A description of a system of programs for mathematically processing on unified series (YeS) computers photographic images of the Earth taken from spacecraft

NASA Technical Reports Server (NTRS)

Zolotukhin, V. G.; Kolosov, B. I.; Usikov, D. A.; Borisenko, V. I.; Mosin, S. T.; Gorokhov, V. N.

1980-01-01

A description of a batch of programs for the YeS-1040 computer combined into an automated system for processing photo (and video) images of the Earth's surface, taken from spacecraft, is presented. Individual programs with the detailed discussion of the algorithmic and programmatic facilities needed by the user are presented. The basic principles for assembling the system, and the control programs are included. The exchange format within whose framework the cataloging of any programs recommended for the system of processing will be activated in the future is displayed.

Universality and Thouless energy in the supersymmetric Sachdev-Ye-Kitaev model

NASA Astrophysics Data System (ADS)

García-García, Antonio M.; Jia, Yiyang; Verbaarschot, Jacobus J. M.

2018-05-01

We investigate the supersymmetric Sachdev-Ye-Kitaev (SYK) model, N Majorana fermions with infinite range interactions in 0 +1 dimensions. We have found that, close to the ground state E ≈0 , discrete symmetries alter qualitatively the spectral properties with respect to the non-supersymmetric SYK model. The average spectral density at finite N , which we compute analytically and numerically, grows exponentially with N for E ≈0 . However the chiral condensate, which is normalized with respect the total number of eigenvalues, vanishes in the thermodynamic limit. Slightly above E ≈0 , the spectral density grows exponentially with the energy. Deep in the quantum regime, corresponding to the first O (N ) eigenvalues, the average spectral density is universal and well described by random matrix ensembles with chiral and superconducting discrete symmetries. The dynamics for E ≈0 is investigated by level fluctuations. Also in this case we find excellent agreement with the prediction of chiral and superconducting random matrix ensembles for eigenvalue separations smaller than the Thouless energy, which seems to scale linearly with N . Deviations beyond the Thouless energy, which describes how ergodicity is approached, are universally characterized by a quadratic growth of the number variance. In the time domain, we have found analytically that the spectral form factor g (t ), obtained from the connected two-level correlation function of the unfolded spectrum, decays as 1 /t2 for times shorter but comparable to the Thouless time with g (0 ) related to the coefficient of the quadratic growth of the number variance. Our results provide further support that quantum black holes are ergodic and therefore can be classified by random matrix theory.

Exact moments of the Sachdev-Ye-Kitaev model up to order 1 /N 2

NASA Astrophysics Data System (ADS)

García-García, Antonio M.; Jia, Yiyang; Verbaarschot, Jacobus J. M.

2018-04-01

We analytically evaluate the moments of the spectral density of the q-body Sachdev-Ye-Kitaev (SYK) model, and obtain order 1 /N 2 corrections for all moments, where N is the total number of Majorana fermions. To order 1 /N, moments are given by those of the weight function of the Q-Hermite polynomials. Representing Wick contractions by rooted chord diagrams, we show that the 1 /N 2 correction for each chord diagram is proportional to the number of triangular loops of the corresponding intersection graph, with an extra grading factor when q is odd. Therefore the problem of finding 1 /N 2 corrections is mapped to a triangle counting problem. Since the total number of triangles is a purely graph-theoretic property, we can compute them for the q = 1 and q = 2 SYK models, where the exact moments can be obtained analytically using other methods, and therefore we have solved the moment problem for any q to 1 /N 2 accuracy. The moments are then used to obtain the spectral density of the SYK model to order 1 /N 2. We also obtain an exact analytical result for all contraction diagrams contributing to the moments, which can be evaluated up to eighth order. This shows that the Q-Hermite approximation is accurate even for small values of N.

Sequence stratigraphy and environmental background of the late Pleistocene and Holocene occupation in the Southeast Primor'ye (the Russian Far East)

NASA Astrophysics Data System (ADS)

Chlachula, Jiri; Krupyanko, Alexander A.

2016-06-01

The paper presents the results of Quaternary palaeoecology and geoarchaeology studies in the Zerkal'naya Basin, with new insights about sequenced natural shifts during the prehistoric occupation of this marginally explored NE Asian maritime territory. The Basin is part of the continental drainage system and the main physiographic and biotic corridor for peopling of the transitive coastal interior SE Primor'ye Region. The Final Pleistocene and Holocene environmental (biotic and abiotic) proxy records from the Upper/Final Palaeolithic to early historical sites document a dynamic climate change with vegetation cover transformations within riverine and mountain valley ecosystems of the Russian Far East. Most of the archaeological sites located on the low terraces and bedrock promontories along the main river channel and its tributary streams suggest traditional hunter gathered lifestyles based on seasonal salmon-fishing supplemented by pastoral economy. Tundra-forests with larch trees, dwarf birch thickets and polypod ferns from the basal stratigraphic units of the late Last Glacial occupation sites associated with the Upper Palaeolithic micro-blade and bifacial stone tool traditions (14C-dated to 19,000-12,000 cal yrs BP) indicate rather pronounced conditions and much lower MAT comparing today. Following a final Pleistocene cooling event, a major climate warming marked the onset of Holocene accompanied by a regional humidity increase promoting the formation of a mixed broadleaved-coniferous oak-dominant taiga, and culminating in the mid-Holocene Climatic Optimum. The appearance of mosaic parklands ca. 5,000-4,000 cal yrs BP. may be partly attributed to the expansion of the Far Eastern Neolithic cultures practicing forest clearance for pastures and dwellings. A progressing landscape opening indicated by the spread of light-demanding thickets and birch-dominated riverine biotopes with Artemisia suggests a further vegetation cover transformation during the late Neolithic

Polyoxygenated Cyclohexenoids with Promising α-Glycosidase Inhibitory Activity Produced by Phomopsis sp. YE3250, an Endophytic Fungus Derived from Paeonia delavayi.

PubMed

Huang, Rong; Jiang, Bo-Guang; Li, Xiao-Nian; Wang, Ya-Ting; Liu, Si-Si; Zheng, Kai-Xuan; He, Jian; Wu, Shao-Hua

2018-02-07

Seven new polyoxygenated cyclohexenoids, namely, phomopoxides A-G (1-7), were isolated from the fermentation broth extract of an endophytic fungal strain Phomopsis sp. YE3250 from the medicinal plant Paeonia delavayi Franch. The structures of these compounds were established by spectroscopic interpretation. The absolute configurations of compounds 1 and 4 were confirmed by X-ray crystallographic analysis and chemical derivative approach. All isolated compounds showed weak cytotoxic activities toward three human tumor cell lines (Hela, MCF-7, and NCI-H460) and weak antifungal activities against five pathogenic fungi (Candida albicans, Aspergillus niger, Pyricularia oryzae, Fusarium avenaceum, and Hormodendrum compactum). In addition, compounds 1-7 showed a promising α-glycosidase inhibitory activity with IC 50 values of 1.47, 1.55, 1.83, 2.76, 2.88, 3.16, and 2.94 mM, respectively, as compared with a positive control of acarbose (IC 50 = 1.22 mM).

Bibliography of Soviet Laser Developments, Number 55. September-October 1981.

DTIC Science & Technology

1983-01-01

Boldeskul , I.Ye., and A.Ye. Boldeskul (0). Fluorescence and resonant R-amanspctra1 probes in studies on the dynamics of biological and micellar...AKAYEV A 45 BOLDESKUL I YE 72 AKHMANOV S A 87 PAPADZHAN YE 1 79 BOLGAROV L N 11 AKHMEDZHANOV I M 24 BABARSKOV YE V 84 BOL’SHOV L A 84 AKHSAKHALYAN A D

Black Hole on a Chip: Proposal for a Physical Realization of the Sachdev-Ye-Kitaev model in a Solid-State System

NASA Astrophysics Data System (ADS)

Pikulin, D. I.; Franz, M.

2017-07-01

A system of Majorana zero modes with random infinite-range interactions—the Sachdev-Ye-Kitaev (SYK) model—is thought to exhibit an intriguing relation to the horizons of extremal black holes in two-dimensional anti-de Sitter space. This connection provides a rare example of holographic duality between a solvable quantum-mechanical model and dilaton gravity. Here, we propose a physical realization of the SYK model in a solid-state system. The proposed setup employs the Fu-Kane superconductor realized at the interface between a three-dimensional topological insulator and an ordinary superconductor. The requisite N Majorana zero modes are bound to a nanoscale hole fabricated in the superconductor that is threaded by N quanta of magnetic flux. We show that when the system is tuned to the surface neutrality point (i.e., chemical potential coincident with the Dirac point of the topological insulator surface state) and the hole has sufficiently irregular shape, the Majorana zero modes are described by the SYK Hamiltonian. We perform extensive numerical simulations to demonstrate that the system indeed exhibits physical properties expected of the SYK model, including thermodynamic quantities and two-point as well as four-point correlators, and discuss ways in which these can be observed experimentally.

Hear ye? Hear ye! Successful auditory aging.

PubMed Central

Gates, G A; Rees, T S

1997-01-01

Age-related hearing loss (presbycusis) is a multifactorial process that affects nearly all people in their senior years. Most cases are due to a loss of cochlear hair cell function and are well mediated by communication courtesy and modern amplification technology. Severe hearing loss is generally due to cochlear problems or age-related diseases and may require speech reading, assistive listening devices, and cochlear implants, depending on the degree of loss. Presbycusis may seriously impair communication and contribute to isolation, depression, and possibly dementia. Accurate diagnosis and prompt remediation are widely available but are frequently underused. Geriatric health care and well-being is enhanced by the detection and remediation of communication disorders. PMID:9348755

Natural variation of rice strigolactone biosynthesis is associated with the deletion of two MAX1 orthologs

PubMed Central

Cardoso, Catarina; Zhang, Yanxia; Jamil, Muhammad; Hepworth, Jo; Charnikhova, Tatsiana; Dimkpa, Stanley O. N.; Meharg, Caroline; Wright, Mark H.; Liu, Junwei; Meng, Xiangbing; Wang, Yonghong; Li, Jiayang; McCouch, Susan R.; Leyser, Ottoline; Price, Adam H.; Bouwmeester, Harro J.; Ruyter-Spira, Carolien

2014-01-01

Rice (Oryza sativa) cultivar Azucena—belonging to the Japonica subspecies—exudes high strigolactone (SL) levels and induces high germination of the root parasitic plant Striga hermonthica. Consistent with the fact that SLs also inhibit shoot branching, Azucena is a low-tillering variety. In contrast, Bala, an Indica cultivar, is a low-SL producer, stimulates less Striga germination, and is highly tillered. Using a Bala × Azucena F6 population, a major quantitative trait loci—qSLB1.1—for the exudation of SL, tillering, and induction of Striga germination was detected on chromosome 1. Sequence analysis of the corresponding locus revealed a rearrangement of a 51- to 59-kbp stretch between 28.9 and 29 Mbp in the Bala genome, resulting in the deletion of two cytochrome P450 genes—SLB1 and SLB2—with high homology to the Arabidopsis SL biosynthesis gene, MAX1. Both rice genes rescue the Arabidopsis max1-1 highly branched mutant phenotype and increase the production of the SL, ent-2′-epi-5-deoxystrigol, when overexpressed in Bala. Furthermore, analysis of this region in 367 cultivars of the publicly available Rice Diversity Panel population shows that the rearrangement at this locus is a recurrent natural trait associated with the Indica/Japonica divide in rice. PMID:24464483

The anti-hyperplasia, anti-oxidative and anti-inflammatory properties of Qing Ye Dan and swertiamarin in testosterone-induced benign prostatic hyperplasia in rats.

PubMed

Wu, Xinying; Gu, Ye; Li, Lun

2017-01-04

Qing Ye Dan (QYD) is the whole plant of Swertia mileensis and used in Chinese folk medicine for the treatment of prostatitis, benign prostatic hyperplasia (BPH) and so on. This study was to investigate the effects of QYD and its main component swertiamarin on BPH induced by testosterone in rats. The prostatic expressions of vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), basic fibroblast growth factor (βFGF) and proliferating cell nuclear antigen (PCNA) were detected by immunohistochemistry assay. Prostatic levels of oxidative stress and inflammatory-related factors were also analyzed. Additionally, the prostatic expressions of androgen receptor (AR), estrogen receptor (ER)-α, ER-β, hypoxia-inducible factor (HIF)-1α, B-cell CLL/lymphoma (Bcl)-2 and Bcl-2-associated X protein (Bax) were measured by western blot. The epithelial-mesenchymal transition (EMT) associated factors were evaluated by quantitative RT-PCR. It showed that QYD and swertiamarin ameliorated the testosterone-induced prostatic hyperplasia and collagen deposition, attenuated the over-expressions of HIF-1α, VEGF, EGF, βFGF, PCNA, AR and ER-α, reduced the ratio of Bcl-2/Bax, enhanced the expression of ER-β, inhibited the oxidative stress and local inflammation, as well as relieved prostatic EMT. It suggested that QYD and swertiamarin had prostatic protective potential against BPH. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

USSR and Eastern Europe Scientific Abstracts, Engineering and Equipment. No. 24

DTIC Science & Technology

1976-10-18

of ribbed cylindrical envelopes with rectangular apertures. 2/2 N USSR UDC 629.78.023.015.4 IVCHENKO, YE. V., MAKEYEV , YE. M. THE STRENGTH OF A...cylindrical envelope is a semizero-moment 1/2 . 203 USSR IVCHENKO, YE. V., MAKEYEV , YE. M., VSES KONF AVTOMATIZ ISSLED NESUSHCHEY SPOSOBIOSTI I...USSR UDC 629.78.002.3.015.4 MAKEYEV , A. I., FOMICHEV, P. A., TRISHINA, L. A., KORUNA, G. S. THE PROBLEM OF NONLINEAR ADDITION OF FATIGUE DAMAGE VSES

Fate of Yersinia enterocolitica during manufacture, ripening and storage of Lighvan cheese.

PubMed

Hanifian, Shahram; Khani, Sajjad

2012-05-15

This study aimed to evaluate the behavior of virulent Yersinia enterocolitica (YE) during the manufacture, ripening and storage of Lighvan cheese with particular reference to strains of YE, initial inoculation level, and storage time. Three strains of YE with low (1 log cfu/ml) and high (3 log cfu/ml) inoculation levels were inoculated to raw whole ewe's milk which was then used for manufacturing of Lighvan cheese. Throughout the manufacturing, ripening and storage periods the number of YE was counted on selective media. Enumerated colonies were then confirmed by duplex PCR using ail and virF genes. Moreover, some microbial and physiochemical characteristics of the cheese samples were examined. According to the results, initial inoculation level and storage time had statistically significant (P<0.01) effects on persistency of YE, while strain type exhibited no statistically significant (P>0.01) impact on survival of the pathogen. Results showed a rapid increase in the number of YE during manufacturing, however, in the ripening and storage periods the number of YE was decreased and eventually it was eliminated in all cheese batches after 4 months of storage. Copyright © 2012 Elsevier B.V. All rights reserved.

Studies on up/down-conversion emission of Yb3+ sensitized Er3+ doped MLa2(MoO4)4 (M = Ba, Sr and Ca) phosphors for thermometry and optical heating

NASA Astrophysics Data System (ADS)

Sinha, Shriya; Kumar, Kaushal

2018-01-01

The photoluminescence properties of Yb3+ sensitized Er3+ doped BaLa2(MoO4)4, SrLa2(MoO4)4 and CaLa2(MoO4)4 phosphors synthesized via hydrothermal method are investigated upon 980 nm and 380 nm light excitations. The phase, purity, and morphology of the samples are characterized by X-ray diffraction, Fourier transform infrared spectroscopy and Field emission scanning electron microscope. Among these three phosphors, the strongest emission intensity is seen in BaLa2(MoO4)4: Er3+/Yb3+ through both the 980 nm and 380 nm light excitations and is explained by the lifetime measurement of 4S3/2 level of Er3+ ion. Temperature sensing measurements were performed by using the fluorescence intensity ratio (FIR) of green emission bands originated from the two thermally coupled 2H11/2 → 4I15/2 and 4S3//2 → 4I15/2 transitions of Er3+ and maximum temperature sensitivity of 1.05% K-1 at 305 K is found for BLa2(MoO4)4: Er3+/Yb3+ sample. Moreover, the laser induced heating is measured in the samples and the maximum temperature of the sample particles is calculated as 422 K at 76 W/cm2 in BaLa2(MoO4)4: Er3+/Yb3+, pointing out large amount of heat generation in such phosphors. The BaLa2(MoO4)4: Er3+/Yb3+ also exhibits higher photothermal conversion efficiency of 46.7%.

Fractionation of yeast extract by nanofiltration process to assess key compounds involved in CHO cell culture improvement.

PubMed

Mosser, Mathilde; Kapel, Romain; Chevalot, Isabelle; Olmos, Eric; Marc, Ivan; Marc, Annie; Oriol, Eric

2015-01-01

Yeast extract (YE) is known to greatly enhance mammalian cell culture performances, but its undefined composition decreases process reliability. Accordingly, in the present study, the nature of YE compounds involved in the improvement of recombinant CHO cell growth and IgG production was investigated. First, the benefits of YE were verified, revealing that it increased maximal concentrations of viable cells and IgG up to 73 and 60%, respectively compared to a reference culture. Then, the analyses of YE composition highlighted the presence of molecules such as amino acids, vitamins, salts, nucleobase, and glucose that were contained in reference medium, while others including peptides, trehalose, polysaccharides, and nucleic acids were not. Consequently, YE was fractionated by a nanofiltration process to deeper evaluate its effects on CHO cell cultures. The YE molecules already contained in reference medium were mainly isolated in the permeate fraction together with trehalose and short peptides, while other molecules were concentrated in the retentate. Permeate, which was free of macromolecules, exhibited a similar positive effect than raw YE on maximal concentrations. Additional studies on cell energetic metabolism underlined that dipeptides and tripeptides in permeate were used as an efficient source of nitrogenous substrates. © 2015 American Institute of Chemical Engineers.

Thermophilic biofiltration of benzene and toluene.

PubMed

Cho, Kyung-Suk; Yoo, Sun-Kyung; Ryu, Hee Wook

2007-12-01

In the current studies, we characterized the degradation of a hot mixture of benzene and toluene (BT) gases by a thermophilic biofilter using polyurethane as packing material and high-temperature compost as a microbial source. We also examined the effect of supplementing the biofilter with yeast extract (YE). We found that YE substantially enhanced microbial activity in the thermophilic biofilter. The degrading activity of the biofilter supplied with YE was stable during long-term operation (approximately 100 d) without accumulating excess biomass. The maximum elimination capacity (1,650 g x m(-3) h(-1)) in the biofilter supplemented with YE was 3.5 times higher than that in the biofilter without YE (470 g g x m(-3) h(-1)). At similar retention times, the capacity to eliminate BT for the YE-supplemented biofilter was higher than for previously reported mesophilic biofilters. Thus, thermophilic biofiltration can be used to degrade hydrophobic compounds such as a BT mixture. Finally, 16S rDNA polymerase chain reaction-DGGE (PCR-DGGE) fingerprinting revealed that the thermophilic bacteria in the biofilter included Rubrobacter sp. and Mycobacterium sp.

Constraints from Water on Mantle Melting and Slab Fluid Composition

NASA Astrophysics Data System (ADS)

Plank, T.; Wade, J.

2005-12-01

Water drives mantle melting and fluid migration in subduction zones, but most models for these phenomena have been developed without constraints from water measurements in arc magmas. For example, the Central American volcanic arc (CAVA) records systematic variations in La/Yb, Ba/La and d18O, and these proxies have been used to predict the extent of mantle melting during decompression [1] and water-addition [2]. Here we use water concentrations in olivine-hosted melt inclusions from arc tephra, along with estimates derived from a clinopyroxene hygrometer [3], to test different models for mantle melting and slab fluid composition along the CAVA (from Nicaragua to Costa Rica). We use Ti as a proxy for mantle melt fraction (F) and invert H2O concentrations in CAVA magmas to obtain those in the mantle source (H2Oo), as in [4]. The relationship between F and H2Oo is nominally linear for Costa Rica mantle, with wet melting productivity dF/dH2O = 30 (wt%/wt%), higher than that used in [2], but consistent with experimentally-determined and MELTS-calculated productivity at 50 degrees above the dry solidus. This predicts mantle temperature beneath Costa Rica of at least 1350°C, and allows for a small (1-2% F) decompression-melting contribution, relative to the wet melting contribution (8-20% F). The percent of wet melting correlates locally with Ba/La, but not regionally, and so the use of Ba/La as a wet melting proxy [1] should be limited to single volcanoes or clusters. The water content of the CAVA melting region varies from 2500-9000 ppm H2O but does not decrease monotonically from Nicaragua to Costa Rica as does Ba/La. The relationship between H2Oo and Ba/La is thus complex, and requires a large along-strike decrease in Ba/La and H2O/La in the slab fluids towards the southeast. Such variation appears to be driven largely by La concentration, reflecting more dilute fluids (higher H2O/La) beneath Nicaragua and more solute-rich fluids (e.g., sediment melts with high La/ H

Enhanced coal-dependent methanogenesis coupled with algal biofuels: Potential water recycle and carbon capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew

Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had onlymore » 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO 2).« less

Enhanced coal-dependent methanogenesis coupled with algal biofuels: Potential water recycle and carbon capture

DOE PAGES

Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew; ...

2017-01-05

Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had onlymore » 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO 2).« less

Enhanced coal-dependent methanogenesis coupled with algal biofuels: Potential water recycle and carbon capture

USGS Publications Warehouse

Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew; Orem, William H.; Cunningham, Alfred B.; Ramsay, Bradley D.; Fields, Matthew W.

2017-01-01

Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had only 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO2).

The enigmatic Bala earthquake of 1974

NASA Astrophysics Data System (ADS)

Musson, R. M. W.

2006-10-01

The earthquake that shook most of North Wales on the night of 23 January 1974 appears unremarkable from its entry in the UK earthquake catalogue. With a magnitude of 3.5 ML it represents the size of earthquake to be expected in the UK with a return period of about one year. However, the prominent atmospheric lights observed at the time of the shock led to speculation that an aircraft had crashed, and search-and-rescue teams were deployed. Since nothing was discovered, it was concluded that a meteorite was responsible; more imaginative members of the public decided (and still believe) that a UFO had crashed. In this paper the record of events is set out, and the nature of the earthquake is discussed with reference to its geological setting.

Early age hydration of calcium sulfoaluminate (synthetic ye'elimite, C{sub 4}A{sub 3}S{sup ¯}) in the presence of gypsum and varying amounts of calcium hydroxide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hargis, Craig W.; Kirchheim, Ana Paula; Monteiro, Paulo J.M., E-mail: monteiro@ce.berkeley.edu

Suspensions of synthetic ye'elimite (C{sub 4}A{sub 3}S{sup ¯}) in a saturated gypsum (CS{sup ¯}H{sub 2}) and calcium hydroxide (CH) solution were examined in-situ in a wet cell by soft X-ray transmission microscopy and ex-situ by scanning electron microscopy. The most voluminous hydration product observed was ettringite. Ettringite commonly displayed acicular, filiform, reticulated, and stellate crystal habits. Additionally, pastes with C{sub 4}A{sub 3}S{sup ¯}, 15% CS{sup ¯}H{sub 2}, and varying amounts of CH were prepared and examined with X-ray diffraction (XRD) and isothermal calorimetry. The XRD experiments showed that increasing CH content caused more solid solution (SO{sub 4}{sup 2−}/OH{sup −}) AFmmore » phases to form at early ages (< 1 d) and more monosulfate to form at later ages (> 1 d). Calorimetry indicated that the increased production of solid solution AFm was accompanied with an increase in the initial (< 30 min) rate of heat evolution, and increasing CH generally reduced the time till the second maximum rate of heat evolution due to the formation of ettringite and monosulfate.« less

A de novo designed 11 kDa polypeptide: model for amyloidogenic intrinsically disordered proteins.

PubMed

Topilina, Natalya I; Ermolenkov, Vladimir V; Sikirzhytski, Vitali; Higashiya, Seiichiro; Lednev, Igor K; Welch, John T

2010-07-01

A de novo polypeptide GH(6)[(GA)(3)GY(GA)(3)GE](8)GAH(6) (YE8) has a significant number of identical weakly interacting beta-strands with the turns and termini functionalized by charged amino acids to control polypeptide folding and aggregation. YE8 exists in a soluble, disordered form at neutral pH but is responsive to changes in pH and ionic strength. The evolution of YE8 secondary structure has been successfully quantified during all stages of polypeptide fibrillation by deep UV resonance Raman (DUVRR) spectroscopy combined with other morphological, structural, spectral, and tinctorial characterization. The YE8 folding kinetics at pH 3.5 are strongly dependent on polypeptide concentration with a lag phase that can be eliminated by seeding with a solution of folded fibrillar YE8. The lag phase of polypeptide folding is concentration dependent leading to the conclusion that beta-sheet folding of the 11-kDa amyloidogenic polypeptide is completely aggregation driven.

Mixed-Integer Nonconvex Quadratic Optimization Relaxations and Performance Analysis

DTIC Science & Technology

2016-10-11

Analysis of Interior Point Algorithms for Non-Lipschitz and Nonconvex Minimization,” (W. Bian, X. Chen, and Ye), Math Programming, 149 (2015) 301-327...Chen, Ge, Wang, Ye), Math Programming, 143 (1-2) (2014) 371-383. This paper resolved an important open question in cardinality constrained...Statistical Performance, and Algorithmic Theory for Local Solutions,” (H. Liu, T. Yao, R. Li, Y. Ye) manuscript, 2nd revision in Math Programming

The Impact of Modernization on the Military Capabilities of the People’s Republic of China.

DTIC Science & Technology

1982-04-19

pair of allies on the Standing Committee were Ye Jianying and Li Xiannian, who represented both the veteran cadres who had survived the Cultural...in October with the arrest of the four leading radical figures ("Gang of Four") in a coup lead by the Defense Minister, Marshall Ye Jianying who...Dengkui, and Wu De, from the Politburo. A new Standing Committee was constituted on which Hua Guofeng now sat in lonely isolation; Marshal Ye Jianying and

Frequency Comb Spectroscopy - From IR to XUV

DTIC Science & Technology

2015-06-09

time resolution of 25 s. Publications: [1] A. Cingöz, Yost, D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J...J. , Eikema, K. S. E. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Full phase stabilization of a Yb:fiber femtosecond frequency comb via high...D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Direct frequency comb spectroscopy in the extreme ultraviolet”, Nature

A case-control study of Yersinia enterocolitica infections in Auckland.

PubMed

Satterthwaite, P; Pritchard, K; Floyd, D; Law, B

1999-10-01

To identify major risk factors for Yersinia enterocolitica (YE) and identify measures to reduce YE infections. A prospective case control study, group age matched, using 186 cases of YE identified by community pathology laboratories and 379 randomly selected controls. Conducted between April 1995 and June 1996 in Auckland, New Zealand. Face-to-face interviews used a standardised questionnaire examining exposures to factors potentially associated with YE infections including untreated water, unreticulated sewerage, consumption of selected foods, selected food handling practices and socio-demographic factors. Multivariate logistic regression was used to calculate adjusted odds ratios for the potential risk factors. Population attributable risk (PAR) was calculated for significant exposures. Having more than two people living in the home was more common among cases than controls (OR = 2.2). Town supply water (OR = 0.2), reticulated sewerage (OR = 0.34) and looking after a young child (OR = 0.51) were significantly less common. Of the meats, only pork (OR = 1.34) had a higher consumption rate, while bacon (OR = 0.75) and smallgoods (OR = 0.73) were consumed less frequently by cases than controls. Eating food from a sandwich bar was more frequent among cases (OR = 1.18). Fruit and vegetable consumption was marginally less (OR = 0.98). The population attributable risk of these factors was 0.89, implying that 89% of YE would be eliminated if adverse exposures were removed. The risk of YE illness is increased by contact with untreated water, unreticulated sewerage and consumption of pork. Investigation of non-town water supply, informal sewerage systems and methods of preparation and consumption of pork are recommended to determine how YE enters the human food chain.

Potential Ameliorative Effects of Qing Ye Dan Against Cadmium Induced Prostatic Deficits via Regulating Nrf-2/HO-1 and TGF-β1/Smad Pathways.

