper (bHLH-LZ) domains of the oncoprotein c-Myc. Further, RPS14 inhibited c-Myc transcriptional activity by preventing the recruitment of c-Myc and its cofactor, TRRAP, to the target gene promoters, as thus suppressing c-Myc-induced cell proliferation. Also, siRNA-mediated RPS14 depletion elevated c-Myc transcriptional activity determined by its target gene, Nucleolin, expression. Interestingly, RPS14 depletion also resulted in the induction of c-Myc mRNA and subsequent protein levels. Consistent with this, RPS14 promoted c-Myc mRNA turnover through an Argonaute 2 (Ago2)- and microRNA-mediated pathway. Taken together, our study demonstrates that RPS14 negates c-Myc functions by directly inhibiting its transcriptional activity and mediating its mRNA degradation via miRNA. PMID:23775087

  4. Spontaneous Emotion Regulation to Positive and Negative Stimuli

    ERIC Educational Resources Information Center

    Volokhov, Rachael N.; Demaree, Heath A.

    2010-01-01

    The ability to regulate one's emotions is an integral part of human social behavior. One antecedent emotion regulation strategy, known as reappraisal, is characterized by cognitively evaluating an emotional stimulus to alter its emotional impact and one response-focused strategy, suppression, is aimed at reducing behavioral output. People are…

  5. PECAM-1 ligation negatively regulates TLR4 signaling in macrophages.

    PubMed

    Rui, Yuxiang; Liu, Xingguang; Li, Nan; Jiang, Yingming; Chen, Guoyou; Cao, Xuetao; Wang, Jianli

    2007-12-01

    Uncontrolled TLR4 signaling may induce excessive production of proinflammatory cytokines and lead to harmful inflammation; therefore, negative regulation of TLR4 signaling attracts much attention now. PECAM-1, a member of Ig-ITIM family, can mediate inhibitory signals in T cells and B cells. However, the role and the mechanisms of PECAM-1 in the regulation of TLR4-mediated LPS response in macrophages remain unclear. In this study, we demonstrate that PECAM-1 ligation with CD38-Fc fusion protein negatively regulates LPS-induced proinflammatory cytokine TNF-alpha, IL-6, and IFN-beta production by inhibiting JNK, NF-kappaB, and IFN regulatory factor 3 activation in macrophages. In addition, PECAM-1 ligation-recruited Src homology region 2 domain-containing phosphatase 1 (SHP-1) and Src homology region 2 domain-containing phosphatase 2 (SHP-2) may be involved in the inhibitory effect of PECAM-1 on TLR4 signaling. Consistently, silencing of PECAM-1 enhances the macrophage response to LPS stimulation. Taken together with the data that PECAM-1 is constitutively expressed in macrophages and its expression is up-regulated by LPS stimulation, PECAM-1 might function as a feedback negative regulator of LPS inflammatory response in macrophages. This study may provide a potential target for intervention of inflammatory diseases. PMID:18025177

  6. Histone Deacetylase 9 Is a Negative Regulator of Adipogenic Differentiation*

    PubMed Central

    Chatterjee, Tapan K.; Idelman, Gila; Blanco, Victor; Blomkalns, Andra L.; Piegore, Mark G.; Weintraub, Daniel S.; Kumar, Santosh; Rajsheker, Srinivas; Manka, David; Rudich, Steven M.; Tang, Yaoliang; Hui, David Y.; Bassel-Duby, Rhonda; Olson, Eric N.; Lingrel, Jerry B.; Ho, Shuk-Mei; Weintraub, Neal L.

    2011-01-01

    Differentiation of preadipocytes into mature adipocytes capable of efficiently storing lipids is an important regulatory mechanism in obesity. Here, we examined the involvement of histone deacetylases (HDACs) and histone acetyltransferases (HATs) in the regulation of adipogenesis. We find that among the various members of the HDAC and HAT families, only HDAC9 exhibited dramatic down-regulation preceding adipogenic differentiation. Preadipocytes from HDAC9 gene knock-out mice exhibited accelerated adipogenic differentiation, whereas HDAC9 overexpression in 3T3-L1 preadipocytes suppressed adipogenic differentiation, demonstrating its direct role as a negative regulator of adipogenesis. HDAC9 expression was higher in visceral as compared with subcutaneous preadipocytes, negatively correlating with their potential to undergo adipogenic differentiation in vitro. HDAC9 localized in the nucleus, and its negative regulation of adipogenesis segregates with the N-terminal nuclear targeting domain, whereas the C-terminal deacetylase domain is dispensable for this function. HDAC9 co-precipitates with USF1 and is recruited with USF1 at the E-box region of the C/EBPα gene promoter in preadipocytes. Upon induction of adipogenic differentiation, HDAC9 is down-regulated, leading to its dissociation from the USF1 complex, whereas p300 HAT is up-regulated to allow its association with USF1 and accumulation at the E-box site of the C/EBPα promoter in differentiated adipocytes. This reciprocal regulation of HDAC9 and p300 HAT in the USF1 complex is associated with increased C/EBPα expression, a master regulator of adipogenic differentiation. These findings provide new insights into mechanisms of adipogenic differentiation and document a critical regulatory role for HDAC9 in adipogenic differentiation through a deacetylase-independent mechanism. PMID:21680747

  7. Regulation of FGF signaling: Recent insights from studying positive and negative modulators.

    PubMed

    Korsensky, Lina; Ron, Dina

    2016-05-01

    Fibroblast growth factor (FGF) signaling is involved in a multitude of biological processes, while impairment of FGF signaling is implicated in a variety of human diseases including developmental disorders and cancer. Therefore, it is not surprising that FGF activity is regulated at multiple and distinct levels. This review focuses on positive and negative modulation of the FGF signal exemplified by recently identified protein modulators anosmin-1, fibronectin-leucine-rich transmembrane protein 3 (FLRT3) and similar expression to FGF (Sef). We examine how these proteins regulate FGF signaling at multiple levels and across species. Finally, we describe the role of these regulators in human disease. PMID:26903404

  8. Integrating Negative Affect Measures in a Measurement Model: Assessing the Function of Negative Affect as Interference to Self-Regulation

    ERIC Educational Resources Information Center

    Magno, Carlo

    2010-01-01

    The present study investigated the composition of negative affect and its function as inhibitory to thought processes such as self-regulation. Negative affect in the present study were composed of anxiety, worry, thought suppression, and fear of negative evaluation. These four factors were selected based on the criteria of negative affect by…

  9. CD23 can negatively regulate B-cell receptor signaling

    PubMed Central

    Liu, Chaohong; Richard, Katharina; Wiggins, Melvin; Zhu, Xiaoping; Conrad, Daniel H.; Song, Wenxia

    2016-01-01

    CD23 has been implicated as a negative regulator of IgE and IgG antibody responses. However, whether CD23 has any role in B-cell activation remains unclear. We examined the expression of CD23 in different subsets of peripheral B cells and the impact of CD23 expression on the early events of B-cell receptor (BCR) activation using CD23 knockout (KO) mice. We found that in addition to marginal zone B cells, mature follicular B cells significantly down regulate the surface expression level of CD23 after undergoing isotype switch and memory B-cell differentiation. Upon stimulation with membrane-associated antigen, CD23 KO causes significant increases in the area of B cells contacting the antigen-presenting membrane and the magnitude of BCR clustering. This enhanced cell spreading and BCR clustering is concurrent with increases in the levels of phosphorylation of tyrosine and Btk, as well as the levels of F-actin and phosphorylated Wiskott Aldrich syndrome protein, an actin nucleation promoting factor, in the contract zone of CD23 KO B cells. These results reveal a role of CD23 in the negative regulation of BCR signaling in the absence of IgE immune complex and suggest that CD23 down-regulates BCR signaling by influencing actin-mediated BCR clustering and B-cell morphological changes. PMID:27181049

  10. CD23 can negatively regulate B-cell receptor signaling.

    PubMed

    Liu, Chaohong; Richard, Katharina; Wiggins, Melvin; Zhu, Xiaoping; Conrad, Daniel H; Song, Wenxia

    2016-01-01

    CD23 has been implicated as a negative regulator of IgE and IgG antibody responses. However, whether CD23 has any role in B-cell activation remains unclear. We examined the expression of CD23 in different subsets of peripheral B cells and the impact of CD23 expression on the early events of B-cell receptor (BCR) activation using CD23 knockout (KO) mice. We found that in addition to marginal zone B cells, mature follicular B cells significantly down regulate the surface expression level of CD23 after undergoing isotype switch and memory B-cell differentiation. Upon stimulation with membrane-associated antigen, CD23 KO causes significant increases in the area of B cells contacting the antigen-presenting membrane and the magnitude of BCR clustering. This enhanced cell spreading and BCR clustering is concurrent with increases in the levels of phosphorylation of tyrosine and Btk, as well as the levels of F-actin and phosphorylated Wiskott Aldrich syndrome protein, an actin nucleation promoting factor, in the contract zone of CD23 KO B cells. These results reveal a role of CD23 in the negative regulation of BCR signaling in the absence of IgE immune complex and suggest that CD23 down-regulates BCR signaling by influencing actin-mediated BCR clustering and B-cell morphological changes. PMID:27181049

  11. Regulation of positive and negative emotion: effects of sociocultural context

    PubMed Central

    Snyder, Sara A.; Heller, S. Megan; Lumian, Daniel S.; McRae, Kateri

    2013-01-01

    Previous research has demonstrated that the use of emotion regulation strategies can vary by sociocultural context. In a previous study, we reported changes in the use of two different emotion regulation strategies at an annual alternative cultural event, Burning Man (McRae et al., 2011). In this sociocultural context, as compared to typically at home, participants reported less use of expressive suppression (a strategy generally associated with maladaptive outcomes), and greater use of cognitive reappraisal (a strategy generally associated with adaptive outcomes). What remained unclear was whether these changes in self-reported emotion regulation strategy use were characterized by changes in the regulation of positive emotion, negative emotion, or both. We addressed this issue in the current study by asking Burning Man participants separate questions about positive and negative emotion. Using multiple datasets, we replicated our previous findings, and found that the decreased use of suppression is primarily driven by reports of decreased suppression of positive emotion at Burning Man. By contrast, the increased use of reappraisal is not characterized by differential reappraisal of positive and negative emotion at Burning Man. Moreover, we observed novel individual differences in the magnitude of these effects. The contextual changes in self-reported suppression that we observe are strongest for men and younger participants. For those who had previously attended Burning Man, we observed lower levels of self-reported suppression in both sociocultural contexts: Burning Man and typically at home. These findings have implications for understanding the ways in which certain sociocultural contexts may decrease suppression, and possibly minimize its associated maladaptive effects. PMID:23840191

  12. Positive and negative regulators of the metallothionein gene (review).

    PubMed

    Takahashi, Shinichiro

    2015-07-01

    Metallothioneins (MTs) are metal-binding proteins involved in diverse processes, including metal homeostasis and detoxification, the oxidative stress response and cell proliferation. Aberrant expression and silencing of these genes are important in a number of diseases. Several positive regulators of MT genes, including metal-responsive element-binding transcription factor (MTF)-1 and upstream stimulatory factor (USF)-1, have been identified and mechanisms of induction have been well described. However, the negative regulators of MT genes remain to be elucidated. Previous studies from the group of the present review have revealed that the hematopoietic master transcription factor, PU.1, directly represses the expression levels of MT genes through its epigenetic activities, and upregulation of MT results in the potent inhibition of myeloid differentiation. The present review focuses on PU.1 and several other negative regulators of this gene, including PZ120, DNA methyltransferase 3a with Mbd3 and Brg1 complex, CCAAT enhancer binding protein α and Ku protein, and describes the suppression of the MT genes through these transcription factors. PMID:25760317

  13. Regulations against the human nature

    NASA Astrophysics Data System (ADS)

    Elizondo-Garza, Fernando J.

    2001-05-01

    The discussion around the concept of the addiction to noise has evidenced the importance of noise for the human being and explains why in some cases the regulations fail to control the noise in cities. In this presentation the different uses, consciously or unconsciously, of the noise will be analyzed, uses that go from habits to maybe addictions. Also discussed are the implications of establishing regulations against the human nature as well as the importance of education to manage the noise and design acoustically instead of trying to ban the noise in some social circumstances.

  14. E3 ubiquitin ligase TRIM32 negatively regulates tumor suppressor p53 to promote tumorigenesis.

    PubMed

    Liu, Ju; Zhang, C; Wang, X L; Ly, P; Belyi, V; Xu-Monette, Z Y; Young, K H; Hu, W; Feng, Z

    2014-11-01

    Tumor suppressor p53 has a key role in maintaining genomic stability and preventing tumorigenesis through its regulation of cellular stress responses, including apoptosis, cell cycle arrest and senescence. To ensure its proper levels and functions in cells, p53 is tightly regulated mainly through post-translational modifications, such as ubiquitination. Here, we identified E3 ubiquitin ligase TRIM32 as a novel p53 target gene and negative regulator to regulate p53-mediated stress responses. In response to stress, such as DNA damage, p53 binds to the p53 responsive element in the promoter of the TRIM32 gene and transcriptionally induces the expression of TRIM32 in cells. In turn, TRIM32 interacts with p53 and promotes p53 degradation through ubiquitination. Thus, TRIM32 negatively regulates p53-mediated apoptosis, cell cycle arrest and senescence in response to stress. TRIM32 is frequently overexpressed in different types of human tumors. TRIM32 overexpression promotes cell oncogenic transformation and tumorigenesis in mice in a largely p53-dependent manner. Taken together, our results demonstrated that as a novel p53 target and a novel negative regulator for p53, TRIM32 has an important role in regulation of p53 and p53-mediated cellular stress responses. Furthermore, our results also revealed that impairing p53 function is a novel mechanism for TRIM32 in tumorigenesis. PMID:25146927

  15. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes

    PubMed Central

    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril

    2015-01-01

    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways. PMID:26617621

  16. Negative transcriptional regulation in the Caulobacter flagellar hierarchy.

    PubMed Central

    Xu, H; Dingwall, A; Shapiro, L

    1989-01-01

    The Caulobacter crescentus flagellum is formed at a specific time in the cell cycle and its assembly requires the ordered expression of a large number of genes. These genes are controlled in a positive trans-acting hierarchy that reflects the order of assembly of the flagellum. Using plasmids carrying transcriptional fusions of either a neo or a lux reporter gene to the promoters of three flagellar genes representing different ranks in the hierarchy (the hook operon, a basal body gene flbN, and the flaO gene), we have measured the level of chimeric gene expression in 13 flagellar mutant backgrounds. Mutants in the hook operon or in basal body genes caused overproduction of both hook operon and basal body gene chimeric mRNAs, suggesting that negative regulation is superimposed on the positive trans-acting control for these early events in the flagellar hierarchy. Mutants in the structural genes and in genes involved in flagellar assembly had no effect on flaO expression, placing the flaO gene near the top of the hierarchy. However, flaO expression appears to be under negative control by two regulatory genes flaS and flaW. Negative control, as a response to the completion of specific steps in the assembly process, may be an important mechanism used by the cell to turn off flagellar gene expression once the gene product is no longer needed. Images PMID:2771950

  17. Negative regulation of juvenile hormone analog for ecdysteroidogenic enzymes.

    PubMed

    Ogihara, Mari H; Hikiba, Juri; Iga, Masatoshi; Kataoka, Hiroshi

    2015-09-01

    Disruption of the appropriate balance between juvenile hormone (JH) and ecdysteroids causes abnormal insect development. The application of a JH analog (JHA) during the early days of the final (fifth) instar induces dauer larvae with low ecdysteroid titers in insects, but the mechanism that underlies the action of JHA remains unclear. In this study, we clarified the negative effects of JHA on ecdysteroidogenic enzymes. JHA application to Bombyx mori larvae during the early stage of the fifth instar suppressed the expression of four enzymes, i.e., neverland (nvd), spook, phantom, and disembodied but not non-molting glossy and shadow. Furthermore, JHA application reduced the amount of 7-dehydrocholesterol, a metabolite produced by Nvd, in both the prothoracic glands and hemolymph, indicating JHA can disrupt ecdysteroidogenic pathway from the first step. Neck ligation resulted in increased nvd expression, whereas JHA application reversed this increase. These results suggest that the endogenous JH represses ecdysteroidogenesis during the early days in final instar larvae. Neck ligation and JHA application had no substantial effects on the expression of a transcription factor, ftz-f1, or a prothoracicotropic hormone receptor, torso; therefore, the inhibitory regulation of JHA may not involve these factors. Further analysis is required to clarify the regulation of JHA in ecdysteroidogenesis, but this study showed that JHA, and probably endogenous JH, can suppress the transcription of four of six ecdysteroidogenic enzymes. This regulation may be essential for maintaining the appropriate balance between JH and ecdysone during insect development. PMID:25907890

  18. When death is not a problem: Regulating implicit negative affect under mortality salience.

    PubMed

    Lüdecke, Christina; Baumann, Nicola

    2015-12-01

    Terror management theory assumes that death arouses existential anxiety in humans which is suppressed in focal attention. Whereas most studies provide indirect evidence for negative affect under mortality salience by showing cultural worldview defenses and self-esteem strivings, there is only little direct evidence for implicit negative affect under mortality salience. In the present study, we assume that this implicit affective reaction towards death depends on people's ability to self-regulate negative affect as assessed by the personality dimension of action versus state orientation. Consistent with our expectations, action-oriented participants judged artificial words to express less negative affect under mortality salience compared to control conditions whereas state-oriented participants showed the reversed pattern. PMID:26335149

  19. Quantifying negative feedback regulation by micro-RNAs

    NASA Astrophysics Data System (ADS)

    Wang, Shangying; Raghavachari, Sridhar

    2011-10-01

    Micro-RNAs (miRNAs) play a crucial role in post-transcriptional gene regulation by pairing with target mRNAs to repress protein production. It has been shown that over one-third of human genes are targeted by miRNA. Although hundreds of miRNAs have been identified in mammalian genomes, the function of miRNA-based repression in the context of gene regulation networks still remains unclear. In this study, we explore the functional roles of feedback regulation by miRNAs. In a model where repression of translation occurs by sequestration of mRNA by miRNA, we find that miRNA and mRNA levels are anti-correlated, resulting in larger fluctuation in protein levels than theoretically expected assuming no correlation between miRNA and mRNA levels. If miRNA repression is due to a catalytic suppression of translation rates, we analytically show that the protein fluctuations can be strongly repressed with miRNA regulation. We also discuss how either of these modes may be relevant for cell function.

  20. ERK5 negatively regulates tobacco smoke-induced pulmonary epithelial–mesenchymal transition

    PubMed Central

    Liang, Zhaofeng; Xie, Wei; Wu, Rui; Geng, Hao; Zhao, Li; Xie, Chunfeng; Li, Xiaoting; Huang, Cong; Zhu, Jianyun; Zhu, Mingming; Zhu, Weiwei; Wu, Jieshu; Geng, Shanshan; Zhong, Caiyun

    2015-01-01

    As the primary cause of lung cancer, tobacco smoke (TS) promotes the initiation and progression of lung tumorigenesis. Epithelial-mesenchymal transition (EMT) is a crucial process involved in cell malignant transformation. The role of ERK5, the lesser studied member of MAPKs family, in regulating TS-triggered pulmonary EMT has not been investigated. Normal human bronchial epithelial cells and BALB/c mice were used as in vitro and in vivo TS exposure models. Exposure of normal human bronchial epithelial cells to TS for 7 days induced morphological change, enhanced migratory and invasive capacities, reduced epithelial marker expression and increased mesenchymal marker expression. Importantly, we demonstrated for the first time that ERK5 negatively regulated TS-mediated lung epithelial EMT, as evidenced by the findings that TS suppressed ERK5 activation, and that TS-triggered EMT was mimicked with ERK5 inhibition and reversed by ERK5 overexpression. The negative regulation of ERK5 on pulmonary EMT was further confirmed in mice exposed to TS for 12 weeks. Taken together, our data suggest that ERK5 negatively regulates TS-mediated pulmonary EMT. These findings provide new insight into the molecular mechanisms of TS-associated lung tumorigenesis and may open up new avenues in the search for potential target of lung cancer intervention. PMID:25965818

  1. Chondroitin-4-sulfation negatively regulates axonal guidance and growth

    PubMed Central

    Wang, Hang; Katagiri, Yasuhiro; McCann, Thomas E.; Unsworth, Edward; Goldsmith, Paul; Yu, Zu-Xi; Tan, Fei; Santiago, Lizzie; Mills, Edward M.; Wang, Yu; Symes, Aviva J.; Geller, Herbert M.

    2008-01-01

    Summary Glycosaminoglycan (GAG) side chains endow extracellular matrix proteoglycans with diversity and complexity based upon the length, composition, and charge distribution of the polysaccharide chain. Using cultured primary neurons, we show that specific sulfation in the GAG chains of chondroitin sulfate (CS) mediates neuronal guidance cues and axonal growth inhibition. Chondroitin-4-sulfate (CS-A), but not chondroitin-6-sulfate (CS-C), exhibits a strong negative guidance cue to mouse cerebellar granule neurons. Enzymatic and gene-based manipulations of 4-sulfation in the GAG side chains alter their ability to direct growing axons. Furthermore, 4-sulfated CS GAG chains are rapidly and significantly increased in regions that do not support axonal regeneration proximal to spinal cord lesions in mice. Thus, our findings provide the evidence showing that specific sulfation along the carbohydrate backbone carries instructions to regulate neuronal function. PMID:18768934

  2. SMN and coilin negatively regulate dyskerin association with telomerase RNA

    PubMed Central

    Poole, Aaron R.

    2016-01-01

    ABSTRACT Telomerase is a ribonucleoprotein comprising telomerase RNA and associated proteins. The formation of the telomerase holoenzyme takes place in the Cajal body (CB), a subnuclear domain that participates in the formation of ribonucleoproteins. CBs also contribute to the delivery of telomerase to telomeres. The protein WRAP53 is enriched within the CB and is instrumental for the targeting of telomerase RNA to CBs. Two other CB proteins, SMN and coilin, are also suspected of taking part in some aspect of telomerase biogenesis. Here we demonstrate newly discovered associations between SMN and coilin with telomerase components, and further show that reduction of SMN or coilin is correlated with increased association of telomerase RNA with one these components, dyskerin. These findings argue that SMN and coilin may negatively regulate the formation of telomerase. Furthermore, clinically defined SMN mutants found in individuals with spinal muscular atrophy are altered in their association with telomerase complex proteins. Additionally, we observe that a coilin derivative also associates with dyskerin, and the amount of this protein in the complex is regulated by SMN, WRAP53 and coilin levels. Collectively, our findings bolster the link between SMN, coilin and the coilin derivative in the biogenesis of telomerase. PMID:27215323

  3. SMN and coilin negatively regulate dyskerin association with telomerase RNA.

    PubMed

    Poole, Aaron R; Hebert, Michael D

    2016-01-01

    Telomerase is a ribonucleoprotein comprising telomerase RNA and associated proteins. The formation of the telomerase holoenzyme takes place in the Cajal body (CB), a subnuclear domain that participates in the formation of ribonucleoproteins. CBs also contribute to the delivery of telomerase to telomeres. The protein WRAP53 is enriched within the CB and is instrumental for the targeting of telomerase RNA to CBs. Two other CB proteins, SMN and coilin, are also suspected of taking part in some aspect of telomerase biogenesis. Here we demonstrate newly discovered associations between SMN and coilin with telomerase components, and further show that reduction of SMN or coilin is correlated with increased association of telomerase RNA with one these components, dyskerin. These findings argue that SMN and coilin may negatively regulate the formation of telomerase. Furthermore, clinically defined SMN mutants found in individuals with spinal muscular atrophy are altered in their association with telomerase complex proteins. Additionally, we observe that a coilin derivative also associates with dyskerin, and the amount of this protein in the complex is regulated by SMN, WRAP53 and coilin levels. Collectively, our findings bolster the link between SMN, coilin and the coilin derivative in the biogenesis of telomerase. PMID:27215323

  4. Architecture and RNA binding of the human negative elongation factor

    PubMed Central

    Vos, Seychelle M; Pöllmann, David; Caizzi, Livia; Hofmann, Katharina B; Rombaut, Pascaline; Zimniak, Tomasz; Herzog, Franz; Cramer, Patrick

    2016-01-01

    Transcription regulation in metazoans often involves promoter-proximal pausing of RNA polymerase (Pol) II, which requires the 4-subunit negative elongation factor (NELF). Here we discern the functional architecture of human NELF through X-ray crystallography, protein crosslinking, biochemical assays, and RNA crosslinking in cells. We identify a NELF core subcomplex formed by conserved regions in subunits NELF-A and NELF-C, and resolve its crystal structure. The NELF-AC subcomplex binds single-stranded nucleic acids in vitro, and NELF-C associates with RNA in vivo. A positively charged face of NELF-AC is involved in RNA binding, whereas the opposite face of the NELF-AC subcomplex binds NELF-B. NELF-B is predicted to form a HEAT repeat fold, also binds RNA in vivo, and anchors the subunit NELF-E, which is confirmed to bind RNA in vivo. These results reveal the three-dimensional architecture and three RNA-binding faces of NELF. DOI: http://dx.doi.org/10.7554/eLife.14981.001 PMID:27282391

  5. Negative Regulation of Tumor Suppressor p53 by microRNA miR-504

    PubMed Central

    Hu, Wenwei; Chan, Chang S.; Wu, Rui; Zhang, Cen; Sun, Yvonne; Song, Jun S.; Tang, Laura H.; Levine, Arnold J.; Feng, Zhaohui

    2010-01-01

    Summary Tumor suppressor p53 plays a central role in tumor prevention. p53 protein levels and activity are under a tight and complex regulation in cells to maintain the proper function of p53. microRNAs play a key role in the regulation of gene expression. Here we report the regulation of p53 through microRNA miR-504. miR-504 acts as a negative regulator of human p53 through its direct binding to two sites in p53 3′-UTR. Overexpression of miR-504 decreases p53 protein levels and functions in cells, including p53 transcriptional activity, p53-mediated apoptosis and cell cycle arrest in response to stress, and furthermore, promotes tumorigenecity of cells in vivo. These results demonstrate the direct negative regulation of p53 by miR-504 as a mechanism for p53 regulation in cells, which highlights the importance of microRNAs in tumorigenesis. PMID:20542001

  6. MEIS1 functions as a potential AR negative regulator

    SciTech Connect

    Cui, Liang; Yang, Yutao; Hang, Xingyi; Cui, Jiajun; Gao, Jiangping

    2014-10-15

    The androgen receptor (AR) plays critical roles in human prostate carcinoma progression and transformation. However, the activation of AR is regulated by co-regulators. MEIS1 protein, the homeodomain transcription factor, exhibited a decreased level in poor-prognosis prostate tumors. In this study, we investigated a potential interaction between MEIS1 and AR. We found that overexpression of MEIS1 inhibited the AR transcriptional activity and reduced the expression of AR target gene. A potential protein–protein interaction between AR and MEIS1 was identified by the immunoprecipitation and GST pull-down assays. Furthermore, MEIS1 modulated AR cytoplasm/nucleus translocation and the recruitment to androgen response element in prostate specific antigen (PSA) gene promoter sequences. In addition, MEIS1 promoted the recruitment of NCoR and SMRT in the presence of R1881. Finally, MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells. Taken together, our data suggests that MEIS1 functions as a novel AR co-repressor. - Highlights: • A potential interaction was identified between MEIS1 and AR signaling. • Overexpression of MEIS1 reduced the expression of AR target gene. • MEIS1 modulated AR cytoplasm/nucleus translocation. • MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells.

  7. Organelle acidification negatively regulates vacuole membrane fusion in vivo

    PubMed Central

    Desfougères, Yann; Vavassori, Stefano; Rompf, Maria; Gerasimaite, Ruta; Mayer, Andreas

    2016-01-01

    The V-ATPase is a proton pump consisting of a membrane-integral V0 sector and a peripheral V1 sector, which carries the ATPase activity. In vitro studies of yeast vacuole fusion and evidence from worms, flies, zebrafish and mice suggested that V0 interacts with the SNARE machinery for membrane fusion, that it promotes the induction of hemifusion and that this activity requires physical presence of V0 rather than its proton pump activity. A recent in vivo study in yeast has challenged these interpretations, concluding that fusion required solely lumenal acidification but not the V0 sector itself. Here, we identify the reasons for this discrepancy and reconcile it. We find that acute pharmacological or physiological inhibition of V-ATPase pump activity de-acidifies the vacuole lumen in living yeast cells within minutes. Time-lapse microscopy revealed that de-acidification induces vacuole fusion rather than inhibiting it. Cells expressing mutated V0 subunits that maintain vacuolar acidity were blocked in this fusion. Thus, proton pump activity of the V-ATPase negatively regulates vacuole fusion in vivo. Vacuole fusion in vivo does, however, require physical presence of a fusion-competent V0 sector. PMID:27363625

  8. Bcr and Abr Cooperate in Negatively Regulating Acute Inflammatory Responses▿

    PubMed Central

    Cunnick, Jess M.; Schmidhuber, Sabine; Chen, Gang; Yu, Min; Yi, Sun-Ju; Cho, Young Jin; Kaartinen, Vesa; Minoo, Parviz; Warburton, David; Groffen, John; Heisterkamp, Nora

    2009-01-01

    Bcr and Abr are GTPase-activating proteins for the small GTPase Rac. Both proteins are expressed in cells of the innate immune system, including neutrophils and macrophages. The function of Bcr has been linked to the negative regulation of neutrophil reactive oxygen species (ROS) production, but the function of Abr in the innate immune system was unknown. Here, we report that mice lacking both proteins are severely affected in two models of experimental endotoxemia, including exposure to Escherichia coli lipopolysaccharide and polymicrobial sepsis, with extensive microvascular leakage, resulting in severe pulmonary edema and hemorrhage. Additionally, in vivo-activated neutrophils of abr and bcr null mutant mice produced excessive tissue-damaging myeloperoxidase (MPO), elastase, and ROS. Moreover, the secretion of the tissue metalloproteinase MMP9 by monocytes and ROS by elicited macrophages was abnormally high. In comparison, ROS production from bone marrow monocytes was not significantly different from that of controls, and the exocytosis of neutrophil secondary and tertiary granule products, including lactoferrin, was normal. These data show that Abr and Bcr normally curb very specific functions of mature tissue innate immune cells, and that each protein has distinct as well as partly overlapping functions in the downregulation of inflammatory processes. PMID:19703997

  9. Organelle acidification negatively regulates vacuole membrane fusion in vivo.

    PubMed

    Desfougères, Yann; Vavassori, Stefano; Rompf, Maria; Gerasimaite, Ruta; Mayer, Andreas

    2016-01-01

    The V-ATPase is a proton pump consisting of a membrane-integral V0 sector and a peripheral V1 sector, which carries the ATPase activity. In vitro studies of yeast vacuole fusion and evidence from worms, flies, zebrafish and mice suggested that V0 interacts with the SNARE machinery for membrane fusion, that it promotes the induction of hemifusion and that this activity requires physical presence of V0 rather than its proton pump activity. A recent in vivo study in yeast has challenged these interpretations, concluding that fusion required solely lumenal acidification but not the V0 sector itself. Here, we identify the reasons for this discrepancy and reconcile it. We find that acute pharmacological or physiological inhibition of V-ATPase pump activity de-acidifies the vacuole lumen in living yeast cells within minutes. Time-lapse microscopy revealed that de-acidification induces vacuole fusion rather than inhibiting it. Cells expressing mutated V0 subunits that maintain vacuolar acidity were blocked in this fusion. Thus, proton pump activity of the V-ATPase negatively regulates vacuole fusion in vivo. Vacuole fusion in vivo does, however, require physical presence of a fusion-competent V0 sector. PMID:27363625

  10. IKKα negatively regulates ASC-dependent inflammasome activation.

    PubMed

    Martin, Bradley N; Wang, Chenhui; Willette-Brown, Jami; Herjan, Tomasz; Gulen, Muhammet F; Zhou, Hao; Bulek, Katarzyna; Franchi, Luigi; Sato, Takashi; Alnemri, Emad S; Narla, Goutham; Zhong, Xiao-Ping; Thomas, James; Klinman, Dennis; Fitzgerald, Katherine A; Karin, Michael; Nuñez, Gabriel; Dubyak, George; Hu, Yinling; Li, Xiaoxia

    2014-01-01

    The inflammasomes are multiprotein complexes that activate caspase-1 in response to infections and stress, resulting in the secretion of pro-inflammatory cytokines. Here we report that IκB kinase α (IKKα) is a critical negative regulator of apoptosis-associated specklike protein containing a C-terminal caspase-activation-andrecruitment (CARD) domain (ASC)-dependent inflammasomes. IKKα controls the inflammasome at the level of the adaptor ASC, which interacts with IKKα in the nucleus of resting macrophages in an IKKα kinase-dependent manner. Loss of IKKα kinase activity results in inflammasome hyperactivation. Mechanistically, the downstream nuclear effector IKK-related kinase (IKKi) facilitates translocation of ASC from the nucleus to the perinuclear area during inflammasome activation. ASC remains under the control of IKKα in the perinuclear area following translocation of the ASC/IKKα complex. Signal 2 of NLRP3 activation leads to inhibition of IKKα kinase activity through the recruitment of PP2A, allowing ASC to participate in NLRP3 inflammasome assembly. Taken together, these findings reveal a IKKi-IKKα-ASC axis that serves as a common regulatory mechanism for ASC-dependent inflammasomes. PMID:25266676

  11. IKKα negatively regulates ASC-dependent inflammasome activation

    PubMed Central

    Martin, Bradley N.; Wang, Chenhui; Willette-Brown, Jami; Herjan, Tomasz; Gulen, Muhammet F.; Zhou, Hao; Bulek, Katarzyna; Franchi, Luigi; Sato, Takashi; Narla, Goutham; Zhong, Xiao-Ping; Thomas, James; Klinman, Dennis; Fitzgerald, Katherine A.; Karin, Michael; Nuñez, Gabriel; Dubyak, George; Hu, Yinling; Li, Xiaoxia

    2014-01-01

    The inflammasomes are multiprotein complexes that activate caspase-1 in response to infections and stress, resulting in the secretion of pro-inflammatory cytokines. Here we report that IKKα is a critical negative regulator of ASC-dependent inflammasomes. IKKα controls the inflammasome at the level of the adaptor ASC, which interacts with IKKα in the nucleus of resting macrophages in an IKKα kinase-dependent manner. Loss of IKKα kinase activity results in inflammasome hyperactivation. Mechanistically, the downstream nuclear effector IKKi facilitates translocation of ASC from the nucleus to the perinuclear area during inflammasome activation. ASC remains under the control of IKKα in the perinuclear area following translocation of the ASC/IKKα complex. Signal 2 of NLRP3 activation leads to inhibition of IKKα kinase activity through the recruitment of PP2A, allowing ASC to participate in NLRP3 inflammasome assembly. Taken together, these findings reveal a IKKi-IKKα-ASC axis that serves as a common regulatory mechanism for ASC-dependent inflammasomes. PMID:25266676

  12. TRIM65 negatively regulates p53 through ubiquitination.

    PubMed

    Li, Yang; Ma, Chengyuan; Zhou, Tong; Liu, Ying; Sun, Luyao; Yu, Zhenxiang

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. PMID:27012201

  13. MicroRNA-146a-5p Negatively Regulates Pro-Inflammatory Cytokine Secretion and Cell Activation in Lipopolysaccharide Stimulated Human Hepatic Stellate Cells through Inhibition of Toll-Like Receptor 4 Signaling Pathways.

    PubMed

    Chen, Yuhan; Zeng, Zhaochong; Shen, Xiaoyun; Wu, Zhifeng; Dong, Yinying; Cheng, Jason Chia-Hsien

    2016-01-01

    Lipopolysaccharide (LPS)/toll-like receptor 4 (TLR4) signaling pathway is demonstrated to be involved in the hepatic fibrosis. MicroRNA (miR)-146a-5p is a key regulator of the innate immune response. The functional significance of miR-146a-5p during the LPS/TLR4 mediated hepatic fibrosis process remains unclear. In this study, we found that TLR4 and α-smooth muscle actin (α-SMA) were up-regulated and miR-146a-5p was down-regulated in human hepatic stellate cell (HSC) line LX2 after LPS stimulation. Overexpression of miR-146a-5p inhibited LPS induced pro-inflammatory cytokines secretion through down-regulating the expression levels of TLR-4, IL-1 receptor-associated kinase 1 (IRAK1), TNF receptor associated factor-6 (TRAF6) and phosphorylation of nuclear factor-kappa B (NF-κB). Knockdown of IRAK1 and TRAF6 also suppressed pro-inflammatory cytokine production by inhibiting NF-κB phosphorylation. In addition, miR-146a-5p mimic blocked LPS induced TRAF6 dependent c-Jun N-terminal kinase (JNK) and Smad2 activation as well as α-SMA production. Taken together, these results suggest that miR-146a-5p suppresses pro-inflammatory cytokine secretion and cell activation of HSC through inhibition of TLR4/NF-κB and TLR4/TRAF6/JNK pathway. PMID:27399683

  14. MicroRNA-146a-5p Negatively Regulates Pro-Inflammatory Cytokine Secretion and Cell Activation in Lipopolysaccharide Stimulated Human Hepatic Stellate Cells through Inhibition of Toll-Like Receptor 4 Signaling Pathways

    PubMed Central

    Chen, Yuhan; Zeng, Zhaochong; Shen, Xiaoyun; Wu, Zhifeng; Dong, Yinying; Cheng, Jason Chia-Hsien

    2016-01-01

    Lipopolysaccharide (LPS)/toll-like receptor 4 (TLR4) signaling pathway is demonstrated to be involved in the hepatic fibrosis. MicroRNA (miR)-146a-5p is a key regulator of the innate immune response. The functional significance of miR-146a-5p during the LPS/TLR4 mediated hepatic fibrosis process remains unclear. In this study, we found that TLR4 and α-smooth muscle actin (α-SMA) were up-regulated and miR-146a-5p was down-regulated in human hepatic stellate cell (HSC) line LX2 after LPS stimulation. Overexpression of miR-146a-5p inhibited LPS induced pro-inflammatory cytokines secretion through down-regulating the expression levels of TLR-4, IL-1 receptor-associated kinase 1 (IRAK1), TNF receptor associated factor-6 (TRAF6) and phosphorylation of nuclear factor-kappa B (NF-κB). Knockdown of IRAK1 and TRAF6 also suppressed pro-inflammatory cytokine production by inhibiting NF-κB phosphorylation. In addition, miR-146a-5p mimic blocked LPS induced TRAF6 dependent c-Jun N-terminal kinase (JNK) and Smad2 activation as well as α-SMA production. Taken together, these results suggest that miR-146a-5p suppresses pro-inflammatory cytokine secretion and cell activation of HSC through inhibition of TLR4/NF-κB and TLR4/TRAF6/JNK pathway. PMID:27399683

  15. Glatiramer acetate treatment negatively regulates type I interferon signaling

    PubMed Central

    Molnarfi, Nicolas; Prod'homme, Thomas; Schulze-Topphoff, Ulf; Spencer, Collin M.; Weber, Martin S.; Patarroyo, Juan C.; Lalive, Patrice H.

    2015-01-01

    Objective: Glatiramer acetate (GA; Copaxone), a disease-modifying therapy for multiple sclerosis (MS), promotes development of anti-inflammatory (M2, type II) monocytes that can direct differentiation of regulatory T cells. We investigated the innate immune signaling pathways that participate in GA-mediated M2 monocyte polarization. Methods: Monocytes were isolated from myeloid differentiation primary response gene 88 (MyD88)–deficient, Toll-IL-1 receptor domain–containing adaptor inducing interferon (IFN)–β (TRIF)–deficient, IFN-α/β receptor subunit 1 (IFNAR1)–deficient, and wild-type (WT) mice and human peripheral blood. GA-treated monocytes were stimulated with Toll-like receptor ligands, then evaluated for activation of kinases and transcription factors involved in innate immunity, and secretion of proinflammatory cytokines. GA-treated mice were evaluated for cytokine secretion and susceptibility to experimental autoimmune encephalomyelitis. Results: GA-mediated inhibition of proinflammatory cytokine production by monocytes occurred independently of MyD88 and nuclear factor–κB, but was blocked by TRIF deficiency. Furthermore, GA did not provide clinical benefit in TRIF-deficient mice. GA inhibited activation of p38 mitogen-activated protein kinase, an upstream regulator of activating transcription factor (ATF)–2, and c-Jun N-terminal kinase 1, which regulates IFN regulatory factor 3 (IRF3). Consequently, nuclear translocation of ATF-2 and IRF3, components of the IFN-β enhanceosome, was impaired. Consistent with these observations, GA inhibited production of IFN-β in vivo in WT mice, but did not modulate proinflammatory cytokine production by monocytes from IFNAR1-deficient mice. Conclusion: Our results demonstrate that GA inhibits the type I IFN pathway in M2 polarization of monocytes independently of MyD88, providing an important mechanism connecting innate and adaptive immune modulation in GA therapy and valuable insight regarding its

  16. Negative feedback confers mutational robustness in yeast transcription factor regulation

    PubMed Central

    Denby, Charles M.; Im, Joo Hyun; Yu, Richard C.; Pesce, C. Gustavo; Brem, Rachel B.

    2012-01-01

    Organismal fitness depends on the ability of gene networks to function robustly in the face of environmental and genetic perturbations. Understanding the mechanisms of this stability is one of the key aims of modern systems biology. Dissecting the basis of robustness to mutation has proven a particular challenge, with most experimental models relying on artificial DNA sequence variants engineered in the laboratory. In this work, we hypothesized that negative regulatory feedback could stabilize gene expression against the disruptions that arise from natural genetic variation. We screened yeast transcription factors for feedback and used the results to establish ROX1 (Repressor of hypOXia) as a model system for the study of feedback in circuit behaviors and its impact across genetically heterogeneous populations. Mutagenesis experiments revealed the mechanism of Rox1 as a direct transcriptional repressor at its own gene, enabling a regulatory program of rapid induction during environmental change that reached a plateau of moderate steady-state expression. Additionally, in a given environmental condition, Rox1 levels varied widely across genetically distinct strains; the ROX1 feedback loop regulated this variation, in that the range of expression levels across genetic backgrounds showed greater spread in ROX1 feedback mutants than among strains with the ROX1 feedback loop intact. Our findings indicate that the ROX1 feedback circuit is tuned to respond to perturbations arising from natural genetic variation in addition to its role in induction behavior. We suggest that regulatory feedback may be an important element of the network architectures that confer mutational robustness across biology. PMID:22355134

  17. RivR is a negative regulator of virulence factor expression in group A Streptococcus.

    PubMed

    Treviño, Jeanette; Liu, Zhuyun; Cao, Tram N; Ramirez-Peña, Esmeralda; Sumby, Paul

    2013-01-01

    The bacterial pathogen group A Streptococcus (GAS) causes human diseases ranging from self-limiting pharyngitis (also known as strep throat) to severely invasive necrotizing fasciitis (also known as the flesh-eating syndrome). To control virulence factor expression, GAS utilizes both protein- and RNA-based mechanisms of regulation. Here we report that the transcription factor RivR (RofA-like protein IV) negatively regulates the abundance of mRNAs encoding the hyaluronic acid capsule biosynthesis proteins (hasABC; ∼7-fold) and the protein G-related α(2)-macroglobulin-binding protein (grab; ∼29-fold). Our data differ significantly from those of a previous study of the RivR regulon. Given that grab and hasABC are also negatively regulated by the two-component system CovR/S (control of virulence), we tested whether RivR functions through CovR/S. A comparison of riv and cov single and double mutant strains showed that RivR requires CovR activity for grab and hasABC regulation. Analysis of the upstream region of rivR identified a novel promoter the deletion of which reduced rivR mRNA abundance by 70%. A rivR mutant strain had a reduced ability to adhere to human keratinocytes relative to that of the parental and complemented strains, a phenotype that was abolished upon GAS pretreatment with hyaluronidase, highlighting the importance of capsule regulation by RivR during colonization. The rivR mutant strain was also attenuated for virulence in a murine model of bacteremia infection. Thus, we identify RivR as an important regulator of GAS virulence and provide new insight into the regulatory networks controlling virulence factor production in this pathogen. PMID:23147037

  18. RivR Is a Negative Regulator of Virulence Factor Expression in Group A Streptococcus

    PubMed Central

    Treviño, Jeanette; Liu, Zhuyun; Cao, Tram N.; Ramirez-Peña, Esmeralda

    2013-01-01

    The bacterial pathogen group A Streptococcus (GAS) causes human diseases ranging from self-limiting pharyngitis (also known as strep throat) to severely invasive necrotizing fasciitis (also known as the flesh-eating syndrome). To control virulence factor expression, GAS utilizes both protein- and RNA-based mechanisms of regulation. Here we report that the transcription factor RivR (RofA-like protein IV) negatively regulates the abundance of mRNAs encoding the hyaluronic acid capsule biosynthesis proteins (hasABC; ∼7-fold) and the protein G-related α2-macroglobulin-binding protein (grab; ∼29-fold). Our data differ significantly from those of a previous study of the RivR regulon. Given that grab and hasABC are also negatively regulated by the two-component system CovR/S (control of virulence), we tested whether RivR functions through CovR/S. A comparison of riv and cov single and double mutant strains showed that RivR requires CovR activity for grab and hasABC regulation. Analysis of the upstream region of rivR identified a novel promoter the deletion of which reduced rivR mRNA abundance by 70%. A rivR mutant strain had a reduced ability to adhere to human keratinocytes relative to that of the parental and complemented strains, a phenotype that was abolished upon GAS pretreatment with hyaluronidase, highlighting the importance of capsule regulation by RivR during colonization. The rivR mutant strain was also attenuated for virulence in a murine model of bacteremia infection. Thus, we identify RivR as an important regulator of GAS virulence and provide new insight into the regulatory networks controlling virulence factor production in this pathogen. PMID:23147037

  19. RNF4 negatively regulates NF-κB signaling by down-regulating TAB2.

    PubMed

    Tan, Bo; Mu, Rui; Chang, Yan; Wang, Yu-Bo; Wu, Min; Tu, Hai-Qing; Zhang, Yu-Cheng; Guo, Sai-Sai; Qin, Xuan-He; Li, Tao; Li, Wei-Hua; Zhang, Xue-Min; Li, Ai-Ling; Li, Hui-Yan

    2015-09-14

    Most of NF-κB (nuclear factor kappa B) signaling molecules have various types of post-translational modifications. In this study, we focused on ubiquitination and designed a siRNA library including most ubiquitin-binding domains. With this library, we identified several candidate regulators of canonical NF-κB pathway, including RNF4. Overexpression of RNF4 impaired NF-κB activation in a dose-dependent manner, whereas RNF4 knockdown potentiated NF-κB activation. We showed that RNF4 interacts with the TAK1-TAB2-TAB3 complex, but not TAB1. Further, we found that RNF4 specifically down-regulated TAB2 through a lysosomal pathway, and knockdown of RNF4 impaired endogenous TAB2 degradation. Therefore, our findings will provide new insights into the negative regulation of NF-κB signaling. PMID:26299341

  20. p53 negatively regulates Aurora A via both transcriptional and posttranslational regulation

    PubMed Central

    Wu, Chun-Chi; Yang, Tsung-Ying; Yu, Chang-Tze Ricky; Phan, Liem; Ivan, Cristina; Sood, Anil K.; Hsu, Shih-Lan; Lee, Mong-Hong

    2012-01-01

    p53 plays an important role in mitotic checkpoint, but what its role is remains enigmatic. Aurora A is a Ser/Thr kinase involved in correcting progression of mitosis. Here, we show that p53 is a negative regulator for Aurora A. We found that p53 deficiency leads to Aurora A elevation. Ectopic expression of p53 or DNA damage-induced expression of p53 can suppress the expression of Aurora A. Mechanistic studies show that p53 is a negative regulator for Aurora A expression through both transcriptional and posttranslational regulation. p53 knockdown in cancer cells reduces the level of p21, which, in turn, increases the activity of CDK2 followed by induction of Rb1 hyperphosphorylation and its dissociation with transcriptional factor E2F3. E2F3 can bind to Aurora A gene promoter, potentiating Aurora A gene expression and p53 deficiency, enhancing the binding of E2F3 on Aurora A promoter. Also, p53 deficiency leads to decelerating Aurora A’s turnover rate, due to the fact that p53 deficiency causes the downregulation of Fbw7α, a component of E3 ligase of Aurora A. Consistently, p53 knockdown-mediated Aurora A elevation is mitigated when Fbw7α is ectopically expressed. Thus, p53-mediated Aurora A degradation requires Fbw7α expression. Significantly, inverse correlation between p53 and Aurora A elevation is translated into the deregulation of centrosome amplification. p53 knockdown leads to high percentages of cells with abnormal amplification of centrosome. These data suggest that p53 is an important negative regulator of Aurora A, and that loss of p53 in many types of cancer could lead to abnormal elevation of Aurora A and dysregulated mitosis, which provides a growth advantage for cancer cells. PMID:22894933

  1. Simultaneous positive and negative external mechanical work in human walking.

    PubMed

    Donelan, J Maxwell; Kram, Rodger; Kuo, Arthur D

    2002-01-01

    In human walking, the center of mass motion is similar to an inverted pendulum. Viewing double support as a transition from one inverted pendulum to the next, we hypothesized that the leading leg performs negative work to redirect the center of mass velocity, while simultaneously, the trailing leg performs positive work to replace the lost energy. To test this hypothesis, we developed a method to quantify the external mechanical work performed by each limb (individual limbs method). Traditional measures of external mechanical work use the sum of the ground reaction forces acting on the limbs (combined limbs method) allowing for the mathematical cancellation of simultaneous positive and negative work during multiple support periods. We expected to find that the traditional combined limbs method underestimates external mechanical work by a substantial amount. We used both methods to measure the external mechanical work performed by humans walking over a range of speeds. We found that during double support, the legs perform a substantial amount of positive and negative external work simultaneously. The combined limbs measures of positive and negative external work were approximately 33% less than those calculated using the individual limbs method. At all speeds, the trailing leg performs greater than 97% of the double support positive work while the leading leg performs greater than 94% of the double support negative work. PMID:11747890

  2. MDM2/MDMX: Master negative regulators for p53 and RB.

    PubMed

    Hu, Linshan; Zhang, Haibo; Bergholz, Johann; Sun, Shengnan; Xiao, Zhi-Xiong Jim

    2016-03-01

    MDM2 (mouse double minute 2 homolog) and MDMX (double minute X human homolog, also known as MDM4) are critical negative regulators of tumor protein p53. Our recent work shows that MDMX binds to and promotes degradation of retinoblastoma protein (RB) in an MDM2-dependent manner. In a xenograft tumor growth mouse model, silencing of MDMX results in inhibition of p53-deficient tumor growth, which can be effectively reversed by concomitant RB silencing. Thus, MDMX exerts its oncogenic activity via suppression of RB. PMID:27308631

  3. MiR-214 suppressed ovarian cancer and negatively regulated semaphorin 4D.

    PubMed

    Liu, Yang; Zhou, Honglin; Ma, Lan; Hou, Youfang; Pan, Jing; Sun, Chunyi; Yang, Yingying; Zhang, Jie

    2016-06-01

    Ovarian cancer is one of the most common human malignancies in women. MiR-214 and semaphorin 4D (sema 4D) were found to be abhorrently expressed and involved in the progress of several kinds of malignant cancers. This study is aimed to investigate the cellular role of miR-214 and demonstrate that miR-214 negatively regulated sema 4D in ovarian cancer cells. The data showed that miR-214 expression was consistently lower in ovarian cancer tissues and cells than those in the normal controls. Over-expression of miR-214 in ovarian cancer SKOV-3 cells inhibited cell proliferation and induced apoptosis. It was suggested that miR-214 functioned as the tumor suppressor in ovarian cancer. Bioinformatic analysis indicated that miR-214 possibly regulated sema 4D by binding the sema 4D messenger RNA (mRNA) 3'-untranslated region (UTR). Sema 4D mRNA and protein levels were up-regulated in ovarian cancer tissues and SKOV-3 cells. Up-regulation of miR-214 in SKOV-3 cell line suppressed the sema 4D expression in both protein and nucleic acid levels. While, down-regulation of miR-214 in SKOV-3 cells would increase sema 4D protein and nucleic acid expression levels. The effects of miR-214 up- and down-regulation on luciferase activities of wild-type (WT) sema 4D 3'-UTR were completely removed upon introduction of mutation in 3'-UTR of WT sema 4D. Therefore, the data also demonstrated that sema 4D was the direct target of miR-214 and was negatively regulated by miR-214 in ovarian cancer cells. PMID:26718213

  4. PINK1 Is a Negative Regulator of Growth and the Warburg Effect in Glioblastoma.

    PubMed

    Agnihotri, Sameer; Golbourn, Brian; Huang, Xi; Remke, Marc; Younger, Susan; Cairns, Rob A; Chalil, Alan; Smith, Christian A; Krumholtz, Stacey-Lynn; Mackenzie, Danielle; Rakopoulos, Patricia; Ramaswamy, Vijay; Taccone, Michael S; Mischel, Paul S; Fuller, Gregory N; Hawkins, Cynthia; Stanford, William L; Taylor, Michael D; Zadeh, Gelareh; Rutka, James T

    2016-08-15

    Proliferating cancer cells are characterized by high rates of glycolysis, lactate production, and altered mitochondrial metabolism. This metabolic reprogramming provides important metabolites for proliferation of tumor cells, including glioblastoma. These biological processes, however, generate oxidative stress that must be balanced through detoxification of reactive oxygen species (ROS). Using an unbiased retroviral loss-of-function screen in nontransformed human astrocytes, we demonstrate that mitochondrial PTEN-induced kinase 1 (PINK1) is a regulator of the Warburg effect and negative regulator of glioblastoma growth. We report that loss of PINK1 contributes to the Warburg effect through ROS-dependent stabilization of hypoxia-inducible factor-1A and reduced pyruvate kinase muscle isozyme 2 activity, both key regulators of aerobic glycolysis. Mechanistically, PINK1 suppresses ROS and tumor growth through FOXO3a, a master regulator of oxidative stress and superoxide dismutase 2. These findings highlight the importance of PINK1 and ROS balance in normal and tumor cells. PINK1 loss was observed in a significant number of human brain tumors including glioblastoma (n > 900) and correlated with poor patient survival. PINK1 overexpression attenuates in vivo glioblastoma growth in orthotopic mouse xenograft models and a transgenic glioblastoma model in Drosophila Cancer Res; 76(16); 4708-19. ©2016 AACR. PMID:27325644

  5. Psoriasis is characterized by deficient negative immune regulation compared to transient delayed-type hypersensitivity reactions.

    PubMed

    Gulati, Nicholas; Suárez-Fariñas, Mayte; Correa da Rosa, Joel; Krueger, James G

    2015-01-01

    Diphencyprone (DPCP) is a hapten that causes delayed-type hypersensitivity (DTH) reactions in human skin, and is used as a topical therapeutic for alopecia areata, warts, and cutaneous melanoma metastases.  We examined peak DTH reactions induced by DPCP (3 days post-challenge) by comprehensive gene expression and histological analysis.  To better understand how these DTH reactions naturally resolve, we compared our DPCP biopsies to those from patients with psoriasis vulgaris, a chronic inflammatory disease that does not resolve.  By both microarray and qRT-PCR, we found that psoriasis lesional skin has significantly lower expression of many negative immune regulators compared to peak DPCP reactions.  These regulators include: interleukin-10, cytotoxic T lymphocyte-associated 4 (CTLA4), programmed cell death 1 (PD1), programmed cell death 1 ligand 1 (PDL1), programmed cell death 1 ligand 2 (PDL2), and indoleamine 2,3-dioxygenase (IDO1).  Their decreased expression was confirmed at the protein level by immunohistochemistry.  To more completely determine the balance of positive vs. negative immune regulators in both DPCP reactions and psoriasis, we developed one comprehensive gene list for positive regulatory (inflammatory) genes, and another for negative regulatory (immunosuppressive) genes, through Gene Ontology terms and literature review.  With this approach, we found that DPCP reactions have a higher ratio of negative to positive regulatory genes (both in terms of quantity and expression levels) than psoriasis lesional skin.  These data suggest that the disease chronicity that distinguishes psoriasis from transient DTH reactions may be related to absence of negative immune regulatory pathways, and induction of these is therefore of therapeutic interest.  Further study of these negative regulatory mechanisms that are present in DPCP reactions, but not in psoriasis, could reveal novel players in the pathogenesis of chronic inflammation.  The DPCP system

  6. Psoriasis is characterized by deficient negative immune regulation compared to transient delayed-type hypersensitivity reactions

    PubMed Central

    Gulati, Nicholas; Suárez-Fariñas, Mayte; Correa da Rosa, Joel; Krueger, James G.

    2015-01-01

    Diphencyprone (DPCP) is a hapten that causes delayed-type hypersensitivity (DTH) reactions in human skin, and is used as a topical therapeutic for alopecia areata, warts, and cutaneous melanoma metastases.  We examined peak DTH reactions induced by DPCP (3 days post-challenge) by comprehensive gene expression and histological analysis.  To better understand how these DTH reactions naturally resolve, we compared our DPCP biopsies to those from patients with psoriasis vulgaris, a chronic inflammatory disease that does not resolve.  By both microarray and qRT-PCR, we found that psoriasis lesional skin has significantly lower expression of many negative immune regulators compared to peak DPCP reactions.  These regulators include: interleukin-10, cytotoxic T lymphocyte-associated 4 (CTLA4), programmed cell death 1 (PD1), programmed cell death 1 ligand 1 (PDL1), programmed cell death 1 ligand 2 (PDL2), and indoleamine 2,3-dioxygenase (IDO1).  Their decreased expression was confirmed at the protein level by immunohistochemistry.  To more completely determine the balance of positive vs. negative immune regulators in both DPCP reactions and psoriasis, we developed one comprehensive gene list for positive regulatory (inflammatory) genes, and another for negative regulatory (immunosuppressive) genes, through Gene Ontology terms and literature review.  With this approach, we found that DPCP reactions have a higher ratio of negative to positive regulatory genes (both in terms of quantity and expression levels) than psoriasis lesional skin.  These data suggest that the disease chronicity that distinguishes psoriasis from transient DTH reactions may be related to absence of negative immune regulatory pathways, and induction of these is therefore of therapeutic interest.  Further study of these negative regulatory mechanisms that are present in DPCP reactions, but not in psoriasis, could reveal novel players in the pathogenesis of chronic inflammation.  The DPCP system

  7. Suppressor of IKKɛ is an essential negative regulator of pathological cardiac hypertrophy

    PubMed Central

    Deng, Ke-Qiong; Wang, Aibing; Ji, Yan-Xiao; Zhang, Xiao-Jing; Fang, Jing; Zhang, Yan; Zhang, Peng; Jiang, Xi; Gao, Lu; Zhu, Xue-Yong; Zhao, Yichao; Gao, Lingchen; Yang, Qinglin; Zhu, Xue-Hai; Wei, Xiang; Pu, Jun; Li, Hongliang

    2016-01-01

    Although pathological cardiac hypertrophy represents a leading cause of morbidity and mortality worldwide, our understanding of the molecular mechanisms underlying this disease is still poor. Here, we demonstrate that suppressor of IKKɛ (SIKE), a negative regulator of the interferon pathway, attenuates pathological cardiac hypertrophy in rodents and non-human primates in a TANK-binding kinase 1 (TBK1)/AKT-dependent manner. Sike-deficient mice develop cardiac hypertrophy and heart failure, whereas Sike-overexpressing transgenic (Sike-TG) mice are protected from hypertrophic stimuli. Mechanistically, SIKE directly interacts with TBK1 to inhibit the TBK1-AKT signalling pathway, thereby achieving its anti-hypertrophic action. The suppression of cardiac remodelling by SIKE is further validated in rats and monkeys. Collectively, these findings identify SIKE as a negative regulator of cardiac remodelling in multiple animal species due to its inhibitory regulation of the TBK1/AKT axis, suggesting that SIKE may represent a therapeutic target for the treatment of cardiac hypertrophy and heart failure. PMID:27249321

  8. Mechanisms of JAK/STAT pathway negative regulation by the short coreceptor Eye Transformer/Latran

    PubMed Central

    Fisher, Katherine H.; Stec, Wojciech; Brown, Stephen; Zeidler, Martin P.

    2016-01-01

    Transmembrane receptors interact with extracellular ligands to transduce intracellular signaling cascades, modulate target gene expression, and regulate processes such as proliferation, apoptosis, differentiation, and homeostasis. As a consequence, aberrant signaling events often underlie human disease. Whereas the vertebrate JAK/STAT signaling cascade is transduced via multiple receptor combinations, the Drosophila pathway has only one full-length signaling receptor, Domeless (Dome), and a single negatively acting receptor, Eye Transformer/Latran (Et/Lat). Here we investigate the molecular mechanisms underlying Et/Lat activity. We demonstrate that Et/Lat negatively regulates the JAK/STAT pathway activity and can bind to Dome, thus reducing Dome:Dome homodimerization by creating signaling-incompetent Dome:Et/Lat heterodimers. Surprisingly, we find that Et/Lat is able to bind to both JAK and STAT92E but, despite the presence of putative cytokine-binding motifs, does not detectably interact with pathway ligands. We find that Et/Lat is trafficked through the endocytic machinery for lysosomal degradation but at a much slower rate than Dome, a difference that may enhance its ability to sequester Dome into signaling-incompetent complexes. Our data offer new insights into the molecular mechanism and regulation of Et/Lat in Drosophila that may inform our understanding of how short receptors function in other organisms. PMID:26658615

  9. Mechanisms of JAK/STAT pathway negative regulation by the short coreceptor Eye Transformer/Latran.

    PubMed

    Fisher, Katherine H; Stec, Wojciech; Brown, Stephen; Zeidler, Martin P

    2016-02-01

    Transmembrane receptors interact with extracellular ligands to transduce intracellular signaling cascades, modulate target gene expression, and regulate processes such as proliferation, apoptosis, differentiation, and homeostasis. As a consequence, aberrant signaling events often underlie human disease. Whereas the vertebrate JAK/STAT signaling cascade is transduced via multiple receptor combinations, the Drosophila pathway has only one full-length signaling receptor, Domeless (Dome), and a single negatively acting receptor, Eye Transformer/Latran (Et/Lat). Here we investigate the molecular mechanisms underlying Et/Lat activity. We demonstrate that Et/Lat negatively regulates the JAK/STAT pathway activity and can bind to Dome, thus reducing Dome:Dome homodimerization by creating signaling-incompetent Dome:Et/Lat heterodimers. Surprisingly, we find that Et/Lat is able to bind to both JAK and STAT92E but, despite the presence of putative cytokine-binding motifs, does not detectably interact with pathway ligands. We find that Et/Lat is trafficked through the endocytic machinery for lysosomal degradation but at a much slower rate than Dome, a difference that may enhance its ability to sequester Dome into signaling-incompetent complexes. Our data offer new insights into the molecular mechanism and regulation of Et/Lat in Drosophila that may inform our understanding of how short receptors function in other organisms. PMID:26658615

  10. Identification of cis-acting repressive sequences within the negative regulatory element of human immunodeficiency virus type 1.

    PubMed Central

    Lu, Y C; Touzjian, N; Stenzel, M; Dorfman, T; Sodroski, J G; Haseltine, W A

    1990-01-01

    The negative regulatory element of human immunodeficiency virus type 1 is a 260-nucleotide-long sequence that decreases the rate of RNA transcription initiation specified by the long terminal repeat. This region has the potential to bind several cellular transcription factors. Here it is shown that sequences which recognize the NFAT-1 and USF cellular transcription factors contribute to this negative regulatory effect. The sequences within the negative regulatory element which resemble the AP-1 site and the URS do not negatively regulate human immunodeficiency virus long terminal repeat transcription initiation. PMID:2398545

  11. Children's Negative Emotionality Combined with Poor Self-Regulation Affects Allostatic Load in Adolescence

    ERIC Educational Resources Information Center

    Dich, Nadya; Doan, Stacey; Evans, Gary

    2015-01-01

    The present study examined the concurrent and prospective, longitudinal effects of childhood negative emotionality and self-regulation on allostatic load (AL), a physiological indicator of chronic stress. We hypothesized that negative emotionality in combination with poor self-regulation would predict elevated AL. Mothers reported on children's…

  12. Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM

    SciTech Connect

    Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim

    2014-07-18

    Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations.

  13. Mammalian Maf1 is a negative regulator of transcription by all three nuclear RNA polymerases.

    PubMed

    Johnson, Sandra S; Zhang, Cheng; Fromm, Jody; Willis, Ian M; Johnson, Deborah L

    2007-05-11

    Most eukaryotic transcriptional regulators act in an RNA polymerase (Pol)-selective manner. Here we show that the human Maf1 protein negatively regulates transcription by all three nuclear Pols. Changes in Maf1 expression affect Pol I- and Pol III-dependent transcription in human glioblastoma lines. These effects are mediated, in part, through the ability of Maf1 to repress transcription of the TATA binding protein, TBP. Maf1 targets an Elk-1-binding site in the TBP promoter, and its occupancy of this region is reciprocal with that of Elk-1. Similarly, Maf1 occupancy of Pol III genes is inversely correlated with that of the initiation factor TFIIIB and Pol III. The phenotypic consequences of reducing Maf1 expression include changes in cell morphology and the accumulation of actin stress fibers, whereas Maf1 overexpression suppresses anchorage-independent growth. Together with the ability of Maf1 to reduce biosynthetic capacity, these findings support the idea that Maf1 regulates the transformation state of cells. PMID:17499043

  14. Cell cycle regulation of the human cdc2 gene.

    PubMed Central

    Dalton, S

    1992-01-01

    Transcription of the human cdc2 gene is cell cycle regulated and restricted to proliferating cells. Nuclear run-on assays show that cdc2 transcription is high in S and G2 phases of the cell cycle but low in G1. To investigate transcriptional control further, genomic clones of the human cdc2 gene containing 5' flanking sequences were isolated and shown to function as a growth regulated promoter in vivo when fused to a CAT reporter gene. In primary human fibroblasts, the human cdc2 promoter is negatively regulated by arrest of cell growth in a similar fashion to the endogenous gene. This requires specific 5' flanking upstream negative control (UNC) sequences which mediate repression. The retinoblastoma susceptibility gene product (Rb) specifically represses cdc2 transcription in cycling cells via 136 bp of 5' flanking sequence located between -245 and -109 within the UNC region. E2F binding sites in this region were shown to be essential for optimal repression. A model is proposed where Rb negatively regulates the cdc2 promoter in non-cycling and cycling G1 cells. Images PMID:1582409

  15. Muscles do more positive than negative work in human locomotion

    PubMed Central

    DeVita, Paul; Helseth, Joseph; Hortobagyi, Tibor

    2008-01-01

    Summary Muscle work during level walking and ascent and descent ramp and stairway walking was assessed in order to explore the proposition that muscles perform more positive than negative work during these locomotion tasks. Thirty four healthy human adults were tested while maintaining a constant average walking velocity in the five gait conditions. Ground reaction force and sagittal plane kinematic data were obtained during the stance phases of these gaits and used in inverse dynamic analyses to calculate joint torques and powers at the hip, knee and ankle. Muscle work was derived as the area under the joint power vs time curves and was partitioned into positive, negative and net components. Dependent t-tests were used to compare positive and negative work in level walking and net joint work between ascent and descent gaits on the ramp and stairs (P<0.010). Total negative and positive work in level walking was −34 J and 50 J, respectively, with the difference in magnitude being statistically significant (P<0.001). Level walking was therefore performed with 16 J of net positive muscle work per step. The magnitude of the net work in ramp ascent was 25% greater than the magnitude of net work in ramp descent (89 vs −71 J m−1, P<0.010). Similarly, the magnitude of the net work in stair ascent was 43% greater than the magnitude of net work in stair descent (107 vs −75 J step−1, P<0.000). We identified three potential causes for the reduced negative vs positive work in these locomotion tasks: (1) the larger magnitude of the accelerations induced by the larger ground reaction forces in descending compared to ascending gaits elicited greater energy dissipation in non-muscular tissues, (2) the ground reaction force vector was directed closer to the joint centers in ramp and stair descent compared to ascent, which reduced the load on the muscular tissues and their energy dissipating response, and (3) despite the need to produce negative muscle work in descending

  16. All-trans retinoic acid negatively regulates cytotoxic activities of nature killer cell line 92

    SciTech Connect

    Li Ang . E-mail: liang3829@sina.com.cn; He Meilan; Wang Hui; Qiao Bin; Chen Ping; Gu Hua; Zhang Mengjie; He Shengxiang

    2007-01-05

    NK cells are key components of innate immune systems and their activities are regulated by cytokines and hormones. All-trans retinoic acid (ATRA), as a metabolite of vitamin A and an immunomodulatory hormone, plays an important role in regulating immune responses. In the present study, we investigated the effect of ATRA on human NK cell line NK92. We found that ATRA dose-dependently suppressed cytotoxic activities of NK92 cells without affecting their proliferation. To explore the mechanisms underlying the ATRA influence on NK92 cells, we examined the production of cytokines (TNF-{alpha}, IFN-{gamma}), gene expression of cytotoxic-associated molecules (perforin, granzyme B, nature killer receptors (NCRs), and NKG2D), and the activation of NF-{kappa}B pathways related with immune response. Our results demonstrated that ATRA suppressed NF-{kappa}B activity and prevented I{kappa}B{alpha} degradation in a dose-dependent way, inhibited IFN-{gamma} production and gene expression of granzyme B and NKp46. Our findings suggest that ATRA is a negative regulator of NK92 cell activation and may act as a potential regulator of anti-inflammatory functions in vivo.