PubMed

Du, Lifen; Lei, Yongfang; Chen, Jinglou; Song, Hongping; Wu, Xinying

2017-01-01

Cadmium (Cd) is an environmental pollutant with reproductive toxicity. Swertia mileensis is used in Chinese medicine for the treatment of prostatic deficits and named as Qing Ye Dan (QYD). This study was undertaken to investigate the potential protective effects of QYD against Cd-induced prostatic deficits. Rat model of prostatic deficits was induced by 0.2 mg/kg/d CdCl2 subcutaneous injection for 15 days. The prostatic oxidative stress was evaluated by detecting the levels of malondialdehyde, nitric oxide, reduced/ oxidized glutathione, total sulfhydryl groups and enzymatic antioxidant status. The prostatic inflammation was estimated by testing the levels of pro-inflammatory cytokines. The levels of epithelial-mesenchymal transition (EMT) markers E-cadherin, fibronectin, vimentin and α-smooth muscle actin were measured by qPCR analysis. Additionally, the prostatic expressions of transforming growth factor-β1 (TGF-β1), type I TGF-β receptor (TGF-βRI), Smad2, phosphorylation-Smad2 (p-Smad2), Smad3, p-Smad3, Smad7, nuclear related factor-2 (Nrf-2), heme oxygenase-1 (HO-1), B-cell CLL/lymphoma (Bcl)-2 and Bcl-2-associated X protein (Bax) were measured by western blot assay. It was found that QYD ameliorated the Cd-induced prostatic oxidative stress and inflammation, attenuated prostatic EMT, inhibited the TGF-β1/Smad pathway, increased Bcl-2/Bax ratio and enhanced the activity of Nrf-2/HO-1 pathway. These results showed that QYD could ameliorate Cd-induced prostatic deficits via modulating Nrf-2/HO-1 and TGF-β1/Smad pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

"Bala ga lili": Meeting Indigenous Learners Halfway

ERIC Educational Resources Information Center

Bissett, Susan Zela

2012-01-01

The author's experience of the day-to-day issues faced as an educator in an Aboriginal school are recounted, along with perspectives gained as part of a research project. The proposition is argued that an Education for Sustainability approach, where learning is structured around a negotiated environmental issue within local community, represents a…

Inhibitory Effects of Yuzu and Its Components on Human Platelet Aggregation

PubMed Central

Kim, Tae-Ho; Kim, Hye-Min; Park, Se Won; Jung, Yi-Sook

2015-01-01

Our previous study demonstrated that yuzu has an anti-platelet effect in rat blood. In the present study, we examined whether the anti-platelet effect of yuzu can be extended to human blood by investigating its ability to inhibit aggregations induced by various agonists in human platelet rich plasma (PRP). This study also investigated the underlying mechanism of yuzu focusing on ADP granule secretion, TXB2 formations, and PLCγ/Akt signaling. The results from this study showed that ethanolic yuzu extract (YE), and its components, hesperidin and naringin, inhibited human platelet aggregation in a concentration-dependent manner. YE, hesperidin and naringin also inhibited TXB2 formation and ADP release. The phosphorylation of PLCγ and Akt was significantly inhibited by YE, heperidin and naringin. Furthermore, we demonstrated that YE, heperidin and naringin has anti-platelet effects in rat ex vivo studies, and lower side effects in mice tail bleeding time studies. The results from this study suggest that YE, hesperidin and naringin can inhibit human platelet aggregation, at least partly through the inhibition of PLCγ and Akt, leading to a decrease in TXB2 formation and granule secretion. PMID:25767683

Inhibitory effects of yuzu and its components on human platelet aggregation.

PubMed

Kim, Tae-Ho; Kim, Hye-Min; Park, Se Won; Jung, Yi-Sook

2015-03-01

Our previous study demonstrated that yuzu has an anti-platelet effect in rat blood. In the present study, we examined whether the anti-platelet effect of yuzu can be extended to human blood by investigating its ability to inhibit aggregations induced by various agonists in human platelet rich plasma (PRP). This study also investigated the underlying mechanism of yuzu focusing on ADP granule secretion, TXB2 formations, and PLCγ/Akt signaling. The results from this study showed that ethanolic yuzu extract (YE), and its components, hesperidin and naringin, inhibited human platelet aggregation in a concentration-dependent manner. YE, hesperidin and naringin also inhibited TXB2 formation and ADP release. The phosphorylation of PLCγ and Akt was significantly inhibited by YE, heperidin and naringin. Furthermore, we demonstrated that YE, heperidin and naringin has anti-platelet effects in rat ex vivo studies, and lower side effects in mice tail bleeding time studies. The results from this study suggest that YE, hesperidin and naringin can inhibit human platelet aggregation, at least partly through the inhibition of PLCγ and Akt, leading to a decrease in TXB2 formation and granule secretion.

75 FR 80813 - Update to Notice of Financial Institutions for Which the Federal Deposit Insurance Corporation...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-23

... the Manager of Receivership Oversight in the appropriate service center. Dated: November 22, 2010... Bala Cynwyd PA 11/19/2010 North America. 10315 First Banking Center... Burlington WI 11/19/2010 10316...

JILA BEC/Ultracold Atoms Homepage

Science.gov Websites

JILA BEC & Ultracold Atoms Bose Einstein Condensate Eric Cornell Cornell Group Debbie Jin Jin Group Jun Ye Ye Group Dana Anderson Anderson Group What is BEC? Easy BEC Machine Nobel BEC BibTek Papers

The effects of point pollutants-originated heavy metals (lead, copper, iron, and cadmium) on fish living in Yeşilırmak River, Turkey.

PubMed

Polat, Fatih; Akın, Şenol; Yıldırım, Alper; Dal, Tarık

2016-08-01

In this study, the association between heavy metals in water and cyprinids sampled from the Yeşilırmak River stretch, which is frequently exposed to pollutant sources (a sugar production factory (Turhal) and solid wastes dump area (Taşlıçiftlik) was explored, and the oxidative effects of heavy metals on cyprinids were evaluated through analyzing some liver enzymes, namely, superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA), and cortisol. The heavy metal concentrations of both fish and water, collected from three different locations along the river during the summer of 2011 and winter of 2010 (Turhal, Taşlıçiftlik, and Gümenek), were determined by inductively coupled plasma atomic emission spectroscopy (ICP-AES). The water and fish liver heavy metal concentrations exhibited increasing trends from upstream (Gümenek) to downstream (Turhal). The water and liver samples collected during the summer had higher heavy metal concentrations than those obtained during the winter. The mean heavy metal concentrations increased from Gümenek to Turhal. The liver heavy metal concentrations were higher than those in the water and exhibited almost the same increasing trend from Gümenek to Turhal. Positive relationships between liver and water heavy metal concentrations, especially for cadmium (R 2 = 0.91) and lead (R 2 = 0.98), were obtained. Among the liver enzymes, only MDA followed the same increasing trend from Gümenek to Turhal as was obtained for heavy metals. On the other hand, CAT and SOD had a contrary spatial pattern of change to those of heavy metals and MDA. Although the values of heavy metals and MDA in Taşlıçiftlik were between the two other locations, fish inhabiting this locality had significantly higher values of cortisol, which is an indication of the other stress-causing factors for fish. © The Author(s) 2015.

Ethanol and Acetic Acid Production from Carbon Monoxide in a Clostridium Strain in Batch and Continuous Gas-Fed Bioreactors

PubMed Central

Nalakath Abubackar, Haris; Veiga, María C.; Kennes, Christian

2015-01-01

The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54. PMID:25608591

Ethanol and acetic acid production from carbon monoxide in a Clostridium strain in batch and continuous gas-fed bioreactors.

PubMed

Abubackar, Haris Nalakath; Veiga, María C; Kennes, Christian

2015-01-20

The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54.

Investigation of Possible Tsunami Events on the Eastern Coast of Taiwan: Case Studies of Lu-Ye, Changping, and Tulan.

NASA Astrophysics Data System (ADS)

Laksono, A. T., Jr.; Tsai, L. L. Y., Sr.

2017-12-01

Major earthquakes had occurred in eastern Taiwan for many times. According to an Amis folklore originated in Chengkong City, there was a big sea wave struck their settlement in 1850 AD. Several studies had been conducted, however, the evidence which indicates the tsunami was very weak. There is also a possibility that big sea waves had occurred due to typhoons which take place 3-4 times a year in Taiwan. The purpose of this study is to prove the possibility of tsunami events on the eastern coast of Taiwan based on sedimentological features. The methods in this study are facies analysis including observation of the marine terrace along Lu-Ye, Changping, and Tulan, identification of lithology, sedimentary structure, and fossil content. Lithology analysis is conducted by using point counting of 12 sandstone samples from marine terrace outcrops. Based on the field observation, we found a thin sand marine deposit included in the beach gravel at a height of 10 meters at the Changping marine terrace. It contains coral and some Mollusca shells and does not display any particular sedimentary structure. Sediments that have similar characteristics were also found in the Tulan marine terrace with a height of 5 m. In addition, fossil analysis of marine sand in Tulan exhibits the presence of several planktonic foraminifera fossils such as Orbulina bilobata and Globigerinoides ruber. Temporary interpretation indicates that there is a "super" event which transports shallow marine and beach materials subsequently deposit them on top of an alluvial fan. A 10 cm thin layer of sediment serves as an early tsunami indicator. In addition, the absence of deposits with the same characteristics further indicates that the event occurred only once. Since the eastern coast of Taiwan is an uplift zone with an uplift rate between 5-8 mm/year, the estimated wave height of tsunami should take into account both the tsunami age and the uplift rate. Furthermore, based on the distance from the

INTEGRATED PETROLEUM ENVIRONMENTAL CONSORTIUM (IPEC)

EPA Science Inventory

EPA GRANT NUMBER: R827015
Title: Integrated Petroleum Environmental Consortium (IPEC)
Investigator: Kerry L. Sublette
Institution: University of Tulsa
EPA Project Officer: S. Bala Krishnan
Project Period: October 1, 19...

ULTRASONIC ENHANCEMENT OF THE REMOVAL OF HEAVY METALS

EPA Science Inventory

EPA GRANT NUMBER: R828598C020
Title: Ultrasonic Enhancement of the Removal of Heavy Metals
Investigators: Dennis Truax, Krishnan Balasubramaniam
Institution: Mississippi State University
EPA Project Officer: S. Bala Krishnan
...

Detection of Yersinia enterocolitica serotype O:9 in the faeces of cattle with false positive reactions in serological tests for brucellosis in Ireland.

PubMed

O'Grady, Don; Kenny, Kevin; Power, Seamus; Egan, John; Ryan, Fergus

2016-10-01

Intestinal infection by Yersinia enterocolitica serotype O:9 (YeO9) in cattle has been linked to false positive serological reactivity (FPSR) in diagnostic tests for brucellosis. Although eradicated in Ireland, brucellosis monitoring still identifies seropositive animals, usually one or two (termed singletons) per herd, which are classed as FPSR. To investigate a link between FPSR and YeO9, faeces and blood were collected from singleton FPSR cattle, and from companion animals, in eight selected herds with more than one FPSR animal, for YeO9 culture and Brucella serology. YeO9 was isolated from 76/474 (16%) FPSR singletons in 309 herds, but not from any of 621 animals in 122 control non-FPSR herds. In the FPSR herds 52/187 (27.8%) animals were culture positive, and 17% of the isolates were from seronegative animals. Seropositive animals were more likely to have a rising antibody titre when culture positive. Copyright © 2016 Elsevier Ltd. All rights reserved.

Production of succinic acid from sugarcane molasses supplemented with a mixture of corn steep liquor powder and peanut meal as nitrogen sources by Actinobacillus succinogenes.

PubMed

Shen, N; Qin, Y; Wang, Q; Liao, S; Zhu, J; Zhu, Q; Mi, H; Adhikari, B; Wei, Y; Huang, R

2015-06-01

The potential of using corn steep liquor powder (CSLP), peanut meal (PM), soybean meal (SM), cotton meal (CM) and urea as the substitute of yeast extract (YE) as the nitrogen source was investigated for producing succinic acid (SA). Actinobacillus succinogenes GXAS137 was used as the fermenting bacterium and sugarcane molasses was used as the main substrate. None of these materials were able to produce SA as high as YE did. The CSLP could still be considered as a feasible and inexpensive alternate for YE as the yield of SA produced using CSLP was second only to the yield of SA obtained by YE. The use of CSLP-PM mixed formulation (CSLP to PM ratio = 2·6) as nitrogen source produced SA up to 59·2 g l(-1) with a productivity of 1·2 g l(-1) h(-1). A batch fermentation using a stirred bioreactor produced up to 60·7 g l(-1) of SA at the same formulation. Fed-batch fermentation that minimized the substrate inhibition produced 64·7 g l(-1) SA. These results suggest that sugarcane molasses supplemented with a mixture of CSLP and PM as the nitrogen source could be used to produce SA more economically using A. succinogenes. Significance and impact of the study: Succinic acid (SA) is commonly used as a platform chemical to produce a number of high value derivatives. Yeast extract (YE) is used as a nitrogen source to produce SA. The high cost of YE is currently the limiting factor for industrial production of SA. This study reports the use of a mixture of corn steep liquor powder (CSLP) and peanut meal (PM) as an inexpensive nitrogen source to substitute YE. The results showed that this CSLP-PM mixed formulation can be used as an effective and economic nitrogen source for the production of SA. © 2015 The Society for Applied Microbiology.

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

PubMed

Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

2013-02-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains

PubMed Central

Walker, Sarah E.; Zhou, Fujun; Mitchell, Sarah F.; Larson, Victoria S.; Valasek, Leos; Hinnebusch, Alan G.; Lorsch, Jon R.

2013-01-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B’s domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome’s mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192

Aflatoxin formation and gene expression in response to carbon source media shift in Aspergillus parasiticus.

PubMed

Wilkinson, J R; Yu, J; Abbas, H K; Scheffler, B E; Kim, H S; Nierman, W C; Bhatnagar, D; Cleveland, T E

2007-10-01

Aflatoxins are toxic and carcinogenic polyketide metabolites produced by fungal species, including Aspergillus flavus and A. parasiticus. The biosynthesis of aflatoxins is modulated by many environmental factors, including the availability of a carbon source. The gene expression profile of A. parasiticus was evaluated during a shift from a medium with low concentration of simple sugars, yeast extract (YE), to a similar medium with sucrose, yeast extract sucrose (YES). Gene expression and aflatoxins (B1, B2, G1, and G2) were quantified from fungal mycelia harvested pre- and post-shifting. When compared with YE media, YES caused temporary reduction of the aflatoxin levels detected at 3-h post-shifting and they remained low well past 12 h post-shift. Aflatoxin levels did not exceed the levels in YE until 24 h post-shift, at which time point a tenfold increase was observed over YE. Microarray analysis comparing the RNA samples from the 48-h YE culture to the YES samples identified a total of 2120 genes that were expressed across all experiments, including most of the aflatoxin biosynthesis genes. One-way analysis of variance (ANOVA) identified 56 genes that were expressed with significant variation across all time points. Three genes responsible for converting norsolorinic acid to averantin were identified among these significantly expressed genes. The potential involvement of these genes in the regulation of aflatoxin biosynthesis is discussed.

BUPT_PRIS at TREC 2014 Knowledge Base Acceleration Track

DTIC Science & Technology

2014-11-01

BUPT_PRIS at TREC 2014 Knowledge Base Acceleration Track Yuanyuan Qi, Ye Xu, Dongxu Zhang, Weiran Xu qiyuanyuan@bupt.edu.cn,bob.ye.xu@gmail.com...Filtering for Entity Profile Updates for TREC 2013 [2]Yan Li, Zhaozhao Wang , Baojin Yu, Yong Zhang, Ruiyang Luo,Weiran Xu, Guang Chen, Jun Guo. PRIS

Biogenic mineral production by a novel arsenic-metabolizing thermophilic bacterium from the Alvord Basin, Oregon.

PubMed

Ledbetter, Rhesa N; Connon, Stephanie A; Neal, Andrew L; Dohnalkova, Alice; Magnuson, Timothy S

2007-09-01

The Alvord Basin in southeast Oregon contains a variety of hydrothermal features which have never been microbiologically characterized. A sampling of Murky Pot (61 degrees C; pH 7.1) led to the isolation of a novel arsenic-metabolizing organism (YeAs) which produces an arsenic sulfide mineral known as beta-realgar, a mineral that has not previously been observed as a product of bacterial arsenic metabolism. YeAs was grown on a freshwater medium and utilized a variety of organic substrates, particularly carbohydrates and organic acids. The temperature range for growth was 37 to 75 degrees C (optimum, 55 degrees C), and the pH range for growth was 6.0 to 8.0 (optimum, pH 7.0 to 7.5). No growth was observed when YeAs was grown under aerobic conditions. The doubling time when the organism was grown with yeast extract and As(V) was 0.71 h. Microscopic examination revealed Gram stain-indeterminate, non-spore-forming, nonmotile, rod-shaped cells, with dimensions ranging from 0.1 to 0.2 microm wide by 3 to 10 microm long. Arsenic sulfide mineralization of cell walls and extracellular arsenic sulfide particulate deposition were observed with electron microscopy and elemental analysis. 16S rRNA gene analysis placed YeAs in the family Clostridiaceae and indicated that the organism is most closely related to the Caloramator and Thermobrachium species. The G+C content was 35%. YeAs showed no detectable respiratory arsenate reductase but did display significant detoxification arsenate reductase activity. The phylogenetic, physiological, and morphological characteristics of YeAs demonstrate that it is an anaerobic, moderately thermophilic, arsenic-reducing bacterium. This organism and its associated metabolism could have major implications in the search for innovative methods for arsenic waste management and in the search for novel biogenic mineral signatures.

Complexes of yeast adenylate kinase and nucleotides investigated by sup 1 H NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vetter, I.R.; Konrad, M.; Rosch, P.

1991-04-30

The role of one of the histidine residues present in many adenylate kinases (H36 in the porcine cytosolic enzyme) is highly disputed. The authors studied the yeast enzyme (AK{sub ye}) containing this His residue. AK{sub ye} is highly homologous to the Escherichia coli enzyme (AK{sub ec}), a protein that is already well characterized by NMR and does not contain the His residue in question. In addition, discrepancies between solution structural and X-ray crystallographic studies on the location of the nucleotide binding sites of adenylate kinases are clarified. One- and two-dimensional nuclear magnetic resonance (NMR) spectroscopy was used to investigate AK{submore » ye} and its complex with the bisubstrate analogue P{sup 1},P{sup 5}-bis(5{prime}-adenosyl)pentaphosphate (AP{sub 5}A). From these studies, all aromatic residues of AK{sub ec} involved in the binding of ATP{center dot}Mg{sup 2+} have functional analogues in AK{sub ye}. The AMP site seems to make no contacts to aromatic side chains, neither in the AK{sub ye}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} nor in the AK{sub ec}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} complexes, so that it is presently not possible to localize this binding site by NMR. In combination with the recent X-ray results on the AP{sub 5}A complexes AK{sub ye} and AK{sub ec} and the GMP complex of guanylate kinase the latter one leading to the definition of the monophosphate site, the problem of the location of the nucleotide sites can be considered to be solved in a way contradicting earlier work and denying the His residue homologous to H36 in porcine adenylate kinase a direct role in substrate binding.« less

Bone characteristics of 16 wk-old turkeys subjected to different dietary regimens and simulated stress

USDA-ARS?s Scientific Manuscript database

The effects of a yeast extract (YE) feed supplement and/or vitamin D3 (VD) on the bone properties of 16 wk-old turkeys, transiently subjected to a simulated stress using dexamethasone (Dex), were determined. The turkeys were fed diets with or without YE and/or VD during 6, 11, and 15 wk post hatch, ...

Ye Olde Maile Surveye.

ERIC Educational Resources Information Center

Berty, Ernest

This publication is primarily designed for educational practitioners who possess little or no training in conducting mail surveys or have not kept current on the present state of the art of survey methods and techniques. It is also intended to be a checking and comparing aid to ensure that important research considerations are taken into account.…

JPRS Report: Proliferation Issues

DTIC Science & Technology

1993-03-08

Mo’allem Khani -ye, approximately 150 km north of Rafsanjani’s brother-in-law and among the leaders of the Tehran. This is a base-most of it underground...the manner national Atomic Energy Agency visited Iran, its mem- in which Saddam Husayn was defeated. bers asked to visit the site at Mo’allem Khani -ye

Effects of yeast extract and vitamin D on turkey mortality and cellulitis incidence in a transport stress model.

USDA-ARS?s Scientific Manuscript database

We evaluated yeast extract (YE) and vitamin D (VD) in turkeys treated with dexamethasone (Dex) at intervals designed to simulate transport stress during a 3 stage growout. YE but not VD decreased early mortality (P = 0.001) and mortality at wk 7 (P= 0.02) and wk 12 (P = 0.002) but not wk 16. Celluli...

The potential application of a transcriptionally regulated oncolytic herpes simplex virus for human cancer therapy

PubMed Central

Miao, L; Fraefel, C; Sia, K C; Newman, J P; Mohamed-Bashir, S A; Ng, W H; Lam, P Y P

2014-01-01

Background: Emerging studies have shown the potential benefit of arming oncolytic viruses with therapeutic genes. However, most of these therapeutic genes are placed under the regulation of ubiquitous viral promoters. Our goal is to generate a safer yet potent oncolytic herpes simplex virus type-1 (HSV-1) for cancer therapy. Methods: Using bacterial artificial chromosome (BAC) recombineering, a cell cycle-regulatable luciferase transgene cassette was replaced with the infected cell protein 6 (ICP6) coding region (encoded for UL39 or large subunit of ribonucleotide reductase) of the HSV-1 genome. These recombinant viruses, YE-PC8, were further tested for its proliferation-dependent luciferase gene expression. Results: The ability of YE-PC8 to confer proliferation-dependent transgene expression was demonstrated by injecting similar amount of viruses into the tumour-bearing region of the brain and the contralateral normal brain parenchyma of the same mouse. The results showed enhanced levels of luciferase activities in the tumour region but not in the normal brain parenchyma. Similar findings were observed in YE-PC8-infected short-term human brain patient-derived glioma cells compared with normal human astrocytes. intratumoural injection of YE-PC8 viruses resulted in 77% and 80% of tumour regression in human glioma and human hepatocellular carcinoma xenografts, respectively. Conclusion: YE-PC8 viruses confer tumour selectivity in proliferating cells and may be developed further as a feasible approach to treat human cancers. PMID:24196790

Bibliography of Soviet Laser Developments, Number 79, September - October 1985.

DTIC Science & Technology

1987-01-01

Prakticheskiye primeneniya. NSPGAN. Leningrad, Nauka, 1985, 107-116. " 470. Ashcheulov, Yu.V.; Petnikov, A.Ye.; Sukhanov , V.I. (). Stability of...YU V 64 SHTANCHAYEV M 1 21 SNEGIREV YE P 75 SUKHANOV V 1 52 SHTERN F K 77 SNITKO 0 V 4 SUKHAREV S A 35 SHTERNI3ERG A R 92 SNOPKO V N 57 SUKHAREVA L K

Acceleration of yoghurt fermentation time by yeast extract and partial characterisation of the active components.

PubMed

Smith, Esti-Andrine; Myburgh, Jacobus; Osthoff, Gernot; de Wit, Maryna

2014-11-01

Water soluble autolysate of yeast, usually utilised for microbial growth support, was used as additive in yoghurt fermentation. The yeast extract (YE) resulted in a decrease of fermentation time by 21% to reach a pH of 4·6. However, the YE resulted in unacceptable flavour and taste. By size exclusion chromatography, a fraction of the YE was obtained that could account for the observed 21% decrease in fermentation time. The fraction contained molecules of low molecular weight, consisting of minerals, free amino acids and peptides. The acceleration of the yoghurt fermentation was ascribed to the short peptides in the fraction. It is proposed that the application of this extract in industrial yoghurt manufacture would result in savings for both the industry and the consumer.

Methyl jasmonate and yeast elicitor induce differential transcriptional and metabolic re-programming in cell suspension cultures of the model legume Medicago truncatula.

PubMed

Suzuki, Hideyuki; Reddy, M S Srinivasa; Naoumkina, Marina; Aziz, Naveed; May, Gregory D; Huhman, David V; Sumner, Lloyd W; Blount, Jack W; Mendes, Pedro; Dixon, Richard A

2005-03-01

Exposure of cell suspension cultures of Medicago truncatula Gaerth. to methyl jasmonate (MeJA) resulted in up to 50-fold induction of transcripts encoding the key triterpene biosynthetic enzyme beta-amyrin synthase (betaAS; EC 5.4.99.-). Transcripts reached maximum levels at 24 h post-elicitation with 0.5 mM MeJA. The entry point enzymes into the phenylpropanoid and flavonoid pathways, L: -phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) and chalcone synthase (CHS; EC 2.3.1.74), respectively, were not induced by MeJA. In contrast, exposure of cells to yeast elicitor (YE) resulted in up to 45- and 14-fold induction of PAL and CHS transcripts, respectively, at only 2 h post-elicitation. betaAS transcripts were weakly induced at 12 h after exposure to YE. Over 30 different triterpene saponins were identified in the cultures, many of which were strongly induced by MeJA, but not by YE. In contrast, cinnamic acids, benzoic acids and isoflavone-derived compounds accumulated following exposure of cultures to YE, but few changes in phenylpropanoid levels were observed in response to MeJA. DNA microarray analysis confirmed the strong differential transcriptional re-programming of the cell cultures for multiple genes in the phenylpropanoid and triterpene pathways in response to MeJA and YE, and indicated different responses of individual members of gene families. This work establishes Medicago cell cultures as an excellent model for future genomics approaches to understand the regulation of legume secondary metabolism.

JPRS Report Science & Technology USSR: Life Sciences.

DTIC Science & Technology

1988-07-18

SOTSIALISTICHESKAYA INDUSTRIYA, 31 Jan 87, 1 Feb 87) 79 PSYCHOLOGY Psychoprevention and Psychotherapy of Alcoholism (V.Ye. Rozhnov, M.Ye. Burno...IMMOBILIZOVANNYYE FERMENTY V MEDITSINE INOVOYE V ZHIZNI, NAUKE, TEKHNIKE: SERIYA "KRTMIYA"] , No 9, Sep 86) 3 Isolation of Cholesterol Oxidase ...No 5, Sep-Oct 86) 17 Alkylation of Benzo- and Dibenzocrown Esters With Various Alcohols (A. K. Tashmukhamedova, I. A. Stempnevskaya, et al

USSR Report, Life Sciences, Biomedical and Behavioral Sciences

DTIC Science & Technology

1985-02-05

of the toxicity and anticholinesterase activity , of a number of organophosphorus compounds and carbamates, for females of the genus hybomitra and...house flies. Anticholinesterase activity and toxicity did not vary identically. 1842-6508] UDC: 619*616.981.42:612.017.1 ANTIGENTREACTIVE CELLS IN...Rukhlyada, M. Ye. Pillpenko; VETERINARIYA, No 8, Aug 84) 2 Toxicity and Anticholinesterase Action of Insecticides (Ye. K. Balashova, V. I

The association between area deprivation and dental caries in groups with and without fluoride in their drinking water.

PubMed

Ellwood, R P; O'Mullane, D M

1995-03-01

In order to determine the association between social background and dental caries for subjects living in areas with and without fluoride in the drinking water, lifetime residents from Anglesey (0.7 mg/l F-, n = 196) and Chester/Bala (< 0.1 mg/l F-, n = 267) were examined. The mean age overall was 14.1 (+/- 0.3) years. For the Anglesey group, when differences in material deprivation were controlled, the mean DMFS was 2.9 compared with 4.3 in Chester/Bala, a difference of 33 per cent. Using multiple linear regression it was found that there was no interaction between material deprivation and water fluoridation. This suggested that absolute differences in dental caries between these areas with and without fluoride in the drinking water were similar for different strata of deprivation. It follows that percentage reductions in dental caries resulting from fluoridation of water supplies tended to be less in deprived than non deprived groups.

VizieR Online Data Catalog: Supernova matter EOS (Buyukcizmeci+, 2014)

NASA Astrophysics Data System (ADS)

Buyukcizmeci, N.; Botvina, A. S.; Mishustin, I. N.

2017-03-01

The Statistical Model for Supernova Matter (SMSM) was developed in Botvina & Mishustin (2004, PhLB, 584, 233 ; 2010, NuPhA, 843, 98) as a direct generalization of the Statistical Multifragmentation Model (SMM; Bondorf et al. 1995, PhR, 257, 133). We treat supernova matter as a mixture of nuclear species, electrons, and photons in statistical equilibrium. The SMSM EOS tables cover the following ranges of control parameters: 1. Temperature: T = 0.2-25 MeV; for 35 T values. 2. Electron fraction Ye: 0.02-0.56; linear mesh of Ye = 0.02, giving 28 Ye values. It is equal to the total proton fraction Xp, due to charge neutrality. 3. Baryon number density fraction {rho}/{rho}0 = (10-8-0.32), giving 31 {rho}/{rho}0 values. (2 data files).

Adventure as Therapy: Using Adventure as Part of Therapeutic Programmes with Young People in Trouble and at Risk.

ERIC Educational Resources Information Center

McNutt, Brendan

This paper defines "adventure-based intervention,""young people," and "trouble and risk" in light of the therapeutic work done at Bryn Melyn Community (Bala, Wales), a therapeutic treatment center. Bryn Melyn provides intensive individualized therapy to young people, aged 15-18, who are in the care of social services…

Hepatocellular carcinoma: short-term reproducibility of apparent diffusion coefficient and intravoxel incoherent motion parameters at 3.0T.

PubMed

Kakite, Suguru; Dyvorne, Hadrien; Besa, Cecilia; Cooper, Nancy; Facciuto, Marcelo; Donnerhack, Claudia; Taouli, Bachir

2015-01-01

To evaluate short-term test-retest and interobserver reproducibility of IVIM (intravoxel incoherent motion) diffusion parameters and ADC (apparent diffusion coefficient) of hepatocellular carcinoma (HCC) and liver parenchyma at 3.0T. In this prospective Institutional Review Board (IRB)-approved study, 11 patients were scanned twice using a free-breathing single-shot echo-planar-imaging, diffusion-weighted imaging (DWI) sequence using 4 b values (b = 0, 50, 500, 1000 s/mm(2)) and IVIM DWI using 16 b values (0-800 s/mm(2)) at 3.0T. IVIM parameters (D: true diffusion coefficient, D*: pseudodiffusion coefficient, PF: perfusion fraction) and ADC (using 4 b and 16 b) were calculated. Short-term test-retest and interobserver reproducibility of IVIM parameters and ADC were assessed by measuring correlation coefficient, coefficient of variation (CV), and Bland-Altman limits of agreements (BA-LA). Fifteen HCCs were assessed in 10 patients. Reproducibility of IVIM metrics in HCC was poor for D* and PF (mean CV 60.6% and 37.3%, BA-LA: -161.6% to 135.3% and -66.2% to 101.0%, for D* and PF, respectively), good for D and ADC (CV 19.7% and <16%, BA-LA -57.4% to 36.3% and -38.2 to 34.1%, for D and ADC, respectively). Interobserver reproducibility was on the same order of test-retest reproducibility except for PF in HCC. Reproducibility of diffusion parameters was better in liver parenchyma compared to HCC. Poor reproducibility of D*/PF and good reproducibility for D/ADC were observed in HCC and liver parenchyma. These findings may have implications for trials using DWI in HCC. © 2014 Wiley Periodicals, Inc.

USSR and Eastern Europe Scientific Abstracts, Cybernetics, Computers, and Automation Technology, Number 26

DTIC Science & Technology

1977-01-26

Sisteme Matematicheskogo Obespecheniya YeS EVM [ Applied Programs in the Software System for the Unified System of Computers], by A. Ye. Fateyev, A. I...computerized systems are most effective in large production complexes , in which the level of utilization of computers can be as high as 500,000...performance of these tasks could be furthered by the complex introduction of electronic computers in automated control systems. The creation of ASU

Detecting and Jamming Dynamic Communication Networks in Anti-Access Environments

DTIC Science & Technology

2011-03-01

P.M. Pardalos, Y. Ye. and C.W. Commander (eds) V. Boginski. Sensors: Theory , Algorithms, and Applications. Springer, to appear in 2009. [21] Joseph C...Sumeetpal S. Singh. Nikolaos Kantas , Ba-Ngu Vo, Arnaud Doucet, and Robin J. Evans. Simulation-based optimal sensor scheduling with application to...observer trajectory planning. Aotomatica, 43(5):817-830, 2007. [27] Anthony Man-Cho So and Yinyu Ye. Theory of semidefinite programming for sensor network

Hear Ye, Hear Ye: A Dozen Messages from the New York Common Core Crier

ERIC Educational Resources Information Center

Jaeger, Paige

2014-01-01

In 2010, Jean Stevens from the New York State Education Department addressed a group of NY state administrators and shared, "It is no mistake that inquiry-based learning is throughout the Common Core." That was a cornerstone cry for which only school librarians knew the significance. After years of fighting for turf as a poor fief, it…

Impact of Neutrino Flavor Oscillations on the Neutrino-driven Wind Nucleosynthesis of an Electron-capture Supernova

NASA Astrophysics Data System (ADS)

Pllumbi, Else; Tamborra, Irene; Wanajo, Shinya; Janka, Hans-Thomas; Hüdepohl, Lorenz

2015-08-01

Neutrino oscillations, especially to light sterile states, can affect nucleosynthesis yields because of their possible feedback effect on the electron fraction (Ye). For the first time, we perform nucleosynthesis calculations for neutrino-driven wind trajectories from the neutrino-cooling phase of an 8.8 {M}⊙ electron-capture supernova (SN), whose hydrodynamic evolution was computed in spherical symmetry with sophisticated neutrino transport and whose Ye evolution was post-processed by including neutrino oscillations between both active and active-sterile flavors. We also take into account the α-effect as well as weak magnetism and recoil corrections in the neutrino absorption and emission processes. We observe effects on the Ye evolution that depend in a subtle way on the relative radial positions of the sterile Mikheyev-Smirnov-Wolfenstein resonances, on collective flavor transformations, and on the formation of α particles. For the adopted SN progenitor, we find that neutrino oscillations, also to a sterile state with eV mass, do not significantly affect the element formation and in particular cannot make the post-explosion wind outflow neutron-rich enough to activate a strong r-process. Our conclusions become even more robust when, in order to mimic equation-of-state-dependent corrections due to nucleon potential effects in the dense-medium neutrino opacities, six cases with reduced Ye in the wind are considered. In these cases, despite the conversion of active neutrinos to sterile neutrinos, Ye increases or is not significantly lowered compared to the values obtained without oscillations and active flavor transformations. This is a consequence of a complicated interplay between sterile-neutrino production, neutrino-neutrino interactions, and α-effect.

Effects on grape amino acid concentration through foliar application of three different elicitors.

PubMed

Gutiérrez-Gamboa, G; Portu, J; Santamaría, P; López, R; Garde-Cerdán, T

2017-09-01

Elicitors play an important role in the defense against pathogens as an alternative to chemical pesticides by increasing secondary metabolites. Their effect on grape amino acid has been little investigated. Thus, the aim of this research was to study the influence of methyl jasmonate (MeJ), chitosan (CHT), and a yeast extract (YE) on grape amino acid composition, through foliar applications to grapevines. The must amino acid concentration was analyzed by HPLC. The results showed that CHT and YE treatments decreased the must concentration of several amino acids, affecting total amino acid content (from 2364 to 1961, and 1818mg/L, respectively). However, MeJ treatment had a slight effect on grape amino acid content, increasing the concentration of Met (from 8.95 to 12.13mg/L) and Phe (from 7.96 to 9.29mg/L). It seems to be that, the resistance induction through CHT and YE treatments results in physiological costs to grapevines associated with a decrease on grape amino acid concentration. Consequently, MeJ applications, as a viticultural practice, could be a better tool than CHT and YE treatments, because did not affect grape amino acid concentration. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Role of the Chinese Military in National Security of Policymaking.

DTIC Science & Technology

1996-01-01

California Press, 1992, pp. 95-124; Wei Li , The Chinese Staff System: A Mechanism for Bureaucratic Control and Integration, Berkeley: Institute of East...representatives, etc. They reportedly continue to perform these roles today. For details, see Wei Li and Lucian W. Pye, "The Ubiquitous Role of the Mishu in...strategic objectives. These included Ye Jianying , Xu Xiangqian, Nie Rongzhen, Yang Shangkun, Zhang Aiping, Yang Dezhi, Yu Qiuli, and Hong Xuezhi. Ye, Xu

Biodegradation of Polychlorinated Methanes in Methanogenic Systems

DTIC Science & Technology

1991-01-01

occurring toxicant and C-1 growth substrate. J. General Microbiol. 132:1139-1142. 18. Hoover, S. R. and N. Porges. 1952. Assimilation of dairy wastes by...carbon and electron donor source; (3) to examine the level of micronutrients - provided as yeast extract (YE) - needed in the system feed; (4) to...provided the electron donor needed to consume oxygen and lower the redox potential in the precolumn; YE provided micronutrients . No reductant (Na2S

FGM (Functionally Graded Material) Thermal Barrier Coatings for Hypersonic Structures - Design and Thermal Structural Analysis

DTIC Science & Technology

2007-06-29

than others. It was found that TZ-3Y-E, which is a partially stabilised zirconia powder , was particularly suitable. The percentage of ceramic powder...layered coatings The current ceramic powder that was being used was a fully stabilised zirconia powder TZ-0Y. However a readily available powder...TZ-3Y-E, partially stabilised zirconia powder , was available and utilised. These tests consisted of a combination of 3, 4 and 5 layers. In the

Identification and classification of genes regulated by phosphatidylinositol 3-kinase- and TRKB-mediated signalling pathways during neuronal differentiation in two subtypes of the human neuroblastoma cell line SH-SY5Y.

PubMed

Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki

2008-10-28

SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF) for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.

Yeast peroxisomal multifunctional enzyme: (3R)-hydroxyacyl-CoA dehydrogenase domains A and B are required for optimal growth on oleic acid.

PubMed

Qin, Y M; Marttila, M S; Haapalainen, A M; Siivari, K M; Glumoff, T; Hiltunen, J K

1999-10-01

The yeast peroxisomal (3R)-hydroxyacyl-CoA dehydrogenase/2-enoyl-CoA hydratase 2 (multifunctional enzyme type 2; MFE-2) has two N-terminal domains belonging to the short chain alcohol dehydrogenase/reductase superfamily. To investigate the physiological roles of these domains, here called A and B, Saccharomyces cerevisiae fox-2 cells (devoid of Sc MFE-2) were taken as a model system. Gly(16) and Gly(329) of the S. cerevisiae A and B domains, corresponding to Gly(16), which is mutated in the human MFE-2 deficiency, were mutated to serine and cloned into the yeast expression plasmid pYE352. In oleic acid medium, fox-2 cells transformed with pYE352:: ScMFE-2(aDelta) and pYE352::ScMFE-2(bDelta) grew slower than cells transformed with pYE352::ScMFE-2, whereas cells transformed with pYE352::ScMFE-2(aDeltabDelta) failed to grow. Candida tropicalis MFE-2 with a deleted hydratase 2 domain (Ct MFE- 2(h2Delta)) and mutational variants of the A and B domains (Ct MFE- 2(h2DeltaaDelta), Ct MFE- 2(h2DeltabDelta), and Ct MFE- 2(h2DeltaaDeltabDelta)) were overexpressed and characterized. All proteins were dimers with similar secondary structure elements. Both wild type domains were enzymatically active, with the B domain showing the highest activity with short chain and the A domain with medium and long chain (3R)-hydroxyacyl-CoA substrates. The data show that the dehydrogenase domains of yeast MFE-2 have different substrate specificities required to allow the yeast to propagate optimally on fatty acids as the carbon source.

Comparison of Free-Breathing With Navigator-Triggered Technique in Diffusion Weighted Imaging for Evaluation of Small Hepatocellular Carcinoma: Effect on Image Quality and Intravoxel Incoherent Motion Parameters.

PubMed

Shan, Yan; Zeng, Meng-su; Liu, Kai; Miao, Xi-Yin; Lin, Jiang; Fu, Cai xia; Xu, Peng-ju

2015-01-01

To evaluate the effect on image quality and intravoxel incoherent motion (IVIM) parameters of small hepatocellular carcinoma (HCC) from choice of either free-breathing (FB) or navigator-triggered (NT) diffusion-weighted (DW) imaging. Thirty patients with 37 small HCCs underwent IVIM DW imaging using 12 b values (0-800 s/mm) with 2 sequences: NT, FB. A biexponential analysis with the Bayesian method yielded true diffusion coefficient (D), pseudodiffusion coefficient (D*), and perfusion fraction (f) in small HCCs and liver parenchyma. Apparent diffusion coefficient (ADC) was also calculated. The acquisition time and image quality scores were assessed for 2 sequences. Independent sample t test was used to compare image quality, signal intensity ratio, IVIM parameters, and ADC values between the 2 sequences; reproducibility of IVIM parameters, and ADC values between 2 sequences was assessed with the Bland-Altman method (BA-LA). Image quality with NT sequence was superior to that with FB acquisition (P = 0.02). The mean acquisition time for FB scheme was shorter than that of NT sequence (6 minutes 14 seconds vs 10 minutes 21 seconds ± 10 seconds P < 0.01). The signal intensity ratio of small HCCs did not vary significantly between the 2 sequences. The ADC and IVIM parameters from the 2 sequences show no significant difference. Reproducibility of D*and f parameters in small HCC was poor (BA-LA: 95% confidence interval, -180.8% to 189.2% for D* and -133.8% to 174.9% for f). A moderate reproducibility of D and ADC parameters was observed (BA-LA: 95% confidence interval, -83.5% to 76.8% for D and -74.4% to 88.2% for ADC) between the 2 sequences. The NT DW imaging technique offers no advantage in IVIM parameters measurements of small HCC except better image quality, whereas FB technique offers greater confidence in fitted diffusion parameters for matched acquisition periods.

TU-F-CAMPUS-I-01: Head and Neck Squamous Cell Carcinoma: Short-Term Repeatability of Apparent Diffusion Coefficient and Intravoxel Incoherent Motion Parameters at 3.0T

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, Y; Fuller, C; Mohamed, A

2015-06-15

Purpose: Many published studies have recently demonstrated the potential value of intravoxel incoherent motion (IVIM) analysis for disease evaluation. However, few have questioned its measurement repeatability/reproducibility when applied. The purpose of this study was to determine the short-term measurement repeatability of apparent diffusion coefficient ADC, true diffusion coefficient D, pseudodiffusion coefficient D* and perfusion fraction f, in head and neck squamous cell carcinoma (HNSCC) primary tumors and metastatic nodes. Methods: Ten patients with known HNSCC were examined twice using echo-planar DW-MRI with 12 b values (0 to 800 s/mm2) 1hour to 24 hours apart before radiation treatment. All patients weremore » scanned with the customized radiation treatment immobilization devices to reduce motion artifacts and to improve image registration in repeat scans. Regions of interests were drawn in primary tumor and metastases node in each patient (Fig. 1). ADC and IVIM parameters D, D* and f were calculated by least squares data fitting. Short-term test–retest repeatability of ADC and IVIM parameters were assessed by measuring Bland–Altman limits of agreements (BA-LA). Results: Sixteen HNSCC lesions were assessed in 10 patients. Repeatability of perfusion-sensitive parameters, D* and f, in HNSCC lesions was poor (BA-LA: -144% to 88% and −57% to 96% for D* and f, respectively); a lesser extent was observed for the diffusion-sensitive parameters of ADC and D (BA-LA: −34% to 39% and −37% to 40%, for ADC and D, respectively) (Fig. 2). Conclusion: Poor repeatability of D*/f and good repeatability for ADC/D were observed in HNSCC primary tumors and metastatic nodes. Efforts should be made to improve the measurement repeatability of perfusion-sensitive IVIM parameters.« less

New records and detailed distribution and abundance of selected arthropod species collected between 1999 and 2011 in Azorean native forests

PubMed Central

Gaspar, Clara; Crespo, Luís Carlos Fonseca; Rigal, François; Cardoso, Pedro; Pereira, Fernando; Rego, Carla; Amorim, Isabel R.; Melo, Catarina; Aguiar, Carlos; André, Genage; Mendonça, Enésima P.; Ribeiro, Sérvio; Hortal, Joaquín; Santos, Ana M.C.; Barcelos, Luís; Enghoff, Henrik; Mahnert, Volker; Pita, Margarida T.; Ribes, Jordi; Baz, Arturo; Sousa, António B.; Vieira, Virgílio; Wunderlich, Jörg; Parmakelis, Aristeidis; Whittaker, Robert J.; Quartau, José Alberto; Serrano, Artur R.M.; Triantis, Kostas A.

2016-01-01

Abstract Background In this contribution we present detailed distribution and abundance data for arthropod species identified during the BALA – Biodiversity of Arthropods from the Laurisilva of the Azores (1999-2004) and BALA2 projects (2010-2011) from 18 native forest fragments in seven of the nine Azorean islands (all excluding Graciosa and Corvo islands, which have no native forest left). New information Of the total 286 species identified, 81% were captured between 1999 and 2000, a period during which only 39% of all the samples were collected. On average, arthropod richness for each island increased by 10% during the time frame of these projects. The classes Arachnida, Chilopoda and Diplopoda represent the most remarkable cases of new island records, with more than 30% of the records being novelties. This study stresses the need to expand the approaches applied in these projects to other habitats in the Azores, and more importantly to other less surveyed taxonomic groups (e.g. Diptera and Hymenoptera). These steps are fundamental for getting a more accurate assessment of biodiversity in the archipelago. PMID:28174509

Effect of a six month yoga exercise intervention on fitness outcomes for breast cancer survivors

PubMed Central

Hughes, Daniel C.; Darby, Nydia; Gonzalez, Krystle; Boggess, Terri; Morris, Ruth M.; Ramirez, Amelie G.

2016-01-01

Yoga-based exercise has proven to be beneficial for practitioners, including cancer survivors. This study reports on the improvements in physical fitness for 20 breast cancer survivors who participated in a six-month yoga-based (YE) exercise program. Results are compared to a comprehensive exercise (CE) program group and a comparison (C) exercise group who chose their own exercises. “Pre” and “post” fitness assessments included measures of anthropometrics, cardiorespiratory capacity, strength and flexibility. Descriptive statistics, effect size (d), dependent sample ‘t’ tests for all outcome measures were calculated for the YE group. Significant improvements included: decreased % body fat (−3.00%, d = −0.44, p < 0.001); increased sit to stand leg strength repetitions (2.05, d = 0.48, p = 0.003); forward reach (3.59 cm, d = 0.61, p = 0.01); and right arm sagittal range of motion (6.50°, d = 0.92, p= 0.05). To compare YE outcomes with the other two groups, a one-way analysis of variance (ANOVA) was used. YE participants significantly outperformed C participants on “forward reach” (3.59 cm gained versus −2.44 cm lost), (p = 0.009) and outperformed CE participants (3.59 cm gained versus 1.35 cm gained), but not statistically significant. Our results support yoga-based exercise modified for breast cancer survivors as safe and effective. PMID:26395825

Bibliography of Soviet Laser Developments, Number 41, May - June 1979.

DTIC Science & Technology

1980-01-10

Andreyeva, O.V., and V.I. Sukhanov (0). Method for calculating the diffraction efficiency of holograms, allowing for the granularity of the photolayer. Sb...thick-layer holograms. Sb 14, 128-133. 315. Sukhanov , V.I., G.I. Lashkov, A.Ye. Petnikov, Yu.V. Ashcheulov, I.I. Reznikova, and A.S. Cherkasov (0... Sukhanov , V.I., Yu.V. Ashcheulov, and A.Ye. Petnikov (0). Recording and readout of holograms in LiNbO :Fe crystals. Sb 14, 64-72. 317. Tanin, L.V. (0

Bibliography of Soviet Laser Developments Number 53, May-June 1981.

DTIC Science & Technology

1982-07-20

Mukhametniyazova, V.M. Sarkisova, and S. Sukhanov (55). Recrystallization of indium antimonide films. IAN Turk, no. 1, 1981, 121-124. 309. Portnova, E.G., K.K...radioholograms. Sb 15, 104-114. (RZhRadiot, 6/81, 6Ye4l0) 506. Andreyeva, O.V., and V.I. Sukhanov (0). Effect of amplitude modulation on the...5Ye356) 714. Sukhanov , I.I., and Yu.V. Troitskiy (0). Phase characteristics of multibeam interferometers. OiS, v. 50, no. 5, 1981, 952-959. 715

On multi-level thinking and scientific understanding

NASA Astrophysics Data System (ADS)

McIntyre, Michael Edgeworth

2017-10-01

Professor Duzheng YE's name has been familiar to me ever since my postdoctoral years at MIT with Professors Jule CHARNEY and Norman PHILLIPS, back in the late 1960s. I had the enormous pleasure of meeting Professor YE personally in 1992 in Beijing. His concern to promote the very best science and to use it well, and his thinking on multi-level orderly human activities, reminds me not only of the communication skills we need as scientists but also of the multi-level nature of science itself. Here I want to say something (a) about what science is; (b) about why multi-level thinking—and taking more than one viewpoint—is so important for scientific as well as for other forms of understanding; and (c) about what is meant, at a deep level, by "scientific understanding" and trying to communicate it, not only with lay persons but also across professional disciplines. I hope that Professor YE would approve.

[Preliminary study on the time of first appearance of "lanhousha" (scarlet fever)].

PubMed

Yu, X

2001-04-01

There are controversies about the problem of the source of "lanhousha" (scarlet fever) in the field of modern medical history, whether it is an epidemic appeared from the ancient time in our country or imported from other countries. Now, almost all researches were carried out around the classic medical books, especially "Medical Records of Ye Tianshi", and hardly dealing it in a historical context at that time. Through contrastive analysis between the records in medical books and historical facts, it is concluded that Ye Tianshi's records of scarlet fever have nothing to do with Ye Tianshi himself, and is by author of allonym. It perhaps was exogenous cold diseases spread when a severe epidemic diseases happened at Southern Jiangsu in the 11th year of Yongzheng reign. Even though there was some scarlet fever, it was not the first spread of scarlet fever in fact. Actually, in late Kangxi reign, scarlet fever was regarded as an epidemic disease seldom seen at Southern Jiangsu.

Fibrillation mechanism of a model intrinsically disordered protein revealed by 2D correlation deep UV resonance Raman spectroscopy.

PubMed

Sikirzhytski, Vitali; Topilina, Natalya I; Takor, Gaius A; Higashiya, Seiichiro; Welch, John T; Uversky, Vladimir N; Lednev, Igor K

2012-05-14

Understanding of numerous biological functions of intrinsically disordered proteins (IDPs) is of significant interest to modern life science research. A large variety of serious debilitating diseases are associated with the malfunction of IDPs including neurodegenerative disorders and systemic amyloidosis. Here we report on the molecular mechanism of amyloid fibrillation of a model IDP (YE8) using 2D correlation deep UV resonance Raman spectroscopy. YE8 is a genetically engineered polypeptide, which is completely unordered at neutral pH yet exhibits all properties of a fibrillogenic protein at low pH. The very first step of the fibrillation process involves structural rearrangements of YE8 at the global structure level without the detectable appearance of secondary structural elements. The formation of β-sheet species follows the global structural changes and proceeds via the simultaneous formation of turns and β-strands. The kinetic mechanism revealed is an important new contribution to understanding of the general fibrillation mechanism proposed for IDP.

Bibliography of Soviet Laser Developments, Number 64, March - April 1983.

DTIC Science & Technology

1984-03-06

140. Mirza, S.Yu. * A.N. Soldatov, and V.B. Sukhanov (0). Efficient conversion of radiation in metal vapor to tunable lasing in dyes. Sb 8, 81-107...Device for reconstructing images. Otkr izobr, no. 16, 1983, 1015508. 521. Sander, Ye.A., V.I. Sukhanov , and S.A. Shoydin (0). Study on holographic...Deposit at VINITI, no. 6231-82, 17 Dec 1982, 27 p. (RZhF, 3/83, 3D975) 556. Sukhanov , V.I., A.Ye. Petnikov, and Yu.V. Ashcheulov (0). Hologram

Barriers to Breast Cancer Screening among Latinas in the U.S.-Mexico Border Region

DTIC Science & Technology

2011-05-01

la Salud : A breast and cervical... en in g E ve r ha d a m am m og ra m H ad a M am m og ra m w ith in th e la st 2 ye ar s H ad a m am m og ra m w ith in th e la st ye ar U na dj us...Cancer Society, Atlanta, GA 22. Fernandez ME, Gonzales A, Tortolero-Luna G et al (2009) Effectiveness of Cultivando la Salud : a breast and cervical

Efficacy of a biomechanically-based yoga exercise program in knee osteoarthritis: A randomized controlled trial.

PubMed

Kuntz, Alexander B; Chopp-Hurley, Jaclyn N; Brenneman, Elora C; Karampatos, Sarah; Wiebenga, Emily G; Adachi, Jonathan D; Noseworthy, Michael D; Maly, Monica R

2018-01-01

Certain exercises could overload the osteoarthritic knee. We developed an exercise program from yoga postures with a minimal knee adduction moment for knee osteoarthritis. The purpose was to compare the effectiveness of this biomechanically-based yoga exercise (YE), with traditional exercise (TE), and a no-exercise attention-equivalent control (NE) for improving pain, self-reported physical function and mobility performance in women with knee osteoarthritis. Single-blind, three-arm randomized controlled trial. Community in Southwestern Ontario, Canada. A convenience sample of 31 women with symptomatic knee osteoarthritis was recruited through rheumatology, orthopaedic and physiotherapy clinics, newspapers and word-of-mouth. Participants were stratified by disease severity and randomly allocated to one of three 12-week, supervised interventions. YE included biomechanically-based yoga exercises; TE included traditional leg strengthening on machines; and NE included meditation with no exercise. Participants were asked to attend three 1-hour group classes/sessions each week. Primary outcomes were pain, self-reported physical function and mobility performance. Secondary outcomes were knee strength, depression, and health-related quality of life. All were assessed by a blinded assessor at baseline and immediately following the intervention. The YE group demonstrated greater improvements in KOOS pain (mean difference of 22.9 [95% CI, 6.9 to 38.8; p = 0.003]), intermittent pain (mean difference of -19.6 [95% CI, -34.8 to -4.4; p = 0.009]) and self-reported physical function (mean difference of 17.2 [95% CI, 5.2 to 29.2; p = 0.003]) compared to NE. Improvements in these outcomes were similar between YE and TE. However, TE demonstrated a greater improvement in knee flexor strength compared to YE (mean difference of 0.1 [95% CI, 0.1 to 0.2]. Improvements from baseline to follow-up were present in quality of life score for YE and knee flexor strength for TE, while both also

Parameter study of r-process lanthanide production and heating rates in kilonovae

NASA Astrophysics Data System (ADS)

Lippuner, Jonas; Roberts, Luke F.

2015-04-01

Explosive r-process nucleosynthesis in material ejected during compact object mergers may lead to radioactively powered transients called kilonovae. The timescale and peak luminosity of these transients are sensitive to the composition of the material after nuclear burning ceases, as the composition determines the local heating rate from nuclear decays and the opacity. The presence of lanthanides in the ejecta can drastically increase the opacity. We use the new general-purpose nuclear reaction network SkyNet to run a parameter study of r-process nucleosynthesis for a range of initial electron fractions Ye, initial entropies s, and density decay timescales τ. We find that the ejecta is lanthanide-free for Ye >~ 0 . 22 - 0 . 3 , depending on s and τ. The heating rate is insensitive to s and τ, but certain, larger values of Ye lead to reduced heating rates, because single nuclides dominate the heating. With a simple model we estimate the luminosity, time, and effective temperature at the peak of the light curve. Since the opacity is much lower in the lanthanide-free case, we find the luminosity peaks much earlier at ~ 1 day vs. ~ 15 days in the lanthanide-rich cases. Although there is significant variation in the heating rate with Ye, changes in the heating rate do not mitigate the effect of the lanthanides. This research is partially supported by NSF under Award Numbers AST-1333520 and AST-1205732.

AUV (Autonomous Underwater Vehicle) Dive Control System Development Including Sensor Bias Compensation and Parameter Estimation

DTIC Science & Technology

1988-12-01

equations, x(k+l) = A*x(k) + B*u(k) + Ko *[y(k)-C*x(k)] in which y(k) is the previous time sensor output signals. In this case, two outputs were...available to the observer, the pitch rate, and the water depth. The observer gains, Ko , may be selected by using the dual of the controller pole placement...becomes, 15 y(k) = [l;l]*ye(k) so that the gains for the two-input system become Ko = [l;l]*ke where Ke are found via pole placement using ye(k). The

Open fermentative production of L-lactic acid with high optical purity by thermophilic Bacillus coagulans using excess sludge as nutrient.

PubMed

Ma, Kedong; Maeda, Toshinari; You, Huiyan; Shirai, Yoshihito

2014-01-01

The development of a low-cost polymer-grade L-lactic acid production process was achieved in this study. Excess sludge hydrolyzate (ESH) was chosen as nutrient source for the objective of reducing nutrient cost in lactic acid production. 1% of ESH had high performance in lactic acid production relative to 2g/l yeast extract (YE) while the production cost of ESH was much lower than that of YE, indicating ESH was a promising substitute of YE. By employing a thermophilic strain of Bacillus coagulans (NBRC 12583), non-sterilized batch and repeated batch L-lactic acid fermentation was successfully performed, and the optical purity of L-lactic acid accumulated was more than 99%. Moreover, the factors associated with cell growth and lactic acid fermentation was investigated through a two-stage lactic acid production strategy. Oxygen played an important role in cell growth, and the optimal condition for cell growth and fermentation was pH 7.0 and 50°C. Copyright © 2013 Elsevier Ltd. All rights reserved.

An Online Respiratory Quotient-Feedback Strategy of Feeding Yeast Extract for Efficient Arachidonic Acid Production by Mortierella alpina

PubMed Central

Li, Xiangyu; Yu, Chao; Yao, Jianming; Wang, Zhiming; Lu, Shuhuan

2018-01-01

Mortierella alpina (M. alpina) is well known for arachidonic acid (ARA) production. However, low efficiency and unstableness are long existed problems for industrial production of ARA by M. alpina due to the lack of online regulations. The aim of the present work is to develop an online-regulation strategy for efficient and stable ARA production in industry. The strategy was developed in 50 L fermenters and then applied in a 200 m3 fermenter. Results indicated that yeast extract (YE) highly increased cell growth in shake flask, it was then used in bioreactor fermentation by various feeding strategies. Feeding YE to control respiratory quotient (RQ) at 1.1 during 0–48 h and at 1.5 during 48–160 h, dry cell weight, and ARA titer reached 53.1 and 11.49 g/L in 50 L fermenter, which were increased by 79.4 and 36.9% as compared to that without YE feeding, respectively. Then, the online RQ-feedback strategy was applied in 200 m3 bioreactor fermentation and an average ARA titer of 16.82 g/L was obtained from 12 batches, which was 41.0% higher than the control batches. This is the first report on successful application of online RQ-feedback control of YE in ARA production, especially in an industrial scale of 200 m3 fermentation. It could be applied to other industrial production of microbial oil by oleaginous microorganisms. PMID:29404320

Biophysical Characterization of Copolymer-Protected Gene Vectors (COPROGs)

PubMed Central

Hönig, Daniel; DeRouchey, Jason; Jungmann, Ralf; Koch, Christian; Plank, Christian; Rädler, Joachim O.