  17. Sorting nexin 9 negatively regulates invadopodia formation and function in cancer cells.

    PubMed

    Bendris, Nawal; Stearns, Carrie J S; Reis, Carlos R; Rodriguez-Canales, Jaime; Liu, Hui; Witkiewicz, Agnieszka W; Schmid, Sandra L

    2016-07-15

    The ability of cancer cells to degrade the extracellular matrix and invade interstitial tissues contributes to their metastatic potential. We recently showed that overexpression of sorting nexin 9 (SNX9) leads to increased cell invasion and metastasis in animal models, which correlates with increased SNX9 protein expression in metastases from human mammary cancers. Here, we report that SNX9 expression is reduced relative to neighboring normal tissues in primary breast tumors, and progressively reduced in more aggressive stages of non-small-cell lung cancers. We show that SNX9 is localized at invadopodia where it directly binds the invadopodia marker TKS5 and negatively regulates invadopodia formation and function. SNX9 depletion increases invadopodia number and the local recruitment of MT1-MMP by decreasing its internalization. Together, these effects result in increased localized matrix degradation. We further identify SNX9 as a Src kinase substrate and show that this phosphorylation is important for SNX9 activity in regulating cell invasion, but is dispensable for its function in regulating invadopodia. The diversified changes associated with SNX9 expression in cancer highlight its importance as a central regulator of cancer cell behavior. PMID:27278018

  18. Tissue damage negatively regulates LPS-induced macrophage necroptosis.

    PubMed

    Li, Z; Scott, M J; Fan, E K; Li, Y; Liu, J; Xiao, G; Li, S; Billiar, T R; Wilson, M A; Jiang, Y; Fan, J

    2016-09-01

    Infection is a common clinical complication following tissue damage resulting from surgery and severe trauma. Studies have suggested that cell pre-activation by antecedent trauma/tissue damage profoundly impacts the response of innate immune cells to a secondary infectious stimulus. Cell necroptosis, a form of regulated inflammatory cell death, is one of the mechanisms that control cell release of inflammatory mediators from important innate immune executive cells such as macrophages (Mφ), which critically regulate the progress of inflammation. In this study, we investigated the mechanism and role of trauma/tissue damage in the regulation of LPS-induced Mφ necroptosis using a mouse model simulating long-bone fracture. We demonstrate that LPS acting through Toll-like receptor (TLR) 4 promotes Mφ necroptosis. However, necroptosis is ameliorated by high-mobility group box 1 (HMGB1) release from damaged tissue. We show that HMGB1 acting through cell surface receptor for advanced glycation end products (RAGE) upregulates caveolin-1 expression, which in turn induces caveolae-mediated TLR4 internalization and desensitization to decrease Mφ necroptosis. We further show that RAGE-MyD88 activation of Cdc42 and subsequent activation of transcription factor Sp1 serves as a mechanism underlying caveolin-1 transcriptional upregulation. These results reveal a previous unidentified protective role of damage-associated molecular pattern (DAMP) molecules in restricting inflammation in response to exogenous pathogen-associated molecular pattern molecules. PMID:26943325

  19. Negative reciprocal regulation between Sirt1 and Per2 modulates the circadian clock and aging

    PubMed Central

    Wang, Rui-Hong; Zhao, Tingrui; Cui, Kairong; Hu, Gangqing; Chen, Qiang; Chen, Weiping; Wang, Xin-Wei; Soto-Gutierrez, Alejandro; Zhao, Keji; Deng, Chu-Xia

    2016-01-01

    Sirtuin 1 (SIRT1) is involved in both aging and circadian-clock regulation, yet the link between the two processes in relation to SIRT1 function is not clear. Using Sirt1-deficient mice, we found that Sirt1 and Period 2 (Per2) constitute a reciprocal negative regulation loop that plays important roles in modulating hepatic circadian rhythmicity and aging. Sirt1-deficient mice exhibited profound premature aging and enhanced acetylation of histone H4 on lysine16 (H4K16) in the promoter of Per2, the latter of which leads to its overexpression; in turn, Per2 suppresses Sirt1 transcription through binding to the Sirt1 promoter at the Clock/Bmal1 site. This negative reciprocal relationship between SIRT1 and PER2 was also observed in human hepatocytes. We further demonstrated that the absence of Sirt1 or the ectopic overexpression of Per2 in the liver resulted in a dysregulated pace of the circadian rhythm. The similar circadian rhythm was also observed in aged wild type mice. The interplay between Sirt1 and Per2 modulates aging gene expression and circadian-clock maintenance. PMID:27346580

  20. The Dishevelled-binding protein CXXC5 negatively regulates cutaneous wound healing

    PubMed Central

    Lee, Soung-Hoon; Kim, Mi-Yeon; Kim, Hyun-Yi; Lee, Young-Mi; Kim, Heesu; Nam, Kyoung Ae; Roh, Mi Ryung; Min, Do Sik; Chung, Kee Yang

    2015-01-01

    Wnt/β-catenin signaling plays important roles in cutaneous wound healing and dermal fibrosis. However, its regulatory mechanism has not been fully elucidated, and a commercially available wound-healing agent targeting this pathway is desirable but currently unavailable. We found that CXXC-type zinc finger protein 5 (CXXC5) serves as a negative feedback regulator of the Wnt/β-catenin pathway by interacting with the Dishevelled (Dvl) protein. In humans, CXXC5 protein levels were reduced in epidermal keratinocytes and dermal fibroblasts of acute wounds. A differential regulation of β-catenin, α-smooth muscle actin (α-SMA), and collagen I by overexpression and silencing of CXXC5 in vitro indicated a critical role for this factor in myofibroblast differentiation and collagen production. In addition, CXXC5−/− mice exhibited accelerated cutaneous wound healing, as well as enhanced keratin 14 and collagen synthesis. Protein transduction domain (PTD)–Dvl-binding motif (DBM), a competitor peptide blocking CXXC5-Dvl interactions, disrupted this negative feedback loop and activated β-catenin and collagen production in vitro. Co-treatment of skin wounds with PTD-DBM and valproic acid (VPA), a glycogen synthase kinase 3β (GSK3β) inhibitor which activates the Wnt/β-catenin pathway, synergistically accelerated cutaneous wound healing in mice. Together, these data suggest that CXXC5 would represent a potential target for future therapies aimed at improving wound healing. PMID:26056233

  1. [NEGATIVE REGULATORS OF TUMOR SUPPRESSOR P53 IN THE CONTEXT OF ANTICANCER THERAPY].

    PubMed

    Shuvalov, O Yu; Fedorova, O A; Petukhov, A V; Daks, A A; Vasilieva, E A; Grigorieva, T A; Ivanov, G S; Barlev, N A

    2015-01-01

    P53 protein is considered to be the major tumor suppressor in human cells. Cancer cells do not survive if the p53-mediated signaling pathways function properly. However, about half of all malignancies still express wild type p53. One of the explanations to this is that p53 is suppressed by overexpression of p53-specific E3-ubiquitin ligases: Mdm2, MdmX, Pirh2 and Cop1. Pharmacological inhibition of protein-protein interactions between p53 and these negative regulators is a promising therapeutic approach to treat cancers retaining wild type p53. To date, a series of chemical inhibitors of p53 interactions with Mdm2 and MdmX E3-ubiquitin ligases have been discovered and characterized. Several of them are in the early stages of clinical trials. Despite this fact, their clinical efficacy may be hampered by a number of reasons, including tumor-specific expression of multiple isoforms of the target E3-ligases, which become inert to treatment with small molecules. This and other biochemical mechanisms of possible resistance of tumor cells with wild type p53 to small molecules against its negative regulators will be discussed in this review. PMID:26995961

  2. Negative reciprocal regulation between Sirt1 and Per2 modulates the circadian clock and aging.

    PubMed

    Wang, Rui-Hong; Zhao, Tingrui; Cui, Kairong; Hu, Gangqing; Chen, Qiang; Chen, Weiping; Wang, Xin-Wei; Soto-Gutierrez, Alejandro; Zhao, Keji; Deng, Chu-Xia

    2016-01-01

    Sirtuin 1 (SIRT1) is involved in both aging and circadian-clock regulation, yet the link between the two processes in relation to SIRT1 function is not clear. Using Sirt1-deficient mice, we found that Sirt1 and Period 2 (Per2) constitute a reciprocal negative regulation loop that plays important roles in modulating hepatic circadian rhythmicity and aging. Sirt1-deficient mice exhibited profound premature aging and enhanced acetylation of histone H4 on lysine16 (H4K16) in the promoter of Per2, the latter of which leads to its overexpression; in turn, Per2 suppresses Sirt1 transcription through binding to the Sirt1 promoter at the Clock/Bmal1 site. This negative reciprocal relationship between SIRT1 and PER2 was also observed in human hepatocytes. We further demonstrated that the absence of Sirt1 or the ectopic overexpression of Per2 in the liver resulted in a dysregulated pace of the circadian rhythm. The similar circadian rhythm was also observed in aged wild type mice. The interplay between Sirt1 and Per2 modulates aging gene expression and circadian-clock maintenance. PMID:27346580

  3. The Dishevelled-binding protein CXXC5 negatively regulates cutaneous wound healing.

    PubMed

    Lee, Soung-Hoon; Kim, Mi-Yeon; Kim, Hyun-Yi; Lee, Young-Mi; Kim, Heesu; Nam, Kyoung Ae; Roh, Mi Ryung; Min, Do Sik; Chung, Kee Yang; Choi, Kang-Yell

    2015-06-29

    Wnt/β-catenin signaling plays important roles in cutaneous wound healing and dermal fibrosis. However, its regulatory mechanism has not been fully elucidated, and a commercially available wound-healing agent targeting this pathway is desirable but currently unavailable. We found that CXXC-type zinc finger protein 5 (CXXC5) serves as a negative feedback regulator of the Wnt/β-catenin pathway by interacting with the Dishevelled (Dvl) protein. In humans, CXXC5 protein levels were reduced in epidermal keratinocytes and dermal fibroblasts of acute wounds. A differential regulation of β-catenin, α-smooth muscle actin (α-SMA), and collagen I by overexpression and silencing of CXXC5 in vitro indicated a critical role for this factor in myofibroblast differentiation and collagen production. In addition, CXXC5(-/-) mice exhibited accelerated cutaneous wound healing, as well as enhanced keratin 14 and collagen synthesis. Protein transduction domain (PTD)-Dvl-binding motif (DBM), a competitor peptide blocking CXXC5-Dvl interactions, disrupted this negative feedback loop and activated β-catenin and collagen production in vitro. Co-treatment of skin wounds with PTD-DBM and valproic acid (VPA), a glycogen synthase kinase 3β (GSK3β) inhibitor which activates the Wnt/β-catenin pathway, synergistically accelerated cutaneous wound healing in mice. Together, these data suggest that CXXC5 would represent a potential target for future therapies aimed at improving wound healing. PMID:26056233

  4. Quantum structure of negation and conjunction in human thought

    PubMed Central

    Aerts, Diederik; Sozzo, Sandro; Veloz, Tomas

    2015-01-01

    We analyze in this paper the data collected in a set of experiments investigating how people combine natural concepts. We study the mutual influence of conceptual conjunction and negation by measuring the membership weights of a list of exemplars with respect to two concepts, e.g., Fruits and Vegetables, and their conjunction Fruits And Vegetables, but also their conjunction when one or both concepts are negated, namely, Fruits And Not Vegetables, Not Fruits And Vegetables, and Not Fruits And Not Vegetables. Our findings sharpen and advance existing analysis on conceptual combinations, revealing systematic deviations from classical (fuzzy set) logic and probability theory. And, more important, our results give further considerable evidence to the validity of our quantum-theoretic framework for the combination of two concepts. Indeed, the representation of conceptual negation naturally arises from the general assumptions of our two-sector Fock space model, and this representation faithfully agrees with the collected data. In addition, we find a new significant and a priori unexpected deviation from classicality, which can exactly be explained by assuming that human reasoning is the superposition of an “emergent reasoning” and a “logical reasoning,” and that these two processes are represented in a Fock space algebraic structure. PMID:26483715

  5. Quantum structure of negation and conjunction in human thought.

    PubMed

    Aerts, Diederik; Sozzo, Sandro; Veloz, Tomas

    2015-01-01

    We analyze in this paper the data collected in a set of experiments investigating how people combine natural concepts. We study the mutual influence of conceptual conjunction and negation by measuring the membership weights of a list of exemplars with respect to two concepts, e.g., Fruits and Vegetables, and their conjunction Fruits And Vegetables, but also their conjunction when one or both concepts are negated, namely, Fruits And Not Vegetables, Not Fruits And Vegetables, and Not Fruits And Not Vegetables. Our findings sharpen and advance existing analysis on conceptual combinations, revealing systematic deviations from classical (fuzzy set) logic and probability theory. And, more important, our results give further considerable evidence to the validity of our quantum-theoretic framework for the combination of two concepts. Indeed, the representation of conceptual negation naturally arises from the general assumptions of our two-sector Fock space model, and this representation faithfully agrees with the collected data. In addition, we find a new significant and a priori unexpected deviation from classicality, which can exactly be explained by assuming that human reasoning is the superposition of an "emergent reasoning" and a "logical reasoning," and that these two processes are represented in a Fock space algebraic structure. PMID:26483715

  6. Parental reactions to children's negative emotions: relationships with emotion regulation in children with an anxiety disorder.

    PubMed

    Hurrell, Katherine E; Hudson, Jennifer L; Schniering, Carolyn A

    2015-01-01

    Research has demonstrated that parental reactions to children's emotions play a significant role in the development of children's emotion regulation (ER) and adjustment. This study compared parent reactions to children's negative emotions between families of anxious and non-anxious children (aged 7-12) and examined associations between parent reactions and children's ER. Results indicated that children diagnosed with an anxiety disorder had significantly greater difficulty regulating a range of negative emotions and were regarded as more emotionally negative and labile by their parents. Results also suggested that mothers of anxious children espoused less supportive parental emotional styles when responding to their children's negative emotions. Supportive and non-supportive parenting reactions to children's negative emotions related to children's emotion regulation skills, with father's non-supportive parenting showing a unique relationship to children's negativity/lability. PMID:25527899

  7. PTEN Is a Negative Regulator of NK Cell Cytolytic Function

    PubMed Central

    Briercheck, Edward L.; Trotta, Rossana; Chen, Li; Hartlage, Alex S.; Cole, Jordan P.; Cole, Tyler D.; Mao, Charlene; Banerjee, Pinaki P.; Hsu, Hsiang-Ting; Mace, Emily M.; Ciarlariello, David; Mundy-Bosse, Bethany L.; Garcia-Cao, Isabel; Scoville, Steven D.; Yu, Lianbo; Pilarski, Robert; Carson, William E.; Leone, Gustavo; Pandolfi, Pier Paolo; Yu, Jianhua; Orange, Jordan S.; Caligiuri, Michael A.

    2015-01-01

    Human NK cells are characterized by their ability to initiate an immediate and direct cytolytic response to virally infected or malignantly transformed cells. Within human peripheral blood, the more mature CD56dim NK cell efficiently kills malignant targets at rest, whereas the less mature CD56bright NK cells cannot. In this study, we show that resting CD56bright NK cells express significantly more phosphatase and tensin homolog deleted on chromosome 10 (PTEN) protein when compared with CD56dim NK cells. Consistent with this, forced overexpression of PTEN in NK cells resulted in decreased cytolytic activity, and loss of PTEN in CD56bright NK cells resulted in elevated cytolytic activity. Comparable studies in mice showed PTEN overexpression did not alter NK cell development or NK cell–activating and inhibitory receptor expression yet, as in humans, did decrease expression of downstream NK activation targets MAPK and AKT during early cytolysis of tumor target cells. Confocal microscopy revealed that PTEN overexpression disrupts the NK cell’s ability to organize immunological synapse components including decreases in actin accumulation, polarization of the microtubule organizing center, and the convergence of cytolytic granules. In summary, our data suggest that PTEN normally works to limit the NK cell’s PI3K/AKT and MAPK pathway activation and the consequent mobilization of cytolytic mediators toward the target cell and suggest that PTEN is among the active regulatory components prior to human NK cells transitioning from the noncytolytic CD56bright NK cell to the cytolytic CD56dim NK cells. PMID:25595786

  8. RANKL Signaling and Osteoclastogenesis Is Negatively Regulated by Cardamonin

    PubMed Central

    Yadav, Vivek R.; Gupta, Subash C.; Reuter, Simone; Yamamoto, Norio; Murakami, Akira; Aggarwal, Bharat B.

    2013-01-01

    Bone loss/resorption or osteoporosis is a disease that is accelerated with aging and age-associated chronic diseases such as cancer. Bone loss has been linked with human multiple myeloma, breast cancer, and prostate cancer and is usually treated with bisphosphonates, and recently approved denosumab, an antibody against receptor activator of NF-κB ligand (RANKL). Because of the numerous side effects of the currently available drugs, the search continues for safe and effective therapies for bone loss. RANKL, a member of the TNF superfamily, has emerged as a major mediator of bone loss via activation of osteoclastogenesis. We have identified cardamonin, a chalcone isolated from Alpinia katsumadai Hayata that can affect osteoclastogenesis through modulation of RANKL. We found that treatment of monocytes with cardamonin suppressed RANKL-induced NF-κB activation and this suppression correlated with inhibition of IκBα kinase and of phosphorylation and degradation of IκBα, an inhibitor of NF-κB. Furthermore, cardamonin also downregulated RANKL-induced phosphorylation of MAPK including ERK and p38 MAPK. Cardamonin suppressed the RANKL-induced differentiation of monocytes to osteoclasts in a dose-dependent and time-dependent manner. We also found that an inhibitor of NF-κB essential modulator (NEMO) blocked RANKL-induced osteoclastogenesis, indicating a direct link with NF-κB. Finally, osteoclastogenesis induced by human breast cancer cells or human multiple myeloma cells were completely suppressed by cardamonin. Collectively, our results indicate that cardamonin suppresses osteoclastogenesis induced by RANKL and tumor cells by suppressing activation of the NF-κB and MAPK pathway. PMID:23691159

  9. Negative regulation of mitochondrial transcription by mitochondrial topoisomerase I

    PubMed Central

    Sobek, Stefan; Dalla Rosa, Ilaria; Pommier, Yves; Bornholz, Beatrice; Kalfalah, Faiza; Zhang, Hongliang; Wiesner, Rudolf J.; von Kleist-Retzow, Jürgen-Christoph; Hillebrand, Frank; Schaal, Heiner; Mielke, Christian; Christensen, Morten O.; Boege, Fritz

    2013-01-01

    Mitochondrial topoisomerase I is a genetically distinct mitochondria-dedicated enzyme with a crucial but so far unknown role in the homeostasis of mitochondrial DNA metabolism. Here, we present data suggesting a negative regulatory function in mitochondrial transcription or transcript stability. Deficiency or depletion of mitochondrial topoisomerase I increased mitochondrial transcripts, whereas overexpression lowered mitochondrial transcripts, depleted respiratory complexes I, III and IV, decreased cell respiration and raised superoxide levels. Acute depletion of mitochondrial topoisomerase I triggered neither a nuclear mito-biogenic stress response nor compensatory topoisomerase IIβ upregulation, suggesting the concomitant increase in mitochondrial transcripts was due to release of a local inhibitory effect. Mitochondrial topoisomerase I was co-immunoprecipitated with mitochondrial RNA polymerase. It selectively accumulated and rapidly exchanged at a subset of nucleoids distinguished by the presence of newly synthesized RNA and/or mitochondrial RNA polymerase. The inactive Y559F-mutant behaved similarly without affecting mitochondrial transcripts. In conclusion, mitochondrial topoisomerase I dampens mitochondrial transcription and thereby alters respiratory capacity. The mechanism involves selective association of the active enzyme with transcriptionally active nucleoids and a direct interaction with mitochondrial RNA polymerase. The inhibitory role of topoisomerase I in mitochondrial transcription is strikingly different from the stimulatory role of topoisomerase I in nuclear transcription. PMID:23982517

  10. A sulfated metabolite produced by stf3 negatively regulates the virulence of Mycobacterium tuberculosis

    PubMed Central

    Mougous, Joseph D.; Senaratne, Ryan H.; Petzold, Christopher J.; Jain, Madhulika; Lee, Dong H.; Schelle, Michael W.; Leavell, Michael D.; Cox, Jeffery S.; Leary, Julie A.; Riley, Lee W.; Bertozzi, Carolyn R.

    2006-01-01

    Sulfated molecules have been shown to modulate isotypic interactions between cells of metazoans and heterotypic interactions between bacterial pathogens or symbionts and their eukaryotic host cells. Mycobacterium tuberculosis, the causative agent of tuberculosis, produces sulfated molecules that have eluded functional characterization for decades. We demonstrate here that a previously uncharacterized sulfated molecule, termed S881, is localized to the outer envelope of M. tuberculosis and negatively regulates the virulence of the organism in two mouse infection models. Furthermore, we show that the biosynthesis of S881 relies on the universal sulfate donor 3′-phosphoadenosine-5′-phosphosulfate and a previously uncharacterized sulfotransferase, stf3. These findings extend the known functions of sulfated molecules as general modulators of cell–cell interactions to include those between a bacterium and a human host. PMID:16537518

  11. PKC{eta} is a negative regulator of AKT inhibiting the IGF-I induced proliferation

    SciTech Connect

    Shahaf, Galit; Rotem-Dai, Noa; Koifman, Gabriela; Raveh-Amit, Hadas; Frost, Sigal A.; Livneh, Etta

    2012-04-15

    The PI3K-AKT pathway is frequently activated in human cancers, including breast cancer, and its activation appears to be critical for tumor maintenance. Some malignant cells are dependent on activated AKT for their survival; tumors exhibiting elevated AKT activity show sensitivity to its inhibition, providing an Achilles heel for their treatment. Here we show that the PKC{eta} isoform is a negative regulator of the AKT signaling pathway. The IGF-I induced phosphorylation on Ser473 of AKT was inhibited by the PKC{eta}-induced expression in MCF-7 breast adenocarcinoma cancer cells. This was further confirmed in shRNA PKC{eta}-knocked-down MCF-7 cells, demonstrating elevated phosphorylation on AKT Ser473. While PKC{eta} exhibited negative regulation on AKT phosphorylation it did not alter the IGF-I induced ERK phosphorylation. However, it enhanced ERK phosphorylation when stimulated by PDGF. Moreover, its effects on IGF-I/AKT and PDGF/ERK pathways were in correlation with cell proliferation. We further show that both PKC{eta} and IGF-I confer protection against UV-induced apoptosis and cell death having additive effects. Although the protective effect of IGF-I involved activation of AKT, it was not affected by PKC{eta} expression, suggesting that PKC{eta} acts through a different route to increase cell survival. Hence, our studies show that PKC{eta} provides negative control on AKT pathway leading to reduced cell proliferation, and further suggest that its presence/absence in breast cancer cells will affect cell death, which could be of therapeutic value.

  12. Injury-induced BMP signaling negatively regulates Drosophila midgut homeostasis

    PubMed Central

    Guo, Zheng; Driver, Ian

    2013-01-01

    Although much is known about injury-induced signals that increase rates of Drosophila melanogaster midgut intestinal stem cell (ISC) proliferation, it is largely unknown how ISC activity returns to quiescence after injury. In this paper, we show that the bone morphogenetic protein (BMP) signaling pathway has dual functions during midgut homeostasis. Constitutive BMP signaling pathway activation in the middle midgut mediated regional specification by promoting copper cell differentiation. In the anterior and posterior midgut, injury-induced BMP signaling acted autonomously in ISCs to limit proliferation and stem cell number after injury. Loss of BMP signaling pathway members in the midgut epithelium or loss of the BMP signaling ligand decapentaplegic from visceral muscle resulted in phenotypes similar to those described for juvenile polyposis syndrome, a human intestinal tumor caused by mutations in BMP signaling pathway components. Our data establish a new link between injury and hyperplasia and may provide insight into how BMP signaling mutations drive formation of human intestinal cancers. PMID:23733344

  13. The Deubiquitinase OTULIN Is an Essential Negative Regulator of Inflammation and Autoimmunity.

    PubMed

    Damgaard, Rune Busk; Walker, Jennifer A; Marco-Casanova, Paola; Morgan, Neil V; Titheradge, Hannah L; Elliott, Paul R; McHale, Duncan; Maher, Eamonn R; McKenzie, Andrew N J; Komander, David

    2016-08-25

    Methionine-1 (M1)-linked ubiquitin chains regulate the activity of NF-κB, immune homeostasis, and responses to infection. The importance of negative regulators of M1-linked chains in vivo remains poorly understood. Here, we show that the M1-specific deubiquitinase OTULIN is essential for preventing TNF-associated systemic inflammation in humans and mice. A homozygous hypomorphic mutation in human OTULIN causes a potentially fatal autoinflammatory condition termed OTULIN-related autoinflammatory syndrome (ORAS). Four independent OTULIN mouse models reveal that OTULIN deficiency in immune cells results in cell-type-specific effects, ranging from over-production of inflammatory cytokines and autoimmunity due to accumulation of M1-linked polyubiquitin and spontaneous NF-κB activation in myeloid cells to downregulation of M1-polyubiquitin signaling by degradation of LUBAC in B and T cells. Remarkably, treatment with anti-TNF neutralizing antibodies ameliorates inflammation in ORAS patients and rescues mouse phenotypes. Hence, OTULIN is critical for restraining life-threatening spontaneous inflammation and maintaining immune homeostasis. PMID:27523608

  14. CYLD negatively regulates nontypeable Haemophilus influenzae-induced IL-8 expression via phosphatase MKP-1-dependent inhibition of ERK.

    PubMed

    Wang, Wenzhuo Y; Komatsu, Kensei; Huang, Yuxian; Wu, Jing; Zhang, Wenhong; Lee, Ji-Yun; Miyata, Masanori; Xu, Haidong; Li, Jian-Dong

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHi), a Gram-negative bacterium, is the primary cause of otitis media in children and the exacerbation of chronic obstructive pulmonary disease in adults. A hallmark of both diseases is an overactive inflammatory response, including the upregulation of chemokines, such as interleukin-8 (IL-8). An appropriate inflammatory response is essential for eradicating pathogens. However, excessive inflammation can cause host tissue damage. Therefore, expression of IL-8 must be tightly regulated. We previously reported that NTHi induces IL-8 expression in an ERK-dependent manner. We also have shown that the deubiquitinase cylindromatosis (CYLD) suppresses NTHi-induced inflammation. However, the underlying molecular mechanism of how CYLD negatively regulates ERK-mediated IL-8 production is largely unknown. Here, we examine both human lung epithelial A549 cells and lung of Cyld-/- mice to show that CYLD specifically targets the activation of ERK. Interestingly, CYLD enhances NTHi-induced upregulation of another negative regulator, MAP Kinase Phosphatase-1 (MKP-1), which, in turn, leads to reduced ERK activation and subsequent suppression of IL-8. Taken together, the CYLD suppression of ERK-dependent IL-8 via MKP-1 may bring novel insights into the tight regulation of inflammatory responses and also lead to innovative therapeutic strategies for controlling these responses by targeting key negative regulators of inflammation. PMID:25389768

  15. Tumor suppressive microRNA-137 negatively regulates Musashi-1 and colorectal cancer progression

    PubMed Central

    Smith, Amber R.; Marquez, Rebecca T.; Tsao, Wei-Chung; Pathak, Surajit; Roy, Alexandria; Ping, Jie; Wilkerson, Bailey; Lan, Lan; Meng, Wenjian; Neufeld, Kristi L.; Sun, Xiao-Feng; Xu, Liang

    2015-01-01

    Stem cell marker, Musashi-1 (MSI1) is over-expressed in many cancer types; however the molecular mechanisms involved in MSI1 over-expression are not well understood. We investigated the microRNA (miRNA) regulation of MSI1 and the implications this regulation plays in colorectal cancer. MicroRNA miR-137 was identified as a MSI1-targeting microRNA by immunoblotting and luciferase reporter assays. MSI1 protein was found to be highly expressed in 79% of primary rectal tumors (n=146), while miR-137 expression was decreased in 84% of the rectal tumor tissues (n=68) compared to paired normal mucosal samples. In addition to reduced MSI1 protein, exogenous expression of miR-137 inhibited cell growth, colony formation, and tumorsphere growth of colon cancer cells. Finally, in vivo studies demonstrated that induction of miR-137 can decrease growth of human colon cancer xenografts. Our results demonstrate that miR-137 acts as a tumor-suppressive miRNA in colorectal cancers and negatively regulates oncogenic MSI1. PMID:25940441

  16. Chondroitin sulfate addition to CD44H negatively regulates hyaluronan binding

    SciTech Connect

    Ruffell, Brian; Johnson, Pauline . E-mail: pauline@interchange.ubc.ca

    2005-08-26

    CD44 is a widely expressed cell adhesion molecule that binds hyaluronan, an extracellular matrix glycosaminoglycan, in a tightly regulated manner. This regulated interaction has been implicated in inflammation and tumor metastasis. CD44 exists in the standard form, CD44H, or as higher molecular mass isoforms due to alternative splicing. Here, we identify serine 180 in human CD44H as the site of chondroitin sulfate addition and show that lack of chondroitin sulfate addition at this site enhances hyaluronan binding by CD44. A CD44H-immunoglobulin fusion protein expressed in HEK293 cells, and CD44H expressed in murine L fibroblast cells were modified by chondroitin sulfate, as determined by reduced sulfate incorporation after chondroitinase ABC treatment. Mutation of serine 180 or glycine 181 in CD44H reduced chondroitin sulfate addition and increased hyaluronan binding, indicating that serine 180 is the site for chondroitin sulfate addition in CD44H and that this negatively regulates hyaluronan binding.

  17. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell.

    PubMed

    Luo, Yumei; Chen, Zikai; Zhu, Detu; Tu, Haitao; Pan, Shen Quan

    2015-01-01

    The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT) can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C); knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells. PMID:26425545

  18. SMARCAL1 Negatively Regulates C-Myc Transcription By Altering The Conformation Of The Promoter Region

    PubMed Central

    Sharma, Tapan; Bansal, Ritu; Haokip, Dominic Thangminlen; Goel, Isha; Muthuswami, Rohini

    2015-01-01

    SMARCAL1, a member of the SWI2/SNF2 protein family, stabilizes replication forks during DNA damage. In this manuscript, we provide the first evidence that SMARCAL1 is also a transcriptional co-regulator modulating the expression of c-Myc, a transcription factor that regulates 10–15% genes in the human genome. BRG1, SMARCAL1 and RNAPII were found localized onto the c-myc promoter. When HeLa cells were serum starved, the occupancy of SMARCAL1 on the c-myc promoter increased while that of BRG1 and RNAPII decreased correlating with repression of c-myc transcription. Using Active DNA-dependent ATPase A Domain (ADAAD), the bovine homolog of SMARCAL1, we show that the protein can hydrolyze ATP using a specific region upstream of the CT element of the c-myc promoter as a DNA effector. The energy, thereby, released is harnessed to alter the conformation of the promoter DNA. We propose that SMARCAL1 negatively regulates c-myc transcription by altering the conformation of its promoter region during differentiation. PMID:26648259

  19. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell

    PubMed Central

    Luo, Yumei; Chen, Zikai; Zhu, Detu; Tu, Haitao; Pan, Shen Quan

    2015-01-01

    The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT) can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C); knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells. PMID:26425545

  20. Temperature: Human Regulating, Ants Conforming

    ERIC Educational Resources Information Center

    Clopton, Joe R.

    2007-01-01

    Biological processes speed up as temperature rises. Procedures for demonstrating this with ants traveling on trails, and data gathered by students on the Argentine ant ("Linepithema humile") are presented. The concepts of temperature regulation and conformity are detailed with a focus on the processes rather than on terms that label the organisms.

  1. Staphylococcus aureus CodY Negatively Regulates Virulence Gene Expression▿

    PubMed Central

    Majerczyk, Charlotte D.; Sadykov, Marat R.; Luong, Thanh T.; Lee, Chia; Somerville, Greg A.; Sonenshein, Abraham L.

    2008-01-01

    CodY is a global regulatory protein that was first discovered in Bacillus subtilis, where it couples gene expression to changes in the pools of critical metabolites through its activation by GTP and branched-chain amino acids. Homologs of CodY can be found encoded in the genomes of nearly all low-G+C gram-positive bacteria, including Staphylococcus aureus. The introduction of a codY-null mutation into two S. aureus clinical isolates, SA564 and UAMS-1, through allelic replacement, resulted in the overexpression of several virulence genes. The mutant strains had higher levels of hemolytic activity toward rabbit erythrocytes in their culture fluid, produced more polysaccharide intercellular adhesin (PIA), and formed more robust biofilms than did their isogenic parent strains. These phenotypes were associated with derepressed levels of RNA for the hemolytic alpha-toxin (hla), the accessory gene regulator (agr) (RNAII and RNAIII/hld), and the operon responsible for the production of PIA (icaADBC). These data suggest that CodY represses, either directly or indirectly, the synthesis of a number of virulence factors of S. aureus. PMID:18156263

  2. Expression of Tyrosine Hydroxylase is Negatively Regulated Via Prion Protein.

    PubMed

    da Luz, Marcio Henrique Mello; Glezer, Isaias; Xavier, Andre Machado; da Silva, Marcelo Alberti Paiva; Pino, Jessica Monteiro Volejnik; Zamith, Thiago Panaro; Vieira, Taynara Fernanda; Antonio, Bruno Brito; Antunes, Hanna Karen Moreira; Martins, Vilma Regina; Lee, Kil Sun

    2016-07-01

    Cellular prion protein (PrP(C)) is a glycoprotein of the plasma membrane that plays pleiotropic functions by interacting with multiple signaling complexes at the cell surface. Recently, a number of studies have reported the involvement of PrP(C) in dopamine metabolism and signaling, including its interactions with tyrosine hydroxylase (TH) and dopamine receptors. However, the outcomes reported by independent studies are still debatable. Therefore in this study, we investigated the effects of PrP(C) on the TH expression during the differentiation of N2a cells with dibutyryl-cAMP, a well-known cAMP analog that activates TH transcription. Upon differentiation, TH was induced with concomitant reduction of PrP(C) at protein level, but not at mRNA level. shRNA-mediated PrP(C) reduction increased the basal level of TH at both mRNA and protein levels without dibutyryl-cAMP treatment. This phenotype was reversed by re-expression of PrP(C). PrP(C) knockdown also potentiated the effect of dibutyryl-cAMP on TH expression. Our findings suggest that PrP(C) has suppressive effects on TH expression. As a consequence, altered PrP(C) functions may affect the regulation of dopamine metabolism and related neurological disorders. PMID:26975317

  3. Anandamide-derived prostamide F2α negatively regulates adipogenesis.

    PubMed

    Silvestri, Cristoforo; Martella, Andrea; Poloso, Neil J; Piscitelli, Fabiana; Capasso, Raffaele; Izzo, Angelo; Woodward, David F; Di Marzo, Vincenzo

    2013-08-01

    Lipid mediators variedly affect adipocyte differentiation. Anandamide stimulates adipogenesis via CB1 receptors and peroxisome proliferator-activated receptor γ. Anandamide may be converted by PTGS2 (COX2) and prostaglandin F synthases, such as prostamide/prostaglandin F synthase, to prostaglandin F2α ethanolamide (PGF2αEA), of which bimatoprost is a potent synthetic analog. PGF2αEA/bimatoprost act via prostaglandin F2αFP receptor/FP alt4 splicing variant heterodimers. We investigated whether prostamide signaling occurs in preadipocytes and controls adipogenesis. Exposure of mouse 3T3-L1 or human preadipocytes to PGF2αEA/bimatoprost during early differentiation inhibits adipogenesis. PGF2αEA is produced from anandamide in preadipocytes and much less so in differentiating adipocytes, which express much less PTGS2, FP, and its alt4 splicing variant. Selective antagonism of PGF2αEA receptors counteracts prostamide effects on adipogenesis, as does inhibition of ERK1/2 phosphorylation. Selective inhibition of PGF2αEA versus prostaglandin F2α biosynthesis accelerates adipogenesis. PGF2αEA levels are reduced in the white adipose tissue of high fat diet-fed mice where there is a high requirement for new adipocytes. Prostamides also inhibit zebrafish larval adipogenesis in vivo. We propose that prostamide signaling in preadipocytes is a novel anandamide-derived antiadipogenic mechanism. PMID:23801328

  4. Anandamide-derived Prostamide F2α Negatively Regulates Adipogenesis

    PubMed Central

    Silvestri, Cristoforo; Martella, Andrea; Poloso, Neil J.; Piscitelli, Fabiana; Capasso, Raffaele; Izzo, Angelo; Woodward, David F.; Di Marzo, Vincenzo

    2013-01-01

    Lipid mediators variedly affect adipocyte differentiation. Anandamide stimulates adipogenesis via CB1 receptors and peroxisome proliferator-activated receptor γ. Anandamide may be converted by PTGS2 (COX2) and prostaglandin F synthases, such as prostamide/prostaglandin F synthase, to prostaglandin F2α ethanolamide (PGF2αEA), of which bimatoprost is a potent synthetic analog. PGF2αEA/bimatoprost act via prostaglandin F2αFP receptor/FP alt4 splicing variant heterodimers. We investigated whether prostamide signaling occurs in preadipocytes and controls adipogenesis. Exposure of mouse 3T3-L1 or human preadipocytes to PGF2αEA/bimatoprost during early differentiation inhibits adipogenesis. PGF2αEA is produced from anandamide in preadipocytes and much less so in differentiating adipocytes, which express much less PTGS2, FP, and its alt4 splicing variant. Selective antagonism of PGF2αEA receptors counteracts prostamide effects on adipogenesis, as does inhibition of ERK1/2 phosphorylation. Selective inhibition of PGF2αEA versus prostaglandin F2α biosynthesis accelerates adipogenesis. PGF2αEA levels are reduced in the white adipose tissue of high fat diet-fed mice where there is a high requirement for new adipocytes. Prostamides also inhibit zebrafish larval adipogenesis in vivo. We propose that prostamide signaling in preadipocytes is a novel anandamide-derived antiadipogenic mechanism. PMID:23801328

  5. Negative urgency and emotion regulation strategy use: Associations with displaced aggression.

    PubMed

    Scott, Jillian Panuzio; DiLillo, David; Maldonado, Rosalita C; Watkins, Laura E

    2015-09-01

    The numerous public health consequences of interpersonal aggression highlight the necessity of a comprehensive understanding of factors influencing its perpetration. This study examined direct and interactive associations between negative urgency and emotion regulation strategy use in predicting displaced aggression under conditions of negative mood. Participants were 197 male and female undergraduate students who were randomly assigned to employ either cognitive reappraisal or expressive suppression in response to a negative mood induction. Immediately afterwards, participants engaged in an analog displaced aggression task. Results revealed direct, positive associations between negative urgency and aggression. In addition, the use of suppression was associated with greater aggression than was the use of reappraisal alone. Counter to the hypothesis, there were no interactive effects between negative urgency and emotion regulation strategy use in predicting aggression. Findings suggest reducing negative urgency and use of suppression as potential intervention targets for individuals who engage in aggressive behavior. Aggr. Behav. 41:502-512, 2015. © 2015 Wiley Periodicals, Inc. PMID:25753818

  6. Iro/IRX transcription factors negatively regulate Dpp/TGF-β pathway activity during intestinal tumorigenesis

    PubMed Central

    Martorell, Òscar; Barriga, Francisco M; Merlos-Suárez, Anna; Stephan-Otto Attolini, Camille; Casanova, Jordi; Batlle, Eduard; Sancho, Elena; Casali, Andreu

    2014-01-01

    Activating mutations in Wnt and EGFR/Ras signaling pathways are common in colorectal cancer (CRC). Remarkably, clonal co-activation of these pathways in the adult Drosophila midgut induces “tumor-like” overgrowths. Here, we show that, in these clones and in CRC cell lines, Dpp/TGF-β acts as a tumor suppressor. Moreover, we discover that the Iroquois/IRX-family-protein Mirror downregulates the transcription of core components of the Dpp pathway, reducing its tumor suppressor activity. We also show that this genetic interaction is conserved in human CRC cells, where the Iro/IRX proteins IRX3 and IRX5 diminish the response to TGF-β. IRX3 and IRX5 are upregulated in human adenomas, and their levels correlate inversely with the gene expression signature of response to TGF-β. In addition, Irx5 expression confers a growth advantage in the presence of TGF-β, but is selected against in its absence. Together, our results identify a set of Iro/IRX proteins as conserved negative regulators of Dpp/TGF-β activity. We propose that during the characteristic adenoma-to-carcinoma transition of human CRC, the activity of IRX proteins could reduce the sensitivity to the cytostatic effect of TGF-β, conferring a growth advantage to tumor cells prior to the acquisition of mutations in TGF-β pathway components. PMID:25296644

  7. Toddler Emotion Regulation with Mothers and Fathers: Temporal Associations between Negative Affect and Behavioral Strategies

    ERIC Educational Resources Information Center

    Ekas, Naomi V.; Braungart-Rieker, Julia M.; Lickenbrock, Diane M.; Zentall, Shannon R.; Maxwell, Scott M.

    2011-01-01

    The present study investigated temporal associations between putative emotion regulation strategies and negative affect in 20-month-old toddlers. Toddlers' parent-focused, self-distraction, and toy-focused strategies, as well as negative affect, were rated on a second-by-second basis during laboratory parent-toddler interactions. Longitudinal…

  8. The Role of Depression and Negative Affect Regulation Expectancies in Tobacco Smoking among College Students

    ERIC Educational Resources Information Center

    Schleicher, Holly E.; Harris, Kari Jo; Catley, Delwyn; Nazir, Niaman

    2009-01-01

    Objective: Expectancies about nicotine's ability to alleviate negative mood states may play a role in the relationship between smoking and depression. The authors examined the role of negative affect regulation expectancies as a potential mediator of depression (history of depression and depressive symptoms) and smoking among college students.…

  9. Mothers' Socialization of Emotion Regulation: The Moderating Role of Children's Negative Emotional Reactivity

    ERIC Educational Resources Information Center

    Mirabile, Scott P.; Scaramella, Laura V.; Sohr-Preston, Sara L.; Robison, Sarah D.

    2009-01-01

    During the toddler period, children begin to shift from being primarily dependent on parents to regulate their emotions to managing their emotions independently. The present study considers how children's propensity towards negative emotional arousal interacts with mothers' efforts to socialize emotion regulation. Fifty-five low income mothers and…

  10. Tetraspanin CD151 Is a Negative Regulator of FcεRI-Mediated Mast Cell Activation

    PubMed Central

    Abdala-Valencia, Hiam; Bryce, Paul J.; Schleimer, Robert P.; Wechsler, Joshua B.; Loffredo, Lucas F.; Cook-Mills, Joan M.; Hsu, Chia-Lin; Berdnikovs, Sergejs

    2016-01-01

    Mast cells are critical in the pathogenesis of allergic disease due to the release of preformed and newly synthesized mediators, yet the mechanisms controlling mast cell activation are not well understood. Members of the tetraspanin family are recently emerging as modulators of FcεRI-mediated mast cell activation; however, mechanistic understanding of their function is currently lacking. The tetraspanin CD151 is a poorly understood member of this family and is specifically induced on mouse and human mast cells upon FcεRI aggregation but its functional effects are unknown. In this study, we show that CD151 deficiency significantly exacerbates the IgE-mediated late phase inflammation in a murine model of passive cutaneous anaphylaxis. Ex vivo, FcεRI stimulation of bone marrow–derived mast cells from CD151−/− mice resulted in significantly enhanced expression of proinflammatory cytokines IL-4, IL-13, and TNF-α compared with wild-type controls. However, FcεRI -induced mast cell degranulation was unaffected. At the molecular signaling level, CD151 selectively regulated IgE-induced activation of ERK1/2 and PI3K, associated with cytokine production, but had no effect on the phospholipase Cγ1 signaling, associated with degranulation. Collectively, our data indicate that CD151 exerts negative regulation over IgE-induced late phase responses and cytokine production in mast cells. PMID:26136426

  11. Tetraspanin CD151 Is a Negative Regulator of FcεRI-Mediated Mast Cell Activation.

    PubMed

    Abdala-Valencia, Hiam; Bryce, Paul J; Schleimer, Robert P; Wechsler, Joshua B; Loffredo, Lucas F; Cook-Mills, Joan M; Hsu, Chia-Lin; Berdnikovs, Sergejs

    2015-08-15

    Mast cells are critical in the pathogenesis of allergic disease due to the release of preformed and newly synthesized mediators, yet the mechanisms controlling mast cell activation are not well understood. Members of the tetraspanin family are recently emerging as modulators of FcεRI-mediated mast cell activation; however, mechanistic understanding of their function is currently lacking. The tetraspanin CD151 is a poorly understood member of this family and is specifically induced on mouse and human mast cells upon FcεRI aggregation but its functional effects are unknown. In this study, we show that CD151 deficiency significantly exacerbates the IgE-mediated late phase inflammation in a murine model of passive cutaneous anaphylaxis. Ex vivo, FcεRI stimulation of bone marrow-derived mast cells from CD151(-/-) mice resulted in significantly enhanced expression of proinflammatory cytokines IL-4, IL-13, and TNF-α compared with wild-type controls. However, FcεRI-induced mast cell degranulation was unaffected. At the molecular signaling level, CD151 selectively regulated IgE-induced activation of ERK1/2 and PI3K, associated with cytokine production, but had no effect on the phospholipase Cγ1 signaling, associated with degranulation. Collectively, our data indicate that CD151 exerts negative regulation over IgE-induced late phase responses and cytokine production in mast cells. PMID:26136426

  12. Identification of osteoblast stimulating factor 5 as a negative regulator in the B-lymphopoietic niche.

    PubMed

    Fujita, Natsuko; Ichii, Michiko; Maeda, Tetsuo; Saitoh, Norimitsu; Yokota, Takafumi; Yamawaki, Kengo; Kakitani, Makoto; Tomizuka, Kazuma; Oritani, Kenji; Kanakura, Yuzuru

    2015-11-01

    Recent studies have revealed the crucial role of the niche which supports B-lymphocyte differentiation from hematopoietic stem cells. In this study, we aimed to identify a novel regulator of B lymphopoiesis secreted in the specific niche using the signal sequence trap method. Among the identified proteins from MS5 stromal cells, expression of pleiotrophin, placental proliferin 2, and osteoblast stimulating factor 5 (OSF-5) was dominantly high in several stromal cell lines. We found that OSF-5 suppressed early B lymphopoiesis in transgenic mice producing the target protein. The number of pre-B and immature B cells was reduced by more than half compared with control in the transgenic mice. In vitro studies showed that a secreted variant of OSF-5 inhibited the proliferation and colony formation of pre-B cells, whereas cell-intrinsic form had no influence on B lymphopoiesis. The main components of the B-lymphopoietic niche, osteoblasts in mice and mesenchymal cells in humans, are primary producers of OSF-5. These results define a novel mechanism of B lymphopoiesis in bone marrow. In the specific niche, B-lymphocyte differentiation is fine-tuned by negative regulators as well as supportive factors. PMID:26213229

  13. Adaptor protein LNK is a negative regulator of brain neural stem cell proliferation after stroke.

    PubMed

    Ahlenius, Henrik; Devaraju, Karthikeyan; Monni, Emanuela; Oki, Koichi; Wattananit, Somsak; Darsalia, Vladimer; Iosif, Robert E; Torper, Olof; Wood, James C; Braun, Sebastian; Jagemann, Lucas; Nuber, Ulrike A; Englund, Elisabet; Jacobsen, Sten-Eirik W; Lindvall, Olle; Kokaia, Zaal

    2012-04-11

    Ischemic stroke causes transient increase of neural stem and progenitor cell (NSPC) proliferation in the subventricular zone (SVZ), and migration of newly formed neuroblasts toward the damaged area where they mature to striatal neurons. The molecular mechanisms regulating this plastic response, probably involved in structural reorganization and functional recovery, are poorly understood. The adaptor protein LNK suppresses hematopoietic stem cell self-renewal, but its presence and role in the brain are poorly understood. Here we demonstrate that LNK is expressed in NSPCs in the adult mouse and human SVZ. Lnk(-/-) mice exhibited increased NSPC proliferation after stroke, but not in intact brain or following status epilepticus. Deletion of Lnk caused increased NSPC proliferation while overexpression decreased mitotic activity of these cells in vitro. We found that Lnk expression after stroke increased in SVZ through the transcription factors STAT1/3. LNK attenuated insulin-like growth factor 1 signaling by inhibition of AKT phosphorylation, resulting in reduced NSPC proliferation. Our findings identify LNK as a stroke-specific, endogenous negative regulator of NSPC proliferation, and suggest that LNK signaling is a novel mechanism influencing plastic responses in postischemic brain. PMID:22496561

  14. ERK8 is a negative regulator of O-GalNAc glycosylation and cell migration

    PubMed Central

    Chia, Joanne; Tham, Keit Min; Gill, David James; Bard-Chapeau, Emilie Anne; Bard, Frederic A

    2014-01-01

    ER O-glycosylation can be induced through relocalisation GalNAc-Transferases from the Golgi. This process markedly stimulates cell migration and is constitutively activated in more than 60% of breast carcinomas. How this activation is achieved remains unclear. Here, we screened 948 signalling genes using RNAi and imaging. We identified 12 negative regulators of O-glycosylation that all control GalNAc-T sub-cellular localisation. ERK8, an atypical MAPK with high basal kinase activity, is a strong hit and is partially localised at the Golgi. Its inhibition induces the relocation of GalNAc-Ts, but not of KDEL receptors, revealing the existence of two separate COPI-dependent pathways. ERK8 down-regulation, in turn, activates cell motility. In human breast and lung carcinomas, ERK8 expression is reduced while ER O-glycosylation initiation is hyperactivated. In sum, ERK8 appears as a constitutive brake on GalNAc-T relocalisation, and the loss of its expression could drive cancer aggressivity through increased cell motility. DOI: http://dx.doi.org/10.7554/eLife.01828.001 PMID:24618899

  15. Histone Deacetylase SIRT1 Negatively Regulates the Differentiation of Interleukin-9-Producing CD4(+) T Cells.

    PubMed

    Wang, Yu; Bi, Yujing; Chen, Xi; Li, Chunxiao; Li, Yan; Zhang, Zhengguo; Wang, Jian; Lu, Yun; Yu, Qing; Su, Huilin; Yang, Hui; Liu, Guangwei

    2016-06-21

    Distinct metabolic programs support the differentiation of CD4(+) T cells into separate functional subsets. In this study, we investigated metabolic mechanisms underlying the differentiation of IL-9-producing CD4(+) T cells (Th9) in allergic airway inflammation and cancerous tumors. We found that histone deacetylase SIRT1 negatively regulated Th9 cell differentiation. A deficiency of SIRT1 induced by either conditional deletion in mouse CD4(+) T cells or the use of small interfering RNA (siRNA) in mouse or human T cells increased IL-9 production, whereas ectopic SIRT1 expression inhibited it. Notably, SIRT1 inhibited Th9 cell differentiation that regulated anti-tumor immunity and allergic pulmonary inflammation. Glycolytic activation through the mTOR-hypoxia-inducible factor-1α (HIF1α) was required for the differentiation of Th9 cells that conferred protection against tumors and is involved in allergic airway inflammation. Our results define the essential features of SIRT1-mTOR-HIF1α signaling-coupled glycolytic pathway in inducing Th9 cell differentiation, with implications for metabolic reprogramming as an immunotherapeutic approach. PMID:27317260

  16. GLTSCR2 is an upstream negative regulator of nucleophosmin in cervical cancer

    PubMed Central

    Kim, Jee-Youn; Cho, Young-Eun; An, Yong-Min; Kim, Sang-Hoon; Lee, Yong-Gwan; Park, Jae-Hoon; Lee, Sun

    2015-01-01

    Nucleophosmin (NPM)/B23, a multifunctional nucleolar phosphoprotein, plays an important role in ribosome biogenesis, cell cycle regulation, apoptosis and cancer pathogenesis. The role of NPM in cells is determined by several factors, including total expression level, oligomerization or phosphorylation status, and subcellular localization. In the nucleolus, NPM participates in rRNA maturation to enhance ribosomal biogenesis. Consistent with this finding, NPM expression is increased in rapidly proliferating cells and many types of human cancers. In response to ribosomal stress, NPM is redistributed to the nucleoplasm, where it inactivates mouse double minute 2 homologue to stabilize p53 and inhibit cell cycle progression. These observations indicate that nucleolus-nucleoplasmic mobilization of NPM is one of the key molecular mechanisms that determine the role of NPM within the cell. However, the regulatory molecule(s) that control(s) NPM stability and subcellular localization, crucial to the pluripotency of intercellular NPM, remain(s) unidentified. In this study, we showed that nucleolar protein GLTSCR2/Pict-1 induced nucleoplasmic translocation and enhanced the degradation of NPM via the proteasomal polyubiquitination pathway. In addition, we showed that GLTSCR2 expression decreased the transforming activity of cells mediated by NPM and that the expression of NPM is reciprocally related to that of GLTSCR2 in cervical cancer tissue. In this study, we demonstrated that GLTSCR2 is an upstream negative regulator of NPM. PMID:25818168

  17. Control your anger! The neural basis of aggression regulation in response to negative social feedback.

    PubMed

    Achterberg, Michelle; van Duijvenvoorde, Anna C K; Bakermans-Kranenburg, Marian J; Crone, Eveline A

    2016-05-01

    Negative social feedback often generates aggressive feelings and behavior. Prior studies have investigated the neural basis of negative social feedback, but the underlying neural mechanisms of aggression regulation following negative social feedback remain largely undiscovered. In the current study, participants viewed pictures of peers with feedback (positive, neutral or negative) to the participant's personal profile. Next, participants responded to the peer feedback by pressing a button, thereby producing a loud noise toward the peer, as an index of aggression. Behavioral analyses showed that negative feedback led to more aggression (longer noise blasts). Conjunction neuroimaging analyses revealed that both positive and negative feedback were associated with increased activity in the medial prefrontal cortex (PFC) and bilateral insula. In addition, more activation in the right dorsal lateral PFC (dlPFC) during negative feedback vs neutral feedback was associated with shorter noise blasts in response to negative social feedback, suggesting a potential role of dlPFC in aggression regulation, or top-down control over affective impulsive actions. This study demonstrates a role of the dlPFC in the regulation of aggressive social behavior. PMID:26755768

  18. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene.

    PubMed

    Venugopal, R; Jaiswal, A K

    1996-12-10

    Twenty-four base pairs of the human antioxidant response element (hARE) are required for high basal transcription of the NAD(P)H:quinone oxidoreductase1 (NQO1) gene and its induction in response to xenobiotics and antioxidants. hARE is a unique cis-element that contains one perfect and one imperfect AP1 element arranged as inverse repeats separated by 3 bp, followed by a "GC" box. We report here that Jun, Fos, Fra, and Nrf nuclear transcription factors bind to the hARE. Overexpression of cDNA derived combinations of the nuclear proteins Jun and Fos or Jun and Fra1 repressed hARE-mediated chloramphenicol acetyltransferase (CAT) gene expression in transfected human hepatoblastoma (Hep-G2) cells. Further experiments suggested that this repression was due to overexpression of c-Fos and Fra1, but not due to Jun proteins. The Jun (c-Jun, Jun-B, and Jun-D) proteins in all the possible combinations were more or less ineffective in repression or upregulation of hARE-mediated gene expression. Interestingly, overexpression of Nrf1 and Nrf2 individually in Hep-G2 and monkey kidney (COS1) cells significantly increased CAT gene expression from reporter plasmid hARE-thymidine kinase-CAT in transfected cells that were inducible by beta-naphthoflavone and teri-butyl hydroquinone. These results indicated that hARE-mediated expression of the NQO1 gene and its induction by xenobiotics and antioxidants are mediated by Nrf1 and Nrf2. The hARE-mediated basal expression, however, is repressed by overexpression of c-Fos and Fra1. PMID:8962164

  19. Automatic control of negative emotions: Evidence that structured practice increases the efficiency of emotion regulation

    PubMed Central

    Christou-Champi, Spyros; Farrow, Tom F. D.; Webb, Thomas L.

    2015-01-01

    Emotion regulation (ER) is vital to everyday functioning. However, the effortful nature of many forms of ER may lead to regulation being inefficient and potentially ineffective. The present research examined whether structured practice could increase the efficiency of ER. During three training sessions, comprising a total of 150 training trials, participants were presented with negatively valenced images and asked either to “attend” (control condition) or “reappraise” (ER condition). A further group of participants did not participate in training but only completed follow-up measures. Practice increased the efficiency of ER as indexed by decreased time required to regulate emotions and increased heart rate variability (HRV). Furthermore, participants in the ER condition spontaneously regulated their negative emotions two weeks later and reported being more habitual in their use of ER. These findings indicate that structured practice can facilitate the automatic control of negative emotions and that these effects persist beyond training. PMID:24678930

  20. Transcriptional regulation of the human biglycan gene.

    PubMed

    Ungefroren, H; Krull, N B

    1996-06-28

    The small leucine-rich proteoglycan biglycan is involved in several physiological and pathophysiological processes through the ability of its core protein to interact with other extracellular matrix molecules and transforming growth factor-beta (TGF-beta). To learn more about the regulation of biglycan core protein expression, we have cloned and sequenced 1218 base pairs from the 5'-flanking region of the human biglycan gene, demonstrated functional promoter activity, and investigated the molecular mechanisms through which various agents modulate its transcriptional activity. Sequencing revealed the presence of several cis-acting elements including multiple AP-2 sites and interleukin-6 response elements, a NF-kappaB site, a TGF-beta negative element, and an E-box. The TATA and CAAT box-lacking promoter possesses many features of a growth-related gene, e.g. a GC-rich immediate 5' region, many Sp1 sites, and the use of multiple transcriptional start sites. Transient transfections of the tumor cell lines MG-63, SK-UT-1, and T47D with various biglycan 5'-flanking region-luciferase reporter gene constructs showed that the proximal 78 base pairs are sufficient for full promoter activity. Several agents among them interleukin-6, and tumor necrosis factor-alpha. were capable of altering biglycan promoter activity. However, in MG-63 cells, TGF-beta1 failed to increase either activity of the biglycan promoter constructs or specific transcription from the endogenous biglycan gene. Since TGF-beta1 also did not alter the stability of cytoplasmic biglycan mRNA as determined from Northern analysis after inhibition of transcription with 5,6-dichloro-1beta-D-ribofuranosylbenzimidazole, an as yet unidentified nuclear post-transcriptional mechanism was considered responsible for the TGF-beta effect in this cell type. These results might help to elucidate the molecular pathways leading to pathological alterations of biglycan expression observed in atherosclerosis, glomerulonephritis

  1. miRNA863-3p sequentially targets negative immune regulator ARLPKs and positive regulator SERRATE upon bacterial infection

    PubMed Central

    Niu, Dongdong; Lii, Yifan E.; Chellappan, Padmanabhan; Lei, Lei; Peralta, Karl; Jiang, Chunhao; Guo, Jianhua; Coaker, Gitta; Jin, Hailing

    2016-01-01

    Plant small RNAs play important roles in gene regulation during pathogen infection. Here we show that miR863-3p is induced by the bacterial pathogen Pseudomonas syringae carrying various effectors. Early during infection, miR863-3p silences two negative regulators of plant defence, atypical receptor-like pseudokinase1 (ARLPK1) and ARLPK2, both lacking extracellular domains and kinase activity, through mRNA degradation to promote immunity. ARLPK1 associates with, and may function through another negative immune regulator ARLPK1-interacting receptor-like kinase 1 (AKIK1), an active kinase with an extracellular domain. Later during infection, miR863-3p silences SERRATE, which is essential for miRNA accumulation and positively regulates defence, through translational inhibition. This results in decreased miR863-3p levels, thus forming a negative feedback loop to attenuate immune responses after successful defence. This is an example of a miRNA that sequentially targets both negative and positive regulators of immunity through two modes of action to fine-tune the timing and amplitude of defence responses. PMID:27108563

  2. The peripheral clock regulates human pigmentation.

    PubMed

    Hardman, Jonathan A; Tobin, Desmond J; Haslam, Iain S; Farjo, Nilofer; Farjo, Bessam; Al-Nuaimi, Yusur; Grimaldi, Benedetto; Paus, Ralf

    2015-04-01

    Although the regulation of pigmentation is well characterized, it remains unclear whether cell-autonomous controls regulate the cyclic on-off switching of pigmentation in the hair follicle (HF). As human HFs and epidermal melanocytes express clock genes and proteins, and given that core clock genes (PER1, BMAL1) modulate human HF cycling, we investigated whether peripheral clock activity influences human HF pigmentation. We found that silencing BMAL1 or PER1 in human HFs increased HF melanin content. Furthermore, tyrosinase expression and activity, as well as TYRP1 and TYRP2 mRNA levels, gp100 protein expression, melanocyte dendricity, and the number gp100+ HF melanocytes, were all significantly increased in BMAL1 and/or PER1-silenced HFs. BMAL1 or PER1 silencing also increased epidermal melanin content, gp100 protein expression, and tyrosinase activity in human skin. These effects reflect direct modulation of melanocytes, as BMAL1 and/or PER1 silencing in isolated melanocytes increased tyrosinase activity and TYRP1/2 expression. Mechanistically, BMAL1 knockdown reduces PER1 transcription, and PER1 silencing induces phosphorylation of the master regulator of melanogenesis, microphthalmia-associated transcription factor, thus stimulating human melanogenesis and melanocyte activity in situ and in vitro. Therefore, the molecular clock operates as a cell-autonomous modulator of human pigmentation and may be targeted for future therapeutic strategies. PMID:25310406

  3. C5orf30 is a negative regulator of tissue damage in rheumatoid arthritis.

    PubMed

    Muthana, Munitta; Hawtree, Sarah; Wilshaw, Adam; Linehan, Eimear; Roberts, Hannah; Khetan, Sachin; Adeleke, Gbadebo; Wright, Fiona; Akil, Mohammed; Fearon, Ursula; Veale, Douglas; Ciani, Barbara; Wilson, Anthony G

    2015-09-15

    The variant rs26232, in the first intron of the chromosome 5 open reading frame 30 (C5orf30) locus, has recently been associated with both risk of developing rheumatoid arthritis (RA) and severity of tissue damage. The biological activities of human C5orf30 are unknown, and neither the gene nor protein show significant homology to any other characterized human sequences. The C5orf30 gene is present only in vertebrate genomes with a high degree of conservation, implying a central function in these organisms. Here, we report that C5orf30 is highly expressed in the synovium of RA patients compared with control synovial tissue, and that it is predominately expressed by synovial fibroblast (RASF) and macrophages in the lining and sublining layer of the tissue. These cells play a central role in the initiation and perpetuation of RA and are implicated in cartilage destruction. RASFs lacking C5orf30 exhibit increased cell migration and invasion in vitro, and gene profiling following C5orf30 inhibition confirmed up-regulation of genes involved in cell migration, adhesion, angiogenesis, and immune and inflammatory pathways. Importantly, loss of C5orf30 contributes to the pathology of inflammatory arthritis in vivo, because inhibition of C5orf30 in the collagen-induced arthritis model markedly accentuated joint inflammation and tissue damage. Our study reveal C5orf30 to be a previously unidentified negative regulator of tissue damage in RA, and this protein may act by modulating the autoaggressive phenotype that is characteristic of RASFs. PMID:26316022

  4. MiR-146a negatively regulates TLR2-induced inflammatory responses in keratinocytes.

    PubMed

    Meisgen, Florian; Xu Landén, Ning; Wang, Aoxue; Réthi, Bence; Bouez, Charbel; Zuccolo, Michela; Gueniche, Audrey; Ståhle, Mona; Sonkoly, Enikö; Breton, Lionel; Pivarcsi, Andor

    2014-07-01

    Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response of keratinocytes. Toll-like receptor 2 (TLR2) stimulation of primary human keratinocytes resulted in an NF-κB- and mitogen-activated protein kinase-dependent upregulation of miR-146a expression, which was surprisingly long lasting, contrasting with the rapid and transient induction of inflammatory mediators. Overexpression of miR-146a significantly suppressed the production of IL-8, CCL20, and tumor necrosis factor-α, which functionally suppressed the chemotactic attraction of neutrophils by keratinocytes. Inhibition of endogenous miR-146a induced the production of inflammatory mediators even in nonstimulated keratinocytes, and potentiated the effect of TLR2 stimulation. Transcriptomic profiling revealed that miR-146a suppresses the expression of a large number of immune-related genes in keratinocytes. MiR-146a downregulated interleukin-1 receptor-associated kinase 1 and TNF receptor-associated factor 6, two key adapter molecules downstream of TLR signaling, and suppressed NF-κB promoter-binding activity as shown by promoter luciferase experiments. Together, these data identify miR-146a as a regulatory element in keratinocyte innate immunity, which prevents the production of inflammatory mediators under homeostatic conditions and serves as a potent negative feedback regulator after TLR2 stimulation. PMID:24670381

  5. Beyond CTLA-4 and PD-1, the Generation Z of Negative Checkpoint Regulators

    PubMed Central

    Le Mercier, Isabelle; Lines, J. Louise; Noelle, Randolph J.

    2015-01-01

    In the last two years, clinical trials with blocking antibodies to the negative checkpoint regulators CTLA-4 and PD-1 have rekindled the hope for cancer immunotherapy. Multiple negative checkpoint regulators protect the host against autoimmune reactions but also restrict the ability of T cells to effectively attack tumors. Releasing these brakes has emerged as an exciting strategy for cancer treatment. Conversely, these pathways can be manipulated to achieve durable tolerance for treatment of autoimmune diseases and transplantation. In the future, treatment may involve combination therapy to target multiple cell types and stages of the adaptive immune responses. In this review, we describe the current knowledge on the recently discovered negative checkpoint regulators, future targets for immunotherapy. PMID:26347741

  6. Signaling hierarchy regulating human endothelial cell development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our present knowledge of the regulation of mammalian endothelial cell differentiation has been largely derived from studies of mouse embryonic development. However, unique mechanisms and hierarchy of signals that govern human endothelial cell development are unknown and, thus, explored in these stud...

  7. 5-Lipoxygenase Negatively Regulates Th1 Response during Brucella abortus Infection in Mice

    PubMed Central

    Fahel, Júlia Silveira; de Souza, Mariana Bueno; Gomes, Marco Túlio Ribeiro; Corsetti, Patricia P.; Carvalho, Natalia B.; Marinho, Fabio A. V.; de Almeida, Leonardo A.; Caliari, Marcelo V.; Machado, Fabiana Simão

    2015-01-01

    Brucella abortus is a Gram-negative bacterium that infects humans and cattle, causing a chronic inflammatory disease known as brucellosis. A Th1-mediated immune response plays a critical role in host control of this pathogen. Recent findings indicate contrasting roles for lipid mediators in host responses against infections. 5-Lipoxygenase (5-LO) is an enzyme required for the production of the lipid mediators leukotrienes and lipoxins. To determine the involvement of 5-LO in host responses to B. abortus infection, we intraperitoneally infected wild-type and 5-LO-deficient mice and evaluated the progression of infection and concomitant expression of immune mediators. Here, we demonstrate that B. abortus induced the upregulation of 5-LO mRNA in wild-type mice. Moreover, this pathogen upregulated the production of the lipid mediators leukotriene B4 and lipoxin A4 in a 5-LO-dependent manner. 5-LO-deficient mice displayed lower bacterial burdens in the spleen and liver and less severe liver pathology, demonstrating an enhanced resistance to infection. Host resistance paralleled an increased expression of the proinflammatory mediators interleukin-12 (IL-12), gamma interferon (IFN-γ), and inducible nitric oxide synthase (iNOS) during the course of infection. Moreover, we demonstrated that 5-LO downregulated the expression of IL-12 in macrophages during B. abortus infection. Our results suggest that 5-LO has a major involvement in B. abortus infection, by functioning as a negative regulator of the protective Th1 immune responses against this pathogen. PMID:25583526

  8. Negative transcriptional regulation of the interferon-gamma promoter by glucocorticoids and dominant negative mutants of c-Jun.

    PubMed

    Cippitelli, M; Sica, A; Viggiano, V; Ye, J; Ghosh, P; Birrer, M J; Young, H A

    1995-05-26

    Interferon-gamma (IFN-gamma) is an immunoregulatory cytokine expressed in large granular lymphocytes and T cells. However, the molecular mechanisms underlying IFN-gamma gene transcription have not been fully defined. Here, we analyze the mechanisms responsible for the inhibition of IFN-gamma promoter activity by the glucocorticoid hormone dexamethasone. Cotransfection assays performed in Jurkat T cells demonstrated that the activity of the initial 108 base pairs of the IFN-gamma promoter was down-regulated in the presence of dexamethasone. Furthermore, utilizing electrophoretic mobility shift analysis, we identified activator protein 1 AP-1-cAMP response element binding protein-activating transcription factor (CREB-ATF) binding elements situated in positions of the IFN-gamma promoter previously identified as essential for promoter activity. Moreover, dominant negative mutants of the c-Jun proto-oncogene were able to mimic the same down-regulatory effect exerted by dexamethasone, and mutations that abolished the binding of the AP-1 CREB-ATF factors were able to block the glucocorticoid effect. These results suggest a model involving the inhibition of IFN-gamma AP-1 CREB-ATF DNA binding complexes as one of the mechanisms involved in the negative regulatory action of glucocorticoids on IFN-gamma gene expression and support the relevance of AP-1 CREB-ATF binding factors during the transcriptional activation of the IFN-gamma promoter in T cells. PMID:7759501

  9. No fear, no panic: probing negation as a means for emotion regulation.

    PubMed

    Herbert, Cornelia; Deutsch, Roland; Platte, Petra; Pauli, Paul

    2013-08-01

    This electroencephalographic study investigated if negating one's emotion results in paradoxical effects or leads to effective emotional downregulation. Healthy participants were asked to downregulate their emotions to happy and fearful faces by using negated emotional cue words (e.g., no fun, no fear). Cue words were congruent with the emotion depicted in the face and presented prior to each face. Stimuli were presented in blocks of happy and fearful faces. Blocks of passive stimulus viewing served as control condition. Active regulation reduced amplitudes of early event-related brain potentials (early posterior negativity, but not N170) and the late positive potential for fearful faces. A fronto-central negativity peaking at about 250 ms after target face onset showed larger amplitude modulations during downregulation of fearful and happy faces. Behaviorally, negating was more associated with reappraisal than with suppression. Our results suggest that in an emotional context, negation processing could be quite effective for emotional downregulation but that its effects depend on the type of the negated emotion (pleasant vs unpleasant). Results are discussed in the context of dual process models of cognition and emotion regulation. PMID:22490924

  10. The trans-kingdom identification of negative regulators of pathogen hypervirulence

    PubMed Central

    Brown, Neil A.; Urban, Martin; Hammond-Kosack, Kim E.

    2015-01-01

    Modern society and global ecosystems are increasingly under threat from pathogens, which cause a plethora of human, animal, invertebrate and plant diseases. Of increasing concern is the trans-kingdom tendency for increased pathogen virulence that is beginning to emerge in natural, clinical and agricultural settings. The study of pathogenicity has revealed multiple examples of convergently evolved virulence mechanisms. Originally described as rare, but increasingly common, are interactions where a single gene deletion in a pathogenic species causes hypervirulence. This review utilised the pathogen–host interaction database (www.PHI-base.org) to identify 112 hypervirulent mutations from 37 pathogen species, and subsequently interrogates the trans-kingdom, conserved, molecular, biochemical and cellular themes that cause hypervirulence. This study investigates 22 animal and 15 plant pathogens including 17 bacterial and 17 fungal species. Finally, the evolutionary significance and trans-kingdom requirement for negative regulators of hypervirulence and the implication of pathogen hypervirulence and emerging infectious diseases on society are discussed. PMID:26468211

  11. Chenodeoxycholic acid-mediated activation of the farnesoid X receptor negatively regulates hydroxysteroid sulfotransferase.