2010-01-01

A copolymer-protected gene vector (COPROG) is a three component gene delivery system consisting of a preformed DNA and branched polyethylenimine (bPEI) complex subsequently modified by the addition of a copolymer (P6YE5C) incorporating both poly(ethylene glycol) (PEG) and anionic peptides. Using fluorescence correlation spectroscopy (FCS) and atomic force microscopy (AFM), we characterized and compared the self-assembly of bPEI/DNA particles and COPROG complexes. In low salt buffer, both bPEI/DNA and COPROG formulations form stable nanoparticles with hydrodynamic radii between 60–120 nm. COPROG particles, as compared to bPEI/DNA, show greatly improved particle stability to both physiological salt as well as low pH conditions. Binding stoichiometry of the three-component COPROG system was investigated by dual-color fluorescence cross-correlation spectroscopy (FCCS). It was found that a significant fraction of P6YE5C copolymer aggregates with excess bPEI forming bPEI/P6YE5C “ghost complexes” with no DNA inside. The ratio of ghost particles to COPROG complexes is about 4:1. In addition we find a large fraction of excess P6YE5C copolymer, which remains unbound in solution. We observe a 2–4 fold enhanced reporter gene expression with COPROG formulations at various equivalents as compared to bPEI-DNA alone. We believe that both complex stabilization as well as the capture of excess bPEI into ghost particles induced by the copolymer is responsible for the improvement in gene expression. PMID:20672861

Efficacy of a biomechanically-based yoga exercise program in knee osteoarthritis: A randomized controlled trial

PubMed Central

Kuntz, Alexander B.; Chopp-Hurley, Jaclyn N.; Brenneman, Elora C.; Karampatos, Sarah; Wiebenga, Emily G.; Adachi, Jonathan D.; Noseworthy, Michael D.

2018-01-01

Objective Certain exercises could overload the osteoarthritic knee. We developed an exercise program from yoga postures with a minimal knee adduction moment for knee osteoarthritis. The purpose was to compare the effectiveness of this biomechanically-based yoga exercise (YE), with traditional exercise (TE), and a no-exercise attention-equivalent control (NE) for improving pain, self-reported physical function and mobility performance in women with knee osteoarthritis. Design Single-blind, three-arm randomized controlled trial. Setting Community in Southwestern Ontario, Canada. Participants A convenience sample of 31 women with symptomatic knee osteoarthritis was recruited through rheumatology, orthopaedic and physiotherapy clinics, newspapers and word-of-mouth. Interventions Participants were stratified by disease severity and randomly allocated to one of three 12-week, supervised interventions. YE included biomechanically-based yoga exercises; TE included traditional leg strengthening on machines; and NE included meditation with no exercise. Participants were asked to attend three 1-hour group classes/sessions each week. Measurements Primary outcomes were pain, self-reported physical function and mobility performance. Secondary outcomes were knee strength, depression, and health-related quality of life. All were assessed by a blinded assessor at baseline and immediately following the intervention. Results The YE group demonstrated greater improvements in KOOS pain (mean difference of 22.9 [95% CI, 6.9 to 38.8; p = 0.003]), intermittent pain (mean difference of -19.6 [95% CI, -34.8 to -4.4; p = 0.009]) and self-reported physical function (mean difference of 17.2 [95% CI, 5.2 to 29.2; p = 0.003]) compared to NE. Improvements in these outcomes were similar between YE and TE. However, TE demonstrated a greater improvement in knee flexor strength compared to YE (mean difference of 0.1 [95% CI, 0.1 to 0.2]. Improvements from baseline to follow-up were present in quality

Feasibility of Screening for Antibiotic Resistance - Part I

DTIC Science & Technology

2005-09-01

Klebsiella pneumonia (AF052258), Providencia stuartii (AF052259), Serratia marcescens (AF052260). After alignment of the sequences of the various...intracellular targets of fluoroquinolones , the type II DNA topoisomerases gyrase and topoisomerase IV [Balas et al., 1998; Weigel et al., 1998]. Mutations in...the quinolones resistant determining region (QRDR) of the parC gene, which encodes the A subunit of topoisomerase , and the gyrA gene, which encodes

A Merged IQC/SOS Theory for Analysis and Synthesis of Nonlinear Control Systems

DTIC Science & Technology

2015-06-23

constraints. As mentioned previously, this enables new applications of IQCs to analyze the robustness of time-varying and nonlinear systems . This...enables new applications of IQCs to analyze the robustness of time-varying and nonlinear systems . This section considers the analysis of nonlinear systems ...AFRL-AFOSR-VA-TR-2016-0008 A Merged IQC/SOS Theory for Analysis and Synthesis of Nonlinear Control Systems Gary Balas REGENTS OF THE UNIVERSITY OF

Optimization of critical medium components using response surface methodology for biomass and extracellular polysaccharide production by Agaricus blazei.

PubMed

Liu, Gao-Qiang; Wang, Xiao-Ling

2007-02-01

Response surface methodology (RSM) was applied to optimize the critical medium ingredients of Agaricus blazei. A three-level Box-Behnken factorial design was employed to determine the maximum biomass and extracellular polysaccharide (EPS) yields at optimum levels for glucose, yeast extract (YE), and peptone. A mathematical model was then developed to show the effect of each medium composition and its interactions on the production of mycelial biomass and EPS. The model predicted the maximum biomass yield of 10.86 g/l that appeared at glucose, YE, peptone of 26.3, 6.84, and 6.62 g/l, respectively, while a maximum EPS yield of 348.4 mg/l appeared at glucose, YE, peptone of 28.4, 4.96, 5.60 g/l, respectively. These predicted values were also verified by validation experiments. The excellent correlation between predicted and measured values of each model justifies the validity of both the response models. The results of bioreactor fermentation also show that the optimized culture medium enhanced both biomass (13.91 +/- 0.71 g/l) and EPS (363 +/- 4.1 mg/l) production by Agaricus blazei in a large-scale fermentation process.

Radio-Astronomical Instruments Observations (Selected Articles),

DTIC Science & Technology

1982-08-02

NL SIIDAUG 82 L I MATVEYENKO, G S MISEZHNIKOV UNCLASSIFIED FTO_ ID(RS) -0564-82 N FTD-ID(RS) T -0564-82 FOREIGN TECHNOLOGY DIVISION RADIO-ASTRONOMICAL...INSTR1ThMNTS OBSERVATIONS (Selected Articles) 3 71982 Approved for public release; LAJ distribuion~ urJA’nited. • I . FTD- ID(RS) T -0564-82 UNEDITED... T , t * r a yy y y 7, u F, f E # Ye, ye; E, e* X x X x Kh, kh X C Zh, zn .4 u L q Ts, ts - -. Z ,. 4 f 14 Ch ,ch U 7 H u I , i w Sh, sh 2 R ia Y, y

Rice–arsenate interactions in hydroponics: whole genome transcriptional analysis

PubMed Central

Norton, Gareth J.; Lou-Hing, Daniel E.; Meharg, Andrew A.; Price, Adam H.

2008-01-01

Rice (Oryza sativa) varieties that are arsenate-tolerant (Bala) and -sensitive (Azucena) were used to conduct a transcriptome analysis of the response of rice seedlings to sodium arsenate (AsV) in hydroponic solution. RNA extracted from the roots of three replicate experiments of plants grown for 1 week in phosphate-free nutrient with or without 13.3 μM AsV was used to challenge the Affymetrix (52K) GeneChip Rice Genome array. A total of 576 probe sets were significantly up-regulated at least 2-fold in both varieties, whereas 622 were down-regulated. Ontological classification is presented. As expected, a large number of transcription factors, stress proteins, and transporters demonstrated differential expression. Striking is the lack of response of classic oxidative stress-responsive genes or phytochelatin synthases/synthatases. However, the large number of responses from genes involved in glutathione synthesis, metabolism, and transport suggests that glutathione conjugation and arsenate methylation may be important biochemical responses to arsenate challenge. In this report, no attempt is made to dissect differences in the response of the tolerant and sensitive variety, but analysis in a companion article will link gene expression to the known tolerance loci available in the Bala×Azucena mapping population. PMID:18453530

Applications of Cavity-Enhanced Direct Frequency Comb Spectroscopy

NASA Astrophysics Data System (ADS)

Cossel, Kevin C.; Adler, Florian; Maslowski, Piotr; Ye, Jun

2010-06-01

Cavity-enhanced direct frequency comb spectroscopy (CE-DFCS) is a unique technique that provides broad bandwidth, high resolution, and ultra-high detection sensitivities. This is accomplished by combining a femtosecond laser based optical frequency comb with an enhancement cavity and a broadband, multichannel imaging system. These systems are capable of simultaneously recording many terahertz of spectral bandwidth with sub-gigahertz resolution and absorption sensitivities of 1×10-7 cm-1 Hz-1/2. In addition, the ultrashort pulses enable efficient nonlinear processes, which makes it possible to reach spectral regions that are difficult to access with conventional laser sources. We will present an application of CE-DFCS for trace impurity detection in the semiconductor processing gas arsine near 1.8 μm and the development of a high-power, mid-infrared frequency comb for breath analysis in the 2.8-4.8 μm region. M. J. Thorpe, K. D. Moll, R. J. Jones, B. Safdi, and J. Ye. Science 311, 1595-1599 (2006) F. Adler, M. J. Thorpe, K. C. Cossel, and J. Ye. Annu. Rev. Anal. Chem. 3, 175-205 (2010) F. Adler, K. C. Cossel, M. J. Thorpe, I. Hartl, M. E. Fermann, and J. Ye. Opt. Lett. 34, 1330-1332 (2009)

Social Networks: Rational Learning and Information Aggregation

DTIC Science & Technology

2009-09-01

most closely related to our work in this genre are Bala and Goyal (1998, 2001), DeMarzo , Vayanos and Zwiebel (2003) and Golub and Jackson (2007). These...observations. DeMarzo , Vayanos and Zwiebel and Golub and Jackson also study similar environ- ments and derive consensus-type results, whereby individuals in the...Cover T., “Hypothesis Testing with Finite Statistics,” The Annals of Mathematical Statistics, vol. 40, no. 3, pp. 828-835, 1969. [18] DeMarzo P.M

JPRS Report, Near East and South Asia.

DTIC Science & Technology

1989-03-21

Orwell, that we live in a political century, "the relationship between two nations is not all politics." Al-Qasim infers that such a lesson can be...planning projects, the information that is sent from the grass roots levels to the Center has no relationship to reality. Even though this discrepancy...34 in Sajerhat. Bala said he had a lucrative practice for four years in Ambhitabazar near his village for four years and earned about Taka 150 daily

Identifying asteroid families >2 Gyrs-old

NASA Astrophysics Data System (ADS)

Bolin, Bryce T.; Morbidelli, Alessandro; Delbo, Marco; Walsh, Kevin J.

2017-10-01

There are only a few known Main Belt (MB) asteroid families with ages >2 Gyr. The lack of ancient families may be due to a bias in current techniques used to identify families. Ancient asteroid family fragments disperse in their orbital elements (a,e,i), due to secular resonances and the Yarkovsky effect (YE) making them difficult to identify. We have developed a new technique that is insensitive to the resonant spreading of fragments in e and i by searching for V-shaped correlations between family members in a vs 1/Diameter space. Our V-shape technique is demonstrated on known families and used to discover a 4 Gyr-old family linking most dark asteroids in the inner MB previously not included in any known family. In addition, the 4 Gyr-old family reveals asteroids with D >35 km that are do not belong to any asteroid family implying that they originally accreted from the protoplanetary disk.The V-shape detection tool is also a powerful analysis tool by finding the boundary of an asteroid family and fitting for its shape. Following the proposed relationship between thermal inertia (TI) with D, we find that asteroids YE drift rate might have a more complex size dependence than previous thought, leading to a curved family boundary in a vs 1/D space. The V-shape tool is capable of detecting this on synthetic families and was deployed on >30 families located throughout the MB to find this effect and quantify the YE size-dependent drift rate. We find that there is no correlation between family age and V-shape curvature. In addition, the V-shape curvature decreases for asteroid families with larger a suggesting that the relationship between TI and D is weaker in the outer MB.By examining families <20 Myrs-old, we can use this tool to separate family shape that is due to the initial ejection velocity and that which is due to the YE drift rate. V-shapes which do not contain any spreading due to YE preserve their initial ejection velocity. We constrain the initial initial

"Thou" and "Ye" in Chaucer's "Clerk's Tale."

ERIC Educational Resources Information Center

Wilcockson, Colin

1980-01-01

Examines the use of the second person pronoun in Chaucer's "Clerk's Tale" to demonstrate that students of medieval texts may well miss important areas of meaning if they fail to give adequate attention to the historical study of language. (GT)

Operation Allied Force: The View from Beijing

DTIC Science & Technology

2000-01-01

should “learn and  master”  anti-air-raid,  anti-electronic-war- fare, and anti-information-control operations.19 Information Warfare Reporter Ye  Lu ...also wanted to see whether a strong stimu­ lus   could  provoke  internal  chaos  within China that would cause a change in China’s orientation.31...Ye  Lu ,  “Strategic  Thought  on  Weapons  Development,” Keji Ribao (Beijing), 20 May 1999, in FBIS-CHI-1999-0621; on-line, Internet, 3 July 1999

Thermal Design of Boiler Unit (Standard Method).

DTIC Science & Technology

1980-04-29

T-0411-80" h EhlllllEI mhEhhhhh m~lEElhElllllE Elhllllllhllll llllllllmllllu llllllllhllllu "’FTD-ID(RS)T-0411-80 FOREIGN TECHNOLOGY DIVISION THERMAL...Block italic Transliter. - - A a A, a P p p p R, r S B, b C C S B V, v T m , t r g Y y SD, d SE a Ye, ye; E, e* x X x Kh, , W Zc h , z h L 4 Ti , L...sh sn arc_4n 6 ch cosh arc or -. tar. th tanh arc t- Scot zth cct arc c’- h sec Sch sech arc sc- . - o-ec csc cscn cs ch aronc sc Russian Er.I n h rot

The Organization of Knowledge in a Multi-Lingual, Integrated Parser.

DTIC Science & Technology

1984-11-01

presunto S maniatico sexual quo dio muerte a golpes y a punalades a una mujer do 55 anos, informiron fuentes illegadas a Is investigacion. Literally in...el hospital la joven Rosa Areas, la que fue herida de bala por un uniformado. English: Rosa Areas is still in the hospital after being shot and wounded...by a soldier. In this sentence, the subject, " joven " (young person), is found after the verb, "se encuentra" (finds herself). To handle situations

LQG/LTR Optimal Attitude Control of Small Flexible Spacecraft Using Free-Free Boundary Conditions

DTIC Science & Technology

2006-08-03

particular on attitude control of flex- ible space structures. Croopnick et al .[50] present a literature survey in the areas of attitude control...modeling and control of space structures is compiled by Nurre et al .[161]. One important thing to note from the surveys listed above is the 21 focus on the...papers surveyed by Croopnick et al . in 1979, by Meirovitch in 1979, Balas in 1982, and Nurre et al . in 1984. The focus of the papers included in all

Dynamical mass ejection from the merger of asymmetric binary neutron stars: Radiation-hydrodynamics study in general relativity

NASA Astrophysics Data System (ADS)

Sekiguchi, Yuichiro; Kiuchi, Kenta; Kyutoku, Koutarou; Shibata, Masaru; Taniguchi, Keisuke

2016-06-01

We perform neutrino radiation-hydrodynamics simulations for the merger of asymmetric binary neutron stars in numerical relativity. Neutron stars are modeled by soft and moderately stiff finite-temperature equations of state (EOS). We find that the properties of the dynamical ejecta such as the total mass, neutron richness profile, and specific entropy profile depend on the mass ratio of the binary systems for a given EOS in a unique manner. For a soft EOS (SFHo), the total ejecta mass depends weakly on the mass ratio, but the average of electron number per baryon (Ye ) and specific entropy (s ) of the ejecta decreases significantly with the increase of the degree of mass asymmetry. For a stiff EOS (DD2), with the increase of the mass asymmetry degree, the total ejecta mass significantly increases while the average of Ye and s moderately decreases. We find again that only for the SFHo, the total ejecta mass exceeds 0.01 M⊙ irrespective of the mass ratio chosen in this paper. The ejecta have a variety of electron number per baryon with an average approximately between Ye˜0.2 and ˜0.3 irrespective of the EOS employed, which is well suited for the production of the rapid neutron capture process heavy elements (second and third peaks), although its averaged value decreases with the increase of the degree of mass asymmetry.

Responses of eastern Chinese coastal salt marshes to sea-level rise combined with vegetative and sedimentary processes.

PubMed

Ge, Zhen-Ming; Wang, Heng; Cao, Hao-Bin; Zhao, Bin; Zhou, Xiao; Peltola, Heli; Cui, Li-Fang; Li, Xiu-Zhen; Zhang, Li-Quan

2016-06-23

The impacts of sea-level rise (SLR) on coastal ecosystems have attracted worldwide attention in relation to global change. In this study, the salt marsh model for the Yangtze Estuary (SMM-YE, developed in China) and the Sea Level Affecting Marshes Model (SLAMM, developed in the U.S.) were used to simulate the effects of SLR on the coastal salt marshes in eastern China. The changes in the dominant species in the plant community were also considered. Predictions based on the SLAMM indicated a trend of habitat degradation up to 2100; total salt marsh habitat area continued to decline (4-16%) based on the low-level scenario, with greater losses (6-25%) predicted under the high-level scenario. The SMM-YE showed that the salt marshes could be resilient to threats of SLR through the processes of accretion of mudflats, vegetation expansion and sediment trapping by plants. This model predicted that salt marsh areas increased (3-6%) under the low-level scenario. The decrease in the total habitat area with the SMM-YE under the high-level scenario was much lower than the SLAMM prediction. Nevertheless, SLR might negatively affect the salt marsh species that are not adapted to prolonged inundation. An adaptive strategy for responding to changes in sediment resources is necessary in the Yangtze Estuary.

Responses of eastern Chinese coastal salt marshes to sea-level rise combined with vegetative and sedimentary processes

NASA Astrophysics Data System (ADS)

Ge, Zhen-Ming; Wang, Heng; Cao, Hao-Bin; Zhao, Bin; Zhou, Xiao; Peltola, Heli; Cui, Li-Fang; Li, Xiu-Zhen; Zhang, Li-Quan

2016-06-01

The impacts of sea-level rise (SLR) on coastal ecosystems have attracted worldwide attention in relation to global change. In this study, the salt marsh model for the Yangtze Estuary (SMM-YE, developed in China) and the Sea Level Affecting Marshes Model (SLAMM, developed in the U.S.) were used to simulate the effects of SLR on the coastal salt marshes in eastern China. The changes in the dominant species in the plant community were also considered. Predictions based on the SLAMM indicated a trend of habitat degradation up to 2100; total salt marsh habitat area continued to decline (4-16%) based on the low-level scenario, with greater losses (6-25%) predicted under the high-level scenario. The SMM-YE showed that the salt marshes could be resilient to threats of SLR through the processes of accretion of mudflats, vegetation expansion and sediment trapping by plants. This model predicted that salt marsh areas increased (3-6%) under the low-level scenario. The decrease in the total habitat area with the SMM-YE under the high-level scenario was much lower than the SLAMM prediction. Nevertheless, SLR might negatively affect the salt marsh species that are not adapted to prolonged inundation. An adaptive strategy for responding to changes in sediment resources is necessary in the Yangtze Estuary.

Elicitation of Jerusalem artichoke (Helianthus tuberosus L.) cell suspension culture for enhancement of inulin production and altered degree of polymerisation.

PubMed

Ma, Chunquan; Zhou, Dong; Wang, Haitao; Han, Dongming; Wang, Yang; Yan, Xiufeng

2017-01-01

Plant cell suspension cultures have emerged as a potential source of secondary metabolites for food additives and pharmaceuticals. In this study inulin accumulation and its degree of polymerisation (DP) in the treated cells in the same medium were investigated after treatment with six types of elicitors. An in vitro cell suspension culture of Jerusalem artichoke (Helianthus tuberosus L.) was optimised by adding an extra nitrogen source. According to the growth kinetics, a maximum biomass of 5.48 g L -1 was obtained from the optimal cell suspension medium consisted of Murashige and Skoog basic medium (MS) + 1.0 mg L -1 α-naphthalene acetic acid (NAA) + 1.0 mg L -1 6-benzylaminopurine (6-BA) + 0.5 mg L -1 proline + 1.0 mg L -1 glutamine. Methyl jasmonate (MeJA, 250 µmol L -1 ) treatment for 15 days led to the highest levels of inulin (2955.27 ± 9.81 mg L -1 compared to control of 1217.46 ± 0.26 mg L -1 ). The elicited effect of five elicitors to the suspension cells of Jerusalem artichoke is as follows: AgNO 3 (Ag, 10 µmol L -1 ), salicylic acid (SA, 75 µmol L -1 ), chitosan (KJT, 40 mg L -1 ), Trichoderma viride (Tv, 90 mg L -1 ), yeast extract (YE, 0.25 mg L -1 ), and the corresponding content of inulin is increased by 2.05-, 1.93-, 1.76-, 1.44- and 1.18-fold compared to control, respectively. The obvious effect on the percentage of lower DP in inulin was observed in cells treated with 40 mg L -1 KJT, 0.25 mg L -1 YE and 10 µmol L -1 Ag. Among the six types of elicitors, the descending order of inulin content is MeJA > Ag > SA > KJT > Tv > YE. For the purpose inulin with lower DP and its application to prebiotic food, three elicitors, including KJT, YE and Ag, can be used for the elicitation. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Genetics Home Reference: microphthalmia

MedlinePlus

... CR, Ye M, Garcha K, Bigot K, Perera AG, Staehling-Hampton K, Mema SC, Chanda B, Mushegian ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

RDM Lifetime measurements in ^191Hg using the Gammasphere Plunger

NASA Astrophysics Data System (ADS)

Jin, H.; Kharraja, B.; Garg, U.; Ghugre, S. S.; Carpenter, M. P.; Fischer, S.; Janssens, R. V. F.; Khoo, T. L.; Lauritsen, T.; Nisius, D.; Kaczarowski, R.; Govil, I. M.; Kruecken, R.; Machiavelli, A.; MacLeod, R.

1998-10-01

Recoil Distance Lifetime Measurements have been performed for the nucleus ^191Hg at Gammasphere with a view to further investigate the prolate non-collective structure (ɛ2 = 0.1 - 0.15, γ ~= - 120^circ) reported several years ago by D. Ye et al. (D. Ye et al.,) Phys. Lett. B236, 7 (1990) The ^174Yb(^22Ne, 5n) reaction was employed at a beam energy of 120 MeV. In this experiment the new Gammasphere Plunger was used for the first time. Data were collected at 7 distances ranging from 50 μm to 1070 μm. The extracted lifetimes for the level sequence of interest are in the range of ~ 7 ps to 120 ps, leading to transition probabilities that indeed correspond to a non-collective nature.

Structure of a pectin methylesterase from Yersinia enterocolitica.

PubMed

Boraston, Alisdair B; Abbott, D Wade

2012-02-01

Pectin methylesterases (PMEs) are family 8 carbohydrate esterases (CE8s) which remove the methyl group from methylesterified galacturonic acid (GalA) residues within pectin. Although the role of pectinases such as PMEs within dedicated phytopathogens has been well established, the significance of homologous enzymes found within the genomes of human enteropathogens remains to be determined. Presented here is the low-resolution (3.5 Å) structure of the CE8 from Yersinia enterocolitica (YeCE8). The high degree of structural conservation in the topology of the active-site cleft and catalytic apparatus that is shared with a characterized PME from a bacterial phytopathogen (i) indicates that YeCE8 is active on methylated pectin and (ii) highlights a more prominent role for pectin utilization in Yersinia than in other enteropathogenic species.

Unified planning work program federal fiscal year 2008

DOT National Transportation Integrated Search

2008-01-01

This Unified Planning Work Program (UPWP) contains information about surface-transportation planning projects that will be conducted in the Boston metropolitan region during the period of October 1, 2007, through September 30, 2008 (federal fiscal ye...

Mars Target Encyclopedia: Information Extraction for Planetary Science

NASA Astrophysics Data System (ADS)

Wagstaff, K. L.; Francis, R.; Gowda, T.; Lu, Y.; Riloff, E.; Singh, K.

2017-06-01

Mars surface targets / and published compositions / Seek and ye will find. We used text mining methods to extract information from LPSC abstracts about the composition of Mars surface targets. Users can search by element, mineral, or target.

Financial management : Federal Aviation Administration lacked accountability for major assets

DOT National Transportation Integrated Search

1998-02-18

This short report is in response to a request by the Congress that the General : Accounting Office (GAO) analyze the Department of Transportation (DOT) Inspector : General's (IG) audit report on the Federal Aviation Administration's (FAA) : fiscal ye...

In-situ early-age hydration study of sulfobelite cements by synchrotron powder diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Álvarez-Pinazo, G.; Cuesta, A.; García-Maté, M.

Eco-friendly belite calcium sulfoaluminate (BCSA) cement hydration behavior is not yet well understood. Here, we report an in-situ synchrotron X-ray powder diffraction study for the first hours of hydration of BCSA cements. Rietveld quantitative phase analysis has been used to establish the degree of reaction (α). The hydration of a mixture of ye'elimite and gypsum revealed that ettringite formation (α ∼ 70% at 50 h) is limited by ye'elimite dissolution. Two laboratory-prepared BCSA cements were also studied: non-active-BCSA and active-BCSA cements, with β- and α′{sub H}-belite as main phases, respectively. Ye'elimite, in the non-active-BCSA system, dissolves at higher pace (αmore » ∼ 25% at 1 h) than in the active-BCSA one (α ∼ 10% at 1 h), with differences in the crystallization of ettringite (α ∼ 30% and α ∼ 5%, respectively). This behavior has strongly affected subsequent belite and ferrite reactivities, yielding stratlingite and other layered phases in non-active-BCSA. The dissolution and crystallization processes are reported and discussed in detail. -- Highlights: •Belite calcium sulfoaluminate cements early hydration mechanism has been determined. •Belite hydration strongly depends on availability of aluminum hydroxide. •Orthorhombic ye’elimite dissolved at a higher pace than cubic one. •Ye’elimite larger reaction degree yields stratlingite formation by belite reaction. •Rietveld method quantified gypsum, anhydrite and bassanite dissolution rates.« less

Proceedings of the Symposium on Air Force Applications of Modern Control Theory Held at Air Force Institute of Technology, Wright-Patterson Air Force Base, Ohio on 9-11 July 1974

DTIC Science & Technology

1974-07-01

vfimummIIW . jnww i ■ i mBi ■ ■ i ii *r’ "" ’ wmrm\\ nWMP’V^^W’ AD/A-003 387 PROCEEDINGS OF THE SYMPOSIUM ON AIR FORCE APPLICATIONS OF...unguided rockets (after burnout ) are all ballistic projectiles. Guided weapons and weapons developing lift are not ballistic projectiles. ■■^■Mtfü^dMH...p.vxr. SCINTUXATICN CYRO DRIFT ACCtlXRftCTE* r.UrT AKGI.E hCASL’ivr.Mr! T SCALE FACTOr. CTi-i-O >’.’> SS UTlBALA-NXt. CTRO AMISOF-LASTICin

Structure of a pectin methylesterase from Yersinia enterocolitica

PubMed Central

Boraston, Alisdair B.; Abbott, D. Wade

2012-01-01

Pectin methylesterases (PMEs) are family 8 carbohydrate esterases (CE8s) which remove the methyl group from methylesterified galacturonic acid (GalA) residues within pectin. Although the role of pectinases such as PMEs within dedicated phytopathogens has been well established, the significance of homologous enzymes found within the genomes of human enteropathogens remains to be determined. Presented here is the low-resolution (3.5 Å) structure of the CE8 from Yersinia enterocolitica (YeCE8). The high degree of structural conservation in the topology of the active-site cleft and catalytic apparatus that is shared with a characterized PME from a bacterial phytopathogen (i) indicates that YeCE8 is active on methylated pectin and (ii) highlights a more prominent role for pectin utilization in Yersinia than in other enteropathogenic species. PMID:22297983

FY 72 Computer Utilization at the Transportation Systems Center

DOT National Transportation Integrated Search

1972-08-01

The Transportation Systems Center currently employs a medley of on-site and off-site computer systems to obtain the computational support it requires. Examination of the monthly User Accountability Reports for FY72 indicated that during the fiscal ye...

Trace-element and Sr, Nd, Pb, and O isotopic composition of Pliocene and Quaternary alkali basalts of the Patagonian Plateau lavas of southernmost South America

USGS Publications Warehouse

Stern, C.R.; Frey, F.A.; Futa, K.; Zartman, R.E.; Peng, Z.; Kurtis, Kyser T.

1990-01-01

The Pliocene and Quaternary Patagonian alkali basalts of southernmost South America can be divided into two groups. The "cratonic" basalts erupted in areas of Cenozoic plateau volcanism and continental sedimentation and show considerable variation in 87Sr/86Sr (0.70316 to 0.70512), 143Nd/144Nd (e{open}Nd) and 206Pb/204Pb, 207Pb/204Pb, and 208Pb/204Pb ratios (18.26 to 19.38, 15.53 to 15.68, and 38.30 to 39.23, respectively). These isotopic values are within the range of oceanic island basalts, as are the Ba/La, Ba/Nb, La/Nb, K/Rb, and Cs/Rb ratios of the "cratonic" basalts. In contrast, the "transitional" basalts, erupted along the western edge of the outcrop belt of the Pliocene and Quaternary plateau lavas in areas that were the locus of earlier Cenozoic Andean orogenic arc colcanism, have a much more restricted range of isotopic composition which can be approximated by 87Sr/86Sr=0.7039??0.0004, e{open}Nd, 206Pb/204Pb=18.60??0.08, 207Pb/204Pb=15.60??0.01, and 208Pb/204Pb=38.50??0.10. These isotopic values are similar to those of Andean orogenic are basalts and, compared to the "cratonic" basalts, are displaced to higher 87Sr/86Sr at a given 143Nd/144Nd and to higher 207Pb/204Pb at a given 208Pb/204Pb. The "transitional" basalts also have Ba/La, Ba/Nb, La/Nb, and Cs/Rb ratios higher than the "cratonic" and oceanic island basalts, although not as high as Andean orogenic are basalts. In contrast to the radiogenic isotopes, ??18O values for both groups of the Patagonian alkali basalts are indistinguishable and are more restricted than the range reported for Andean orogenic are basalts. Whole rock ??18O values calculated from mineral separates for both groups range from 5.3 to 6.5, while measured whole rock ??18O values range from 5.1 to 7.8. The trace element and isotopic data suggest that decreasing degrees of partial melting in association with lessened significance of subducted slabderived components are fundamental factors in the west to east transition from arc

National Hydroclimatic Change and Infrastructure Adaptation Assessment: Region-Specific Adaptation Factors

EPA Science Inventory

Climate change, land use and socioeconomic developments are principal variables that define the need and scope of adaptive engineering and management to sustain water resource and infrastructure development. As described in IPCC (2007), hydroclimatic changes in the next 30-50 ye...