    PubMed

    Miyata, Masaaki; Matsuda, Yoshiki; Tsuchiya, Hiroyuki; Kitada, Hirotaka; Akase, Takanori; Shimada, Miki; Nagata, Kiyoshi; Gonzalez, Frank J; Yamazoe, Yasushi

    2006-08-01

    Hydroxysteroid sulfotransferase catalyzing bile acid sulfation plays an essential role in protection against lithocholic acid (LCA)-induced liver toxicity. Hepatic levels of Sult2a is up to 8-fold higher in farnesoid X receptor-null mice than in the wild-type mice. Thus, the influence of FXR ligand (chenodeoxycholic acid (CDCA) and LCA) feeding on hepatic Sult2a expression was examined in FXR-null and wild-type mice. Hepatic Sult2a protein content was elevated in FXR-null and wild-type mice fed a LCA (1% and 0.5%) diet. Treatment with 0.5% CDCA diet decreased hepatic Sult2a to 20% of the control in wild-type mice, but increased the content in FXR-null mice. Liver Sult2a1 (St2a4) mRNA levels were reduced to 26% in wild-type mice after feeding of a CDCA diet, while no decrease was observed on Sult2a1 mRNA levels in FXR-null mice after CDCA feeding. A significant inverse relationship (r(2)=0.523) was found between hepatic Sult2a protein content and small heterodimer partner (SHP) mRNA level. PCN-mediated increase in Sult2a protein levels were attenuated by CDCA feeding in wild-type mice, but not in FXR-null mice. Human SULT2A1 protein and mRNA levels were decreased in HepG2 cells treated with the FXR agonists, CDCA or GW4064 in dose-dependent manners, although SHP mRNA levels were increased. These results suggest that SULT2A is negatively regulated through CDCA-mediated FXR activation in mice and humans. PMID:16946559

  12. LIF negatively regulates tumour-suppressor p53 through Stat3/ID1/MDM2 in colorectal cancers.

    PubMed

    Yu, Haiyang; Yue, Xuetian; Zhao, Yuhan; Li, Xiaoyan; Wu, Lihua; Zhang, Cen; Liu, Zhen; Lin, Kevin; Xu-Monette, Zijun Y; Young, Ken H; Liu, Juan; Shen, Zhiyuan; Feng, Zhaohui; Hu, Wenwei

    2014-01-01

    Leukaemia inhibitory factor (LIF) has been recently identified as a p53 target gene, which mediates the role of p53 in maternal implantation under normal physiological conditions. Here we report that LIF is a negative regulator of p53; LIF downregulates p53 protein levels and function in human colorectal cancer (CRC) cells. The downregulation of p53 by LIF is mediated by the activation of Stat3, which transcriptionally induces inhibitor of DNA-binding 1 (ID1). ID1 upregulates MDM2, a key negative regulator of p53, and promotes p53 protein degradation. LIF is overexpressed in a large percentage of CRCs. LIF overexpression promotes cellular resistance towards chemotherapeutic agents in cultured CRC cells and colorectal xenograft tumours in a largely p53-dependent manner. Overexpression of LIF is associated with a poor prognosis in CRC patients. Taken together, LIF is a novel negative regulator of p53, overexpression of LIF is an important mechanism for the attenuation of p53, which promotes chemoresistance in CRCs. PMID:25323535

  13. NLRX1 Sequesters STING to Negatively Regulate the Interferon Response, Thereby Facilitating the Replication of HIV-1 and DNA Viruses.

    PubMed

    Guo, Haitao; König, Renate; Deng, Meng; Riess, Maximilian; Mo, Jinyao; Zhang, Lu; Petrucelli, Alex; Yoh, Sunnie M; Barefoot, Brice; Samo, Melissa; Sempowski, Gregory D; Zhang, Aiping; Colberg-Poley, Anamaris M; Feng, Hui; Lemon, Stanley M; Liu, Yong; Zhang, Yanping; Wen, Haitao; Zhang, Zhigang; Damania, Blossom; Tsao, Li-Chung; Wang, Qi; Su, Lishan; Duncan, Joseph A; Chanda, Sumit K; Ting, Jenny P-Y

    2016-04-13

    Understanding the negative regulators of antiviral immune responses will be critical for advancing immune-modulated antiviral strategies. NLRX1, an NLR protein that negatively regulates innate immunity, was previously identified in an unbiased siRNA screen as required for HIV infection. We find that NLRX1 depletion results in impaired nuclear import of HIV-1 DNA in human monocytic cells. Additionally, NLRX1 was observed to reduce type-I interferon (IFN-I) and cytokines in response to HIV-1 reverse-transcribed DNA. NLRX1 sequesters the DNA-sensing adaptor STING from interaction with TANK-binding kinase 1 (TBK1), which is a requisite for IFN-1 induction in response to DNA. NLRX1-deficient cells generate an amplified STING-dependent host response to cytosolic DNA, c-di-GMP, cGAMP, HIV-1, and DNA viruses. Accordingly, Nlrx1(-/-) mice infected with DNA viruses exhibit enhanced innate immunity and reduced viral load. Thus, NLRX1 is a negative regulator of the host innate immune response to HIV-1 and DNA viruses. PMID:27078069

  14. Highly frequent mutations in negative regulators of multiple virulence genes in group A streptococcal toxic shock syndrome isolates.

    PubMed

    Ikebe, Tadayoshi; Ato, Manabu; Matsumura, Takayuki; Hasegawa, Hideki; Sata, Tetsutaro; Kobayashi, Kazuo; Watanabe, Haruo

    2010-04-01

    Streptococcal toxic shock syndrome (STSS) is a severe invasive infection characterized by the sudden onset of shock and multiorgan failure; it has a high mortality rate. Although a number of studies have attempted to determine the crucial factors behind the onset of STSS, the responsible genes in group A Streptococcus have not been clarified. We previously reported that mutations of csrS/csrR genes, a two-component negative regulator system for multiple virulence genes of Streptococcus pyogenes, are found among the isolates from STSS patients. In the present study, mutations of another negative regulator, rgg, were also found in clinical isolates of STSS patients. The rgg mutants from STSS clinical isolates enhanced lethality and impaired various organs in the mouse models, similar to the csrS mutants, and precluded their being killed by human neutrophils, mainly due to an overproduction of SLO. When we assessed the mutation frequency of csrS, csrR, and rgg genes among S. pyogenes isolates from STSS (164 isolates) and non-invasive infections (59 isolates), 57.3% of the STSS isolates had mutations of one or more genes among three genes, while isolates from patients with non-invasive disease had significantly fewer mutations in these genes (1.7%). The results of the present study suggest that mutations in the negative regulators csrS/csrR and rgg of S. pyogenes are crucial factors in the pathogenesis of STSS, as they lead to the overproduction of multiple virulence factors. PMID:20368967

  15. Highly Frequent Mutations in Negative Regulators of Multiple Virulence Genes in Group A Streptococcal Toxic Shock Syndrome Isolates

    PubMed Central

    Ikebe, Tadayoshi; Ato, Manabu; Matsumura, Takayuki; Hasegawa, Hideki; Sata, Tetsutaro; Kobayashi, Kazuo; Watanabe, Haruo

    2010-01-01

    Streptococcal toxic shock syndrome (STSS) is a severe invasive infection characterized by the sudden onset of shock and multiorgan failure; it has a high mortality rate. Although a number of studies have attempted to determine the crucial factors behind the onset of STSS, the responsible genes in group A Streptococcus have not been clarified. We previously reported that mutations of csrS/csrR genes, a two-component negative regulator system for multiple virulence genes of Streptococcus pyogenes, are found among the isolates from STSS patients. In the present study, mutations of another negative regulator, rgg, were also found in clinical isolates of STSS patients. The rgg mutants from STSS clinical isolates enhanced lethality and impaired various organs in the mouse models, similar to the csrS mutants, and precluded their being killed by human neutrophils, mainly due to an overproduction of SLO. When we assessed the mutation frequency of csrS, csrR, and rgg genes among S. pyogenes isolates from STSS (164 isolates) and non-invasive infections (59 isolates), 57.3% of the STSS isolates had mutations of one or more genes among three genes, while isolates from patients with non-invasive disease had significantly fewer mutations in these genes (1.7%). The results of the present study suggest that mutations in the negative regulators csrS/csrR and rgg of S. pyogenes are crucial factors in the pathogenesis of STSS, as they lead to the overproduction of multiple virulence factors. PMID:20368967

  16. Attachment's Links With Adolescents' Social Emotions: The Roles of Negative Emotionality and Emotion Regulation.

    PubMed

    Murphy, Tia Panfile; Laible, Deborah J; Augustine, Mairin; Robeson, Lindsay

    2015-01-01

    Recent research has attempted to explain the mechanisms through which parental attachment affects social and emotional outcomes (e.g., Burnette, Taylor, Worthington, & Forsyth, 2007 ; Panfile & Laible, 2012 ). The authors' goal was to examine negative emotionality and emotion regulation as mediators of the associations that attachment has with empathy, forgiveness, guilt, and jealousy. One hundred forty-eight adolescents reported their parental attachment security, general levels of negative emotionality and abilities to regulate emotional responses, and tendencies to feel empathy, forgiveness, guilt, and jealousy. Results revealed that attachment security was associated with higher levels of empathy, forgiveness, and guilt, but lower levels of jealousy. In addition, emotion regulation mediated the links attachment shared with both empathy and guilt, such that higher levels of attachment security were linked with greater levels of emotion regulation, which led to greater levels of empathy and guilt. Alternatively, negative emotionality mediated the links attachment shared with both forgiveness and jealousy, such that higher levels of attachment security were associated with lower levels of negative emotionality, which in turn was linked to lower levels of forgiveness and higher levels of jealousy. This study provides a general picture of how attachment security may play a role in shaping an individual's levels of social emotions. PMID:26244914

  17. Relationships among Burnout, Social Support, and Negative Mood Regulation Expectancies of Elementary School Teachers in Korea

    ERIC Educational Resources Information Center

    Kim, Mi Y.; Lee, Jee Y.; Kim, Jinsook

    2009-01-01

    The purposes of this study are as follows: (1) to determine whether burnout among elementary school teachers in Korea differs on selected demographic variables, (2) to investigate the relationship between burnout and negative mood regulation expectancies, as an internal variable, and social support, as an external variable, and (3) to examine the…

  18. Therapeutic Alliance, Negative Mood Regulation, and Treatment Outcome in Child Abuse-Related Posttraumatic Stress Disorder

    ERIC Educational Resources Information Center

    Cloitre, Marylene; Chase Stovall McClough,K.; Miranda, Regina; Chemtob, Claude M.

    2004-01-01

    This study examined the related contributions of the therapeutic alliance and negative mood regulation to the outcome of a 2-phase treatment for childhood abuse-related posttraumatic stress disorder (PTSD). Phase 1 focused on stabilization and preparatory skills building, whereas Phase 2 was comprised primarily of imaginal exposure to traumatic…

  19. Conflict Management with Friends and Romantic Partners: The Role of Attachment and Negative Mood Regulation Expectancies.

    ERIC Educational Resources Information Center

    Creasey, Gary; Kershaw, Kathy; Boston, Ada

    1999-01-01

    Studied the degree to which attachment orientations were related to negative mood regulation expectancies and conflict management strategies with best friends and romantic partners in a sample of 140 female college students. Discusses results in relation to previous research on attachment theory and implications for interventions. (SLD)

  20. Improved wound management by regulated negative pressure-assisted wound therapy and regulated, oxygen- enriched negative pressure-assisted wound therapy through basic science research and clinical assessment.

    PubMed

    Topaz, Moris

    2012-05-01

    Regulated negative pressure-assisted wound therapy (RNPT) should be regarded as a state-of-the-art technology in wound treatment and the most important physical, nonpharmaceutical, platform technology developed and applied for wound healing in the last two decades. RNPT systems maintain the treated wound's environment as a semi-closed, semi-isolated system applying external physical stimulations to the wound, leading to biological and biochemical effects, with the potential to substantially influence wound-host interactions, and when properly applied may enhance wound healing. RNPT is a simple, safe, and affordable tool that can be utilized in a wide range of acute and chronic conditions, with reduced need for complicated surgical procedures, and antibiotic treatment. This technology has been shown to be effective and safe, saving limbs and lives on a global scale. Regulated, oxygen-enriched negative pressure-assisted wound therapy (RO-NPT) is an innovative technology, whereby supplemental oxygen is concurrently administered with RNPT for their synergistic effect on treatment and prophylaxis of anaerobic wound infection and promotion of wound healing. Understanding the basic science, modes of operation and the associated risks of these technologies through their fundamental clinical mechanisms is the main objective of this review. PMID:23162229

  1. Wheat CBL-interacting protein kinase 25 negatively regulates salt tolerance in transgenic wheat

    PubMed Central

    Jin, Xia; Sun, Tao; Wang, Xiatian; Su, Peipei; Ma, Jingfei; He, Guangyuan; Yang, Guangxiao

    2016-01-01

    CBL-interacting protein kinases are involved in plant responses to abiotic stresses, including salt stress. However, the negative regulating mechanism of this gene family in response to salinity is less reported. In this study, we evaluated the role of TaCIPK25 in regulating salt response in wheat. Under conditions of high salinity, TaCIPK25 expression was markedly down-regulated in roots. Overexpression of TaCIPK25 resulted in hypersensitivity to Na+ and superfluous accumulation of Na+ in transgenic wheat lines. TaCIPK25 expression did not decline in transgenic wheat and remained at an even higher level than that in wild-type wheat controls under high-salinity treatment. Furthermore, transmembrane Na+/H+ exchange was impaired in the root cells of transgenic wheat. These results suggested that TaCIPK25 negatively regulated salt response in wheat. Additionally, yeast-one-hybrid, β-glucuronidase activity and DNA-protein-interaction-enzyme-linked-immunosorbent assays showed that the transcription factor TaWRKY9 bound W-box in the TaCIPK25 promoter region. Quantitative real-time polymerase chain reaction assays showed concomitantly inverted expression patterns of TaCIPK25 and TaWRKY9 in wheat roots under salt treatment, ABA application and inhibition of endogenous ABA condition. Overall, based on our results, in a salt stress condition, the negative salt response in wheat involved TaCIPK25 with the expression regulated by TaWRKY9. PMID:27358166

  2. RRAD inhibits the Warburg effect through negative regulation of the NF-κB signaling

    PubMed Central

    Wu, Rui; Lin, Meihua; Liang, Yingjian; Liu, Jia; Wang, Xiaolong; Yang, Bo; Feng, Zhaohui

    2015-01-01

    Cancer cells preferentially use aerobic glycolysis to meet their increased energetic and biosynthetic demands, a phenomenon known as the Warburg effect. Its underlying mechanism is not fully understood. RRAD, a small GTPase, is a potential tumor suppressor in lung cancer. RRAD expression is frequently down-regulated in lung cancer, which is associated with tumor progression and poor prognosis. Recently, RRAD was reported to repress the Warburg effect, indicating that down-regulation of RRAD expression is an important mechanism contributing to the Warburg effect in lung cancer. However, the mechanism by which RRAD inhibits the Warburg effect remains unclear. Here, we found that RRAD negatively regulates the NF-κB signaling to inhibit the GLUT1 translocation and the Warburg effect in lung cancer cells. Mechanically, RRAD directly binds to the p65 subunit of the NF-κB complex and inhibits the nuclear translocation of p65, which in turn negatively regulates the NF-κB signaling to inhibit GLUT1 translocation and the Warburg effect. Blocking the NF-κB signaling largely abolishes the inhibitory effects of RRAD on the translocation of GLUT1 to the plasma membrane and the Warburg effect. Taken together, our results revealed a novel mechanism by which RRAD negatively regulates the Warburg effect in lung cancer cells. PMID:25893381

  3. Wheat CBL-interacting protein kinase 25 negatively regulates salt tolerance in transgenic wheat.

    PubMed

    Jin, Xia; Sun, Tao; Wang, Xiatian; Su, Peipei; Ma, Jingfei; He, Guangyuan; Yang, Guangxiao

    2016-01-01

    CBL-interacting protein kinases are involved in plant responses to abiotic stresses, including salt stress. However, the negative regulating mechanism of this gene family in response to salinity is less reported. In this study, we evaluated the role of TaCIPK25 in regulating salt response in wheat. Under conditions of high salinity, TaCIPK25 expression was markedly down-regulated in roots. Overexpression of TaCIPK25 resulted in hypersensitivity to Na(+) and superfluous accumulation of Na(+) in transgenic wheat lines. TaCIPK25 expression did not decline in transgenic wheat and remained at an even higher level than that in wild-type wheat controls under high-salinity treatment. Furthermore, transmembrane Na(+)/H(+) exchange was impaired in the root cells of transgenic wheat. These results suggested that TaCIPK25 negatively regulated salt response in wheat. Additionally, yeast-one-hybrid, β-glucuronidase activity and DNA-protein-interaction-enzyme-linked-immunosorbent assays showed that the transcription factor TaWRKY9 bound W-box in the TaCIPK25 promoter region. Quantitative real-time polymerase chain reaction assays showed concomitantly inverted expression patterns of TaCIPK25 and TaWRKY9 in wheat roots under salt treatment, ABA application and inhibition of endogenous ABA condition. Overall, based on our results, in a salt stress condition, the negative salt response in wheat involved TaCIPK25 with the expression regulated by TaWRKY9. PMID:27358166

  4. Relationship of Maternal Negative Moods to Child Emotion Regulation during Family Interaction

    PubMed Central

    Dagne, Getachew A.; Snyder, James

    2016-01-01

    The relationship of maternal hostile and depressive moods to children’s down-regulation of unprovoked anger and sadness/fear was assessed in a community sample of 267 five year old boys and girls. The speed of children’s down-regulation of unprovoked anger and sadness/fear was based on real-time observations during mother-child interaction. The association of down-regulation with maternal mood was estimated using Bayesian event history analysis. As mothers reported higher depressive mood, both boys and girls were faster to down regulate anger displays as those displays accumulated during mother child interaction. The speed of boys’ down regulation of anger and of sadness/fear was not associated with maternal hostile mood. As mothers reported more hostile mood, girls were faster to down regulate displays of sadness/fear, but the speed of this down regulation slowed as those displays accumulated during ongoing mother-child interaction. These associations of child down regulation and maternal mood were observed after controlling for child adjustment. The data suggest frequent exposure to different negative maternal moods affect children’s expression and regulation of emotions in relatively specific ways, conditional on the type of maternal mood, the type of child emotion, and child gender. PMID:21262049

  5. Corp Regulates P53 in Drosophila melanogaster via a Negative Feedback Loop

    PubMed Central

    Chakraborty, Riddhita; Li, Ying; Zhou, Lei; Golic, Kent G.

    2015-01-01

    The tumor suppressor P53 is a critical mediator of the apoptotic response to DNA double-strand breaks through the transcriptional activation of pro-apoptotic genes. This mechanism is evolutionarily conserved from mammals to lower invertebrates, including Drosophila melanogaster. P53 also transcriptionally induces its primary negative regulator, Mdm2, which has not been found in Drosophila. In this study we identified the Drosophila gene companion of reaper (corp) as a gene whose overexpression promotes survival of cells with DNA damage in the soma but reduces their survival in the germline. These disparate effects are shared by p53 mutants, suggesting that Corp may be a negative regulator of P53. Confirming this supposition, we found that corp negatively regulates P53 protein level. It has been previously shown that P53 transcriptionally activates corp; thus, Corp produces a negative feedback loop on P53. We further found that Drosophila Corp shares a protein motif with vertebrate Mdm2 in a region that mediates the Mdm2:P53 physical interaction. In Corp, this motif mediates physical interaction with Drosophila P53. Our findings implicate Corp as a functional analog of vertebrate Mdm2 in flies. PMID:26230084

  6. [Regulation of Positive and Negative Emotions as Mediator between Maternal Emotion Socialization and Child Problem Behavior].

    PubMed

    Fäsche, Anika; Gunzenhauser, Catherine; Friedlmeier, Wolfgang; von Suchodoletz, Antje

    2015-01-01

    The present study investigated five to six year old children's ability to regulate negative and positive emotions in relation to psychosocial problem behavior (N=53). It was explored, whether mothers' supportive and nonsupportive strategies of emotion socialization influence children's problem behavior by shaping their emotion regulation ability. Mothers reported on children's emotion regulation and internalizing and externalizing problem behavior via questionnaire, and were interviewed about their preferences for socialization strategies in response to children's expression of negative affect. Results showed that children with more adaptive expression of adequate positive emotions had less internalizing behavior problems. When children showed more control of inadequate negative emotions, children were less internalizing as well as externalizing in their behavior. Furthermore, results indicated indirect relations of mothers' socialization strategies with children's problem behavior. Control of inadequate negative emotions mediated the link between non-supportive strategies on externalizing problem behavior. Results suggest that emotion regulatory processes should be part of interventions to reduce the development of problematic behavior in young children. Parents should be trained in dealing with children's emotions in a constructive way. PMID:26032031

  7. Maternal Attachment Style and Responses to Adolescents’ Negative Emotions: The Mediating Role of Maternal Emotion Regulation

    PubMed Central

    Jones, Jason D.; Brett, Bonnie E.; Ehrlich, Katherine B.; Lejuez, Carl W.; Cassidy, Jude

    2014-01-01

    SYNOPSIS Objective Previous research has examined the developmental consequences, particularly in early childhood, of parents’ supportive and unsupportive responses to children’s negative emotions. Much less is known about factors that explain why parents respond in ways that may support or undermine their children’s emotions, and even less is known about how these parenting processes unfold with adolescents. We examined the associations between mothers’ attachment styles and their distress, harsh, and supportive responses to their adolescents’ negative emotions two years later and whether these links were mediated by maternal emotion regulation difficulties. Design Mothers in a longitudinal study (n = 230) reported on their attachment style, difficulties regulating their emotions, and their hypothetical responses to their adolescents’ negative emotions, respectively, at consecutive laboratory visits one year apart. Results Mothers who reported greater attachment-related avoidance and anxiety reported having greater difficulties with emotion regulation one year later. Emotion dysregulation, in turn, predicted more distressed, harsher, and less supportive maternal responses to adolescents’ negative emotions the following year. In addition, greater avoidance directly predicted harsher maternal responses two years later. Conclusions These findings extend previous research by identifying maternal attachment style as a predictor of responses to adolescent distress and by documenting the underlying role of emotion dysregulation in the link between adult attachment style and parenting. PMID:25568638

  8. DDIT4/REDD1/RTP801 is a novel negative regulator of Schwann cell myelination.

    PubMed

    Noseda, Roberta; Belin, Sophie; Piguet, Françoise; Vaccari, Ilaria; Scarlino, Stefania; Brambilla, Paola; Martinelli Boneschi, Filippo; Feltri, Maria Laura; Wrabetz, Lawrence; Quattrini, Angelo; Feinstein, Elena; Huganir, Richard L; Bolino, Alessandra

    2013-09-18

    Signals that promote myelination must be tightly modulated to adjust myelin thickness to the axonal diameter. In the peripheral nervous system, axonal neuregulin 1 type III promotes myelination by activating erbB2/B3 receptors and the PI3K/AKT/mTOR pathway in Schwann cells. Conversely, PTEN (phosphatase and tensin homolog on chromosome 10) dephosphorylates PtdIns(3,4,5)P3 and negatively regulates the AKT pathway and myelination. Recently, the DLG1/SAP97 scaffolding protein was described to interact with PTEN to enhance PIP3 dephosphorylation. Here we now report that nerves from mice with conditional inactivation of Dlg1 in Schwann cells display only a transient increase in myelin thickness during development, suggesting that DLG1 is a transient negative regulator of myelination. Instead, we identified DDIT4/RTP801/REDD1 as a sustained negative modulator of myelination. We show that DDIT4 is expressed in Schwann cells and its maximum expression level precedes the peak of AKT activation and of DLG1 activity in peripheral nerves. Moreover, loss of DDIT4 expression both in vitro and in vivo in Ddit4-null mice provokes sustained hypermyelination and enhanced mTORC1 activation, thus suggesting that this molecule is a novel negative regulator of PNS myelination. PMID:24048858

  9. Fear is only as deep as the mind allows: a coordinate-based meta-analysis of neuroimaging studies on the regulation of negative affect.

    PubMed

    Diekhof, Esther Kristina; Geier, Katharina; Falkai, Peter; Gruber, Oliver

    2011-09-01

    Humans have the ability to control negative affect and perceived fear. Nevertheless, it is still unclear whether this affect regulation capacity relies on a common neural mechanism in different experimental domains. Here, we sought to identify commonalities in regulatory brain activation in the domains of fear extinction, placebo, and cognitive emotion regulation. Using coordinate-based activation-likelihood estimation meta-analysis we intended to elucidate concordant hyperactivations and the associated deactivations in the three experimental domains, when human subjects successfully diminished negative affect. Our data show that only one region in the ventromedial prefrontal cortex (VMPFC) controlled negative affective responses and reduced the degree of subjectively perceived unpleasantness independent of the experimental domain. This down-regulation of negative affect was further accompanied by a concordant reduction of activation in the left amygdala. Finally, the soothing effect of placebo treatments and cognitive reappraisal strategies, but not extinction retrieval, was specifically accompanied by a coherent hyperactivation in the anterior cingulate and the insular cortex. Collectively, our data strongly imply that the human VMPFC may represent a domain-general controller of perceived fear and aversiveness that modulates negative affective responses in phylogenetically older structures of the emotion processing system. In addition, higher-level regulation strategies may further engage complementary neural resources to effectively deal with the emotion-eliciting events. PMID:21669291

  10. Gonadotropin-regulated Testicular RNA Helicase (GRTH/DDX25), a Negative Regulator of Luteinizing/Chorionic Gonadotropin Hormone-induced Steroidogenesis in Leydig Cells

    PubMed Central

    Fukushima, Masato; Villar, Joaquin; Tsai-Morris, Chon-Hwa; Dufau, Maria L.

    2011-01-01

    Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) is a testis-specific gonadotropin-regulated RNA helicase that is present in Leydig cells (LCs) and germ cells and is essential for spermatid development and completion of spermatogenesis. Normal basal levels of testosterone in serum and LCs were observed in GRTH null (GRTH−/−) mice. However, testosterone production was enhanced in LCs of GRTH−/− mice compared with WT mice by both in vivo and in vitro human chorionic gonadotropin stimulation. LCs of GRTH−/− mice had swollen mitochondria with a significantly increased cholesterol content in the inner mitochondrial membrane. Basal protein levels of SREBP2, HMG-CoA reductase, and steroidogenic acute regulatory protein (StAR; a protein that transports cholesterol to the inner mitochondrial membrane) were markedly increased in LCs of GRTH−/− mice compared with WT mice. Gonadotropin stimulation caused an increase in StAR mRNA levels and protein expression in GRTH−/− mice versus WT mice, with no further increase in SREBP2 and down-regulation of HMG-CoA reductase protein. The half-life of StAR mRNA was significantly increased in GRTH−/− mice. Moreover, association of StAR mRNA with GRTH protein was observed in WT mice. Human chorionic gonadotropin increased GRTH gene expression and its associated StAR protein at cytoplasmic sites. Taken together, these findings indicate that, through its negative role in StAR message stability, GRTH regulates cholesterol availability at the mitochondrial level. The finding of an inhibitory action of GRTH associated with gonadotropin-mediated steroidogenesis has provided insights into a novel negative autocrine molecular control mechanism of this helicase in the regulation of steroid production in the male. PMID:21719703

  11. Parental Negative Control Moderates the Shyness–Emotion Regulation Pathway to School-Age Internalizing Symptoms

    PubMed Central

    Shaw, Daniel S.; Moilanen, Kristin L.

    2011-01-01

    Models of developmental psychopathology emphasize both mediation and moderation processes among child and caregiving attributes; however, little research has examined both these processes simultaneously on the development of internalizing problems. This study tested a moderated mediation model that related early childhood shyness, emotion regulation and maternal negative control to school-age internalizing problems among 257 boys from low-income families. Shyness and maternal negative control was assessed at ages 1.5–2, emotion regulation was observed at age 3.5, and internalizing symptoms were assessed by mothers and teachers at age 6 or 7. Results indicated that 1) the active distraction regulation strategy mediated the relations between early shyness and maternal report of internalizing symptoms; 2) the passive/dependent regulation strategy mediated the relations between shyness and teacher report of internalizing symptoms; and 3) both mediation processes were moderated by maternal negative control. The results are discussed in relation to implications for early prevention and intervention. PMID:21107676

  12. Phosphorylation of Trihelix Transcriptional Repressor ASR3 by MAP KINASE4 Negatively Regulates Arabidopsis Immunity

    PubMed Central

    Li, Bo; Jiang, Shan; Yu, Xiao; Cheng, Cheng; Chen, Sixue; Cheng, Yanbing; Yuan, Joshua S.; Jiang, Daohong; He, Ping; Shan, Libo

    2015-01-01

    Proper control of immune-related gene expression is crucial for the host to launch an effective defense response. Perception of microbe-associated molecular patterns (MAMPs) induces rapid and profound transcriptional reprogramming via unclear mechanisms. Here, we show that ASR3 (ARABIDOPSIS SH4-RELATED3) functions as a transcriptional repressor and plays a negative role in regulating pattern-triggered immunity (PTI) in Arabidopsis thaliana. ASR3 belongs to a plant-specific trihelix transcription factor family for which functional studies are lacking. MAMP treatments induce rapid phosphorylation of ASR3 at threonine 189 via MPK4, a mitogen-activated protein kinase that negatively regulates PTI responses downstream of multiple MAMP receptors. ASR3 possesses transcriptional repressor activity via its ERF-associated amphiphilic repression motifs and negatively regulates a large subset of flg22-induced genes. Phosphorylation of ASR3 by MPK4 enhances its DNA binding activity to suppress gene expression. Importantly, the asr3 mutant shows enhanced disease resistance to virulent bacterial pathogen infection, whereas transgenic plants overexpressing the wild-type or phospho-mimetic form of ASR3 exhibit compromised PTI responses. Our studies reveal a function of the trihelix transcription factors in plant innate immunity and provide evidence that ASR3 functions as a transcriptional repressor regulated by MAMP-activated MPK4 to fine-tune plant immune gene expression. PMID:25770109

  13. MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3.

    PubMed

    Zhang, Nan; Zhong, Jie; Han, Song; Li, Yun; Yin, Yanling; Li, Junfa

    2016-01-01

    miRNAs have been linked to many human diseases, including ischemic stroke, and are being pursued as clinical diagnostics and therapeutic targets. Among the aberrantly expressed miRNAs in our previous report using large-scale microarray screening, the downregulation of miR-378 in the peri-infarct region of middle cerebral artery occluded (MCAO) mice can be reversed by hypoxic preconditioning (HPC). In this study, the role of miR-378 in the ischemic injury was further explored. We found that miR-378 levels significantly decreased in N2A cells following oxygen-glucose deprivation (OGD) treatment. Overexpression of miR-378 significantly enhanced cell viability, decreased TUNEL-positive cells and the immunoreactivity of cleaved-caspase-3. Conversely, downregulation of miR-378 aggravated OGD-induced apoptosis and ischemic injury. By using bioinformatic algorithms, we discovered that miR-378 may directly bind to the predicted 3'-untranslated region (UTR) of Caspase-3 gene. The protein level of caspase-3 increased significantly upon OGD treatment, and can be downregulated by pri-miR-378 transfection. The luciferase reporter assay confirmed the binding of miR-378 to the 3'-UTR of Caspase-3 mRNA and repressed its translation. In addition, miR-378 agomir decreased cleaved-caspase-3 ratio, reduced infarct volume and neural cell death induced by MCAO. Furthermore, caspase-3 knockdown could reverse anti-miR-378 mediated neuronal injury. Taken together, our data demonstrated that miR-378 attenuated ischemic injury by negatively regulating the apoptosis executioner, caspase-3, providing a potential therapeutic target for ischemic stroke. PMID:27598143

  14. Gene expression in human thyrocytes and autonomous adenomas reveals suppression of negative feedbacks in tumorigenesis

    PubMed Central

    van Staveren, Wilma C. G.; Solís, David Weiss; Delys, Laurent; Venet, David; Cappello, Matteo; Andry, Guy; Dumont, Jacques E.; Libert, Frédérick; Detours, Vincent; Maenhaut, Carine

    2006-01-01

    The cAMP signaling pathway regulates growth of many cell types, including somatotrophs, thyrocytes, melanocytes, ovarian follicular granulosa cells, adrenocortical cells, and keratinocytes. Mutations of partners from the cAMP signaling cascade are involved in tumor formation. Thyroid-stimulating hormone (TSH) receptor and Gsα activating mutations have been detected in thyroid autonomous adenomas, Gsα mutations in growth hormone-secreting pituitary adenomas, and PKAR1A mutations in Carney complex, a multiple neoplasia syndrome. To gain more insight into the role of cAMP signaling in tumor formation, human primary cultures of thyrocytes were treated for different times (1.5, 3, 16, 24, and 48 h) with TSH to characterize modulations in gene expression using cDNA microarrays. This kinetic study showed a clear difference in expression, early (1.5 and 3 h) and late (16–48 h) after the onset of TSH stimulation. This result suggests a progressive sequential process leading to a change of cell program. The gene expression profile of the long-term stimulated cultures resembled the autonomous adenomas, but not papillary carcinomas. The molecular phenotype of the adenomas thus confirms the role of long-term stimulation of the TSH–cAMP cascade in the pathology. TSH induced a striking up-regulation of different negative feedback modulators of the cAMP cascade, presumably insuring the one-shot effect of the stimulus. Some were down- or nonregulated in adenomas, suggesting a loss of negative feedback control in the tumors. These results suggest that in tumorigenesis, activation of proliferation pathways may be complemented by suppression of multiple corresponding negative feedbacks, i.e., specific tumor suppressors. PMID:16381821

  15. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase

    PubMed Central

    Tong, Amy; Lynn, Grace; Ngo, Vy; Wong, Daniel; Moseley, Sarah L.; Ewbank, Jonathan J.; Goncharov, Alexandr; Wu, Yi-Chun; Pujol, Nathalie; Chisholm, Andrew D.

    2009-01-01

    Wounding of epidermal layers triggers multiple coordinated responses to damage. We show here that the Caenorhabditis elegans ortholog of the tumor suppressor death-associated protein kinase, dapk-1, acts as a previously undescribed negative regulator of barrier repair and innate immune responses to wounding. Loss of DAPK-1 function results in constitutive formation of scar-like structures in the cuticle, and up-regulation of innate immune responses to damage. Overexpression of DAPK-1 represses innate immune responses to needle wounding. Up-regulation of innate immune responses in dapk-1 requires the TIR-1/p38 signal transduction pathway; loss of function in this pathway synergizes with dapk-1 to drastically reduce adult lifespan. Our results reveal a previously undescribed function for the DAPK tumor suppressor family in regulation of epithelial damage responses. PMID:19164535

  16. Nanoparticles, human health hazard and regulation

    PubMed Central

    Seaton, Anthony; Tran, Lang; Aitken, Robert; Donaldson, Kenneth

    2010-01-01

    New developments in technology usually entail some hazard as well as advantage to a society. Hazard of a material translates into risk by exposure of humans and/or their environment to the agent in question, and risk is reduced by control of exposure, usually guided by regulation based on understanding of the mechanisms of harm. We illustrate risks relating to the causation of diseases associated with exposure to aerosols of combustion particles and asbestos, leading to paradigms of particle toxicity, and discuss analogies with potential exposure to manufactured nanoparticles (NPs). We review the current understanding of the hazard of NPs derived from the new science of nanotoxicology and the limited research to date into human exposure to these particles. We identify gaps in knowledge relating to the properties of NPs that might determine toxicity and in understanding the most appropriate ways both to measure this in the laboratory and to assess it in the workplace. Nevertheless, we point out that physical principles governing the behaviour of such particles allow determination of practical methods of protecting those potentially exposed. Finally, we discuss the early steps towards regulation and the difficulties facing regulators in controlling potentially harmful exposures in the absence of sufficient scientific evidence. PMID:19726441

  17. Glucocorticoid regulation of human BMP-6 transcription.

    PubMed

    Liu, Yunshan; Titus, Louisa; Barghouthi, Mejd; Viggeswarapu, Manjula; Hair, Gregory; Boden, Scott D

    2004-09-01

    Addition of dexamethasone (Dex) to human mesenchymal stem cells (hMSCs) resulted in a 16-fold increase in human bone morphogenetic protein-6 (hBMP-6) mRNA levels 24 h after treatment. Evaluation of luciferase expression after transfection of HeLa cells with hBMP-6 promoter/luciferase reporter constructs indicated that the hBMP-6 promoter activity was contained in a 268-bp region (-1051 to -784 where +1 is the translation start site) over 600 bases 5' to that previously published. It further showed that the promoter activity is regulated by glucocorticoid treatment. Analysis of RNA from hMSCs and HeLa cells by primer extension, RNase protection, and 5' RACE further narrowed the location of the transcription start site to an 84-bp region (-940 to -857). To determine whether this start site was regulated in hMSCs, hBMP-6 mRNA levels in control and Dex-treated cells were quantitated by RT-PCR using one primer set in the translated region of the gene and one located just 3' of the 84-bp region. Both primer sets showed hBMP-6 mRNA levels approximately 16- to 22-fold higher in the Dex-treated cells, demonstrating that hBMP-6 transcription is being regulated by glucocorticoids in the pluripotent hMSCs at the upstream transcription start site. PMID:15336603

  18. TRIM45 negatively regulates NF-{kappa}B-mediated transcription and suppresses cell proliferation

    SciTech Connect

    Shibata, Mio; Sato, Tomonobu; Nukiwa, Ryota; Ariga, Tadashi; Hatakeyama, Shigetsugu

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer NF-{kappa}B plays an important role in cell survival and carcinogenesis. Black-Right-Pointing-Pointer TRIM45 negatively regulates TNF{alpha}-induced NF-{kappa}B-mediated transcription. Black-Right-Pointing-Pointer TRIM45 overexpression suppresses cell growth. Black-Right-Pointing-Pointer TRIM45 acts as a repressor for the NF-{kappa}B signal and regulates cell growth. -- Abstract: The NF-{kappa}B signaling pathway plays an important role in cell survival, immunity, inflammation, carcinogenesis, and organogenesis. Activation of NF-{kappa}B is regulated by several posttranslational modifications including phosphorylation, neddylation and ubiquitination. The NF-{kappa}B signaling pathway is activated by two distinct signaling mechanisms and is strictly modulated by the ubiquitin-proteasome system. It has been reported that overexpression of TRIM45, one of the TRIM family ubiquitin ligases, suppresses transcriptional activities of Elk-1 and AP-1, which are targets of the MAPK signaling pathway. In this study, we showed that TRIM45 also negatively regulates TNF{alpha}-induced NF-{kappa}B-mediated transcription by a luciferase reporter assay and that TRIM45 lacking a RING domain also has an activity to inhibit the NF-{kappa}B signal. Moreover, we found that TRIM45 overexpression suppresses cell growth. These findings suggest that TRIM45 acts as a repressor for the NF-{kappa}B signal and regulates cell growth.

  19. Krüppel-like factor 4 negatively regulates cellular antiviral immune response

    PubMed Central

    Luo, Wei-Wei; Lian, Huan; Zhong, Bo; Shu, Hong-Bing; Li, Shu

    2016-01-01

    Viral infection triggers activation of the transcription factors NF-κB and IRF3, which collaborate to induce the expression of type I interferons (IFNs) and elicit innate antiviral response. In this report, we identified Krüppel-like factor 4 (KLF4) as a negative regulator of virus-triggered signaling. Overexpression of KLF4 inhibited virus-induced activation of ISRE and IFN-β promoter in various types of cells, while knockdown of KLF4 potentiated viral infection-triggered induction of IFNB1 and downstream genes and attenuated viral replication. In addition, KLF4 was found to be localized in the cytosol and nucleus, and viral infection promoted the translocation of KLF4 from cytosol to nucleus. Upon virus infection, KLF4 was bound to the promoter of IFNB gene and inhibited the recruitment of IRF3 to the IFNB promoter. Our study thus suggests that KLF4 negatively regulates cellular antiviral response. PMID:25531393

  20. An RNA chaperone, AtCSP2, negatively regulates salt stress tolerance

    PubMed Central

    Sasaki, Kentaro; Liu, Yuelin; Kim, Myung-Hee; Imai, Ryozo

    2015-01-01

    Cold shock domain (CSD) proteins are RNA chaperones that destabilize RNA secondary structures. Arabidopsis Cold Shock Domain Protein 2 (AtCSP2), one of the 4 CSD proteins (AtCSP1-AtCSP4) in Arabidopsis, is induced during cold acclimation but negatively regulates freezing tolerance. Here, we analyzed the function of AtCSP2 in salt stress tolerance. A double mutant, with reduced AtCSP2 and no AtCSP4 expression (atcsp2–3 atcsp4–1), displayed higher survival rates after salt stress. In addition, overexpression of AtCSP2 resulted in reduced salt stress tolerance. These data demonstrate that AtCSP2 acts as a negative regulator of salt stress tolerance in Arabidopsis. PMID:26252779

  1. Ceramide and ceramide 1-phosphate are negative regulators of TNF-α production induced by lipopolysaccharide.

    PubMed

    Józefowski, Szczepan; Czerkies, Maciej; Łukasik, Anna; Bielawska, Alicja; Bielawski, Jacek; Kwiatkowska, Katarzyna; Sobota, Andrzej

    2010-12-01

    LPS is a constituent of cell walls of Gram-negative bacteria that, acting through the CD14/TLR4 receptor complex, causes strong proinflammatory activation of macrophages. In murine peritoneal macrophages and J774 cells, LPS at 1-2 ng/ml induced maximal TNF-α and MIP-2 release, and higher LPS concentrations were less effective, which suggested a negative control of LPS action. While studying the mechanism of this negative regulation, we found that in J774 cells, LPS activated both acid sphingomyelinase and neutral sphingomyelinase and moderately elevated ceramide, ceramide 1-phosphate, and sphingosine levels. Lowering of the acid sphingomyelinase and neutral sphingomyelinase activities using inhibitors or gene silencing upregulated TNF-α and MIP-2 production in J774 cells and macrophages. Accordingly, treatment of those cells with exogenous C8-ceramide diminished TNF-α and MIP-2 production after LPS stimulation. Exposure of J774 cells to bacterial sphingomyelinase or interference with ceramide hydrolysis using inhibitors of ceramidases also lowered the LPS-induced TNF-α production. The latter result indicates that ceramide rather than sphingosine suppresses TNF-α and MIP-2 production. Of these two cytokines, only TNF-α was negatively regulated by ceramide 1-phosphate as was indicated by upregulated TNF-α production after silencing of ceramide kinase gene expression. None of the above treatments diminished NO or RANTES production induced by LPS. Together the data indicate that ceramide negatively regulates production of TNF-α and MIP-2 in response to LPS with the former being sensitive to ceramide 1-phosphate as well. We hypothesize that the ceramide-mediated anti-inflammatory pathway may play a role in preventing endotoxic shock and in limiting inflammation. PMID:21041721

  2. Determinants of body weight regulation in humans.

    PubMed

    Moehlecke, Milene; Canani, Luis Henrique; Silva, Lucas Oliveira Junqueira E; Trindade, Manoel Roberto Maciel; Friedman, Rogerio; Leitão, Cristiane Bauermann

    2016-04-01

    Body weight is regulated by the ability of hypothalamic neurons to orchestrate behavioral, endocrine and autonomic responses via afferent and efferent pathways to the brainstem and the periphery. Weight maintenance requires a balance between energy intake and energy expenditure. Although several components that participate in energy homeostasis have been identified, there is a need to know in more detail their actions as well as their interactions with environmental and psychosocial factors in the development of human obesity. In this review, we examine the role of systemic mediators such as leptin, ghrelin and insulin, which act in the central nervous system by activating or inhibiting neuropeptide Y, Agouti-related peptide protein, melanocortin, transcript related to cocaine and amphetamine, and others. As a result, modifications in energy homeostasis occur through regulation of appetite and energy expenditure. We also examine compensatory changes in the circulating levels of several peripheral hormones after diet-induced weight loss. PMID:26910628

  3. Mindfulness in schizophrenia: Associations with self-reported motivation, emotion regulation, dysfunctional attitudes, and negative symptoms.

    PubMed

    Tabak, Naomi T; Horan, William P; Green, Michael F

    2015-10-01

    Mindfulness-based interventions are gaining empirical support as alternative or adjunctive treatments for a variety of mental health conditions, including anxiety, depression, and substance use disorders. Emerging evidence now suggests that mindfulness-based treatments may also improve clinical features of schizophrenia, including negative symptoms. However, no research has examined the construct of mindfulness and its correlates in schizophrenia. In this study, we examined self-reported mindfulness in patients (n=35) and controls (n=25) using the Five-Facet Mindfulness Questionnaire. We examined correlations among mindfulness, negative symptoms, and psychological constructs associated with negative symptoms and adaptive functioning, including motivation, emotion regulation, and dysfunctional attitudes. As hypothesized, patients endorsed lower levels of mindfulness than controls. In patients, mindfulness was unrelated to negative symptoms, but it was associated with more adaptive emotion regulation (greater reappraisal) and beliefs (lower dysfunctional attitudes). Some facets of mindfulness were also associated with self-reported motivation (behavioral activation and inhibition). These patterns of correlations were similar in patients and controls. Findings from this initial study suggest that schizophrenia patients may benefit from mindfulness-based interventions because they (a) have lower self-reported mindfulness than controls and (b) demonstrate strong relationships between mindfulness and psychological constructs related to adaptive functioning. PMID:26232242

  4. Identifying miRNA/mRNA negative regulation pairs in colorectal cancer

    PubMed Central

    Zhou, Xile; Xu, Xiangming; Wang, Jinhai; Lin, Jianjiang; Chen, Wenbin

    2015-01-01

    Although considerable progress has been made in the molecular biology of Colorectal cancer (CRC), novel approaches are still required to uncover the detailed molecular mechanism of CRC. We aim to explore the potential negatively regulated miRNA-mRNA pairs and investigate their regulatory roles so as to elaborate the potential roles of the critical proteins in the signaling pathways enriched by the differential target genes of negatively regulated miRNA in CRC. Firstly, the differential miRNA-mRNA pairs were selected, followed by pairs of miRNA and their target genes. The obtained relationships were subjected to do functional enrichment analysis and those enriched in CRC pathways were chose to further construct a protein interaction network. Finally, we analyzed the regulatory roles of these relationships and constructed a regulatory network of negatively regulated miRNA and mRNA relationships. A total of 372 pairs of miRNA-mRNA were found and 108 target genes of miRNA were obtained. Three miRNAs including hsa-mir-23b, hsa-mir-365-1 and hsa-mir-365-2 showed significant influence on prognosis of CRC patients. To conclude, the miRNA/mRNA deregulations pairs identified in this study have high potentials to be further applied in diagnosis and treatment of CRC. PMID:26269151

  5. Type One Protein Phosphatase 1 and Its Regulatory Protein Inhibitor 2 Negatively Regulate ABA Signaling

    PubMed Central

    Zhao, Yang; Xie, Shaojun; Batelli, Giorgia; Wang, Bangshing; Duan, Cheng-Guo; Wang, Xingang; Xing, Lu; Lei, Mingguang; Yan, Jun; Zhu, Xiaohong; Zhu, Jian-Kang

    2016-01-01

    The phytohormone abscisic acid (ABA) regulates plant growth, development and responses to biotic and abiotic stresses. The core ABA signaling pathway consists of three major components: ABA receptor (PYR1/PYLs), type 2C Protein Phosphatase (PP2C) and SNF1-related protein kinase 2 (SnRK2). Nevertheless, the complexity of ABA signaling remains to be explored. To uncover new components of ABA signal transduction pathways, we performed a yeast two-hybrid screen for SnRK2-interacting proteins. We found that Type One Protein Phosphatase 1 (TOPP1) and its regulatory protein, At Inhibitor-2 (AtI-2), physically interact with SnRK2s and also with PYLs. TOPP1 inhibited the kinase activity of SnRK2.6, and this inhibition could be enhanced by AtI-2. Transactivation assays showed that TOPP1 and AtI-2 negatively regulated the SnRK2.2/3/6-mediated activation of the ABA responsive reporter gene RD29B, supporting a negative role of TOPP1 and AtI-2 in ABA signaling. Consistent with these findings, topp1 and ati-2 mutant plants displayed hypersensitivities to ABA and salt treatments, and transcriptome analysis of TOPP1 and AtI-2 knockout plants revealed an increased expression of multiple ABA-responsive genes in the mutants. Taken together, our results uncover TOPP1 and AtI-2 as negative regulators of ABA signaling. PMID:26943172

  6. SOCS3 Drives Proteasomal Degradation of TBK1 and Negatively Regulates Antiviral Innate Immunity.

    PubMed

    Liu, Dong; Sheng, Chunjie; Gao, Shijuan; Yao, Chen; Li, Jiandong; Jiang, Wei; Chen, Huiming; Wu, Jiaoxiang; Pan, Changchuan; Chen, Shuai; Huang, Wenlin

    2015-07-01

    TANK-binding kinase 1 (TBK1)-mediated induction of type I interferon (IFN) plays a critical role in host antiviral responses and immune homeostasis. The negative regulation of TBK1 activity is largely unknown. We report that suppressor of cytokine signaling 3 (SOCS3) inhibits the IFN-β signaling pathway by promoting proteasomal degradation of TBK1. Overexpression and knockdown experiments indicated that SOCS3 is a negative regulator of IFN regulatory factor 3 (IRF3) phosphorylation and IFN-β transcription. Moreover, SOCS3 directly associates with TBK1, and they colocalize in the cytoplasm. SOCS3 catalyzes K48-linked polyubiquitination of TBK1 at Lys341 and Lys344 and promotes subsequent TBK1 degradation. On the contrary, SOCS3 knockdown markedly increases the abundance of TBK1. Interestingly, both the BOX domain of SOCS3 and Ser172 phosphorylation of TBK1 are indispensable for the processes of ubiquitination and degradation. Ectopic expression of SOCS3 significantly inhibits vesicular stomatitis virus (VSV) and influenza A virus strain A/WSN/33 (WSN)-induced IRF3 phosphorylation and facilitates the replication of WSN virus by detecting the transcription of its viral RNA (vRNA). Knockdown of SOCS3 represses WSN replication. Collectively, these results demonstrate that SOCS3 acts as a negative regulator of IFN-β signal by ubiquitinating and degrading TBK1, shed light on the understanding of antiviral innate immunity, and provide a potential target for developing antiviral agents. PMID:25939384

  7. Negative regulation of RIG-I-mediated antiviral signaling by TRK-fused gene (TFG) protein

    SciTech Connect

    Lee, Na-Rae; Shin, Han-Bo; Kim, Hye-In; Choi, Myung-Soo; Inn, Kyung-Soo

    2013-07-19

    Highlights: •TRK-fused gene product (TFG) interacts with TRIM25 upon viral infection. •TFG negatively regulates RIG-I mediated antiviral signaling. •TFG depletion leads to enhanced viral replication. •TFG act downstream of MAVS. -- Abstract: RIG-I (retinoic acid inducible gene I)-mediated antiviral signaling serves as the first line of defense against viral infection. Upon detection of viral RNA, RIG-I undergoes TRIM25 (tripartite motif protein 25)-mediated K63-linked ubiquitination, leading to type I interferon (IFN) production. In this study, we demonstrate that TRK-fused gene (TFG) protein, previously identified as a TRIM25-interacting protein, binds TRIM25 upon virus infection and negatively regulates RIG-I-mediated type-I IFN signaling. RIG-I-mediated IFN production and nuclear factor (NF)-κB signaling pathways were upregulated by the suppression of TFG expression. Furthermore, vesicular stomatitis virus (VSV) replication was significantly inhibited by small inhibitory hairpin RNA (shRNA)-mediated knockdown of TFG, supporting the suppressive role of TFG in RIG-I-mediated antiviral signaling. Interestingly, suppression of TFG expression increased not only RIG-I-mediated signaling but also MAVS (mitochondrial antiviral signaling protein)-induced signaling, suggesting that TFG plays a pivotal role in negative regulation of RNA-sensing, RIG-I-like receptor (RLR) family signaling pathways.

  8. Down-Regulation of Negative Emotional Processing by Transcranial Direct Current Stimulation: Effects of Personality Characteristics

    PubMed Central

    Peña-Gómez, Cleofé; Vidal-Piñeiro, Dídac; Clemente, Immaculada C.; Pascual-Leone, Álvaro; Bartrés-Faz, David

    2011-01-01

    Evidence from neuroimaging and electrophysiological studies indicates that the left dorsolateral prefrontal cortex (DLPFC) is a core region in emotional processing, particularly during down-regulation of negative emotional conditions. However, emotional regulation is a process subject to major inter-individual differences, some of which may be explained by personality traits. In the present study we used transcranial direct current stimulation (tDCS) over the left DLPFC to investigate whether transiently increasing the activity of this region resulted in changes in the ratings of positive, neutral and negative emotional pictures. Results revealed that anodal, but not cathodal, tDCS reduced the perceived degree of emotional valence for negative stimuli, possibly due to an enhancement of cognitive control of emotional expression. We also aimed to determine whether personality traits (extraversion and neuroticism) might condition the impact of tDCS. We found that individuals with higher scores on the introversion personality dimension were more permeable than extraverts to the modulatory effects of the stimulation. The present study underlines the role of the left DLPFC in emotional regulation, and stresses the importance of considering individual personality characteristics as a relevant variable, although replication is needed given the limited sample size of our study. PMID:21829522

  9. Transcription Factor Foxo1 Is a Negative Regulator of NK Cell Maturation and Function

    PubMed Central

    Deng, Youcai; Kerdiles, Yann; Chu, Jianhong; Yuan, Shunzong; Wang, Youwei; Chen, Xilin; Mao, Hsiaoyin; Zhang, Lingling; Zhang, Jianying; Hughes, Tiffany; Deng, Yafei; Zhang, Qi; Wang, Fangjie; Zou, Xianghong; Liu, Chang-Gong; Freud, Aharon G.; Li, Xiaohui; Caligiuri, Michael A; Vivier, Eric; Yu, Jianhua

    2015-01-01

    SUMMARY Little is known about the role of negative regulators in controlling natural killer (NK) cell development and effector functions. Foxo1 is a multifunctional transcription factor of the forkhead family. Using a mouse model of conditional deletion in NK cells, we found that Foxo1 negatively controlled NK cell differentiation and function. Immature NK cells expressed abundant Foxo1 and little Tbx21 relative to mature NK cells, but these two transcription factors reversed their expression as NK cells proceeded through development. Foxo1 promoted NK cell homing to lymph nodes through upregulating CD62L expression, and impaired late-stage maturation and effector functions by repressing Tbx21 expression. Loss of Foxo1 rescued the defect in late-stage NK cell maturation in heterozygous Tbx21+/− mice. Collectively, our data reveal a regulatory pathway by which the negative regulator Foxo1 and the positive regulator Tbx21 play opposing roles in controlling NK cell development and effector functions. PMID:25769609

  10. NF-κB RelB Negatively Regulates Osteoblast Differentiation and Bone Formation

    PubMed Central

    Yao, Zhenqiang; Li, Yanyun; Yin, Xiaoxiang; Dong, Yufeng; Xing, Lianping; Boyce, Brendan F.

    2013-01-01

    RelA-mediated NF-κB canonical signaling promotes mesenchymal progenitor cell (MPC) proliferation, but inhibits differentiation of mature osteoblasts (OBs) and thus negatively regulates bone formation. Previous studies suggest that NF-κB RelB may also negatively regulate bone formation through non-canonical signaling, but they involved a complex knockout mouse model and the molecular mechanisms involved were not investigated. Here, we report that RelB−/− mice develop age-related increased trabecular bone mass associated with increased bone formation. RelB−/− bone marrow stromal cells expanded faster in vitro and have enhanced OB differentiation associated with increased expression of the osteoblastogenic transcription factor, Runx2. In addition, RelB directly targeted the Runx2 promoter to inhibit its activation. Importantly, RelB−/− bone-derived MPCs formed bone more rapidly than wild-type cells after they were injected into a murine tibial bone defect model. Our findings indicate that RelB negatively regulates bone mass as mice age and limits bone formation in healing bone defects, suggesting that inhibition of RelB could reduce age-related bone loss and enhance bone repair. PMID:24115294

  11. A balance of positive and negative regulators determines the pace of the segmentation clock

    PubMed Central

    Wiedermann, Guy; Bone, Robert Alexander; Silva, Joana Clara; Bjorklund, Mia

    2015-01-01

    Somitogenesis is regulated by a molecular oscillator that drives dynamic gene expression within the pre-somitic mesoderm. Previous mathematical models of the somitogenesis clock that invoke the mechanism of delayed negative feedback predict that its oscillation period depends on the sum of delays inherent to negative-feedback loops and inhibitor half-lives. We develop a mathematical model that explores the possibility that positive feedback also plays a role in determining the period of clock oscillations. The model predicts that increasing the half-life of the positive regulator, Notch intracellular domain (NICD), can lead to elevated NICD levels and an increase in the oscillation period. To test this hypothesis, we investigate a phenotype induced by various small molecule inhibitors in which the clock is slowed. We observe elevated levels and a prolonged half-life of NICD. Reducing NICD production rescues these effects. These data provide the first indication that tight control of the turnover of positive as well as negative regulators of the clock determines its periodicity. DOI: http://dx.doi.org/10.7554/eLife.05842.001 PMID:26357015

  12. Burkholderia mallei and Burkholderia pseudomallei Cluster 1 Type VI Secretion System Gene Expression Is Negatively Regulated by Iron and Zinc

    PubMed Central

    Burtnick, Mary N.; Brett, Paul J.

    2013-01-01

    Burkholderia mallei is a facultative intracellular pathogen that causes glanders in humans and animals. Previous studies have demonstrated that the cluster 1 type VI secretion system (T6SS-1) expressed by this organism is essential for virulence in hamsters and is positively regulated by the VirAG two-component system. Recently, we have shown that T6SS-1 gene expression is up-regulated following internalization of this pathogen into phagocytic cells and that this system promotes multinucleated giant cell formation in infected tissue culture monolayers. In the present study, we further investigated the complex regulation of this important virulence factor. To assess T6SS-1 expression, B. mallei strains were cultured in various media conditions and Hcp1 production was analyzed by Western immunoblotting. Transcript levels of several VirAG-regulated genes (bimA, tssA, hcp1 and tssM) were also determined using quantitative real time PCR. Consistent with previous observations, T6SS-1 was not expressed during growth of B. mallei in rich media. Curiously, growth of the organism in minimal media (M9G) or minimal media plus casamino acids (M9CG) facilitated robust expression of T6SS-1 genes whereas growth in minimal media plus tryptone (M9TG) did not. Investigation of this phenomenon confirmed a regulatory role for VirAG in this process. Additionally, T6SS-1 gene expression was significantly down-regulated by the addition of iron and zinc to M9CG. Other genes under the control of VirAG did not appear to be as tightly regulated by these divalent metals. Similar results were observed for B. pseudomallei, but not for B. thailandensis. Collectively, our findings indicate that in addition to being positively regulated by VirAG, B. mallei and B. pseudomallei T6SS-1 gene expression is negatively regulated by iron and zinc. PMID:24146925

  13. A salt-regulated peptide derived from the CAP superfamily protein negatively regulates salt-stress tolerance in Arabidopsis

    PubMed Central

    Chien, Pei-Shan; Nam, Hong Gil; Chen, Yet-Ran

    2015-01-01

    High salinity has negative impacts on plant growth through altered water uptake and ion-specific toxicities. Plants have therefore evolved an intricate regulatory network in which plant hormones play significant roles in modulating physiological responses to salinity. However, current understanding of the plant peptides involved in this regulatory network remains limited. Here, we identified a salt-regulated peptide in Arabidopsis. The peptide was 11 aa and was derived from the C terminus of a cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins (CAP) superfamily. This peptide was found by searching homologues in Arabidopsis using the precursor of a tomato CAP-derived peptide (CAPE) that was initially identified as an immune signal. In searching for a CAPE involved in salt responses, we screened CAPE precursor genes that showed salt-responsive expression and found that the PROAtCAPE1 (AT4G33730) gene was regulated by salinity. We confirmed the endogenous Arabidopsis CAP-derived peptide 1 (AtCAPE1) by mass spectrometry and found that a key amino acid residue in PROAtCAPE1 is critical for AtCAPE1 production. Moreover, although PROAtCAPE1 was expressed mainly in the roots, AtCAPE1 was discovered to be upregulated systemically upon salt treatment. The salt-induced AtCAPE1 negatively regulated salt tolerance by suppressing several salt-tolerance genes functioning in the production of osmolytes, detoxification, stomatal closure control, and cell membrane protection. This discovery demonstrates that AtCAPE1, a homologue of tomato immune regulator CAPE1, plays an important role in the regulation of salt stress responses. Our discovery thus suggests that the peptide may function in a trade-off between pathogen defence and salt tolerance. PMID:26093145

  14. Negative feedback regulation of Homer 1a on norepinephrine-dependent cardiac hypertrophy

    SciTech Connect

    Chiarello, Carmelina; Bortoloso, Elena; Carpi, Andrea; Furlan, Sandra; Volpe, Pompeo

    2013-07-15

    Homers are scaffolding proteins that modulate diverse cell functions being able to assemble signalling complexes. In this study, the presence, sub-cellular distribution and function of Homer 1 was investigated. Homer 1a and Homer 1b/c are constitutively expressed in cardiac muscle of both mouse and rat and in HL-1 cells, a cardiac cell line. As judged by confocal immunofluorescence microscopy, Homer 1a displays sarcomeric and peri-nuclear localization. In cardiomyocytes and cultured HL-1 cells, the hypertrophic agonist norepinephrine (NE) induces α{sub 1}-adrenergic specific Homer 1a over-expression, with a two-to-three-fold increase within 1 h, and no up-regulation of Homer 1b/c, as judged by Western blot and qPCR. In HL-1 cells, plasmid-driven over-expression of Homer 1a partially antagonizes activation of ERK phosphorylation and ANF up-regulation, two well-established, early markers of hypertrophy. At the morphometric level, NE-induced increase of cell size is likewise and partially counteracted by exogenous Homer 1a. Under the same experimental conditions, Homer 1b/c does not have any effect on ANF up-regulation nor on cell hypertrophy. Thus, Homer 1a up-regulation is associated to early stages of cardiac hypertrophy and appears to play a negative feedback regulation on molecular transducers of hypertrophy. -- Highlights: • Homer 1a is constitutively expressed in cardiac tissue. • In HL-1 cells, norepinephrine activates signaling pathways leading to hypertrophy. • Homer 1a up-regulation is an early event of norepinephrine-induced hypertrophy. • Homer 1a plays a negative feedback regulation modulating pathological hypertrophy. • Over-expression of Homer 1a per se does not induce hypertrophy.

  15. OsGF14b Positively Regulates Panicle Blast Resistance but Negatively Regulates Leaf Blast Resistance in Rice.

    PubMed

    Liu, Qing; Yang, Jianyuan; Zhang, Shaohong; Zhao, Junliang; Feng, Aiqing; Yang, Tifeng; Wang, Xiaofei; Mao, Xinxue; Dong, Jingfang; Zhu, Xiaoyuan; Leung, Hei; Leach, Jan E; Liu, Bin

    2016-01-01

    Although 14-3-3 proteins have been reported to be involved in responses to biotic stresses in plants, their functions in rice blast, the most destructive disease in rice, are largely unknown. Only GF14e has been confirmed to negatively regulate leaf blast. We report that GF14b is highly expressed in seedlings and panicles during blast infection. Rice plants overexpressing GF14b show enhanced resistance to panicle blast but are susceptible to leaf blast. In contrast, GF14b-silenced plants show increased susceptibility to panicle blast but enhanced resistance to leaf blast. Yeast one-hybrid assays demonstrate that WRKY71 binds to the promoter of GF14b and modulates its expression. Overexpression of GF14b induces expression of jasmonic acid (JA) synthesis-related genes but suppresses expression of salicylic acid (SA) synthesis-related genes. In contrast, suppressed GF14b expression causes decreased expression of JA synthesis-related genes but activation of SA synthesis-related genes. These results suggest that GF14b positively regulates panicle blast resistance but negatively regulates leaf blast resistance, and that GF14b-mediated disease resistance is associated with the JA- and SA-dependent pathway. The different functions for 14-3-3 proteins in leaf and panicle blast provide new evidence that leaf and panicle blast resistance are controlled by different mechanisms. PMID:26467468

  16. Stress chaperone mortalin regulates human melanogenesis.

    PubMed

    Wadhwa, Renu; Priyandoko, Didik; Gao, Ran; Widodo, Nashi; Nigam, Nupur; Li, Ling; Ahn, Hyo Min; Yun, Chae-Ok; Ando, Nobuhiro; Mahe, Christian; Kaul, Sunil C

    2016-07-01

    In order to identify the cellular factors involved in human melanogenesis, we carried out shRNA-mediated loss-of-function screening in conjunction with induction of melanogenesis by 1-oleoyl-2-acetyl-glycerol (OAG) in human melanoma cells using biochemical and visual assays. Gene targets of the shRNAs (that caused loss of OAG-induced melanogenesis) and their pathways, as determined by bioinformatics, revealed involvement of proteins that regulate cell stress response, mitochondrial functions, proliferation, and apoptosis. We demonstrate, for the first time, that the mitochondrial stress chaperone mortalin is crucial for melanogenesis. Upregulation of mortalin was closely associated with melanogenesis in in vitro cell-based assays and clinical samples of keloids with hyperpigmentation. Furthermore, its knockdown resulted in compromised melanogenesis. The data proposed mortalin as an important protein that may be targeted to manipulate pigmentation for cosmetic and related disease therapeutics. PMID:27056733

  17. MecA Protein Acts as a Negative Regulator of Genetic Competence in Streptococcus mutans

    PubMed Central

    Tian, Xiao-Lin; Dong, Gaofeng; Liu, Tianlei; Gomez, Zubelda A.; Wahl, Astrid; Hols, Pascal

    2013-01-01

    Streptococcus mutans develops competence for genetic transformation through a complex network that receives inputs from at least two signaling peptides, competence-stimulating peptide (CSP) and sigX-inducing peptide (XIP). The key step of competence induction is the transcriptional activation of comX, which encodes an alternative sigma factor, SigX (σX), controlling the expression of late competence genes essential for DNA uptake and recombination. In this study, we provide evidence that MecA acts as a negative regulator in the posttranslational regulation of SigX in S. mutans. Using luxAB transcriptional reporter strains, we demonstrate that MecA represses the expression of late competence genes in S. mutans grown in a complex medium that is subpermissive for competence induction by CSP. The negative regulation of competence by MecA requires the presence of a functional SigX. Accordingly, inactivation of MecA results in a prolonged competence state of S. mutans under this condition. We have also found that the AAA+ protease ClpC displays a similar repressing effect on late competence genes, suggesting that both MecA and ClpC function coordinately to regulate competence in the same regulatory circuit in S. mutans. This suggestion is strongly supported by the results of bacterial two-hybrid assays, which demonstrate that MecA interacts with both SigX and ClpC, forming a ternary SigX-MecA-ClpC complex. Western blot analysis also confirms that inactivation of MecA or ClpC results in the intracellular accumulation of the SigX in S. mutans. Together, our data support the notion that MecA mediates the formation of a ternary SigX-MecA-ClpC complex that sequesters SigX and thereby negatively regulates genetic competence in S. mutans. PMID:24039267

  18. Clostridium difficile toxin synthesis is negatively regulated by TcdC.

    PubMed

    Dupuy, B; Govind, R; Antunes, A; Matamouros, S

    2008-06-01

    Clostridium difficile toxin synthesis is growth phase-dependent and is regulated by various environmental signals. The toxin genes tcdA and tcdB are located in a pathogenicity locus, which also includes three accessory genes, tcdR, tcdC and tcdE. TcdR has been shown to act as an alternative sigma factor that mediates positive regulation of both the toxin genes and its own gene. The tcdA, tcdB and tcdR genes are transcribed during the stationary growth phase. The tcdC gene, however, is expressed during exponential phase. This expression pattern suggested that TcdC may act as a negative regulator of toxin gene expression. TcdC is a small acidic protein without any conserved DNA-binding motif. It is able to form dimers and its N-terminal region includes a putative transmembrane domain. Genetic and biochemical evidence showed that TcdC negatively regulates C. difficile toxin synthesis by interfering with the ability of TcdR-containing RNA polymerase to recognize the tcdA and tcdB promoters. In addition, the C. difficile NAP1/027 epidemic strains that produce higher levels of toxins have mutations in tcdC. Interestingly, a frameshift mutation at position 117 of the tcdC coding sequence seems to be, at least in part, responsible for the hypertoxigenicity phenotype of these epidemic strains. PMID:18480323

  19. Btg2 is a Negative Regulator of Cardiomyocyte Hypertrophy through a Decrease in Cytosolic RNA

    PubMed Central

    Masumura, Yuki; Higo, Shuichiro; Asano, Yoshihiro; Kato, Hisakazu; Yan, Yi; Ishino, Saki; Tsukamoto, Osamu; Kioka, Hidetaka; Hayashi, Takaharu; Shintani, Yasunori; Yamazaki, Satoru; Minamino, Tetsuo; Kitakaze, Masafumi; Komuro, Issei; Takashima, Seiji; Sakata, Yasushi

    2016-01-01

    Under hypertrophic stimulation, cardiomyocytes enter a hypermetabolic state and accelerate biomass accumulation. Although the molecular pathways that regulate protein levels are well-studied, the functional implications of RNA accumulation and its regulatory mechanisms in cardiomyocytes remain elusive. Here, we have elucidated the quantitative kinetics of RNA in cardiomyocytes through single cell imaging and c-Myc (Myc)-mediated hypermetabolic analytical model using cultured cardiomyocytes. Nascent RNA labeling combined with single cell imaging demonstrated that Myc protein significantly increased the amount of global RNA production per cardiomyocyte. Chromatin immunoprecipitation with high-throughput sequencing clarified that overexpressed Myc bound to a specific set of genes and recruits RNA polymerase II. Among these genes, we identified Btg2 as a novel target of Myc. Btg2 overexpression significantly reduced cardiomyocyte surface area. Conversely, shRNA-mediated knockdown of Btg2 accelerated adrenergic stimulus-induced hypertrophy. Using mass spectrometry analysis, we determined that Btg2 binds a series of proteins that comprise mRNA deadenylation complexes. Intriguingly, Btg2 specifically suppresses cytosolic, but not nuclear, RNA levels. Btg2 knockdown further enhances cytosolic RNA accumulation in cardiomyocytes under adrenergic stimulation, suggesting that Btg2 negatively regulates reactive hypertrophy by negatively regulating RNA accumulation. Our findings provide insight into the functional significance of the mechanisms regulating RNA levels in cardiomyocytes. PMID:27346836

  20. Negative feedback regulation of auxin signaling by ATHB8/ACL5-BUD2 transcription module.

    PubMed

    Baima, Simona; Forte, Valentina; Possenti, Marco; Peñalosa, Andrés; Leoni, Guido; Salvi, Sergio; Felici, Barbara; Ruberti, Ida; Morelli, Giorgio

    2014-06-01

    The role of auxin as main regulator of vascular differentiation is well established, and a direct correlation between the rate of xylem differentiation and the amount of auxin reaching the (pro)cambial cells has been proposed. It has been suggested that thermospermine produced by ACAULIS5 (ACL5) and bushy and dwarf2 (BUD2) is one of the factors downstream to auxin contributing to the regulation of this process in Arabidopsis. Here, we provide an in-depth characterization of the mechanism through which ACL5 modulates xylem differentiation. We show that an increased level of ACL5 slows down xylem differentiation by negatively affecting the expression of homeodomain-leucine zipper (HD-ZIP) III and key auxin signaling genes. This mechanism involves the positive regulation of thermospermine biosynthesis by the HD-ZIP III protein Arabidopsis thaliana homeobox8 tightly controlling the expression of ACL5 and BUD2. In addition, we show that the HD-ZIP III protein REVOLUTA contributes to the increased leaf vascularization and long hypocotyl phenotype of acl5 likely by a direct regulation of auxin signaling genes such as like auxin resistant2 (LAX2) and LAX3. We propose that proper formation and differentiation of xylem depend on a balance between positive and negative feedback loops operating through HD-ZIP III genes. PMID:24777988

  1. Btg2 is a Negative Regulator of Cardiomyocyte Hypertrophy through a Decrease in Cytosolic RNA.

    PubMed

    Masumura, Yuki; Higo, Shuichiro; Asano, Yoshihiro; Kato, Hisakazu; Yan, Yi; Ishino, Saki; Tsukamoto, Osamu; Kioka, Hidetaka; Hayashi, Takaharu; Shintani, Yasunori; Yamazaki, Satoru; Minamino, Tetsuo; Kitakaze, Masafumi; Komuro, Issei; Takashima, Seiji; Sakata, Yasushi

    2016-01-01

    Under hypertrophic stimulation, cardiomyocytes enter a hypermetabolic state and accelerate biomass accumulation. Although the molecular pathways that regulate protein levels are well-studied, the functional implications of RNA accumulation and its regulatory mechanisms in cardiomyocytes remain elusive. Here, we have elucidated the quantitative kinetics of RNA in cardiomyocytes through single cell imaging and c-Myc (Myc)-mediated hypermetabolic analytical model using cultured cardiomyocytes. Nascent RNA labeling combined with single cell imaging demonstrated that Myc protein significantly increased the amount of global RNA production per cardiomyocyte. Chromatin immunoprecipitation with high-throughput sequencing clarified that overexpressed Myc bound to a specific set of genes and recruits RNA polymerase II. Among these genes, we identified Btg2 as a novel target of Myc. Btg2 overexpression significantly reduced cardiomyocyte surface area. Conversely, shRNA-mediated knockdown of Btg2 accelerated adrenergic stimulus-induced hypertrophy. Using mass spectrometry analysis, we determined that Btg2 binds a series of proteins that comprise mRNA deadenylation complexes. Intriguingly, Btg2 specifically suppresses cytosolic, but not nuclear, RNA levels. Btg2 knockdown further enhances cytosolic RNA accumulation in cardiomyocytes under adrenergic stimulation, suggesting that Btg2 negatively regulates reactive hypertrophy by negatively regulating RNA accumulation. Our findings provide insight into the functional significance of the mechanisms regulating RNA levels in cardiomyocytes. PMID:27346836

  2. TORC1 Signaling Is Governed by Two Negative Regulators in Fission Yeast

    PubMed Central

    Ma, Ning; Liu, Qingbin; Zhang, Lili; Henske, Elizabeth P.; Ma, Yan

    2013-01-01

    The target of rapamycin (TOR) is a highly conserved protein kinase that regulates cell growth and metabolism. Here we performed a genome-wide screen to identify negative regulators of TOR complex 1 (TORC1) in Schizosaccharomyces pombe by isolating mutants that phenocopy Δtsc2, in which TORC1 signaling is known to be up-regulated. We discovered that Δnpr2 displayed similar phenotypes to Δtsc2 in terms of amino acid uptake defects and mislocalization of the Cat1 permease. However, Δnpr2 and Δtsc2 clearly showed different phenotypes in terms of rapamycin supersensitivity and Isp5 transcription upon various treatments. Furthermore, we showed that Tor2 controls amino acid homeostasis at the transcriptional and post-transcriptional levels. Our data reveal that both Npr2 and Tsc2 negatively regulate TORC1 signaling, and Npr2, but not Tsc2, may be involved in the feedback loop of a nutrient-sensing pathway. PMID:23934889

  3. RIP1 negatively regulates basal autophagic flux through TFEB to control sensitivity to apoptosis

    PubMed Central

    Yonekawa, Tohru; Gamez, Graciela; Kim, Jihye; Tan, Aik Choon; Thorburn, Jackie; Gump, Jacob; Thorburn, Andrew; Morgan, Michael J

    2015-01-01

    In a synthetic lethality/viability screen, we identified the serine–threonine kinase RIP1 (RIPK1) as a gene whose knockdown is highly selected against during growth in normal media, in which autophagy is not critical, but selected for in conditions that increase reliance on basal autophagy. RIP1 represses basal autophagy in part due to its ability to regulate the TFEB transcription factor, which controls the expression of autophagy-related and lysosomal genes. RIP1 activates ERK, which negatively regulates TFEB though phosphorylation of serine 142. Thus, in addition to other pro-death functions, RIP1 regulates cellular sensitivity to pro-death stimuli by modulating basal autophagy. PMID:25908842

  4. Microbe–Host Interactions are Positively and Negatively Regulated by Galectin–Glycan Interactions

    PubMed Central

    Baum, Linda G.; Garner, Omai B.; Schaefer, Katrin; Lee, Benhur

    2014-01-01

    Microbe–host interactions are complex processes that are directly and indirectly regulated by a variety of factors, including microbe presentation of specific molecular signatures on the microbial surface, as well as host cell presentation of receptors that recognize these pathogen signatures. Cell surface glycans are one important class of microbial signatures that are recognized by a variety of host cell lectins. Host cell lectins that recognize microbial glycans include members of the galectin family of lectins that recognize specific glycan ligands on viruses, bacteria, fungi, and parasites. In this review, we will discuss the ways that the interactions of microbial glycans with host cell galectins positively and negatively regulate pathogen attachment, invasion, and survival, as well as regulate host responses that mitigate microbial pathogenesis. PMID:24995007

  5. IL-10-producing CD4+ T cells negatively regulate fucosylation of epithelial cells in the gut

    PubMed Central

    Goto, Yoshiyuki; Lamichhane, Aayam; Kamioka, Mariko; Sato, Shintaro; Honda, Kenya; Kunisawa, Jun; Kiyono, Hiroshi

    2015-01-01

    Fucosylated glycans on the surface of epithelial cells (ECs) regulate intestinal homeostasis by serving as attachment receptors and a nutrient source for some species of bacteria. We show here that epithelial fucosylation in the ileum is negatively regulated by IL-10-producing CD4+ T cells. The number of fucosylated ECs was increased in the ileum of mice lacking T cells, especially those expressing αβ T cell receptor (TCR), CD4, and IL-10. No such effect was observed in mice lacking B cells. Adoptive transfer of αβTCR+ CD4+ T cells from normal mice, but not IL-10-deficient mice, normalized fucosylation of ECs. These findings suggest that IL-10-producing CD4+ T cells contribute to the maintenance of the function of ECs by regulating their fucosylation. PMID:26522513

  6. The protein kinase LKB1 negatively regulates bone morphogenetic protein receptor signaling

    PubMed Central

    Raja, Erna; Edlund, Karolina; Kahata, Kaoru; Zieba, Agata; Morén, Anita; Watanabe, Yukihide; Voytyuk, Iryna; Botling, Johan; Söderberg, Ola; Micke, Patrick; Pyrowolakis, George; Heldin, Carl-Henrik; Moustakas, Aristidis

    2016-01-01

    The protein kinase LKB1 regulates cell metabolism and growth and is implicated in intestinal and lung cancer. Bone morphogenetic protein (BMP) signaling regulates cell differentiation during development and tissue homeostasis. We demonstrate that LKB1 physically interacts with BMP type I receptors and requires Smad7 to promote downregulation of the receptor. Accordingly, LKB1 suppresses BMP-induced osteoblast differentiation and affects BMP signaling in Drosophila wing longitudinal vein morphogenesis. LKB1 protein expression and Smad1 phosphorylation analysis in a cohort of non-small cell lung cancer patients demonstrated a negative correlation predominantly in a subset enriched in adenocarcinomas. Lung cancer patient data analysis indicated strong correlation between LKB1 loss-of-function mutations and high BMP2 expression, and these two events further correlated with expression of a gene subset functionally linked to apoptosis and migration. This new mechanism of BMP receptor regulation by LKB1 has ramifications in physiological organogenesis and disease. PMID:26701726

  7. Thyroid hormone negatively regulates CDX2 and SOAT2 mRNA expression via induction of miRNA-181d in hepatic cells

    SciTech Connect

    Yap, Chui Sun; Sinha, Rohit Anthony; Ota, Sho; Katsuki, Masahito; Yen, Paul Michael

    2013-11-01

    Highlights: •Thyroid hormone induces miR-181d expression in human hepatic cells and mouse livers. •Thyroid hormone downregulates CDX2 and SOAT2 (or ACAT2) via miR-181d. •miR-181d reduces cholesterol output from human hepatic cells. -- Abstract: Thyroid hormones (THs) regulate transcription of many metabolic genes in the liver through its nuclear receptors (TRs). Although the molecular mechanisms for positive regulation of hepatic genes by TH are well understood, much less is known about TH-mediated negative regulation. Recently, several nuclear hormone receptors were shown to downregulate gene expression via miRNAs. To further examine the potential role of miRNAs in TH-mediated negative regulation, we used a miRNA microarray to identify miRNAs that were directly regulated by TH in a human hepatic cell line. In our screen, we discovered that miRNA-181d is a novel hepatic miRNA that was regulated by TH in hepatic cell culture and in vivo. Furthermore, we identified and characterized two novel TH-regulated target genes that were downstream of miR-181d signaling: caudal type homeobox 2 (CDX2) and sterol O-acyltransferase 2 (SOAT2 or ACAT2). CDX2, a known positive regulator of hepatocyte differentiation, was regulated by miR-181d and directly activated SOAT2 gene expression. Since SOAT2 is an enzyme that generates cholesteryl esters that are packaged into lipoproteins, our results suggest miR-181d plays a significant role in the negative regulation of key metabolic genes by TH in the liver.