Dynamic flashing yellow arrow (FYA) : a study on variable left turn mode operational and safety impacts.

DOT National Transportation Integrated Search

2013-12-01

Accommodating left turns at signalized intersections has been a challenge for traffic engineers as they : seek balance between two conflicting goals; capacity and safety. The use of a four-section head for the left-turn : lane only with a flashing ye...

As Ye Sow, So Shall Ye Reap: From Consultant to Collaborator in the Development of a Teacher Preparation Program in Lesotho.

ERIC Educational Resources Information Center

Rothenberg, Julia Johnson

This paper reports on the author's 4-week consultation with faculty of the Lesotho National Teachers College as part of the Primary Education Project which provided technical assistance with issues of primary age schooling in the Kingdom of Lesotho. The consultant worked with 12 faculty members of the National Teachers College in a process that…

Light element production in the big bang and the synthesis of heavy elements in 3D MHD jets from core-collapse supernovae

NASA Astrophysics Data System (ADS)

Winteler, Christian

2014-02-01

In this dissertation we present the main features of a new nuclear reaction network evolution code. This new code allows nucleosynthesis calculations for large numbers of nuclides. The main results in this dissertation are all obtained using this new code. The strength of standard big bang nucleosynthesis is, that all primordial abundances are determined by only one free parameter, the baryon-to-photon ratio η. We perform self consistent nucleosynthesis calculations for the latest WMAP value η = (6.16±0.15)×10^-10 . We predict primordial light element abundances: D/H = (2.84 ± 0.23)×10^-5, 3He/H = (1.07 ± 0.09)×10^-5, Yp = 0.2490±0.0005 and 7Li/H = (4.57 ± 0.55)×10^-10, in agreement with current observations and other predictions. We investigate the influence of the main production rate on the 6 Li abundance, but find no significant increase of the predicted value, which is known to be orders of magnitude lower than the observed. The r-process is responsible for the formation of about half of the elements heavier than iron in our solar system. This neutron capture process requires explosive environments with large neutron densities. The exact astrophysical site where the r-process occurs has not yet been identified. We explore jets from magnetorotational core collapse supernovae (MHD jets) as possible r-process site. In a parametric study, assuming adiabatic expansion, we find good agreement with solar system abundances for a superposition of components with different electron fraction (Ye ), ranging from Ye = 0.1 to Ye = 0.3. Fission is found to be important only for Ye ≤ 0.17. The first postprocessing calculations with data from 3D MHD core collapse supernova simulations are performed for two different simulations. Calculations are based on two different methods to extract data from the simulation: tracer particles and a two dimensional, mass weighted histogram. Both results yield almost identical results. We find that both simulations can

Pedestrian accidents : a state-of-the-art 1970-1980

DOT National Transportation Integrated Search

1981-09-01

In 1979 in the United States, 8,090 pedestrians were killed in motor vehicle accidents out of a total of 51,093 total traffic fatalities. An estimated total of 150,000 police reported pedestrian accidents of all severities occurred during the same ye...

Summary of nighttime belt use studies

DOT National Transportation Integrated Search

2007-05-01

Despite gains in the daytime national seat belt rate over the past few years, reaching 81 percent in 2006 (Glassbrenner and Ye, 2007), the number of fatalities has remained basically unchanged. One reason for this may be that many fatalities occur at...

Targeting Environmental Quality to Improve Population Health and Lower Healthcare Costs

EPA Science Inventory

Key goals of health care reform are to stimulate innovative approaches to improve healthcare quality and clinical outcomes while holding down costs. To achieve these goals value-based payment places the needs of the patient first and encourages multi-stakeholder cooperation. Ye...

Differentiation of Yersinia enterocolitica biotype 1A from pathogenic Yersinia enterocolitica biotypes by detection of β-glucosidase activity: comparison of two chromogenic culture media and Vitek2.

PubMed

Karhukorpi, Jari; Päivänurmi, Marjut

2014-01-01

Aesculin hydrolysis (ESC) is one of the key reactions in differentiating pathogenic Yersinia enterocolitica biotypes 1B, 2, 3, 4 and 5 from the less-pathogenic biotype 1A. Because the ESC reaction is caused by β-glucosidase (βGLU) activity of the bacteria, we studied whether two commonly used methods (BBL CHROMagar Orientation and Vitek2 Gram-negative identification card) could be used in assessing βGLU activity of 74 Yersinia strains. Both methods were sensitive (100 % and 97 %) and specific (100 % and 100 %) in differentiating βGLU-positive YE BT1A from βGLU-negative Y. enterocolitica biotypes. For a subset of strains (n = 69), a new selective CHROMagar Yersinia showed excellent agreement with the strains' βGLU activity. Thus all the methods evaluated in this study may be used to differentiate between YE BT1A and other Y. enterocolitica biotypes.

Effects of gamma irradiation on the survival of Listeria monocytogenes and on its growth at refrigeration temperature in poultry and red meat.

PubMed

Gürsel, B; Gürakan, G C

1997-12-01

Gamma irradiation sensitivity of a strain of Listeria monocytogenes was determined in trypticase soy broth supplemented with yeast extract (TSB-YE), in a slurry of chicken breast meat and in raw ground beef. D10 values in these different media were 0.364, 0.599, and 0.699 kGy, respectively. This organism appeared most sensitive in TSB-YE, more resistant in minced fresh chicken breast meat, and most resistant in fresh minced beef. It was found that irradiation at 2.5 kGy prior to refrigeration is an efficient way for the preservation of meat products contaminated at 10(3) to 10(4) per gram initial load of L. monocytogenes for about 7 d. However, with this initial load, the injured cells might repair themselves and cause a health hazard during storage at 4 C in the presence of air after 7 d.

Fibre fortification of wheat bread: impact on mineral composition and bioaccessibility.

PubMed

Martins, Zita E; Pinto, Edgar; Almeida, Agostinho A; Pinho, Olívia; Ferreira, Isabel M P L V O

2017-05-24

In this work, wheat bread was fortified with fibre enriched extracts recovered from agroindustry by-products, namely, elderberry skin, pulp and seeds (EE); orange peel (OE); pomegranate peel and interior membranes (PE); and spent yeast (YE). The impact of this fortification on the total and bioaccessible mineral composition of wheat breads, estimated mineral daily intake, and the relationship between bioaccessibility and dietary fibre was evaluated. Fortification with OE, EE, and PE improved the content of essential minerals in bread when compared to control bread. The exception was bread fortified with YE, which presented a mineral content similar to control bread, but its mineral bioaccessibility was significantly higher than in all the other bread formulations. The opposite was observed for PE bread, which presented a significant reduction of bioaccessible minerals. We concluded that the origin of the fibre rich extract must be carefully selected, to avoid potential negative impact on mineral bioaccessibility.

Identification of odor volatile compounds and deodorization of Paphia undulata enzymatic hydrolysate

NASA Astrophysics Data System (ADS)

Chen, Deke; Chen, Xin; Chen, Hua; Cai, Bingna; Wan, Peng; Zhu, Xiaolian; Sun, Han; Sun, Huili; Pan, Jianyu

2016-12-01

Unfavorable fishy odour is an inevitable problem in aquatic products. In the present study, headspace solid-phase microextraction gas chromatography mass spectrometry (HS-SPME-GC-MS) analysis of volatiles from untreated samples and three deodorized samples (under the optimal conditions) of Paphia undulata enzymatic hydrolysate revealed that the compounds contributing to the distinctive odor were 1-octen-3-ol, n-hexanal, n-heptanal, 2,4-heptadienal, and 2,4-decadienal, whereas n-pentanal, n-octanal, n-octanol, benzaldehyde, 2-ethylfuran and 2-pentylfuran were the main contributors to the aromatic flavor. The deodorizing effects of activated carbon (AC) adsorption, yeast extract (YE) masking and tea polyphenol (TP) treatment on a P. undulata enzymatic hydrolysate were investigated using orthogonal experiments with sensory evaluation as the index. The following optimized deodorization conditions were obtained: AC adsorption (35 mg mL-1, 80°C, 40 min), YE masking (7 mg mL-1, 45°C, 30 min) and TP treatment (0.4 mg mL-1, 40°C, 50 min). AC adsorption effectively removed off-flavor volatile aldehydes and ketones. YE masking modified the odor profile by increasing the relative contents of aromatic compounds and decreasing the relative contents of aldehydes and ketones. The TP treatment was not effective in reducing the odor score, but it significantly reduced the relative content of aldehydes while increasing that of alkanes. It is also notable that TP effectively suppressed trimethylamine (TMA) formation in a P. undulate hydrolysate solution for a period of 72 h.

The Telegraph and the Control of Material Movements: A Micro-Study about the Detachment of Communication from Transport.

PubMed

Wenzlhuemer, Roland

Relatively recent historiographical approaches such as global or transnational history have attracted new attention to telegraphy and its role in processes of globalization. This renewed interest in submarine cables and overland wires has recently provided us with a reasonably good idea of how the global telegraph network developed in the nineteenth century, who its principal designers were, and where it was more and where it was less tight. Little, however, has been said so far about the actual matters communicated telegraphically, certainly not in any systematic fashion. Apart from individual telegraphic messages that gained prominence in political or military history, the contents of telegrams have attracted little historiographical attention. What was conveyed in telegrams has not been interrogated as to its significance in globalization processes. This article seeks to make a first step in this direction and suggests that only in a content analysis of everyday telegrams do the most important qualities of telegraphy become apparent. It introduces a small but coherent corpus of telegrams-the Bala railway telegrams-that provides us with a rare opportunity to study the contents of telegraphic messages in a systematic form. In the course of the analysis of the Bala railway telegrams the importance of this device's power to coordinate and control movement begins to show. By relating evidence from this micro-level study to the contexts in which telegraphy was employed on a larger scale, the article suggests that this capacity for coordination and control was the principal new quality introduced by the technology.

STUDIES ON ADSORPTION OF 2-CHLORO BIPHENYL ON SEDIMENTS AND SEDIMENT COMPONENTS

EPA Science Inventory

Polychlorinated biphenyls, or PCBs, are a family of 209 structurally related chemical compounds (congeners), consisting of two benzene rings and 1 to 10 chlorine atoms. They range from light, oily fluids to heavier, greasy or waxy substances. PCBs were discovered more than 100 ye...

Hot mix asphalt tender zone

DOT National Transportation Integrated Search

2000-04-01

Approximately 500 million tons of hot mix asphalt (HMA) are placed in the United States each year. With this large quantity of HMA, it is expected that some construction problems will occur from time to time. One problem that has been observed for ye...

Yeast probiotic supplementation mitigates some of the negative effects of heat stress in feedlot heifers

USDA-ARS?s Scientific Manuscript database

Heat stress (HS) in feedlot cattle can be detrimental to performance, health and profitability; however, utilization of feed additives has the potential to mitigate some of these negative effects. Therefore, this study was designed to determine if supplementation of a combination live yeast and ye...

2003 traffic crash facts annual report

DOT National Transportation Integrated Search

2003-01-01

In 2003, the death rate on Nebraska roadways was 1.6 persons killed per : 100 million vehicle miles traveled. The death rate in Nebraska, from 1961 : to 2003 is represented in Figure 1 (Page 2). Even though the death rate : fluctuates from year to ye...

Yeasts as distinct life forms of fungi

USDA-ARS?s Scientific Manuscript database

This review describes all presently recognized genera of the Ascomycete yeasts (Saccharomycotina, budding yeasts, and the Taphrinomycotina, fission yeasts and related) as well as all currently recognized genera of the Basidiomycete yeasts. This update will be the lead chapter for a book entitled “Ye...

2001 traffic crash facts annual report

DOT National Transportation Integrated Search

2001-01-01

In 2001, the death rate on Nebraska roadways was 1.6 persons killed per : 100 million vehicle miles traveled. The death rate in Nebraska, from 1961 to : 2001 is represented in Figure 1 (Page 2). Even though the death rate fluctuates : from year to ye...

Area-Wide Management of the Formosan subterranean termite, Coptotermes formosanus, Shiraki (Isoptera: Rhinotermitidae) in the New Orleans French Quarter

USDA-ARS?s Scientific Manuscript database

The Formosan subterranean termite, Coptotermes formosanus Shiraki (FST) was first introduced to the continental US after WWII. New Orleans’ French Quarter (FQ) in particular has been severely impacted experiencing reoccurring cycles of damages and repairs since FST was introduced to the region 65 ye...

Undegassed Carbon Content from a Highly Depleted Segment of the Mid-Atlantic Ridge (1-5°S): Evidence from Melt Inclusions

NASA Astrophysics Data System (ADS)

Le Voyer, M.; Kelley, K. A.; Cottrell, E.; Hauri, E. H.

2014-12-01

As carbon solubility is low in basalts, MORB contain little dissolved CO2 (189±61 ppm, 1σ, n=600 [1]). A global negative correlation between CO2/Nb (proxy for amount of CO2 lost by degassing) and Ba/La (proxy for source enrichment) indicates that depleted MORB are less affected by degassing than enriched MORB: CO2/Nb ratios range from 0-100 for samples with Ba/La>4, while CO2/Nb range from 50 to 400 for samples with Ba/La<4 [1]. To assess the CO2 content of undegassed MORB, we analyzed the volatile content of 70 olivine-hosted, glassy melt inclusions (MIs) from four basalts dredged along MAR 1-5°S, a ridge segment that produces highly depleted MORB in terms of trace element enrichment and radiogenic isotopes [2, 3]. MIs contain CO2 contents (180-1420 ppm) that are higher than their respective matrix glasses (130-220 ppm, typical for vapor-saturated melts erupted at 3-5 km b.s.l.). One of the four dredges (EN061 5D-3Ag) contains MIs that do not exhibit shrinkage bubbles. For this sample only, we find a positive correlation between the CO2 content (240-770 ppm) and the Cl content (6-20 ppm) of the MIs that is not found in the matrix glasses (see Fig.). We infer that the correlation between CO2 and Cl, both highly incompatible in silicate minerals during fractional crystallization, is strong evidence for vapor-undersaturation, as any CO2 degassing would have erased the correlation. Together with MIs from the Siqueiros Fracture Zone [4] and from northern Iceland [5], the MIs from EN061 5D-3Ag may represent another occurrence of carbon-undersaturated MORB. Our results will be used to model the primary carbon content of MORB and of the depleted upper mantle. Note that the average Cl content of the matrix glasses (20±1 ppm) is higher than those of the MIs (12±3 ppm, see Fig.). This indicates either that the matrix glasses assimilated a small amount of seawater Cl, or that the MIs are all more depleted than the matrix glass. We will acquire major and trace element

A Focus into the Charity "Young Enterprise Northern Ireland" and How Effective Their "Company Programme" Is at Increasing "Life Skills" in Young People

ERIC Educational Resources Information Center

McVeigh, Francis

2014-01-01

Purpose - This research project has investigated the "Company Programme" of the charity YE and how effective it is at increasing Life Skills in young people. Data has been obtained using student questionnaires and teacher interviews. Previous studies have been completed on "Life Skills" and "Enterprise Programmes",…

An Investigation Into the Feasibility of Establishing Manpower Standards for Major Air Command Engineering and Services Organizations.

DTIC Science & Technology

1984-09-01

time ;oent ikontcorvng, enforcing. and rs,) lving *Lfitculties ind discrepancies inouLd ilso ye Lncluded. time 131 5. 9required to houdjet or:74rias...OH: Grid Publishers, 1979. 21. McNichols, Charles W. An Introduction to Applied Mltivariate Data Analysis, Unpublished Notes. Air Force Institute of

Study of Chlamydia trachomatis in Military Women; Prevalence, Risk Factors, and a Cost Benefit Analysis of Early Diagnosis and Treatment

DTIC Science & Technology

1998-09-01

lymphogranuloma venereum (LGV). .?.■ Methods: One hundred and ninety seven consecutive men with a clinical presentation coasUtent with IJGV were...REACTION FOR THE DIAGNOSIS OF \\J 1 / Z> LYMPIIOGRANULOMA VENEREUM IN SOUTHERN AFRICA. Radebc F. Fehler HG, Ye Hrun. Tshabalala V, Ballard RC j V

Mustard seed meal for management of root-knot nematode and weeds in tomato production

USDA-ARS?s Scientific Manuscript database

Mustard seed meals of indian mustard [InM (Brassica juncea)] and yellow mustard [YeM (Sinapis alba)], alone and combined, were tested for effects on tomato (Solanum lycopersicum) plants and for suppression of southern root-knot nematode [RKN (Meloidogyne incognita)] and weed populations. In the gree...

How Can Service-Learning Prepare Students for the Workforce? Exploring the Potential of Positive Psychological Capital

ERIC Educational Resources Information Center

McElravy, L. J.; Matkin, Gina; Hastings, Lindsay J.

2018-01-01

Although service-learning increases several important development and learning outcomes in college students (Yorio & Ye, 2012), it is not clear whether service-learning is better preparing these students for their future careers (Gray, Ondaatje, Fricker, & Geschwind, 2000). To better understand the influence of service-learning on student…

Genetic diversity and paternal origin of domestic donkeys.

PubMed

Han, H; Chen, N; Jordana, J; Li, C; Sun, T; Xia, X; Zhao, X; Ji, C; Shen, S; Yu, J; Ainhoa, F; Chen, H; Lei, C; Dang, R

2017-12-01

Numerous studies have been conducted to investigate genetic diversity, origins and domestication of donkey using autosomal microsatellites and the mitochondrial genome, whereas the male-specific region of the Y chromosome of modern donkeys is largely uncharacterized. In the current study, 14 published equine Y chromosome-specific microsatellites (Y-STR) were investigated in 395 male donkey samples from China, Egypt, Spain and Peru using fluorescent labeled microsatellite markers. The results showed that seven Y-STRs-EcaYP9, EcaYM2, EcaYE2, EcaYE3, EcaYNO1, EcaYNO2 and EcaYNO4-were male specific and polymorphic, showing two to eight alleles in the donkeys studied. A total of 21 haplotypes corresponding to three haplogroups were identified, indicating three independent patrilines in domestic donkey. These markers are useful for the study the Y-chromosome diversity and population genetics of donkeys in Africa, Europe, South America and China. © 2017 Stichting International Foundation for Animal Genetics.

Effect of Sediment Gas Voids and Ebullition on Benthic Solute Exchange.

PubMed

Flury, Sabine; Glud, Ronnie N; Premke, Katrin; McGinnis, Daniel F

2015-09-01

The presence of free gas in sediments and ebullition events can enhance the pore water transport and solute exchange across the sediment-water interface. However, we experimentally and theoretically document that the presence of free gas in sediments can counteract this enhancement effect. The apparent diffusivities (Da) of Rhodamine WT and bromide in sediments containing 8-18% gas (Da,YE) were suppressed by 7-39% compared to the control (no gas) sediments (Da,C). The measured ratios of Da,YE:Da,C were well within the range of ratios predicted by a theoretical soil model for gas-bearing soils. Whereas gas voids in sediments reduce the Da for soluble species, they represent a shortcut for low-soluble species such as methane and oxygen. Therefore, the presence of even minor amounts of gas can increase the fluxes of low-soluble species (i.e., gases) by several factors, while simultaneously suppressing fluxes of dissolved species.

Integrated Surveillance for the Next Generation Air Transportation System. Final Report of the Integrated Surveillance Study Team

DTIC Science & Technology

2008-10-31

Navigation Services Working Group Jan de Regt FAA Tony Richardson JPDO Technical Support James Roberts DoD AFFSA Eric Rolfe JPDO Air Navigation...Kirsch DHS Drew Kuepper DoD eragency Architecture and Engineering Division Jay Merkle JPDO Int Paul Polski DHS ing GroupElizabeth Lynn ye JPDO Air

Pigmentation restored in mutant laboratory strain of the lady beetle Coleomegilla maculata through dietary supplementation

USDA-ARS?s Scientific Manuscript database

A laboratory colony of Coleomegilla maculata (DeGeer), ye, selected for a pigmentation deficiency, was restored to near wild type cuticle coloration by adding crushed heads and wings of the red colored parental strain to the diet. While the wings and other colored portions of the cuticle regained th...

Intensifying drought eliminates the expected benefits of elevated [CO2] for soybean

USDA-ARS?s Scientific Manuscript database

Stimulation of C3 crop yield by rising [CO2] is widely expected to counteract crop losses to greater drought this century. But these expectations come from sparse field trials that have been biased towards mesic growth conditions. This eight-year study used precipitation manipulations and year-to-ye...

USSR Report Engineering and Equipment.

DTIC Science & Technology

1987-05-04

Korenev , et al. ; ENERGETICHESKOYE STROITELSTVO, No 7, Jul 86) 33 Improving Fire Protection of Cables in Electric Power Plants (S.Ye. Korshunov...Russian No 7, Jul 86 pp 32-33 {Article by V.D. Likhachev, candidate of technical sciences, K.I. Korenev , candidate of technical sciences, K.I. Chikvaidze

Carbon dynamics and sequestration in urban turfgrass ecosystems

USDA-ARS?s Scientific Manuscript database

Urbanization is a global trend. Turfgrass covers 1.9% of land in the continental US. Here we review existing literature associated with carbon (C) pools, sequestration, and nitrous oxide emission of urban turfgrass ecosystems. Turfgrasses exhibit significant carbon sequestration (0.34–1.4 Mg ha-1 ye...

National outbreak of Yersinia enterocolitica infections in military and civilian populations associated with consumption of mixed salad, Norway, 2014

PubMed Central

MacDonald, Emily; Einöder-Moreno, Margot; Borgen, Katrine; Thorstensen Brandal, Lin; Diab, Lore; Fossli, Øivind; Guzman Herrador, Bernardo; Hassan, Ammar Ali; Johannessen, Gro S; Johansen, Eva Jeanette; Jørgensen Kimo, Roger; Lier, Tore; Paulsen, Bjørn Leif; Popescu, Rodica; Tokle Schytte, Charlotte; Sæbø Pettersen, Kristin; Vold, Line; Ørmen, Øyvind; Wester, Astrid Louise; Wiklund, Marit; Nygård, Karin

2016-01-01

In May 2014, a cluster of Yersinia enterocolitica (YE) O9 infections was reported from a military base in northern Norway. Concurrently, an increase in YE infections in civilians was observed in the Norwegian Surveillance System for Communicable Diseases. We investigated to ascertain the extent of the outbreak and identify the source in order to implement control measures. A case was defined as a person with laboratory-confirmed YE O9 infection with the outbreak multilocus variable-number tandem repeat analysis (MLVA)-profile (5-6-9-8-9-9). We conducted a case–control study in the military setting and calculated odds ratios (OR) using logistic regression. Traceback investigations were conducted to identify common suppliers and products in commercial kitchens frequented by cases. By 28 May, we identified 133 cases, of which 117 were linked to four military bases and 16 were civilians from geographically dispersed counties. Among foods consumed by cases, multivariable analysis pointed to mixed salad as a potential source of illness (OR 10.26; 95% confidence interval (CI): 0.85–123.57). The four military bases and cafeterias visited by 14/16 civilian cases received iceberg lettuce or radicchio rosso from the same supplier. Secondary transmission cannot be eliminated as a source of infection in the military camps. The most likely source of the outbreak was salad mix containing imported radicchio rosso, due to its long shelf life. This outbreak is a reminder that fresh produce should not be discounted as a vehicle in prolonged outbreaks and that improvements are still required in the production and processing of fresh salad products. PMID:27588690

National outbreak of Yersinia enterocolitica infections in military and civilian populations associated with consumption of mixed salad, Norway, 2014.

PubMed

MacDonald, Emily; Einöder-Moreno, Margot; Borgen, Katrine; Thorstensen Brandal, Lin; Diab, Lore; Fossli, Øivind; Guzman Herrador, Bernardo; Hassan, Ammar Ali; Johannessen, Gro S; Johansen, Eva Jeanette; Jørgensen Kimo, Roger; Lier, Tore; Paulsen, Bjørn Leif; Popescu, Rodica; Tokle Schytte, Charlotte; Sæbø Pettersen, Kristin; Vold, Line; Ørmen, Øyvind; Wester, Astrid Louise; Wiklund, Marit; Nygård, Karin

2016-08-25

In May 2014, a cluster of Yersinia enterocolitica (YE) O9 infections was reported from a military base in northern Norway. Concurrently, an increase in YE infections in civilians was observed in the Norwegian Surveillance System for Communicable Diseases. We investigated to ascertain the extent of the outbreak and identify the source in order to implement control measures. A case was defined as a person with laboratory-confirmed YE O9 infection with the outbreak multilocus variable-number tandem repeat analysis (MLVA)-profile (5-6-9-8-9-9). We conducted a case-control study in the military setting and calculated odds ratios (OR) using logistic regression. Traceback investigations were conducted to identify common suppliers and products in commercial kitchens frequented by cases. By 28 May, we identified 133 cases, of which 117 were linked to four military bases and 16 were civilians from geographically dispersed counties. Among foods consumed by cases, multivariable analysis pointed to mixed salad as a potential source of illness (OR 10.26; 95% confidence interval (CI): 0.85-123.57). The four military bases and cafeterias visited by 14/16 civilian cases received iceberg lettuce or radicchio rosso from the same supplier. Secondary transmission cannot be eliminated as a source of infection in the military camps. The most likely source of the outbreak was salad mix containing imported radicchio rosso, due to its long shelf life. This outbreak is a reminder that fresh produce should not be discounted as a vehicle in prolonged outbreaks and that improvements are still required in the production and processing of fresh salad products. This article is copyright of The Authors, 2016.

A study of in-situ sediment flocculation in the turbidity maxima of the Yangtze Estuary

NASA Astrophysics Data System (ADS)

Guo, Chao; He, Qing; Guo, Leicheng; Winterwerp, Johan C.

2017-05-01

In order to improve our understandings of temporal and vertical variations of sediment flocculation dynamics within the turbidity maxima (TM) of the highly turbid Yangtze Estuary (YE), we deployed LISST-100C, a laser instrument for in-situ monitor of the sizes and concentrations of flocculated particles in a wet season. Field data in terms of vertical profiles of flow velocity, suspended sediment concentration (SSC), salinity, flocculated particle size distribution and volume concentration were obtained, based on field works conducted at consecutive spring, moderate, and neap tides. Data analyses show that the mean floc diameters (DM) were in the range of 14-95 μm, and flocculation exhibited strong temporal and vertical variations within a tidal cycle and between spring-neap cycles. Larger DM were observed during high and low slack waters, and the averaged floc size at neap tide was found 57% larger than at spring tide. Effective density of flocs decreased with the increase of floc size, and fractal dimension of flocs in the YE was mainly between 1.5 and 2.1. We also estimated the settling velocity of flocs by 0.04-0.6 mm s-1 and the largest settling velocity occurred also at slack waters. Moreover, it is found that turbulence plays a dominant role in the flocculation process. Floc size decreases significantly when the shear rate parameter G is > 2-3 s-1, suggesting the turbulence breaking force. Combined effects of fine sediment flocculation, enhanced settling process, and high sediment concentration resulted in a large settling flux around high water, which can in part explain the severe siltation in the TM of the YE, thus shedding lights on the navigation channel management.

Post-merger evolution of a neutron star-black hole binary with neutrino transport

NASA Astrophysics Data System (ADS)

Foucart, Francois; O'Connor, Evan; Roberts, Luke; Duez, Matthew D.; Haas, Roland; Kidder, Lawrence E.; Ott, Christian D.; Pfeiffer, Harald P.; Scheel, Mark A.; Szilagyi, Bela

2015-06-01

We present a first simulation of the post-merger evolution of a black hole-neutron star binary in full general relativity using an energy-integrated general-relativistic truncated moment formalism for neutrino transport. We describe our implementation of the moment formalism and important tests of our code, before studying the formation phase of an accretion disk after a black hole-neutron star merger. We use as initial data an existing general-relativistic simulation of the merger of a neutron star of mass 1.4 M⊙ with a black hole of mass 7 M⊙ and dimensionless spin χBH=0.8 . Comparing with a simpler leakage scheme for the treatment of the neutrinos, we find noticeable differences in the neutron-to-proton ratio in and around the disk, and in the neutrino luminosity. We find that the electron neutrino luminosity is much lower in the transport simulations, and that both the disk and the disk outflows are less neutron rich. The spatial distribution of the neutrinos is significantly affected by relativistic effects, due to large velocities and curvature in the regions of strongest emission. Over the short time scale evolved, we do not observe purely neutrino-driven outflows. However, a small amount of material (3 ×10-4M⊙ ) is ejected in the polar region during the circularization of the disk. Most of that material is ejected early in the formation of the disk, and is fairly neutron rich (electron fraction Ye˜0.15 - 0.25 ). Through r-process nucleosynthesis, that material should produce high-opacity lanthanides in the polar region, and could thus affect the light curve of radioactively powered electromagnetic transients. We also show that by the end of the simulation, while the bulk of the disk remains neutron rich (Ye˜0.15 - 0.2 and decreasing), its outer layers have a higher electron fraction: 10% of the remaining mass has Ye>0.3 . As that material would be the first to be unbound by disk outflows on longer time scales, and as composition evolution is

Q'epethet ye Mestiyexw, A Gathering of the People.