  8. Invited review: aging and human temperature regulation.

    PubMed

    Kenney, W Larry; Munce, Thayne A

    2003-12-01

    This mini-review focuses on the effects of aging on human temperature regulation. Although comprehensive reviews have been published on this topic (Kenney WL. Exercise and Sport Sciences Reviews, Baltimore: Williams & Wilkins, 1997, p. 41-76; Pandolf KB. Exp Aging Res 17: 189-204, 1991; Van Someren EJ, Raymann RJ, Scherder EJ, Daanen HA, and Swaab DF. Ageing Res Rev 1: 721-778, 2002; and Young AJ. Exp Aging Res 17: 205-213, 1991), this mini-review concisely summarizes the present state of knowledge about human temperature regulation and aging in thermoneutral conditions, as well as during hypo- and hyperthermic challenges. First, we discuss age-related effects on baseline body core temperature and phasing rhythms of the circadian temperature cycle. We then examine the altered physiological responses to cold stress that result from aging, including attenuated peripheral vasoconstriction and reduced cold-induced metabolic heat production. Finally, we present the age-related changes in sweating and cardiovascular function associated with heat stress. Although epidemiological evidence of increased mortality among older adults from hypo- and hyperthermia exists, this outcome does not reflect an inability to thermoregulate with advanced age. In fact, studies that have attempted to separate the effects of chronological age from concurrent factors, such as fitness level, body composition, and the effects of chronic disease, have shown that thermal tolerance appears to be minimally compromised by age. PMID:14600165

  9. Proportion of beta-D-glucuronidase-negative Escherichia coli in human fecal samples.

    PubMed Central

    Chang, G W; Brill, J; Lum, R

    1989-01-01

    Convenient assays and reports that almost all clinical isolates of Escherichia coli produce beta-D-glucuronidase (GUR) have led to great interest in the use of the enzyme for the rapid detection of the bacterium in water, food, and environmental samples. In these materials, E. coli serves as an indicator of possible fecal contamination. Therefore, it was crucial to examine the proportion of GUR-negative E. coli in human fecal samples. The bacterium was isolated from 35 samples, and a mean of 34% and a median of 15% were found to be GUR negative in lauryl sulfate tryptose broth with 4-methylumbelliferyl-beta-D-glucuronide. E. coli from three samples were temperature dependent for GUR production: very weakly positive at 37 degrees C but strongly positive at 44.5 degrees C. These results remind us of differences between fecal and clinical E. coli populations, of diversity in GUR regulation and expression in natural populations of E. coli, and of the need for caution in using GUR for the detection of fecal E. coli. PMID:2655534

  10. A Longitudinal Study of Emotion Regulation, Emotion Lability/Negativity, and Internalizing Symptomatology in Maltreated and Nonmaltreated Children

    PubMed Central

    Kim-Spoon, Jungmeen; Cicchetti, Dante; Rogosch, Fred A.

    2013-01-01

    The longitudinal contributions of emotion regulation and emotion lability/negativity to internalizing symptomatology were examined in a low-income sample (171 maltreated and 151 nonmaltreated children, from age 7 to 10 years). Latent difference score models indicated that, for both maltreated and nonmaltreated children, emotion regulation was a mediator between emotion lability/negativity and internalizing symptomatology, whereas emotion lability/negativity was not a mediator between emotion regulation and internalizing symptomatology. Early maltreatment was associated with high emotion lability/negativity (age 7) that contributed to poor emotion regulation (age 8), which in turn was predictive of increases in internalizing symptomatology (from age 8 to 9). The results imply important roles of emotion regulation in the development of internalizing symptomatology, especially for children with high emotion lability/negativity. PMID:23034132

  11. Conserved miR164-targeted NAC genes negatively regulate drought resistance in rice

    PubMed Central

    Xie, Kabin; Xiong, Lizhong

    2014-01-01

    MicroRNAs constitute a large group of endogenous small RNAs of ~22 nt that emerge as vital regulators, mainly by targeting mRNAs for post-transcriptional repression. Previous studies have revealed that the miR164 family in Arabidopsis is comprised of three members which guide the cleavage of the mRNAs of five NAC genes to modulate developmental processes. However, the functions of the miR164-targeted NAC genes in crops are poorly deciphered. In this study, the conserved features of six miR164-targeted NAC genes (OMTN1–OMTN6) in rice are described, and evidence is provided that four of them confer a negative regulatory role in drought resistance. OMTN proteins have the characteristics of typical NAC transcriptional factors. The miR164 recognition sites of the OMTN genes are highly conserved in rice germplasms. Deletion of the recognition sites impaired the transactivation activity, indicating that the conserved recognition sites play a crucial role in maintaining the function of the OMTN proteins. The OMTN genes were responsive to abiotic stresses, and showed diverse spatio-temporal expression patterns in rice. Overexpression of OMTN2, OMTN3, OMTN4, and OMTN6 in rice led to negative effects on drought resistance at the reproductive stage. The expression of numerous genes related to stress response, development, and metabolism was altered in OMTN2-, OMTN3-, OMTN4-, and OMTN6-overexpressing plants. Most of the up-regulated genes in the OMTN-overexpressing plants were down-regulated by drought stress. The results suggest that the conserved miR164-targeted NAC genes may be negative regulators of drought tolerance in rice, in addition to their reported roles in development. PMID:24604734

  12. BRAFV600E Negatively Regulates the AKT Pathway in Melanoma Cell Lines

    PubMed Central

    Chen, Brenden; Tardell, Christine; Higgins, Brian; Packman, Kathryn; Boylan, John F.; Niu, Huifeng

    2012-01-01

    Cross-feedback activation of MAPK and AKT pathways is implicated as a resistance mechanism for cancer therapeutic agents targeting either RAF/MEK or PI3K/AKT/mTOR. It is thus important to have a better understanding of the molecular resistance mechanisms to improve patient survival benefit from these agents. Here we show that BRAFV600E is a negative regulator of the AKT pathway. Expression of BRAFV600E in NIH3T3 cells significantly suppresses MEK inhibitor (RG7167) or mTORC1 inhibitor (rapamycin) induced AKT phosphorylation (pAKT) and downstream signal activation. Treatment-induced pAKT elevation is found in BRAF wild type melanoma cells but not in a subset of melanoma cell lines harboring BRAFV600E. Knock-down of BRAFV600E in these melanoma cells elevates basal pAKT and downstream signals, whereas knock-down of CRAF, MEK1/2 or ERK1/2 or treatment with a BRAF inhibitor have no impact on pAKT. Mechanistically, we show that BRAFV600E interacts with rictor complex (mTORC2) and regulates pAKT through mTORC2. BRAFV600E is identified in mTORC2 after immunoprecipitation of rictor. Knock-down of rictor abrogates BRAFV600E depletion induced pAKT. Knock-down of BRAFV600E enhances cellular enzyme activity of mTORC2. Aberrant activation of AKT pathway by PTEN loss appears to override the negative impact of BRAFV600E on pAKT. Taken together, our findings suggest that in a subset of BRAFV600E melanoma cells, BRAFV600E negatively regulates AKT pathway in a rictor-dependent, MEK/ERK and BRAF kinase-independent manner. Our study reveals a novel molecular mechanism underlying the regulation of feedback loops between the MAPK and AKT pathways. PMID:22880048

  13. BRAFV600E negatively regulates the AKT pathway in melanoma cell lines.

    PubMed

    Chen, Brenden; Tardell, Christine; Higgins, Brian; Packman, Kathryn; Boylan, John F; Niu, Huifeng

    2012-01-01

    Cross-feedback activation of MAPK and AKT pathways is implicated as a resistance mechanism for cancer therapeutic agents targeting either RAF/MEK or PI3K/AKT/mTOR. It is thus important to have a better understanding of the molecular resistance mechanisms to improve patient survival benefit from these agents. Here we show that BRAFV600E is a negative regulator of the AKT pathway. Expression of BRAFV600E in NIH3T3 cells significantly suppresses MEK inhibitor (RG7167) or mTORC1 inhibitor (rapamycin) induced AKT phosphorylation (pAKT) and downstream signal activation. Treatment-induced pAKT elevation is found in BRAF wild type melanoma cells but not in a subset of melanoma cell lines harboring BRAFV600E. Knock-down of BRAFV600E in these melanoma cells elevates basal pAKT and downstream signals, whereas knock-down of CRAF, MEK1/2 or ERK1/2 or treatment with a BRAF inhibitor have no impact on pAKT. Mechanistically, we show that BRAFV600E interacts with rictor complex (mTORC2) and regulates pAKT through mTORC2. BRAFV600E is identified in mTORC2 after immunoprecipitation of rictor. Knock-down of rictor abrogates BRAFV600E depletion induced pAKT. Knock-down of BRAFV600E enhances cellular enzyme activity of mTORC2. Aberrant activation of AKT pathway by PTEN loss appears to override the negative impact of BRAFV600E on pAKT. Taken together, our findings suggest that in a subset of BRAFV600E melanoma cells, BRAFV600E negatively regulates AKT pathway in a rictor-dependent, MEK/ERK and BRAF kinase-independent manner. Our study reveals a novel molecular mechanism underlying the regulation of feedback loops between the MAPK and AKT pathways. PMID:22880048

  14. Complex Negative Regulation of TLR9 by Multiple Proteolytic Cleavage Events.

    PubMed

    Sinha, Siddhartha S; Cameron, Jody; Brooks, James C; Leifer, Cynthia A

    2016-08-15

    TLR9 is an innate immune receptor important for recognizing DNA of host and foreign origin. A mechanism proposed to prevent excessive response to host DNA is the requirement for proteolytic cleavage of TLR9 in endosomes to generate a mature form of the receptor (TLR9(471-1032)). We previously described another cleavage event in the juxtamembrane region of the ectodomain that generated a dominant-negative form of TLR9. Thus, there are at least two independent cleavage events that regulate TLR9. In this study, we investigated whether an N-terminal fragment of TLR9 could be responsible for regulation of the mature or negative-regulatory form. We show that TLR9(471-1032), corresponding to the proteolytically cleaved form, does not function on its own. Furthermore, activity is not rescued by coexpression of the N-terminal fragment (TLR9(1-440)), inclusion of the hinge region (TLR9(441-1032)), or overexpression of UNC93B1, the last of which is critical for trafficking and cleavage of TLR9. TLR9(1-440) coimmunoprecipitates with full-length TLR9 and TLR9(471-1032) but does not rescue the native glycosylation pattern; thus, inappropriate trafficking likely explains why TLR9(471-1032) is nonfunctional. Lastly, we show that TLR9(471-1032) is also a dominant-negative regulator of TLR9 signaling. Together, these data provide a new perspective on the complexity of TLR9 regulation by proteolytic cleavage and offer potential ways to inhibit activity through this receptor, which may dampen autoimmune inflammation. PMID:27421483

  15. The MprB Extracytoplasmic Domain Negatively Regulates Activation of the Mycobacterium tuberculosis MprAB Two-Component System

    PubMed Central

    Bretl, Daniel J.; Bigley, Tarin M.; Terhune, Scott S.

    2014-01-01

    Mycobacterium tuberculosis is an acid-fast pathogen of humans and the etiological agent of tuberculosis (TB). It is estimated that one-third of the world's population is latently (persistently) infected with M. tuberculosis. M. tuberculosis persistence is regulated, in part, by the MprAB two-component signal transduction system, which is activated by and mediates resistance to cell envelope stress. Here we identify MprAB as part of an evolutionarily conserved cell envelope stress response network and demonstrate that MprAB-mediated signal transduction is negatively regulated by the MprB extracytoplasmic domain (ECD). In particular, we report that deregulated production of the MprB sensor kinase, or of derivatives of this protein, negatively impacts M. tuberculosis growth. The observed growth attenuation is dependent on MprAB-mediated signal transduction and is exacerbated in strains of M. tuberculosis producing an MprB variant lacking its ECD. Interestingly, full-length MprB, and the ECD of MprB specifically, immunoprecipitates the Hsp70 chaperone DnaK in vivo, while overexpression of dnaK inhibits MprAB-mediated signal transduction in M. tuberculosis grown in the absence or presence of cell envelope stress. We propose that under nonstress conditions, or under conditions in which proteins present in the extracytoplasmic space are properly folded, signaling through the MprAB system is inhibited by the MprB ECD. Following exposure to cell envelope stress, proteins present in the extracytoplasmic space become unfolded or misfolded, leading to removal of the ECD-mediated negative regulation of MprB and subsequent activation of MprAB. PMID:24187094

  16. Identification of a New Class of Negative Regulators Affecting Sporulation-Specific Gene Expression in Yeast

    PubMed Central

    Benni, M. L.; Neigeborn, L.

    1997-01-01

    We characterized two yeast loci, MDS3 and PMD1, that negatively regulate sporulation. Initiation of sporulation is mediated by the meiotic activator IME1, which relies on MCK1 for maximal expression. We isolated the MDS3-1 allele (encoding a truncated form of Mds3p) as a suppressor that restores IME1 expression in mck1 mutants. mds3 null mutations confer similar suppression phenotypes as MDS3-1, indicating that Mds3p is a negative regulator of sporulation and the MDS3-1 allele confers a dominant-negative phenotype. PMD1 is predicted to encode a protein sharing significant similarity with Mds3p. mds3 pmd1 double mutants are better suppressors of mck1 than is either single mutant, indicating that Mds3p and Pmd1p function synergistically. Northern blot analysis revealed that suppression is due to increased IME1 transcript accumulation. The roles of Mds3p and Pmd1p are not restricted to the MCK1 pathway because mds3 pmd1 mutations also suppress IME1 expression defects associated with MCK1-independent sporulation mutants. Furthermore, mds3 pmd1 mutants express significant levels of IME1 even in vegetative cells and this unscheduled expression results in premature sporulation. These phenotypes and interactions with RAS2-Val19 suggest that unscheduled derepression of IME1 is probably due to a defect in recognition of nutritional status. PMID:9383076

  17. Cutting Edge: EZH2 Promotes Osteoclastogenesis by Epigenetic Silencing of the Negative Regulator IRF8.

    PubMed

    Fang, Celestia; Qiao, Yu; Mun, Se Hwan; Lee, Min Joon; Murata, Koichi; Bae, Seyeon; Zhao, Baohong; Park-Min, Kyung-Hyun; Ivashkiv, Lionel B

    2016-06-01

    Osteoclasts are resorptive cells that are important for homeostatic bone remodeling and pathological bone resorption. Emerging evidence suggests an important role for epigenetic mechanisms in osteoclastogenesis. A recent study showed that epigenetic silencing of the negative regulator of osteoclastogenesis Irf8 by DNA methylation is required for osteoclast differentiation. In this study, we investigated the role of EZH2, which epigenetically silences gene expression by histone methylation, in osteoclastogenesis. Inhibition of EZH2 by the small molecule GSK126, or decreasing its expression using antisense oligonucleotides, impeded osteoclast differentiation. Mechanistically, EZH2 was recruited to the IRF8 promoter after RANKL stimulation to deposit the negative histone mark H3K27me3 and downregulate IRF8 expression. GSK126 attenuated bone loss in the ovariectomy mouse model of postmenopausal osteoporosis. Our findings provide evidence for an additional mechanism of epigenetic IRF8 silencing during osteoclastogenesis that likely works cooperatively with DNA methylation, further emphasizing the importance of IRF8 as a negative regulator of osteoclastogenesis. PMID:27183582

  18. Drosophila protein kinase N (Pkn) is a negative regulator of actin-myosin activity during oogenesis.

    PubMed

    Ferreira, Tânia; Prudêncio, Pedro; Martinho, Rui Gonçalo

    2014-10-15

    Nurse cell dumping is an actin-myosin based process, where 15 nurse cells of a given egg chamber contract and transfer their cytoplasmic content through the ring canals into the growing oocyte. We isolated two mutant alleles of protein kinase N (pkn) and showed that Pkn negatively-regulates activation of the actin-myosin cytoskeleton during the onset of dumping. Using live-cell imaging analysis we observed that nurse cell dumping rates sharply increase during the onset of fast dumping. Such rate increase was severely impaired in pkn mutant nurse cells due to excessive nurse cell actin-myosin activity and/or loss of tissue integrity. Our work demonstrates that the transition between slow and fast dumping is a discrete event, with at least a five to six-fold dumping rate increase. We show that Pkn negatively regulates nurse cell actin-myosin activity. This is likely to be important for directional cytoplasmic flow. We propose Pkn provides a negative feedback loop to help avoid excessive contractility after local activation of Rho GTPase. PMID:25131196

  19. Endogenous cholecystokinin regulates growth of human cholangiocarcinoma.

    PubMed Central

    Evers, B M; Gomez, G; Townsend, C M; Rajaraman, S; Thompson, J C

    1989-01-01

    Exogenous administration of cholecystokinin (CCK) or caerulein inhibits growth of SLU-132, a human cholangiocarcinoma that we have shown to possess receptors for CCK. Chronic administration of cholestyramine, a resin that binds bile salts, increases release of CCK and growth of the pancreas in guinea pigs. Feeding the bile salt, taurocholate, inhibits meal-stimulated release of CCK. The purpose of this study was to determine whether endogenous CCK affects growth of the human cholangiocarcinoma, SLU-132. We implanted SLU-132 subcutaneously into athymic nude mice. The bile salt pool was depleted by feeding 4% cholestyramine for 40 days, either alone or enriched with 0.5% taurocholate for 32 days. When the mice were killed, tumors and pancreas were removed. Cholestyramine significantly inhibited the growth of SLU-132 and stimulated growth of the normal pancreas. Feeding of taurocholate acted to stimulate tumor growth. These results demonstrate that endogenous levels of CCK regulate growth of this human cholangiocarcinoma. Our findings suggest that manipulation of levels of endogenous gut hormones may, in the future, play a role in management of patients with certain gastrointestinal cancers. Images Fig. 1. PMID:2476084

  20. The orphan response regulator CovR: a globally negative modulator of virulence in Streptococcus suis serotype 2.

    PubMed

    Pan, Xiuzhen; Ge, Junchao; Li, Ming; Wu, Bo; Wang, Changjun; Wang, Jing; Feng, Youjun; Yin, Zhimin; Zheng, Feng; Cheng, Gong; Sun, Wen; Ji, Hongfeng; Hu, Dan; Shi, Peiju; Feng, Xiaodan; Hao, Xina; Dong, Ruiping; Hu, Fuquan; Tang, Jiaqi

    2009-04-01

    Streptococcus suis serotype 2 is an emerging zoonotic pathogen responsible for a wide range of life-threatening diseases in pigs and humans. However, the pathogenesis of S. suis serotype 2 infection is not well understood. In this study, we report that an orphan response regulator, CovR, globally regulates gene expression and negatively controls the virulence of S. suis 05ZYH33, a streptococcal toxic shock syndrome (STSS)-causing strain. A covR-defective (DeltacovR) mutant of 05ZYH33 displayed dramatic phenotypic changes, such as formation of longer chains, production of thicker capsules, and increased hemolytic activity. Adherence of the DeltacovR mutant to epithelial cells was greatly increased, and its resistance to phagocytosis and killing by neutrophils and monocytes was also significantly enhanced. More importantly, inactivation of covR increased the lethality of S. suis serotype 2 in experimental infection of piglets, and this phenotype was restored by covR complementation. Colonization experiments also showed that the DeltacovR mutant exhibited an increased ability to colonize susceptible tissues of piglets. The pleiotropic phenotype of the DeltacovR mutant is in full agreement with the large number of genes controlled by CovR as revealed by transcription profile analysis: 2 genes are positively regulated, and 193 are repressed, including many that encode known or putative virulence factors. These findings suggested that CovR is a global repressor in virulence regulation of STSS-causing S. suis serotype 2. PMID:19181815

  1. Liver X Receptor (LXR) activation negatively regulates visfatin expression in macrophages

    SciTech Connect

    Mayi, Therese Hervee; Rigamonti, Elena; Pattou, Francois; Staels, Bart; Chinetti-Gbaguidi, Giulia

    2011-01-07

    Research highlights: {yields} Synthetic LXR ligands decreased visfatin expression in human macrophages. {yields} LXR activation leads to a modest and transient decrease of NAD{sup +} concentration. {yields} LXR activation decreased PPAR{gamma}-induced visfatin in human macrophages. -- Abstract: Adipose tissue macrophages (ATM) are the major source of visfatin, a visceral fat adipokine upregulated during obesity. Also known to play a role in B cell differentiation (pre-B cell colony-enhancing factor (PBEF)) and NAD biosynthesis (nicotinamide phosphoribosyl transferase (NAMPT)), visfatin has been suggested to play a role in inflammation. Liver X Receptor (LXR) and Peroxisome Proliferator-Activated Receptor (PPAR){gamma} are nuclear receptors expressed in macrophages controlling the inflammatory response. Recently, we reported visfatin as a PPAR{gamma} target gene in human macrophages. In this study, we examined whether LXR regulates macrophage visfatin expression. Synthetic LXR ligands decreased visfatin gene expression in a LXR-dependent manner in human and murine macrophages. The decrease of visfatin mRNA was paralleled by a decrease of protein secretion. Consequently, a modest and transient decrease of NAD{sup +} concentration was observed. Interestingly, LXR activation decreased the PPAR{gamma}-induced visfatin gene and protein secretion in human macrophages. Our results identify visfatin as a gene oppositely regulated by the LXR and PPAR{gamma} pathways in human macrophages.

  2. AMPK Signaling in the Dorsal Hippocampus Negatively Regulates Contextual Fear Memory Formation.

    PubMed

    Han, Ying; Luo, Yixiao; Sun, Jia; Ding, Zengbo; Liu, Jianfeng; Yan, Wei; Jian, Min; Xue, Yanxue; Shi, Jie; Wang, Ji-Shi; Lu, Lin

    2016-06-01

    Both the formation of long-term memory (LTM) and dendritic spine growth that serves as a physical basis for the long-term storage of information require de novo protein synthesis. Memory formation also critically depends on transcription. Adenosine monophosphate-activated protein kinase (AMPK) is a transcriptional regulator that has emerged as a major energy sensor that maintains cellular energy homeostasis. However, still unknown is its role in memory formation. In the present study, we found that AMPK is primarily expressed in neurons in the hippocampus, and then we demonstrated a time-dependent decrease in AMPK activity and increase in mammalian target of rapamycin complex 1 (mTORC1) activity after contextual fear conditioning in the CA1 but not CA3 area of the dorsal hippocampus. Using pharmacological methods and adenovirus gene transfer to bidirectionally regulate AMPK activity, we found that increasing AMPK activity in the CA1 impaired the formation of long-term fear memory, and decreasing AMPK activity enhanced fear memory formation. These findings were associated with changes in the phosphorylation of AMPK and p70s6 kinase (p70s6k) and expression of BDNF and membrane GluR1 and GluR2 in the CA1. Furthermore, the prior administration of an mTORC1 inhibitor blocked the enhancing effect of AMPK inhibition on fear memory formation, suggesting that this negative regulation of contextual fear memory by AMPK in the CA1 depends on the mTORC1 signaling pathway. Finally, we found that AMPK activity regulated hippocampal spine growth associated with memory formation. In summary, our results indicate that AMPK is a key negative regulator of plasticity and fear memory formation. PMID:26647974

  3. Hfq negatively regulates type III secretion in EHEC and several other pathogens

    PubMed Central

    Shakhnovich, Elizabeth A.; Davis, Brigid M.; Waldor, Matthew K.

    2009-01-01

    Summary Hfq is a conserved RNA-binding protein that regulates diverse cellular processes through post-transcriptional control of gene expression, often by functioning as a chaperone for regulatory sRNAs. Here, we explored the role of Hfq in enterohaemorrhagic E. coli (EHEC), a group of non-invasive intestinal pathogens. EHEC virulence is dependent on a Type III secretion system encoded in the LEE pathogenicity island. The abundance of transcripts for all 41 LEE genes and more than half of confirmed non-LEE-encoded T3 effectors were elevated in an EHEC hfq deletion mutant. Thus, Hfq promotes coordinated expression of the LEE-encoded T3S apparatus and both LEE- and non-LEE-encoded effectors. Increased transcript levels led to the formation of functional secretion complexes capable of secreting high quantities of effectors into the supernatant. The increase in LEE-derived transcripts and proteins was dependent on Ler, the LEE-encoded transcriptional activator, and the ler transcript appears to be a direct target of Hfq-mediated negative regulation. Finally, we found that Hfq contributes to the negative regulation of T3SSs in several other pathogens, suggesting that Hfq, potentially along with species-specific sRNAs, underlies a common means to prevent unfettered expression of T3SSs. PMID:19703108

  4. Social anxiety and emotion regulation in daily life: spillover effects on positive and negative social events.

    PubMed

    Farmer, Antonina Savostyanova; Kashdan, Todd B

    2012-01-01

    To minimize the possibility of scrutiny, people with social anxiety difficulties exert great effort to manage their emotions, particularly during social interactions. We examined how the use of two emotion regulation strategies, emotion suppression and cognitive reappraisal, predict the generation of emotions and social events in daily life. Over 14 consecutive days, 89 participants completed daily diary entries on emotions, positive and negative social events, and their regulation of emotions. Using multilevel modeling, we found that when people high in social anxiety relied more on positive emotion suppression, they reported fewer positive social events and less positive emotion on the subsequent day. In contrast, people low in social anxiety reported fewer negative social events on days subsequent to using cognitive reappraisal to reduce distress; the use of cognitive reappraisal did not influence the daily lives of people high in social anxiety. Our findings support theories of emotion regulation difficulties associated with social anxiety. In particular, for people high in social anxiety, maladaptive strategy use contributed to diminished reward responsiveness. PMID:22428662

  5. The Arabidopsis Protein Phosphatase PP2C38 Negatively Regulates the Central Immune Kinase BIK1.

    PubMed

    Couto, Daniel; Niebergall, Roda; Liang, Xiangxiu; Bücherl, Christoph A; Sklenar, Jan; Macho, Alberto P; Ntoukakis, Vardis; Derbyshire, Paul; Altenbach, Denise; Maclean, Dan; Robatzek, Silke; Uhrig, Joachim; Menke, Frank; Zhou, Jian-Min; Zipfel, Cyril

    2016-08-01

    Plants recognize pathogen-associated molecular patterns (PAMPs) via cell surface-localized pattern recognition receptors (PRRs), leading to PRR-triggered immunity (PTI). The Arabidopsis cytoplasmic kinase BIK1 is a downstream substrate of several PRR complexes. How plant PTI is negatively regulated is not fully understood. Here, we identify the protein phosphatase PP2C38 as a negative regulator of BIK1 activity and BIK1-mediated immunity. PP2C38 dynamically associates with BIK1, as well as with the PRRs FLS2 and EFR, but not with the co-receptor BAK1. PP2C38 regulates PAMP-induced BIK1 phosphorylation and impairs the phosphorylation of the NADPH oxidase RBOHD by BIK1, leading to reduced oxidative burst and stomatal immunity. Upon PAMP perception, PP2C38 is phosphorylated on serine 77 and dissociates from the FLS2/EFR-BIK1 complexes, enabling full BIK1 activation. Together with our recent work on the control of BIK1 turnover, this study reveals another important regulatory mechanism of this central immune component. PMID:27494702

  6. The Arabidopsis Protein Phosphatase PP2C38 Negatively Regulates the Central Immune Kinase BIK1

    PubMed Central

    Liang, Xiangxiu; Bücherl, Christoph A.; Sklenar, Jan; Macho, Alberto P.; Ntoukakis, Vardis; Derbyshire, Paul; Altenbach, Denise; Robatzek, Silke; Uhrig, Joachim; Menke, Frank; Zhou, Jian-Min

    2016-01-01

    Plants recognize pathogen-associated molecular patterns (PAMPs) via cell surface-localized pattern recognition receptors (PRRs), leading to PRR-triggered immunity (PTI). The Arabidopsis cytoplasmic kinase BIK1 is a downstream substrate of several PRR complexes. How plant PTI is negatively regulated is not fully understood. Here, we identify the protein phosphatase PP2C38 as a negative regulator of BIK1 activity and BIK1-mediated immunity. PP2C38 dynamically associates with BIK1, as well as with the PRRs FLS2 and EFR, but not with the co-receptor BAK1. PP2C38 regulates PAMP-induced BIK1 phosphorylation and impairs the phosphorylation of the NADPH oxidase RBOHD by BIK1, leading to reduced oxidative burst and stomatal immunity. Upon PAMP perception, PP2C38 is phosphorylated on serine 77 and dissociates from the FLS2/EFR-BIK1 complexes, enabling full BIK1 activation. Together with our recent work on the control of BIK1 turnover, this study reveals another important regulatory mechanism of this central immune component. PMID:27494702

  7. Two distinct mechanisms for negative regulation of the Wee1 protein kinase.

    PubMed Central

    Tang, Z; Coleman, T R; Dunphy, W G

    1993-01-01

    The Wee1 protein kinase negatively regulates the entry into mitosis by catalyzing the inhibitory tyrosine phosphorylation of the Cdc2 protein. To examine the potential mechanisms for Wee1 regulation during the cell cycle, we have introduced a recombinant form of the fission yeast Wee1 protein kinase into Xenopus egg extracts. We find that the Wee1 protein undergoes dramatic changes in its phosphorylation state and kinase activity during the cell cycle. The Wee1 protein oscillates between an underphosphorylated 107 kDa form during interphase and a hyperphosphorylated 170 kDa version at mitosis. The mitosis-specific hyperphosphorylation of the Wee1 protein results in a substantial reduction in its activity as a Cdc2-specific tyrosine kinase. This phosphorylation occurs in the N-terminal region of the protein that lies outside the C-terminal catalytic domain, which was recently shown to be a substrate for the fission yeast Nim1 protein kinase. These experiments demonstrate the existence of a Wee1 regulatory system, consisting of both a Wee1-inhibitory kinase and a Wee1-stimulatory phosphatase, which controls the phosphorylation of the N-terminal region of the Wee1 protein. Moreover, these findings indicate that there are apparently two potential mechanisms for negative regulation of the Wee1 protein, one involving phosphorylation of its C-terminal domain by the Nim1 protein and the other involving phosphorylation of its N-terminal region by a different kinase. Images PMID:7504624

  8. Impact of physical maltreatment on the regulation of negative affect and aggression.

    PubMed

    Shackman, Jessica E; Pollak, Seth D

    2014-11-01

    Physically maltreated children are at risk for developing externalizing behavioral problems characterized by reactive aggression. The current experiment tested the relationships between individual differences in a neural index of social information processing, histories of child maltreatment, child negative affect, and aggressive behavior. Fifty boys (17 maltreated) performed an emotion recognition task while the P3b component of the event-related potential was recorded to index attention allocation to angry faces. Children then participated in a peer-directed aggression task. Negative affect was measured by recording facial electromyography, and aggression was indexed by the feedback that children provided to a putative peer. Physically maltreated children exhibited greater negative affect and more aggressive behavior, compared to nonmaltreated children, and this relationship was mediated by children's allocation of attention to angry faces. These data suggest that physical maltreatment leads to inappropriate regulation of both negative affect and aggression, which likely place maltreated children at increased risk for the development and maintenance of externalizing behavior disorders. PMID:24914736

  9. Impact of physical maltreatment on the regulation of negative affect and aggression

    PubMed Central

    SHACKMAN, JESSICA E.; POLLAK, SETH D.

    2015-01-01

    Physically maltreated children are at risk for developing externalizing behavioral problems characterized by reactive aggression. The current experiment tested the relationships between individual differences in a neural index of social information processing, histories of child maltreatment, child negative affect, and aggressive behavior. Fifty boys (17 maltreated) performed an emotion recognition task while the P3b component of the event-related potential was recorded to index attention allocation to angry faces. Children then participated in a peer-directed aggression task. Negative affect was measured by recording facial electromyography, and aggression was indexed by the feedback that children provided to a putative peer. Physically maltreated children exhibited greater negative affect and more aggressive behavior, compared to nonmaltreated children, and this relationship was mediated by children’s allocation of attention to angry faces. These data suggest that physical maltreatment leads to inappropriate regulation of both negative affect and aggression, which likely place maltreated children at increased risk for the development and maintenance of externalizing behavior disorders. PMID:24914736

  10. TRIM39 negatively regulates the NFκB-mediated signaling pathway through stabilization of Cactin.

    PubMed

    Suzuki, Masanobu; Watanabe, Masashi; Nakamaru, Yuji; Takagi, Dai; Takahashi, Hidehisa; Fukuda, Satoshi; Hatakeyama, Shigetsugu

    2016-03-01

    NFκB is one of the central regulators of cell survival, immunity, inflammation, carcinogenesis and organogenesis. The activation of NFκB is strictly regulated by several posttranslational modifications including phosphorylation, neddylation and ubiquitination. Several types of ubiquitination play important roles in multi-step regulations of the NFκB pathway. Some of the tripartite motif-containing (TRIM) proteins functioning as E3 ubiquitin ligases are known to regulate various biological processes such as inflammatory signaling pathways. One of the TRIM family proteins, TRIM39, for which the gene has single nucleotide polymorphisms, has been identified as one of the genetic factors in Behcet's disease. However, the role of TRIM39 in inflammatory signaling had not been fully elucidated. In this study, to elucidate the function of TRIM39 in inflammatory signaling, we performed yeast two-hybrid screening using TRIM39 as a bait and identified Cactin, which has been reported to inhibit NFκB- and TLR-mediated transcriptions. We show that TRIM39 stabilizes Cactin protein and that Cactin is upregulated after TNFα stimulation. TRIM39 knockdown also causes activation of the NFκB signal. These findings suggest that TRIM39 negatively regulates the NFκB signal in collaboration with Cactin induced by inflammatory stimulants such as TNFα. PMID:26363554

  11. Dynamin-2 is a novel NOS1β interacting protein and negative regulator in the collecting duct.

    PubMed

    Hyndman, Kelly A; Arguello, Alexandra M; Morsing, Sofia K H; Pollock, Jennifer S

    2016-04-01

    Nitric oxide synthase 1 (NOS1)-derived nitric oxide (NO) production in collecting ducts is critical for maintaining fluid-electrolyte balance. Rat collecting ducts express both the full-length NOS1α and its truncated variant NOS1β, while NOS1β predominates in mouse collecting ducts. We reported that dynamin-2 (DNM2), a protein involved in excising vesicles from the plasma membrane, and NOS1α form a protein-protein interaction that promotes NO production in rat collecting ducts. NOS1β was found to be highly expressed in human renal cortical/medullary samples; hence, we tested the hypothesis that DNM2 is a positive regulator of NOS1β-derived NO production. COS7 and mouse inner medullary collecting duct-3 (mIMCD3) cells were transfected with NOS1β and/or DNM2. Coimmunoprecipitation experiments show that NOS1β and DNM2 formed a protein-protein interaction. DNM2 overexpression decreased nitrite production (index of NO) in both COS7 and mIMCD-3 cells by 50-75%. mIMCD-3 cells treated with a panel of dynamin inhibitors or DNM2 siRNA displayed increased nitrite production. To elucidate the physiological significance of IMCD DNM2/NOS1β regulation in vivo, flox control and CDNOS1 knockout mice were placed on a high-salt diet, and freshly isolated IMCDs were treated acutely with a dynamin inhibitor. Dynamin inhibition increased nitrite production by IMCDs from flox mice. This response was blunted (but not abolished) in collecting duct-specific NOS1 knockout mice, suggesting that DNM2 also negatively regulates NOS3 in the mouse IMCD. We conclude that DNM2 is a novel negative regulator of NO production in mouse collecting ducts. We propose that DNM2 acts as a "break" to prevent excess or potentially toxic NO levels under high-salt conditions. PMID:26791826

  12. Negative mood regulation expectancies moderate the relationship between psychological abuse and avoidant coping.

    PubMed

    Shepherd-McMullen, Cassandra; Mearns, Jack; Stokes, Julie E; Mechanic, Mindy B

    2015-05-01

    This study explored the relationships among psychological abuse, attitudes about intimate partner violence (IPV), negative mood regulation expectancies (NMRE), and coping. Participants were 126 female college students in dating, cohabitating, or married relationships within the previous year. In one single session, they completed self-report scales measuring IPV, NMRE, and coping. Results indicated that women reporting higher levels of psychological abuse reported less negative attitudes toward IPV, engaged in less-active coping responses, and had lower NMRE. Psychological abuse was a significant predictor of avoidant coping, while NMRE significantly predicted both active and avoidant coping. In addition, the interaction of NMRE × Psychological abuse added incremental prediction of avoidant coping. Implications for research and practice are discussed. PMID:25049030

  13. MiR-21 promoted proliferation and migration in hepatocellular carcinoma through negative regulation of Navigator-3

    SciTech Connect

    Wang, Zhipeng; Yang, Huan; Ren, Lei

    2015-09-04

    MicroRNA-21 (miR-21) has been well-established and found to be over-expressed in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanism of miR-21 involvement in the development and progression of HCC remains to be understood. In the present study, we firstly identified that the Navigator-3 (NAV-3) gene as a novel direct target of miR-21. Knock-down of NAV-3 using shRNA can rescue the effects of anti-miR-21 inhibitor in HCC cell lines, whereas re-expression of miR-21 using transfection with miR-21 mimics phenocopied the NAV-3 knock-down model. Additionally, miR-21 levels inversely correlated with NAV-3 both in HCC cells and tissues. Knock-down of NAV-3 promoted both the proliferation and migration in HCC cells. Together, our findings suggest an important role for miR-21 in the progression of HCC, which negatively regulated Navigator-3 in the migration of HCC. - Highlights: • Navigator-3 (NAV-3) suppresses proliferation, migration and tumorigenesis of HCC cells. • NAV-3 was a novel target of miR-21. • MiR-21 negatively regulates NAV-3 in HCC.

  14. Regulation of human airway surface liquid.

    PubMed

    Widdicombe, J H; Widdicombe, J G

    1995-01-01

    Human airways are lined with a film of liquid from 5-100 microns in depth, consisting of a periciliary sol around and a mucous gel above the cilia. Microscopical studies have shown the sol to be invariably the same depth as the length of the cilia, and we discuss possible reasons for this. The composition and sources of the airway surface liquid are also described. In addition the forces regulating its volume are analyzed. Several airway diseases are characterised by dramatic changes in the volume and composition of airway liquid. We review recent research suggesting that the accumulation of airway mucous secretions in cystic fibrosis is caused by alterations in active transport of ions and water across both the surface and gland epithelia. PMID:7740210

  15. Human body temperature - Its measurement and regulation

    SciTech Connect

    Houdas, Y.; Ring, E.F.J.

    1982-01-01

    The terminology used in thermal physiology is examined, and principles of heat transfer are discussed, taking into account heat quantity, heat flux, temperature, pressure, quantities used in physiology, a number of common definitions, the equivalence between different forms of energy, the release of potential energy in living tissues, heat transfer without change of state, and heat transfer with change of state. Temperature and humidity measurement are considered along with man and his environment, the temperature distribution in the systems and tracts of the human body, physiological changes affecting the temperature distribution, problems of temperature regulation, questions of heat loss and conservation, acclimatization to heat and cold, and disorders of thermoregulation. Attention is given to possible thermal imaging applications, causes of temperature irregularities in the head and neck, common causes of increased temperatures of upper limbs, and thermography in disease. 193 references.

  16. Dietary methanol regulates human gene activity.

    PubMed

    Shindyapina, Anastasia V; Petrunia, Igor V; Komarova, Tatiana V; Sheshukova, Ekaterina V; Kosorukov, Vyacheslav S; Kiryanov, Gleb I; Dorokhov, Yuri L

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  17. Dietary Methanol Regulates Human Gene Activity

    PubMed Central

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  18. Integrative regulation of human brain blood flow

    PubMed Central

    Willie, Christopher K; Tzeng, Yu-Chieh; Fisher, Joseph A; Ainslie, Philip N

    2014-01-01

    Herein, we review mechanisms regulating cerebral blood flow (CBF), with specific focus on humans. We revisit important concepts from the older literature and describe the interaction of various mechanisms of cerebrovascular control. We amalgamate this broad scope of information into a brief review, rather than detailing any one mechanism or area of research. The relationship between regulatory mechanisms is emphasized, but the following three broad categories of control are explicated: (1) the effect of blood gases and neuronal metabolism on CBF; (2) buffering of CBF with changes in blood pressure, termed cerebral autoregulation; and (3) the role of the autonomic nervous system in CBF regulation. With respect to these control mechanisms, we provide evidence against several canonized paradigms of CBF control. Specifically, we corroborate the following four key theses: (1) that cerebral autoregulation does not maintain constant perfusion through a mean arterial pressure range of 60–150 mmHg; (2) that there is important stimulatory synergism and regulatory interdependence of arterial blood gases and blood pressure on CBF regulation; (3) that cerebral autoregulation and cerebrovascular sensitivity to changes in arterial blood gases are not modulated solely at the pial arterioles; and (4) that neurogenic control of the cerebral vasculature is an important player in autoregulatory function and, crucially, acts to buffer surges in perfusion pressure. Finally, we summarize the state of our knowledge with respect to these areas, outline important gaps in the literature and suggest avenues for future research. PMID:24396059

  19. Integrative regulation of human brain blood flow.

    PubMed

    Willie, Christopher K; Tzeng, Yu-Chieh; Fisher, Joseph A; Ainslie, Philip N

    2014-03-01

    Herein, we review mechanisms regulating cerebral blood flow (CBF), with specific focus on humans. We revisit important concepts from the older literature and describe the interaction of various mechanisms of cerebrovascular control. We amalgamate this broad scope of information into a brief review, rather than detailing any one mechanism or area of research. The relationship between regulatory mechanisms is emphasized, but the following three broad categories of control are explicated: (1) the effect of blood gases and neuronal metabolism on CBF; (2) buffering of CBF with changes in blood pressure, termed cerebral autoregulation; and (3) the role of the autonomic nervous system in CBF regulation. With respect to these control mechanisms, we provide evidence against several canonized paradigms of CBF control. Specifically, we corroborate the following four key theses: (1) that cerebral autoregulation does not maintain constant perfusion through a mean arterial pressure range of 60-150 mmHg; (2) that there is important stimulatory synergism and regulatory interdependence of arterial blood gases and blood pressure on CBF regulation; (3) that cerebral autoregulation and cerebrovascular sensitivity to changes in arterial blood gases are not modulated solely at the pial arterioles; and (4) that neurogenic control of the cerebral vasculature is an important player in autoregulatory function and, crucially, acts to buffer surges in perfusion pressure. Finally, we summarize the state of our knowledge with respect to these areas, outline important gaps in the literature and suggest avenues for future research. PMID:24396059

  20. Evidence for the negative impact of reward on self-regulated learning.

    PubMed

    Wehe, Hillary S; Rhodes, Matthew G; Seger, Carol A

    2015-01-01

    The undermining effect refers to the detrimental impact rewards can have on intrinsic motivation to engage in a behaviour. The current study tested the hypothesis that participants' self-regulated learning behaviours are susceptible to the undermining effect. Participants were assigned to learn a set of Swahili-English word pairs. Half of the participants were offered a reward for performance, and half were not offered a reward. After the initial study phase, participants were permitted to continue studying the words during a free period. The results were consistent with an undermining effect: Participants who were not offered a reward spent more time studying the words during the free period. The results suggest that rewards may negatively impact self-regulated learning behaviours and provide support for the encouragement of intrinsic motivation. PMID:26106977

  1. Antennally mediated negative feedback regulation of pheromone production in the pine engraver beetle, Ips pini

    NASA Astrophysics Data System (ADS)

    Ginzel, Matthew D.; Bearfield, Jeremy C.; Keeling, Christopher I.; McCormack, Colin C.; Blomquist, Gary J.; Tittiger, Claus

    2007-01-01

    Bark beetles use monoterpenoid aggregation pheromones to coordinate host colonization and mating. These chemical signals are produced de novo in midgut cells via the mevalonate pathway, and pheromone production may be regulated by a negative feedback system mediated through the antennae. In this study, we explored the effect of antennectomy on pheromone production and transcript levels of key mevalonate pathway genes in juvenile hormone III-treated male pine engraver beetles, Ips pini (Say). Antennectomized males produced significantly greater amounts of pheromone than podectomized males and those with intact antennae. Likewise, mRNA levels of three mevalonate pathway genes important in pheromone biosynthesis were measured by quantitative real-time PCR and found to be induced to a greater extent with antennectomy, suggesting a transcriptional regulation of pheromone production.

  2. Anaplastic Lymphoma Kinase Acts in the Drosophila Mushroom Body to Negatively Regulate Sleep

    PubMed Central

    Bai, Lei; Sehgal, Amita

    2015-01-01

    Though evidence is mounting that a major function of sleep is to maintain brain plasticity and consolidate memory, little is known about the molecular pathways by which learning and sleep processes intercept. Anaplastic lymphoma kinase (Alk), the gene encoding a tyrosine receptor kinase whose inadvertent activation is the cause of many cancers, is implicated in synapse formation and cognitive functions. In particular, Alk genetically interacts with Neurofibromatosis 1 (Nf1) to regulate growth and associative learning in flies. We show that Alk mutants have increased sleep. Using a targeted RNAi screen we localized the negative effects of Alk on sleep to the mushroom body, a structure important for both sleep and memory. We also report that mutations in Nf1 produce a sexually dimorphic short sleep phenotype, and suppress the long sleep phenotype of Alk. Thus Alk and Nf1 interact in both learning and sleep regulation, highlighting a common pathway in these two processes. PMID:26536237

  3. miR-375 negatively regulates porcine preadipocyte differentiation by targeting BMPR2.

    PubMed

    Liu, Siyuan; Sun, Guangjie; Yuan, Bao; Zhang, Lianjiang; Gao, Yan; Jiang, Hao; Dai, Lisheng; Zhang, Jiabao

    2016-05-01

    The differentiation of preadipocytes into adipose tissues is tightly regulated by various factors including miRNAs and cytokines. In this study, taking advantage of isolated porcine primary preadipocytes, we showed that ectopic expression of miR-375 could change preadipocyte differentiation. In addition, bone morphogenetic protein receptor 2 (BMPR2) was identified as a direct target of miR-375. Silencing BMPR2 had the same inhibition effects as overexpressing miR-375 on the preadipocyte differentiation. Together, we demonstrated that miR-375 is a negative regulator of adipogenic differentiation using porcine primary preadipocytes. These results clarified the role of miR-375 in ex vivo adipogenic differentiation. PMID:27059117

  4. CD45 negatively regulates tumour necrosis factor and interleukin-6 production in dendritic cells.

    PubMed

    Piercy, Jenny; Petrova, Svetla; Tchilian, Elma Z; Beverley, Peter C L

    2006-06-01

    CD45 is known to regulate signalling through many different surface receptors in diverse haemopoietic cell types. Here we report for the first time that CD45-/- bone marrow dendritic cells (BMDC) are more activated than CD45+/+ cells and that tumour necrosis factor (TNF) and interleukin-6 (IL-6) production by BMDC and splenic dendritic cells (sDC), is increased following stimulation via Toll-like receptor (TLR)3 and TLR9. Nuclear factor-kappaB activation, an important downstream consequence of TLR3 and TLR9 signalling, is also increased in CD45-/- BMDC. BMDC of CD45-/- mice also produce more TNF and IL-6 following stimulation with the cytokines TNF and interferon-alpha. These results show that TLR signalling is increased in CD45-/- dendritic cells and imply that CD45 is a negative regulator of TLR and cytokine receptor signalling in dendritic cells. PMID:16771860

  5. The Emerging Regulation of VEGFR-2 in Triple-Negative Breast Cancer

    PubMed Central

    Zhu, Xiaoxia; Zhou, Wen

    2015-01-01

    Vascular endothelial growth factor-A (VEGF) signals vascular development and angiogenesis mainly by binding to VEGF receptor family member 2 (VEGFR-2). Adaptor proteins mediate many VEGFR-2’s functions in the development of blood vessels. Cancer cells secrete VEGF to activate VEGFR-2 pathway in their neighboring endothelial cells in the process of cancer-related angiogenesis. Interestingly, activation of VEGFR-2 signaling is found in breast cancer cells, but its role and regulation are not clear. We highlighted research advances of VEGFR-2, with a focus on VEGFR-2’s regulation by mutant p53 in breast cancer. In addition, we reviewed recent Food and Drug Administration-approved tyrosine kinase inhibitor drugs that can inhibit the function of VEGFR-2. Ongoing preclinical and clinical studies might prove that pharmaceutically targeting VEGFR-2 could be an effective therapeutic strategy in treating triple-negative breast cancer. PMID:26500608

  6. TRIM13 Is a Negative Regulator of MDA5-Mediated Type I Interferon Production

    PubMed Central

    Narayan, Kavitha; Waggoner, Lisa; Pham, Serena T.; Hendricks, Gabriel L.; Waggoner, Stephen N.; Conlon, Joseph; Wang, Jennifer P.

    2014-01-01

    ABSTRACT Retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) are essential intracellular detectors of viral RNA. They contribute to the type I interferon (IFN) response that is crucial for host defense against viral infections. Given the potent antiviral and proinflammatory activities elicited by the type I IFNs, induction of the type I IFN response is tightly regulated. Members of the tripartite motif (TRIM) family of proteins have recently emerged as key regulators of antiviral immunity. We show that TRIM13, an E3 ubiquitin ligase, is expressed in immune cells and is upregulated in bone marrow-derived macrophages upon stimulation with inducers of type I IFN. TRIM13 interacts with MDA5 and negatively regulates MDA5-mediated type I IFN production in vitro, acting upstream of IFN regulatory factor 3. We generated Trim13−/− mice and show that upon lethal challenge with encephalomyocarditis virus (EMCV), which is sensed by MDA5, Trim13−/− mice produce increased amounts of type I IFNs and survive longer than wild-type mice. Trim13−/− murine embryonic fibroblasts (MEFs) challenged with EMCV or poly(I·C) also show a significant increase in beta IFN (IFN-β) levels, but, in contrast, IFN-β responses to the RIG-I-detected Sendai virus were diminished, suggesting that TRIM13 may play a role in positively regulating RIG-I function. Together, these results demonstrate that TRIM13 regulates the type I IFN response through inhibition of MDA5 activity and that it functions nonredundantly to modulate MDA5 during EMCV infection. IMPORTANCE The type I interferon (IFN) response is crucial for host defense against viral infections, and proper regulation of this pathway contributes to maintaining immune homeostasis. Retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) are intracellular detectors of viral RNA that induce the type I IFN response. In this study, we show that expression of the

  7. Regulating the use of human bodily material.

    PubMed

    Skene, Loane

    2013-12-01

    The articles in this special issue consider recent developments in the law regulating the use of human bodily material and the wider implications of those developments. For some time, the law has accepted that a person who has undertaken "work and skill" on excised bodily material may obtain at least a possessory right; but the person from whom the material came did not have such a right. Now, however, the law has recognised that people may have some legal rights regarding their own bodily material. What is the nature and source of those rights? Should they be expanded? If so, what legal principles are best to do that? The most frequent suggestion is the law of property but many other areas of law are also relevant: the law of contract; tort (bailment and consent); criminal law (e.g., forensic testing); gifts; custodianship and others. These regulatory options are outlined in this editorial and discussed by lawyers and other contributors in their articles in this special issue. There are also stimulating philosophical reflections on the nature of human bodily material. PMID:24597369

  8. Rapid estrogen signaling negatively regulates PTEN activity through phosphorylation in endometrial cancer cells

    PubMed Central

    Scully, Melanie M.; Palacios-Helgeson, Leslie K.; Wah, Lah S.; Jackson, Twila A.

    2014-01-01

    Hyperestrogenicity is a risk factor for endometrial cancer. 17β-estradiol (E2) is known to stimulate both genomic and nongenomic estrogen receptor-α (ERα) actions in a number of reproductive tissues. However, the contributions of transcription-independent ERα signaling on normal and malignant endometrium are not fully understood. Phosphatase and tensin homolog (PTEN) is a tumor suppressor that decreases cellular mitosis primarily through negative regulation of the phosphoinositide 3-kinase/AKT signaling axis. PTEN levels are elevated during the E2 dominated, mitotically active, proliferative phase of the menstrual cycle, indicating possible hormonal regulation of PTEN in the uterus. In order to determine if rapid E2 signaling regulates PTEN, we used ERα positive, PTEN positive, endometrial cells. We show that cytosolic E2/ERα signaling leads to increased phosphorylation of PTEN at key regulatory residues. Importantly, E2 stimulation decreased PTEN lipid phosphatase activity and caused consequent increases in phospho-AKT. We further demonstrate that cytosolic ERα forms a complex with PTEN in an E2-dependent manner, and that ERα constitutively complexes with protein kinase2-α (CK2α), a kinase previously shown to phosphorylate the C-terminal tail of PTEN. These results provide mechanistic support for an E2-dependent, ERα cytosolic signaling complex that negatively regulates PTEN activity through carboxy terminus phosphorylation. Using an animal model, we show that sustained E2 signaling results in increased phospho-PTEN (S380, T382, T383), total PTEN and phospho-AKT (S473). Taken together, we provide a novel mechanism in which transcription-independent E2/ERα signaling may promote a pro-tumorigenic environment in the endometrium. PMID:24844349

  9. Penta-EF-Hand Protein Peflin Is a Negative Regulator of ER-To-Golgi Transport

    PubMed Central

    Held, Aaron; Sargeant, John; Thorsen, Kevin; Hay, Jesse C.

    2016-01-01

    Luminal calcium regulates vesicle transport early in the secretory pathway. In ER-to-Golgi transport, depletion of luminal calcium leads to significantly reduced transport and a buildup of budding and newly budded COPII vesicles and vesicle proteins. Effects of luminal calcium on transport may be mediated by cytoplasmic calcium sensors near ER exits sites (ERES). The penta-EF-hand (PEF) protein apoptosis-linked gene 2 (ALG-2) stabilizes sec31A at ER exit sites (ERES) and promotes the assembly of inner and outer shell COPII components. However, in vitro and intact cell approaches have not determined whether ALG-2 is a negative or positive regulator, or a regulator at all, under basal physiological conditions. ALG-2 interacts with another PEF protein, peflin, to form cytosolic heterodimers that dissociate in response to calcium. However, a biological function for peflin has not been demonstrated and whether peflin and the ALG-2/peflin interaction modulates transport has not been investigated. Using an intact, single cell, morphological assay for ER-to-Golgi transport in normal rat kidney (NRK) cells, we found that depletion of peflin using siRNA resulted in significantly faster transport of the membrane cargo VSV-G. Double depletion of peflin and ALG-2 blocked the increased transport resulting from peflin depletion, demonstrating a role for ALG-2 in the increased transport. Furthermore, peflin depletion caused increased targeting of ALG-2 to ERES and increased ALG-2/sec31A interactions, suggesting that peflin may normally inhibit transport by preventing ALG-2/sec31A interactions. This work identifies for the first time a clear steady state role for a PEF protein in ER-to-Golgi transport—peflin is a negative regulator of transport. PMID:27276012

  10. The R3-MYB Gene GhCPC Negatively Regulates Cotton Fiber Elongation

    PubMed Central

    Liu, Bingliang; Zhu, Yichao; Zhang, Tianzhen

    2015-01-01

    Cotton (Gossypium spp.) fibers are single-cell trichomes that arise from the outer epidermal layer of seed coat. Here, we isolated a R3-MYB gene GhCPC, identified by cDNA microarray analysis. The only conserved R3 motif and different expression between TM-1 and fuzzless-lintless mutants suggested that it might be a negative regulator in fiber development. Transgenic evidence showed that GhCPC overexpression not only delayed fiber initiation but also led to significant decreases in fiber length. Interestingly, Yeast two-hybrid analysis revealed an interaction complex, in which GhCPC and GhTTG1/4 separately interacted with GhMYC1. In transgenic plants, Q-PCR analysis showed that GhHOX3 (GL2) and GhRDL1 were significantly down regulated in −1–5 DPA ovules and fibers. In addition, Yeast one-hybrid analysis demonstrated that GhMYC1 could bind to the E-box cis-elements and the promoter of GhHOX3. These results suggested that GhHOX3 (GL2) might be downstream gene of the regulatory complex. Also, overexpression of GhCPC in tobacco led to differential loss of pigmentation. Taken together, the results suggested that GhCPC might negatively regulate cotton fiber initiation and early elongation by a potential CPC-MYC1-TTG1/4 complex. Although the fibers were shorter in transgenic cotton lines than in the wild type, no significant difference was detected in stem or leaf trichomes, even in cotton mutants (five naked seed or fuzzless), suggesting that fiber and trichome development might be regulated by two sets of genes sharing a similar model. PMID:25646816

  11. miR-466 is putative negative regulator of Coxsackie virus and Adenovirus Receptor.

    PubMed

    Lam, W Y; Cheung, Ariel C Y; Tung, Christine K C; Yeung, Apple C M; Ngai, Karry L K; Lui, Vivian W Y; Chan, Paul K S; Tsui, Stephen K W

    2015-01-16

    This study aimed at elucidating how Coxsackie B virus (CVB) perturbs the host's microRNA (miRNA) regulatory pathways that lead to antiviral events. The results of miRNA profiling in rat pancreatic cells infection models revealed that rat rno-miR-466d was up-regulated in CVB infection. Furthermore, in silico studies showed that Coxsackie virus and Adenovirus Receptor (CAR), a cellular receptor, was one of the rno-miR-466d targets involved in viral entry. Subsequent experiments also proved that both the rno-miR-466d and the human hsa-miR-466, which are orthologs of the miR-467 gene family, could effectively down-regulate the levels of rat and human CAR protein expression, respectively. PMID:25497012

  12. Retinoic acid negatively regulates dact3b expression in the hindbrain of zebrafish embryos

    PubMed Central

    Mandal, Amrita; Waxman, Joshua

    2014-01-01

    Wnt signaling plays important roles in normal development as well as pathophysiological conditions. The Dapper antagonist of β-catenin (Dact) proteins are modulators of both canonical and non-canonical Wnt signaling via direct interactions with Dishevelled (Dvl) and Van Gogh like-2 (Vangl2). Here, we report the dynamic expression patterns of two zebrafish dact3 paralogs during early embryonic development. Our whole mount in situ hybridization (WISH) analysis indicates that specific dact3a expression starts by the tailbud stage in adaxial cells. Later, it is expressed in the anterior lateral plate mesoderm, somites, migrating cranial neural crest, and hindbrain neurons. By comparison, dact3b expression initiates on the dorsal side at the dome stage and soon after is expressed in the dorsal forerunner cells (DFCs) during gastrulation. At later stages, dact3b expression becomes restricted to the branchial neurons of the hindbrain and to the 2nd pharyngeal arch. To investigate how zebrafish dact3 gene expression is regulated, we manipulated retinoic acid (RA) signaling during development and found it negatively regulates dact3b in the hindbrain. Our study is the first to document the expression of the paralogous zebrafish dact3 genes during early development and demonstrate dact3b can be regulated by RA signaling. Therefore, our study opens up new avenues to study Dact3 function in the development of multiple tissues and suggests a previously unappreciated cross regulation of Wnt signaling by RA signaling in the developing vertebrate hindbrain. PMID:25266145

  13. Constitutive Negative Regulation of R Proteins in Arabidopsis also via Autophagy Related Pathway?

    PubMed Central

    Pečenková, Tamara; Sabol, Peter; Kulich, Ivan; Ortmannová, Jitka; Žárský, Viktor

    2016-01-01

    Even though resistance (R) genes are among the most studied components of the plant immunity, there remain still a lot of aspects to be explained about the regulation of their function. Many gain-of-function mutants of R genes and loss-of-function of their regulators often demonstrate up-regulated defense responses in combination with dwarf stature and/or spontaneous leaf lesions formation. For most of these mutants, phenotypes are a consequence of an ectopic activation of R genes. Based on the compilation and comparison of published results in this field, we have concluded that the constitutively activated defense phenotypes recurrently arise by disruption of tight, constitutive and multilevel negative control of some of R proteins that might involve also their targeting to the autophagy pathway. This mode of R protein regulation is supported also by protein–protein interactions listed in available databases, as well as in silico search for autophagy machinery interacting motifs. The suggested model could resolve some explanatory discrepancies found in the studies of the immunity responses of autophagy mutants. PMID:26973696

  14. microRNAs are differentially regulated between MDM2-positive and negative malignant pleural mesothelioma

    PubMed Central

    Walter, Robert Fred Henry; Vollbrecht, Claudia; Werner, Robert; Wohlschlaeger, Jeremias; Christoph, Daniel Christian; Schmid, Kurt Werner; Mairinger, Fabian Dominik

    2016-01-01

    Background Malignant pleural mesothelioma (MPM) is a highly aggressive tumour first-line treated with a combination of cisplatin and pemetrexed. MDM2 and P14/ARF (CDKN2A) are upstream regulators of TP53 and may contribute to its inactivation. In the present study, we now aimed to define the impact of miRNA expression on this mechanism. Material and Methods 24 formalin-fixed paraffin-embedded (FFPE) tumour specimens were used for miRNA expression analysis of the 800 most important miRNAs using the nCounter technique (NanoString). Significantly deregulated miRNAs were identified before a KEGG-pathway analysis was performed. Results 17 miRNAs regulating TP53, 18 miRNAs regulating MDM2, and 11 miRNAs directly regulating CDKN2A are significantly downregulated in MDM2-expressing mesotheliomas. TP53 is downregulated in MDM2-negative tumours through miRNAs with a miSVR prediction score of 11.67, RB1 with a prediction score of 8.02, MDM2 with a prediction score of 4.50 and CDKN2A with a prediction score of 1.27. Conclusion MDM2 expression seems to impact miRNA expression levels in MPM. Especially, miRNAs involved in TP53-signaling are strongly decreased in MDM2-positive mesotheliomas. A better understanding of its tumour biology may open the chance for new therapeutic approaches and thereby augment patients' outcome. PMID:26918730

  15. Histone deacetylase HDA9 negatively regulates salt and drought stress responsiveness in Arabidopsis.

    PubMed

    Zheng, Yu; Ding, Yue; Sun, Xuan; Xie, Sisi; Wang, Dan; Liu, Xiaoyun; Su, Lufang; Wei, Wei; Pan, Lei; Zhou, Dao-Xiu

    2016-04-01

    Histone modification is an important epigenetic regulation in higher plants adapting to environment changes including salt and drought stresses. In this report, we show that the Arabidopsis RPD3-type histone deacetylase HDA9 is involved in modulating plant responses to salt and drought stresses in Arabidopsis. Loss-of-function mutants of the gene displayed phenotypes (such as seedling root growth and seed germination) insensitive to NaCl and polyethylene glycol (PEG) treatments. HDA9 mutation led to up-regulation of many genes, among which those involved in response to water deprivation stress (GO: 0009414) were enriched. These genes were much more induced in the mutants than wild-type plants when treated with PEG and NaCl. In addition, we found that in the mutants, salt and drought stresses led to much higher levels of histone H3K9 acetylation at promoters of 14 genes randomly selected from those that respond to water-deprivation stress than in wild-type plants. Our study suggested that HDA9 might be a novel chromatin protein that negatively regulates plant sensitivity to salt and drought stresses by regulating histone acetylation levels of a large number of stress-responsive genes in Arabidopsis. PMID:26733691

  16. Mycobacterial FurA is a negative regulator of catalase-peroxidase gene katG.

    PubMed

    Zahrt, T C; Song, J; Siple, J; Deretic, V

    2001-03-01

    In several bacteria, the catalase-peroxidase gene katG is under positive control by oxyR, a transcriptional regulator of the peroxide stress response. The Mycobacterium tuberculosis genome also contains sequences corresponding to oxyR, but this gene has been inactivated in the tubercle bacillus because of the presence of multiple mutations and deletions. Thus, M. tuberculosis katG and possibly other parts of the oxidative stress response in this organism are either not regulated or are controlled by a factor different from OxyR. The mycobacterial FurA is a homologue of the ferric uptake regulator Fur and is encoded by a gene located immediately upstream of katG. Here, we examine the possibility that FurA regulates katG expression. Inactivation of furA on the Mycobacterium smegmatis chromosome, a mycobacterial species that also lacks an oxyR homologue, resulted in derepression of katG, concomitant with increased resistance of the furA mutant to H2O2. In addition, M. smegmatis furA::Km(r) was more sensitive to the front-line antituberculosis agent isonicotinic acid hydrazide (INH) compared with the parental furA+ strain. The phenotypic manifestations were specific, as the mutant strain did not show altered sensitivity to organic peroxides, and both H2O2 and INH susceptibility profiles were complemented by the wild-type furA+ gene. We conclude that FurA is a second regulator of oxidative stress response in mycobacteria and that it negatively controls katG. In species lacking a functional oxyR, such as M. tuberculosis and M. smegmatis, FurA appears to be a dominant regulator affecting mycobacterial physiology and intracellular survival. PMID:11251835

  17. Caudal is a negative regulator of the Anopheles IMD Pathway that controls resistance to P. falciparum infection

    PubMed Central

    Clayton, April M.; Cirimotich, Chris M.; Dong, Yuemei; Dimopoulos, George

    2013-01-01

    Malaria parasite transmission depends upon the successful development of Plasmodium in its Anopheles mosquito vector. The mosquito’s innate immune system constitutes a major bottleneck for parasite population growth. We show here that in Anopheles gambiae, the midgut-specific transcription factor Caudal acts as a negative regulator in the Imd pathway-mediated immune response against the human malaria parasite P. falciparum. Caudal also modulates the mosquito midgut bacterial flora. RNAi-mediated silencing of Caudal enhanced the mosquito’s resistance to bacterial infections and increased the transcriptional abundance of key immune effector genes. Interestingly, Caudal’s silencing resulted in an increased lifespan of the mosquito, while it impaired reproductive fitness with respect to egg laying and hatching. PMID:23178401

  18. Soybean Homologs of MPK4 Negatively Regulate Defense Responses and Positively Regulate Growth and Development1[W][OA

    PubMed Central

    Liu, Jian-Zhong; Horstman, Heidi D.; Braun, Edward; Graham, Michelle A.; Zhang, Chunquan; Navarre, Duroy; Qiu, Wen-Li; Lee, Yeunsook; Nettleton, Dan; Hill, John H.; Whitham, Steven A.

    2011-01-01

    Mitogen-activated protein kinase (MAPK) cascades play important roles in disease resistance in model plant species such as Arabidopsis (Arabidopsis thaliana) and tobacco (Nicotiana tabacum). However, the importance of MAPK signaling pathways in the disease resistance of crops is still largely uninvestigated. To better understand the role of MAPK signaling pathways in disease resistance in soybean (Glycine max), 13, nine, and 10 genes encoding distinct MAPKs, MAPKKs, and MAPKKKs, respectively, were silenced using virus-induced gene silencing mediated by Bean pod mottle virus. Among the plants silenced for various MAPKs, MAPKKs, and MAPKKKs, those in which GmMAPK4 homologs (GmMPK4s) were silenced displayed strong phenotypes including stunted stature and spontaneous cell death on the leaves and stems, the characteristic hallmarks of activated defense responses. Microarray analysis showed that genes involved in defense responses, such as those in salicylic acid (SA) signaling pathways, were significantly up-regulated in GmMPK4-silenced plants, whereas genes involved in growth and development, such as those in auxin signaling pathways and in cell cycle and proliferation, were significantly down-regulated. As expected, SA and hydrogen peroxide accumulation was significantly increased in GmMPK4-silenced plants. Accordingly, GmMPK4-silenced plants were more resistant to downy mildew and Soybean mosaic virus compared with vector control plants. Using bimolecular fluorescence complementation analysis and in vitro kinase assays, we determined that GmMKK1 and GmMKK2 might function upstream of GmMPK4. Taken together, our results indicate that GmMPK4s negatively regulate SA accumulation and defense response but positively regulate plant growth and development, and their functions are conserved across plant species. PMID:21878550

  19. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression

    NASA Astrophysics Data System (ADS)

    Makino, Yuichi; Cao, Renhai; Svensson, Kristian; Bertilsson, Göran; Asman, Mikael; Tanaka, Hirotoshi; Cao, Yihai; Berkenstam, Anders; Poellinger, Lorenz

    2001-11-01

    Alteration of gene expression is a crucial component of adaptive responses to hypoxia. These responses are mediated by hypoxia-inducible transcription factors (HIFs). Here we describe an inhibitory PAS (Per/Arnt/Sim) domain protein, IPAS, which is a basic helix-loop-helix (bHLH)/PAS protein structurally related to HIFs. IPAS contains no endogenous transactivation function but demonstrates dominant negative regulation of HIF-mediated control of gene expression. Ectopic expression of IPAS in hepatoma cells selectively impairs induction of genes involved in adaptation to a hypoxic environment, notably the vascular endothelial growth factor (VEGF) gene, and results in retarded tumour growth and tumour vascular density in vivo. In mice, IPAS was predominantly expressed in Purkinje cells of the cerebellum and in corneal epithelium of the eye. Expression of IPAS in the cornea correlates with low levels of expression of the VEGF gene under hypoxic conditions. Application of an IPAS antisense oligonucleotide to the mouse cornea induced angiogenesis under normal oxygen conditions, and demonstrated hypoxia-dependent induction of VEGF gene expression in hypoxic corneal cells. These results indicate a previously unknown mechanism for negative regulation of angiogenesis and maintenance of an avascular phenotype.

  20. BMX Negatively Regulates BAK Function, Thereby Increasing Apoptotic Resistance to Chemotherapeutic Drugs.

    PubMed

    Fox, Joanna L; Storey, Alan

    2015-04-01

    The ability of chemotherapeutic agents to induce apoptosis, predominantly via the mitochondrial (intrinsic) apoptotic pathway, is thought to be a major determinant of the sensitivity of a given cancer to treatment. Intrinsic apoptosis, regulated by the BCL2 family, integrates diverse apoptotic signals to determine cell death commitment and then activates the nodal effector protein BAK to initiate the apoptotic cascade. In this study, we identified the tyrosine kinase BMX as a direct negative regulator of BAK function. BMX associates with BAK in viable cells and is the first kinase to phosphorylate the key tyrosine residue needed to maintain BAK in an inactive conformation. Importantly, elevated BMX expression prevents BAK activation in tumor cells treated with chemotherapeutic agents and is associated with increased resistance to apoptosis and decreased patient survival. Accordingly, BMX expression was elevated in prostate, breast, and colon cancers compared with normal tissue, including in aggressive triple-negative breast cancers where BMX overexpression may be a novel biomarker. Furthermore, BMX silencing potentiated BAK activation, rendering tumor cells hypersensitive to otherwise sublethal doses of clinically relevant chemotherapeutic agents. Our finding that BMX directly inhibits a core component of the intrinsic apoptosis machinery opens opportunities to improve the efficacy of existing chemotherapy by potentiating BAK-driven cell death in cancer cells. PMID:25649765

  1. High mobility group protein DSP1 negatively regulates HSP70 transcription in Crassostrea hongkongensis.

    PubMed

    Miao, Zongyu; Xu, Delin; Cui, Miao; Zhang, Qizhong

    2016-06-10

    HSP70 acts mostly as a molecular chaperone and plays important roles in facilitating the folding of nascent peptides as well as the refolding or degradation of the denatured proteins. Under stressed conditions, the expression level of HSP70 is upregulated significantly and rapidly, as is known to be achieved by various regulatory factors controlling the transcriptional level. In this study, a high mobility group protein DSP1 was identified by DNA-affinity purification from the nuclear extracts of Crassostrea hongkongensis using the ChHSP70 promoter as a bait. The specific interaction between the prokaryotically expressed ChDSP1 and the FITC-labeled ChHSP70 promoter was confirmed by EMSA analysis. ChDSP1 was shown to negatively regulate ChHSP70 promoter expression by Luciferase Reporter Assay in the heterologous HEK293T cells. Both ChHSP70 and ChDSP1 transcriptions were induced by either thermal or CdCl2 stress, while the accumulated expression peaks of ChDSP1 were always slightly delayed when compared with that of ChHSP70. This indicates that ChDSP1 is involved, very likely to exert its suppressive role, in the recovery of the ChHSP70 expression from the induced level to its original state. This study is the first to report negative regulator of HSP70 gene transcription, and provides novel insights into the mechanisms controlling heat shock protein expression. PMID:27154224

  2. The homeobox transcription factor Irxl1 negatively regulates MyoD expression and myoblast differentiation.

    PubMed

    Chuang, Han-Ni; Hsiao, Kuang-Ming; Chang, Hui-Yi; Wu, Chia-Chi; Pan, Huichin

    2014-07-01

    Irxl1/Mkx (Iroquois homeobox-like 1/Mohawk) encodes a member of the TALE subfamily of homeodomain proteins. It is expressed in multiple mesoderm-derived tissues and has recently been shown to regulate tendon differentiation during mouse embryonic development. Previously we showed that knockdown of Irxl1 in zebrafish caused a deficit in neural crest cells which consequently resulted in deformation of craniofacial muscles and arch cartilages. Here, we further demonstrate that loss of Irxl1 function results in deformed somites with disordered muscle fibers and myotendinous junctions. Because expression of myoD is increased in the somites of Irxl1 knockdown morphants, we test whether Irxl1 negatively regulates myoD expression. When stable C2C12 myoblasts overexpressing Irxl1/Mkx were induced to differentiate, myotube formation was inhibited and protein levels of myoD and myosin heavy chain were decreased accordingly. A series of deletion constructs of myoD promoter fragments were tested by luciferase reporter assays, which identified a promoter fragment that is necessary and sufficient for Irxl1-mediated repression. Direct interaction of Irxl1 and myoD promoter was subsequently elucidated by yeast one-hybrid assays, electrophoretic mobility shift assays and chromatin immunoprecipitation analysis. Furthermore, mouse Mkx also binds to and represses myoD promoter. These results indicate that Irxl1/Mkx can repress myoD expression through direct binding to its promoter and may thus play a negative regulatory role in muscle differentiation. PMID:24814716

  3. Quercetin negatively regulates TLR4 signaling induced by lipopolysaccharide through Tollip expression.

    PubMed

    Byun, Eui-Baek; Yang, Mi-So; Choi, Han-Gyu; Sung, Nak-Yun; Song, Du-Sup; Sin, Sung-Jae; Byun, Eui-Hong

    2013-02-22

    Polyphenolic compounds have been regarded as one of the most promising dietary agents for the prevention and treatment of inflammation-related chronic diseases; however, the anti-inflammatory activities of flavonoids, such as quercetin, are not completely characterized, and many features remain to be elucidated. In this study, we showed the molecular basis for the downregulation of TLR4 signal transduction by quercetin. Quercetin markedly elevated the expression of the Toll-interacting protein, a negative regulator of TLR signaling. Lipopolysaccharide-induced expression of cell surface molecules (CD80, CD86, and MHC class I/II) and production of pro-inflammatory cytokines (tumor necrosis factor-α, IL-1β, IL-6, and IL-12p70) were inhibited by quercetin, and this action was prevented by Toll-interacting protein silencing. In addition, quercetin-treated macrophages inhibited lipopolysaccharide-induced activation of mitogen-activated protein kinases, such as extracellular signal-regulated kinase 1/2, p38, and c-Jun N-terminal kinase, and the translocation of nuclear factor-κB and p65 through Toll-interacting protein. Treatment with quercetin resulted in a significant decrease in prostaglandin E2 and cyclooxygenase-2 levels as well as inducible nitric oxide synthase-mediated nitric oxide production induced by lipopolysaccharide. Taken together, these findings represent new insights into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and effective therapeutic intervention for the treatment of inflammatory disease. PMID:23353651

  4. AtMYB93 is a novel negative regulator of lateral root development in Arabidopsis

    PubMed Central

    Gibbs, Daniel J; Voß, Ute; Harding, Susan A; Fannon, Jessica; Moody, Laura A; Yamada, Erika; Swarup, Kamal; Nibau, Candida; Bassel, George W; Choudhary, Anushree; Lavenus, Julien; Bradshaw, Susan J; Stekel, Dov J; Bennett, Malcolm J; Coates, Juliet C

    2014-01-01

    Plant root system plasticity is critical for survival in changing environmental conditions. One important aspect of root architecture is lateral root development, a complex process regulated by hormone, environmental and protein signalling pathways. Here we show, using molecular genetic approaches, that the MYB transcription factor AtMYB93 is a novel negative regulator of lateral root development in Arabidopsis. We identify AtMYB93 as an interaction partner of the lateral-root-promoting ARABIDILLO proteins. Atmyb93 mutants have faster lateral root developmental progression and enhanced lateral root densities, while AtMYB93-overexpressing lines display the opposite phenotype. AtMYB93 is expressed strongly, specifically and transiently in the endodermal cells overlying early lateral root primordia and is additionally induced by auxin in the basal meristem of the primary root. Furthermore, Atmyb93 mutant lateral root development is insensitive to auxin, indicating that AtMYB93 is required for normal auxin responses during lateral root development. We propose that AtMYB93 is part of a novel auxin-induced negative feedback loop stimulated in a select few endodermal cells early during lateral root development, ensuring that lateral roots only develop when absolutely required. Putative AtMYB93 homologues are detected throughout flowering plants and represent promising targets for manipulating root systems in diverse crop species. PMID:24902892

  5. Zac1 functions through TGFβII to negatively regulate cell number in the developing retina

    PubMed Central

    Ma, Lin; Cantrup, Robert; Varrault, Annie; Colak, Dilek; Klenin, Natalia; Götz, Magdalena; McFarlane, Sarah; Journot, Laurent; Schuurmans, Carol

    2007-01-01

    Background Organs are programmed to acquire a particular size during development, but the regulatory mechanisms that dictate when dividing progenitor cells should permanently exit the cell cycle and stop producing additional daughter cells are poorly understood. In differentiated tissues, tumor suppressor genes maintain a constant cell number and intact tissue architecture by controlling proliferation, apoptosis and cell dispersal. Here we report a similar role for two tumor suppressor genes, the Zac1 zinc finger transcription factor and that encoding the cytokine TGFβII, in the developing retina. Results Using loss and gain-of-function approaches, we show that Zac1 is an essential negative regulator of retinal size. Zac1 mutants develop hypercellular retinae due to increased progenitor cell proliferation and reduced apoptosis at late developmental stages. Consequently, supernumerary rod photoreceptors and amacrine cells are generated, the latter of which form an ectopic cellular layer, while other retinal cells are present in their normal number and location. Strikingly, Zac1 functions as a direct negative regulator of a rod fate, while acting cell non-autonomously to modulate amacrine cell number. We implicate TGFβII, another tumor suppressor and cytokine, as a Zac1-dependent amacrine cell negative feedback signal. TGFβII and phospho-Smad2/3, its downstream effector, are expressed at reduced levels in Zac1 mutant retinae, and exogenous TGFβII relieves the mutant amacrine cell phenotype. Moreover, treatment of wild-type retinae with a soluble TGFβ inhibitor and TGFβ receptor II (TGFβRII) conditional mutants generate excess amacrine cells, phenocopying the Zac1 mutant phenotype. Conclusion We show here that Zac1 has an essential role in cell number control during retinal development, akin to its role in tumor surveillance in mature tissues. Furthermore, we demonstrate that Zac1 employs a novel cell non-autonomous strategy to regulate amacrine cell number

  6. The Human Ventromedial Frontal Lobe Is Critical for Learning from Negative Feedback

    ERIC Educational Resources Information Center

    Wheeler, Elizabeth Z.; Fellows, Lesley K.

    2008-01-01

    Are positive and negative feedback weighed in a common balance in the brain, or do they influence behaviour through distinct neural mechanisms? Recent neuroeconomic studies in both human and non-human primates indicate that the ventromedial frontal lobe carries information about both losses and gains, suggesting that this region may encode value…

  7. Determining the Presence of Superantigens in Coagulase Negative Staphylococci from Humans.

    PubMed

    Stach, Christopher S; Vu, Bao G; Schlievert, Patrick M

    2015-01-01

    Superantigens (SAgs) are important virulence factors in S. aureus. Recent studies identified their presence in animal coagulase-negative staphylococci (CNS). The emergence of human-associated SAg+ CNS would mark a prodigious shift in virulence capabilities. We examined CNS isolates from healthy human nares and diseased individuals, and determined that no known SAgs were present. PMID:26599862

  8. Ligand binding to WW tandem domains of YAP2 transcriptional regulator is under negative cooperativity.

    PubMed

    Schuchardt, Brett J; Mikles, David C; Hoang, Lawrence M; Bhat, Vikas; McDonald, Caleb B; Sudol, Marius; Farooq, Amjad

    2014-12-01

    YES-associated protein 2 (YAP2) transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of the WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. PMID:25283809

  9. Ligand Binding to WW Tandem Domains of YAP2 Transcriptional Regulator Is Under Negative Cooperativity

    PubMed Central

    Schuchardt, Brett J.; Mikles, David C.; Hoang, Lawrence M.; Bhat, Vikas; McDonald, Caleb B.; Sudol, Marius; Farooq, Amjad

    2014-01-01

    YAP2 transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well-documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. PMID:25283809

  10. Coronavirus papain-like proteases negatively regulate antiviral innate immune response through disruption of STING-mediated signaling.

    PubMed

    Sun, Li; Xing, Yaling; Chen, Xiaojuan; Zheng, Yang; Yang, Yudong; Nichols, Daniel B; Clementz, Mark A; Banach, Bridget S; Li, Kui; Baker, Susan C; Chen, Zhongbin

    2012-01-01

    Viruses have evolved elaborate mechanisms to evade or inactivate the complex system of sensors and signaling molecules that make up the host innate immune response. Here we show that human coronavirus (HCoV) NL63 and severe acute respiratory syndrome (SARS) CoV papain-like proteases (PLP) antagonize innate immune signaling mediated by STING (stimulator of interferon genes, also known as MITA/ERIS/MYPS). STING resides in the endoplasmic reticulum and upon activation, forms dimers which assemble with MAVS, TBK-1 and IKKε, leading to IRF-3 activation and subsequent induction of interferon (IFN). We found that expression of the membrane anchored PLP domain from human HCoV-NL63 (PLP2-TM) or SARS-CoV (PLpro-TM) inhibits STING-mediated activation of IRF-3 nuclear translocation and induction of IRF-3 dependent promoters. Both catalytically active and inactive forms of CoV PLPs co-immunoprecipitated with STING, and viral replicase proteins co-localize with STING in HCoV-NL63-infected cells. Ectopic expression of catalytically active PLP2-TM blocks STING dimer formation and negatively regulates assembly of STING-MAVS-TBK1/IKKε complexes required for activation of IRF-3. STING dimerization was also substantially reduced in cells infected with SARS-CoV. Furthermore, the level of ubiquitinated forms of STING, RIG-I, TBK1 and IRF-3 are reduced in cells expressing wild type or catalytic mutants of PLP2-TM, likely contributing to disruption of signaling required for IFN induction. These results describe a new mechanism used by CoVs in which CoV PLPs negatively regulate antiviral defenses by disrupting the STING-mediated IFN induction. PMID:22312431

  11. Sarco(endo)plasmic reticulum ATPase is a molecular partner of Wolfram syndrome 1 protein, which negatively regulates its expression.

    PubMed

    Zatyka, Malgorzata; Da Silva Xavier, Gabriela; Bellomo, Elisa A; Leadbeater, Wendy; Astuti, Dewi; Smith, Joel; Michelangeli, Frank; Rutter, Guy A; Barrett, Timothy G

    2015-02-01

    Wolfram syndrome is an autosomal recessive disorder characterized by neurodegeneration and diabetes mellitus. The gene responsible for the syndrome (WFS1) encodes an endoplasmic reticulum (ER)-resident transmembrane protein that is involved in the regulation of the unfolded protein response (UPR), intracellular ion homeostasis, cyclic adenosine monophosphate production and regulation of insulin biosynthesis and secretion. In this study, single cell Ca(2+) imaging with fura-2 and direct measurements of free cytosolic ATP concentration ([ATP]CYT) with adenovirally expressed luciferase confirmed a reduced and delayed rise in cytosolic free Ca(2+) concentration ([Ca(2+)]CYT), and additionally, diminished [ATP]CYT rises in response to elevated glucose concentrations in WFS1-depleted MIN6 cells. We also observed that sarco(endo)plasmic reticulum ATPase (SERCA) expression was elevated in several WFS1-depleted cell models and primary islets. We demonstrated a novel interaction between WFS1 and SERCA by co-immunoprecipitation in Cos7 cells and with endogenous proteins in human neuroblastoma cells. This interaction was reduced when cells were treated with the ER stress inducer dithiothreitol. Treatment of WFS1-depleted neuroblastoma cells with the proteasome inhibitor MG132 resulted in reduced accumulation of SERCA levels compared with wild-type cells. Together these results reveal a role for WFS1 in the negative regulation of SERCA and provide further insights into the function of WFS1 in calcium homeostasis. PMID:25274773

  12. Nitric oxide negatively regulates abscisic acid signaling in guard cells by S-nitrosylation of OST1

    PubMed Central

    Wang, Pengcheng; Du, Yanyan; Hou, Yueh-Ju; Zhao, Yang; Hsu, Chuan-Chih; Yuan, Feijuan; Zhu, Xiaohong; Tao, W. Andy; Song, Chun-Peng; Zhu, Jian-Kang

    2015-01-01

    The phytohormone abscisic acid (ABA) plays important roles in plant development and adaptation to environmental stress. ABA induces the production of nitric oxide (NO) in guard cells, but how NO regulates ABA signaling is not understood. Here, we show that NO negatively regulates ABA signaling in guard cells by inhibiting open stomata 1 (OST1)/sucrose nonfermenting 1 (SNF1)-related protein kinase 2.6 (SnRK2.6) through S-nitrosylation. We found that SnRK2.6 is S-nitrosylated at cysteine 137, a residue adjacent to the kinase catalytic site. Dysfunction in the S-nitrosoglutathione (GSNO) reductase (GSNOR) gene in the gsnor1-3 mutant causes NO overaccumulation in guard cells, constitutive S-nitrosylation of SnRK2.6, and impairment of ABA-induced stomatal closure. Introduction of the Cys137 to Ser mutated SnRK2.6 into the gsnor1-3/ost1-3 double-mutant partially suppressed the effect of gsnor1-3 on ABA-induced stomatal closure. A cysteine residue corresponding to Cys137 of SnRK2.6 is present in several yeast and human protein kinases and can be S-nitrosylated, suggesting that the S-nitrosylation may be an evolutionarily conserved mechanism for protein kinase regulation. PMID:25550508

  13. Negative regulation of multifunctional Ca2+/calmodulin-dependent protein kinases: physiological and pharmacological significance of protein phosphatases

    PubMed Central

    Ishida, A; Sueyoshi, N; Shigeri, Y; Kameshita, I

    2008-01-01

    Multifunctional Ca2+/calmodulin-dependent protein kinases (CaMKs) play pivotal roles in intracellular Ca2+ signaling pathways. There is growing evidence that CaMKs are involved in the pathogenic mechanisms underlying various human diseases. In this review, we begin by briefly summarizing our knowledge of the involvement of CaMKs in the pathogenesis of various diseases suggested to be caused by the dysfunction/dysregulation or aberrant expression of CaMKs. It is widely known that the activities of CaMKs are strictly regulated by protein phosphorylation/dephosphorylation of specific phosphorylation sites. Since phosphorylation status is balanced by protein kinases and protein phosphatases, the mechanism of dephosphorylation/deactivation of CaMKs, corresponding to their ‘switching off', is extremely important, as is the mechanism of phosphorylation/activation corresponding to their ‘switching on'. Therefore, we focus on the regulation of multifunctional CaMKs by protein phosphatases. We summarize the current understanding of negative regulation of CaMKs by protein phosphatases. We also discuss the biochemical properties and physiological significance of a protein phosphatase that we designated as Ca2+/calmodulin-dependent protein kinase phosphatase (CaMKP), and those of its homologue CaMKP-N. Pharmacological applications of CaMKP inhibitors are also discussed. These compounds may be useful not only for exploring the physiological functions of CaMKP/CaMKP-N, but also as novel chemotherapies for various diseases. PMID:18454172

  14. Basal core promoters control the equilibrium between negative cofactor 2 and preinitiation complexes in human cells

    PubMed Central

    2010-01-01

    Background The general transcription factor TFIIB and its antagonist negative cofactor 2 (NC2) are hallmarks of RNA polymerase II (RNAPII) transcription. Both factors bind TATA box-binding protein (TBP) at promoters in a mutually exclusive manner. Dissociation of NC2 is thought to be followed by TFIIB association and subsequent preinitiation complex formation. TFIIB dissociates upon RNAPII promoter clearance, thereby providing a specific measure for steady-state preinitiation complex levels. As yet, genome-scale promoter mapping of human TFIIB has not been reported. It thus remains elusive how human core promoters contribute to preinitiation complex formation in vivo. Results We compare target genes of TFIIB and NC2 in human B cells and analyze associated core promoter architectures. TFIIB occupancy is positively correlated with gene expression, with the vast majority of promoters being GC-rich and lacking defined core promoter elements. TATA elements, but not the previously in vitro defined TFIIB recognition elements, are enriched in some 4 to 5% of the genes. NC2 binds to a highly related target gene set. Nonetheless, subpopulations show strong variations in factor ratios: whereas high TFIIB/NC2 ratios select for promoters with focused start sites and conserved core elements, high NC2/TFIIB ratios correlate to multiple start-site promoters lacking defined core elements. Conclusions TFIIB and NC2 are global players that occupy active genes. Preinitiation complex formation is independent of core elements at the majority of genes. TATA and TATA-like elements dictate TFIIB occupancy at a subset of genes. Biochemical data support a model in which preinitiation complex but not TBP-NC2 complex formation is regulated. PMID:20230619

  15. Negative regulation of TGFβ-induced lens epithelial to mesenchymal transition (EMT) by RTK antagonists.

    PubMed

    Zhao, Guannan; Wojciechowski, Magdalena C; Jee, Seonah; Boros, Jessica; McAvoy, John W; Lovicu, Frank J

    2015-03-01

    An eclectic range of ocular growth factors with differing actions are present within the aqueous and vitreous humors that bathe the lens. Growth factors that exert their actions via receptor tyrosine kinases (RTKs), such as FGF, play a normal regulatory role in lens; whereas other factors, such as TGFβ, can lead to an epithelial to mesenchymal transition (EMT) that underlies several forms of cataract. The respective downstream intracellular signaling pathways of these factors are in turn tightly regulated. One level of negative regulation is thought to be through RTK-antagonists, namely, Sprouty (Spry), Sef and Spred that are all expressed in the lens. In this study, we tested these different negative regulators and compared their ability to block TGFβ-induced EMT in rat lens epithelial cells. Spred expression within the rodent eye was confirmed using RT-PCR, western blotting and immunofluorescence. Rat lens epithelial explants were used to examine the morphological changes associated with TGFβ-induced EMT over 3 days of culture, as well as α-smooth muscle actin (α-sma) immunolabeling. Cells in lens epithelial explants were transfected with either a reporter (EGFP) vector (pLXSG), or with plasmids also coding for different RTK-antagonists (i.e. pLSXG-Spry1, pLSXG-Spry2, pLXSG-Sef, pLSXG-Spred1, pLSXG-Spred2, pLSXG-Spred3), before treating with TGFβ for up to 3 days. The percentages of transfected cells that underwent TGFβ-induced morphological changes consistent with an EMT were determined using cell counts and validated with a paired two-tailed t-test. Explants transfected with pLXSG demonstrated a distinct transition in cell morphology after TGFβ treatment, with ∼60% of the cells undergoing fibrotic-like cell elongation. This percentage was significantly reduced in cells overexpressing the different antagonists, indicative of a block in lens EMT. Of the antagonists tested under these in vitro conditions, Spred1 was the most potent demonstrating the

  16. Procyanidin dimer B2-mediated IRAK-M induction negatively regulates TLR4 signaling in macrophages

    SciTech Connect

    Sung, Nak-Yun; Yang, Mi-So; Song, Du-Sub; Kim, Jae-Kyung; Park, Jong-Heum; Song, Beom-Seok; Park, Sang-Hyun; Lee, Ju-Woon; Park, Hyun-Jin; Kim, Jae-Hun; Byun, Eui-Baek; Byun, Eui-Hong

    2013-08-16

    Highlights: •Pro B2 elevated the expression of IRAK-M, a negative regulator of TLR signaling. •LPS-induced expression of cell surface molecules was inhibited by Pro B2. •LPS-induced production of pro-inflammatory cytokines was inhibited by Pro B2. •Pro B2 inhibited LPS-induced activation of MAPKs and NF-κB through IRAK-M. •Pro B2 inactivated naïve T cells by inhibiting LPS-induced cytokines via IRAK-M. -- Abstract: Polyphenolic compounds have been found to possess a wide range of physiological activities that may contribute to their beneficial effects against inflammation-related diseases; however, the molecular mechanisms underlying this anti-inflammatory activity are not completely characterized, and many features remain to be elucidated. In this study, we investigated the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by procyanidin dimer B2 (Pro B2) in macrophages. Pro B2 markedly elevated the expression of the interleukin (IL)-1 receptor-associated kinase (IRAK)-M protein, a negative regulator of TLR signaling. Lipopolysaccharide (LPS)-induced expression of cell surface molecules (CD80, CD86, and MHC class I/II) and production of pro-inflammatory cytokines (tumor necrosis factor-α, IL-1β, IL-6, and IL-12p70) were inhibited by Pro B2, and this action was prevented by IRAK-M silencing. In addition, Pro B2-treated macrophages inhibited LPS-induced activation of mitogen-activated protein kinases such as extracellular signal-regulated kinase 1/2, p38, and c-Jun N-terminal kinase and the translocation of nuclear factor κB and p65 through IRAK-M. We also found that Pro B2-treated macrophages inactivated naïve T cells by inhibiting LPS-induced interferon-γ and IL-2 secretion through IRAK-M. These novel findings provide new insights into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and the immune-pharmacological role of Pro B2 in the immune response against the development

  17. Forskolin-inducible cAMP Pathway Negatively Regulates T-cell Proliferation by Uncoupling the Interleukin-2 Receptor Complex*

    PubMed Central

    Rodriguez, Georgialina; Ross, Jeremy A.; Nagy, Zsuzsanna S.; Kirken, Robert A.

    2013-01-01

    Cytokine-mediated regulation of T-cell activity involves a complex interplay between key signal transduction pathways. Determining how these signaling pathways cross-talk is essential to understanding T-cell function and dysfunction. In this work, we provide evidence that cross-talk exists between at least two signaling pathways: the Jak3/Stat5 and cAMP-mediated cascades. The adenylate cyclase activator forskolin (Fsk) significantly increased intracellular cAMP levels and reduced proliferation of the human T-cells via inhibition of cell cycle regulatory genes but did not induce apoptosis. To determine this inhibitory mechanism, effects of Fsk on IL-2 signaling was investigated. Fsk treatment of MT-2 and Kit 225 T-cells inhibited IL-2-induced Stat5a/b tyrosine and serine phosphorylation, nuclear translocation, and DNA binding activity. Fsk treatment also uncoupled IL-2 induced association of the IL-2Rβ and γc chain, consequently blocking Jak3 activation. Interestingly, phosphoamino acid analysis revealed that Fsk-treated cells resulted in elevated serine phosphorylation of Jak3 but not Stat5, suggesting that Fsk can negatively regulate Jak3 activity possibly mediated through PKA. Indeed, in vitro kinase assays and small molecule inhibition studies indicated that PKA can directly serine phosphorylate and functionally inactivate Jak3. Taken together, these findings suggest that Fsk activation of adenylate cyclase and PKA can negatively regulate IL-2 signaling at multiple levels that include IL-2R complex formation and Jak3/Stat5 activation. PMID:23341462

  18. Peroxiredoxin II Is an Antioxidant Enzyme That Negatively Regulates Collagen-stimulated Platelet Function*

    PubMed Central

    Jang, Ji Yong; Wang, Su Bin; Min, Ji Hyun; Chae, Yun Hee; Baek, Jin Young; Yu, Dae-Yeul; Chang, Tong-Shin

    2015-01-01

    Collagen-induced platelet signaling is mediated by binding to the primary receptor glycoprotein VI (GPVI). Reactive oxygen species produced in response to collagen have been found to be responsible for the propagation of GPVI signaling pathways in platelets. Therefore, it has been suggested that antioxidant enzymes could down-regulate GPVI-stimulated platelet activation. Although the antioxidant enzyme peroxiredoxin II (PrxII) has emerged as having a role in negatively regulating signaling through various receptors by eliminating H2O2 generated upon receptor stimulation, the function of PrxII in collagen-stimulated platelets is not known. We tested the hypothesis that PrxII negatively regulates collagen-stimulated platelet activation. We analyzed PrxII-deficient murine platelets. PrxII deficiency enhanced GPVI-mediated platelet activation through the defective elimination of H2O2 and the impaired protection of SH2 domain-containing tyrosine phosphatase 2 (SHP-2) against oxidative inactivation, which resulted in increased tyrosine phosphorylation of key components for the GPVI signaling cascade, including Syk, Btk, and phospholipase Cγ2. Interestingly, PrxII-mediated antioxidative protection of SHP-2 appeared to occur in the lipid rafts. PrxII-deficient platelets exhibited increased adhesion and aggregation upon collagen stimulation. Furthermore, in vivo experiments demonstrated that PrxII deficiency facilitated platelet-dependent thrombus formation in injured carotid arteries. This study reveals that PrxII functions as a protective antioxidant enzyme against collagen-stimulated platelet activation and platelet-dependent thrombosis. PMID:25802339

  19. EWI-2 negatively regulates TGF-β signaling leading to altered melanoma growth and metastasis

    PubMed Central

    Wang, Hong-Xing; Sharma, Chandan; Knoblich, Konstantin; Granter, Scott R; Hemler, Martin E

    2015-01-01

    In normal melanocytes, TGF-β signaling has a cytostatic effect. However, in primary melanoma cells, TGF-β-induced cytostasis is diminished, thus allowing melanoma growth. Later, a second phase of TGF-β signaling supports melanoma EMT-like changes, invasion and metastasis. In parallel with these “present-absent-present” TGF-β signaling phases, cell surface protein EWI motif-containing protein 2 (EWI-2 or IgSF8) is “absent-present-absent” in melanocytes, primary melanoma, and metastatic melanoma, respectively, suggesting that EWI-2 may serve as a negative regulator of TGF-β signaling. Using melanoma cell lines and melanoma short-term cultures, we performed RNAi and overexpression experiments and found that EWI-2 negatively regulates TGF-β signaling and its downstream events including cytostasis (in vitro and in vivo), EMT-like changes, cell migration, CD271-dependent invasion, and lung metastasis (in vivo). When EWI-2 is present, it associates with cell surface tetraspanin proteins CD9 and CD81 — molecules not previously linked to TGF-β signaling. Indeed, when associated with EWI-2, CD9 and CD81 are sequestered and have no impact on TβR2-TβR1 association or TGF-β signaling. However, when EWI-2 is knocked down, CD9 and CD81 become available to provide critical support for TβR2-TβR1 association, thus markedly elevating TGF-β signaling. Consequently, all of those TGF-β-dependent functions specifically arising due to EWI-2 depletion are reversed by blocking or depleting cell surface tetraspanin proteins CD9 or CD81. These results provide new insights into regulation of TGF-β signaling in melanoma, uncover new roles for tetraspanins CD9 and CD81, and strongly suggest that EWI-2 could serve as a favorable prognosis indicator for melanoma patients. PMID:25656846

  20. A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus

    USGS Publications Warehouse

    Leisy, D.J.; Rasmussen, C.; Owusu, E.O.; Rohrmann, G.F.

    1997-01-01

    The Autographa californica multinucleocapsid nuclear polyhedrosis virus (AcMNPV) ie-1 gene product (IE-1) is thought to play a central role in stimulating early viral transcription. IE-1 has been demonstrated to activate several early viral gene promoters and to negatively regulate the promoters of two other AcMNPV regulatory genes, ie-0 and ie-2. Our results indicate that IE-1 negatively regulates the expression of certain genes by binding directly, or as part of a complex, to promoter regions containing a specific IE-1-binding motif (5'-ACBYGTAA-3') near their mRNA start sites. The IE-1 binding motif was also found within the palindromic sequences of AcMNPV homologous repeat (hr) regions that have been shown to bind IE-1. The role of this IE-1 binding motif in the regulation of the ie-2 and pe-38 promoters was examined by introducing mutations in these promoters in which the central 6 bp were replaced with Bg/II sites. GUS reporter constructs containing ie-2 and pe-38 promoter fragments with and without these specific mutations were cotransfected into Sf9 cells with various amounts of an ie-1-containing plasmid (ple-1). Comparisons of GUS expression produced by the mutant and wild-type constructs demonstrated that the IE-1 binding motif mediated a significant decrease in expression from the ie-2 and pe-38 promoters in response to increasing pIe-1 concentrations. Electrophoretic mobility shift assays with pIe-1-transfected cell extracts and supershift assays with IE-1- specific antiserum demonstrated that IE-1 binds to promoter fragments containing the IE-1 binding motif but does not bind to promoter fragments lacking this motif.

  1. Checkpoint Kinase 2 Negatively Regulates Androgen Sensitivity and Prostate Cancer Cell Growth.

    PubMed

    Ta, Huy Q; Ivey, Melissa L; Frierson, Henry F; Conaway, Mark R; Dziegielewski, Jaroslaw; Larner, James M; Gioeli, Daniel

    2015-12-01

    Prostate cancer is the second leading cause of cancer death in American men, and curing metastatic disease remains a significant challenge. Nearly all patients with disseminated prostate cancer initially respond to androgen deprivation therapy (ADT), but virtually all patients will relapse and develop incurable castration-resistant prostate cancer (CRPC). A high-throughput RNAi screen to identify signaling pathways regulating prostate cancer cell growth led to our discovery that checkpoint kinase 2 (CHK2) knockdown dramatically increased prostate cancer growth and hypersensitized cells to low androgen levels. Mechanistic investigations revealed that the effects of CHK2 were dependent on the downstream signaling proteins CDC25C and CDK1. Moreover, CHK2 depletion increased androgen receptor (AR) transcriptional activity on androgen-regulated genes, substantiating the finding that CHK2 affects prostate cancer proliferation, partly, through the AR. Remarkably, we further show that CHK2 is a novel AR-repressed gene, suggestive of a negative feedback loop between CHK2 and AR. In addition, we provide evidence that CHK2 physically associates with the AR and that cell-cycle inhibition increased this association. Finally, IHC analysis of CHK2 in prostate cancer patient samples demonstrated a decrease in CHK2 expression in high-grade tumors. In conclusion, we propose that CHK2 is a negative regulator of androgen sensitivity and prostate cancer growth, and that CHK2 signaling is lost during prostate cancer progression to castration resistance. Thus, perturbing CHK2 signaling may offer a new therapeutic approach for sensitizing CRPC to ADT and radiation. PMID:26573794

  2. Procyanidin dimer B2-mediated IRAK-M induction negatively regulates TLR4 signaling in macrophages.

    PubMed

    Sung, Nak-Yun; Yang, Mi-So; Song, Du-Sub; Kim, Jae-Kyung; Park, Jong-Heum; Song, Beom-Seok; Park, Sang-Hyun; Lee, Ju-Woon; Park, Hyun-Jin; Kim, Jae-Hun; Byun, Eui-Baek; Byun, Eui-Hong

    2013-08-16

    Polyphenolic compounds have been found to possess a wide range of physiological activities that may contribute to their beneficial effects against inflammation-related diseases; however, the molecular mechanisms underlying this anti-inflammatory activity are not completely characterized, and many features remain to be elucidated. In this study, we investigated the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by procyanidin dimer B2 (Pro B2) in macrophages. Pro B2 markedly elevated the expression of the interleukin (IL)-1 receptor-associated kinase (IRAK)-M protein, a negative regulator of TLR signaling. Lipopolysaccharide (LPS)-induced expression of cell surface molecules (CD80, CD86, and MHC class I/II) and production of pro-inflammatory cytokines (tumor necrosis factor-α, IL-1β, IL-6, and IL-12p70) were inhibited by Pro B2, and this action was prevented by IRAK-M silencing. In addition, Pro B2-treated macrophages inhibited LPS-induced activation of mitogen-activated protein kinases such as extracellular signal-regulated kinase 1/2, p38, and c-Jun N-terminal kinase and the translocation of nuclear factor κB and p65 through IRAK-M. We also found that Pro B2-treated macrophages inactivated naïve T cells by inhibiting LPS-induced interferon-γ and IL-2 secretion through IRAK-M. These novel findings provide new insights into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and the immune-pharmacological role of Pro B2 in the immune response against the development and progression of many chronic diseases. PMID:23872113

  3. Plexin-B2 negatively regulates macrophage motility, Rac, and Cdc42 activation.

    PubMed

    Roney, Kelly E; O'Connor, Brian P; Wen, Haitao; Holl, Eda K; Guthrie, Elizabeth H; Davis, Beckley K; Jones, Stephen W; Jha, Sushmita; Sharek, Lisa; Garcia-Mata, Rafael; Bear, James E; Ting, Jenny P-Y

    2011-01-01

    Plexins are cell surface receptors widely studied in the nervous system, where they mediate migration and morphogenesis though the Rho family of small GTPases. More recently, plexins have been implicated in immune processes including cell-cell interaction, immune activation, migration, and cytokine production. Plexin-B2 facilitates ligand induced cell guidance and migration in the nervous system, and induces cytoskeletal changes in overexpression assays through RhoGTPase. The function of Plexin-B2 in the immune system is unknown. This report shows that Plexin-B2 is highly expressed on cells of the innate immune system in the mouse, including macrophages, conventional dendritic cells, and plasmacytoid dendritic cells. However, Plexin-B2 does not appear to regulate the production of proinflammatory cytokines, phagocytosis of a variety of targets, or directional migration towards chemoattractants or extracellular matrix in mouse macrophages. Instead, Plxnb2(-/-) macrophages have greater cellular motility than wild type in the unstimulated state that is accompanied by more active, GTP-bound Rac and Cdc42. Additionally, Plxnb2(-/-) macrophages demonstrate faster in vitro wound closure activity. Studies have shown that a closely related family member, Plexin-B1, binds to active Rac and sequesters it from downstream signaling. The interaction of Plexin-B2 with Rac has only been previously confirmed in yeast and bacterial overexpression assays. The data presented here show that Plexin-B2 functions in mouse macrophages as a negative regulator of the GTPases Rac and Cdc42 and as a negative regulator of basal cell motility and wound healing. PMID:21966369

  4. P. brasiliensis Virulence Is Affected by SconC, the Negative Regulator of Inorganic Sulfur Assimilation

    PubMed Central

    Menino, João Filipe; Saraiva, Margarida; Gomes-Rezende, Jéssica; Sturme, Mark; Pedrosa, Jorge; Castro, António Gil; Ludovico, Paula; Goldman, Gustavo H.; Rodrigues, Fernando

    2013-01-01

    Conidia/mycelium-to-yeast transition of Paracoccidioidesbrasiliensis is a critical step for the establishment of paracoccidioidomycosis, a systemic mycosis endemic in Latin America. Thus, knowledge of the factors that mediate this transition is of major importance for the design of intervention strategies. So far, the only known pre-requisites for the accomplishment of the morphological transition are the temperature shift to 37°C and the availability of organic sulfur compounds. In this study, we investigated the auxotrophic nature to organic sulfur of the yeast phase of Paracoccidioides, with special attention to P. brasiliensis species. For this, we addressed the role of SconCp, the negative regulator of the inorganic sulfur assimilation pathway, in the dimorphism and virulence of this pathogen. We show that down-regulation of SCONC allows initial steps of mycelium-to-yeast transition in the absence of organic sulfur compounds, contrarily to the wild-type fungus that cannot undergo mycelium-to-yeast transition under such conditions. However, SCONC down-regulated transformants were unable to sustain yeast growth using inorganic sulfur compounds only. Moreover, pulses with inorganic sulfur in SCONC down-regulated transformants triggered an increase of the inorganic sulfur metabolism, which culminated in a drastic reduction of the ATP and NADPH cellular levels and in higher oxidative stress. Importantly, the down-regulation of SCONC resulted in a decreased virulence of P. brasiliensis, as validated in an in vivo model of infection. Overall, our findings shed light on the inability of P. brasiliensis yeast to rely on inorganic sulfur compounds, correlating its metabolism with cellular energy and redox imbalances. Furthermore, the data herein presented reveal SconCp as a novel virulence determinant of P. brasiliensis. PMID:24066151

  5. Grouper TRIM13 exerts negative regulation of antiviral immune response against nodavirus.

    PubMed

    Huang, Youhua; Yang, Min; Yu, Yepin; Yang, Ying; Zhou, Linli; Huang, Xiaohong; Qin, Qiwei

    2016-08-01

    The tripartite motif (TRIM)-containing proteins have attracted particular attention to their multiple functions in different biological processes. TRIM13, a member of the TRIM family, is a RING domain-containing E3 ubiquitin ligase which plays critical roles in diverse cellular processes including cell death, cancer and antiviral immunity. In this study, a TRIM13 homolog from orange spotted grouper, Epinephelus coioides (EcTRIM13) was cloned and characterized. The full-length of EcTRIM13 cDNA encoded a polypeptide of 399 amino acids which shared 81% identity with TRIM13 homolog from large yellow croaker (Larimichthys crocea). Amino acid alignment analysis showed that EcTRIM13 contained conserved RING finger and B-box domain. Expression patterns analysis indicated that EcTRIM13 was abundant in liver, spleen, kidney, intestine and gill. Moreover, the transcript of EcTRIM13 in grouper spleen was differently regulated after injection with Singapore grouper iridovirus (SGIV) or polyinosin-polycytidylic acid (poly I:C). Under fluorescence microscopy, we observed the tubular structure in wild type EcTRIM13 transfected cells, but the RING domain mutant resulted in the fluorescence distribution was changed and the bright punctate fluorescence was evenly situated throughout the cytoplasm, suggesting that the RING domain was essential for its accurate localization. Overexpression of EcTRIM13 in vitro obviously increased the replication of red spotted grouper nervous necrosis virus (RGNNV), and the enhancing effect of EcTRIM13 on virus replication was affected by the RING domain. Furthermore, the ectopic expression of EcTRIM13 not only negatively regulated the interferon promoter activity induced by interferon regulator factor (IRF) 3, IRF7, and melanoma differentiation-associated protein 5 (MDA5), but also decreased the expression of several interferon related factors. In addition, the overexpression of EcTRIM13 also differently regulated the transcription of pro

  6. KIF14 negatively regulates Rap1a-Radil signaling during breast cancer progression.

    PubMed

    Ahmed, Syed M; Thériault, Brigitte L; Uppalapati, Maruti; Chiu, Catherine W N; Gallie, Brenda L; Sidhu, Sachdev S; Angers, Stéphane

    2012-12-10

    The small GTPase Rap1 regulates inside-out integrin activation and thereby influences cell adhesion, migration, and polarity. Several Rap1 effectors have been described to mediate the cellular effects of Rap1 in a context-dependent manner. Radil is emerging as an important Rap effector implicated in cell spreading and migration, but the molecular mechanisms underlying its functions are unclear. We report here that the kinesin KIF14 associates with the PDZ domain of Radil and negatively regulates Rap1-mediated inside-out integrin activation by tethering Radil on microtubules. The depletion of KIF14 led to increased cell spreading, altered focal adhesion dynamics, and inhibition of cell migration and invasion. We also show that Radil is important for breast cancer cell proliferation and for metastasis in mice. Our findings provide evidence that the concurrent up-regulation of Rap1 activity and increased KIF14 levels in several cancers is needed to reach optimal levels of Rap1-Radil signaling, integrin activation, and cell-matrix adhesiveness required for tumor progression. PMID:23209302

  7. Phosphorylation acts positively and negatively to regulate MRTF-A subcellular localisation and activity.

    PubMed

    Panayiotou, Richard; Miralles, Francesc; Pawlowski, Rafal; Diring, Jessica; Flynn, Helen R; Skehel, Mark; Treisman, Richard

    2016-01-01

    The myocardin-related transcription factors (MRTF-A and MRTF-B) regulate cytoskeletal genes through their partner transcription factor SRF. The MRTFs bind G-actin, and signal-regulated changes in cellular G-actin concentration control their nuclear accumulation. The MRTFs also undergo Rho- and ERK-dependent phosphorylation, but the function of MRTF phosphorylation, and the elements and signals involved in MRTF-A nuclear export are largely unexplored. We show that Rho-dependent MRTF-A phosphorylation reflects relief from an inhibitory function of nuclear actin. We map multiple sites of serum-induced phosphorylation, most of which are S/T-P motifs and show that S/T-P phosphorylation is required for transcriptional activation. ERK-mediated S98 phosphorylation inhibits assembly of G-actin complexes on the MRTF-A regulatory RPEL domain, promoting nuclear import. In contrast, S33 phosphorylation potentiates the activity of an autonomous Crm1-dependent N-terminal NES, which cooperates with five other NES elements to exclude MRTF-A from the nucleus. Phosphorylation thus plays positive and negative roles in the regulation of MRTF-A. PMID:27304076

  8. Effects of negative air ions on activity of neural substrates involved in autonomic regulation in rats

    NASA Astrophysics Data System (ADS)

    Suzuki, Satoko; Yanagita, Shinya; Amemiya, Seiichiro; Kato, Yumi; Kubota, Natsuko; Ryushi, Tomoo; Kita, Ichiro

    2008-07-01

    The neural mechanism by which negative air ions (NAI) mediate the regulation of autonomic nervous system activity is still unknown. We examined the effects of NAI on physiological responses, such as blood pressure (BP), heart rate (HR), and heart rate variability (HRV) as well as neuronal activity, in the paraventricular nucleus of the hypothalamus (PVN), locus coeruleus (LC), nucleus ambiguus (NA), and nucleus of the solitary tract (NTS) with c-Fos immunohistochemistry in anesthetized, spontaneously breathing rats. In addition, we performed cervical vagotomy to reveal the afferent pathway involved in mediating the effects of NAI on autonomic regulation. NAI significantly decreased BP and HR, and increased HF power of the HRV spectrum. Significant decreases in c-Fos positive nuclei in the PVN and LC, and enhancement of c-Fos expression in the NA and NTS were induced by NAI. After vagotomy, these physiological and neuronal responses to NAI were not observed. These findings suggest that NAI can modulate autonomic regulation through inhibition of neuronal activity in PVN and LC as well as activation of NA neurons, and that these effects of NAI might be mediated via the vagus nerves.

  9. An Arabidopsis SUMO E3 Ligase, SIZ1, Negatively Regulates Photomorphogenesis by Promoting COP1 Activity.

    PubMed

    Lin, Xiao-Li; Niu, De; Hu, Zi-Liang; Kim, Dae Heon; Jin, Yin Hua; Cai, Bin; Liu, Peng; Miura, Kenji; Yun, Dae-Jin; Kim, Woe-Yeon; Lin, Rongcheng; Jin, Jing Bo

    2016-04-01

    COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1), a ubiquitin E3 ligase, is a central negative regulator of photomorphogenesis. However, how COP1 activity is regulated by post-translational modifications remains largely unknown. Here we show that SUMO (small ubiquitin-like modifier) modification enhances COP1 activity. Loss-of-function siz1 mutant seedlings exhibit a weak constitutive photomorphogenic phenotype. SIZ1 physically interacts with COP1 and mediates the sumoylation of COP1. A K193R substitution in COP1 blocks its SUMO modification and reduces COP1 activity in vitro and in planta. Consistently, COP1 activity is reduced in siz1 and the level of HY5, a COP1 target protein, is increased in siz1. Sumoylated COP1 may exhibits higher transubiquitination activity than does non-sumoylated COP1, but SIZ1-mediated SUMO modification does not affect COP1 dimerization, COP1-HY5 interaction, and nuclear accumulation of COP1. Interestingly, prolonged light exposure reduces the sumoylation level of COP1, and COP1 mediates the ubiquitination and degradation of SIZ1. These regulatory mechanisms may maintain the homeostasis of COP1 activity, ensuing proper photomorphogenic development in changing light environment. Our genetic and biochemical studies identify a function for SIZ1 in photomorphogenesis and reveal a novel SUMO-regulated ubiquitin ligase, COP1, in plants. PMID:27128446

  10. An Arabidopsis SUMO E3 Ligase, SIZ1, Negatively Regulates Photomorphogenesis by Promoting COP1 Activity

    PubMed Central

    Lin, Xiao-Li; Niu, De; Hu, Zi-Liang; Kim, Dae Heon; Jin, Yin Hua; Cai, Bin; Liu, Peng; Miura, Kenji; Yun, Dae-Jin; Kim, Woe-Yeon; Lin, Rongcheng

    2016-01-01

    COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1), a ubiquitin E3 ligase, is a central negative regulator of photomorphogenesis. However, how COP1 activity is regulated by post-translational modifications remains largely unknown. Here we show that SUMO (small ubiquitin-like modifier) modification enhances COP1 activity. Loss-of-function siz1 mutant seedlings exhibit a weak constitutive photomorphogenic phenotype. SIZ1 physically interacts with COP1 and mediates the sumoylation of COP1. A K193R substitution in COP1 blocks its SUMO modification and reduces COP1 activity in vitro and in planta. Consistently, COP1 activity is reduced in siz1 and the level of HY5, a COP1 target protein, is increased in siz1. Sumoylated COP1 may exhibits higher transubiquitination activity than does non-sumoylated COP1, but SIZ1-mediated SUMO modification does not affect COP1 dimerization, COP1-HY5 interaction, and nuclear accumulation of COP1. Interestingly, prolonged light exposure reduces the sumoylation level of COP1, and COP1 mediates the ubiquitination and degradation of SIZ1. These regulatory mechanisms may maintain the homeostasis of COP1 activity, ensuing proper photomorphogenic development in changing light environment. Our genetic and biochemical studies identify a function for SIZ1 in photomorphogenesis and reveal a novel SUMO-regulated ubiquitin ligase, COP1, in plants. PMID:27128446

  11. WDR82 Negatively Regulates Cellular Antiviral Response by Mediating TRAF3 Polyubiquitination in Multiple Cell Lines.

    PubMed

    Zhu, Kun; Wang, Xiang; Ju, Lin-Gao; Zhu, Yuan; Yao, Jie; Wang, Yanyi; Wu, Min; Li, Lian-Yun

    2015-12-01

    Upon virus infection, retinoic acid-inducible gene I-like receptors in host cells recognize viral RNA and activate type I IFN expression. Previously, we identified WD repeat domain (WDR) 5 as one positive regulator for pathway activation. In this study, we report that WDR82, a homolog protein of WDR5, acts opposite to WDR5 and inhibits the activation of the retinoic acid-inducible gene I signaling pathway. WDR82 overexpression inhibits virus-triggered pathway activation, whereas its knockdown enhances induced IFN-β expression. WDR82 is localized on the mitochondria, and its first N-terminal WD40 domain is critical for localization. WDR82 interacts with TNFR-associated factor (TRAF) 3, and its overexpression promotes K48-linked, but not K63-linked, polyubiquitination on TRAF3. Furthermore, WDR82 knockdown inhibits viral replication in the cell, whereas its overexpression has the opposite effect. Interestingly, WDR82 regulates Sendai virus-induced IFNB1 expression in a cell type-specific manner. Taken together, our findings demonstrate that WDR82 is a negative regulator of virus-triggered type I IFNs pathway through mediating TRAF3 polyubiquitination status and stability on mitochondria. PMID:26519536

  12. p73: a Positive or Negative Regulator of Angiogenesis, or Both?

    PubMed

    Sabapathy, Kanaga

    2016-03-01

    The role of p73, the homologue of the tumor suppressor p53, in regulating angiogenesis has recently been extensively investigated, resulting in the publication of five articles. Of these, two studies suggested a suppressive role, while the others implied a stimulatory role for the p73 isoforms in regulating angiogenesis. A negative role for TAp73, the full-length form that is often associated with tumor suppression, in blood vessel formation, is consistent with its general attributes and was proposed to be effected indirectly through the degradation of hypoxia-inducible factor 1α (HIF1-α), the master angiogenic regulator. In contrast, a positive role for TAp73 coincides with its recently understood role in supporting cellular survival and thus tumorigenesis, consistent with TAp73 being not-mutated but rather often overexpressed in clinical contexts. In the latter case, TAp73 expression was induced by hypoxia via HIF1-α, and it appears to directly promote angiogenic target gene activation and blood vessel formation independent of HIF1-α. This mini review will provide an overview of these seemingly opposite recent findings as well as earlier data, which collectively establish the definite possibility that TAp73 is indeed capable of both promoting and inhibiting angiogenesis, depending on the cellular context. PMID:26711266

  13. Phosphorylation acts positively and negatively to regulate MRTF-A subcellular localisation and activity

    PubMed Central

    Panayiotou, Richard; Miralles, Francesc; Pawlowski, Rafal; Diring, Jessica; Flynn, Helen R; Skehel, Mark; Treisman, Richard

    2016-01-01

    The myocardin-related transcription factors (MRTF-A and MRTF-B) regulate cytoskeletal genes through their partner transcription factor SRF. The MRTFs bind G-actin, and signal-regulated changes in cellular G-actin concentration control their nuclear accumulation. The MRTFs also undergo Rho- and ERK-dependent phosphorylation, but the function of MRTF phosphorylation, and the elements and signals involved in MRTF-A nuclear export are largely unexplored. We show that Rho-dependent MRTF-A phosphorylation reflects relief from an inhibitory function of nuclear actin. We map multiple sites of serum-induced phosphorylation, most of which are S/T-P motifs and show that S/T-P phosphorylation is required for transcriptional activation. ERK-mediated S98 phosphorylation inhibits assembly of G-actin complexes on the MRTF-A regulatory RPEL domain, promoting nuclear import. In contrast, S33 phosphorylation potentiates the activity of an autonomous Crm1-dependent N-terminal NES, which cooperates with five other NES elements to exclude MRTF-A from the nucleus. Phosphorylation thus plays positive and negative roles in the regulation of MRTF-A. DOI: http://dx.doi.org/10.7554/eLife.15460.001 PMID:27304076

  14. Piwi maintains germline stem cells and oogenesis in Drosophila through negative regulation of Polycomb group proteins.

    PubMed

    Peng, Jamy C; Valouev, Anton; Liu, Na; Lin, Haifan

    2016-03-01

    The Drosophila melanogaster Piwi protein regulates both niche and intrinsic mechanisms to maintain germline stem cells, but its underlying mechanism remains unclear. Here we report that Piwi interacts with Polycomb group complexes PRC1 and PRC2 in niche and germline cells to regulate ovarian germline stem cells and oogenesis. Piwi physically interacts with the PRC2 subunits Su(z)12 and Esc in the ovary and in vitro. Chromatin coimmunoprecipitation of Piwi, the PRC2 enzymatic subunit E(z), histone H3 trimethylated at lysine 27 (H3K27me3) and RNA polymerase II in wild-type and piwi mutant ovaries demonstrates that Piwi binds a conserved DNA motif at ∼ 72 genomic sites and inhibits PRC2 binding to many non-Piwi-binding genomic targets and H3K27 trimethylation. Moreover, Piwi influences RNA polymerase II activities in Drosophila ovaries, likely via inhibiting PRC2. We hypothesize that Piwi negatively regulates PRC2 binding by sequestering PRC2 in the nucleoplasm, thus reducing PRC2 binding to many targets and influencing transcription during oogenesis. PMID:26780607

  15. p73: a Positive or Negative Regulator of Angiogenesis, or Both?

    PubMed Central

    2015-01-01

    The role of p73, the homologue of the tumor suppressor p53, in regulating angiogenesis has recently been extensively investigated, resulting in the publication of five articles. Of these, two studies suggested a suppressive role, while the others implied a stimulatory role for the p73 isoforms in regulating angiogenesis. A negative role for TAp73, the full-length form that is often associated with tumor suppression, in blood vessel formation, is consistent with its general attributes and was proposed to be effected indirectly through the degradation of hypoxia-inducible factor 1α (HIF1-α), the master angiogenic regulator. In contrast, a positive role for TAp73 coincides with its recently understood role in supporting cellular survival and thus tumorigenesis, consistent with TAp73 being not-mutated but rather often overexpressed in clinical contexts. In the latter case, TAp73 expression was induced by hypoxia via HIF1-α, and it appears to directly promote angiogenic target gene activation and blood vessel formation independent of HIF1-α. This mini review will provide an overview of these seemingly opposite recent findings as well as earlier data, which collectively establish the definite possibility that TAp73 is indeed capable of both promoting and inhibiting angiogenesis, depending on the cellular context. PMID:26711266

  16. Integrated expression analysis of muscle hypertrophy identifies Asb2 as a negative regulator of muscle mass

    PubMed Central

    Davey, Jonathan R.; Watt, Kevin I.; Parker, Benjamin L.; Chaudhuri, Rima; Ryall, James G.; Cunningham, Louise; Qian, Hongwei; Sartorelli, Vittorio; Sandri, Marco; Chamberlain, Jeffrey; James, David E.; Gregorevic, Paul

    2016-01-01

    The transforming growth factor-β (TGF-β) signaling network is a critical regulator of skeletal muscle mass and function and, thus, is an attractive therapeutic target for combating muscle disease, but the underlying mechanisms of action remain undetermined. We report that follistatin-based interventions (which modulate TGF-β network activity) can promote muscle hypertrophy that ameliorates aging-associated muscle wasting. However, the muscles of old sarcopenic mice demonstrate reduced response to follistatin compared with healthy young-adult musculature. Quantitative proteomic and transcriptomic analyses of young-adult muscles identified a transcription/translation signature elicited by follistatin exposure, which included repression of ankyrin repeat and SOCS box protein 2 (Asb2). Increasing expression of ASB2 reduced muscle mass, thereby demonstrating that Asb2 is a TGF-β network–responsive negative regulator of muscle mass. In contrast to young-adult muscles, sarcopenic muscles do not exhibit reduced ASB2 abundance with follistatin exposure. Moreover, preventing repression of ASB2 in young-adult muscles diminished follistatin-induced muscle hypertrophy. These findings provide insight into the program of transcription and translation events governing follistatin-mediated adaptation of skeletal muscle attributes and identify Asb2 as a regulator of muscle mass implicated in the potential mechanistic dysfunction between follistatin-mediated muscle growth in young and old muscles. PMID:27182554

  17. Induction of Posttranslational Modifications of Mitochondrial Proteins by ATP Contributes to Negative Regulation of Mitochondrial Function

    PubMed Central

    Zhang, Yong; Zhao, Zhiyun; Ke, Bilun; Wan, Lin; Wang, Hui; Ye, Jianping

    2016-01-01

    It is generally accepted that ATP regulates mitochondrial function through the AMPK signaling pathway. However, the AMPK-independent pathway remains largely unknown. In this study, we investigated ATP surplus in the negative regulation of mitochondrial function with a focus on pyruvate dehydrogenase (PDH) phosphorylation and protein acetylation. PDH phosphorylation was induced by a high fat diet in the liver of obese mice, which was associated with ATP elevation. In 1c1c7 hepatoma cells, the phosphorylation was induced by palmitate treatment through induction of ATP production. The phosphorylation was associated with a reduction in mitochondria oxygen consumption after 4 h treatment. The palmitate effect was blocked by etomoxir, which inhibited ATP production through suppression of fatty acid β-oxidation. The PDH phosphorylation was induced by incubation of mitochondrial lysate with ATP in vitro without altering the expression of PDH kinase 2 (PDK2) and 4 (PDK4). In addition, acetylation of multiple mitochondrial proteins was induced by ATP in the same conditions. Acetyl-CoA exhibited a similar activity to ATP in induction of the phosphorylation and acetylation. These data suggest that ATP elevation may inhibit mitochondrial function through induction of the phosphorylation and acetylation of mitochondrial proteins. The results suggest an AMPK-independent mechanism for ATP regulation of mitochondrial function. PMID:26930489

  18. KIF14 negatively regulates Rap1a–Radil signaling during breast cancer progression

    PubMed Central

    Ahmed, Syed M.; Thériault, Brigitte L.; Uppalapati, Maruti; Chiu, Catherine W.N.; Gallie, Brenda L.; Sidhu, Sachdev S.

    2012-01-01

    The small GTPase Rap1 regulates inside-out integrin activation and thereby influences cell adhesion, migration, and polarity. Several Rap1 effectors have been described to mediate the cellular effects of Rap1 in a context-dependent manner. Radil is emerging as an important Rap effector implicated in cell spreading and migration, but the molecular mechanisms underlying its functions are unclear. We report here that the kinesin KIF14 associates with the PDZ domain of Radil and negatively regulates Rap1-mediated inside-out integrin activation by tethering Radil on microtubules. The depletion of KIF14 led to increased cell spreading, altered focal adhesion dynamics, and inhibition of cell migration and invasion. We also show that Radil is important for breast cancer cell proliferation and for metastasis in mice. Our findings provide evidence that the concurrent up-regulation of Rap1 activity and increased KIF14 levels in several cancers is needed to reach optimal levels of Rap1–Radil signaling, integrin activation, and cell–matrix adhesiveness required for tumor progression. PMID:23209302

  19. Piwi maintains germline stem cells and oogenesis in Drosophila through negative regulation of Polycomb Group proteins

    PubMed Central

    Peng, Jamy C.; Valouev, Anton; Liu, Na; Lin, Haifan

    2015-01-01

    The Drosophila Piwi protein regulates both niche and intrinsic mechanisms to maintain germline stem cells, but its underlying mechanism remains unclear. Here we report that Piwi cooperates with Polycomb Group complexes PRC1 and PRC2 in niche and germline cells to regulate ovarian germline stem cells and oogenesis. Piwi physically interacts with PRC2 subunits Su(z)12 and Esc in the ovary and in vitro. Chromatin co-immunoprecipitation of Piwi, the PRC2 enzymatic subunit E(z), lysine-27-tri-methylated histone 3 (H3K27m3), and RNA polymerase II in wild-type and piwi mutant ovaries reveals that Piwi binds a conserved DNA motif at ~72 genomic sites, and inhibits PRC2 binding to many non-Piwi-binding genomic targets and H3K27 tri-methylation. Moreover, Piwi influences RNA Polymerase II activities in Drosophila ovaries likely via inhibiting PRC2. We hypothesize that Piwi negatively regulates PRC2 binding by sequestering PRC2 in the nucleoplasm, thus reducing PRC2 binding to many targets and influences transcription during oogenesis. PMID:26780607

  20. Arabidopsis type B cytokinin response regulators ARR1, ARR10, and ARR12 negatively regulate plant responses to drought.

    PubMed

    Nguyen, Kien Huu; Ha, Chien Van; Nishiyama, Rie; Watanabe, Yasuko; Leyva-González, Marco Antonio; Fujita, Yasunari; Tran, Uven Thi; Li, Weiqiang; Tanaka, Maho; Seki, Motoaki; Schaller, G Eric; Herrera-Estrella, Luis; Tran, L S

    2016-03-15

    In this study, we used a loss-of-function approach to elucidate the functions of three Arabidopsis type B response regulators (ARRs)--namely ARR1, ARR10, and ARR12--in regulating the Arabidopsis plant responses to drought. The arr1,10,12 triple mutant showed a significant increase in drought tolerance versus WT plants, as indicated by its higher relative water content and survival rate on drying soil. This enhanced drought tolerance of arr1,10,12 plants can be attributed to enhanced cell membrane integrity, increased anthocyanin biosynthesis, abscisic acid (ABA) hypersensitivity, and reduced stomatal aperture, but not to altered stomatal density. Further drought-tolerance tests of lower-order double and single mutants indicated that ARR1, ARR10, and ARR12 negatively and redundantly control plant responses to drought, with ARR1 appearing to bear the most critical function among the three proteins. In agreement with these findings, a comparative genome-wide analysis of the leaves of arr1,10,12 and WT plants under both normal and dehydration conditions suggested a cytokinin (CK) signaling-mediated network controlling plant adaptation to drought via many dehydration/drought- and/or ABA-responsive genes that can provide osmotic adjustment and protection to cellular and membrane structures. Expression of all three ARR genes was repressed by dehydration and ABA treatments, inferring that plants down-regulate these genes as an adaptive mechanism to survive drought. Collectively, our results demonstrate that repression of CK response, and thus CK signaling, is one of the strategies plants use to cope with water deficit, providing novel insight for the design of drought-tolerant plants by genetic engineering. PMID:26884175

  1. Arabidopsis type B cytokinin response regulators ARR1, ARR10, and ARR12 negatively regulate plant responses to drought

    PubMed Central

    Nguyen, Kien Huu; Ha, Chien Van; Nishiyama, Rie; Watanabe, Yasuko; Leyva-González, Marco Antonio; Fujita, Yasunari; Tran, Uven Thi; Li, Weiqiang; Tanaka, Maho; Seki, Motoaki; Schaller, G. Eric; Herrera-Estrella, Luis; Tran, Lam-Son Phan

    2016-01-01

    In this study, we used a loss-of-function approach to elucidate the functions of three Arabidopsis type B response regulators (ARRs)—namely ARR1, ARR10, and ARR12—in regulating the Arabidopsis plant responses to drought. The arr1,10,12 triple mutant showed a significant increase in drought tolerance versus WT plants, as indicated by its higher relative water content and survival rate on drying soil. This enhanced drought tolerance of arr1,10,12 plants can be attributed to enhanced cell membrane integrity, increased anthocyanin biosynthesis, abscisic acid (ABA) hypersensitivity, and reduced stomatal aperture, but not to altered stomatal density. Further drought-tolerance tests of lower-order double and single mutants indicated that ARR1, ARR10, and ARR12 negatively and redundantly control plant responses to drought, with ARR1 appearing to bear the most critical function among the three proteins. In agreement with these findings, a comparative genome-wide analysis of the leaves of arr1,10,12 and WT plants under both normal and dehydration conditions suggested a cytokinin (CK) signaling-mediated network controlling plant adaptation to drought via many dehydration/drought- and/or ABA-responsive genes that can provide osmotic adjustment and protection to cellular and membrane structures. Expression of all three ARR genes was repressed by dehydration and ABA treatments, inferring that plants down-regulate these genes as an adaptive mechanism to survive drought. Collectively, our results demonstrate that repression of CK response, and thus CK signaling, is one of the strategies plants use to cope with water deficit, providing novel insight for the design of drought-tolerant plants by genetic engineering. PMID:26884175

  2. Seroprevalence of human herpesvirus 8 in human immunodeficiency virus 1-positive and human immunodeficiency virus 1-negative populations in Japan.