ERIC Educational Resources Information Center

Kenny, Carolyn; Archibald, Jo-ann

2000-01-01

A 4-week program in Vancouver (British Columbia) used traditional and academic formats to connect Aboriginal communities throughout British Columbia with each other and with Maori participants from New Zealand. A conference, a symposium and graduate courses covered the role of Aboriginal art, politics of transforming education, revitalization of…

Say YeSSSSS to Collaboration: Transforming Collaborative Mentoring Relationships

ERIC Educational Resources Information Center

Lamb, Dennis; Ludy, Robbie

2008-01-01

School administrators frequently find themselves working with personnel unprepared for the dynamics of the schools today. Thus, approaches to meeting the needs of newly hired (in-service or novice) teachers have manifested itself since the 1980s. As many researchers have indicated, formal evaluation of performance is essential to one's growth…

Effects of Parental Expectations and Cultural-Values Orientation on Career Decision-Making Difficulties of Chinese University Students

ERIC Educational Resources Information Center

Leung, S. Alvin; Hou, Zhi-Jin; Gati, Itamar; Li, Xixi

2011-01-01

This study examined the effects of cultural-values conflict and parental expectations on the career decision-making difficulties of university students in three cities in China (Beijing, Wuhan, and Hong Kong, N = 1342). The Multidimensional Scales of Individual Traditionality and Modernity (Yang, Yu, & Ye, 1989) were used as a measure of…

Modeling the interannual variability of microbial quality metrics of irrigation water in a Pennsylvanian stream

USDA-ARS?s Scientific Manuscript database

Knowledge of the microbial quality of irrigation waters is extremely limited. For this reason, the US FDA has promulgated the Produce Rule, mandating the testing of irrigation water sources for many farms. The rule requires the collection and analysis of at least 20 water samples over two to four ye...

Cool Andromeda

NASA Image and Video Library

2013-01-28

In this new view of the Andromeda, also known as M31, galaxy from the Herschel space observatory, cool lanes of forming stars are revealed in the finest detail yet. M31 is the nearest major galaxy to our own Milky Way at a distance of 2.5 million light-ye

War Comes to Bala Morghab: A Tragedy of Policy and Action in Three Acts

DTIC Science & Technology

2011-12-01

real shower in December—a full 5 months after operations had commenced. The North Atlantic Treaty Organization (NATO) side of the FOB improved...Security Assistance Force (ISAF), Stability Operations Integration Cell ( SOIC ), “Murghab District, Badghis District Narrative Assessment, 5 May 2010...available at <http://publicintelligence. net/ufouo-stability-operations-information-center- soic -murghab-district-assessment/>. 3 Ibid. 4 Most facts

Prosthetic Rehabilitation of a Child Suffering from Hypohidrotic Ectodermal Dysplasia with Complete Anodontia

PubMed Central

Nikhil, M; Chugh, Anshul; Narwal, Anjali

2012-01-01

ABSTRACT A 7-year-old male, described in the case report, exhibited many of the manifestations of ectodermal dysplasia as well as behavioral problems. The treatment to improve his appearance and oral function included a removable prosthesis. The results were significant improvements in speech, masticatory function, and facial esthetics, contributing to the development of normal dietary habits, and the improved and more rapid social integration of the child. How to cite this article: Bala S, Nikhil M, Chugh A, Narwal A. Prosthetic Rehabilitation of a Child Suffering from Hypohidrotic Ectodermal Dysplasia with Complete Anodontia. Int J Clin Pediatr Dent 2012;5(2):148-150. PMID:25206157

Potential Partners in the Pacific? Soft Power and the SINO-NATO Relationship

DTIC Science & Technology

2011-01-01

non-threatening manner. While both NATO and China have interests in Afghanistan, the most fertile ground for a future relationship lies in mutual...Soviet Card’ in the U.S. Opening to China, 1971-1974” Diplomatic History, Vol. 29, No. 3 (June 2005): 487. 22 Zhou-Ye Jianying -Kissinger memcon, 20/6

Study of Electromagnetic Wave Absorption Properties of Carbon Nanotubes-Based Composites

DTIC Science & Technology

2012-11-29

Publications: [1]. G. L. Zhao, Z. Ye, Z. Li, J. A. Roberts, "New carbon nanotube-epoxy composite for dampening microwave cavity resonance", IEEE Xplore ...Nanotechnology ( IEEE - NANO), 2012 12th IEEE Conference on 20-23 Aug. 2012. [2]. Z. Li, G. L. Zhao, P. Zhang, S. Guo, J. Tang, " Thermoelectric

14 CFR 399.34 - Intra-Hawaii and Intra-Puerto Rico/Virgin Islands fare flexibility.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Kodiak ($24.40). 10 July 1977 fare increased by cumulative adjustment factor of 1.5558% per Order 80-4... at 12.35 Percent Return Regulatory actual Y.E. March 1977 Aloha Hawaiian Total Cost inflation... fourth quarter of 1976. 2 Passenger revenue divided by RPM's. 3 Passenger yield at 12.35 percent return...

Imperial Parallels: Analyzing the U.S. Army Regionally Aligned Force Strategy in the Context of Historical Imperialism

DTIC Science & Technology

2014-06-13

bicycle. If it slows down, it could fall off, and the earth might quake ” (Behar 2008c). In order to maintain this momentum, China aggressively...ANALYSIS Rise like Lions after slumber In unvanquishable number — Shake your chains to earth like dew Which in your sleep had fallen on you— Ye are

Equation-free modeling unravels the behavior of complex ecological systems

USGS Publications Warehouse

DeAngelis, Donald L.; Yurek, Simeon

2015-01-01

Ye et al. (1) address a critical problem confronting the management of natural ecosystems: How can we make forecasts of possible future changes in populations to help guide management actions? This problem is especially acute for marine and anadromous fisheries, where the large interannual fluctuations of populations, arising from complex nonlinear interactions among species and with varying environmental factors, have defied prediction over even short time scales. The empirical dynamic modeling (EDM) described in Ye et al.’s report, the latest in a series of papers by Sugihara and his colleagues, offers a promising quantitative approach to building models using time series to successfully project dynamics into the future. With the term “equation-free” in the article title, Ye et al. (1) are suggesting broader implications of their approach, considering the centrality of equations in modern science. From the 1700s on, nature has been increasingly described by mathematical equations, with differential or difference equations forming the basic framework for describing dynamics. The use of mathematical equations for ecological systems came much later, pioneered by Lotka and Volterra, who showed that population cycles might be described in terms of simple coupled nonlinear differential equations. It took decades for Lotka–Volterra-type models to become established, but the development of appropriate differential equations is now routine in modeling ecological dynamics. There is no question that the injection of mathematical equations, by forcing “clarity and precision into conjecture” (2), has led to increased understanding of population and community dynamics. As in science in general, in ecology equations are a key method of communication and of framing hypotheses. These equations serve as compact representations of an enormous amount of empirical data and can be analyzed by the powerful methods of mathematics.

Risk assessment of debris flow in Yushu seismic area in China: a perspective for the reconstruction

NASA Astrophysics Data System (ADS)

Lan, H. X.; Li, L. P.; Zhang, Y. S.; Gao, X.; Liu, H. J.

2013-11-01

The 14 April 2010 Ms = 7.1 Yushu Earthquake (YE) had caused severe damage in the Jiegu township, the residential centre of Yushu Tibetan Autonomous Prefecture, Qinghai Province, China. In view of the fragile geological conditions after YE, risk assessment of secondary geohazards becomes an important concern for the reconstruction. A quantitative methodology was developed to assess the risk of debris flow by taking into account important intensity information. Debris flow scenarios were simulated with respect to rainfall events with 10, 50 and 100 yr returning period, respectively. The possible economic loss and fatalities caused by damage to buildings were assessed both in the settlement area and in the low hazard settlement area regarding the simulated debris flow events. Three modelled building types were adopted, i.e. hollow brick wood (HBW), hollow brick concrete (HBC) and reinforced concrete (RC) buildings. The results suggest that HBC structure achieves a good balance for the cost-benefit relationship compared with HBW and RC structures and thus could be an optimal choice for most of the new residential buildings in the Jiegu township. The low hazard boundary presents significant risk reduction efficiency in the 100 yr returning debris flow event. In addition, the societal risk for the settlement area is unacceptable when the 100 yr returning event occurs but reduces to ALARP (as low as reasonably practicable) level as the low hazard area is considered. Therefore, the low hazard area was highly recommended to be taken into account in the reconstruction. Yet, the societal risk might indeed approach an unacceptable level if one considers that YE has inevitably increased the occurrence frequency of debris flow. The quantitative results should be treated as a perspective for the reconstruction rather than precise numbers of future losses, owing to the complexity of the problem and the deficiency of data.

Bibliography of Soviet Laser Developments, Number 90, July-August 1987

DTIC Science & Technology

1988-06-27

8, 1987, 1250-1255. 51. Cernai, K.; Novakov , M. 0. Concentration dependence of stimulated emission in 4-methylumbelliferone-fluorescein laser dye...118 PANCHENKO I P 129 NADENENKO A V 29 NOVAK A 9 PANCHENKO V YA 18 NADEZHDINSKIY A 1 115 NOVAKOV 14 7 PANKOV F N 88 NAGORNYKH S N 121 NOVICHENKOV V YE

Effects of whole-stream nutrient enrichment on the concentration and abundance of aquatic hyphomycete conidia in transport

Treesearch

Vol. 96(1): 57-65 Mycologia

2004-01-01

The concentrations and relative abundances of aquatic hyphomycete conidia in water were followed during a three-year study in two headwater streams at Coweeta Hydrologic Laboratory, North Carolina, using the membrane-filtration technique. After a one-ye& pretreatment period, one of the streams was enriched continuously with inorganic nutrients (N+P) for two years...

Genome sequences of thirty Escherichia coli O157:H7 isolates recovered from a single dairy farm and its associated off-site heifer raising facility

USDA-ARS?s Scientific Manuscript database

Cattle are the primary reservoir of Escherichia coli O157:H7, the most frequently isolated serotype of enterohemorrhagic E. coli infections among humans in North America. To evaluate the diversity of E. coli O157:H7 isolates within a single dairy herd the genomes of 30 isolates collected over a 7-ye...

Along and across arc geochemical variations in NW Central America: Evidence for involvement of lithospheric pyroxenite

NASA Astrophysics Data System (ADS)

Heydolph, Ken; Hoernle, Kaj; Hauff, Folkmar; Bogaard, Paul van den; Portnyagin, Maxim; Bindeman, Ilya; Garbe-Schönberg, Dieter

2012-05-01

The Central American Volcanic Arc (CAVA) has been the subject of intensive research over the past few years, leading to a variety of distinct models for the origin of CAVA lavas with various source components. We present a new model for the NW Central American Volcanic Arc based on a comprehensive new geochemical data set (major and trace element and Sr-Nd-Pb-Hf-O isotope ratios) of mafic volcanic front (VF), behind the volcanic front (BVF) and back-arc (BA) lava and tephra samples from NW Nicaragua, Honduras, El Salvador and Guatemala. Additionally we present data on subducting Cocos Plate sediments (from DSDP Leg 67 Sites 495 and 499) and igneous oceanic crust (from DSDP Leg 67 Site 495), and Guatemalan (Chortis Block) granitic and metamorphic continental basement. We observe systematic variations in trace element and isotopic compositions both along and across the arc. The data require at least three different endmembers for the volcanism in NW Central America. (1) The NW Nicaragua VF lavas require an endmember with very high Ba/(La, Th) and U/Th, relatively radiogenic Sr, Nd and Hf but unradiogenic Pb and low δ18O, reflecting a largely serpentinite-derived fluid/hydrous melt flux from the subducting slab into a depleted N-MORB type of mantle wedge. (2) The Guatemala VF and BVF mafic lavas require an enriched endmember with low Ba/(La, Th), U/Th, high δ18O and radiogenic Sr and Pb but unradiogenic Nd and Hf isotope ratios. Correlations of Hf with both Nd and Pb isotopic compositions are not consistent with this endmember being subducted sediments. Granitic samples from the Chiquimula Plutonic Complex in Guatemala have the appropriate isotopic composition to serve as this endmember, but the large amounts of assimilation required to explain the isotope data are not consistent with the basaltic compositions of the volcanic rocks. In addition, mixing regressions on Nd vs. Hf and the Sr and O isotope plots do not go through the data. Therefore, we propose that this

Weak scale from the maximum entropy principle

NASA Astrophysics Data System (ADS)

Hamada, Yuta; Kawai, Hikaru; Kawana, Kiyoharu

2015-03-01

The theory of the multiverse and wormholes suggests that the parameters of the Standard Model (SM) are fixed in such a way that the radiation of the S3 universe at the final stage S_rad becomes maximum, which we call the maximum entropy principle. Although it is difficult to confirm this principle generally, for a few parameters of the SM, we can check whether S_rad actually becomes maximum at the observed values. In this paper, we regard S_rad at the final stage as a function of the weak scale (the Higgs expectation value) vh, and show that it becomes maximum around vh = {{O}} (300 GeV) when the dimensionless couplings in the SM, i.e., the Higgs self-coupling, the gauge couplings, and the Yukawa couplings are fixed. Roughly speaking, we find that the weak scale is given by vh ˜ T_{BBN}2 / (M_{pl}ye5), where ye is the Yukawa coupling of electron, T_BBN is the temperature at which the Big Bang nucleosynthesis starts, and M_pl is the Planck mass.

Extremely high sulfate reduction, sediment oxygen demand and benthic nutrient flux associated with a large-scale artificial dyke and its implication to benthic-pelagic coupling in the Yeongsan River estuary, Yellow Sea.

PubMed

Kim, Sung-Han; Lee, Jae Seong; Hyun, Jung-Ho

2017-07-15

We investigated environmental impact of large-scale dyke on the sediment geochemistry, sulfate reduction rates (SRRs), sediment oxygen demand (SOD) and potential contribution of benthic nutrient flux (BNF) to primary production in the Yeongsan River estuary, Yellow Sea. The sediment near the dyke (YE1) with high organic carbon (C org ) content (>4%, dry wt.) was characterized by extremely high SOD (327mmolm -2 d -1 ) and SRRs (91-140mmolm -2 d -1 ). The sulfate reduction accounted for 73% of C org oxidation, and was responsible for strikingly high concentrations of NH 4 + (7.7mM), PO 4 3- (67μM) and HS - (487μM) in pore water. The BNF at YE1 accounted for approximately 200% of N and P required for primary production in the water column. The results present one of the most extreme cases that the construction of an artificial dyke may have profound impacts on the biogeochemical and ecological processes in coastal ecosystems. Copyright © 2017 Elsevier Ltd. All rights reserved.

Navy Occupational Health Information Management System (NOHIMS). Users’ Reference Manual. COSTAR (Computer-Stored Ambulatory Record System). Operators Guide

DTIC Science & Technology

1987-05-01

AUDIOGRAM DAY Of WEEK MJIL-TIME-DAY HOURS SINCE ENT PROBLEM AT TIME OF TESI do,~iiII. r___1 ISON WEDHURSA LAST~ N II-o 2YE LIii. I2 MON T-URS I E...POS ’REI...such as CHEMISTRY, HEMATOLOGY, MICROBIOLOGY , RADIOLOGY, and MISCELLANEOUS. The date is displayed in the same format as previously described. The

Bi-local holography in the SYK model: Perturbations

DOE PAGES

Jevicki, Antal; Suzuki, Kenta

2016-11-08

We continue the study of the Sachdev-Ye-Kitaev model in the Large N limit. Following our formulation in terms of bi-local collective fields with dynamical reparametrization symmetry, we perform perturbative calculations around the conformal IR point. As a result, these are based on an ε expansion which allows for analytical evaluation of correlators and finite temperature quantities.

Tomicus piniperda (Scolytidae): a serious pest of yunnan pine in southwestern China

Treesearch

Hui Ye; Robert A. Haack; Jun Lu

2003-01-01

The pine shoot beetle, Tomicus piniperda (L.), is native to the pine growing regions of Europe, Asia, and northern Africa (Bakke 1968; L?ngstrom 1983; Ye 1991). Established populations of T. piniperda were first found in North America in 1992 (Haack and Kucera 1993), and as of January 2002, it now occurs in 318 counties in the...

The Impact of Enterprise Education on Attitudes to Enterprise in Young People: An Evaluation Study

ERIC Educational Resources Information Center

Athayde, Rosemary

2012-01-01

Purpose: The purpose of the paper is to present evidence on the impact of enterprise education on young people still at school in London, UK. The study was designed to measure the effect of participation in a Young Enterprise (YE) Company Program on young people's attitudes toward starting a business, and on their enterprise potential.…

Radio Engineering System of Short-Range Navigation. RSBN-2. Part I. (Radioteknicheskaya Sistema Blizhney Navigatsii RSBN-2)

DTIC Science & Technology

1977-02-09

RANGE NAVIGATION. RSBN-2 By: Ye. M. Yakovlev, A. N. Kleplkov, et al. English pages: 706 source: Radlotekhnlcheskaya Sistema Bllzhney Navigatsli...L4 and the grid of tube L5 (6N8S) limits grid m^^mammm^m^^^f.^^ rn .„ | -.,, ..S^JTv i tOC = 77050017 PAGE ^ I current©. |: *■ «a—m

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jevicki, Antal; Suzuki, Kenta

We continue the study of the Sachdev-Ye-Kitaev model in the Large N limit. Following our formulation in terms of bi-local collective fields with dynamical reparametrization symmetry, we perform perturbative calculations around the conformal IR point. As a result, these are based on an ε expansion which allows for analytical evaluation of correlators and finite temperature quantities.

Studies in the Phonology of Asian Languages VI: Complex Syllable Nuclei in Vietnamese.

ERIC Educational Resources Information Center

Han, Mieko S.

This study is the sixth in the series "Studies in the Phonology of Asian Languages." A phonetic and phonemic analysis of the three complex nuclei of Vietnames (Hanoi dialect), spelled (1) ye-, -ie-, -ia, (2) -u'o'-, -u'a, and (3) -uo-, -ua, was carried out using the sound spectrograph. The relative domains of the target qualities of the…

Effects of an 8-Month Ashtanga-Based Yoga Intervention on Bone Metabolism in Middle-Aged Premenopausal Women: A Randomized Controlled Study

PubMed Central

Kim, SoJung; Bemben, Michael G.; Knehans, Allen W.; Bemben, Debra A.

2015-01-01

Although Yoga has the potential to be an alternative physical activity to enhance bone health, there is a lack of high quality evidence for this type of intervention. The purpose of this randomized controlled trial was to examine the effects of a progressive 8-month Ashtanga-based Yoga program on bone turnover markers (BTM), areal bone mineral density (aBMD) and volumetric bone characteristics in premenopausal women. Thirty-four premenopausal women (35-50 years) were randomly assigned either to a Yoga group (YE, n = 16) or a control group (CON, n = 18). Participants in YE group performed 60 minutes of an Ashtanga-based Yoga series 2 times/week with one day between sessions for 8 months, and the session intensity was progressively increased by adding the number of sun salutations (SS). Participants in CON were encouraged to maintain their normal daily lifestyles monitored by the bone specific physical activity questionnaire (BPAQ) at 2 month intervals for 8 months. Body composition was measured by dual energy x-ray absorptiometry (DXA). Bone formation (bone alkaline phosphatase, Bone ALP) and bone resorption (Tartrate-Resistant Acid Phosphatase-5b, TRAP5b) markers were assessed at baseline and after 8 months. aBMD of total body, lumbar spine and dual proximal femur and tibia bone characteristics were measured using DXA and peripheral Quantitative Computed Tomography (pQCT), respectively. We found that the serum Bone ALP concentrations were maintained in YE, but significantly (p = 0.005) decreased in CON after the 8 month intervention, and there were significant (p = 0.002) group differences in Bone ALP percent changes (YE 9.1 ± 4.0% vs. CON -7.1 ± 2.3%). No changes in TRAP5b were found in either group. The 8-month Yoga program did not increase aBMD or tibia bone strength variables. Body composition results showed no changes in weight, fat mass, or % fat, but small significant increases in bone free lean body mass occurred in both groups. The findings of this study

Application of a combined approach involving classical random mutagenesis and metabolic engineering to enhance FK506 production in Streptomyces sp. RM7011.

PubMed

Mo, SangJoon; Lee, Sung-Kwon; Jin, Ying-Yu; Oh, Chung-Hun; Suh, Joo-Won

2013-04-01

FK506 production by a mutant strain (Streptomyces sp. RM7011) induced by N-methyl-N'-nitro-N-nitrosoguanidine and ultraviolet mutagenesis was improved by 11.63-fold (94.24 mg/l) compared to that of the wild-type strain. Among three different metabolic pathways involved in the biosynthesis of methylmalonyl-CoA, only expression of propionyl-CoA carboxylase (PCC) pathway led to a 1.75-fold and 2.5-fold increase in FK506 production and the methylmalonyl-CoA pool, respectively, compared to those of the RM7011 strain. Lipase activity of the high FK506 producer mutant increased in direct proportion to the increase in FK506 yield, from low detection level up to 43.1 U/ml (12.6-fold). The level of specific FK506 production and lipase activity was improved by enhancing the supply of lipase inducers. This improvement was approximately 1.88-fold (71.5 mg/g) with the supplementation of 5 mM Tween 80, which is the probable effective stimulator in lipase production, to the R2YE medium. When 5 mM vinyl propionate was added as a precursor for PCC pathway to R2YE medium, the specific production of FK506 increased approximately 1.9-fold (71.61 mg/g) compared to that under the non-supplemented condition. Moreover, in the presence of 5 mM Tween 80, the specific FK506 production was approximately 2.2-fold (157.44 mg/g) higher than that when only vinyl propionate was added to the R2YE medium. In particular, PCC expression in Streptomyces sp. RM7011 (RM7011/pSJ1003) together with vinyl propionate feeding resulted in an increase in the FK506 titer to as much as 1.6-fold (251.9 mg/g) compared with that in RM7011/pSE34 in R2YE medium with 5 mM Tween 80 supplementation, indicating that the vinyl propionate is more catabolized to propionate by stimulated lipase activity on Tween 80, that propionyl-CoA yielded from propionate generates methylmalonyl-CoA, and that the PCC pathway plays a key role in increasing the methylmalonyl-CoA pool for FK506 biosynthesis in RM7011 strain. Overall

C-LAMP Subproject Description:Climate Forcing by the Terrestrial Biosphere During the Second Half of the 20th Century

DOE Office of Scientific and Technical Information (OSTI.GOV)

Covey, Curt; Hoffman, Forrest

2008-10-02

This project will quantify selected components of climate forcing due to changes in the terrestrial biosphere over the period 1948-2004, as simulated by the climate / carboncycle models participating in C-LAMP (the Carbon-Land Model Intercomparison Project; see http://www.climatemodeling.org/c-lamp). Unlike other C-LAMP projects that attempt to close the carbon budget, this project will focus on the contributions of individual biomes in terms of the resulting climate forcing. Bala et al. (2007) used a similar (though more comprehensive) model-based technique to assess and compare different components of biospheric climate forcing, but their focus was on potential future deforestation rather than the historicalmore » period.« less

China/Taiwan: Evolution of the One China Policy - Key Statements from Washington, Beijing, and Taipei

DTIC Science & Technology

2006-09-07

Statements During Clinton Administration . . . . . . . . . . . . . . . . . . . . . . . . . 48 PRC Premier Li Peng Warns Taiwan...Soviet Union/Russia and built up its theater missile force.48 In December 1992 and March 1993, PRC President Jiang Zemin and Premier Li Peng began to...Ye Jianying Explains Policy Concerning Return of Taiwan to Motherland and Peaceful Unification,” Xinhua [New China News Agency], September 30, 1981

U.S. EPA, Pesticide Product Label, , 11/13/1987

EPA Pesticide Factsheets

2011-04-14

... r'r~-::)pir'ati()ll by !J'o(.rll.th-·-I:o···mrouth (H" othl~r mC'·)frS:· \\1t \\·r ... 'f·qhqI.3ti~ nr::~1n r::au~ji:.~ tl.l.ng et:ir:.'rna YE'mit:1 ...

Atomic Layer Deposition of Al2O3 on GaSb Using In Situ Hydrogen Plasma Exposure

DTIC Science & Technology

2012-12-03

Krishna, and A. Javey, Nano Lett. 12, 3592 (2012). 7A. Ali, H. Madan , A. Agrawal, I. Ramirez, R. Misra, J. B. Boos, B. R. Bennett, J. Lindemuth, and S...Trans. Electron Devices 58, 3407 (2011). 9M. Xu, R. S. Wang, and P. D. Ye, IEEE Electron Device Lett. 32, 883 (2011). 10A. Ali, H. S. Madan , A. P. Kirk

USSR Report, Earth Sciences.

DTIC Science & Technology

1985-04-19

Specifics of Geology of Saryshagan Molybdenum- Copper - Porphyry Deposit (Northwestern Balkash Area) (Yu. K. Kudryavtsev, V. V. Izotov, et al...SPECIFICS’OF GEOLOGY OF SARYSHAGAN MOLYBDENUM- COPPER - PORPHYRY DEPOSIT (NORTHWESTERN BALKASH AREA) Moscow IZVESTIYA VYSSHIKH UCHEBNYKH ZAVEDENIY... Copper , Lead and Cadmium in Ooze Water of Central Pacific (A. Ye. Kosov, T. P. Demidova; GEOKHIMIYA, No 10, Oct 84) 37 Nickel Minerals in

Bibliography of Soviet Laser Developments, Number 37, September - October 1978

DTIC Science & Technology

1979-07-01

RZhF, 10/78, lbD1210) 333. Sukhanov , V.I., Yu.V. Ashcheulov, and A.Ye. Petnikov (0). Hologram recording in lithium niobate crystals. Sb 15, 86-88...SUCIU P SUKHANOV V I SUKHOVERKHOVA L G SUKOV A I SUSHENKO A N SUSHKEVICH T N SUSHKIN V N SUSLENNIKOV L A SUSLIKOV L M SUSLOV A M SVERDLOV B N

Fiscal Year 2013 Comprehensive Oversight Plan for Southwest Asia

DTIC Science & Technology

2012-09-26

Republic JO Jordan TJ Tajikistan KZ Kazakhstan TM Turkmenistan KW Kuwait AE United Arab Emirates KG Kyrgyzstan UZ Uzbekistan LB Lebanon YE Yemen...effective, responsive, democratic, transparent, accountable, and gender sensitive municipal governance in select municipalities in Afghanistan? (Project...CAII-Creative Associates International, Inc., Ambassador’s Small Grants Program to Support Gender Equality in Afghanistan – ASGP Objective: 306-A-00

JPRS Report, Science & Technology, USSR: Computers

DTIC Science & Technology

1987-07-15

Algebras and Multilevel Program Planning (G. Ye.. Tseytlin; PROGRAMMIROVANIYE, No 3, May-Jun 86) 36 Linguistic Facilities for Programming...scientific production associations which, jointly with the USSR Academy of Sciences, will solve basic and applied problems in the informatics industry...especially the establishment of complex , interdisciplinary problems and directions), the change in the style of the scientific thought of the epoch, and

Thermo-Mechanical and Thermal Behavior of High-Temperature Structural Materials.

DTIC Science & Technology

1981-12-31

8217 wtich should r’o = - :a . mere ilret ap. l I it;on to , ision reactor mat.er als. The "roaa ot)l c i: ye oi tie work has 5,!iere : iS tte .:k i,.’nt...Center Materials Department Office of Naval Research Annapolis, Maryland 21402 (1) San Francisco Area Office One Hallidie Plaza, Suite 601 Naval Undersea

Directory of Soviet Officials: Science and Education: A Reference Aid

DTIC Science & Technology

1989-05-01

Sergey Yevstratovich id 1971 Organic Semifinished Products and Dyes SRI imeni K. Ye. Voroshllov, Moscow (Nil organicheskikh poluproduktov i... products and also produces dyes for use in the textile industry.) Director Physical Chemistry SRI imeni L Ya, Karppv, Moscow (Nauchno...103 Organic Semifinished Products and Dyes SRI imeni K.Yc. Voroshilov. Moscow 197 Organic Synthesis Institute. Riga 157 Oriental Studies Institute

Cleaving the Halqeh-ye-nur diamonds: a dynamic fracture analysis.