    PubMed

    Fujii, T; Taguchi, H; Katano, H; Mori, S; Nakamura, T; Nojiri, N; Nakajima, K; Tadokoro, K; Juji, T; Iwamoto, A

    1999-02-01

    To determine the seroprevalence of human herpesvirus 8 (HHV8) among human immunodeficiency virus 1 (HIV-1)-positive (HIV-1+) and HIV-1-negative (HIV-1-) populations in Japan, 276 HIV-1+ patients and 1,000 HIV-1- blood donors were enrolled in this study. Antibodies against HHV8 latency-associated nuclear antigen (LANA) were examined through indirect immunofluorescent assay by using a B-cell line that was infected latently with HHV8 (body cavity-based lymphoma 1). An HHV8- and Epstein-Barr virus-negative B-cell line (Ramos) was used as a control. Thirty-two seropositive cases against LANA (anti-LANA+) were identified among the 276 HIV-1+ patients who were studied. Five cases were foreigners living in Japan. The risk factor of all 27 Japanese cases was unprotected sexual intercourse, and the great majority of these cases (23 in 27; 85%) reported homosexual/bisexual behavior. Anti-LANA+ status correlated with the presence of sexually transmitted diseases, such as amoeba and HBV infection, further suggesting male homosexual behavior as the main route of HHV8 transmission in Japan. Only two LANA+ cases were identified among 1,000 HIV- blood donors in Japan; thus, seroprevalence of HHV8 identified by LANA was estimated to be 0.2% among HIV-1- populations in this country. PMID:9892401

  3. Human self-protein CD8+ T-cell epitopes are both positively and negatively selected.

    PubMed

    Almani, Michal; Raffaeli, Shai; Vider-Shalit, Tal; Tsaban, Lea; Fishbain, Vered; Louzoun, Yoram

    2009-04-01

    The cellular immune system recognizes self-epitopes in the context of MHC-I molecules. The immunological general view presumes that these self-epitopes are just a background, both positively and negatively selecting T cells. We here estimate the number of epitopes in each human protein for many frequent HLA alleles, and a score representing over or under presentation of epitopes on these proteins. We further show that there is a clear selection for the presentation of specific self-protein types. Proteins presenting many epitopes include, for example, autoimmune regulator (AIRE) upregulated tissue-specific antigens, immune system receptors and proteins with a high expression level. On the other hand, proteins that may be considered less "useful" for the immune system, such as low expression level proteins, are under-presented. We combine our epitope estimate with single nucleotide polymorphism (SNP) measures to show that this selection can be directly observed through the fraction of non-synonymous SNP (replacement fraction), which is significantly higher inside epitopes than outside. PMID:19291702

  4. Negative regulation of RNA-binding protein HuR by tumor-suppressor ECRG2.

    PubMed

    Lucchesi, C; Sheikh, M S; Huang, Y

    2016-05-19

    Esophageal cancer-related gene 2 (ECRG2) is a newer tumor suppressor whose function in the regulation of cell growth and apoptosis remains to be elucidated. Here we show that ECRG2 expression was upregulated in response to DNA damage, and increased ECRG2 expression induced growth suppression in cancer cells but not in non-cancerous epithelial cells. ECRG2-mediated growth suppression was associated with activation of caspases and marked reduction in the levels of apoptosis inhibitor, X chromosome-linked inhibitor of apoptosis protein (XIAP). ECRG2, via RNA-binding protein human antigen R (HuR), regulated XIAP mRNA stability and expression. Furthermore, ECRG2 increased HuR ubiquitination and degradation but was unable to modulate the non-ubiquitinable mutant form of HuR. We also identified missense and frame-shift ECRG2 mutations in various human malignancies and noted that, unlike wild-type ECRG2, one cancer-derived ECRG2 mutant harboring glutamic acid instead of valine at position 30 (V30E) failed to induce cell death and activation of caspases. This naturally occurring V30E mutant also did not suppress XIAP and HuR. Importantly, the V30E mutant overexpressing cancer cells acquired resistance against multiple anticancer drugs, thus suggesting that ECRG2 mutations appear to have an important role in the acquisition of anticancer drug resistance in a subset of human malignancies. PMID:26434587

  5. 75 FR 21508 - Health and Human Services Acquisition Regulation; Corrections

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-26

    ... HUMAN SERVICES 48 CFR Chapter 3 Health and Human Services Acquisition Regulation; Corrections AGENCY: Department of Health and Human Services. ACTION: Correcting amendments. SUMMARY: This action corrects minor errors, inconsistencies and omissions in the final rule, which revised the Health and Human...

  6. PACT is a negative regulator of p53 and essential for cell growth and embryonic development.

    PubMed

    Li, Li; Deng, Binwei; Xing, Guichun; Teng, Yan; Tian, Chunyan; Cheng, Xuan; Yin, Xiushan; Yang, Juntao; Gao, Xue; Zhu, Yunping; Sun, Qihong; Zhang, Lingqiang; Yang, Xiao; He, Fuchu

    2007-05-01

    The tumor suppressor p53 regulates cell cycle progression and apoptosis in response to various types of stress, whereas excess p53 activity creates unwanted effects. Tight regulation of p53 is essential for maintaining normal cell growth. p53-associated cellular protein-testes derived (PACT, also known as P2P-R, RBBP6) is a 250-kDa Ring finger-containing protein that can directly bind to p53. PACT is highly up-regulated in esophageal cancer and may be a promising target for immunotherapy. However, the physiological role of the PACT-p53 interaction remains largely unclear. Here, we demonstrate that the disruption of PACT in mice leads to early embryonic lethality before embryonic day 7.5 (E7.5), accompanied by an accumulation of p53 and widespread apoptosis. p53-null mutation partially rescues the lethality phenotype and prolonged survival to E11.5. Endogenous PACT can interact with Hdm2 and enhance Hdm2-mediated ubiquitination and degradation of p53 as a result of the increase of the p53-Hdm2 affinity. Consequently, PACT represses p53-dependent gene transcription. Knockdown of PACT significantly attenuates the p53-Hdm2 interaction, reduces p53 polyubiquitination, and enhances p53 accumulation, leading to both apoptosis and cell growth retardation. Taken together, our data demonstrate that the PACT-p53 interaction plays a critical role in embryonic development and tumorigenesis and identify PACT as a member of negative regulators of p53. PMID:17470788

  7. E3 Ubiquitin Ligase Fbw7 Negatively Regulates Osteoblast Differentiation by Targeting Runx2 for Degradation.

    PubMed

    Kumar, Yogesh; Kapoor, Isha; Khan, Kainat; Thacker, Gatha; Khan, Mohd Parvez; Shukla, Nidhi; Kanaujiya, Jitendra Kumar; Sanyal, Sabyasachi; Chattopadhyay, Naibedya; Trivedi, Arun Kumar

    2015-12-25

    Runx2, a master regulator of osteoblast differentiation, is tightly regulated at both transcriptional and post-translational levels. Post-translational modifications such as phosphorylation and ubiquitination have differential effects on Runx2 functions. Here, we show that the reduced expression and functions of Runx2 upon its phosphorylation by GSK3β are mediated by its ubiquitin-mediated degradation through E3 ubiquitin ligase Fbw7α. Fbw7α through its WD domain interacts with Runx2 both in a heterologous (HEK293T cells) system as well as in osteoblasts. GSK3β was also present in the same complex as determined by co-immunoprecipitation. Furthermore, overexpression of either Fbw7α or GSK3β was sufficient to down-regulate endogenous Runx2 expression and function; however, both failed to inhibit endogenous Runx2 when either of them was depleted in osteoblasts. Fbw7α-mediated inhibition of Runx2 expression also led to reduced Runx2 transactivation and osteoblast differentiation. In contrast, inhibition of Fbw7α restored Runx2 levels and promoted osteoblast differentiation. We also observed reciprocal expression levels of Runx2 and Fbw7α in models of bone loss such as lactating (physiological bone loss condition) and ovariectomized (induction of surgical menopause) animals that show reduced Runx2 and enhanced Fbw7α, whereas this was reversed in the estrogen-treated ovariectomized animals. In addition, methylprednisolone (a synthetic glucocorticoid) treatment to neonatal rats showed a temporal decrease in Runx2 with a reciprocal increase in Fbw7 in their calvarium. Taken together, these data demonstrate that Fbw7α negatively regulates osteogenesis by targeting Runx2 for ubiquitin-mediated degradation in a GSK3β-dependent manner and thus provides a plausible explanation for GSK3β-mediated bone loss as described before. PMID:26542806

  8. Ski and SnoN, potent negative regulators of TGF-β signaling

    PubMed Central

    Deheuninck, Julien; Luo, Kunxin

    2011-01-01

    Ski and the closely related SnoN were discovered as oncogenes by their ability to transform chicken embryo fibroblasts upon overexpression. While elevated expressions of Ski and SnoN have also been reported in many human cancer cells and tissues, consistent with their pro-oncogenic activity, emerging evidence also suggests a potential anti-oncogenic activity for both. In addition, Ski and SnoN have been implicated in regulation of cell differentiation, especially in the muscle and neuronal lineages. Multiple cellular partners of Ski and SnoN have been identified in an effort to understand the molecular mechanisms underlying the complex roles of Ski and SnoN. In this review, we summarize recent findings on the biological functions of Ski and SnoN, their mechanisms of action and how their levels of expression are regulated. PMID:19114989

  9. Toll-Like Receptor 9 Alternatively Spliced Isoform Negatively Regulates TLR9 Signaling in Teleost Fish

    PubMed Central

    Chen, Nai-Yu; Nagarajan, Govindarajulu; Chiou, Pinwen Peter

    2015-01-01

    Toll-like receptor 9 (TLR9) recognizes and binds unmethylated CpG motifs in DNA, which are found in the genomes of bacteria and DNA viruses. In fish, Tlr9 is highly diverse, with the number of introns ranging from 0 to 4. A fish Tlr9 gene containing two introns has been reported to express two alternatively spliced isoforms, namely gTLR9A (full-length) and gTLR9B (with a truncated Cʹ-terminal signal transducing domain), whose regulation and function remain unclear. Here, we report a unique regulatory mechanism of gTLR9 signaling in orange-spotted grouper (Epinephelus coioides), whose gTlr9 sequence also contains two introns. We demonstrated that the grouper gTlr9 gene indeed has the capacity to produce two gTLR9 isoforms via alternative RNA splicing. We found that gTLR9B could function as a negative regulator to suppress gTLR9 signaling as demonstrated by the suppression of downstream gene expression. Following stimulation with CpG oligodeoxynucleotide (ODN), gTLR9A and gTLR9B were observed to translocate into endosomes and co-localize with ODN and the adaptor protein gMyD88. Both gTLR9A and gTLR9B could interact with gMyD88; however, gTLR9B could not interact with downstream IRAK4 and TRAF6. Further analysis of the expression profile of gTlr9A and gTlr9B upon immune-stimulation revealed that the two isoforms were differentially regulated in a time-dependent manner. Overall, these data suggest that fish TLR9B functions as a negative regulator, and that its temporal expression is mediated by alternative RNA splicing. This has not been observed in mammalian TLR9s and might have been acquired relatively recently in the evolution of fish. PMID:25955250

  10. Smart conjugated polymer nanocarrier for healthy weight loss by negative feedback regulation of lipase activity.

    PubMed

    Chen, Yu-Lei; Zhu, Sha; Zhang, Lei; Feng, Pei-Jian; Yao, Xi-Kuang; Qian, Cheng-Gen; Zhang, Can; Jiang, Xi-Qun; Shen, Qun-Dong

    2016-02-14

    Healthy weight loss represents a real challenge when obesity is increasing in prevalence. Herein, we report a conjugated polymer nanocarrier for smart deactivation of lipase and thus balancing calorie intake. After oral administration, the nanocarrier is sensitive to lipase in the digestive tract and releases orlistat, which deactivates the enzyme and inhibits fat digestion. It also creates negative feedback to control the release of itself. The nanocarrier smartly regulates activity of the lipase cyclically varied between high and low levels. In spite of high fat diet intervention, obese mice receiving a single dose of the nanocarrier lose weight over eight days, whereas a control group continues the tendency to gain weight. Daily intragastric administration of the nanocarrier leads to lower weight of livers or fat pads, smaller adipocyte size, and lower total cholesterol level than that of the control group. Near-infrared fluorescence of the nanocarrier reveals its biodistribution. PMID:26790821

  11. A Putative PP2C-Encoding Gene Negatively Regulates ABA Signaling in Populus euphratica

    PubMed Central

    Chen, Jinhuan; Zhang, Dongzhi; Zhang, Chong; Xia, Xinli; Yin, Weilun; Tian, Qianqian

    2015-01-01

    A PP2C homolog gene was cloned from the drought-treated cDNA library of Populus euphratica. Multiple sequence alignment analysis suggested that the gene is a potential ortholog of HAB1. The expression of this HAB1 ortholog (PeHAB1) was markedly induced by drought and moderately induced by ABA. To characterize its function in ABA signaling, we generated transgenic Arabidopsis thaliana plants overexpressing this gene. Transgenic lines exhibited reduced responses to exogenous ABA and reduced tolerance to drought compared to wide-type lines. Yeast two-hybrid analyses indicated that PeHAB1 could interact with the ABA receptor PYL4 in an ABA-independent manner. Taken together; these results indicated that PeHAB1 is a new negative regulator of ABA responses in poplar. PMID:26431530

  12. IRTKS negatively regulates antiviral immunity through PCBP2 sumoylation-mediated MAVS degradation

    PubMed Central

    Xia, Pengyan; Wang, Shuo; Xiong, Zhen; Ye, Buqing; Huang, Li-Yu; Han, Ze-Guang; Fan, Zusen

    2015-01-01

    RNA virus infection is recognized by the RIG-I family of receptors that activate the mitochondrial adaptor MAVS, leading to the clearance of viruses. Antiviral signalling activation requires strict modulation to avoid damage to the host from exacerbated inflammation. Insulin receptor tyrosine kinase substrate (IRTKS) participates in actin bundling and insulin signalling and its deficiency causes insulin resistance. However, whether IRTKS is involved in the regulation of innate immunity remains elusive. Here we show that IRTKS deficiency causes enhanced innate immune responses against RNA viruses. IRTKS-mediated suppression of antiviral responses depends on the RIG-I-MAVS signalling pathway. IRTKS recruits the E2 ligase Ubc9 to sumoylate PCBP2 in the nucleus, which causes its cytoplasmic translocation during viral infection. The sumoylated PCBP2 associates with MAVS to initiate its degradation, leading to downregulation of antiviral responses. Thus, IRTKS functions as a negative modulator of excessive inflammation. PMID:26348439

  13. Abscisic acid is a negative regulator of root gravitropism in Arabidopsis thaliana.

    PubMed

    Han, Woong; Rong, Honglin; Zhang, Hanma; Wang, Myeong-Hyeon

    2009-01-23

    The plant hormone abscisic acid (ABA) plays a role in root gravitropism and has led to an intense debate over whether ABA acts similar to auxin by translating the gravitational signal into directional root growth. While tremendous advances have been made in the past two decades in establishing the role of auxin in root gravitropism, little progress has been made in characterizing the role of ABA in this response. In fact, roots of plants that have undetectable levels of ABA and that display a normal gravitropic response have raised some serious doubts about whether ABA plays any role in root gravitropism. Here, we show strong evidence that ABA plays a role opposite to that of auxin and that it is a negative regulator of the gravitropic response of Arabidopsis roots. PMID:19056344

  14. Dynamic control of type I IFN signalling by an integrated network of negative regulators.

    PubMed

    Porritt, Rebecca A; Hertzog, Paul J

    2015-03-01

    Whereas type I interferons (IFNs) have critical roles in protection from pathogens, excessive IFN responses contribute to pathology in both acute and chronic settings, pointing to the importance of balancing activating signals with regulatory mechanisms that appropriately tune the response. Here we review evidence for an integrated network of negative regulators of IFN production and action, which function at all levels of the activating and effector signalling pathways. We propose that the aim of this extensive network is to limit tissue damage while enabling an IFN response that is temporally appropriate and of sufficient magnitude. Understanding the architecture and dynamics of this network, and how it differs in distinct tissues, will provide new insights into IFN biology and aid the design of more effective therapeutics. PMID:25725583

  15. A Putative PP2C-Encoding Gene Negatively Regulates ABA Signaling in Populus euphratica.

    PubMed

    Chen, Jinhuan; Zhang, Dongzhi; Zhang, Chong; Xia, Xinli; Yin, Weilun; Tian, Qianqian

    2015-01-01

    A PP2C homolog gene was cloned from the drought-treated cDNA library of Populus euphratica. Multiple sequence alignment analysis suggested that the gene is a potential ortholog of HAB1. The expression of this HAB1 ortholog (PeHAB1) was markedly induced by drought and moderately induced by ABA. To characterize its function in ABA signaling, we generated transgenic Arabidopsis thaliana plants overexpressing this gene. Transgenic lines exhibited reduced responses to exogenous ABA and reduced tolerance to drought compared to wide-type lines. Yeast two-hybrid analyses indicated that PeHAB1 could interact with the ABA receptor PYL4 in an ABA-independent manner. Taken together; these results indicated that PeHAB1 is a new negative regulator of ABA responses in poplar. PMID:26431530

  16. Nuclear TRAF3 is a negative regulator of CREB in B cells.

    PubMed

    Mambetsariev, Nurbek; Lin, Wai W; Stunz, Laura L; Hanson, Brett M; Hildebrand, Joanne M; Bishop, Gail A

    2016-01-26

    The adaptor protein TNF receptor-associated factor 3 (TRAF3) regulates signaling through B-lymphocyte receptors, including CD40, BAFF receptor, and Toll-like receptors, and also plays a critical role inhibiting B-cell homoeostatic survival. Consistent with these findings, loss-of-function human TRAF3 mutations are common in B-cell cancers, particularly multiple myeloma and B-cell lymphoma. B cells of B-cell-specific TRAF3(-/-) mice (B-Traf3(-/-)) display remarkably enhanced survival compared with littermate control (WT) B cells. The mechanism for this abnormal homeostatic survival is poorly understood, a key knowledge gap in selecting optimal treatments for human B-cell cancers with TRAF3 deficiency. We show here for the first time to our knowledge that TRAF3 is a resident nuclear protein that associates with the transcriptional regulator cAMP response element binding protein (CREB) in both mouse and human B cells. The TRAF-C domain of TRAF3 was necessary and sufficient to localize TRAF3 to the nucleus via a functional nuclear localization signal. CREB protein was elevated in TRAF3(-/-) B cells, without change in mRNA, but with a decrease in CREB ubiquitination. CREB-mediated transcriptional activity was increased in TRAF3-deficient B cells. Consistent with these findings, Mcl-1, an antiapoptotic target of CREB-mediated transcription, was increased in the absence of TRAF3 and enhanced Mcl-1 was suppressed with CREB inhibition. TRAF3-deficient B cells were also preferentially sensitive to survival inhibition with pharmacologic CREB inhibitor. Our results identify a new mechanism by which nuclear TRAF3 regulates B-cell survival via inhibition of CREB stability, information highly relevant to the role of TRAF3 in B-cell malignancies. PMID:26755589

  17. Multiple Signals Regulate PLC beta 3 in Human Myometrial Cells

    PubMed Central

    Zhong, Miao; Murtazina, Dilyara A.; Phillips, Jennifer; Ku, Chun-Ying; Sanborn, Barbara M.

    2008-01-01

    Summary The regulation of PLCB3-Serine1105 phosphorylation by both negative feedback and negative crosstalk facilitates the integration of multiple signaling pathways in myometrial cells. Phospholipase CB3 (PLCB3) Serine1105, a substrate for multiple protein kinases, represents a potential point of convergence of several signaling pathways in the myometrium. To explore this hypothesis, the regulation of PLCB3-Serine1105 phosphorylation (P-S1105) was studied in immortalized and primary human myometrial cells. CPT-cAMP and calcitonin gene-related peptide (CALCA) transiently increased P-S1105. Relaxin also stimulated P-S1105; this effect was partially blocked by the protein kinase A (PRKA) inhibitor Rp-8-CPT-cAMPS. Oxytocin, which stimulates Gαq-mediated pathways, also rapidly increased P-S1105, as did PGF2α and ATP. Oxytocin-stimulated phosphorylation was blocked by the protein kinase C (PRKC) inhibitor Go6976 and by pretreatment overnight with a phorbol ester. Cypermethrin, a PP2B phosphatase inhibitor, but not okadaic acid, a PP1/PP2A inhibitor, prolonged the effect of CALCA on P-S1105, whereas the reverse was the case for the oxytocin-stimulated increase in P-S1105. PLCB3 was the predominant PLC isoform expressed in the myometrial cells and PLCB3 shRNA constructs significantly attenuated oxytocin-stimulated increases in intracellular calcium. Oxytocin-induced phosphatidylinositol (PI) turnover was inhibited by CPT-cAMP and okadaic acid but enhanced by pretreatment with Go6976. CPT-cAMP inhibited oxytocin-stimulated PI turnover in the presence of overexpressed PLCB3, but not overexpressed PLCB3-S1105A. These data demonstrate that both negative crosstalk from the cAMP/PRKA pathway and a negative feedback loop in the oxytocin/G protein/PLCB pathway involving PRKC operate in myometrial cells and suggest that different protein phosphatases predominate in mediating P-S1105 dephosphorylation in these pathways. The integration of multiple signal components at the level

  18. PECAM-1 negatively regulates GPIb/V/IX signaling in murine platelets.

    PubMed

    Rathore, Vipul; Stapleton, Michelle A; Hillery, Cheryl A; Montgomery, Robert R; Nichols, Timothy C; Merricks, Elizabeth P; Newman, Debra K; Newman, Peter J

    2003-11-15

    Platelet adhesion at sites of vascular injury is mediated, in part, by interaction of the platelet plasma membrane glycoprotein (GP) Ib/V/IX complex with von Willebrand Factor (VWF) presented on collagen-exposed surfaces. Recent studies indicate that GPIb/V/IX may be functionally coupled with the Fc receptor gamma (FcR gamma)-chain, which, by virtue of its cytoplasmic immunoreceptor tyrosine-based activation motif, sends activation signals into the cell. Platelet endothelial cell adhesion molecule-1 (PECAM-1) is an inhibitory receptor that has previously been shown to negatively regulate platelet responses to collagen, which transduces activation signals via the GPVI/FcR gamma-chain complex. To determine whether PECAM-1 might similarly regulate signals emanating from GPIb/FcR gamma, we compared activation and aggregation responses to VWF of PECAM-1-positive and PECAM-1-deficient murine platelets. PECAM-1 and the FcR gamma-chain became rapidly tyrosine phosphorylated in platelets following botrocetin-induced VWF binding, but FcR gamma-chain tyrosine phosphorylation was delayed in PECAM-1-positive, versus PECAM-1-deficient, platelets. PECAM-1-deficient platelets were hyperaggregable to VWF, exhibited enhanced spreading and, under conditions of arterial flow, formed markedly larger thrombi on immobilized VWF than did wild-type platelets. Taken together, these data support the notion that engagement of the GPIb complex, in addition to sending activation signals, also initiates a negative feedback loop involving PECAM-1 that controls the rate and extent of platelet activation. PMID:12893757

  19. Smart conjugated polymer nanocarrier for healthy weight loss by negative feedback regulation of lipase activity

    NASA Astrophysics Data System (ADS)

    Chen, Yu-Lei; Zhu, Sha; Zhang, Lei; Feng, Pei-Jian; Yao, Xi-Kuang; Qian, Cheng-Gen; Zhang, Can; Jiang, Xi-Qun; Shen, Qun-Dong

    2016-02-01

    Healthy weight loss represents a real challenge when obesity is increasing in prevalence. Herein, we report a conjugated polymer nanocarrier for smart deactivation of lipase and thus balancing calorie intake. After oral administration, the nanocarrier is sensitive to lipase in the digestive tract and releases orlistat, which deactivates the enzyme and inhibits fat digestion. It also creates negative feedback to control the release of itself. The nanocarrier smartly regulates activity of the lipase cyclically varied between high and low levels. In spite of high fat diet intervention, obese mice receiving a single dose of the nanocarrier lose weight over eight days, whereas a control group continues the tendency to gain weight. Daily intragastric administration of the nanocarrier leads to lower weight of livers or fat pads, smaller adipocyte size, and lower total cholesterol level than that of the control group. Near-infrared fluorescence of the nanocarrier reveals its biodistribution.Healthy weight loss represents a real challenge when obesity is increasing in prevalence. Herein, we report a conjugated polymer nanocarrier for smart deactivation of lipase and thus balancing calorie intake. After oral administration, the nanocarrier is sensitive to lipase in the digestive tract and releases orlistat, which deactivates the enzyme and inhibits fat digestion. It also creates negative feedback to control the release of itself. The nanocarrier smartly regulates activity of the lipase cyclically varied between high and low levels. In spite of high fat diet intervention, obese mice receiving a single dose of the nanocarrier lose weight over eight days, whereas a control group continues the tendency to gain weight. Daily intragastric administration of the nanocarrier leads to lower weight of livers or fat pads, smaller adipocyte size, and lower total cholesterol level than that of the control group. Near-infrared fluorescence of the nanocarrier reveals its biodistribution

  20. Expression of microRNAs in HPV negative tonsil cancers and their regulation of PDCD4.

    PubMed

    Khoury, Samantha; Ahadi, Alireza; Zhang, Xiaoying; Tran, Nham

    2016-06-01

    Global rates of tonsil cancer have been increasing since the turn of the millennia, however we still have a limited understanding of the genes and pathways which control this disease. This array dataset which is linked to our publication (Zhang et al., 2015) describes the profiling of human miRNAs in tonsil and normal adjacent tissues. With this dataset, we identified a list of microRNA (miRNA) which were highly over represented in tonsil cancers and showed that several miRNAs were able to regulate the tumour suppressor PDCD4 in a temporal manner. The dataset has been deposited into Gene Expression Omnibus (GSE75630). PMID:27222808

  1. Cannabinoid Modulation of Frontolimbic Activation and Connectivity During Volitional Regulation of Negative Affect.

    PubMed

    Gorka, Stephanie M; Phan, K Luan; Lyons, Maryssa; Mori, Shoko; Angstadt, Mike; Rabinak, Christine A

    2016-06-01

    Behavioral and brain research indicates that administration of Δ(9)-tetrahydrocannabinol (THC) alters threat perception and enhances the suppression of conditioned fear responses via modulation of the frontolimbic circuit. No prior studies, however, have examined whether THC also affects volitional forms of emotion processing such as cognitive reappraisal. The aim of the current study was therefore to examine the effects of THC on frontolimbic activation and functional connectivity during cognitive reappraisal in a sample of healthy adults. The study was a randomized, double-blind, placebo-controlled, between-subject design and all participants ingested either an oral dose of synthetic THC (n=41) or placebo (n=37) before completion of an emotion regulation task during functional magnetic resonance imaging (fMRI). Functional connectivity was assessed using generalized psychophysiological interaction (gPPI) analyses. Results indicated that although there were no group differences in self-reported attenuation of negative affect during cognitive reappraisal, relative to placebo, THC increased amygdala activation and reduced amygdala and dorsolateral prefrontal cortex (dlPFC) functional coupling during cognitive reappraisal of emotionally negative pictures. This suggests that in addition to automatic emotional processes, THC affects frontolimbic functioning during cognitive reappraisal. PMID:26647971

  2. The Lipid-Modifying Enzyme SMPDL3B Negatively Regulates Innate Immunity.

    PubMed

    Heinz, Leonhard X; Baumann, Christoph L; Köberlin, Marielle S; Snijder, Berend; Gawish, Riem; Shui, Guanghou; Sharif, Omar; Aspalter, Irene M; Müller, André C; Kandasamy, Richard K; Breitwieser, Florian P; Pichlmair, Andreas; Bruckner, Manuela; Rebsamen, Manuele; Blüml, Stephan; Karonitsch, Thomas; Fauster, Astrid; Colinge, Jacques; Bennett, Keiryn L; Knapp, Sylvia; Wenk, Markus R; Superti-Furga, Giulio

    2015-06-30

    Lipid metabolism and receptor-mediated signaling are highly intertwined processes that cooperate to fulfill cellular functions and safeguard cellular homeostasis. Activation of Toll-like receptors (TLRs) leads to a complex cellular response, orchestrating a diverse range of inflammatory events that need to be tightly controlled. Here, we identified the GPI-anchored Sphingomyelin Phosphodiesterase, Acid-Like 3B (SMPDL3B) in a mass spectrometry screening campaign for membrane proteins co-purifying with TLRs. Deficiency of Smpdl3b in macrophages enhanced responsiveness to TLR stimulation and profoundly changed the cellular lipid composition and membrane fluidity. Increased cellular responses could be reverted by re-introducing affected ceramides, functionally linking membrane lipid composition and innate immune signaling. Finally, Smpdl3b-deficient mice displayed an intensified inflammatory response in TLR-dependent peritonitis models, establishing its negative regulatory role in vivo. Taken together, our results identify the membrane-modulating enzyme SMPDL3B as a negative regulator of TLR signaling that functions at the interface of membrane biology and innate immunity. PMID:26095358

  3. The Lipid-Modifying Enzyme SMPDL3B Negatively Regulates Innate Immunity

    PubMed Central

    Heinz, Leonhard X.; Baumann, Christoph L.; Köberlin, Marielle S.; Snijder, Berend; Gawish, Riem; Shui, Guanghou; Sharif, Omar; Aspalter, Irene M.; Müller, André C.; Kandasamy, Richard K.; Breitwieser, Florian P.; Pichlmair, Andreas; Bruckner, Manuela; Rebsamen, Manuele; Blüml, Stephan; Karonitsch, Thomas; Fauster, Astrid; Colinge, Jacques; Bennett, Keiryn L.; Knapp, Sylvia; Wenk, Markus R.; Superti-Furga, Giulio

    2015-01-01

    Summary Lipid metabolism and receptor-mediated signaling are highly intertwined processes that cooperate to fulfill cellular functions and safeguard cellular homeostasis. Activation of Toll-like receptors (TLRs) leads to a complex cellular response, orchestrating a diverse range of inflammatory events that need to be tightly controlled. Here, we identified the GPI-anchored Sphingomyelin Phosphodiesterase, Acid-Like 3B (SMPDL3B) in a mass spectrometry screening campaign for membrane proteins co-purifying with TLRs. Deficiency of Smpdl3b in macrophages enhanced responsiveness to TLR stimulation and profoundly changed the cellular lipid composition and membrane fluidity. Increased cellular responses could be reverted by re-introducing affected ceramides, functionally linking membrane lipid composition and innate immune signaling. Finally, Smpdl3b-deficient mice displayed an intensified inflammatory response in TLR-dependent peritonitis models, establishing its negative regulatory role in vivo. Taken together, our results identify the membrane-modulating enzyme SMPDL3B as a negative regulator of TLR signaling that functions at the interface of membrane biology and innate immunity. PMID:26095358

  4. DCIR negatively regulates CpG-ODN-induced IL-1β and IL-6 production.

    PubMed

    Zhao, Xibao; Shen, Yaping; Hu, Weiwei; Chen, Junru; Wu, Tian; Sun, Xiaoqiang; Yu, Juan; Wu, Tingting; Chen, Weilin

    2015-12-01

    C-type lectin receptors (CLR) are a diverse family of proteins mainly expressed on antigen-presenting cells (APC). As antigen-uptake and signaling receptors, CLR modulate immune responses of APC. The dendritic cell immunoreceptor (DCIR) is a member of CLR and has an immunoreceptor tyrosine based inhibitory motif (ITIM) in cytoplasmic tail, which is believed to play a negative role in cellular responses after antigen exposure. In addition to pathogen recognition, DCIR has been shown to be pivotal in preventing autoimmune disease by controlling dendritic cell proliferation. However, much less is known about the role of DCIR in innate immunity and its crosstalk with the Toll like receptors (TLR) pathway. In this study, we demonstrate that CpG-ODN stimulation can promote DCIR expression in macrophages and DCIR triggering inhibits the production of CpG-ODN-induced proinflammatory cytokines. We further confirm that siRNA-mediated knockdown of DCIR expression enhances CpG-ODN-induced phosphorylation of Erk1/2, JNK1/2 and p38 in macrophages. Collectively, these results indicate that DCIR is a negatively regulator in TLR9-mediated innate immune response. PMID:26514427

  5. Transcription factor interactions: Selectors of positive or negative regulation from a single DNA element

    SciTech Connect

    Diamond, M.I.; Miner, J.N.; Yoshinaga, S.K.; Yamamoto, K.R. )

    1990-09-14

    The mechanism by which a single factor evokes opposite regulatory effects from a specific DNA sequence is not well understood. In this study, a 25-base pair element that resides upstream of the mouse proliferin gene was examined; it conferred on linked promoters either positive or negative glucocorticoid regulation, depending upon physiological context. This sequence, denoted a composite glucocorticoid response element (GRE), was bound selective in vitro both by the glucocorticoid receptor and by c-Jun and c-Fos, components of the phorbol ester-activated AP-1 transcription factor. Indeed, c-Jun and c-Fos served as selectors of hormone responsiveness: the composite GRE was inactive in the absence of c-Jun, whereas it conferred a positive glucocorticoid effect in the presence of c-Jun, and a negative glucocorticoid effect in the presence of c-Jun and relatively high levels of c-Fos. The receptor also interacted selectively with c-Jun in vitro. A general model for composite GRE action is proposed that invokes both DNA binding and protein-protein interactions by receptor and nonreceptor factors.

  6. Human amygdala response to dynamic facial expressions of positive and negative surprise.

    PubMed

    Vrticka, Pascal; Lordier, Lara; Bediou, Benoît; Sander, David

    2014-02-01

    Although brain imaging evidence accumulates to suggest that the amygdala plays a key role in the processing of novel stimuli, only little is known about its role in processing expressed novelty conveyed by surprised faces, and even less about possible interactive encoding of novelty and valence. Those investigations that have already probed human amygdala involvement in the processing of surprised facial expressions either used static pictures displaying negative surprise (as contained in fear) or "neutral" surprise, and manipulated valence by contextually priming or subjectively associating static surprise with either negative or positive information. Therefore, it still remains unresolved how the human amygdala differentially processes dynamic surprised facial expressions displaying either positive or negative surprise. Here, we created new artificial dynamic 3-dimensional facial expressions conveying surprise with an intrinsic positive (wonderment) or negative (fear) connotation, but also intrinsic positive (joy) or negative (anxiety) emotions not containing any surprise, in addition to neutral facial displays either containing ("typical surprise" expression) or not containing ("neutral") surprise. Results showed heightened amygdala activity to faces containing positive (vs. negative) surprise, which may either correspond to a specific wonderment effect as such, or to the computation of a negative expected value prediction error. Findings are discussed in the light of data obtained from a closely matched nonsocial lottery task, which revealed overlapping activity within the left amygdala to unexpected positive outcomes. PMID:24219397

  7. Negative regulation of the interferon response by an interferon-induced long non-coding RNA.

    PubMed

    Kambara, Hiroto; Niazi, Farshad; Kostadinova, Lenche; Moonka, Dilip K; Siegel, Christopher T; Post, Anthony B; Carnero, Elena; Barriocanal, Marina; Fortes, Puri; Anthony, Donald D; Valadkhan, Saba

    2014-01-01

    Long non-coding RNAs (lncRNAs) play critical roles in diverse cellular processes; however, their involvement in many critical aspects of the immune response including the interferon (IFN) response remains poorly understood. To address this gap, we compared the global gene expression pattern of primary human hepatocytes before and at three time points after treatment with IFN-α. Among ∼ 200 IFN-induced lncRNAs, one transcript showed ∼ 100-fold induction. This RNA, which we named lncRNA-CMPK2, was a spliced, polyadenylated nuclear transcript that was induced by IFN in diverse cell types from human and mouse. Similar to protein-coding IFN-stimulated genes (ISGs), its induction was dependent on JAK-STAT signaling. Intriguingly, knockdown of lncRNA-CMPK2 resulted in a marked reduction in HCV replication in IFN-stimulated hepatocytes, suggesting that it could affect the antiviral role of IFN. We could show that lncRNA-CMPK2 knockdown resulted in upregulation of several protein-coding antiviral ISGs. The observed upregulation was caused by an increase in both basal and IFN-stimulated transcription, consistent with loss of transcriptional inhibition in knockdown cells. These results indicate that the IFN response involves a lncRNA-mediated negative regulatory mechanism. lncRNA-CMPK2 was strongly upregulated in a subset of HCV-infected human livers, suggesting a role in modulation of the IFN response in vivo. PMID:25122750

  8. Negative regulation of the interferon response by an interferon-induced long non-coding RNA

    PubMed Central

    Kambara, Hiroto; Niazi, Farshad; Kostadinova, Lenche; Moonka, Dilip K.; Siegel, Christopher T.; Post, Anthony B.; Carnero, Elena; Barriocanal, Marina; Fortes, Puri; Anthony, Donald D.; Valadkhan, Saba

    2014-01-01

    Long non-coding RNAs (lncRNAs) play critical roles in diverse cellular processes; however, their involvement in many critical aspects of the immune response including the interferon (IFN) response remains poorly understood. To address this gap, we compared the global gene expression pattern of primary human hepatocytes before and at three time points after treatment with IFN-α. Among ∼200 IFN-induced lncRNAs, one transcript showed ∼100-fold induction. This RNA, which we named lncRNA-CMPK2, was a spliced, polyadenylated nuclear transcript that was induced by IFN in diverse cell types from human and mouse. Similar to protein-coding IFN-stimulated genes (ISGs), its induction was dependent on JAK-STAT signaling. Intriguingly, knockdown of lncRNA-CMPK2 resulted in a marked reduction in HCV replication in IFN-stimulated hepatocytes, suggesting that it could affect the antiviral role of IFN. We could show that lncRNA-CMPK2 knockdown resulted in upregulation of several protein-coding antiviral ISGs. The observed upregulation was caused by an increase in both basal and IFN-stimulated transcription, consistent with loss of transcriptional inhibition in knockdown cells. These results indicate that the IFN response involves a lncRNA-mediated negative regulatory mechanism. lncRNA-CMPK2 was strongly upregulated in a subset of HCV-infected human livers, suggesting a role in modulation of the IFN response in vivo. PMID:25122750

  9. A Longitudinal Study of Emotion Regulation, Emotion Lability-Negativity, and Internalizing Symptomatology in Maltreated and Nonmaltreated Children

    ERIC Educational Resources Information Center

    Kim-Spoon, Jungmeen; Cicchetti, Dante; Rogosch, Fred A.

    2013-01-01

    The longitudinal contributions of emotion regulation and emotion lability-negativity to internalizing symptomatology were examined in a low-income sample (171 maltreated and 151 nonmaltreated children, from age 7 to 10 years). Latent difference score models indicated that for both maltreated and nonmaltreated children, emotion regulation was a…

  10. Mesalazine negatively regulates CDC25A protein expression and promotes accumulation of colon cancer cells in S phase.

    PubMed

    Stolfi, Carmine; Fina, Daniele; Caruso, Roberta; Caprioli, Flavio; Fantini, Massimo Claudio; Rizzo, Angelamaria; Sarra, Massimiliano; Pallone, Francesco; Monteleone, Giovanni

    2008-06-01

    Regular consumption of mesalazine has been associated with a reduced risk of colorectal cancer (CRC) in patients with inflammatory bowel disease. The molecular mechanisms underlying the antineoplastic effect of 5-aminosalicylic acid remain, however, poorly characterized. In this study, we examined whether mesalazine affects cell cycle progression and analyzed specific checkpoint pathways in experimental models of CRC. Mesalazine inhibited the growth of HCT-116 and HT-29 cells, two CRC cell lines that express either a wild-type or mutated p53. Cell cycle analysis revealed that mesalazine induced cells to accumulate in S phase. This effect was associated with a sustained phosphorylation of the cyclin-dependent kinase (CDK)2 at threonine 14 and tyrosine 15 residues, an event that inactivates the CDK2-cyclin complex and blocks S-G(2) phase cell cycle transition. Consistently, mesalazine reduced the protein content of CDC25A, a phosphatase that regulates CDK2 phosphorylation status. Analysis of upstream kinases that negatively control CDC25A expression showed that mesalazine enhanced the activation of CHK1 and CHK2. However, silencing of CHK1 and CHK2 did not prevent the mesalazine-induced CDC25A protein downregulation. In contrast, CDC25A protein ubiquitination and degradation and accumulation of cells in S phase following mesalazine exposure were reverted by proteasome inhibitors. Notably, mesalazine also inhibited CDC25A in human CRC explants. Finally, we showed that mesalazine downregulated CDC25A in CT26, a murine CRC cell line, and prevented the formation of CT26-derived tumors in mice. Data show that mesalazine negatively regulates CDC25A protein expression, thus delaying CRC cell progression. PMID:18495657

  11. Dok-1 negatively regulates platelet integrin αIIbβ3 outside-in signalling and inhibits thrombosis in mice.

    PubMed

    Niki, Masaru; Nayak, Manasa K; Jin, Hong; Bhasin, Neha; Plow, Edward F; Pandolfi, Pier Paolo; Rothman, Paul B; Chauhan, Anil K; Lentz, Steven R

    2016-05-01

    Adaptor proteins play a critical role in the assembly of signalling complexes after engagement of platelet receptors by agonists such as collagen, ADP and thrombin. Recently, using proteomics, the Dok (downstream of tyrosine kinase) adapter proteins were identified in human and mouse platelets. In vitro studies suggest that Dok-1 binds to platelet integrin β3, but the underlying effects of Dok-1 on αIIbβ3 signalling, platelet activation and thrombosis remain to be elucidated. In the present study, using Dok-1-deficient (Dok-1-/-) mice, we determined the phenotypic role of Dok-1 in αIIbβ3 signalling. We found that platelets from Dok-1-/- mice displayed normal aggregation, activation of αIIbβ3 (assessed by binding of JON/A), P-selectin surface expression (assessed by anti-CD62P), and soluble fibrinogen binding. These findings indicate that Dok-1 does not affect "inside-out" platelet signalling. Compared with platelets from wild-type (WT) mice, platelets from Dok-1-/- mice exhibited increased clot retraction (p < 0.05 vs WT), increased PLCγ2 phosphorylation, and enhanced spreading on fibrinogen after thrombin stimulation (p < 0.01 vs WT), demonstrating that Dok-1 negatively regulates αIIbβ3 "outside-in" signalling. Finally, we found that Dok-1-/- mice exhibited significantly shortened bleeding times and accelerated carotid artery thrombosis in response to photochemical injury (p < 0.05 vs WT mice). We conclude that Dok-1 modulates thrombosis and haemostasis by negatively regulating αIIbβ3 outside-in signalling. PMID:26790499

  12. PGC-1-related coactivator (PRC) negatively regulates endothelial adhesion of monocytes via inhibition of NF κB activity

    SciTech Connect

    Chengye, Zhan; Daixing, Zhou Qiang, Zhong; Shusheng, Li

    2013-09-13

    Highlights: •First time to display that LPS downregulate the expression of PRC. •First time to show that PRC inhibits the induction of VCAM-1 and E-selectin. •First time to show that PRC inhibit monocytes attachment to endothelial cells. •First time to display that PRC inhibits transcriptional activity of NF-κB. •PRC protects the respiration rate and suppresses the glycolysis rate against LPS. -- Abstract: PGC-1-related coactivator (PRC) is a growth-regulated transcriptional cofactor known to activate many of the nuclear genes specifying mitochondrial respiratory function. Endothelial dysfunction is a prominent feature found in many inflammatory diseases. Adhesion molecules, such as VCAM-1, mediate the attachment of monocytes to endothelial cells, thereby playing an important role in endothelial inflammation. The effects of PRC in regards to endothelial inflammation remain unknown. In this study, our findings show that PRC can be inhibited by the inflammatory cytokine LPS in cultured human umbilical vein endothelial cells (HUVECs). In the presence of LPS, the expression of endothelial cell adhesion molecular, such as VCAM1 and E-selectin, is found to be increased. These effects can be negated by overexpression of PRC. Importantly, monocyte adhesion to endothelial cells caused by LPS is significantly attenuated by PRC. In addition, overexpression of PRC protects mitochondrial metabolic function and suppresses the rate of glycolysis against LPS. It is also found that overexpression of PRC decreases the transcriptional activity of NF-κB. These findings suggest that PRC is a negative regulator of endothelial inflammation.

  13. Working memory capacity and spontaneous emotion regulation: high capacity predicts self-enhancement in response to negative feedback.

    PubMed

    Schmeichel, Brandon J; Demaree, Heath A

    2010-10-01

    Although previous evidence suggests that working memory capacity (WMC) is important for success at emotion regulation, that evidence may reveal simply that people with higher WMC follow instructions better than those with lower WMC. The present study tested the hypothesis that people with higher WMC more effectively engage in spontaneous emotion regulation following negative feedback, relative to those with lower WMC. Participants were randomly assigned to receive either no feedback or negative feedback about their emotional intelligence. They then completed a disguised measure of self-enhancement and a self-report measure of affect. Experimental condition and WMC interacted such that higher WMC predicted more self-enhancement and less negative affect following negative feedback. This research provides novel insight into the consequences of individual differences in WMC and illustrates that cognitive capacity may facilitate the spontaneous self-regulation of emotion. PMID:21038959

  14. DEC2 is a negative regulator for the proliferation and differentiation of chondrocyte lineage-committed mesenchymal stem cells.

    PubMed

    Sasamoto, Tomoko; Fujimoto, Katsumi; Kanawa, Masami; Kimura, Junko; Takeuchi, Junpei; Harada, Naoko; Goto, Noriko; Kawamoto, Takeshi; Noshiro, Mitsuhide; Suardita, Ketut; Tanne, Kazuo; Kato, Yukio

    2016-09-01

    Differentiated embryo chondrocyte 2 (DEC2) is a basic helix-loop-helix-Orange transcription factor that regulates cell differentiation in various mammalian tissues. DEC2 has been shown to suppress the differentiation of mesenchymal stem cells (MSCs) into myocytes and adipocytes. In the present study, we examined the role of DEC2 in the chondrogenic differentiation of human MSCs. The overexpression of DEC2 exerted minimal effects on the proliferation of MSCs in monolayer cultures with the growth medium under undifferentiating conditions, whereas it suppressed increases in DNA content, glycosaminoglycan content, and the expression of several chondrocyte-related genes, including aggrecan and type X collagen alpha 1, in MSC pellets in centrifuge tubes under chondrogenic conditions. In the pellets exposed to chondrogenesis induction medium, DEC2 overexpression downregulated the mRNA expression of fibroblast growth factor 18, which is involved in the proliferation and differentiation of chondrocytes, and upregulated the expression of p16INK4, which is a cell cycle inhibitor. These findings suggest that DEC2 is a negative regulator of the proliferation and differentiation of chondrocyte lineage-committed mesenchymal cells. PMID:27430159

  15. Hormonal regulation of the gravity s negative control of morphogenesis in cucumber seedlings

    NASA Astrophysics Data System (ADS)

    Takahashi, H.; Kamada, M.; Saito, Y.; Fujii, N.

    Just after germination, seedlings of most cucurbitaceous plants develop a peg to pull the cotyledons and plumule out from the seed coat. The peg usually develops on the concave side of the gravitropically bending transition zone between the hypocotyl and the root. Because cucumber seedlings grown in microgravity developed a peg on each side of the transition zone, it was suggested that peg formation was negatively regulated by gravity on Earth. It has also been suggested that auxin is an essential factor responsible for peg formation. To verify this hypothesis and to understand the molecular mechanism of the gravity-regulated peg formation, we measured the distribution of endogenous auxin in the transition zone, examined the expression patterns of an auxininducible genes (CS-IAAs), auxin response factor and auxin carrier genes (CS-ARFs, CS-AUX1, CS-PIN1). Because ethylene modifies peg development, we examined the expression of ACC synthase genes (CS-ACSs) and its relation to the auxin-mediated development of peg. Furthermore, we examined some other factors that might interact with auxin for peg formation. Based on the results of these studies, we propose a model for the mechanism of peg formation in cucumber seedlings.

  16. Sip1 Is a Catabolite Repression-Specific Negative Regulator of Gal Gene Expression

    PubMed Central

    Mylin, L. M.; Bushman, V. L.; Long, R. M.; Yu, X.; Lebo, C. M.; Blank, T. E.; Hopper, J. E.

    1994-01-01

    The yeast Snflp kinase is required for normal expression of amny genes involved in utilization of non-glucose carbon. Snflp is known to associate with several proteins. One is Sip1p, a protein that becomes phosphorylated in the presence of Snflp and thus is a candidate Snflp kinase substrate. We have isolated the SIP1 gene as a multicopy suppressor of the gal83-associated defect in glucose repression of GAL gene expression. Multicopy SIP1 also suppressed the gal82-associated defect in glucose repression, suggesting that SIP1, GAL83 and GAL82 function interdependently. Multicopy SIP1 gene reduces GAL1, GAL2, GAL7 and GAL10 gene expression three- to fourfold in cells grown in the presence of glucose but has no effect in cells grown on nonrepressing carbon. Sip1-deletion cells exhibited a two- to threefold increase in GAL gene expression compared to wild-type cells when grown on glucose. These studies show that SIP1 is a catabolite repression-specific negative regulator of GAL gene expression. Northern analysis revealed two SIP1 transcripts whose relative abundance changed with carbon source. Western blots revealed that Sip1p abundance is not markedly affected by carbon source, suggesting that Sip1p may be regulated post-translationally. PMID:8088514

  17. Neuronal leucine-rich repeat 1 negatively regulates anaplastic lymphoma kinase in neuroblastoma

    PubMed Central

    Satoh, Shunpei; Takatori, Atsushi; Ogura, Atsushi; Kohashi, Kenichi; Souzaki, Ryota; Kinoshita, Yoshiaki; Taguchi, Tomoaki; Hossain, Md. Shamim; Ohira, Miki; Nakamura, Yohko; Nakagawara, Akira

    2016-01-01

    In neuroblastoma (NB), one of the most common paediatric solid tumours, activation of anaplastic lymphoma kinase (ALK) is often associated with poor outcomes. Although genetic studies have identified copy number alteration and nonsynonymous mutations of ALK, the regulatory mechanism of ALK signalling at protein levels is largely elusive. Neuronal leucine-rich repeat 1 (NLRR1) is a type 1 transmembrane protein that is highly expressed in unfavourable NB and potentially influences receptor tyrosine kinase signalling. Here, we showed that NLRR1 and ALK exhibited a mutually exclusive expression pattern in primary NB tissues by immunohistochemistry. Moreover, dorsal root ganglia of Nlrr1+/+ and Nlrr1−/− mice displayed the opposite expression patterns of Nlrr1 and Alk. Of interest, NLRR1 physically interacted with ALK in vitro through its extracellular region. Notably, the NLRR1 ectodomain impaired ALK phosphorylation and proliferation of ALK-mutated NB cells. A newly identified cleavage of the NLRR1 ectodomain also supported NLRR1-mediated ALK signal regulation in trans. Thus, we conclude that NLRR1 appears to be an extracellular negative regulator of ALK signalling in NB and neuronal development. Our findings may be beneficial to comprehend NB heterogeneity and to develop a novel therapy against unfavourable NB. PMID:27604320

  18. RUNX3 is a novel negative regulator of oncogenic TEAD-YAP complex in gastric cancer.

    PubMed

    Qiao, Y; Lin, S J; Chen, Y; Voon, D C-C; Zhu, F; Chuang, L S H; Wang, T; Tan, P; Lee, S C; Yeoh, K G; Sudol, M; Ito, Y

    2016-05-19

    Runt-related transcription factor 3 (RUNX3) is a well-documented tumour suppressor that is frequently inactivated in gastric cancer. Here, we define a novel mechanism by which RUNX3 exerts its tumour suppressor activity involving the TEAD-YAP complex, a potent positive regulator of proliferative genes. We report that the TEAD-YAP complex is not only frequently hyperactivated in liver and breast cancer, but also confers a strong oncogenic activity in gastric epithelial cells. The increased expression of TEAD-YAP in tumour tissues significantly correlates with poorer overall survival of gastric cancer patients. Strikingly, RUNX3 physically interacts with the N-terminal region of TEAD through its Runt domain. This interaction markedly reduces the DNA-binding ability of TEAD that attenuates the downstream signalling of TEAD-YAP complex. Mutation of RUNX3 at Arginine 122 to Cysteine, which was previously identified in gastric cancer, impairs the interaction between RUNX3 and TEAD. Our data reveal that RUNX3 acts as a tumour suppressor by negatively regulating the TEAD-YAP oncogenic complex in gastric carcinogenesis. PMID:26364597

  19. LGR4 is a receptor for RANKL and negatively regulates osteoclast differentiation and bone resorption.

    PubMed

    Luo, Jian; Yang, Zhengfeng; Ma, Yu; Yue, Zhiying; Lin, Hongyu; Qu, Guojun; Huang, Jinping; Dai, Wentao; Li, Chenghai; Zheng, Chunbing; Xu, Leqin; Chen, Huaqing; Wang, Jiqiu; Li, Dali; Siwko, Stefan; Penninger, Josef M; Ning, Guang; Xiao, Jianru; Liu, Mingyao

    2016-05-01

    Tumor necrosis factor (TNF) superfamily member 11 (TNFSF11, also known as RANKL) regulates multiple physiological or pathological functions, including osteoclast differentiation and osteoporosis. TNFRSF11A (also called RANK) is considered to be the sole receptor for RANKL. Herein we report that leucine-rich repeat-containing G-protein-coupled receptor 4 (LGR4, also called GPR48) is another receptor for RANKL. LGR4 competes with RANK to bind RANKL and suppresses canonical RANK signaling during osteoclast differentiation. RANKL binding to LGR4 activates the Gαq and GSK3-β signaling pathway, an action that suppresses the expression and activity of nuclear factor of activated T cells, cytoplasmic, calcineurin-dependent 1 (NFATC1) during osteoclastogenesis. Both whole-body (Lgr4(-/-)) and monocyte conditional knockout mice of Lgr4 (Lgr4 CKO) exhibit osteoclast hyperactivation (including elevation of osteoclast number, surface area, and size) and increased bone erosion. The soluble LGR4 extracellular domain (ECD) binds RANKL and inhibits osteoclast differentiation in vivo. Moreover, LGR4-ECD therapeutically abrogated RANKL-induced bone loss in three mouse models of osteoporosis. Therefore, LGR4 acts as a second RANKL receptor that negatively regulates osteoclast differentiation and bone resorption. PMID:27064449

  20. The PhoP transcription factor negatively regulates avermectin biosynthesis in Streptomyces avermitilis.

    PubMed

    Yang, Renjun; Liu, Xingchao; Wen, Ying; Song, Yuan; Chen, Zhi; Li, Jilun

    2015-12-01

    Bacteria sense and respond to the stress of phosphate limitation, anticipating Pi deletion/starvation via the two-component PhoR-PhoP system. The role of the response regulator PhoP in primary metabolism and avermectin biosynthesis in Streptomyces avermitilis was investigated. In response to phosphate starvation, S. avermitilis PhoP, like Streptomyces coelicolor and Streptomyces lividans PhoP, activates the expression of phoRP, phoU, and pstS by binding to the PHO boxes in their promoter regions. Avermectin biosynthesis was significantly increased in ΔphoP deletion mutants. Electrophoretic mobility gel shift assay (EMSA) and DNase I footprinting assays showed that PhoP can bind to a PHO box formed by two direct repeat units of 11 nucleotides located downstream of the transcriptional start site of aveR. By negatively regulating the transcription of aveR, PhoP directly affects avermectin biosynthesis in S. avermitilis. PhoP indirectly affects melanogenesis on Casaminoacids Minimal Medium (MMC) lacking supplemental phosphate. Nitrogen metabolism and some key genes involved in morphological differentiation and antibiotic production in S. avermitilis are also under the control of PhoP. PMID:26298701

  1. NCoR negatively regulates adipogenic differentiation of mesenchymal stem cells.

    PubMed

    Hong-Wei, Gao; Lan, Liu; De-Guo, Xing; Zhong-Hao, Liu; Peng, Ren; Zhi-Qiang, Li; Guo-Qiang, Shan; Ming-Zhi, Gong

    2015-08-01

    The nuclear receptor corepressor (NCoR) regulates the activities of gene transcription. Mesenchymal stem cells (MSCs) derived from bone marrow are multipotent cells which can differentiate into osteoblasts and adipocytes. This study was conducted to investigate the effects of NCoR on adipogenic differentiation of MSCs isolated from the rats. The results suggested that rat MSCs could differentiate into adipocytes successfully after cultured in adipogenic medium. NCoR protein determined by Western blot showed a lower expression in MSC-derived adipocytes, indicating that NCoR was involved in adipocyte differentiation of rat MSCs. It further proved that small interfering RNA (siRNA)-mediated knockdown of NCoR could promote cell viability and differentiation and enhance messenger RNA (mRNA) expression of lipoprotein lipase (LPL) and protein expression of CCAAT/enhancer binding protein-α (C/EBPα) and peroxisome proliferator-activated receptor-γ (PPARγ). However, over-expression of NCoR exerted its functions in contrary to NCoR knockdown. It indicated that NCoR could negatively regulate adipogenic differentiation of rat MSCs. PMID:26019118

  2. Regulated Breathing Effect of Silicon Negative Electrode for Dramatically Enhanced Performance of Li-Ion Battery

    SciTech Connect

    Xiao, Xingcheng; Zhou, Weidong; Kim, Youngnam; Ryu, Ill; Gu, Meng; Wang, Chong M.; Liu, Gao; Liu, Zhongyi; Gao, Huajian

    2015-03-01

    Si is an attractive negative electrode material for lithium ion batteries due to its high specifi c capacity (≈3600 mAh g –1 ). However, the huge volume swelling and shrinking during cycling, which mimics a breathing effect at the material/electrode/cell level, leads to several coupled issues including fracture of Si particles, unstable solid electrolyte interphase, and low Coulombic effi ciency. In this work, the regulation of the breathing effect is reported by using Si–C yolk–shell nanocomposite which has been well-developed by other researchers. The focus is on understanding how the nanoscaled materials design impacts the mechanical and electrochemical response at electrode level. For the fi rst time, it is possible to observe one order of magnitude of reduction on breathing effect at the electrode level during cycling: the electrode thickness variation reduced down to 10%, comparing with 100% in the electrode with Si nanoparticles as active materials. The Si–C yolk–shell nanocomposite electrode exhibits excellent capacity retention and high cycle effi ciency. In situ transmission electron microscopy and fi nite element simulations consistently reveals that the dramatically enhanced performance is associated with the regulated breathing of the Si in the new composite, therefore the suppression of the overall electrode expansion.

  3. Rem2 Is an Activity-Dependent Negative Regulator of Dendritic Complexity In Vivo

    PubMed Central

    Ghiretti, Amy E.; Moore, Anna R.; Brenner, Rebecca G.; Chen, Liang-Fu; West, Anne E.; Lau, Nelson C.; Van Hooser, Stephen D.

    2014-01-01

    A key feature of the CNS is structural plasticity, the ability of neurons to alter their morphology and connectivity in response to sensory experience and other changes in the environment. How this structural plasticity is achieved at the molecular level is not well understood. We provide evidence that changes in sensory experience simultaneously trigger multiple signaling pathways that either promote or restrict growth of the dendritic arbor; structural plasticity is achieved through a balance of these opposing signals. Specifically, we have uncovered a novel, activity-dependent signaling pathway that restricts dendritic arborization. We demonstrate that the GTPase Rem2 is regulated at the transcriptional level by calcium influx through L-VGCCs and inhibits dendritic arborization in cultured rat cortical neurons and in the Xenopus laevis tadpole visual system. Thus, our results demonstrate that changes in neuronal activity initiate competing signaling pathways that positively and negatively regulate the growth of the dendritic arbor. It is the balance of these opposing signals that leads to proper dendritic morphology. PMID:24403140

  4. The murine stanniocalcin 2 gene is a negative regulator of postnatal growth.

    PubMed

    Chang, Andy C-M; Hook, Jeff; Lemckert, Frances A; McDonald, Michelle M; Nguyen, Mai-Anh T; Hardeman, Edna C; Little, David G; Gunning, Peter W; Reddel, Roger R

    2008-05-01

    Stanniocalcin (STC), a secreted glycoprotein, was first studied in fish as a classical hormone with a role in regulating serum calcium levels. There are two closely related proteins in mammals, STC1 and STC2, with functions that are currently unclear. Both proteins are expressed in numerous mammalian tissues rather than being secreted from a specific endocrine gland. No phenotype has been detected yet in Stc1-null mice, and to investigate whether Stc2 could have compensated for the loss of Stc1, we have now generated Stc2(-/-) and Stc1(-/-) Stc2(-/-) mice. Although Stc1 is expressed in the ovary and lactating mouse mammary glands, like the Stc1(-/-) mice, the Stc1(-/-) Stc2(-/-) mice had no detected decrease in fertility, fecundity, or weight gain up until weaning. Serum calcium and phosphate levels were normal in Stc1(-/-) Stc2(-/-) mice, indicating it is unlikely that the mammalian stanniocalcins have a major physiological role in mineral homeostasis. Mice with Stc2 deleted were 10-15% larger and grew at a faster rate than wild-type mice from 4 wk onward, and the Stc1(-/-) Stc2(-/-) mice had a similar growth phenotype. This effect was not mediated through the GH/IGF-I axis. The results are consistent with STC2 being a negative regulator of postnatal growth. PMID:18258678

  5. The Vacuolar ATPase a2-subunit regulates Notch signaling in triple-negative breast cancer cells

    PubMed Central

    Pamarthy, Sahithi; Jaiswal, Mukesh K.; Kulshreshtha, Arpita; Katara, Gajendra K.; Gilman-Sachs, Alice; Beaman, Kenneth D.

    2015-01-01

    Triple Negative Breast Cancer (TNBC) is a subtype of breast cancer with poor prognosis for which no targeted therapies are currently available. Notch signaling has been implicated in breast cancer but the factors that control Notch in TNBC are unknown. Because the Vacuolar ATPase has been shown to be important in breast cancer invasiveness, we investigated the role of a2-subunit isoform of Vacuolar ATPase (a2V) in regulating Notch signaling in TNBC. Confocal microscopy revealed that among all the ‘a’ subunit isoforms, a2V was uniquely expressed on the plasma membrane of breast cancer cells. Both a2V and NOTCH1 were elevated in TNBC tumors tissues and cell lines. a2V knockdown by siRNA as well as V-ATPase inhibition by Bafilomycin A1 (Baf A1) in TNBC cell lines enhanced Notch signaling by increasing the expression of Notch1 intracellular Domain (N1ICD). V-ATPase inhibition blocked NICD degradation by disrupting autophagy and lysosomal acidification as demonstrated by accumulation of LC3B and diminished expression of LAMP1 respectively. Importantly, treatment with Baf A1 or anti-a2V, a novel-neutralizing antibody against a2V hindered cell migration of TNBC cells. Our findings indicate that a2V regulates Notch signaling through its role in endolysosomal acidification and emerges as a potential target for TNBC. PMID:26418877

  6. TIPE1 induces apoptosis by negatively regulating Rac1 activation in hepatocellular carcinoma cells.

    PubMed

    Zhang, Z; Liang, X; Gao, L; Ma, H; Liu, X; Pan, Y; Yan, W; Shan, H; Wang, Z; Chen, Y H; Ma, C

    2015-05-14

    TIPE1 (tumor necrosis factor-α-induced protein 8-like 1 or TNFAIP8L1) is a newly identified member of the TIPE (TNFAIP8) family, which play roles in regulating cell death. However, the biologic functions of TIPE1 in physiologic and pathologic conditions are largely unknown. Here, we report the roles of TIPE1 in hepatocellular carcinoma (HCC). Evaluated by immunohistochemical staining, HCC tissues showed significantly downregulated TIPE1 expression compared with adjacent non-tumor tissues, which positively correlated with tumor pathologic grades and patient survival. Using a homograft tumor model in Balb/c mice, we discovered that TIPE1 significantly diminished the growth and tumor weight of murine liver cancer homografts. Consistently, TIPE1 inhibited both cell growth and colony formation ability of cultured HCC cell lines, which was further identified to be due to TIPE1-inducing apoptosis in a caspase-independent, necrostatin-1 (Nec-1)-insensitive manner. Furthermore, mechanistic investigations revealed that TIPE1 interacted with Rac1, and inhibited the activation of Rac1 and its downstream p65 and c-Jun N-terminal kinase pathway. Moreover, overexpression of constitutively active Rac1 partially rescued the apoptosis induced by TIPE1, and Rac1 knockdown significantly restored the deregulated cell growth induced by TIPE1 small interfering RNA. Our findings revealed that TIPE1 induced apoptosis in HCC cells by negatively regulating Rac1 pathway, and loss of TIPE1 might be a new prognostic indicator for HCC patients. PMID:25043299

  7. AMPK is a negative regulator of the Warburg Effect and suppresses tumor growth in vivo

    PubMed Central

    Faubert, Brandon; Boily, Gino; Izreig, Said; Griss, Takla; Samborska, Bozena; Dong, Zhifeng; Dupuy, Fanny; Chambers, Christopher; Fuerth, Benjamin J.; Viollet, Benoit; Mamer, Orval A.; Avizonis, Daina; DeBerardinis, Ralph J.; Siegel, Peter M.; Jones, Russell G.

    2012-01-01

    Summary AMPK is a metabolic sensor that helps maintain cellular energy homeostasis. Despite evidence linking AMPK with tumor suppressor functions, the role of AMPK in tumorigenesis and tumor metabolism is unknown. Here we show that AMPK negatively regulates aerobic glycolysis (the Warburg effect) in cancer cells, and suppresses tumor growth in vivo. Genetic ablation of the α1 catalytic subunit of AMPK accelerates Myc-induced lymphomagenesis. Inactivation of AMPKα in both transformed and non-transformed cells promotes a metabolic shift to aerobic glycolysis, increased allocation of glucose carbon into lipids, and biomass accumulation. These metabolic effects require normoxic stabilization of the hypoxia-inducible factor-1α (HIF-1α), as silencing HIF-1α reverses the shift to aerobic glycolysis and the biosynthetic and proliferative advantages conferred by reduced AMPKα signaling. Together our findings suggest that AMPK activity opposes tumor development, and its loss fosters tumor progression in part by regulating cellular metabolic pathways that support cell growth and proliferation. PMID:23274086

  8. Lrig2 Negatively Regulates Ectodomain Shedding of Axon Guidance Receptors by ADAM Proteases.

    PubMed

    van Erp, Susan; van den Heuvel, Dianne M A; Fujita, Yuki; Robinson, Ross A; Hellemons, Anita J C G M; Adolfs, Youri; Van Battum, Eljo Y; Blokhuis, Anna M; Kuijpers, Marijn; Demmers, Jeroen A A; Hedman, Håkan; Hoogenraad, Casper C; Siebold, Christian; Yamashita, Toshihide; Pasterkamp, R Jeroen

    2015-12-01

    Many guidance receptors are proteolytically cleaved by membrane-associated metalloproteases of the ADAM family, leading to the shedding of their ectodomains. Ectodomain shedding is crucial for receptor signaling and function, but how this process is controlled in neurons remains poorly understood. Here, we show that the transmembrane protein Lrig2 negatively regulates ADAM-mediated guidance receptor proteolysis in neurons. Lrig2 binds Neogenin, a receptor for repulsive guidance molecules (RGMs), and prevents premature Neogenin shedding by ADAM17 (TACE). RGMa reduces Lrig2-Neogenin interactions, providing ADAM17 access to Neogenin and allowing this protease to induce ectodomain shedding. Regulation of ADAM17-mediated Neogenin cleavage by Lrig2 is required for neurite growth inhibition by RGMa in vitro and for cortical neuron migration in vivo. Furthermore, knockdown of Lrig2 significantly improves CNS axon regeneration. Together, our data identify a unique ligand-gated mechanism to control receptor shedding by ADAMs and reveal functions for Lrigs in neuron migration and regenerative failure. PMID:26651291

  9. Splicing factor SRSF1 negatively regulates alternative splicing of MDM2 under damage

    PubMed Central

    Comiskey, Daniel F.; Jacob, Aishwarya G.; Singh, Ravi K.; Tapia-Santos, Aixa S.; Chandler, Dawn S.