PubMed

Atkinson, Colin; Martineau, Philip M; Khan, Rizwan U A; Field, John E; Fisher, David; Davies, Nick M; Samartseva, Julia V; Putterman, Seth J; Hird, Jonathan R

2015-03-28

The degree of surface roughness and clarity with which a surface in a brittle material can be formed via fracture is known to be related to the speed of the propagating crack. Cracks traversing a brittle material at low speed produce very smooth surfaces, while those propagating faster create less reflective and rough surfaces (Buehler MJ, Gao H. 2006 Nature 439, 307-310 (doi:10.1038/nature04408)). The elastic wave speeds (c(l)≈18 000 m s(-1), c(s)≈11 750 m s(-1)) in diamond are fast (Willmott GR, Field JE. 2006 Phil. Mag. 86, 4305-4318 (doi:10.1080/14786430500482336)) and present a particular problem in creating smooth surfaces during the cleaving of diamond-a routine operation in the fashioning of diamonds for gemstone purposes--as the waves are reflected from the boundaries of the material and can add a tensile component to the propagating crack tip causing the well-known cleavage steps observed on diamond surfaces (Field JE. 1971 Contemp. Phys. 12, 1-31 (doi:10.1080/00107517108205103); Field JE. 1979 Properties of diamond, 1st edn, Academic Press; Wilks EM. 1958 Phil. Mag. 3, 1074-1080 (doi:10.1080/14786435808237036)). Here we report an analysis of two diamonds, having large dimensions and high aspect ratio, which from a gemological analysis are shown to have been cleaved from the same 200 carat specimen. A methodology for their manufacture is calculated by an analysis of a model problem. This takes into account the effect of multiple reflections from the sample boundaries. It is suggested that the lapidary had an intuitive guide to how to apply the cleavage force in order to control the crack speed. In particular, it is shown that it is likely that this technique caused the fracture to propagate at a lower speed. The sacrifice of a large diamond with the intention of creating thin plates, rather than a faceted gemstone, demonstrates how symbolism and beliefs associated with gemstones have changed over the centuries (Harlow GE. 1998 The nature of diamonds, Cambridge University Press). The scientific insights gained by studying these gemstones suggest a method of producing macroscale atomically flat and stress-free surfaces on other brittle materials.

Cleaving the Halqeh-ye-nur diamonds: a dynamic fracture analysis

PubMed Central

Atkinson, Colin; Martineau, Philip M.; Khan, Rizwan U. A.; Field, John E.; Fisher, David; Davies, Nick M.; Samartseva, Julia V.; Putterman, Seth J.; Hird, Jonathan R.

2015-01-01

The degree of surface roughness and clarity with which a surface in a brittle material can be formed via fracture is known to be related to the speed of the propagating crack. Cracks traversing a brittle material at low speed produce very smooth surfaces, while those propagating faster create less reflective and rough surfaces (Buehler MJ, Gao H. 2006 Nature 439, 307–310 (doi:10.1038/nature04408)). The elastic wave speeds (cl≈18 000 m s−1, cs≈11 750 m s−1) in diamond are fast (Willmott GR, Field JE. 2006 Phil. Mag. 86, 4305–4318 (doi:10.1080/14786430500482336)) and present a particular problem in creating smooth surfaces during the cleaving of diamond—a routine operation in the fashioning of diamonds for gemstone purposes—as the waves are reflected from the boundaries of the material and can add a tensile component to the propagating crack tip causing the well-known cleavage steps observed on diamond surfaces (Field JE. 1971 Contemp. Phys. 12, 1–31 (doi:10.1080/00107517108205103); Field JE. 1979 Properties of diamond, 1st edn, Academic Press; Wilks EM. 1958 Phil. Mag. 3, 1074–1080 (doi:10.1080/14786435808237036)). Here we report an analysis of two diamonds, having large dimensions and high aspect ratio, which from a gemological analysis are shown to have been cleaved from the same 200 carat specimen. A methodology for their manufacture is calculated by an analysis of a model problem. This takes into account the effect of multiple reflections from the sample boundaries. It is suggested that the lapidary had an intuitive guide to how to apply the cleavage force in order to control the crack speed. In particular, it is shown that it is likely that this technique caused the fracture to propagate at a lower speed. The sacrifice of a large diamond with the intention of creating thin plates, rather than a faceted gemstone, demonstrates how symbolism and beliefs associated with gemstones have changed over the centuries (Harlow GE. 1998 The nature of diamonds, Cambridge University Press). The scientific insights gained by studying these gemstones suggest a method of producing macroscale atomically flat and stress-free surfaces on other brittle materials. PMID:25713458

Kilonova from post-merger ejecta as an optical and near-Infrared counterpart of GW170817

NASA Astrophysics Data System (ADS)

Tanaka, Masaomi; Utsumi, Yousuke; Mazzali, Paolo A.; Tominaga, Nozomu; Yoshida, Michitoshi; Sekiguchi, Yuichiro; Morokuma, Tomoki; Motohara, Kentaro; Ohta, Kouji; Kawabata, Koji S.; Abe, Fumio; Aoki, Kentaro; Asakura, Yuichiro; Baar, Stefan; Barway, Sudhanshu; Bond, Ian A.; Doi, Mamoru; Fujiyoshi, Takuya; Furusawa, Hisanori; Honda, Satoshi; Itoh, Yoichi; Kawabata, Miho; Kawai, Nobuyuki; Kim, Ji Hoon; Lee, Chien-Hsiu; Miyazaki, Shota; Morihana, Kumiko; Nagashima, Hiroki; Nagayama, Takahiro; Nakaoka, Tatsuya; Nakata, Fumiaki; Ohsawa, Ryou; Ohshima, Tomohito; Okita, Hirofumi; Saito, Tomoki; Sumi, Takahiro; Tajitsu, Akito; Takahashi, Jun; Takayama, Masaki; Tamura, Yoichi; Tanaka, Ichi; Terai, Tsuyoshi; Tristram, Paul J.; Yasuda, Naoki; Zenko, Tetsuya

2017-12-01

Recent detection of gravitational waves from a neutron star (NS) merger event GW170817 and identification of an electromagnetic counterpart provide a unique opportunity to study the physical processes in NS mergers. To derive properties of ejected material from the NS merger, we perform radiative transfer simulations of kilonova, optical and near-infrared emissions powered by radioactive decays of r-process nuclei synthesized in the merger. We find that the observed near-infrared emission lasting for >10 d is explained by 0.03 M⊙ of ejecta containing lanthanide elements. However, the blue optical component observed at the initial phases requires an ejecta component with a relatively high electron fraction (Ye). We show that both optical and near-infrared emissions are simultaneously reproduced by the ejecta with a medium Ye of ˜0.25. We suggest that a dominant component powering the emission is post-merger ejecta, which exhibits that the mass ejection after the first dynamical ejection is quite efficient. Our results indicate that NS mergers synthesize a wide range of r-process elements and strengthen the hypothesis that NS mergers are the origin of r-process elements in the Universe.

The advertisement calls of Quasipaa shini (Ahl, 1930) (Anura: Dicroglossidae).

PubMed

Kong, Shen Shen; Zheng, Rong Quan; Zhang, Qi Peng

2016-12-04

The genus Quasipaa (Family Dicroglossidae) is currently composed of 11 species distributed in China and Southeast Asia: Quasipaa acanthophora (Dubois & Ohler 2009), Q. boulengeri (Günther 1889), Q. courtoisi (Angel 1922), Q. delacouri (Angel 1928), Q. exilispinosa (Liu & Hu, 1975), Q. fasciculispina (Inger 1970), Q. jiulongensis (Huang & Liu, 1985), Q. shini (Ahl 1930), Q. spinosa (David 1875), Q. verrucospinosa (Bourret 1937), Q. yei (Chen, Qu & Jiang 2002) (Frost 2016). These species are morphologically similar, and their taxonomy is subject to controversy (Che et al. 2009). Analyses of nuclear and mitochondrial genes suggest the genus likely encompass additional cryptic species (Ye et al. 2013). Bioacoustics has contributed to studies on the taxonomy of the genus (Ye et al. 2013; Shen et al. 2015), however, to date, only the advertisement calls of Q. spinosa are known (Yu & Zheng 2009; Chen et al. 2012; Shen et al. 2015). Here, we describe the advertisement calls of Q. shini, which inhabits streams in the southern part of central China(Guizhou, Hunan, Guangxi and Jiangxi) and is characterized by the presence of keratinized skin spines on the lateral surfaces of the body.

Calculated and Observed Speeds of Cavitation About Two- and Three- Dimensional Bodies in Water

DTIC Science & Technology

1942-11-01

yE1l0.044po ellipse of - 36 (1 - Y) 6 0 .l.Olxx 0(y) L . 6.54 Porabolo Elipe em - Cicl Y ,11p f. 2 1 - fal: Figure 1 ScinofCylinders and Bodies of...Propellers,* by E.Z. Stowell and A.F. Deming , BACA Report 526, 1935. (2) "Flow about a Pair of Adjacent, Parallel Cylinders Normal to a Stream, Theoretical

An Ada/SQL (Structured Query Language) Application Scanner.

DTIC Science & Technology

1988-03-01

Digital ...8217 (" DIGITS "), 46 new STRING’ ("DO"), new STRING’ ("ELSE"), new STRING’ ("ELSIF"), new STRING’ ("END"), new STRING’ ("ENTRY"), new STRING’ ("EXCEPTION...INTEGERPRINT; generic type NUM is digits <>; package FLOATPRINT is package txtprts.ada 18 prcdr PR (FL inFL %YE LINE n LINTYPE UNCLASSIFIED procedure

SOVRaD - A Digest of Recent Soviet R and D Articles. Volume 2, Number 1, 1976

DTIC Science & Technology

1976-01-01

sensors and for making pyroelectric pow^r generators. [ Chechkin , V . V . , A , I. Leychenko, O. S. Didkovskaya, G. Ye. Savenkova, V . V ...ALlenov, M. I. , A . V . Afomn, M. F. Akhmetzyanov, et al. High-speed apparatus for recording and processing measurements of fluctuations...is included. [Medvedev, G. A . , M. A . Markovich, and V . I. Shlyakhov. Optical light flux demodulation device for optical probes. Author’s

USSR Report, Life Sciences Biomedical and Behavioral Sciences

DTIC Science & Technology

1984-02-02

Plant Protection 1 Predicting Effectiveness of Mineral Fertilizers on Rice Plantings (Ye. P. Aleshin. et al.; DOKLADY VASKhNIL, No 5, May 83... Protection Cited (Yu. Zaytsev; PRAVDA UKRAINY, 5 Oct 83) 88 - f - AGROTECHNOLOGY BRIEFS BIOLOGICAL PLANT PROTECTION —The criticism contained in the...the biological means of plant protection manufactured by Glavmikrobioprom enterprises are still inferior in quality to better samples. Measures

USSR Report, Military Affairs

DTIC Science & Technology

1984-12-12

extracted - Unfamiliar names rendered phonetically or transliterated are enclosed in parentheses. Words or names preceded by a question mark and...warrant officers, and six NCO’s and soldiers raised their scores. Moreover, St Lieutenants Ye. Shavrov, S. Boldin , and V. Radionov became specialists...absence—a scientific essay on the selected specialty; notarized copies of the VUZ graduation diploma and an extract from the academic record; service

2016 Quantum Science Gordon Research Conference

DTIC Science & Technology

2018-01-10

PERSON 19b. TELEPHONE NUMBER Jun Ye 611102 c. THIS PAGE The public reporting burden for this collection of information is estimated to average 1 hour...completing and reviewing the collection of information . Send comments regarding this burden estimate or any other aspect of this collection of information ...including suggesstions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215

Laser Instrumentation for Attosecond Experimentation

DTIC Science & Technology

2009-06-15

Spectroscopy Principal Investigator: Jun Ye, JILA, NIST and University of Colorado, Boulder With revolutionary impact on precision metrology and...geometry, one of the focusing cavity mirrors had a 100-mm hole drilled in the middle. The coupling efficiency and cavity loss associated with such...carried out by the Leone and Neumark groups. These studies provided a gauge of the plasmon-field ponderomotive forces. Attosecond experiments were prepared

Manipulation of Molecular Quantum Wavepackets with Ultrashort Laser Pulses for Non-destructive Detection of Volatile Explosives

DTIC Science & Technology

2013-02-01

DTRA-TR-12-65 Manipulation of Molecular Quantum Wavepackets with Ultrashort Laser Pulses for Non-destructive Detection of Volatile Explosives ...Manipulation of Molecular Quantum Wavepackets with Ultrashort Laser Pulses for Non-destructive Detection of Volatile Explosives HDTRA1-09-1-0021 Valery...destructive detection of volatile explosives . Moshe Shapiro1, Valery Milner1 and Jun Ye2 1University of British Columbia, Vancouver, Canada 2JILA

JPRS Report, Science & Technology, USSR: Science & Technology Policy

DTIC Science & Technology

1990-05-31

SERVICE SPRINGFIELD, VA. 22161 DTTC QUALITY INSPECTED t Science & Technology USSR: Science & Technology Policy JPRS-UST-90-006 CONTENTS 31 May...64 Uzbek Central Committee Examines S& T Cadre Problem [PRAVDA VOSTOKA, 27Feb 90] 65 Miscellaneous Scientists Comment on Compensation, Contract...Expositions POISK Commentary on February S& T Conference [V. Oshchenko, Ye. Ponarina; POISK, 22-28 Feb 90] 77 Conference Sets Policy for Future S& T

FEASIL Implementation under VAX VMS with Design Information.

DTIC Science & Technology

1986-11-01

desirable to eventually port FEASIL to the HP 9000, the IBM PC, and several other com- puters. However, the flowcharting and VAX conversion efforts have...v W l EU l l~rl EDIIkEL (pg 12) DEL El’F TJ-’LE C rr~PACE 13 HPvrwrH IIUpdate the I Itpe DescrL c ðere tau,1es remaining nthe relatioil ? ye

Ute Unit: Study Guide and Follow Up Activities.

ERIC Educational Resources Information Center

North Conejos School District, Capulin, CO.

The study guide and follow-up activities were designed primarily to give students a feeling of Ute life in the San Luis Valley in Colorado. The unit begins with six Southern Ute stories about the wolf and coyote, the race between the skunk and the coyote, the frog and the eagle, why the frog croaks, the bear (Que Ye Qat), and the two Indian…

Propionic acid production from corn stover hydrolysate by Propionibacterium acidipropionici

DOE PAGES

Wang, Xiaoqing; Salvachua, Davinia; Sanchez i Nogue, Violeta; ...

2017-08-17

The production of value-added chemicals alongside biofuels from lignocellulosic hydrolysates is critical for developing economically viable biorefineries. Here, the production of propionic acid (PA), a potential building block for C3-based chemicals, from corn stover hydrolysate is investigated using the native PA-producing bacterium Propionibacterium acidipropionici. A wide range of culture conditions and process parameters were examined and experimentally optimized to maximize titer, rate, and yield of PA. The effect of gas sparging during fermentation was first examined, and N 2 was found to exhibit improved performance over CO 2. Subsequently, the effects of different hydrolysate concentrations, nitrogen sources, and neutralization agentsmore » were investigated. One of the best combinations found during batch experiments used yeast extract (YE) as the primary nitrogen source and NH 4OH for pH control. This combination enabled PA titers of 30.8 g/L with a productivity of 0.40 g/L h from 76.8 g/L biomass sugars, while successfully minimizing lactic acid production. Due to the economic significance of downstream separations, increasing titers using fed-batch fermentation was examined by changing both feeding media and strategy. Continuous feeding of hydrolysate was found to be superior to pulsed feeding and combined with high YE concentrations increased PA titers to 62.7 g/L and improved the simultaneous utilization of different biomass sugars. Additionally, applying high YE supplementation maintains the lactic acid concentration below 4 g/L for the duration of the fermentation. Finally, with the aim of increasing productivity, high cell density fed-batch fermentations were conducted. PA titers increased to 64.7 g/L with a productivity of 2.35 g/L h for the batch stage and 0.77 g/L h for the overall process. These results highlight the importance of media and fermentation strategy to improve PA production. Altogether, this work demonstrates the feasibility of

Rheological profile of diets produced using agro-industrial wastes for rearing codling moth larvae for baculovirus biopesticides.

PubMed

Gnepe, J R; Tyagi, R D; Brar, S K; Valero, J R

2011-01-01

A rheological study of diets using the agro-industrial wastes (brewery wastewater and pomace waste) was carried out in order to obtain a diet most adapted to supply nutrients for growth of codling moth (CM) larvae. Nutritive capacity (g/L) of brewery wastewater (BWW) (25.5 ± 5.5 carbohydrates; 16.9 ± 2.1 proteins; 6 ± 1.6 lipids) and pomace waste (POM) (22.0 ± 0.03 carbohydrates; 11.3 ± 1.3 proteins; 2 ± 0.2 lipids) were essential and important as replacement or in association with other ingredients [soya flour (SF), wheat germ (WG), yeast extract (YE)] of the standard diet for the breeding of codling moth larvae. These diet additives also contributed to the preservation of texture and nutritive content of larvae diet. The eggs and CM larvae were grown on alternate diets under industrial conditions (16:8 h photoperiod; 25 ± 1 °C and 50 ± 0.5 % of humidity). The higher assimilation of nutrients of the diets in BWW and control diet was observed by calculating the rate of hatching of eggs (0.48 to 0.71); larvae growth (0.23 to 0.4) and fertility (1.33 to 3 for control diet). The excellent growth and fertility rates of codling moth larvae were attributed to variations in viscosity (varying from 50 to 266 mPa.s⁻¹), particle size (varying 24.3 μm in 88.05 μm with regard to 110 μm the control diet) and total solids (145.88 g/L POM + YE; 162.08 g/L BWW + YE; 162.2 g/L POM + WG; 173 g/L control; 174.3 g/L BWW + WG) diets. Lower viscosity favored improved diet due to ease of assimilation of nutrients. Thus, rheology is an important parameter during preparation of diets for growth of codling moth larvae as it will dictate the nutrient assimilation which is an important parameter of larvae growth.

Propionic acid production from corn stover hydrolysate by Propionibacterium acidipropionici

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xiaoqing; Salvachua, Davinia; Sanchez i Nogue, Violeta

The production of value-added chemicals alongside biofuels from lignocellulosic hydrolysates is critical for developing economically viable biorefineries. Here, the production of propionic acid (PA), a potential building block for C3-based chemicals, from corn stover hydrolysate is investigated using the native PA-producing bacterium Propionibacterium acidipropionici. A wide range of culture conditions and process parameters were examined and experimentally optimized to maximize titer, rate, and yield of PA. The effect of gas sparging during fermentation was first examined, and N 2 was found to exhibit improved performance over CO 2. Subsequently, the effects of different hydrolysate concentrations, nitrogen sources, and neutralization agentsmore » were investigated. One of the best combinations found during batch experiments used yeast extract (YE) as the primary nitrogen source and NH 4OH for pH control. This combination enabled PA titers of 30.8 g/L with a productivity of 0.40 g/L h from 76.8 g/L biomass sugars, while successfully minimizing lactic acid production. Due to the economic significance of downstream separations, increasing titers using fed-batch fermentation was examined by changing both feeding media and strategy. Continuous feeding of hydrolysate was found to be superior to pulsed feeding and combined with high YE concentrations increased PA titers to 62.7 g/L and improved the simultaneous utilization of different biomass sugars. Additionally, applying high YE supplementation maintains the lactic acid concentration below 4 g/L for the duration of the fermentation. Finally, with the aim of increasing productivity, high cell density fed-batch fermentations were conducted. PA titers increased to 64.7 g/L with a productivity of 2.35 g/L h for the batch stage and 0.77 g/L h for the overall process. These results highlight the importance of media and fermentation strategy to improve PA production. Altogether, this work demonstrates the feasibility of

Natural hazards at the southern margin of the Central Anatolian Plateau (CAP) (southern Turkey): Tsunami evidence

NASA Astrophysics Data System (ADS)

Ogretmen, Nazik; Cosentino, Domenico; Gliozzi, Elsa; Cipollari, Paola; Radeff, Giuditta; Yıldırım, Cengiz

2016-04-01

In regions that are located in steep, orogenic plateau margins, such as the coastal area of the Central Anatolian Plateau (CAP) southern margin, natural hazard studies related to active tectonics and events that are triggered by active tectonics (e.g., earthquakes, landslides, tsunamis) are very essential in the context of preventing possible damages. This work herein, represents some evidence of the tsunami hazard along the coast between Aydıncık and Narlıkuyu, in southern Turkey. The work is based on a study on out-of-place beachrock-slab boulder acummulation in Aydıncık district, which were transported onshore by sliding process, and on out-of-place more rounded boulders that were transported by saltation process in Narlıkuyu and Yeşilovacık districts. The presence of intertidal organisms (e.g., lithophaga boring, balanids, oysters, etc.) encrusting the boulders of both localities shows that those boulders were carried onland from a marine environment. According to their dimensions and weight, in agreement with out-of-place boulders from areas surely affected by tsunamis, those out-of-place boulders here are interpreted as due to tsunami waves. The tsunamites in the Aydıncık area are located on beachrock slabs. They are platty and some of those blocks are embricated and oriented perpendicular to the shoreline (NE-SW direction). Those boulders have been interpreted as transported by sliding process, in relation with the coastal morphology and the boulder geometry, which means that to move those boulders the energy of the tsunami not necessarily should have been as high as in saltation or rolling transport processes. On the contrary, in Narlıkuyu and Yeşilovacık localities, the boulders are well-rounded and ellipsoidal shaped, suggesting that they were transported by rolling and/or saltation mode rather than by sliding. To carry onland the tsunami boulders observed in the Narlıkuyu and Yeşilovacık districts, which in the Yeşilovacık area they are

Molecular Studies of Alphavirus Immunogenicity

DTIC Science & Technology

1992-12-03

RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

China/Taiwan: Evolution of the One China Policy - Key Statements from Washington, Beijing, and Taipei

DTIC Science & Technology

2007-07-09

48 PRC Premier Li Peng Warns Taiwan . . . . . . . . . . . . . . . . . . . . . . . . . 48 Mainland-Taiwan “Koo-Wang...and March 1993, PRC President Jiang Zemin and Premier Li Peng began to warn of having to use “drastic” or “resolute” measures to prevent Taiwan...commitment in its referral to Quemoy and Matsu.” (Wolff and Simon, p. 282-283.) 95 “Ye Jianying Explains Policy Concerning Return of Taiwan to Motherland and

Professionalization of the Senior Chinese Officer Corps Trends and Implications

DTIC Science & Technology

1997-01-01

81The officers who retired were Ye Jianying , Nie Rongzhen, Xu Xiangqian, Wang Zhen, Song Renqiong, and Li Desheng. Of course, the political impact of...increased education level, functional spe- cialization, and adherence to retirement norms.4 Li Cheng and Lynn White, in their 1993 Asian Survey article...making rigorous comparative analysis untenable. Second, Li and White do not place their results or analysis in any theoretical context. In

Dynamics of Photoexcitation and Photocatalysis at Nanostructured Carbon Interfaces

DTIC Science & Technology

2015-07-14

nanotubes with a sacrificial polymer and eliminating the polymer using a critical point drying process. This process creates aerogel structures that...Bindl DJ, Jacobberger RM, Wu M-Y, Singha Roy S, Arnold MS, Semiconducting Carbon Nanotube Aerogel Bulk Heterojunction Solar Cells, Small 10 (16), pp...ACS Nano 2015, 9 (1), 564-572. Ye Y, Bindl DJ, Jacobberger RM, Wu M-Y, Singha Roy S, Arnold MS, Semiconducting Carbon Nanotube Aerogel Bulk

USSR Report, Chemistry

DTIC Science & Technology

1985-07-24

ZAVEDENIY: KHBIIYA I KHIMICHESKAYA TEKHNOLOGIYA, No 3, Mar 85) ................ 2 ANALYTICAL CHEMISTRY Spectroscopic Method of Studying...Ye. Gutman, I. A. Myasnikov, et al.; ZHURNAL FIZICHESKOY KHE-1II, No 3, Mar 85) 4 -a - [III - USSR - 21B S&T] Detailed Method for...Containing Rare Earth and Transitional Elements (S. E. Mamedov, B. A. Dadashev: KINETIKA I KATALIZ, No 1, Jan-Feb 85) 11 Isotope Exchange Method in

USSR Report. Life Sciences: Biomedical and Behavioral Sciences

DTIC Science & Technology

1987-05-29

Ioffe, M.G. Bezrukov; BIOTEKHNOLOGIYA, No 5, Sep-Oct 86) • 29 Influence of Hydrodynamic Structure of Flows on Processes in Bubbler Reactor (A.A...Ye.F. Andreyev and M.A. Kazaryan, Ali-Union Scientific Research Biosynthetic Institute, Moscow] [Abstract] Flow -through microbiocalorimeters widely...references 13: 2 Russian, 11 Western. 6508/13046 CSO: 1840/356 UDC 663.033.063.86 INFLUENCE OF HYDRODYNAMIC STRUCTURE OF FLOWS ON PROCESSES IN

Eighth Mendeleyev Congress on General and Applied Chemistry - USSR -

DTIC Science & Technology

1960-07-18

A. Nazarova and V. S. Orlova (Moscow) succeeded in forming sulfates , nitrates and carbonates of platinum iodopentamine by ammonia substitution of...of ruthenium; S. I. Ginsburg, N. K. Pshenitsyn and L. G. Sal’skaya (moscow) studied the nature of colored iridum compounds formed in sulfuric ...phosphoric and perchloric acids ; Ye. V. Shenderet- skaya and I. I. Chernyayev (Moscow) studied formates of mono- valent rhodium; E. P. Deichman (Moscow

JPRS Report, Science & Technology, USSR: Science & Technology Policy.

DTIC Science & Technology

1987-07-15

called for by the specifications. We pointed this out, tut the suppliers were in no hurry to correct the situation," shop foreman S . Korenev ... S &T Progress ( S . Leznov; TEKHNIKA I NAUKA,No 9, Sep 86) 10 Work of ESSR S &T Societies on Intensifying Social Production (Vladimir...Moscow Automated Control System ( S . Ye. Serdyuk; TEKHNIKA I NAUKA, No 9, Sep 86) 41 INDUSTRIAL, COMMERCIAL APPLICATION Development of Methods

JPRS Report, Science & Technology, USSR: Physics & Mathematics

DTIC Science & Technology

1987-06-17

Manishin, G. A. Pasmanik; KVANTOVAYA ELEKTRONIKA, No 12, Dec 86) Determination of Weak Optical Absorption of Optoacoustic Method ( S . A. Vinokurov...Gorbunov, A. S . Kaminskiy; ZHURNAL EKSPERIMENTALNOY I TEORETICHESKOY FIZIKI, No 3(9),- -’"’ Sep 86) , ’.. 󈧐 ■ ■ \\ - b - Dependence of...Kokurin, N. Ye. Kuzmenko, et al.; KVANTOVAYA ELEKTRONIKA, No 12, Dec 86) 17 Kinematic Mode Locking in Continuous-Wave YAG:Nd3 Ring Laser (L. S

JPRS Report, Science & Technology USSR: Chemistry

DTIC Science & Technology

1991-05-02

91] 11 Using Ftorlon Fabric for the Diaphragms of Hydrochloric Acid Electrolyzers [Ye.M. Levinskiy, V.l. Barmashenko, et ai; KHIMICHESKAYA...that boron trifluoride was used in an adsorbed state over a neutral carrier and not complexed with strong inorganic acids . Because of this carrier...the Diaphragms of Hydrochloric Acid Electrolyzers 917M0069I Kiev KHIMICHESKAYA TEKHNOLOGIYA in Russian No 1, Jan-Fcb 91 (manuscript received 13 Nov

Clinical Investigation Program.

DTIC Science & Technology

1981-10-01

Tomographic (CT) Appearance of the ryc- cardium After Neversible and Irreversible Ischemic Injury . 29th Annual Meeting of the Association of University...Orthopedic Surgeons, San Antonio, TX, Nov 1980. (C) Greenfield, G. Q., Jr.: Injuries Related to Rollerskating. Annual Mleeting, Society of Military...volume reduction odiumw balance A c-umuatie-.EDLASE I E st Ac cumul a ti ye Perio -di-c ............ Lost: LOA Cost: $1LO0. Review Results: Continue

The Conference on the Dynamics of Molecular Collisions Held in Oglebay Park, Wheeling, West Virginia on 12-17 July 1987.

DTIC Science & Technology

1987-07-17

Yuhua Guan, Gillian C. Lynch and Donald L. Thompson Department of Chemistry, Oklahoma State University, Stillwater, OK 74078 Classical trajectories...P20 PHOTOFRAGMrTATION OF ALKYL IODIDES -- Photofragmentation Channels and Energy Partitioning of the Fragments Qihe Zhu, Shouling Huang, J.R. Cao , Ye...Chemistry (314) 553-5344 Upton, NY 11973 (516) 282-4348 Dr. William L. Hase Wayne State University Dr. Yuhua Guan 435 Chemistry Department of Chemistry

USSR Report, Chemistry

DTIC Science & Technology

1985-08-16

of the thermal interaction of polonium - 210 with palladium and iridium. The vacuum-thermal method of direct synthesis was used, a study of the...ZHURNAL -PRIKLADNOY KHIMII, No k, Apr 85) Ik CATALYSIS Effect of Intermetallic Compounds Zr-Co Composition on Their Catalytic Properties in...KHIMICHESKAYA, No U, Apr 85) IT Effect of Stabilization on Adsorption and Catalytic Properties of Electrodeposited Platinum Catalysts (T. M. Grishina, Ye. V

JPRS Report, Soviet Union, Political Affairs

DTIC Science & Technology

1989-05-18

crops and grapes which go from production plan was less than half fulfilled, said Viktor here to the city market . This brings the farm a good deal...hurriedly describing the advan- that go back to the days of communal existence- tages of the market from the point of view of effective - traditions of...Ye. Dodolev; MOSKOVSKA YA PRA VDA, 31 Dec 88; 3, 4 Jan 89] ......................................................... 59 Evaluating Effectiveness of

Sensing Biological, Chemical, and Radiation Hazards in Harsh Environment

DTIC Science & Technology

2013-07-05

has supported research to develop multimodal microcantilever gas sensing, to investiate the mechanical properties of Zn and Sn oxide nanobelts for...properties of Zn and Sn oxide nanobelts for mechanical detection, nanoscale assembly of magnetic nanomaterials into user defined shapes, noise properties of...2013 1.00 L. Ye, B. Terry, O. T. Mefford, C. Rinaldi, T. M. Crawford. All- nanoparticle concave diffraction grating fabricated by self-assembly onto

Development of Conventional and Real-Time Reverse Transcription Polymerase Chain Reaction Assays to Detect Tembusu Virus in Culex tarsalis Mosquitoes

DTIC Science & Technology

2014-08-11

methods for determining potential human health hazards , especially in field environment set- tings. We described the development of sensitive and specific...Smith, Department of Microbiology , Immunology and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort...2012. Adapted Tembusu-like virus in chickens and geese in China. J Clin Microbiol 50: 2807–2809. 7. Yun T, Ye W, Ni Z, Zhang D, Zhang C, 2012

Fortification of Wheat Bread with Agroindustry By-Products: Statistical Methods for Sensory Preference Evaluation and Correlation with Color and Crumb Structure.