    2015-01-01

    Genotoxic stress induces alternative splicing of the oncogene MDM2 generating MDM2-ALT1, an isoform attributed with tumorigenic properties. However, the mechanisms underlying this event remain unclear. Here we explore MDM2 splicing regulation by utilizing a novel minigene that mimics endogenous MDM2 splicing in response to UV and cisplatinum-induced DNA damage. We report that exon 11 is necessary and sufficient for the damage-specific alternative splicing of the MDM2 minigene and that the splicing factor SRSF1 binds exon 11 at evolutionarily conserved sites. Interestingly, mutations disrupting this interaction proved sufficient to abolish the stress-induced alternative splicing of the MDM2 minigene. Furthermore, SRSF1 overexpression promoted exclusion of exon 11, while its siRNA-mediated knockdown prevented the stress-induced alternative splicing of endogenous MDM2. Additionally, we observed elevated SRSF1 levels under stress and in tumors correlating with the expression of MDM2-ALT1. Notably, we demonstrate that MDM2-ALT1 splicing can be blocked by targeting SRSF1 sites on exon 11 using antisense oligonucleotides. These results present conclusive evidence supporting a negative role for SRSF1 in MDM2 alternative splicing. Importantly, we define for the first time, a clear-cut mechanism for the regulation of damage-induced MDM2 splicing and present potential strategies for manipulating MDM2 expression via splicing modulation. PMID:25845590

  10. IMP3 promotes stem-like properties in triple-negative breast cancer by regulating SLUG.

    PubMed

    Samanta, S; Sun, H; Goel, H L; Pursell, B; Chang, C; Khan, A; Greiner, D L; Cao, S; Lim, E; Shultz, L D; Mercurio, A M

    2016-03-01

    IMP3 (insulin-like growth factor-2 mRNA binding protein 3) is an oncofetal protein whose expression is prognostic for poor outcome in several cancers. Although IMP3 is expressed preferentially in triple-negative breast cancer (TNBC), its function is poorly understood. We observed that IMP3 expression is significantly higher in tumor initiating than in non-tumor initiating breast cancer cells and we demonstrate that IMP3 contributes to self-renewal and tumor initiation, properties associated with cancer stem cells (CSCs). The mechanism by which IMP3 contributes to this phenotype involves its ability to induce the stem cell factor SOX2. IMP3 does not interact with SOX2 mRNA significantly or regulate SOX2 expression directly. We discovered that IMP3 binds avidly to SNAI2 (SLUG) mRNA and regulates its expression by binding to the 5' UTR. This finding is significant because SLUG has been implicated in breast CSCs and TNBC. Moreover, we show that SOX2 is a transcriptional target of SLUG. These data establish a novel mechanism of breast tumor initiation involving IMP3 and they provide a rationale for its association with aggressive disease and poor outcome. PMID:25982283

  11. MDM1 is a microtubule-binding protein that negatively regulates centriole duplication

    PubMed Central

    Van de Mark, Daniel; Kong, Dong; Loncarek, Jadranka; Stearns, Tim

    2015-01-01

    Mouse double-minute 1 (Mdm1) was originally identified as a gene amplified in transformed mouse cells and more recently as being highly up-regulated during differentiation of multiciliated epithelial cells, a specialized cell type having hundreds of centrioles and motile cilia. Here we show that the MDM1 protein localizes to centrioles of dividing cells and differentiating multiciliated cells. 3D-SIM microscopy showed that MDM1 is closely associated with the centriole barrel, likely residing in the centriole lumen. Overexpression of MDM1 suppressed centriole duplication, whereas depletion of MDM1 resulted in an increase in granular material that likely represents early intermediates in centriole formation. We show that MDM1 binds microtubules in vivo and in vitro. We identified a repeat motif in MDM1 that is required for efficient microtubule binding and found that these repeats are also present in CCSAP, another microtubule-binding protein. We propose that MDM1 is a negative regulator of centriole duplication and that its function is mediated through microtubule binding. PMID:26337392

  12. Ubc9 negatively regulates BMP-mediated osteoblastic differentiation in cultured cells.

    PubMed

    Yukita, Akira; Hosoya, Akihiro; Ito, Yuzuru; Katagiri, Takenobu; Asashima, Makoto; Nakamura, Hiroaki

    2012-05-01

    SUMO (small ubiquitin-related modifier) modification (SUMOylation) has been reported to regulate various biological events such as cell-cycle progression, proliferation, and survival. Bone morphogenetic proteins (BMPs) play an important role in osteoblast differentiation and maturation. Although Smad4, which acts as a transcriptional factor in the BMP signaling, is a target of SUMOylation, the involvement of SUMOylation in osteoblast differentiation remains unclear. In this report, we demonstrated spatial expression patterns of SUMO proteins and Ubc9 (ubiquitin conjugating enzyme 9), which is a unique E2-SUMOylation enzyme, in mouse tibia. Furthermore, siRNA knockdown of Ubc9 enhanced osteoblastic differentiation induced by BMP2 in C2C12 mouse myoblasts and ST2 mouse bone-marrow derived stromal cells. Ubc9 knockdown elevated the BMP signaling transduction and reduced the expression of muscle-related genes in cooperation with BMP2. Finally, a luciferase assay using an Id1 (target gene of BMP signaling) reporter revealed that Smad4 mutants prevented from SUMOylation at their Lys158 possessed more potent transcriptional activity than wild-type Smad4. Taken together, these findings suggest that Ubc9 negatively regulates osteoblastic differentiation induced by BMP via, at least in part, SUMOylation of Smad4. PMID:22366399

  13. Cif is negatively regulated by the TetR family repressor CifR.

    PubMed

    MacEachran, Daniel P; Stanton, Bruce A; O'Toole, George A

    2008-07-01

    We previously reported that the novel Pseudomonas aeruginosa toxin Cif is capable of decreasing apical membrane expression of the cystic fibrosis transmembrane conductance regulator (CFTR). We further demonstrated that Cif is capable of degrading the synthetic epoxide hydrolase (EH) substrate S-NEPC [(2S,3S)-trans-3-phenyl-2-oxiranylmethyl 4-nitrophenol carbonate], suggesting that Cif may be reducing apical membrane expression of CFTR via its EH activity. Here we report that Cif is capable of degrading the xenobiotic epoxide epibromohydrin (EBH) to its vicinal diol 3-bromo-1,2-propanediol. We also demonstrate that this epoxide is a potent inducer of cif gene expression. We show that the predicted TetR family transcriptional repressor encoded by the PA2931 gene, which is immediately adjacent to and divergently transcribed from the cif-containing, three-gene operon, negatively regulates cif gene expression by binding to the promoter region immediately upstream of the cif-containing operon. Furthermore, this protein-DNA interaction is disrupted by the epoxide EBH in vitro, suggesting that the binding of EBH by the PA2931 protein product drives the disassociation from its DNA-binding site. Given its role as a repressor of cif gene expression, we have renamed PA2931 as CifR. Finally, we demonstrate that P. aeruginosa strains isolated from cystic fibrosis patient sputum with increased cif gene expression are impaired for the expression of the cifR gene. PMID:18458065

  14. Regnase-1 in microglia negatively regulates high mobility group box 1-mediated inflammation and neuronal injury

    PubMed Central

    Liu, Xiao-Xi; Wang, Chen; Huang, Shao-Fei; Chen, Qiong; Hu, Ya-Fang; Zhou, Liang; Gu, Yong

    2016-01-01

    Extracellular high mobility group box 1 (HMGB1) has been demonstrated to function as a proinflammatory cytokine and induces neuronal injury in response to various pathological stimuli in central nervous system (CNS). However, the regulatory factor involved in HMGB1-mediated inflammatory signaling is largely unclear. Regulatory RNase 1 (Regnase-1) is a potent anti-inflammation enzyme that can degrade a set of mRNAs encoding proinflammatory cytokines. The present study aims to determine the role of Regnase-1 in the regulation of HMGB1-mediated inflammatory injury in CNS. Cultured microglia and rat brain were treated with recombinant HMGB1 to examine the induction of Regnase-1 expression. Moreover, the role of Regnase-1 in modulating the expression of inflammatory cytokines and neuronal injury was then investigated in microglia by specific siRNA knockdown upon HMGB1 treatment. Results showed that HMGB1 could significantly induce the de novo synthesis of Regnase-1 in cultured microglia. Consistently, Regnase-1 was elevated and found to be co-localized with microglia marker in the brain of rat treated with HMGB1. Silencing Regnase-1 in microglia enhanced HMGB1-induced expression of proinflammatory cytokines and exacerbated neuronal toxicity. Collectively, these results suggest that Regnase-1 can be induced by HMGB1 in microglia and negatively regulates HMGB1-mediated neuroinflammation and neuronal toxicity. PMID:27044405

  15. Mitofusin 1 Is Negatively Regulated by MicroRNA 140 in Cardiomyocyte Apoptosis

    PubMed Central

    Li, Jincheng; Li, Yuzhen; Jiao, Jianqin; Wang, Jianxun; Li, Yanrui

    2014-01-01

    MicroRNAs (miRNAs) are a class of small noncoding RNAs that mediate posttranscriptional gene silencing. Mitochondrial fission participates in the induction of apoptosis. It remains largely unknown whether miRNAs can regulate mitochondrial fission. Reactive oxygen species and doxorubicin could induce mitochondrial fission and apoptosis in cardiomyocytes. Concomitantly, mitofusin 1 (Mfn1) was downregulated, whereas miRNA 140 (miR-140) was upregulated upon apoptotic stimulation. We investigated whether Mfn1 and miR-140 play a functional role in mitochondrial fission and apoptosis. Ectopic expression of Mfn1 attenuated mitochondrial fission and apoptosis. Knockdown of miR-140 inhibited mitochondrial fission. Our results further revealed that knockdown of miR-140 was able to reduce myocardial infarct sizes in an animal model. We observed that miR-140 could suppress the expression of Mfn1, and it exerted its effect on mitochondrial fission and apoptosis through targeting Mfn1. Our data revealed that mitochondrial fission occurs in cardiomyocytes and can be counteracted by Mfn1. However, the function of Mfn1 is negatively regulated by miR-140. Our present work suggests that Mfn1 and miR-140 are integrated into the program of cardiomyocyte apoptosis. PMID:24615014

  16. Atf3 negatively regulates Ptgs2/Cox2 expression during acute inflammation

    PubMed Central

    Hellmann, Jason; Tang, Yunan; Zhang, Michael J.; Hai, Tsonwin; Bhatnagar, Aruni; Srivastava, Sanjay; Spite, Matthew

    2015-01-01

    By generating prostaglandins, cyclooxygenase-2 (Cox-2/Ptgs2) plays a critical role in regulating inflammatory responses. While several inflammatory stimuli have been shown to increase Ptgs2 expression, less is known about how the transcription of this gene is terminated. Here we show that stimulation of macrophages with yeast zymosan, a TLR2/6 and dectin-1 agonist, causes a transient increase in the expression of Ptgs2 accompanied by a simultaneous increase in the expression of the transcriptional repressor, Activating transcription factor-3 (Atf3). The expression of Ptgs2 was significantly higher in resident peritoneal macrophages isolated from Atf3−/− mice than that from Atf3+/+ mice and was associated with higher prostaglandin production upon stimulation with zymosan. In activated macrophages, Atf3 accumulated in the nucleus and chromatin-immunoprecipitation analysis showed that Atf3 is recruited to the Ptgs2 promoter region. In acute peritonitis and in cutaneous wounds, there was increased leukocyte accumulation and higher levels of prostaglandins (PGE2/PGD2) in inflammatory exudates of Atf3−/− mice compared with WT mice. Collectively, these results demonstrate that during acute inflammation Atf3 negatively regulates Ptgs2 and therefore dysregulation of this axis could potentially contribute to aberrant Ptgs2 expression in chronic inflammatory diseases. Moreover, this axis could be a new therapeutic target for suppressing Ptgs2 expression and the resultant inflammatory responses. PMID:25619459

  17. proBDNF negatively regulates neuronal remodeling, synaptic transmission, and synaptic plasticity in hippocampus.

    PubMed

    Yang, Jianmin; Harte-Hargrove, Lauren C; Siao, Chia-Jen; Marinic, Tina; Clarke, Roshelle; Ma, Qian; Jing, Deqiang; Lafrancois, John J; Bath, Kevin G; Mark, Willie; Ballon, Douglas; Lee, Francis S; Scharfman, Helen E; Hempstead, Barbara L

    2014-05-01

    Experience-dependent plasticity shapes postnatal development of neural circuits, but the mechanisms that refine dendritic arbors, remodel spines, and impair synaptic activity are poorly understood. Mature brain-derived neurotrophic factor (BDNF) modulates neuronal morphology and synaptic plasticity, including long-term potentiation (LTP) via TrkB activation. BDNF is initially translated as proBDNF, which binds p75(NTR). In vitro, recombinant proBDNF modulates neuronal structure and alters hippocampal long-term plasticity, but the actions of endogenously expressed proBDNF are unclear. Therefore, we generated a cleavage-resistant probdnf knockin mouse. Our results demonstrate that proBDNF negatively regulates hippocampal dendritic complexity and spine density through p75(NTR). Hippocampal slices from probdnf mice exhibit depressed synaptic transmission, impaired LTP, and enhanced long-term depression (LTD) in area CA1. These results suggest that proBDNF acts in vivo as a biologically active factor that regulates hippocampal structure, synaptic transmission, and plasticity, effects that are distinct from those of mature BDNF. PMID:24746813

  18. Purification and Crystallization of Murine Myostatin: A Negative Regulator of Muscle Mass

    NASA Technical Reports Server (NTRS)

    Hong, Young S.; Adamek, Daniel; Bridge, Kristi; Malone, Christine C.; Young, Ronald B.; Miller, Teresa; Karr, Laurel

    2004-01-01

    Myostatin (MSTN) has been crystallized and its preliminary X-ray diffraction data were collected. MSTN is a negative regulator of muscle growt/differentiation and suppressor of fat accumulation. It is a member of TGF-b family of proteins. Like other members of this family, the regulation of MSTN is critically tied to its process of maturation. This process involves the formation of a homodimer followed by two proteolytic steps. The first proteolytic cleavage produces a species where the n-terminal portion of the dimer is covalently separated from, but remains non-covalently bound to, the c-terminal, functional, portion of the protein. The protein is activated upon removal of the n-terminal "pro-segment" by a second n-terminal proteolytic cut by BMP-1 in vivo, or by acid treatment in vitro. Understanding the structural nature and physical interactions involved in these regulatory processes is the objective of our studies. Murine MSTN was purified from culture media of genetically engineered Chinese Hamster Ovary cells by multicolumn purification process and crystallized using the vapor diffusion method.

  19. Small heterodimer partner interacts with NLRP3 and negatively regulates activation of the NLRP3 inflammasome

    PubMed Central

    Yang, Chul-Su; Kim, Jwa-Jin; Kim, Tae Sung; Lee, Phil Young; Kim, Soo Yeon; Lee, Hye-Mi; Shin, Dong-Min; Nguyen, Loi T.; Lee, Moo-Seung; Jin, Hyo Sun; Kim, Kwang-Kyu; Lee, Chul-Ho; Kim, Myung Hee; Park, Sung Goo; Kim, Jin-Man; Choi, Hueng-Sik; Jo, Eun-Kyeong

    2015-01-01

    Excessive activation of the NLRP3 inflammasome results in damaging inflammation, yet the regulators of this process remain poorly defined. Herein, we show that the orphan nuclear receptor small heterodimer partner (SHP) is a negative regulator of NLRP3 inflammasome activation. NLRP3 inflammasome activation leads to an interaction between SHP and NLRP3, proteins that are both recruited to mitochondria. Overexpression of SHP competitively inhibits binding of NLRP3 to apoptosis-associated speck-like protein containing a CARD (ASC). SHP deficiency results in increased secretion of proinflammatory cytokines IL-1β and IL-18, and excessive pathologic responses typically observed in mouse models of kidney tubular necrosis and peritoneal gout. Notably, the loss of SHP results in accumulation of damaged mitochondria and a sustained interaction between NLRP3 and ASC in the endoplasmic reticulum. These data are suggestive of a role for SHP in controlling NLRP3 inflammasome activation through a mechanism involving interaction with NLRP3 and maintenance of mitochondrial homeostasis. PMID:25655831

  20. BAT3 negatively regulates lipopolysaccharide-induced NF-κB signaling through TRAF6.

    PubMed

    Lee, Yeojin; Lee, In Young; Yun, Hee Jae; Lee, Woo Sang; Kang, Seongman; Cho, Ssang-Goo; Lee, Ji Eun; Choi, Eui-Ju

    2016-09-16

    TNF receptor-associated factor 6 (TRAF6) plays a critical role in NF-κB and mitogen-activated protein kinase (MAPK) signaling pathways, both of which mediate macrophage activation in response to pathogen-associated molecular patterns such as bacterial endotoxin, lipopolysaccharides (LPS). In this study, we investigated whether HLA-B associated transcript-3 (BAT3) regulates LPS-induced macrophage activation. BAT3 physically interacted with TRAF6 in macrophages, and this interaction was enhanced in the cells after LPS treatment. Furthermore, BAT3 inhibited the homo-oligomerization of TRAF6 as well as the interaction between TRAF6 and its downstream kinase transforming growth factor beta-activated kinase 1 (TAK1), thereby suppressing TRAF6-mediated signaling events. Intriguingly, TRAF6 mediated ubiquitination of BAT3 and this ubiquitination was crucial for its inhibitory effect on TRAF6-mediated signaling. Depletion of BAT3 by RNA interference resulted in enhancement of LPS-induced activation of the NF-κB signaling with increasing expression levels of pro-inflammatory cytokines. These findings suggest that BAT3 functions as the negative regulator of LPS-induced macrophage activation. PMID:27501752

  1. Positive and negative regulation of odor receptor gene choice in Drosophila by acj6.

    PubMed

    Bai, Lei; Goldman, Aaron L; Carlson, John R

    2009-10-14

    Little is known about how individual olfactory receptor neurons (ORNs) select, from among many odor receptor genes, which genes to express. Abnormal chemosensory jump 6 (Acj6) is a POU domain transcription factor essential for the specification of ORN identity and odor receptor (Or) gene expression in the Drosophila maxillary palp, one of the two adult olfactory organs. However, the mechanism by which Acj6 functions in this process has not been investigated. Here, we systematically examine the role of Acj6 in the maxillary palp and in a major subset of antennal ORNs. We define an Acj6 binding site by a reiterative in vitro selection process. The site is found upstream of Or genes regulated by Acj6, and Acj6 binds to the site in Or promoters. Mutational analysis shows that the site is essential for Or regulation in vivo. Surprisingly, a novel ORN class in acj6 adults is found to arise from ectopic expression of a larval Or gene, which is repressed in wild type via an Acj6 binding site. Thus, Acj6 acts directly in the process of receptor gene choice; it plays a dual role, positive and negative, in the logic of the process, and acts in partitioning the larval and adult receptor repertoires. PMID:19828808

  2. Neuronal leucine-rich repeat 1 negatively regulates anaplastic lymphoma kinase in neuroblastoma.

    PubMed

    Satoh, Shunpei; Takatori, Atsushi; Ogura, Atsushi; Kohashi, Kenichi; Souzaki, Ryota; Kinoshita, Yoshiaki; Taguchi, Tomoaki; Hossain, Md Shamim; Ohira, Miki; Nakamura, Yohko; Nakagawara, Akira

    2016-01-01

    In neuroblastoma (NB), one of the most common paediatric solid tumours, activation of anaplastic lymphoma kinase (ALK) is often associated with poor outcomes. Although genetic studies have identified copy number alteration and nonsynonymous mutations of ALK, the regulatory mechanism of ALK signalling at protein levels is largely elusive. Neuronal leucine-rich repeat 1 (NLRR1) is a type 1 transmembrane protein that is highly expressed in unfavourable NB and potentially influences receptor tyrosine kinase signalling. Here, we showed that NLRR1 and ALK exhibited a mutually exclusive expression pattern in primary NB tissues by immunohistochemistry. Moreover, dorsal root ganglia of Nlrr1+/+ and Nlrr1-/- mice displayed the opposite expression patterns of Nlrr1 and Alk. Of interest, NLRR1 physically interacted with ALK in vitro through its extracellular region. Notably, the NLRR1 ectodomain impaired ALK phosphorylation and proliferation of ALK-mutated NB cells. A newly identified cleavage of the NLRR1 ectodomain also supported NLRR1-mediated ALK signal regulation in trans. Thus, we conclude that NLRR1 appears to be an extracellular negative regulator of ALK signalling in NB and neuronal development. Our findings may be beneficial to comprehend NB heterogeneity and to develop a novel therapy against unfavourable NB. PMID:27604320

  3. Tmem178 acts in a novel negative feedback loop targeting NFATc1 to regulate bone mass

    PubMed Central

    Decker, Corinne E.; Yang, Zhengfeng; Rimer, Ryan; Park-Min, Kyung-Hyun; Macaubas, Claudia; Mellins, Elizabeth D.; Novack, Deborah V.; Faccio, Roberta

    2015-01-01

    Phospholipase C gamma-2 (PLCγ2)-dependent calcium (Ca2+) oscillations are indispensable for nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1) activation and downstream gene transcription driving osteoclastogenesis during skeletal remodeling and pathological bone loss. Here we describe, to our knowledge, the first known function of transmembrane protein 178 (Tmem178), a PLCγ2 downstream target gene, as a critical modulator of the NFATc1 axis. In surprising contrast to the osteopetrotic phenotype of PLCγ2−/− mice, Tmem178−/− mice are osteopenic in basal conditions and are more susceptible to inflammatory bone loss, owing to enhanced osteoclast formation. Mechanistically, Tmem178 localizes to the ER membrane and regulates RANKL-induced Ca2+ fluxes, thus controlling NFATc1 induction. Importantly, down-regulation of Tmem178 is observed in human CD14+ monocytes exposed to plasma from systemic juvenile idiopathic arthritis patients. Similar to the mouse model, reduced Tmem178 expression in human cells correlates with excessive osteoclastogenesis. In sum, these findings identify an essential role for Tmem178 to maintain skeletal mass and limit pathological bone loss. PMID:26644563

  4. CLCA2, a target of the p53 family, negatively regulates cancer cell migration and invasion.

    PubMed

    Sasaki, Yasushi; Koyama, Ryota; Maruyama, Reo; Hirano, Takehiro; Tamura, Miyuki; Sugisaka, Jun; Suzuki, Hiromu; Idogawa, Masashi; Shinomura, Yasuhisa; Tokino, Takashi

    2012-12-01

    The tumor suppressor p53 transcriptionally regulates a number of genes that are involved in cell-cycle inhibition, apoptosis and the maintenance of genetic stability. Recent studies suggest that p53 also contributes to the regulation of cell migration and invasion. Here, we show that human chloride channel accessory-2 (CLCA2) is a target gene of the p53 family (p53, p73 and p63). CLCA2 is induced by DNA damage in a p53-dependent manner. The p53 family proteins activate the CLCA2 promoter by binding directly to the conserved consensus p53-binding site present in the CLCA2 promoter. In terms of function, ectopic expression of CLCA2 inhibited cancer cell migration. In contrast, silencing CLCA2 with siRNA stimulated cancer cell migration and invasion. We also found that inactivation of CLCA2 enhanced the expression of focal adhesion kinase (FAK), as well as its promoter activation. A small-molecule FAK inhibitor reduced the effect of CLCA2 siRNA on cell migration and invasion, suggesting that CLCA2 inhibits cancer cell migration and invasion through suppression of the FAK signaling pathway. Furthermore, there was an inverse correlation between CLCA2 and FAK expression in 251 human breast cancer tissues. These results strongly suggest that CLCA2 is involved in the p53 tumor suppressor network and has a significant effect on cell migration and invasion. PMID:22990203

  5. Prolyl isomerase Pin1 negatively regulates the stability of SUV39H1 to promote tumorigenesis in breast cancer.

    PubMed

    Khanal, Prem; Kim, Garam; Lim, Sung-Chul; Yun, Hyo-Jeong; Lee, Kwang Youl; Choi, Hoo-Kyun; Choi, Hong Seok

    2013-11-01

    Pin1, a conserved eukaryotic peptidyl-prolyl cis/trans isomerase, has profound effects on numerous key-signaling molecules, and its deregulation contributes to disease, particularly cancer. Although Pin1-mediated prolyl isomerization of protein servers as a regulatory switch in signaling pathways, the significance of proline isomerase activity in chromatin modifying complex remains unclear. Here, we identify Pin1 as a key negative regulator for suppressor of variegation 3-9 homologue 1 (SUV39H1) stability, a major methyltransferase responsible for histone H3 trimethylation on Lys9 (H3K9me3). Pin1 interacts with SUV39H1 in a phosphorylation-dependent manner and promotes ubiquitination-mediated degradation of SUV39H1. Consequently, Pin1 reduces SUV39H1 abundance and suppresses SUV39H1 ability to induce H3K9me3. In contrast, depletion of Pin1 in cancer cells leads to elevated SUV39H1 expression, which subsequently increases H3K9me3, inhibiting tumorigenecity of cancer cells. In a xenograft model with 4T1 metastatic mouse breast carcinoma cells, Pin1 overexpression increases tumor growth, whereas SUV39H1 overexpression abrogates it. In human breast cancer patients, immunohistochemical staining shows that Pin1 levels are negatively correlated with SUV39H1 as well as H3K9me3 levels. Thus, Pin1-mediated reduction of SUV39H1 stability contributes to convey oncogenic signals for aggressiveness of human breast cancer, suggesting that Pin1 may be a promising drug target for anticancer therapy. PMID:23934277

  6. Peroxisome proliferators and fatty acids negatively regulate liver X receptor-mediated activity and sterol biosynthesis.

    PubMed

    Johnson, T E; Ledwith, B J

    2001-04-01

    Peroxisome proliferators (PPs) are potent tumor promoters in rodents. The mechanism of hepatocarcinogenesis requires the nuclear receptor peroxisome proliferator activated receptor-alpha (PPARalpha), but might also involve the PPARalpha independent alteration of signaling pathways that regulate cell growth. Here, we studied the effects of PPs on the mevalonate pathway, a critical pathway that controls cell proliferation. Liver X receptors (LXRs) are nuclear receptors that act as sterol sensors in the mevalonate pathway. In gene reporter assays in COS-7 cells, the basal activity of the LXR responsive reporter gene (LXRE-luc) was suppressed by 10 microM lovastatin and zaragozic acid A, suggesting that this activity was attributed to the activation of native LXRs, by endogenously produced mevalonate products. The potent PP and rodent tumor promoter, pirinixic acid (WY-14643) also inhibited LXR-mediated transcription in a dose related manner (approximate IC(50) of 100 microM). As did several other PPs including ciprofibric acid and mono-ethylhexylphthalate. Polyunsaturated and medium to long chain fatty acids at 100 microM were also potent inhibitors; the arachidonic acid analogue eicosatetraynoic acid being the most active (approximate IC(50) of 10 microM). Of the PPs and fatty acids tested, there was a strong correlation between the ability of these agents to suppress de novo sterol synthesis in a rat hepatoma cell line, H4IIEC3, and inhibit LXR-mediated transcription in COS-7 cells, but a discordance between these endpoints and PPARalpha activation and fatty acid acyl-CoA oxidase induction. Taken together, these results suggest that PPs and fatty acids negatively regulate the mevalonate pathway through a mechanism that is not entirely dependent on PPARalpha activation. Because of the importance of the mevalonate pathway in regulating cell proliferation, the modulation of this pathway by PPs and fatty acids might contribute to their actions on cell growth

  7. PGC-1α Is a Central Negative Regulator of Vascular Senescence

    PubMed Central

    Xiong, Shiqin; Salazar, Gloria; Patrushev, Nikolay; Ma, Minhui; Forouzandeh, Farshad; Hilenski, Lula; Alexander, R. Wayne

    2013-01-01

    Objective Cellular senescence influences organismal aging and increases predisposition to age-related diseases, in particular cardiovascular disease, a leading cause of death and disability worldwide. PGC-1α is a master regulator of mitochondrial biogenesis and function, oxidative stress and insulin resistance. Senescence is associated with telomere and mitochondrial dysfunction and oxidative stress, inferring a potential causal role of PGC-1α in senescence pathogenesis. Methods and Results We generated a PGC-1α+/−/ApoE−/− mouse model and show that PGC-1α deficiency promotes a vascular senescence phenotype that is associated with increased oxidative stress, mitochondrial abnormalities, and reduced telomerase activity. PGC-1α disruption results in reduced expression of the longevity-related deacetylase sirtuin 1 (SIRT1) and the antioxidant catalase, and increased expression of the senescence marker p53 in aortas. Further, angiotensin II (Ang II), a major hormonal inducer of vascular senescence, induces prolonged lysine acetylation of PGC-1α and releases the PGC-1α·FoxO1 complex from the SIRT1 promoter, thus reducing SIRT1 expression. The phosphorylation defective mutant PGC-1α S570A is not acetylated, is constitutively active for FoxO1-dependent SIRT1 transcription and prevents Ang II-induced senescence. Acetylation of PGC-1α by Ang II interrupts the PGC-1α-FoxO1-SIRT1 feed-forward signaling circuit leading to SIRT1 and catalase downregulation and vascular senescence. Conclusions PGC-1α is a primary negative regulator of vascular senescence. Moreover, the central role of post-translational modification of PGC-1α in regulating Ang II-induced vascular senescence may inform development of novel therapeutic strategies for mitigating age-associated diseases such as atherosclerosis. PMID:23430617

  8. ABSCISIC ACID-INSENSITIVE 4 negatively regulates flowering through directly promoting Arabidopsis FLOWERING LOCUS C transcription

    PubMed Central

    Shu, Kai; Chen, Qian; Wu, Yaorong; Liu, Ruijun; Zhang, Huawei; Wang, Shengfu; Tang, Sanyuan; Yang, Wenyu; Xie, Qi

    2016-01-01

    During the life cycle of a plant, one of the major biological processes is the transition from the vegetative to the reproductive stage. In Arabidopsis, flowering time is precisely controlled by extensive environmental and internal cues. Gibberellins (GAs) promote flowering, while abscisic acid (ABA) is considered as a flowering suppressor. However, the detailed mechanism through which ABA inhibits the floral transition is poorly understood. Here, we report that ABSCISIC ACID-INSENSITIVE 4 (ABI4), a key component in the ABA signalling pathway, negatively regulates floral transition by directly promoting FLOWERING LOCUS C (FLC) transcription. The abi4 mutant showed the early flowering phenotype whereas ABI4-overexpressing (OE-ABI4) plants had delayed floral transition. Consistently, quantitative reverse transcription–PCR (qRT–PCR) assay revealed that the FLC transcription level was down-regulated in abi4, but up-regulated in OE-ABI4. The change in FT level was consistent with the pattern of FLC expression. Chromatin immunoprecipitation-qPCR (ChIP-qPCR), electrophoretic mobility shift assay (EMSA), and tobacco transient expression analysis showed that ABI4 promotes FLC expression by directly binding to its promoter. Genetic analysis demonstrated that OE-ABI4::flc-3 could not alter the flc-3 phenotype. OE-FLC::abi4 showed a markedly delayed flowering phenotype, which mimicked OE-FLC::WT, and suggested that ABI4 acts upstream of FLC in the same genetic pathway. Taken together, these findings suggest that ABA inhibits the floral transition by activating FLC transcription through ABI4. PMID:26507894

  9. KLF17 is a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer.

    PubMed

    Gumireddy, Kiranmai; Li, Anping; Gimotty, Phyllis A; Klein-Szanto, Andres J; Showe, Louise C; Katsaros, Dionyssios; Coukos, George; Zhang, Lin; Huang, Qihong

    2009-11-01

    Metastasis is a complex multistep process, which requires the concerted action of many genes and is the primary cause of cancer death. Both pathways that regulate metastasis enhancement and those that regulate its suppression contribute to the tumour dissemination process. To identify new metastasis suppressors, we set up a forward genetic screen in a mouse model. We transduced a genome-wide RNA interference (RNAi) library into the non-metastatic 168FARN breast cancer cell line and orthotopically transplanted the cells into mouse mammary fat pads. We then selected cells that could metastasize to the lung and identified an RNAi for the KLF17 gene. Conversely, we demonstrate that ectopic expression of KLF17 in a highly metastatic 4T1 breast cancer cell line inhibits the ability of cells to metastasize from the mammary fat pad to the lung. We also show that suppression of KLF17 expression promotes breast cancer cell invasion and epithelial-mesenchymal transition (EMT), and that KLF17 protein functions by directly binding to the promoter region of Id1 (which encodes a key metastasis regulator in breast cancer) to inhibit its transcription. Finally, we demonstrate that KLF17 expression is significantly downregulated in primary human breast cancer samples and that the combined expression pattern of KLF17 and Id1 can serve as a potential biomarker for lymph node metastasis in breast cancer. PMID:19801974

  10. KLF17 is a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer

    PubMed Central

    Gumireddy, Kiranmai; Li, Anping; Gimotty, Phyllis A.; Klein-Szanto, Andres J.; Showe, Louise C.; Katsaros, Dionyssios; Coukos, George; Zhang, Lin; Huang, Qihong

    2009-01-01

    Metastasis is a complex multi-step process requiring the concerted action of many genes and is the primary cause of cancer deaths. Pathways that regulate metastasis enhancement and suppression both contribute to tumor dissemination process. In order to identify novel metastasis suppressors, we set up a forward genetic screen in a mouse model. We transduced a genome-wide RNAi library into the non-metastatic 168FARN breast cancer cell line, orthotopically transplanted the cells into mouse mammary fat pads, and then selected for cells that could metastasize to the lung and identified an RNAi for the KLF17 gene. Conversely, we demonstrate that ectopic expression of KLF17 in highly metastatic 4T1 breast cancer cell line inhibited their ability to metastasize from the mammary fat pad to the lung. We also show that suppression of KLF17 expression promotes breast cancer cell invasion and epithelial-mesenchymal transition (EMT) and that KLF17 functions by directly binding to the promoter of Id-1, a key metastasis regulator in breast cancer, to inhibit its transcription. Finally, we demonstrate that KLF17 expression is significantly down-regulated in primary human breast cancer samples and that the combined expression patterns of KLF17 and Id-1 can serve as a potential biomarker for lymph node metastasis in breast cancer. PMID:19801974

  11. miR-124 negatively regulates osteogenic differentiation and in vivo bone formation of mesenchymal stem cells.

    PubMed

    Qadir, Abdul S; Um, Soyoun; Lee, Heesu; Baek, Kyunghwa; Seo, Byoung Moo; Lee, Gene; Kim, Gwan-Shik; Woo, Kyung Mi; Ryoo, Hyun-Mo; Baek, Jeong-Hwa

    2015-05-01

    MicroRNAs are novel key regulators of cellular differentiation. Dlx transcription factors play an important role in osteoblast differentiation, and Dlx5 and Dlx2 are known targets of miR-124. Therefore, in the present study, we investigated the regulatory effects of miR-124 on the osteogenic differentiation and in vivo bone formation of mesenchymal stem cells (MSCs). During osteogenic induction by BMP2, the expression levels of miR-124 were inversely correlated with those of osteogenic differentiation marker genes in human and mouse bone marrow-derived MSCs, MC3T3-E1 cells and C2C12 cells. The overexpression of a miR-124 mimic significantly decreased the expression levels of Dlx5, Dlx3, and Dlx2, whereas the silencing of miR-124 with hairpin inhibitors significantly increased the expression of these Dlx genes. Luciferase reporter assays demonstrated that miR-124 directly targets the 3'UTRs of Dlx3, Dlx5, and Dlx2. The overexpression of a miR-124 mimic suppressed the osteogenic marker gene expression levels, alkaline phosphatase activity and matrix mineralization, which were all significantly increased by the overexpression of a miR-124 inhibitor. When ectopic bone formation was induced by the subcutaneous transplantation of human bone marrow-derived MSCs in nude mice, MSCs overexpressing a miR-124 inhibitor significantly enhanced woven bone formation compared with control MSCs. However, MSCs overexpressing a miR-124 mimic exhibited increased adipocyte differentiation at the expense of ectopic bone formation. These results suggest that miR-124 is a negative regulator of osteogenic differentiation and in vivo bone formation and that the targeting of Dlx5, Dlx3, and Dlx2 genes partly contributes to this inhibitory effect exerted by miR-124. PMID:25424317

  12. The role of myogenic mechanisms in human cerebrovascular regulation

    PubMed Central

    Tan, Can Ozan; Hamner, J W; Taylor, J Andrew

    2013-01-01

    Although myogenic mechanisms have been hypothesized to play a role in cerebrovascular regulation, previous data from both animals and humans have not provided an unequivocal answer. However, cerebral autoregulation is explicitly non-linear and most prior work relied on simple linear approaches for assessment, potentially missing important changes in autoregulatory characteristics. Therefore, we examined cerebral blood flow responses to augmented arterial pressure oscillations with and without calcium channel blockade (nicardipine) during blood pressure fluctuations (oscillatory lower body negative pressure, OLBNP) across a range of frequencies in 16 healthy subjects. Autoregulation was characterized via a robust non-linear method (projection pursuit regression, PPR). Blockade resulted in significant tachycardia, a modest but significant elevation in mean arterial pressure, and reductions in mean cerebral blood flow and end-tidal CO2 during OLBNP. The reductions in flow were directly related to the reductions in CO2 (r= 0.57). While linear cross-spectral analysis showed that the relationship between pressure–flow fluctuations was preserved after blockade, PPR showed that blockade significantly altered the non-linearity between pressure and flow, particularly at the slowest fluctuations. At 0.03 Hz, blockade reduced the range of pressure fluctuations that can be buffered (7.5 ± 1.0 vs. 3.7 ± 0.8 mmHg) while increasing the autoregulatory slope (0.10 ± 0.05 vs. 0.24 ± 0.08 cm s−1 mmHg−1). Furthermore, the same rate of change in pressure elicited a change in flow more than twice as large as at baseline. Thus, our results show that myogenic mechanisms play a significant role in cerebrovascular regulation but this may not be appreciated without adequately characterizing the non-linearities inherent in cerebrovascular regulation. PMID:23959681

  13. The habenula encodes negative motivational value associated with primary punishment in humans

    PubMed Central

    Lawson, Rebecca P.; Seymour, Ben; Loh, Eleanor; Lutti, Antoine; Dolan, Raymond J.; Dayan, Peter; Weiskopf, Nikolaus; Roiser, Jonathan P.

    2014-01-01

    Learning what to approach, and what to avoid, involves assigning value to environmental cues that predict positive and negative events. Studies in animals indicate that the lateral habenula encodes the previously learned negative motivational value of stimuli. However, involvement of the habenula in dynamic trial-by-trial aversive learning has not been assessed, and the functional role of this structure in humans remains poorly characterized, in part, due to its small size. Using high-resolution functional neuroimaging and computational modeling of reinforcement learning, we demonstrate positive habenula responses to the dynamically changing values of cues signaling painful electric shocks, which predict behavioral suppression of responses to those cues across individuals. By contrast, negative habenula responses to monetary reward cue values predict behavioral invigoration. Our findings show that the habenula plays a key role in an online aversive learning system and in generating associated motivated behavior in humans. PMID:25071182

  14. Perfectionism, Emotion Regulation and Their Relationship to Negative Affect in Patients with Social Phobia

    PubMed Central

    Rukmini, Systla; Sudhir, Paulomi M.; Math, Suresh Bada

    2014-01-01

    Context: Research on the perfectionism and emotion regulation strategies in anxiety disorders has gained increased attention. These have an important implication for formulation of therapies. Aims: We examined perfectionism, emotion regulation were examined in 30 patients with social phobia (SP) and 30 community participants. Settings and Design: A cross-sectional design using a clinical and a community control sample was adopted in this exploratory study. Materials and Methods: Participants were assessed on The Mini-International Neuropsychiatric Interview, Frost's-Multidimensional Perfectionism Scale, Ruminative Response Scale of the response style questionnaire, cognitive emotion regulation questionnaire, Social Interaction Anxiety Scale and the Beck's Depression Inventory. Statistical Analysis: Data was analyzed using independents samples t-test and Pearson's Product moment correlations and step-wise linear regression. Results: Individuals with SP had higher perfectionism (mean = 100.30, SD = ±17.73, t = 7.29, P < 0.001), rumination (mean = 61.47, SD = ±11.96, t = 6.71, P < 0.001) and lower levels of positive reappraisal (mean = 11.53, SD = ±3.85, t = 4.90, P < 0.001). Perfectionism was correlated with social anxiety (r = 0.44, P < 0.05) and rumination (r = 0.43, P < 0.05), but not with depression. Rumination was positively correlated with both social anxiety (r = 0.513, P < 0.01) and depression (r = 0.485, P < 0.01). Positive reappraisal was negatively correlated with depression (r = -0.396, P < 0.05) and anxiety (r = -0.335, P < 0.05). Acceptance was found to be significantly correlated only to the reflective pondering subscale of rumination. Parental criticism was a significant predictor of social anxiety (F = 11.11, P < 0.01) and brooding predicted depression (F = 10.49, P < 0.01). Conclusions: This study highlights the role of perfectionism as a maintaining factor in SP and the importance of adaptive forms of emotion regulation that need to be addressed

  15. Tumor necrosis factor alpha negatively regulates hepatitis B virus gene expression in transgenic mice.

    PubMed Central

    Gilles, P N; Fey, G; Chisari, F V

    1992-01-01

    It is well known that several inflammatory cytokines can modulate hepatocellular gene expression in a complex physiological process known as the hepatic acute-phase response. Since hepatitis B virus (HBV) characteristically induces a vigorous lymphomononuclear inflammatory response in the liver during acute and chronic hepatitis, it is possible that hepatocellular HBV gene expression may also be modulated by one or more of the cytokines produced by these cells. Using bacterial lipopolysaccharide (LPS) as a surrogate inducer of inflammatory cytokines in vivo, we have tested this hypothesis in a transgenic mouse model system. In experiments with two independent transgenic mouse lineages that express the HBV envelope region under the control of either HBV or cellular promoters, we observed a 50 to 80% reduction in the hepatic steady-state content of a 2.1-kb HBV mRNA following administration of a single intraperitoneal dose of LPS. The regulatory influence of several inflammatory cytokines known to be induced by LPS was also examined in this system. The negative regulatory effect of LPS was consistently reproduced by the administration of a single nontoxic dose of tumor necrosis factor alpha, and it was occasionally observed following the administration of high doses of alpha interferon and interleukin-6, while no effect was detectable in response to high-dose interleukin-1 alpha or to gamma interferon. These observations suggest that tumor necrosis factor alpha and perhaps other cytokines may activate a heretofore unsuspected intracellular pathway that negatively regulates HBV gene expression. The intracellular mechanism(s) responsible for this effect and its pathophysiologic relevance remain to be elucidated. Images PMID:1583737

  16. 78 FR 2229 - Health and Human Services Acquisition Regulation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-10

    ... From the Federal Register Online via the Government Publishing Office ] DEPARTMENT OF HEALTH AND HUMAN SERVICES 48 CFR Parts 327 and 352 RIN 0991-AB87 Health and Human Services Acquisition Regulation AGENCY: Department of Health and Human Services; Office of the Assistant Secretary for...

  17. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  18. Lysophosphatidic acid receptor-5 negatively regulates cellular responses in mouse fibroblast 3T3 cells

    SciTech Connect

    Dong, Yan; Hirane, Miku; Araki, Mutsumi; Fukushima, Nobuyuki; Tsujiuchi, Toshifumi

    2014-04-04

    Highlights: • LPA{sub 5} inhibits the cell growth and motile activities of 3T3 cells. • LPA{sub 5} suppresses the cell motile activities stimulated by hydrogen peroxide in 3T3 cells. • Enhancement of LPA{sub 5} on the cell motile activities inhibited by LPA{sub 1} in 3T3 cells. • The expression and activation of Mmp-9 were inhibited by LPA{sub 5} in 3T3 cells. • LPA signaling via LPA{sub 5} acts as a negative regulator of cellular responses in 3T3 cells. - Abstract: Lysophosphatidic acid (LPA) signaling via G protein-coupled LPA receptors (LPA{sub 1}–LPA{sub 6}) mediates a variety of biological functions, including cell migration. Recently, we have reported that LPA{sub 1} inhibited the cell motile activities of mouse fibroblast 3T3 cells. In the present study, to evaluate a role of LPA{sub 5} in cellular responses, Lpar5 knockdown (3T3-L5) cells were generated from 3T3 cells. In cell proliferation assays, LPA markedly stimulated the cell proliferation activities of 3T3-L5 cells, compared with control cells. In cell motility assays with Cell Culture Inserts, the cell motile activities of 3T3-L5 cells were significantly higher than those of control cells. The activity levels of matrix metalloproteinases (MMPs) were measured by gelatin zymography. 3T3-L5 cells stimulated the activation of Mmp-2, correlating with the expression levels of Mmp-2 gene. Moreover, to assess the co-effects of LPA{sub 1} and LPA{sub 5} on cell motile activities, Lpar5 knockdown (3T3a1-L5) cells were also established from Lpar1 over-expressing (3T3a1) cells. 3T3a1-L5 cells increased the cell motile activities of 3T3a1 cells, while the cell motile activities of 3T3a1 cells were significantly lower than those of control cells. These results suggest that LPA{sub 5} may act as a negative regulator of cellular responses in mouse fibroblast 3T3 cells, similar to the case for LPA{sub 1}.

  19. Caenorhabditis elegans TBX-2 Directly Regulates Its Own Expression in a Negative Autoregulatory Loop

    PubMed Central

    Milton, Angenee C.; Okkema, Peter G.

    2015-01-01

    T-box genes often exhibit dynamic expression patterns, and their expression levels can be crucial for normal function. Despite the importance of these genes, there is little known about T-box gene regulation. We have focused on the Caenorhabditis elegans gene tbx-2 to understand how T-box gene expression is regulated, and here we demonstrate TBX-2 itself directly represses its own expression in a negative autoregulatory loop. tbx-2 is essential for normal pharyngeal muscle development, and a tbx-2 promoter gfp fusion (Ptbx-2::gfp) is transiently expressed in the pharynx during embryogenesis and in a small number of head neurons in larvae and adults. Reduced tbx-2 function resulted in ectopic Ptbx-2::gfp expression in the seam cells and gut in larvae and adults. Mutation of potential T-box binding sites within the tbx-2 promoter resulted in a similar pattern of ectopic Ptbx-2::gfp expression, and chromatin immunoprecipitation analyses show TBX-2 binds these sites in vivo. This pattern of ectopic Ptbx-2::gfp expression in tbx-2 mutants was very similar to that observed in mutants affecting the NF-Y complex, and our results comparing tbx-2 and nfyb-1 single- and double mutants suggest TBX-2 and NF-Y function in a single pathway to repress the tbx-2 promoter. The tbx-2 promoter is the first direct target identified for TBX-2, and we used it to ask whether SUMOylation is essential for TBX-2 repression. RNAi knockdown of SUMOylation pathway components led to ectopic Ptbx-2::gfp expression in the seam cells and gut. Ectopic Ptbx-2::gfp also was observed in the syncytial hypodermis, suggesting either the tbx-2 promoter is repressed by other SUMOylation dependent mechanisms, or that decreased SUMOylation leads to stable changes in seam cell nuclei as they fuse with the syncytial hypodermis. We suggest negative autoregulation is an important mechanism that allows precise control of tbx-2 expression levels and may allow rapid changes in gene expression during development

  20. Cereblon negatively regulates TLR4 signaling through the attenuation of ubiquitination of TRAF6

    PubMed Central

    Min, Yoon; Wi, Sae Mi; Kang, Jung-Ah; Yang, Taewoo; Park, Chul-Seung; Park, Sung-Gyoo; Chung, Sungkwon; Shim, Jae-Hyuck; Chun, Eunyoung; Lee, Ki-Young

    2016-01-01

    Cereblon (CRBN) is a substrate receptor protein for the CRL4A E3 ubiquitin ligase complex. In this study, we report on a new regulatory role of CRBN in TLR4 signaling. CRBN overexpression leads to suppression of NF-κB activation and production of pro-inflammatory cytokines including IL-6 and IL-1β in response to TLR4 stimulation. Biochemical studies revealed interactions between CRBN and TAK1, and TRAF6 proteins. The interaction between CRBN and TAK1 did not affect the association of the TAB1 and TAB2 proteins, which have pivotal roles in the activation of TAK1, whereas the CRBN-TRAF6 interaction critically affected ubiquitination of TRAF6 and TAB2. Binding mapping results revealed that CRBN interacts with the Zinc finger domain of TRAF6, which contains the ubiquitination site of TRAF6, leading to attenuation of ubiquitination of TRAF6 and TAB2. Functional studies revealed that CRBN-knockdown THP-1 cells show enhanced NF-κB activation and p65- or p50-DNA binding activities, leading to up-regulation of NF-κB-dependent gene expression and increased pro-inflammatory cytokine levels in response to TLR4 stimulation. Furthermore, Crbn−/− mice exhibit decreased survival in response to LPS challenge, accompanied with marked enhancement of pro-inflammatory cytokines, such as TNF-α and IL-6. Taken together, our data demonstrate that CRBN negatively regulates TLR4 signaling via attenuation of TRAF6 and TAB2 ubiquitination. PMID:27468689

  1. Negative regulation of cytosolic phospholipase A(2) by melatonin in the rat pineal gland.

    PubMed Central

    Li, B; Zhang, H; Akbar, M; Kim, H Y

    2000-01-01

    In this paper evidence that supports a new role for melatonin as a negative endogenous regulator of cytosolic phospholipase A(2) (cPLA(2)) is presented. When rat pineal glands were incubated in culture, time-dependent release of arachidonic acid (AA) was observed, which was significantly inhibited by a known 85-kDa cPLA(2) inhibitor, methyl arachidonyl fluorophosphonate. Co-incubation with melatonin inhibited the AA release in a concentration-dependent manner, and this decrease was accompanied by a reduction of cPLA(2) protein and mRNA expression. Melatonin-receptor agonists, 2-iodo-N-butanoyl-5-methoxytryptamine and 5-methoxycarbonylamino-N-acetyltryptamine, also decreased AA release and cPLA(2) protein and mRNA levels, while pre-incubation with the melatonin receptor antagonists luzindole and 2-phenylmelatonin abolished the melatonin effect. In vivo, as melatonin production reflected a typical diurnal variation, endogenous non-esterified AA and cPLA(2) mRNA levels in the rat pineal gland showed an off-phase diurnal pattern in relation to melatonin levels. Intravenous administration of isoproterenol, which has been shown to elevate melatonin production, also decreased the levels of non-esterified AA and cPLA(2) mRNA significantly. Direct administration of melatonin to rats by intravenous injection decreased the levels of non-esterified AA, cPLA(2) protein and mRNA in rat pineal glands. In conclusion, melatonin endogenously down-regulates cPLA(2) expression, presumably through melatonin-receptor-mediated processes. PMID:11042126

  2. SUMOylation of phytochrome-B negatively regulates light-induced signaling in Arabidopsis thaliana

    PubMed Central

    Sadanandom, Ari; Ádám, Éva; Orosa, Beatriz; Viczián, András; Klose, Cornelia; Zhang, Cunjin; Josse, Eve-Marie; Kozma-Bognár, László; Nagy, Ferenc

    2015-01-01

    The red/far red light absorbing photoreceptor phytochrome-B (phyB) cycles between the biologically inactive (Pr, λmax, 660 nm) and active (Pfr; λmax, 730 nm) forms and functions as a light quality and quantity controlled switch to regulate photomorphogenesis in Arabidopsis. At the molecular level, phyB interacts in a conformation-dependent fashion with a battery of downstream regulatory proteins, including PHYTOCHROME INTERACTING FACTOR transcription factors, and by modulating their activity/abundance, it alters expression patterns of genes underlying photomorphogenesis. Here we report that the small ubiquitin-like modifier (SUMO) is conjugated (SUMOylation) to the C terminus of phyB; the accumulation of SUMOylated phyB is enhanced by red light and displays a diurnal pattern in plants grown under light/dark cycles. Our data demonstrate that (i) transgenic plants expressing the mutant phyBLys996Arg-YFP photoreceptor are hypersensitive to red light, (ii) light-induced SUMOylation of the mutant phyB is drastically decreased compared with phyB-YFP, and (iii) SUMOylation of phyB inhibits binding of PHYTOCHROME INTERACTING FACTOR 5 to phyB Pfr. In addition, we show that OVERLY TOLERANT TO SALT 1 (OTS1) de-SUMOylates phyB in vitro, it interacts with phyB in vivo, and the ots1/ots2 mutant is hyposensitive to red light. Taken together, we conclude that SUMOylation of phyB negatively regulates light signaling and it is mediated, at least partly, by the action of OTS SUMO proteases. PMID:26283376

  3. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity

    PubMed Central

    Chan, Pamela Y.; Carrera Silva, Eugenio A.; De Kouchkovsky, Dimitri; Joannas, Leonel D.; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S.; Herbert, De’Broski R.; Craft, Joseph E.; Flavell, Richard A.; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G.; Torgerson, Dara G.; Ghosh, Sourav; Rothlin, Carla V.

    2016-01-01

    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded by Tyro3 in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell–specific Pros1 knockouts phenocopied the loss of Tyro3. Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses. PMID:27034374

  4. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity.

    PubMed

    Chan, Pamela Y; Carrera Silva, Eugenio A; De Kouchkovsky, Dimitri; Joannas, Leonel D; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S; Herbert, De'Broski R; Craft, Joseph E; Flavell, Richard A; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G; Torgerson, Dara G; Ghosh, Sourav; Rothlin, Carla V

    2016-04-01

    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded byTyro3in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell-specificPros1knockouts phenocopied the loss ofTyro3 Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses. PMID:27034374

  5. Wild-type p53 and p73 negatively regulate expression of proliferation related genes.

    PubMed

    Scian, M J; Carchman, E H; Mohanraj, L; Stagliano, K E R; Anderson, M A E; Deb, D; Crane, B M; Kiyono, T; Windle, B; Deb, S P; Deb, S

    2008-04-17

    When normal cells come under stress, the wild-type (WT) p53 level increases resulting in the regulation of gene expression responsible for growth arrest or apoptosis. Here we show that elevated levels of WT p53 or its homologue, p73, inhibit expression of a number of cell cycle regulatory and growth promoting genes. Our analysis also identified a group of genes whose expression is differentially regulated by WT p53 and p73. We have infected p53-null H1299 human lung carcinoma cells with recombinant adenoviruses expressing WT p53, p73 or beta-galactosidase, and have undertaken microarray hybridization analyses to identify genes whose expression profile is altered by p53 or p73. Quantitative real-time PCR verified the repression of E2F-5, centromere protein A and E, minichromosome maintenance proteins (MCM)-2, -3, -5, -6 and -7 and human CDC25B after p53 expression. 5-Fluorouracil treatment of colon carcinoma HCT116 cells expressing WT p53 results in a reduction of the cyclin B2 protein level suggesting that DNA damage may indeed cause repression of these genes. Transient transcriptional assays verified that WT p53 repressed promoters of a number of these genes. Interestingly, a gain-of-function p53 mutant instead upregulated a number of these promoters in transient transfection. Using promoter deletion mutants of MCM-7 we have found that WT p53-mediated repression needs a minimal promoter that contains a single E2F site and surrounding sequences. However, a single E2F site cannot be significantly repressed by WT p53. Many of the genes identified are also repressed by p21. Thus, our work shows that WT p53 and p73 repress a number of growth-related genes and that in many instances this repression may be through the induction of p21. PMID:17982488

  6. NRROS Negatively Regulates Osteoclast Differentiation by Inhibiting RANKL-Mediated NF-κB and Reactive Oxygen Species Pathways

    PubMed Central

    Kim, Jung Ha; Kim, Kabsun; Kim, Inyoung; Seong, Semun; Kim, Nacksung

    2015-01-01

    Negative regulator of reactive oxygen species (NRROS) is known to repress ROS generation in phagocytes. In this study, we examined the roles of NRROS in both osteoclasts and osteoblasts. Our results demonstrate that NRROS negatively regulates the differentiation of osteoclasts, but not osteoblasts. Further, overexpression of NRROS in osteoclast precursor cells attenuates RANKL-induced osteoclast differentiation. Conversely, osteoclast differentiation is enhanced upon siRNA-mediated knockdown of NRROS. Additionally, NRROS attenuates RANKL-induced NF-κB activation, as well as degradation of the NOX1 and NOX2 proteins, which are required for ROS generation. Based on our observations, we present NRROS as a novel negative regulator of RANKL-induced osteoclastogenesis. PMID:26442864

  7. Negative regulation of parathyroid hormone-related protein expression by steroid hormones

    SciTech Connect

    Kajitani, Takashi; Tamamori-Adachi, Mimi; Okinaga, Hiroko; Chikamori, Minoru; Iizuka, Masayoshi; Okazaki, Tomoki

    2011-04-15

    Highlights: {yields} Steroid hormones repress expression of PTHrP in the cell lines where the corresponding nuclear receptors are expressed. {yields} Nuclear receptors are required for suppression of PTHrP expression by steroid hormones, except for androgen receptor. {yields} Androgen-induced suppression of PTHrP expression appears to be mediated by estrogen receptor. -- Abstract: Elevated parathyroid hormone-related protein (PTHrP) is responsible for humoral hypercalcemia of malignancy (HHM), which is of clinical significance in treatment of terminal patients with malignancies. Steroid hormones were known to cause suppression of PTHrP expression. However, detailed studies linking multiple steroid hormones to PTHrP expression are lacking. Here we studied PTHrP expression in response to steroid hormones in four cell lines with excessive PTHrP production. Our study established that steroid hormones negatively regulate PTHrP expression. Vitamin D receptor, estrogen receptor {alpha}, glucocorticoid receptor, and progesterone receptor, were required for repression of PTHrP expression by the cognate ligands. A notable exception was the androgen receptor, which was dispensable for suppression of PTHrP expression in androgen-treated cells. We propose a pathway(s) involving nuclear receptors to suppress PTHrP expression.

  8. In vivo RNAi screen identifies NLK as a negative regulator of mesenchymal activity in glioblastoma

    PubMed Central

    Cho, Hee Jin; Lee, Jin-Ku; Kim, Gi-Soo; Han, Suji; Kim, Woon Jin; Shin, Yong Jae; Joo, Kyeung Min; Paddison, Patrick J.; Ishitani, Tohru; Lee, Jeongwu; Nam, Do-Hyun

    2015-01-01

    Glioblastoma (GBM) is the most lethal brain cancer with profound genomic alterations. While the bona fide tumor suppressor genes such as PTEN, NF1, and TP53 have high frequency of inactivating mutations, there may be the genes with GBM-suppressive roles for which genomic mutation is not a primary cause for inactivation. To identify such genes, we employed in vivo RNAi screening approach using the patient-derived GBM xenograft models. We found that Nemo-Like Kinase (NLK) negatively regulates mesenchymal activities, a characteristic of aggressive GBM, in part via inhibition of WNT/β-catenin signaling. Consistent with this, we found that NLK expression is especially low in a subset of GBMs that harbors high WNT/mesenchymal activities. Restoration of NLK inhibited WNT and mesenchymal activities, decreased clonogenic growth and survival, and impeded tumor growth in vivo. These data unravel a tumor suppressive role of NLK and support the feasibility of combining oncogenomics with in vivo RNAi screen. PMID:26023737

  9. Androgen Inhibits Abdominal Fat Accumulation and Negatively Regulates the PCK1 Gene in Male Chickens

    PubMed Central

    Shao, Yonggang; Li, Junying; Ling, Yao; Teng, Kedao; Li, Hongwei; Wu, Changxin

    2013-01-01

    Capons are male chickens whose testes have been surgically incised. Capons show a significant increase in fat accumulation compared to intact male chickens. However, while caponization leads to a significant reduction in androgen levels in roosters, little is known about the molecular mechanisms through which androgen status affects lipogenesis in avian species. Therefore, investigation of the influence of androgens on fat accumulation in the chicken will provide insights into this process. In this study, Affymetrix microarray technology was used to analyze the gene expression profiles of livers from capons and intact male chickens because the liver is the major site of lipogenesis in avian species. Through gene ontology, we found that genes involved in hepatic lipogenic biosynthesis were the most highly enriched. Interestingly, among the upregulated genes, the cytosolic form of the phosphoenolpyruvate carboxykinase (PCK1) gene showed the greatest fold change. Additionally, in conjunction with quantitative real-time PCR data, our results suggested that androgen status negatively regulated the PCK1 gene in male chickens. PMID:23544081

  10. Cyclic nucleotide gated channel 10 negatively regulates salt tolerance by mediating Na+ transport in Arabidopsis.

    PubMed

    Jin, Yakang; Jing, Wen; Zhang, Qun; Zhang, Wenhua

    2015-01-01

    A number of cyclic nucleotide gated channel (CNGC) genes have been identified in plant genomes, but their functions are mainly undefined. In this study, we identified the role of CNGC10 in the response of Arabidopsis thaliana to salt stress. The cngc10 T-DNA insertion mutant showed greater tolerance to salt than wild-type A. thaliana during seed germination and seedling growth. The cngc10 mutant accumulated less Na(+) and K(+), but not less Ca(2+), in shoots in response to salt stress. By contrast, overexpression of CNGC10 resulted in greater sensitivity to salt stress, and complementation of this gene recovered salt sensitivity. In response to salt stress, heterologous expression of CNGC10 in the Na(+) sensitive yeast mutant strain B31 inhibited growth due to accumulation of Na(+) at a rate greater than that of yeast transformed with an empty vector. Quantitative RT-PCR analysis demonstrated that CNGC10 was expressed mainly in roots and flowers. GUS analysis of a root cross section indicated that CNGC10 was expressed mainly in the endodermis and epidermis. Furthermore, the expression of CNGC10 in roots was dramatically inhibited by exposure to 200 mM NaCl for 6 h. These data suggest that CNGC10 negatively regulates salt tolerance in A. thaliana and may be involved in mediating Na(+) transport. PMID:25416933

  11. Syndecan-4 negatively regulates antiviral signalling by mediating RIG-I deubiquitination via CYLD

    PubMed Central

    Lin, Wei; Zhang, Jing; Lin, Haiyan; Li, Zexing; Sun, Xiaofeng; Xin, Di; Yang, Meng; Sun, Liwei; Li, Lin; Wang, Hongmei; Chen, Dahua; Sun, Qinmiao

    2016-01-01

    Retinoic acid-inducible gene I (RIG-I) plays important roles in pathogen recognition and antiviral signalling transduction. Here we show that syndecan-4 (SDC4) is a RIG-I-interacting partner identified in a yeast two-hybrid screen. We find that SDC4 negatively regulates the RIG-I-mediated antiviral signalling in a feedback-loop control manner. The genetic evidence obtained by using knockout mice further emphasizes this biological role of SDC4 in antiviral signalling. Mechanistically, we show that SDC4 interacts with both RIG-I and deubiquitinase CYLD via its carboxyl-terminal intracellular region. SDC4 likely promotes redistribution of RIG-I and CYLD in a perinuclear pattern post viral infection, and thus enhances the RIG-I–CYLD interaction and potentiates the K63-linked deubiquitination of RIG-I. Collectively, our findings uncover a mechanism by which SDC4 antagonizes the activation of RIG-I in a CYLD-mediated deubiquitination-dependent process, thereby balancing antiviral signalling to avoid deleterious effects on host cells. PMID:27279133

  12. Glucocorticoids suppress inflammation via the upregulation of negative regulator IRAK-M.

    PubMed

    Miyata, Masanori; Lee, Ji-Yun; Susuki-Miyata, Seiko; Wang, Wenzhuo Y; Xu, Haidong; Kai, Hirofumi; Kobayashi, Koichi S; Flavell, Richard A; Li, Jian-Dong

    2015-01-01

    Glucocorticoids are among the most commonly used anti-inflammatory agents. Despite the enormous efforts in elucidating the glucocorticoid-mediated anti-inflammatory actions, how glucocorticoids tightly control overactive inflammatory response is not fully understood. Here we show that glucocorticoids suppress bacteria-induced inflammation by enhancing IRAK-M, a central negative regulator of Toll-like receptor signalling. The ability of glucocorticoids to suppress pulmonary inflammation induced by non-typeable Haemophilus influenzae is significantly attenuated in IRAK-M-deficient mice. Glucocorticoids improve the survival rate after a lethal non-typeable Haemophilus influenzae infection in wild-type mice, but not in IRAK-M-deficient mice. Moreover, we show that glucocorticoids and non-typeable Haemophilus influenzae synergistically upregulate IRAK-M expression via mutually and synergistically enhancing p65 and glucocorticoid receptor binding to the IRAK-M promoter. Together, our studies unveil a mechanism by which glucocorticoids tightly control the inflammatory response and host defense via the induction of IRAK-M and may lead to further development of anti-inflammatory therapeutic strategies. PMID:25585690

  13. NUCLEOPHOSMIN/B23 NEGATIVELY REGULATES GCN5-DEPENDENT HISTONE ACETYLATION AND TRANSACTIVATION

    SciTech Connect

    Zou, Yonglong; Wu, Jun; Giannone, Richard J; Boucher, Lorrie; Du, Hansen; Huang, Ying; Johnson, Dabney K; Liu, Yie; Wang, Yisong

    2007-01-01

    Nucleophosmin/B23 is a multifunctional phosphoprotein that is overexpressed in cancer cells and has been shown to be involved in both positive and negative regulation of transcription. In this study, we first identified GCN5 acetyltransferase as a B23-interacting protein by mass spectrometry, which was then confirmed by in vivo co-immunoprecipitation. In vitro assay demonstrated that B23 bound the PCAF-N domain of GCN5 and inhibited GCN5-mediated acetylation of both free and mononucleosomal histones, probably through interfering with GCN5 and masking histones from being acetylated. Mitotic B23 exhibited higher inhibitory activity on GCN5-mediated histone acetylation than interphase B23. Immunodepletion experiments of mitotic extracts revealed that phosphorylation of B23 at Thr199 enhanced the inhibition of GCN5-mediated histone acetylation. Moreover, luciferase reporter and microarray analyses suggested that B23 attenuated GCN5-mediated transactivation in vivo. Taken together, our studies suggest a molecular mechanism of B23 in the mitotic inhibition of GCN5-mediated histone acetylation and transactivation.

  14. A role for VEGF as a negative regulator of pericyte function and vessel maturation.

    PubMed

    Greenberg, Joshua I; Shields, David J; Barillas, Samuel G; Acevedo, Lisette M; Murphy, Eric; Huang, Jianhua; Scheppke, Lea; Stockmann, Christian; Johnson, Randall S; Angle, Niren; Cheresh, David A

    2008-12-11

    Angiogenesis does not only depend on endothelial cell invasion and proliferation: it also requires pericyte coverage of vascular sprouts for vessel stabilization. These processes are coordinated by vascular endothelial growth factor (VEGF) and platelet-derived growth factor (PDGF) through their cognate receptors on endothelial cells and vascular smooth muscle cells (VSMCs), respectively. PDGF induces neovascularization by priming VSMCs/pericytes to release pro-angiogenic mediators. Although VEGF directly stimulates endothelial cell proliferation and migration, its role in pericyte biology is less clear. Here we define a role for VEGF as an inhibitor of neovascularization on the basis of its capacity to disrupt VSMC function. Specifically, under conditions of PDGF-mediated angiogenesis, VEGF ablates pericyte coverage of nascent vascular sprouts, leading to vessel destabilization. At the molecular level, VEGF-mediated activation of VEGF-R2 suppresses PDGF-Rbeta signalling in VSMCs through the assembly of a previously undescribed receptor complex consisting of PDGF-Rbeta and VEGF-R2. Inhibition of VEGF-R2 not only prevents assembly of this receptor complex but also restores angiogenesis in tissues exposed to both VEGF and PDGF. Finally, genetic deletion of tumour cell VEGF disrupts PDGF-Rbeta/VEGF-R2 complex formation and increases tumour vessel maturation. These findings underscore the importance of VSMCs/pericytes in neovascularization and reveal a dichotomous role for VEGF and VEGF-R2 signalling as both a promoter of endothelial cell function and a negative regulator of VSMCs and vessel maturation. PMID:18997771

  15. Negative density dependence regulates two tree species at later life stage in a temperate forest.

    PubMed

    Piao, Tiefeng; Chun, Jung Hwa; Yang, Hee Moon; Cheon, Kwangil

    2014-01-01

    Numerous studies have demonstrated that tree survival is influenced by negative density dependence (NDD) and differences among species in shade tolerance could enhance coexistence via resource partitioning, but it is still unclear how NDD affects tree species with different shade-tolerance guilds at later life stages. In this study, we analyzed the spatial patterns for trees with dbh (diameter at breast height) ≥2 cm using the pair-correlation g(r) function to test for NDD in a temperate forest in South Korea after removing the effects of habitat heterogeneity. The analyses were implemented for the most abundant shade-tolerant (Chamaecyparis obtusa) and shade-intolerant (Quercus serrata) species. We found NDD existed for both species at later life stages. We also found Quercus serrata experienced greater NDD compared with Chamaecyparis obtusa. This study indicates that NDD regulates the two abundant tree species at later life stages and it is important to consider variation in species' shade tolerance in NDD study. PMID:25058660

  16. Neutrophils negatively regulate induction of mucosal IgA responses after sublingual immunization.

    PubMed

    Jee, J; Bonnegarde-Bernard, A; Duverger, A; Iwakura, Y; Cormet-Boyaka, E; Martin, T L; Steiner, H E; Bachman, R C; Boyaka, P N

    2015-07-01

    Induction of mucosal immunoglobulin-A (IgA) capable of providing a first line of defense against bacterial and viral pathogens remains a major goal of needle-free vaccines given via mucosal routes. Innate immune cells are known to play a central role in induction of IgA responses by mucosal vaccines, but the relative contribution of myeloid cell subsets to these responses has not firmly been established. Using an in vivo model of sublingual vaccination with Bacillus anthracis edema toxin (EdTx) as adjuvant, we examined the role of myeloid cell subsets for mucosal secretory IgA responses. Sublingual immunization of wild-type mice resulted in a transient increase of neutrophils in sublingual tissues and cervical lymph nodes. These mice later developed Ag-specific serum IgG responses, but not serum or mucosal IgA. Interestingly, EdTx failed to increase neutrophils in sublingual tissues and cervical lymph nodes of IKKβ(ΔMye) mice, and these mice developed IgA responses. Partial depletion of neutrophils before immunization of wild-type mice allowed the development of both mucosal and serum IgA responses. Finally, co-culture of B cells with neutrophils from either wild-type or IKKβ(ΔMye) mice suppressed secretion of IgA, but not IgM or IgG. These results identify a new role for neutrophils as negative regulators of IgA responses. PMID:25563500

  17. Identification and functional characterization of Bet protein as a negative regulator of BFV3026 replication.

    PubMed

    Bing, Tiejun; Wu, Kai; Cui, Xiaoxu; Shao, Peng; Zhang, Qicheng; Bai, Xiaobo; Tan, Juan; Qiao, Wentao

    2014-06-01

    Foamy virus (FV) establishes persistent infection in the host without causing apparent disease. Besides the transactivator Tas protein, another auxiliary protein--Bet--has been reported in prototype foamy virus, equine foamy virus, and feline foamy virus. Here, we found the putative bbet gene in clone C74 from a cDNA library of bovine foamy virus strain 3026 (BFV3026) by comparison of gene localization, composition, and splicing features with other known bet genes. Subsequently, BBet protein was detected in BFV3026-infected cells by Western blot and immunofluorescence analyses. Analysis of the BBet mutant infectious clone (pBS-BFVdelBBet) revealed that BBet could inhibit BFV3026 replication. Consistent with this result, overexpression of BBet in Cf2Th cells reduced BFV replication by approximately threefold. Furthermore, virus replication levels similarly were reduced by approximately threefold in pBS-BFV-transfected and BFV3026-infected Cf2Th cells stably expressing BBet compared with control cells. After three passages, BFV3026 replicated more slowly in BBet-expressing cells. This study implicates BBet as a negative regulator of BFV replication and provides a resource for future studies on the function of this protein in the virus lifecycle. PMID:24615636

  18. A negative feedback loop at the nuclear periphery regulates GAL gene expression

    PubMed Central

    Green, Erin M.; Jiang, Ying; Joyner, Ryan; Weis, Karsten

    2012-01-01

    The genome is nonrandomly organized within the nucleus, but it remains unclear how gene position affects gene expression. Silenced genes have frequently been found associated with the nuclear periphery, and the environment at the periphery is believed to be refractory to transcriptional activation. However, in budding yeast, several highly regulated classes of genes, including the GAL7-10-1 gene cluster, are known to translocate to the nuclear periphery concurrent with their activation. To investigate the role of gene positioning on GAL gene expression, we monitored the effects of mutations that disrupt the interaction between the GAL locus and the periphery or synthetically tethered the locus to the periphery. Localization to the nuclear periphery was found to dampen initial GAL gene induction and was required for rapid repression after gene inactivation, revealing a function for the nuclear periphery in repressing endogenous GAL gene expression. Our results do not support a gene-gating model in which GAL gene interaction with the nuclear pore ensures rapid gene expression, but instead they suggest that a repressive environment at the nuclear periphery establishes a negative feedback loop that enables the GAL locus to respond rapidly to changes in environmental conditions. PMID:22323286

  19. Neutrophils negatively regulate induction of mucosal IgA responses after sublingual immunization

    PubMed Central

    Jee, Junbae; Bonnegarde-Bernard, Astrid; Duverger, Alexandra; Iwakura, Yoichiro; Cormet-Boyaka, Estelle; Martin, Tara L.; Steiner, Haley E.; Bachman, Ryan C.; Boyaka, Prosper N.

    2015-01-01

    Induction of mucosal IgA capable of providing a first line of defense against bacterial and viral pathogens remains a major goal of needle-free vaccines given via mucosal routes. Innate immune cells are known to play a central role in induction of IgA responses by mucosal vaccines, but the relative contribution of myeloid cell subsets to these responses has not firmly been established. Using an in vivo model of sublingual vaccination with Bacillus anthracis edema toxin (EdTx) as adjuvant, we examined the role of myeloid cell subsets for mucosal secretory IgA responses. Sublingual immunization of wild-type mice resulted in a transient increase of neutrophils in sublingual tissues and cervical lymph nodes. These mice later developed Ag-specific serum IgG responses, but not serum or mucosal IgA. Interestingly, EdTx failed to increase neutrophils in sublingual tissues of IKKβΔMye mice, and these mice developed IgA responses. Partial depletion of neutrophils before immunization of wild-type mice allowed the development of both mucosal and serum IgA responses. Finally, co-culture of B cells with neutrophils from either wild-type or IKKβΔMye mice suppressed production of IgA, but not IgM or IgG. These results identify a new role for neutrophils as negative regulators of IgA responses. PMID:25563500

  20. RNA-destabilizing Factor Tristetraprolin Negatively Regulates NF-κB Signaling*

    PubMed Central

    Liang, Jian; Lei, Tianhua; Song, Yuting; Yanes, Natalie; Qi, Yongfen; Fu, Mingui

    2009-01-01

    Tristetraprolin (TTP) is a CCCH zinc finger-containing protein that destabilizes mRNA by binding to an AU-rich element. Mice deficient in TTP develop a severe inflammatory syndrome mainly because of overproduction of tumor necrosis factor α. We report here that TTP also negatively regulates NF-κB signaling at the transcriptional corepressor level, by which it may repress inflammatory gene transcription. TTP expression inhibited NF-κB-dependent transcription. However, overexpression of TTP did not affect reporter mRNA stability. Instead, TTP functioned as a corepressor of p65/NF-κB. In support of this concept, we found that TTP physically interacted with the p65 subunit of NF-κB and was also associated with HDAC1, -3, and -7 in vivo. Treatment with histone deacetylase inhibitors or small interfering RNA induced HDAC1 or HDAC3 knockdown completely or partly abolished the inhibitory activity of TTP on NF-κB reporter activation. Consistently, chromatin immunoprecipitation showed decreased recruitment of HDAC1 and increased recruitment of CREB-binding protein on the Mcp-1 promoter in TTP−/− cells compared with wild-type cells. Moreover, overexpression of TTP blocked CREB-binding protein-induced acetylation of p65/NF-κB. Taken together, these data suggest that TTP may also function in vivo as a modulator in suppressing the transcriptional activity of NF-κB. PMID:19738286

  1. Event-Related Potentials Reveal Preserved Attention Allocation but Impaired Emotion Regulation in Patients with Epilepsy and Comorbid Negative Affect

    PubMed Central

    De Taeye, Leen; Pourtois, Gilles; Meurs, Alfred; Boon, Paul; Vonck, Kristl; Carrette, Evelien; Raedt, Robrecht

    2015-01-01

    Patients with epilepsy have a high prevalence of comorbid mood disorders. This study aims to evaluate whether negative affect in epilepsy is associated with dysfunction of emotion regulation. Event-related potentials (ERPs) are used in order to unravel the exact electrophysiological time course and investigate whether a possible dysfunction arises during early (attention) and/or late (regulation) stages of emotion control. Fifty epileptic patients with (n = 25) versus without (n = 25) comorbid negative affect plus twenty-five matched controls were recruited. ERPs were recorded while subjects performed a face- or house-matching task in which fearful, sad or neutral faces were presented either at attended or unattended spatial locations. Two ERP components were analyzed: the early vertex positive potential (VPP) which is normally enhanced for faces, and the late positive potential (LPP) that is typically larger for emotional stimuli. All participants had larger amplitude of the early face-sensitive VPP for attended faces compared to houses, regardless of their emotional content. By contrast, in patients with negative affect only, the amplitude of the LPP was significantly increased for unattended negative emotional expressions. These VPP results indicate that epilepsy with or without negative affect does not interfere with the early structural encoding and attention selection of faces. However, the LPP results suggest abnormal regulation processes during the processing of unattended emotional faces in patients with epilepsy and comorbid negative affect. In conclusion, this ERP study reveals that early object-based attention processes are not compromised by epilepsy, but instead, when combined with negative affect, this neurological disease is associated with dysfunction during the later stages of emotion regulation. As such, these new neurophysiological findings shed light on the complex interplay of epilepsy with negative affect during the processing of emotional

  2. Identification of miRNA/mRNA-Negative Regulation Pairs in Nasopharyngeal Carcinoma

    PubMed Central

    Liu, Minglei; Zhu, Kangru; Qian, Xinmei; Li, Wei

    2016-01-01

    Background Nasopharyngeal carcinoma (NPC) is a common malignancy in South-East Asia. NPC is characterized by distant metastasis and poor prognosis. The pathophysiological mechanism of nasopharyngeal carcinoma is unknown. This study aimed to identify the crucial miRNAs in nasopharyngeal carcinoma and their target genes, and to discover the potential mechanism of nasopharyngeal carcinoma development. Material/Methods Microarray expression profiling of miRNA and mRNA from the Gene Expression Omnibus database was downloaded, and we performed a significance analysis of differential expression. An interaction network of miRNAs and target genes was constructed. The underlying function of differentially expressed genes was predicted through Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses. To validate the microarray analysis data, significantly different expression levels of miRNAs and target genes were validated by quantitative real-time polymerase chain reaction. Results We identified 27 differentially expressed miRNAs and 982 differentially expressed mRNAs between NPC and normal control tissues. 12 miRNAs and 547 mRNAs were up-regulated and 15 miRNAs and 435 mRNAs were down-regulated in NPC samples. We found a total of 1185 negative correlation pairs between miRNA and mRNA. Differentially expressed target genes were significantly enriched in pathways in cancer, cell cycle, and cytokine-cytokine receptor interaction signaling pathways. Significantly differentially expressed miRNAs and genes, such as hsa-miR-205, hsa-miR-18b, hsa-miR-632, hsa-miR-130a, hsa-miR-34b, PIGR, SMPD3, CD22, DTX4, and CDC6, may play essential roles in the development of nasopharyngeal carcinoma. Conclusions hsa-miR-205, hsa-miR-18b, hsa-miR-632, hsa-miR-130a, and hsa-miR-34b may be related to the development of nasopharyngeal carcinoma by regulating the genes involved in pathways in cancer and cell cycle signaling pathways. PMID:27350400

  3. Human immunodeficiency virus-negative plasmablastic lymphoma: a comprehensive analysis of 114 cases.

    PubMed

    Liu, Min; Liu, Bailong; Liu, Bin; Wang, Qiang; Ding, Lijuan; Xia, Chengcheng; Dong, Lihua

    2015-04-01

    Human immunodeficiency virus-negative plasma-blastic lymphoma (PBL) is an extremely rare entity. Its clinicopathological features, optimal treatment strategy and prognostic factors remain obsure. An extensive search was performed in the English language literature within the Pubmed database using the key words: 'plasmablastic lymphoma and human immunodeficiency virus-negative or immunocompetent'. Data from 114 patients from 52 articles were analyzed. The mean patient age at diagnosis was 58.90 years (range, 2-86). HIV-negative PBL showed a predilection for elderly individuals (patients older than 60 years, 56.14%) and affected more males than females (M:F, 2.29:1). Ann Arbor stage IV patients accounted for 39.22% while bone marrow involvement was less frequent (12.79%). The Ki-67 index was high with a mean expression of 83%. Epstein-Barr virus (EBV) infection was common being positive in 58.70% of the patients while herpesvirus-8 (HHV-8) infection was rare being positive in only 7.55% of the patients. Immunosuppression was noted in 28.16% of patients. The median overall survival (OS) was 19 months. The 1- and 2-year survival rates were 52.3 and 45.3%, respectively. Age, gender and primary site showed no strong relationship with OS while Immunosuppression, Ann Arbor stage IV and EBV negativity were able to predict a poorer OS. Either complete remission (CR) or partial remission (PR) was superior to the refractory group in OS (P<0.0001 and P=0.0066, respectively). For stage Ⅰ patients, the application of radiotherapy did not improve the OS. In conclusion, HIV-negative PBL is a distinct entity likely occurring in elderly and immunosuppressed individuals. Immunosuppression status, Ann Arbor stage IV, EBV negativity and refractory to treatment are poor prognostic factors of OS in HIV-negative PBL. PMID:25695332

  4. How Is Emotional Awareness Related to Emotion Regulation Strategies and Self-Reported Negative Affect in the General Population?

    PubMed Central

    Subic-Wrana, Claudia; Beutel, Manfred E.; Brähler, Elmar; Stöbel-Richter, Yve; Knebel, Achim; Lane, Richard D.; Wiltink, Jörg

    2014-01-01

    Objective The Levels of Emotional Awareness Scale (LEAS) as a performance task discriminates between implicit or subconscious and explicit or conscious levels of emotional awareness. An impaired awareness of one's feeling states may influence emotion regulation strategies and self-reports of negative emotions. To determine this influence, we applied the LEAS and self-report measures for emotion regulation strategies and negative affect in a representative sample of the German general population. Sample and Methods A short version of the LEAS, the Hospital Anxiety and Depression Scale (HADS) and the Emotion Regulation Questionnaire (ERQ), assessing reappraisal and suppression as emotion regulation strategies, were presented to N = 2524 participants of a representative German community study. The questionnaire data were analyzed with regard to the level of emotional awareness. Results LEAS scores were independent from depression, but related to self-reported anxiety. Although of small or medium effect size, different correlational patters between emotion regulation strategies and negative affectivity were related to implict and explict levels of emotional awareness. In participants with implicit emotional awareness, suppression was related to higher anxiety and depression, whereas in participants with explicit emotional awareness, in addition to a positive relationship of suppression and depression, we found a negative relationship of reappraisal to depression. These findings were independent of age. In women high use of suppression and little use of reappraisal were more strongly related to negative affect than in men. Discussion Our first findings suggest that conscious awareness of emotions may be a precondition for the use of reappraisal as an adaptive emotion regulation strategy. They encourage further research in the relation between subconsious and conscious emotional awareness and the prefarance of adaptive or maladaptive emotion regulation strategies The

  5. Negative Regulation of DsbA-L Gene Expression by the Transcription Factor Sp1

    PubMed Central

    Fang, Qichen; Yang, Wenjing; Li, Huating; Hu, Wenxiu; Chen, Lihui; Jiang, Shan; Dong, Kun; Song, Qianqian; Wang, Chen; Chen, Shuo; Liu, Feng

    2014-01-01

    Disulfide-bond A oxidoreductase-like protein (DsbA-L) possesses beneficial effects such as promoting adiponectin multimerization and stability, increasing insulin sensitivity, and enhancing energy metabolism. The expression level of DsbA-L is negatively correlated with obesity in mice and humans, but the underlying mechanisms remain unknown. To address this question, we generated reporter gene constructs containing the promoter sequence of the mouse DsbA-L gene. Deletion analysis showed that the proximal promoter of mouse DsbA-L is located between −186 and −34 bp relative to the transcription start site. In silico analysis identified a putative Sp1 transcription factor binding site in the first intron of the DsbA-L gene. Electrophoretic mobility shift assay and chromatin immunoprecipitation analysis indicated that Sp1 bound to this intron region in vitro and in intact cells. Overexpression of Sp1 or suppressing Sp1 expression by siRNA reduced or increased DsbA-L promoter activity, respectively. The binding activity of Sp1 was gradually decreased during 3T3-L1 cell differentiation and was significantly increased in adipose tissues of obese mice. Our results identify Sp1 as an inhibitor of DsbA-L gene transcription, and the Sp1-mediated inhibition of DsbA-L gene expression may provide a mechanism underlying obesity-induced adiponectin downregulation and insulin resistance. PMID:25024375

  6. PKC{delta}-mediated IRS-1 Ser24 phosphorylation negatively regulates IRS-1 function

    SciTech Connect

    Greene, Michael W. . E-mail: michael.greene@bassett.org; Ruhoff, Mary S.; Roth, Richard A.; Kim, Jeong-a; Quon, Michael J.; Krause, Jean A.

    2006-10-27

    The IRS-1 PH and PTB domains are essential for insulin-stimulated IRS-1 Tyr phosphorylation and insulin signaling, while Ser/Thr phosphorylation of IRS-1 disrupts these signaling events. To investigate consensus PKC phosphorylation sites in the PH-PTB domains of human IRS-1, we changed Ser24, Ser58, and Thr191 to Ala (3A) or Glu (3E), to block or mimic phosphorylation, respectively. The 3A mutant abrogated the inhibitory effect of PKC{delta} on insulin-stimulated IRS-1 Tyr phosphorylation, while reductions in insulin-stimulated IRS-1 Tyr phosphorylation, cellular proliferation, and Akt activation were observed with the 3E mutant. When single Glu mutants were tested, the Ser24 to Glu mutant had the greatest inhibitory effect on insulin-stimulated IRS-1 Tyr phosphorylation. PKC{delta}-mediated IRS-1 Ser24 phosphorylation was confirmed in cells with PKC{delta} catalytic domain mutants and by an RNAi method. Mechanistic studies revealed that IRS-1 with Ala and Glu point mutations at Ser24 impaired phosphatidylinositol-4,5-bisphosphate binding. In summary, our data are consistent with the hypothesis that Ser24 is a negative regulatory phosphorylation site in IRS-1.

  7. Human brain evolution: transcripts, metabolites and their regulators.

    PubMed

    Somel, Mehmet; Liu, Xiling; Khaitovich, Philipp

    2013-02-01

    What evolutionary events led to the emergence of human cognition? Although the genetic differences separating modern humans from both non-human primates (for example, chimpanzees) and archaic hominins (Neanderthals and Denisovans) are known, linking human-specific mutations to the cognitive phenotype remains a challenge. One strategy is to focus on human-specific changes at the level of intermediate phenotypes, such as gene expression and metabolism, in conjunction with evolutionary changes in gene regulation involving transcription factors, microRNA and proximal regulatory elements. In this Review we show how this strategy has yielded some of the first hints about the mechanisms of human cognition. PMID:23324662

  8. MiR-146b negatively regulates migration and delays progression of T-cell acute lymphoblastic leukemia.

    PubMed

    Correia, Nádia C; Fragoso, Rita; Carvalho, Tânia; Enguita, Francisco J; Barata, João T

    2016-01-01

    Previous results indicated that miR-146b-5p is downregulated by TAL1, a transcription factor critical for early hematopoiesis that is frequently overexpressed in T-cell acute lymphoblastic leukemia (T-ALL) where it has an oncogenic role. Here, we confirmed that miR-146b-5p expression is lower in TAL1-positive patient samples than in other T-ALL cases. Furthermore, leukemia T-cells display decreased levels of miR-146b-5p as compared to normal T-cells, thymocytes and other hematopoietic progenitors. MiR-146b-5p silencing enhances the in vitro migration and invasion of T-ALL cells, associated with increased levels of filamentous actin and chemokinesis. In vivo, miR-146b overexpression in a TAL1-positive cell line extends mouse survival in a xenotransplant model of human T-ALL. In contrast, knockdown of miR-146b-5p results in leukemia acceleration and decreased mouse overall survival, paralleled by faster tumor infiltration of the central nervous system. Our results suggest that miR-146b-5p is a functionally relevant microRNA gene in the context of T-ALL, whose negative regulation by TAL1 and possibly other oncogenes contributes to disease progression by modulating leukemia cell motility and disease aggressiveness. PMID:27550837

  9. Negative Regulation of the Stability and Tumor Suppressor Function of Fbw7 by the Pin1 Prolyl Isomerase

    PubMed Central

    Min, Sang-Hyun; Lau, Alan W.; Lee, Tae Ho; Inuzuka, Hiroyuki; Wei, Shuo; Huang, Pengyu; Shaik, Shavali; Lee, Daniel Yenhong; Finn, Greg; Balastik, Martin; Chen, Chun-Hau; Luo, Manli; Tron, Adriana E.; DeCaprio, James A.; Zhou, Xiao Zhen; Wei, Wenyi; Lu, Kun Ping

    2012-01-01

    SUMMARY Fbw7 is the substrate recognition component of the SCF (Skp1-Cullin-F-box)-type E3 ligase complex and a well-characterized tumor suppressor that targets numerous oncoproteins for destruction. Genomic deletion or mutation of FBW7 has been frequently found in various types of human cancers, however, little is known about the upstream signaling pathway(s) governing Fbw7 stability and cellular functions. Here we report that Fbw7 protein destruction and tumor suppressor function are negatively regulated by the prolyl isomerase Pin1. Pin1 interacts with Fbw7 in a phoshorylation-dependent manner and promotes Fbw7 self-ubiquitination and protein degradation by disrupting Fbw7 dimerization. Consequently, over-expressing Pin1 reduces Fbw7 abundance and suppresses Fbw7’s ability to inhibit proliferation and transformation. By contrast, depletion of Pin1 in cancer cells leads to elevated Fbw7 expression, which subsequently reduces Mcl-1 abundance, sensitizing cancer cells to Taxol. Thus, Pin1-mediated inhibition of Fbw7 contributes to oncogenesis and Pin1 may be a promising drug target for anti-cancer therapy. PMID:22608923

  10. Negative regulation of the stability and tumor suppressor function of Fbw7 by the Pin1 prolyl isomerase.

    PubMed

    Min, Sang-Hyun; Lau, Alan W; Lee, Tae Ho; Inuzuka, Hiroyuki; Wei, Shuo; Huang, Pengyu; Shaik, Shavali; Lee, Daniel Yenhong; Finn, Greg; Balastik, Martin; Chen, Chun-Hau; Luo, Manli; Tron, Adriana E; Decaprio, James A; Zhou, Xiao Zhen; Wei, Wenyi; Lu, Kun Ping

    2012-06-29

    Fbw7 is the substrate recognition component of the Skp1-Cullin-F-box (SCF)-type E3 ligase complex and a well-characterized tumor suppressor that targets numerous oncoproteins for destruction. Genomic deletion or mutation of FBW7 has been frequently found in various types of human cancers; however, little is known about the upstream signaling pathway(s) governing Fbw7 stability and cellular functions. Here we report that Fbw7 protein destruction and tumor suppressor function are negatively regulated by the prolyl isomerase Pin1. Pin1 interacts with Fbw7 in a phoshorylation-dependent manner and promotes Fbw7 self-ubiquitination and protein degradation by disrupting Fbw7 dimerization. Consequently, overexpressing Pin1 reduces Fbw7 abundance and suppresses Fbw7's ability to inhibit proliferation and transformation. By contrast, depletion of Pin1 in cancer cells leads to elevated Fbw7 expression, which subsequently reduces Mcl-1 abundance, sensitizing cancer cells to Taxol. Thus, Pin1-mediated inhibition of Fbw7 contributes to oncogenesis, and Pin1 may be a promising drug target for anticancer therapy. PMID:22608923

  11. MiR-146b negatively regulates migration and delays progression of T-cell acute lymphoblastic leukemia

    PubMed Central

    Correia, Nádia C.; Fragoso, Rita; Carvalho, Tânia; Enguita, Francisco J.; Barata, João T.

    2016-01-01

    Previous results indicated that miR-146b-5p is downregulated by TAL1, a transcription factor critical for early hematopoiesis that is frequently overexpressed in T-cell acute lymphoblastic leukemia (T-ALL) where it has an oncogenic role. Here, we confirmed that miR-146b-5p expression is lower in TAL1-positive patient samples than in other T-ALL cases. Furthermore, leukemia T-cells display decreased levels of miR-146b-5p as compared to normal T-cells, thymocytes and other hematopoietic progenitors. MiR-146b-5p silencing enhances the in vitro migration and invasion of T-ALL cells, associated with increased levels of filamentous actin and chemokinesis. In vivo, miR-146b overexpression in a TAL1-positive cell line extends mouse survival in a xenotransplant model of human T-ALL. In contrast, knockdown of miR-146b-5p results in leukemia acceleration and decreased mouse overall survival, paralleled by faster tumor infiltration of the central nervous system. Our results suggest that miR-146b-5p is a functionally relevant microRNA gene in the context of T-ALL, whose negative regulation by TAL1 and possibly other oncogenes contributes to disease progression by modulating leukemia cell motility and disease aggressiveness. PMID:27550837

  12. DCAF4L2 promotes colorectal cancer invasion and metastasis via mediating degradation of NFκb negative regulator PPM1B

    PubMed Central

    Wang, Haiyu; Chen, Yusheng; Han, Jun; Meng, Qingyang; Xi, Qiulei; Wu, Guohao; Zhang, Bo

    2016-01-01

    DCAF4L2 is a member of WD-repeat proteins, which commonly serve as mediators of protein-protein interplay. In this study, we reported that elevated DCAF4L2 expression in human colorectal cancer (CRC) significantly correlated with a more advanced clinical stage as in lymphatic and distant metastasis. More importantly, elevated DCAF4L2 expression is an independent prognosis factor for survival. Genetic perturbations demonstrated that DCAF4L2 overexpression in CRC cells promoted cell migration and invasion, whereas knockdown of which had opposing effects. Moreover we discovered that DCAF4L2 overexpression could promote epithelial-mesenchymal-transition (EMT) through activating NFκB signal pathway. Mass spectrometry analysis showed that DCAF4L2 could form an E3 ligase complex with Cul4A and DDB1 thus mediated degradation of PPM1B, which has been reported to negatively regulate NFκB signaling. We identified PPM1B as a substrate of Cul4A-DDB1-DCAF4L2 E3 ligase complex, as knockdown of PPM1B abrogated shDCAF4L2 mediated inhibition of cell invasion in CRC cells. For further verification, DCAF4L2 expression inversely correlated with PPM1B expression in a cohort of 87 CRC patients. These findings may provide insight into the understanding of DCAF4L2 as a novel critical factor and a candidate target for CRC treatment. PMID:27158335

  13. Glutaminase 2 is a novel negative regulator of small GTPase Rac1 and mediates p53 function in suppressing metastasis

    PubMed Central

    Zhang, Cen; Liu, Juan; Zhao, Yuhan; Yue, Xuetian; Zhu, Yu; Wang, Xiaolong; Wu, Hao; Blanco, Felix; Li, Shaohua; Bhanot, Gyan; Haffty, Bruce G; Hu, Wenwei; Feng, Zhaohui

    2016-01-01

    Glutaminase (GLS) isoenzymes GLS1 and GLS2 are key enzymes for glutamine metabolism. Interestingly, GLS1 and GLS2 display contrasting functions in tumorigenesis with elusive mechanism; GLS1 promotes tumorigenesis, whereas GLS2 exhibits a tumor-suppressive function. In this study, we found that GLS2 but not GLS1 binds to small GTPase Rac1 and inhibits its interaction with Rac1 activators guanine-nucleotide exchange factors, which in turn inhibits Rac1 to suppress cancer metastasis. This function of GLS2 is independent of GLS2 glutaminase activity. Furthermore, decreased GLS2 expression is associated with enhanced metastasis in human cancer. As a p53 target, GLS2 mediates p53’s function in metastasis suppression through inhibiting Rac1. In summary, our results reveal that GLS2 is a novel negative regulator of Rac1, and uncover a novel function and mechanism whereby GLS2 suppresses metastasis. Our results also elucidate a novel mechanism that contributes to the contrasting functions of GLS1 and GLS2 in tumorigenesis. DOI: http://dx.doi.org/10.7554/eLife.10727.001 PMID:26751560

  14. MicroRNA-27a-3p Is a Negative Regulator of Lung Fibrosis by Targeting Myofibroblast Differentiation.

    PubMed

    Cui, Huachun; Banerjee, Sami; Xie, Na; Ge, Jing; Liu, Rui-Ming; Matalon, Sadis; Thannickal, Victor J; Liu, Gang

    2016-06-01

    Although microRNAs (miRs) have been well recognized to play an important role in the pathogenesis of organ fibrosis, there is a lack of evidence as to whether miRs directly regulate the differentiation of myofibroblasts, the putative effector cells during pathological fibrogenesis. In this study, we found that levels of miR-27a-3p were up-regulated in transforming growth factor-β1-treated human lung fibroblasts in a Smad2/3-dependent manner and in fibroblasts isolated from lungs of mice with experimental pulmonary fibrosis. However, both basal and transforming growth factor-β1-induced expression of miR-27a-3p were reduced in lung fibroblasts from patients with idiopathic pulmonary fibrosis compared with that from normal control subjects. Overexpression of miR-27a-3p inhibited, whereas knockdown of miR-27a-3p enhanced, the differentiation of lung fibroblasts into myofibroblasts. We found that miR-27a-3p directly targeted the phenotypic marker of myofibroblasts, α-smooth muscle actin, and two key Smad transcription factors, Smad2 and Smad4. More importantly, we found that therapeutic expression of miR-27a-3p in mouse lungs through lentiviral delivery diminished bleomycin-induced lung fibrosis. In conclusion, our data suggest that miR-27a-3p functions via a negative-feedback mechanism in inhibiting lung fibrosis. This study also indicates that targeting miR-27a-3p is a novel therapeutic approach to treat fibrotic organ disorders, including lung fibrosis. PMID:26600197

  15. RIN3 is a negative regulator of mast cell responses to SCF.

    PubMed

    Janson, Christine; Kasahara, Noriyuki; Prendergast, George C; Colicelli, John

    2012-01-01

    Stimulation of the receptor tyrosine kinase KIT by Stem Cell Factor (SCF) triggers activation of RAS and its downstream effectors. Proper KIT activation is essential for the maturation, survival and proliferation of mast cells. In addition, SCF activation of KIT is critical for recruiting mast cells to sites of infection or injury, where they release a mix of pro-inflammatory substances. RIN3, a RAS effector and RAB5-directed guanine nucleotide exchange factor (GEF), is highly expressed and enriched in human mast cells. SCF treatment of mast cells increased the amount of GTP-bound RAB5, and the degree of RAB5 activation correlated with the expression level of RIN3. At the same time, SCF caused the dissociation of a pre-formed complex of RIN3 with BIN2, a membrane bending protein implicated in endocytosis. Silencing of RIN3 increased the rate of SCF-induced KIT internalization, while persistent RIN3 over-expression led to KIT down regulation. These observations strongly support a role for RIN3 in coordinating the early steps of KIT endocytosis. Importantly, RIN3 also functioned as an inhibitor of mast cell migration toward SCF. Finally, we demonstrate that elevated RIN3 levels sensitize mastocytosis cells to treatment with a KIT tyrosine kinase inhibitor, suggesting the value of a two-pronged inhibitor approach for this difficult to treat malignancy. These findings directly connect KIT activation with a mast cell-specific RAS effector that regulates the cellular response to SCF and provide new insight for the development of more effective mastocytosis treatments. PMID:23185384

  16. Tctex1d2 Is a Negative Regulator of GLUT4 Translocation and Glucose Uptake.

    PubMed

    Shimoda, Yoko; Okada, Shuichi; Yamada, Eijiro; Pessin, Jeffrey E; Yamada, Masanobu

    2015-10-01

    Tctex1d2 (Tctex1 domain containing 2) is an open reading frame that encodes for a functionally unknown protein that contains a Tctex1 domain found in dynein light chain family members. Examination of gene expression during adipogenesis demonstrated a marked increase in Tctex1d2 protein expression that was essentially undetectable in preadipocytes and markedly induced during 3T3-L1 adipocyte differentiation. Tctex1d2 overexpression significantly inhibited insulin-stimulated glucose transporter 4 (GLUT4) translocation and 2-deoxyglucose uptake. In contrast, Tctex1d2 knockdown significantly increased insulin-stimulated GLUT4 translocation and 2-deoxyglucose uptake. However, acute insulin stimulation (up to 30 min) in 3T3-L1 adipocytes with overexpression or knockdown of Tctex1d2 had no effect on Akt phosphorylation, a critical signal transduction target required for GLUT4 translocation. Although overexpression of Tctex1d2 had no significant effect on GLUT4 internalization, Tctex1d2 was found to associate with syntaxin 4 in an insulin-dependent manner and inhibit Doc2b binding to syntaxin 4. In addition, glucose-dependent insulinotropic polypeptide rescued the Tctex1d2 inhibition of insulin-stimulated GLUT4 translocation by suppressing the Tctex1d2-syntaxin 4 interaction and increasing Doc2b-Synatxin4 interactions. Taking these results together, we hypothesized that Tctex1d2 is a novel syntaxin 4 binding protein that functions as a negative regulator of GLUT4 plasma membrane translocation through inhibition of the Doc2b-syntaxin 4 interaction. PMID:26200093

  17. A mutation of the fission yeast EB1 overcomes negative regulation by phosphorylation and stabilizes microtubules

    SciTech Connect

    Iimori, Makoto; Ozaki, Kanako; Chikashige, Yuji; Habu, Toshiyuki; Hiraoka, Yasushi; Maki, Takahisa; Hayashi, Ikuko; Obuse, Chikashi; Matsumoto, Tomohiro

    2012-02-01

    Mal3 is a fission yeast homolog of EB1, a plus-end tracking protein (+ TIP). We have generated a mutation (89R) replacing glutamine with arginine in the calponin homology (CH) domain of Mal3. Analysis of the 89R mutant in vitro has revealed that the mutation confers a higher affinity to microtubules and enhances the intrinsic activity to promote the microtubule-assembly. The mutant Mal3 is no longer a + TIP, but binds strongly the microtubule lattice. Live cell imaging has revealed that while the wild type Mal3 proteins dissociate from the tip of the growing microtubules before the onset of shrinkage, the mutant Mal3 proteins persist on microtubules and reduces a rate of shrinkage after a longer pausing period. Consequently, the mutant Mal3 proteins cause abnormal elongation of microtubules composing the spindle and aster. Mal3 is phosphorylated at a cluster of serine/threonine residues in the linker connecting the CH and EB1-like C-terminal motif domains. The phosphorylation occurs in a microtubule-dependent manner and reduces the affinity of Mal3 to microtubules. We propose that because the 89R mutation is resistant to the effect of phosphorylation, it can associate persistently with microtubules and confers a stronger stability of microtubules likely by reinforcing the cylindrical structure. -- Highlights: Black-Right-Pointing-Pointer We characterize a mutation (mal3-89R) in fission yeast homolog of EB1. Black-Right-Pointing-Pointer The mutation enhances the activity to assemble microtubules. Black-Right-Pointing-Pointer Mal3 is phosphorylated in a microtubule-dependent manner. Black-Right-Pointing-Pointer The phosphorylation negatively regulates the Mal3 activity.

  18. Crystal structure of PhoU from Pseudomonas aeruginosa, a negative regulator of the Pho regulon.

    PubMed

    Lee, Sang Jae; Park, Ye Seol; Kim, Soon-Jong; Lee, Bong-Jin; Suh, Se Won

    2014-10-01

    In Escherichia coli, seven genes (pstS, pstC, pstA, pstB, phoU, phoR, and phoB) are involved in sensing environmental phosphate (Pi) and controlling the expression of the Pho regulon. PhoU is a negative regulator of the Pi-signaling pathway and modulates Pi transport through Pi transporter proteins (PstS, PstC, PstA, and PstB) through the two-component system PhoR and PhoB. Inactivation of PhoY2, one of the two PhoU homologs in Mycobacterium tuberculosis, causes defects in persistence phenotypes and increased susceptibility to antibiotics and stresses. Despite the important biological role, the mechanism of PhoU function is still unknown. Here we have determined the crystal structure of PhoU from Pseudomonas aeruginosa. It exists as a dimer in the crystal, with each monomer consisting of two structurally similar three-helix bundles. Our equilibrium sedimentation measurements support the reversible monomer-dimer equilibrium model in which P. aeruginosa PhoU exists in solution predominantly as dimers, with monomers in a minor fraction, at low protein concentrations. The dissociation constant for PhoU dimerization is 3.2×10(-6)M. The overall structure of P. aeruginosa PhoU dimer resembles those of Aquifex aeolicus PhoU and Thermotoga maritima PhoU2. However, it shows distinct structural features in some loops and the dimerization pattern. PMID:25220976

  19. The pif1 helicase, a negative regulator of telomerase, acts preferentially at long telomeres.

    PubMed

    Phillips, Jane A; Chan, Angela; Paeschke, Katrin; Zakian, Virginia A

    2015-04-01

    Telomerase, the enzyme that maintains telomeres, preferentially lengthens short telomeres. The S. cerevisiae Pif1 DNA helicase inhibits both telomerase-mediated telomere lengthening and de novo telomere addition at double strand breaks (DSB). Here, we report that the association of the telomerase subunits Est2 and Est1 at a DSB was increased in the absence of Pif1, as it is at telomeres, suggesting that Pif1 suppresses de novo telomere addition by removing telomerase from the break. To determine how the absence of Pif1 results in telomere lengthening, we used the single telomere extension assay (STEX), which monitors lengthening of individual telomeres in a single cell cycle. In the absence of Pif1, telomerase added significantly more telomeric DNA, an average of 72 nucleotides per telomere compared to the 45 nucleotides in wild type cells, and the fraction of telomeres lengthened increased almost four-fold. Using an inducible short telomere assay, Est2 and Est1 no longer bound preferentially to a short telomere in pif1 mutant cells while binding of Yku80, a telomere structural protein, was unaffected by the status of the PIF1 locus. Two experiments demonstrate that Pif1 binding is affected by telomere length: Pif1 (but not Yku80) -associated telomeres were 70 bps longer than bulk telomeres, and in the inducible short telomere assay, Pif1 bound better to wild type length telomeres than to short telomeres. Thus, preferential lengthening of short yeast telomeres is achieved in part by targeting the negative regulator Pif1 to long telomeres. PMID:25906395

  20. Regulation of release factor expression using a translational negative feedback loop: a systems analysis.

    PubMed

    Betney, Russell; de Silva, Eric; Mertens, Christina; Knox, Yvonne; Krishnan, J; Stansfield, Ian

    2012-12-01

    The essential eukaryote release factor eRF1, encoded by the yeast SUP45 gene, recognizes stop codons during ribosomal translation. SUP45 nonsense alleles are, however, viable due to the establishment of feedback-regulated readthrough of the premature termination codon; reductions in full-length eRF1 promote tRNA-mediated stop codon readthrough, which, in turn, drives partial production of full-length eRF1. A deterministic mathematical model of this eRF1 feedback loop was developed using a staged increase in model complexity. Model predictions matched the experimental observation that strains carrying the mutant SUQ5 tRNA (a weak UAA suppressor) in combination with any of the tested sup45(UAA) nonsense alleles exhibit threefold more stop codon readthrough than that of an SUQ5 yeast strain. The model also successfully predicted that eRF1 feedback control in an SUQ5 sup45(UAA) mutant would resist, but not completely prevent, imposed changes in eRF1 expression. In these experiments, the introduction of a plasmid-borne SUQ5 copy into a sup45(UAA) SUQ5 mutant directed additional readthrough and full-length eRF1 expression, despite feedback. Secondly, induction of additional sup45(UAA) mRNA expression in a sup45(UAA) SUQ5 strain also directed increased full-length eRF1 expression. The autogenous sup45 control mechanism therefore acts not to precisely control eRF1 expression, but rather as a damping mechanism that only partially resists changes in release factor expression level. The validated model predicts that the degree of feedback damping (i.e., control precision) is proportional to eRF1 affinity for the premature stop codon. The validated model represents an important tool to analyze this and other translational negative feedback loops. PMID:23104998

  1. Regulation of release factor expression using a translational negative feedback loop: A systems analysis

    PubMed Central

    Betney, Russell; de Silva, Eric; Mertens, Christina; Knox, Yvonne; Krishnan, J.; Stansfield, Ian

    2012-01-01

    The essential eukaryote release factor eRF1, encoded by the yeast SUP45 gene, recognizes stop codons during ribosomal translation. SUP45 nonsense alleles are, however, viable due to the establishment of feedback-regulated readthrough of the premature termination codon; reductions in full-length eRF1 promote tRNA-mediated stop codon readthrough, which, in turn, drives partial production of full-length eRF1. A deterministic mathematical model of this eRF1 feedback loop was developed using a staged increase in model complexity. Model predictions matched the experimental observation that strains carrying the mutant SUQ5 tRNA (a weak UAA suppressor) in combination with any of the tested sup45UAA nonsense alleles exhibit threefold more stop codon readthrough than that of an SUQ5 yeast strain. The model also successfully predicted that eRF1 feedback control in an SUQ5 sup45UAA mutant would resist, but not completely prevent, imposed changes in eRF1 expression. In these experiments, the introduction of a plasmid-borne SUQ5 copy into a sup45UAA SUQ5 mutant directed additional readthrough and full-length eRF1 expression, despite feedback. Secondly, induction of additional sup45UAA mRNA expression in a sup45UAA SUQ5 strain also directed increased full-length eRF1 expression. The autogenous sup45 control mechanism therefore acts not to precisely control eRF1 expression, but rather as a damping mechanism that only partially resists changes in release factor expression level. The validated model predicts that the degree of feedback damping (i.e., control precision) is proportional to eRF1 affinity for the premature stop codon. The validated model represents an important tool to analyze this and other translational negative feedback loops. PMID:23104998

  2. Extragenic Suppressors of Saccharomyces Cerevisiae Prp4 Mutations Identify a Negative Regulator of Prp Genes

    PubMed Central

    Maddock, J. R.; Weidenhammer, E. M.; Adams, C. C.; Lunz, R. L.; Woolford-Jr., J. L.

    1994-01-01

    The PRP4 gene encodes a protein that is a component of the U4/U6 small nuclear ribonucleoprotein particle and is necessary for both spliceosome assembly and pre-mRNA splicing. To identify genes whose products interact with the PRP4 gene or gene product, we isolated second-site suppressors of temperature-sensitive prp4 mutations. We limited ourselves to suppressors with a distinct phenotype, cold sensitivity, to facilitate analysis of mutants. Ten independent recessive suppressors were obtained that identified four complementation groups, spp41, spp42, spp43 and spp44 (suppressor of prp4, numbers 1-4). spp41-spp44 suppress the pre-mRNA splicing defect as well as the temperature-sensitive phenotype of prp4 strains. Each of these spp mutations also suppresses prp3; spp41 and spp42 suppress prp11 as well. Neither spp41 nor spp42 suppresses null alleles of prp3 or prp4, indicating that the suppression does not occur via a bypass mechanism. The spp41 and spp42 mutations are neither allele- nor gene-specific in their pattern of suppression and do not result in a defect in pre-mRNA splicing. Thus the SPP41 and SPP42 gene products are unlikely to participate directly in mRNA splicing or interact directly with Prp3p or Prp4p. Expression of PRP3-lacZ and PRP4-lacZ gene fusions is increased in spp41 strains, suggesting that wild-type Spp41p represses expression of PRP3 and PRP4. SPP41 was cloned and sequenced and found to be essential. spp43 is allelic to the previously identified suppressor srn1, which encodes a negative regulator of gene expression. PMID:8005438

  3. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

    2009-01-01

    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  4. Protection against gram-negative bacteremia and endotoxemia with human monoclonal IgM antibodies.

    PubMed Central

    Teng, N N; Kaplan, H S; Hebert, J M; Moore, C; Douglas, H; Wunderlich, A; Braude, A I

    1985-01-01

    Hybridomas producing human monoclonal IgM antibodies (mAbs) against bacterial lipopolysaccharide (LPS) were generated by fusion of B lymphocytes from sensitized human spleen with heteromyeloma cells. The splenocytes were from patients undergoing splenectomy during staging for Hodgkin disease after vaccination with the J5 mutant of Escherichia coli, which is deficient in O antigenic side chains. This deficiency exposes the core oligosaccharide, common to LPS of all Gram-negative bacteria. The mAbs cross-reacted strongly with endotoxins from a wide range of unrelated species of Gram-negative bacteria. The mAbs also gave strong protection against LPS in the dermal Shwartzman reaction and against lethal Gram-negative bacteremia in mice. These findings indicate that monoclonal IgM against LPS endotoxin can neutralize its toxicity in vivo and might be valuable for treatment of patients with Gram-negative bacteremia. Analysis of one of the hybridoma clones, A6(H4C5), showed that the IgM mAb is directed against the covalently bound lipid A, which represents the most conservative and least variable structural element of LPS. Images PMID:3856860

  5. Regulation of toll-like receptors-mediated inflammation by immunobiotics in bovine intestinal epitheliocytes: role of signaling pathways and negative regulators.

    PubMed

    Villena, Julio; Aso, Hisashi; Kitazawa, Haruki

    2014-01-01

    Intestinal epithelial cells (IECs) detect bacterial and viral associated molecular patterns via germline-encoded pattern-recognition receptors (PRRs) and are responsible for maintaining immune tolerance to the communities of resident commensal bacteria while being also capable to mount immune responses against pathogens. Toll-like receptors (TLRs) are a major class of PRRs expressed on IECs and immune cells, which are involved in the induction of both tolerance and inflammation. In the last decade, experimental and clinical evidence was generated to support the application of probiotics with immunoregulatory capacities (immunobiotics) for the prevention and treatment of several gastrointestinal inflammatory disorders in which TLRs exert a significant role. The majority of these studies were performed in mouse and human cell lines, and despite the growing interest in the bovine immune system due to the economic importance of cattle as livestock, only few studies have been conducted on cattle. In this regard, our group has established a bovine intestinal epithelial (BIE) cell line originally derived from fetal bovine intestinal epitheliocytes and used this cell line to evaluate the impact of immunobiotics in TLR-mediated inflammation. This review aims to summarize the current knowledge of the beneficial effects of immunobiotics in the regulation of intestinal inflammation/infection in cattle. Especially, we discuss the role of TLRs and their negative regulators in both the inflammatory response and the beneficial effects of immunobiotics in bovine IECs. This review article emphasizes the cellular and molecular interactions of immunobiotics with BIE cells through TLRs and gives the scientific basis for the development of immunomodulatory feed for bovine healthy development. PMID:25228903

  6. NK Cell Proliferation Induced by IL-15 Transpresentation Is Negatively Regulated by Inhibitory Receptors.

    PubMed

    Anton, Olga M; Vielkind, Susina; Peterson, Mary E; Tagaya, Yutaka; Long, Eric O

    2015-11-15

    IL-15 bound to the IL-15Rα-chain (IL-15Rα) is presented in trans to cells bearing the IL-2Rβ-chain and common γ-chain. As IL-15 transpresentation occurs in the context of cell-to-cell contacts, it has the potential for regulation by and of other receptor-ligand interactions. In this study, human NK cells were tested for the sensitivity of IL-15 transpresentation to inhibitory receptors. Human cells expressing HLA class I ligands for inhibitory receptors KIR2DL1, KIR2DL2/3, or CD94-NKG2A were transfected with IL-15Rα. Proliferation of primary NK cells in response to transpresented IL-15 was reduced by engagement of either KIR2DL1 or KIR2DL2/3 by cognate HLA-C ligands. Inhibitory KIR-HLA-C interactions did not reduce the proliferation induced by soluble IL-15. Therefore, transpresentation of IL-15 is subject to downregulation by MHC class I-specific inhibitory receptors. Similarly, proliferation of the NKG2A(+) cell line NKL induced by IL-15 transpresentation was inhibited by HLA-E. Coengagement of inhibitory receptors, either KIR2DL1 or CD94-NKG2A, did not inhibit phosphorylation of Stat5 but inhibited selectively phosphorylation of Akt and S6 ribosomal protein. IL-15Rα was not excluded from, but was evenly distributed across, inhibitory synapses. These findings demonstrate a novel mechanism to attenuate IL-15-dependent NK cell proliferation and suggest that inhibitory NK cell receptors contribute to NK cell homeostasis. PMID:26453750

  7. Maternal Positive and Negative Interaction Behaviors and Early Adolescents' Depressive Symptoms: Adolescent Emotion Regulation as a Mediator

    ERIC Educational Resources Information Center

    Yap, Marie B. H.; Schwartz, Orli S.; Byrne, Michelle L.; Simmons, Julian G.; Allen, Nicholas B.

    2010-01-01

    This study examined the relation between mothers' positive and negative interaction behaviors during mother-child interactions and the emotion regulation (ER) and depressive symptoms of their adolescent offspring. Event-planning (EPI) and problem-solving interactions (PSI) were observed in 163 mother-adolescent dyads, and adolescents also provided…

  8. Identification of a negative regulatory domain in the human papillomavirus type 18 promoter: interaction with the transcriptional repressor YY1.

    PubMed Central

    Bauknecht, T; Angel, P; Royer, H D; zur Hausen, H

    1992-01-01

    The human papillomavirus type 18 (HPV-18) promoter contains a TPA responsive element (TRE) which confers TPA responsiveness on a heterologous promoter. In the context of the HPV-18 promoter, however, this AP-1 site is inactive. We have identified a negative regulatory domain in the HPV-18 promoter which represses the constitutive and TPA-induced AP-1 activity. This negative regulatory sequence has been mapped to 44 nucleotides (OL13). We identified this element as a transcriptional silencer based on its ability to interfere with transcriptional initiation. This HPV-18 silencer domain was narrowed down further to 23 nucleotides, the OL13B element, which bears similarity to three other silencer sequences, present in the mouse N-ras gene upstream regulatory region, the mouse albumin gene enhancer and the adeno-associated virus P5 promoter. The transcriptional repressor protein YY1, which negatively regulates the P5 promoter, binds to the HPV-18 silencer with high affinity. Mutation of the YY1 binding site leads to an enhanced activity of the HPV-18 promoter, strongly suggesting that YY1 plays an important role in controlling HPV-18 early gene expression. Images PMID:1330541

  9. CLAVATA1 Dominant-Negative Alleles Reveal Functional Overlap between Multiple Receptor Kinases That Regulate Meristem and Organ Development

    PubMed Central

    Diévart, Anne; Dalal, Monica; Tax, Frans E.; Lacey, Alexzandria D.; Huttly, Alison; Li, Jianming; Clark, Steven E.

    2003-01-01

    The CLAVATA1 (CLV1) receptor kinase controls stem cell number and differentiation at the Arabidopsis shoot and flower meristems. Other components of the CLV1 signaling pathway include the secreted putative ligand CLV3 and the receptor-like protein CLV2. We report evidence indicating that all intermediate and strong clv1 alleles are dominant negative and likely interfere with the activity of unknown receptor kinase(s) that have functional overlap with CLV1. clv1 dominant-negative alleles show major differences from dominant-negative alleles characterized to date in animal receptor kinase signaling systems, including the lack of a dominant-negative effect of kinase domain truncation and the ability of missense mutations in the extracellular domain to act in a dominant-negative manner. We analyzed chimeric receptor kinases by fusing CLV1 and BRASSINOSTEROID INSENSITIVE1 (BRI1) coding sequences and expressing these in clv1 null backgrounds. Constructs containing the CLV1 extracellular domain and the BRI1 kinase domain were strongly dominant negative in the regulation of meristem development. Furthermore, we show that CLV1 expressed within the pedicel can partially replace the function of the ERECTA receptor kinase. We propose the presence of multiple receptors that regulate meristem development in a functionally related manner whose interactions are driven by the extracellular domains and whose activation requires the kinase domain. PMID:12724544

  10. CHIP-mediated degradation of transglutaminase 2 negatively regulates tumor growth and angiogenesis in renal cancer.

    PubMed

    Min, B; Park, H; Lee, S; Li, Y; Choi, J-M; Lee, J Y; Kim, J; Choi, Y D; Kwon, Y-G; Lee, H-W; Bae, S-C; Yun, C-O; Chung, K C

    2016-07-14

    The multifunctional enzyme transglutaminase 2 (TG2) primarily catalyzes cross-linking reactions of proteins via (γ-glutamyl) lysine bonds. Several recent findings indicate that altered regulation of intracellular TG2 levels affects renal cancer. Elevated TG2 expression is observed in renal cancer. However, the molecular mechanism underlying TG2 degradation is not completely understood. Carboxyl-terminus of Hsp70-interacting protein (CHIP) functions as an ubiquitin E3 ligase. Previous studies reveal that CHIP deficiency mice displayed a reduced life span with accelerated aging in kidney tissues. Here we show that CHIP promotes polyubiquitination of TG2 and its subsequent proteasomal degradation. In addition, TG2 upregulation contributes to enhanced kidney tumorigenesis. Furthermore, CHIP-mediated TG2 downregulation is critical for the suppression of kidney tumor growth and angiogenesis. Notably, our findings are further supported by decreased CHIP expression in human renal cancer tissues and renal cancer cells. The present work reveals that CHIP-mediated TG2 ubiquitination and proteasomal degradation represent a novel regulatory mechanism that controls intracellular TG2 levels. Alterations in this pathway result in TG2 hyperexpression and consequently contribute to renal cancer. PMID:26568304

  11. MAGI3 negatively regulates Wnt/β-catenin signaling and suppresses malignant phenotypes of glioma cells.

    PubMed

    Ma, Qian; Yang, Ying; Feng, Duiping; Zheng, Shuai; Meng, Ran; Fa, Pengyan; Zhao, Chunjuan; Liu, Hua; Song, Ran; Tao, Tao; Yang, Longyan; Dai, Jie; Wang, Songlin; Jiang, Wen G; He, Junqi

    2015-11-01

    Gliomas are the most common primary brain malignancies and are associated with a poor prognosis. Here, we showed that the PDZ domain-containing protein membrane-associated guanylate kinase inverted 3 (MAGI3) was downregulated at the both mRNA and protein levels in human glioma samples. MAGI3 inhibited proliferation, migration, and cell cycle progression of glioma cells in its overexpression and knockdown studies. By using GST pull-down and co-immunoprecipitation assays, we found that MAGI3 bound to β-catenin through its PDZ domains and the PDZ-binding motif of β-catenin. MAGI3 overexpression inhibited β-catenin transcriptional activity via its interaction with β-catenin. Consistently, MAGI3 overexpression in glioma cells C6 suppressed expression of β-catenin target genes including Cyclin D1 and Axin2, whereas MAGI3 knockdown in glioma cells U373 and LN229 enhanced their expression. MAGI3 overexpression decreased growth of C6 subcutaneous tumors in mice, and inhibited expression of β-catenin target genes in xenograft tumors. Furthermore, analysis based on the Gene Expression Omnibus (GEO) glioma dataset showed association of MAGI3 expression with overall survival and tumor grade. Finally, we demonstrated negative correlation between MAGI3 expression and activity of Wnt/β-catenin signaling through GSEA of three public glioma datasets and immunohistochemical staining of clinical glioma samples. Taken together, these results identify MAGI3 as a novel tumor suppressor and provide insight into the pathogenesis of glioma. PMID:26452219

  12. Human Misato regulates mitochondrial distribution and morphology

    SciTech Connect

    Kimura, Masashi . E-mail: yo@gifu-u.ac.jp; Okano, Yukio

    2007-04-15

    Misato of Drosophila melanogaster and Saccharomyces cerevisiae DML1 are conserved proteins having a homologous region with a part of the GTPase family that includes eukaryotic tubulin and prokaryotic FtsZ. We characterized human Misato sharing homology with Misato of D. melanogaster and S. cerevisiae DML1. Tissue distribution of Misato exhibited ubiquitous distribution. Subcellular localization of the protein studied using anti-Misato antibody suggested that it is localized to the mitochondria. Further experiments of fractionating mitochondria revealed that Misato was localized to the outer membrane. The transfection of Misato siRNA led to growth deficiencies compared with control siRNA transfected HeLa cells, and the Misato-depleted HeLa cells showed apoptotic nuclear fragmentation resulting in cell death. After silencing of Misato, the filamentous mitochondrial network disappeared and fragmented mitochondria were observed, indicating human Misato has a role in mitochondrial fusion. To examine the effects of overexpression, COS-7 cells were transfected with cDNA encoding EGFP-Misato. Its overexpression resulted in the formation of perinuclear aggregations of mitochondria in these cells. The Misato-overexpressing cells showed low viability and had no nuclei or a small and structurally unusual ones. These results indicated that human Misato has a role(s) in mitochondrial distribution and morphology and that its unregulated expression leads to cell death.

  13. Mothers’ Responses to Children’s Negative Emotions and Child Emotion Regulation: The Moderating Role of Vagal Suppression

    PubMed Central

    Perry, Nicole B.; Calkins, Susan D.; Nelson, Jackie A.; Leerkes, Esther M.; Marcovitch, Stuart

    2011-01-01

    The current study examined the moderating effect of children’s cardiac vagal suppression on the association between maternal socialization of negative emotions (supportive and non-supportive responses) and children’s emotion regulation behaviors. One hundred and ninety-seven 4-year-olds and their mothers participated. Mothers reported on their reactions to children’s negative emotions and children’s regulatory behaviors. Observed distraction, an adaptive self-regulatory strategy, and vagal suppression were assessed during a laboratory task designed to elicit frustration. Results indicated that children’s vagal suppression moderated the association between mothers’ non-supportive emotion socialization and children’s emotion regulation behaviors such that non-supportive reactions to negative emotions predicted lower observed distraction and lower reported emotion regulation behaviors when children displayed lower levels of vagal suppression. No interaction was found between supportive maternal emotion socialization and vagal suppression for children’s emotion regulation behaviors. Results suggest physiological regulation may serve as a buffer against non-supportive emotion socialization. PMID:22072217

  14. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  15. Activated amelogenin Y-linked (AMELY) regulation and angiogenesis in human hepatocellular carcinoma by biocomputation.

    PubMed

    Qi, Lianxiu; Wang, Lin; Huang, Juxiang; Jiang, Minghu; Diao, Haizhen; Zhou, Huilei; Li, Xiaohe; Jiang, Zhenfu

    2013-03-01

    In the present study, a comparison of the biological processes and gene ontology (GO) in human hepatocellular carcinoma (HCC) with high expression (fold change ≥2) of amelogenin Y-linked (AMELY)-activated upstream regulation networks with non-tumor hepatitis/cirrhotic tissues (HBV or HCV infection) with low expression of activated networks was performed. The principle biological processes involved in non-tumor hepatitis/cirrhotic tissues include positive regulation of mismatch repair, regulation of transcription from RNA polymerase II promoters, negative regulation of cell-cell adhesion, protein ubiquitinatin and protein catabolism. The main biological processes involved in the development of HCC include positive regulation of calcium ion transport into the cytosol, cell proliferation, DNA replication, fibroblast proliferation, immune response, microtubule polymerization and protein secretion. Specific transcription from RNA polymerase II promoters, regulation of angiogenesis, cell growth, protein metabolism, Wnt receptor signaling pathways, negative regulation of endothelial cell differentiation, microtubule depolymerization, peptidase activity and progression through the cell cycle are also involved. Positive regulation of transcription is involved in both processes. An activated AMELY-coupled upstream positive regulation of immune response-mediated protein secretion to Wnt signaling and calcium into cytosol-induced regulation of cell growth and angiogenesis in HCC is proposed. The AMELY upstream regulation molecular network model was constructed with BUB1B, CST6, ESM1, HOXA5, LEF1, MAPT, MYBL2, NOTCH3, PLA2G1B, PROK1, ROBO1, SCML2 and UBE2C in HCC from a Gene Expression Omnibus (GEO) dataset by gene regulation network inference methods and our programming methods. PMID:23426651

  16. Liver X Receptor (LXR) Regulates Human Adipocyte Lipolysis*

    PubMed Central

    Stenson, Britta M.; Rydén, Mikael; Venteclef, Nicolas; Dahlman, Ingrid; Pettersson, Annie M. L.; Mairal, Aline; Åström, Gaby; Blomqvist, Lennart; Wang, Victoria; Jocken, Johan W. E.; Clément, Karine; Langin, Dominique; Arner, Peter; Laurencikiene, Jurga

    2011-01-01

    The Liver X receptor (LXR) is an important regulator of carbohydrate and lipid metabolism in humans and mice. We have recently shown that activation of LXR regulates cellular fuel utilization in adipocytes. In contrast, the role of LXR in human adipocyte lipolysis, the major function of human white fat cells, is not clear. In the present study, we stimulated in vitro differentiated human and murine adipocytes with the LXR agonist GW3965 and observed an increase in basal lipolysis. Microarray analysis of human adipocyte mRNA following LXR activation revealed an altered gene expression of several lipolysis-regulating proteins, which was also confirmed by quantitative real-time PCR. We show that expression and intracellular localization of perilipin1 (PLIN1) and hormone-sensitive lipase (HSL) are affected by GW3965. Although LXR activation does not influence phosphorylation status of HSL, HSL activity is required for the lipolytic effect of GW3965. This effect is abolished by PLIN1 knockdown. In addition, we demonstrate that upon activation, LXR binds to the proximal regions of the PLIN1 and HSL promoters. By selective knock-down of either LXR isoform, we show that LXRα is the major isoform mediating the lipolysis-related effects of LXR. In conclusion, the present study demonstrates that activation of LXRα up-regulates basal human adipocyte lipolysis. This is at least partially mediated through LXR binding to the PLIN1 promoter and down-regulation of PLIN1 expression. PMID:21030586

  17. Liver X receptor (LXR) regulates human adipocyte lipolysis.

    PubMed

    Stenson, Britta M; Rydén, Mikael; Venteclef, Nicolas; Dahlman, Ingrid; Pettersson, Annie M L; Mairal, Aline; Aström, Gaby; Blomqvist, Lennart; Wang, Victoria; Jocken, Johan W E; Clément, Karine; Langin, Dominique; Arner, Peter; Laurencikiene, Jurga

    2011-01-01

    The Liver X receptor (LXR) is an important regulator of carbohydrate and lipid metabolism in humans and mice. We have recently shown that activation of LXR regulates cellular fuel utilization in adipocytes. In contrast, the role of LXR in human adipocyte lipolysis, the major function of human white fat cells, is not clear. In the present study, we stimulated in vitro differentiated human and murine adipocytes with the LXR agonist GW3965 and observed an increase in basal lipolysis. Microarray analysis of human adipocyte mRNA following LXR activation revealed an altered gene expression of several lipolysis-regulating proteins, which was also confirmed by quantitative real-time PCR. We show that expression and intracellular localization of perilipin1 (PLIN1) and hormone-sensitive lipase (HSL) are affected by GW3965. Although LXR activation does not influence phosphorylation status of HSL, HSL activity is required for the lipolytic effect of GW3965. This effect is abolished by PLIN1 knockdown. In addition, we demonstrate that upon activation, LXR binds to the proximal regions of the PLIN1 and HSL promoters. By selective knock-down of either LXR isoform, we show that LXRα is the major isoform mediating the lipolysis-related effects of LXR. In conclusion, the present study demonstrates that activation of LXRα up-regulates basal human adipocyte lipolysis. This is at least partially mediated through LXR binding to the PLIN1 promoter and down-regulation of PLIN1 expression. PMID:21030586

  18. Both positive and negative selection pressures contribute to the polymorphism pattern of the duplicated human CYP21A2 gene.

    PubMed

    Szabó, Julianna Anna; Szilágyi, Ágnes; Doleschall, Zoltán; Patócs, Attila; Farkas, Henriette; Prohászka, Zoltán; Rácz, Kárioly; Füst, George; Doleschall, Márton

    2013-01-01

    The human steroid 21-hydroxylase gene (CYP21A2) participates in cortisol and aldosterone biosynthesis, and resides together with its paralogous (duplicated) pseudogene in a multiallelic copy number variation (CNV), called RCCX CNV. Concerted evolution caused by non-allelic gene conversion has been described in great ape CYP21 genes, and the same conversion activity is responsible for a serious genetic disorder of CYP21A2, congenital adrenal hyperplasia (CAH). In the current study, 33 CYP21A2 haplotype variants encoding 6 protein variants were determined from a European population. CYP21A2 was shown to be one of the most diverse human genes (HHe=0.949), but the diversity of intron 2 was greater still. Contrary to previous findings, the evolution of intron 2 did not follow concerted evolution, although the remaining part of the gene did. Fixed sites (different fixed alleles of sites in human CYP21 paralogues) significantly accumulated in intron 2, indicating that the excess of fixed sites was connected to the lack of effective non-allelic conversion and concerted evolution. Furthermore, positive selection was presumably focused on intron 2, and possibly associated with the previous genetic features. However, the positive selection detected by several neutrality tests was discerned along the whole gene. In addition, the clear signature of negative selection was observed in the coding sequence. The maintenance of the CYP21 enzyme function is critical, and could lead to negative selection, whereas the presumed gene regulation altering steroid hormone levels via intron 2 might help fast adaptation, which broadly characterizes the genes of human CNVs responding to the environment. PMID:24312389

  19. Episodic Memory and Appetite Regulation in Humans

    PubMed Central

    Brunstrom, Jeffrey M.; Burn, Jeremy F.; Sell, Nicola R.; Collingwood, Jane M.; Rogers, Peter J.; Wilkinson, Laura L.; Hinton, Elanor C.; Maynard, Olivia M.; Ferriday, Danielle

    2012-01-01

    Psychological and neurobiological evidence implicates hippocampal-dependent memory processes in the control of hunger and food intake. In humans, these have been revealed in the hyperphagia that is associated with amnesia. However, it remains unclear whether ‘memory for recent eating’ plays a significant role in neurologically intact humans. In this study we isolated the extent to which memory for a recently consumed meal influences hunger and fullness over a three-hour period. Before lunch, half of our volunteers were shown 300 ml of soup and half were shown 500 ml. Orthogonal to this, half consumed 300 ml and half consumed 500 ml. This process yielded four separate groups (25 volunteers in each). Independent manipulation of the ‘actual’ and ‘perceived’ soup portion was achieved using a computer-controlled peristaltic pump. This was designed to either refill or draw soup from a soup bowl in a covert manner. Immediately after lunch, self-reported hunger was influenced by the actual and not the perceived amount of soup consumed. However, two and three hours after meal termination this pattern was reversed - hunger was predicted by the perceived amount and not the actual amount. Participants who thought they had consumed the larger 500-ml portion reported significantly less hunger. This was also associated with an increase in the ‘expected satiation’ of the soup 24-hours later. For the first time, this manipulation exposes the independent and important contribution of memory processes to satiety. Opportunities exist to capitalise on this finding to reduce energy intake in humans. PMID:23227200

  20. Linking Emotion Regulation Strategies to Affective Events and Negative Emotions at Work

    ERIC Educational Resources Information Center

    Diefendorff, James M.; Richard, Erin M.; Yang, Jixia

    2008-01-01

    This study examined the use of specific forms of emotion regulation at work, utilizing Gross's [Gross, J. J. (1998). "The emerging field of emotion regulation: An integrative review." "Review of General Psychology" 2, 271-299] process-based framework of emotion regulation as a guiding structure. In addition to examining employee self-reported…

  1. Effects of positive and negative human contacts and intranasal oxytocin on cerebrospinal fluid oxytocin.

    PubMed

    Rault, Jean-Loup

    2016-07-01

    Despite the popularity of oxytocin (OT) research for its role in social behavior, the relationship between the social environment and endogenous central OT remains poorly understood. This study investigated the effects of positive and negative human contacts and intranasal OT administration on OT concentration in the cerebrospinal fluid (CSF). The pig was used as a model, with repeated CSF sampling through a spinal catheter using a within-subject design. Positive human contact led to sustained CSF OT elevation in pigs over 120min which outlasted the 15min interaction. Furthermore, the frequency of positive interactions was correlated with CSF OT increase. This provides a neurophysiological basis to positive human-animal relationships, with OT preserving bonds within but also between species through interactions. Conversely, CSF OT concentration did not vary during or after negative contact with an unfamiliar person, supporting CSF OT as a biomarker of positive valence in the human-animal relationship context. Intranasal OT administration resulted in peak CSF OT within 10min, with approximately 0.001% of the administered dose reaching the CSF. The sensitivity of the oxytocinergic system to variations in the social environment is a worthy area of investigation for its scientific and clinical implications. In particular, positive interactions result in outlasting central OT release. PMID:27032064

  2. Fas-Associated Factor 1 Negatively Regulates the Antiviral Immune Response by Inhibiting Translocation of Interferon Regulatory Factor 3 to the Nucleus

    PubMed Central

    Song, Soonhwa; Lee, Jae-Jin; Kim, Hee-Jung; Lee, Jeong Yoon; Chang, Jun

    2016-01-01

    This study is designed to examine the cellular functions of human Fas-associated factor 1 (FAF1) containing multiple ubiquitin-related domains. Microarray analyses revealed that interferon-stimulated genes related to the antiviral response are significantly increased in FAF1-knockdown HeLa cells. Silencing FAF1 enhanced the poly(I·C)- and respiratory syncytial virus (RSV)-induced production of type I interferons (IFNs), the target genes of interferon regulator factor 3 (IRF3). IRF3 is a key transcription factor in IFN-β signaling responsible for the host innate immune response. This study also found that FAF1 and IRF3 physically associate with IPO5/importin-β3 and that overexpression of FAF1 reduces the interaction between IRF3 and IPO5/importin-β3. These findings suggest that FAF1 negatively regulates IRF3-mediated IFN-β production and the antiviral innate immune response by regulating nuclear translocation of IRF3. We conclude that FAF1 plays a novel role in negatively regulating virus-induced IFN-β production and the antiviral response by inhibiting the translocation of active, phosphorylated IRF3 from the cytosol to the nucleus. PMID:26811330

  3. Circadian regulation of human cortical excitability.

    PubMed

    Ly, Julien Q M; Gaggioni, Giulia; Chellappa, Sarah L; Papachilleos, Soterios; Brzozowski, Alexandre; Borsu, Chloé; Rosanova, Mario; Sarasso, Simone; Middleton, Benita; Luxen, André; Archer, Simon N; Phillips, Christophe; Dijk, Derk-Jan; Maquet, Pierre; Massimini, Marcello; Vandewalle, Gilles

    2016-01-01

    Prolonged wakefulness alters cortical excitability, which is essential for proper brain function and cognition. However, besides prior wakefulness, brain function and cognition are also affected by circadian rhythmicity. Whether the regulation of cognition involves a circadian impact on cortical excitability is unknown. Here, we assessed cortical excitability from scalp electroencephalography (EEG) responses to transcranial magnetic stimulation in 22 participants during 29 h of wakefulness under constant conditions. Data reveal robust circadian dynamics of cortical excitability that are strongest in those individuals with highest endocrine markers of circadian amplitude. In addition, the time course of cortical excitability correlates with changes in EEG synchronization and cognitive performance. These results demonstrate that the crucial factor for cortical excitability, and basic brain function in general, is the balance between circadian rhythmicity and sleep need, rather than sleep homoeostasis alone. These findings have implications for clinical applications such as non-invasive brain stimulation in neurorehabilitation. PMID:27339884

  4. Circadian regulation of human cortical excitability

    PubMed Central

    Ly, Julien Q. M.; Gaggioni, Giulia; Chellappa, Sarah L.; Papachilleos, Soterios; Brzozowski, Alexandre; Borsu, Chloé; Rosanova, Mario; Sarasso, Simone; Middleton, Benita; Luxen, André; Archer, Simon N.; Phillips, Christophe; Dijk, Derk-Jan; Maquet, Pierre; Massimini, Marcello; Vandewalle, Gilles

    2016-01-01

    Prolonged wakefulness alters cortical excitability, which is essential for proper brain function and cognition. However, besides prior wakefulness, brain function and cognition are also affected by circadian rhythmicity. Whether the regulation of cognition involves a circadian impact on cortical excitability is unknown. Here, we assessed cortical excitability from scalp electroencephalography (EEG) responses to transcranial magnetic stimulation in 22 participants during 29 h of wakefulness under constant conditions. Data reveal robust circadian dynamics of cortical excitability that are strongest in those individuals with highest endocrine markers of circadian amplitude. In addition, the time course of cortical excitability correlates with changes in EEG synchronization and cognitive performance. These results demonstrate that the crucial factor for cortical excitability, and basic brain function in general, is the balance between circadian rhythmicity and sleep need, rather than sleep homoeostasis alone. These findings have implications for clinical applications such as non-invasive brain stimulation in neurorehabilitation. PMID:27339884

  5. Profound CD4+ T lymphocytopenia in human immunodeficiency virus negative individuals, improved with anti-human herpes virus treatment

    PubMed Central

    Klínger Hernández, Julio César; Niño Castaño, Victoria Eugenia

    2012-01-01

    Lymphocytopenia and CD4+ T lymphocytopenia can be associated with many bacterial, fungal, parasite and viral infections. They can also be found in autoimmune and neoplastic diseases, common variable immunodeficiency syndrome, physical, psychological and traumatic stress, malnutrition and immunosuppressive therapy. Besides, they can also be brought into relation, without a known cause, with idiopathic CD4+ T lymphocytopenia. Among viral infections, the Retrovirus, specially the human immunodeficiency virus, is the most frequently cause. However, many acute viral infections, including cytomegalovirus and Epstein Barr virus can be associated with transient lymphocytopenia and CD4+ T lymphocytopenia. As is well known, transient lymphocytopenia and CD4+ T lymphocytopenia are temporary and overcome when the disease improves. Nonetheless, severe CD4+ T Lymphocytopenia associated with chronic infections by human herpes virus has not been reported. We describe 6 cases of human immunodeficiency virus negative patients, with chronic cytomegalovirus and Epstein Barr virus infections and profound lymphocytopenia with clinical symptoms of cellular immunodeficiency. These patients improved rapidly with ganciclovir or valganciclovir treatment. We claim here that it is important to consider the chronic human herpes virus infection in the differential diagnosis of profoundly CD4+ T lymphocytopenia etiology, when human immunodeficiency virus is absent, in order to start effective treatment and to determine, in future studies, the impact of chronic human herpes virus infection in human beings' health. PMID:24893304

  6. Negative regulation of the antiviral response by grouper LGP2 against fish viruses.

    PubMed

    Yu, Yepin; Huang, Youhua; Yang, Ying; Wang, Shaowen; Yang, Min; Huang, Xiaohong; Qin, Qiwei

    2016-09-01

    Laboratory of genetics and physiology 2 (LGP2), a member of RIG-I like receptor (RLR) family, plays crucial roles in modulating cellular antiviral response during viral infection. However, the detailed roles of LGP2 in different virus infection were controversial up to now. Here, we cloned a LGP2 gene from orange-spotted grouper (EcLGP2) and investigated its roles in response to grouper virus infection. EcLGP2 encoded a 678-aa protein which shared 83% identity to sea perch (Lateolabrax japonicas). Amino acid alignment showed that EcLGP2 contained three conserved domains, including a DEAD/DEAH box helicase domain, a helicase superfamily C-terminal domain and a C-terminal domain of RIG-I. In healthy grouper, the transcript of EcLGP2 could be predominantly detected in kidney, gill, fin, spleen and skin. Subcellular localization analysis showed that EcLGP2 distributed throughout the cytoplasm in grouper cells. Notably, the intracellular distribution of EcLGP2 was altered at the late stage of Singapore grouper iridovirus (SGIV) infection, but remained unchanged during red-spotted grouper nervous necrosis virus (RGNNV) infection. Moreover, overexpression of EcLGP2 in vitro significantly enhanced the viral replication of SGIV and RGNNV, evidenced by the acceleration of CPE occurrence and the up-regulation of the viral gene transcription or protein synthesis. Further studies indicated that overexpression of EcLGP2 decreased the expression level of interferon related molecules or effectors, including IRF3, IRF7, ISG15, IFP35, MXI, MXII, and MDA5, suggesting that the negative feedback of interferon immune response by EcLGP2 might contribute to the enhancement of RGNNV infection. Moreover, the expression levels of pro-inflammation cytokines, including IL-8 and TNFα were significantly decreased, but that of IL-6 was increased by the ectopic expression of EcLGP2. Thus, our results will contribute greatly to understanding the roles of fish LGP2 in innate immune response during

  7. A Novel Generalized Normal Distribution for Human Longevity and other Negatively Skewed Data

    PubMed Central

    Robertson, Henry T.; Allison, David B.

    2012-01-01

    Negatively skewed data arise occasionally in statistical practice; perhaps the most familiar example is the distribution of human longevity. Although other generalizations of the normal distribution exist, we demonstrate a new alternative that apparently fits human longevity data better.