PubMed

Martins, Z E; Pinho, O; Ferreira, I M P L V O

2017-09-01

The use of agroindustry by-products (BP) for fortification of wheat bread can be an alternative to waste disposal because BP are appealing sources of dietary fiber. Moreover, it may also contribute to indirect income generation. In this study, sensory, color, and crumb structure properties of breads fortified with fiber rich fraction recovered from four types of agroindustry BP were tested, namely orange (OE), pomegranate (PE), elderberry (EE), and spent yeast (YE). Statistical models for sensory preference evaluation and correlation with color and crumb structure were developed. External preference mapping indicated consumer preferences and enabled selection of the concentrations of BP fibre-rich fraction with best acceptance, namely 7.0% EE, 2.5% OE, 5.0% PE, and 2.5% YE. Data collected from image analysis complemented sensory profile information, whereas multivariate PLS regression provided information on the relationship between "crust color" and "crumb color" and instrumental data. Regression models developed for both sensory attributes presented good fitting (R 2 Y > 0.700) and predictive ability (Q 2 > 0.500), with low RMSE. Crust and crumb a* parameters had a positive influence on "crust color" and "crumb color" models, while crust L* and b* had a negative influence. © 2017 Institute of Food Technologists®.

Self-Consistent Frequency Sweeping of TAE mode

NASA Astrophysics Data System (ADS)

Wang, Ge

2012-03-01

We have extended our intuitive Toroidal Alfven Wave (TAE) model [1] for describing spontaneous frequency sweeping by a destabilizing component of energetic particles. Now a fully developed self-consistent description for frequency sweeping of an isolated TAE mode has been developed. As in [1], we use the Rosenbluth, Berk,Van Dam tip theory [2], valid for low beta, large aspect ratio, circular tokamaks, to describe the evolution of the TAE wave equation. The wave is coupled to the particle dynamics that uses the Berk, Breizman, Ye map model [3] to construct the particle/wave Lagrangian associated with a phase space dependent mode structure. Then together with the appropriate Vlasov equation for describing the particle dynamics, a set of equations determining the dynamics of the system has been formulated. Adiabatic solutions have been obtained and work is underway in simulating the exact nonlinear dynamics. A status report of our results will be given at the meeting. [4pt] [1] G. Wang and H. L. Berk, Communication in Nonlinear Science and Numerical Simulation 17, 2179 (2012) [0pt] [2] M. N. Rosenbluth,; H. L. Berk, J. Van Dam and D. M. Lingberg, Phys. Rev. Lett. 68, 596 (1992). [0pt] [3] Berk, H.L.; Breizman, B.N.; Ye, H. In: Physics of Fluids B 51993, 1506 (1993)

Elicitor-induced transcription factors for metabolic reprogramming of secondary metabolism in Medicago truncatula

PubMed Central

Naoumkina, Marina A; He, XianZhi; Dixon, Richard A

2008-01-01

Background Exposure of Medicago truncatula cell suspension cultures to pathogen or wound signals leads to accumulation of various classes of flavonoid and/or triterpene defense molecules, orchestrated via a complex signalling network in which transcription factors (TFs) are essential components. Results In this study, we analyzed TFs responding to yeast elicitor (YE) or methyl jasmonate (MJ). From 502 differentially expressed TFs, WRKY and AP2/EREBP gene families were over-represented among YE-induced genes whereas Basic Helix-Loop-Helix (bHLH) family members were more over-represented among the MJ-induced genes. Jasmonate ZIM-domain (JAZ) transcriptional regulators were highly induced by MJ treatment. To investigate potential involvement of WRKY TFs in signalling, we expressed four Medicago WRKY genes in tobacco. Levels of soluble and wall bound phenolic compounds and lignin were increased in all cases. WRKY W109669 also induced tobacco endo-1,3-β-glucanase (NtPR2) and enhanced the systemic defense response to tobacco mosaic virus in transgenic tobacco plants. Conclusion These results confirm that Medicago WRKY TFs have broad roles in orchestrating metabolic responses to biotic stress, and that they also represent potentially valuable reagents for engineering metabolic changes that impact pathogen resistance. PMID:19102779

Engineering of Yersinia Phytases to Improve Pepsin and Trypsin Resistance and Thermostability and Application Potential in the Food and Feed Industry.

PubMed

Niu, Canfang; Yang, Peilong; Luo, Huiying; Huang, Huoqing; Wang, Yaru; Yao, Bin

2017-08-30

Susceptibility to proteases usually limits the application of phytase. We sought to improve the pepsin and trypsin resistance of YeAPPA from Yersinia enterocolitica and YkAPPA from Y. kristensenii by optimizing amino acid polarity and charge. The predicted pepsin/trypsin cleavage sites F89/K226 in pepsin/trypsin-sensitive YeAPPA and the corresponding sites (F89/E226) in pepsin-sensitive but trypsin-resistant YkAPPA were substituted with S and H, respectively. Six variants were produced in Pichia pastoris for catalytic and biochemical characterization. F89S, E226H, and F89S/E226H elevated pepsin resistance and thermostability and K226H and F89S/K226H improved pepsin and trypsin resistance and stability at 60 °C and low pH. All the variants increased the ability of the proteins to hydrolyze phytate in corn meal by 2.6-14.9-fold in the presence of pepsin at 37 °C and low pH. This study developed a genetic manipulation strategy specific for pepsin/trypsin-sensitive phytases that can improve enzyme tolerance against proteases and heat and benefit the food and feed industry in a cost-effective way.

Comfort Ye My People: Chaplains, Spiritual Care, and Operational Stress Injury

DTIC Science & Technology

2011-04-30

differently, offering "both ·a degree of predictability and an element of surprise.ඉ In the Hebrew Scriptures we read of Jacob who wrestles through...by the use of spiritual practices such as: prayer, meditation, Yoga, Bible reading, reading of other sacred Scripture, a twelve-step program

A new genus and species of false vampire (Chiroptera: Megadermatidae) from peninsular Thailand.

PubMed

Soisook, Pipat; Prajakjitr, Amorn; Karapan, Sunate; Francis, Charles M; Bates, Paul J J

2015-03-16

A new genus and associated species of false vampire, family Megadermatidae, are described based on three specimens from Bala Forest, Narathiwat Province, peninsular Thailand. The new taxon is characterised by a unique combination of distinctive dental, cranial, and external characters, some of which are shared with exclusively African genera and some with Asian genera. These characters are comparable to, or exceed in number, those differentiating currently recognised genera in the family Megadermatidae. They include the absence of a first upper premolar; greatly enlarged upper canine without an anterolingual cingular cusp but with a robust posterolingual cusp; unmodified upper first molar with the preparacrista subequal in length to the postmetacrista, the metastyle not reduced and situated labially; robust lower canine without an anterolingual cusp; the first lower premolar enlarged, equal to or larger than the second lower premolar. In the skull, there is a pronounced rostral depression but no well developed frontal shield with preorbital and/or postorbital processes; the coronoid process is greatly enlarged in each half mandible. Externally, the body size is relatively large and the posterior noseleaf is rounded. The baculum has a robust shaft and two short prongs-the bacula of all five other species of megadermatid are illustrated for the first time; extraordinarily, those of Macroderma gigas and Megaderma lyra comprise two separate bones. DNA barcoding indicate a genetic divergence of about 20 percent (sequence divergence in the mitochondrial gene CO1) between the new genus and species of Megaderma and Cardioderma. Currently, despite numerous bat surveys in peninsular Thailand, the new genus is only known from Bala Forest. The small area of this forest and the very low capture rate suggest that the new species may be extremely rare. Its natural history is little known, although its robust dental and cranial features when coupled with chance observations of its

Quaternary volcanic evolution in the continental back-arc of southern Mendoza, Argentina

NASA Astrophysics Data System (ADS)

May, Venera R.; Chivas, Allan R.; Dosseto, Anthony; Honda, Masahiko; Matchan, Erin L.; Phillips, David; Price, David M.

2018-07-01

The Payenia Basaltic Province (PBP) is the largest and the northernmost of the Quaternary back-arc Patagonian basaltic provinces in South America. In the last 10 years, several studies have investigated either, the geochemistry or the geochronology of this basaltic province. However, only a few investigations have focused on the two aspects simultaneously in order to reconstruct its Quaternary volcanic history. Consequently, this study aims to provide new Quaternary ages and to contribute in understanding how its geochemistry evolved though time. In the current study nine basaltic flows from the PBP in central west Argentina were dated using a combination of cosmogenic surface exposure, 40Ar/39Ar, and thermoluminescence dating methods. Seven flows have Middle to Late Pleistocene ages and two erupted in the Holocene. Using the new ages here inferred and the previously published Quaternary geochronology, together with the available geochemical data, maps of Pleistocene geochemical evolution have been generated. These maps indicate that two geochemically distinct magma types erupted over the same time interval (ca. 1.5 Ma) within the PBP: In the north-eastern part (Nevado volcanic field) of the province, an arc-like signature is distinguishable, whereas the southern part of the PBP (Río Colorado volcanic field) exhibits an intraplate, Ocean Island Basalt (OIB)-like signature. The arc-like signature decreases in the Early to Middle Pleistocene as indicated by a reduction in Ba/La and La/Ta values in the Nevado volcanic field. At ca. 0.25 Ma a similar disparity has been inferred between two volcanic fields on the western part of the PBP, one erupting lavas with arc-like characteristics and the other with OIB-like signatures, despite being only tens of kilometres apart. Holocene volcanism is restricted to the western side of the Payún Matrú volcanic field and is dominated by OIB-like signatures, notably high Ta/Hf and low Ba/La and La/Ta values.

Measures of Effectiveness-CONUS Reorganization 1973 (As Pertains to FORSCOM, TRADOC, HSC, OTEA and CAA). Volume I. Executive Summary

DTIC Science & Technology

1974-11-01

obvioun that they were’ dkep]y corncented a d halrd at work in &,tvrloping meaw to masure their rmT effectiveness . This proposed eval- tiatiot plIn wilt be...AD/A-002 532 MEASURES OF EFFECTIVENESS -CONUS REORCAN- IZATION 1973 (AS PERTAINS TO FORSCOM. TRADOC, HSC, OTEA AND CAA). VOLUME I.EXECUTIVE SUMMARY M...resulting Interaction organizational objective goal effectiveness imovati ye chanuge vrasurement are a The study provider, an evaluatinn plan, "ased

Development of Technologies for Early Detection and Stratification of Breast Cancer

DTIC Science & Technology

2016-12-01

heterogeneous nature of these cells. Figure 17 shows a yellow emitting Pdot (semiconducting polymer dot), which is a new family of ultra-bright fluorescent...Yu, J., Zhang, X., Sun, W., Ye, F., Wu, I., Zhang, Y., Hayden, S., Zhang, Y., Wu, C., Chiu, D.T. "New yellow fluorescent semiconducting polymer dots...fluorescent fluorinated semiconducting polymer dots for cellular imaging and analysis" Chemical Communication, 2013, 49, 8256-8258. • Zhao, M., Wei, B

Current Chinese Leadership: Background, Associations, and Issues for Selected Key Military Leaders

DTIC Science & Technology

1985-09-01

58 years old). Key leaders classified as conservative, such as Ye Jianying and Xu Xiangqian, lost their influential positions in September 1985...Cmte, CCP-CC (since Oct 83); VC, Central Greening Cmte (since Feb 82) Name;Jiang Xianchen Position; Deputy Chief, PLA GSD (since Mar 85) Name; Li ...Guang Position; Dir, Weapons & Equipment Dept, PLA GSD (since Nov 82) Name; Li Jing Position; Dep Cdr, PLA Navy (since Jul 83) Name; Li Jiulong

JPRS Report, Science & Technology, USSR: Life Sciences

DTIC Science & Technology

1988-04-05

Order Boundary Conditions [A.N. Zaikin; BIOFIZIKA, Nov-Dec 87] 4 Biotechnology Optimization of Batch Cultivation of Biomass [Ye.G. Kosman, I.P...Vol 297, No 4 , Dec 87 (manuscript received 17 Jul 87) pp 1018-1021 [Article by I.B. Kaplan, S.I. Malyshenko, A.B. Fedina, M.E. Talyanskiy, M.Ya...Crosslinking and Effects on Combination of Retinal With Bacterioopsin 18400193 Moscow BIOLOGICHESKIYE MEMBRANY in Russian Vol 4 , No 11, Nov 87

Multifunctional Poly(2,5-benzimidazole)/Carbon Nanotube Composite Films

DTIC Science & Technology

2010-01-01

Multifunctional Poly(2,5- benzimidazole )/Carbon Nanotube Composite Films JI-YE KANG,1 SOO-MI EO,1 IN-YUP JEON,1 YEONG SUK CHOI,2 LOON-SENG TAN,3 JONG...molecular-weight poly(2,5- benzimidazole ) (ABPBI). ABPBI/carbon nanotube (CNT) compo- sites were prepared via in situ polymerization of the AB-monomer in the...polymerization; multiwalled carbon nanotube (MWCNT); nano- composites; poly(2,5- benzimidazole ); (ABPBI); polycondensa- tion; poly(phosphoric acid); single-walled

Bibliography of Soviet Laser Developments, Number 52, March - April 1981.

DTIC Science & Technology

1982-05-17

KNbOj crystal and pumped by the second harmonic of a YAG laser. KE, no. 4, 1981, 715-721. 187. Soldatov, A.N., V.B. Sukhanov , Yu.P. Polunin, and A.I...27.63SLOBODYANYUC A V 36 SUENDER D 96 TOLSTOY M N 7SNIRNOY A N 88 SUKHANOV V B 30 TOMCHUK YE YA 59SMIRNOY D F 37 SUI(HANOVA G3 B 15 TOHILINA V 1 60S?4IRNOV S

Precision Atomic Beam Laser Spectroscopy

DTIC Science & Technology

1999-02-20

optical efficiency with a new coupled- cavity scheme. We have locked a MISER Nd:YAG laser to a finesse 50,000 cavity with a...sensitivity of optical heterodyne detection is preserved with ZERO sensitivity to small laser / cavity frequency noises. The new method is called Noise-Immune...1996), P. Dube, L.- S. Ma, J. Ye, and J.L.Hall. 9 . "Free-induction decay in molecular iodine measured with an extended - cavity diode laser ,"

Thermal Management as a Force Multiplier within the Research, Development, and Engineering Command (RDECOM)

DTIC Science & Technology

2012-08-01

pp. 4–9. 46. Ye, Liang; Tong, Ming Wei; Zeng, Xin Design and Analysis of Multiple Parallel-pass Condensers. International Journal of Refrigeration...we mean energy that has low availability to do work (low exergy ). The closer a system is to the condition of its surroundings in terms of...vehicle with a gasoline internal combustion engine loses 40% of its fuel energy through the exhaust gas, which is still at a relatively high

JPRS Report, Science & Technology, USSR: Life Sciences

DTIC Science & Technology

1987-07-09

87) 59 Prophylactic Effectiveness of Epsilon- Aminocaproic Acid (EACA) on Influenza in Mice (L.Ye. Puzis, V.P. Lozitskiy, et al.; ACTA VIROLOGICA...EFFECTIVENESS OF EPSILON- AMINOCAPROIC ACID (EACA) ON INFLUENZA IN MICE Bratislava ACTA VIROLOGICA in Russian Vol 30, No 1, Jan 86 (manuscript received 17...MEDITSINSKOY KHIMII, No 4, Jul-Aug 86) 59 Effects of Novel Antineoplastic Blastozole on Nucleic Acid Levels and DNA Synthesis in Cancer Cells (S.N

Bibliography of Soviet Laser Developments, March-April 1988

DTIC Science & Technology

1988-08-01

f. Iodine g. Hydrogen h. Ammonia --- i. Carbon Tetrafluoride --- j. Nitrous Oxide k. Water Vapor I. Heavy-Water Vapor --- m. Submillimeter --- n...1988, 25-26. 36. Porskiy, Yu.Ye.; Sitenkov, Yu.L.; Khokhlov, Yu.M. (-0-). Influence of the discharge circuit inductance on the value of specific...Hydrogen h. Ammonia i. Carbon Tetrafluoride j. Nitrous Oxide k. Water Vapor 1. Heavy-Water Vapor m. Submillimeter 9 n. Metal Vapor 59. Astadzhov, D.N

Proceedings of the 1993 Complex Systems Engineering Synthesis and Assessment Technology Workshop (CSESAW 󈨡)

DTIC Science & Technology

1993-10-17

34, "in criteria, and scoring each applicable high resolution mode’, "within 10 minutes of element as I (satisfactory) or 0 power -on...everone ese, humanity. We humans are kowledg limited and we The specificatio concept development design, and ye the problem caused by that limitation...human task that is component, we would have 53=125 integration spaces. within the power of a normal, single, specialized As you can imagine this could

Bibliography of Soviet Laser Developments, No. 17, July - September 1974

DTIC Science & Technology

1975-01-29

A . N. Tokare and V . M. Usova (0). Effect of structural differ va. ences in flashlamps on the efficiency of solid state lasers...USATYUK, V.V. USHAKOV. A . Yt». USMANOV, A . G. USMANOV, R.G. USOVA , V . M. UZKIY. A . E. VALYASHKO, YE.G. VAREOLOMEYEV. A.A...ot’ power oulpul In a ruby laser with self-Q- switching. ZhPS, v . 20, no. 6, 1974, 987-989. 2, Kopvillem, U. Kh. , V .

Bibliography of Soviet Laser Developments

DTIC Science & Technology

1975-09-22

Nagibarov, V. R. , I. A. Nagibarova, and A. M. Shegeda (0). Nonresonant supermigration [of energy ] in concentrated specimens of ruby. ZhETF P...Korniyenko (1). Relationship of luminescence energies of various transitions with the metastable level of the Nd ion in glass. KE, no. 2, 1975...12Ye8) 98. 99. 100. Anan’kin, A. I. (0). Calculating the energy characteriitJcs of a thermally excited CG-, laser. KE, no. 1, 1975

USA: Economics, Politics, Ideology No. 7, Jul 1978

DTIC Science & Technology

1978-09-22

121 United States and Canadian Underwater Vehicles ( I . B . Ikonnikov, G . P. Lisov) 122 Book Reviews Washington’s Budget Policy, "by Ye. P...Federal Program Information Bill (A.A. Voronkov, G . B . Kochetkov) 105 Focus on Western Europe (T. V. Oberemko) 112 - a - [III - USSR - 39...well, and the exam will, hopefully, corroborate this. Each student can select a particular topic in advance for in-depth study; during the exam, I

USSR Report, Life Sciences Biomedical and Behavioral Sciences.

DTIC Science & Technology

1987-05-13

Activities of Selected Organoboron Compounds (A.N. Lukashik, A.A. Malama, et al.; MIKOLOGIYA I FTTOPATOLOGIYA, No 5, Sep-Oct 86) .35 - e - Mycotic Flora... Compounds (G.B. Pliss, N.N. Antashkova, et al.; VOPROSY ONKOLOGII, No 7, Jul 86). • • 94 Review of Book on Protection of Machinery From Biodegradation...Jul 85) pp 746-751 [Article by K.Ye. Dorokhov and G.L. Grigoryan, Scientific Research Institute for Biological Testing of Chemical Compounds

JPRS Report, Soviet Union, Political Affairs.

DTIC Science & Technology

1989-10-03

18000602 Moscow PRA VDA in Russian 2 Aug 88 p 3 [Article by I . Zarakhovich and T . Trukhacheva, journal- ists, and Ye. Sokolova, member, Central Council...QTJAUn INSP1CH3B t Soviet Union Political Affairs JPRS-UPA-88-044 CONTENTS 03 OCTOBER 1989 PARTY, STATE AFFAIRS History of Formation of Nagorno...Advocated //. Zarakhovich, T . Trukhacheva; PRAVDA, 2 Aug 88] 86 REGIONAL ISSUES Biologist on Costs of Pollution Control Measures [A. Valentey

JPRS Report, Science & Technology, USSR: Science & Technology Policy

DTIC Science & Technology

1990-09-18

Ye. Ponarina; POISK, 22-28 Jun 90] .. ■ ■ 7 People’s Deputies Propose Scientific- Industrial Union [SOVETSKAYA ROSSIYA, 18 May 90] 10...achievements of science and tech- nology in industry and other spheres of life, and for material and technical and financial support for the planned work, and...low: even in machine building it does not exceed 40 percent. Due to the slow penetration in industry of new techno- logical processes and systems

Immunological Study of the O-Antigens of Streptomycin-Dependent Mutants of Salmonella

DTIC Science & Technology

1974-10-23

AD/A-O00 361 IMMUNOLOGICAL STUDY OF THE O-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA L. S. Edvabnaya, et al Foreign Technology Division...U. S. Air Force SREPORT TITLE IMMUNOLOGICAL STUDY OF THE 0-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA 4 DCESCRIPTIVIE NOTES (?T’pe of...THE O-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA By: L. S. Yedvabnaya, Ye. S. Stanislavskiy, and V. V. Sergeyev Englihs pages: 10 Source

JPRS Report, Science & Technology USSR: Lift Sciences

DTIC Science & Technology

1987-07-17

Viral Diseases and Productivity (A.D. Bobyr, A.A. Barkalova; MIKROBIOLOGICHESKIY ZHURNAL, No 5, Sep-Oct 86) 3 Culture Age as Factor in...Proteinase Production by Bacillus Subtilis (V.V. Artemov, Ye.L. Barskiy, et al.; BIOKHIMIYA, No 5, May 86).. 14 Inhibition of Glutamate Synthetase...I KLETKA, No 4, Jul-Aug 86) 27 Production of Recipient Yeasts for Stable Reproduction of Vectors Involving 2 Micron DNA (O.V. Nevzglyadova, A.G

Ceramics for High Power Lasers

DTIC Science & Technology

2011-12-01

Y3Al5O12”, Applied Physics Letters, 93, 191902 (2008) [2] I. Sakaguchi et al., J . Am. Ceram. Soc. 79 (1996), 1627 [3] http://www.vloc.com/PDFs...of growth defects in synthetic quartz crystals by light-scattering tomography “ J . Crystal Growth, Volume 44, Issue 1, August 1978, Pages 53-60...Investigator Romain Gaume - Research Scientist Roger Route - Senior Research Associate Ye He - Graduate Student Research Assistant V. Publications

12th US-Japan Seminar: Many Body Quantum Systems from Quantum Gases to Metrology and Information Processing. Held in Madison, Wisconsin on 20-24 September 2015

DTIC Science & Technology

2016-06-03

Ultracold Atoms 5:10 Zelevinsky Ye Inouye High-precision spectroscopy with two-body quantum systems Low entropy quantum gas of polar molecules New limit...12th US-Japan Seminar: Many Body Quantum Systems from Quantum Gases to Metrology and Information Processing Support was provided for The 12th US...Japan Seminar on many body quantum systems which was held in Madison, Wisconsin from September 20 to 24, 2015 at the Monona Terrace Convention Center

Very high potassium (VHK) basalt - Complications in mare basalt petrogenesis

NASA Technical Reports Server (NTRS)

Shervais, J. W.; Taylor, L. A.; Laul, J. C.; Shih, C.-Y.; Nyquist, L. E.

1985-01-01

The first comprehensive report on the petrology and geochemistry of Apollo 14 VHK (Very High Potassium) basalts and their implications for lunar evolution is presented. The reported data are most consistent with the hypothesis that VHK basalts formed through the partial assimilation of granite by a normal low-Ti, high-Al mare basalt magma. Assimilation was preceded by the diffusion-controlled exchange of alkalis and Ba between basalt magma and the low-temperature melt fraction of the granite. Hypotheses involving volatile/nonvolatile fractionations or long-term enrichment of the source regions in K are inconsistent with the suprachondritic Ba/La ratios and low initial Sr-87/Sr-86 ratios of VHK basalt. An important implication of this conclusion is that granite should be a significant component of the lunar crust at the Apollo 14 site.

Group-Based Yogic Weight Loss with Ayurveda-Inspired Components: A Pilot Investigation of Female Yoga Practitioners and Novices.

PubMed

Braun, Tosca D; Park, Crystal L; Gorin, Amy A; Garivaltis, Hilary; Noggle, Jessica J; Conboy, Lisa A

2016-01-01

Overweight/obesity is a pressing international health concern and conventional treatments demonstrate poor long-term efficacy. Preliminary evidence suggests yoga and Ayurveda may be promising approaches, although recent NHIS estimates indicate rare utilization of Ayurveda in the US. Group-based curricula that integrate yoga and Ayurveda-inspired principles to attenuate overweight and obesity across individuals may prove a feasible, disseminable clinical adjunct to facilitate psychosocial health and weight loss and/or maintenance. Determine feasibility and preliminary effectiveness of a ten-week yoga - based, Ayurveda-inspired weight management curriculum (YWL) piloted in female yoga practitioners (Study 1) then refined and tailored for yoga naïves (Study 2), on self-reported psychosocial process variables and % of self-reported total body weight loss (%TBWL). Study 1 enrolled 22 yoga-experienced women (48.2 ± 14.3 years, BMI 30.8 ± 4.2 kg/m2) in a 10-week yoga-based program (YWL-YE). Study 2 enrolled 21 yoga- naïve women (49.4 ± 10.7 years, BMI 35.5 ± 6.8 kg/m2) in a revised 10-week program (YWL-YN). Self-reported weight and self-ratings of mindful eating behavior, body image disturbance, weight loss self-efficacy, body awareness, and self-compassion were collected at baseline, post-treatment (T2), and 3-month follow- up (T3). YWL curricula was feasible in both studies. While attrition rates for both studies favorably compared to other weight management studies, attrition was higher for YWL-YN (28.6%) than YWL-YE (18.2%). In both studies, self-reported process variables and self-reported % TBWL changed in hypothesized directions at T2 and evidenced greater improvement at T3; effect sizes across all process variables were medium (-0.4) to large (-1.8). % TBWL reached clinical significance (>5%) only at T3 for the YWL-YE group. The YWL curricula employed here appear to improve psychosocial health among both overweight/obese yoga-experienced and yoga- na

Group-Based Yogic Weight Loss with Ayurveda-Inspired Components: A Pilot Investigation of Female Yoga Practitioners and Novices.

PubMed

Braun, Tosca D; Park, Crystal L; Gorin, Amy A; Garivaltis, Hilary; Noggle, Jessica J; Conboy, Lisa A

2016-09-01

Overweight/obesity is a pressing international health concern and conventional treatments demonstrate poor long-term efficacy. Preliminary evidence suggests yoga and Ayurveda may be promising approaches, although recent NHIS estimates indicate rare utilization of Ayurveda in the US. Group-based curricula that integrate yoga and Ayurveda-inspired principles to attenuate overweight and obesity across individuals may prove a feasible, disseminable clinical adjunct to facilitate psychosocial health and weight loss and/or maintenance. Determine feasibility and preliminary effectiveness of a ten-week yoga-based, Ayurveda-inspired weight management curriculum (YWL) piloted in female yoga practitioners (Study 1) then refined and tailored for yoga naïves (Study 2), on self-reported psychosocial process variables and % of self-reported total body weight loss (%TBWL). Study 1 enrolled 22 yoga-experienced women (48.2 ± 14.3 years, BMI 30.8 ± 4.2 kg/m2) in a 10-week yoga-based program (YWL-YE). Study 2 enrolled 21 yoga- naïve women (49.4 ± 10.7 years, BMI 35.5 ± 6.8 kg/m2) in a revised 10-week program (YWL-YN). Self-reported weight and self-ratings of mindful eating behavior, body image disturbance, weight loss self-efficacy, body awareness, and self-compassion were collected at baseline, post-treatment (T2), and 3-month follow- up (T3). YWL curricula was feasible in both studies. While attrition rates for both studies favorably compared to other weight management studies, attrition was higher for YWL-YN (28.6%) than YWL-YE (18.2%). In both studies, self-reported process variables and self-reported % TBWL changed in hypothesized directions at T2 and evidenced greater improvement at T3; effect sizes across all process variables were medium (-0.4) to large (-1.8). % TBWL reached clinical significance (>5%) only at T3 for the YWL-YE group. The YWL curricula employed here appear to improve psychosocial health among both overweight/obese yoga-experienced and yoga-naïve women

Report of Class II Survey and Testing of Cultural Resources at the WIPP (Waste Isolation Pilot Plant) Site at Carlsbad, New Mexico,

DTIC Science & Technology

1987-05-01

a ;-A.act! ye Cune led mcl.t. a Iong I l’ nlortheasternf p i- tcr of ; e s~ e e uA n it w,’a 0 .;Taq"eI t1bf td o tie re:’ p. *, a. ~: t I..c() rvf ...just starting so they maue extra money selling milk to the Lniners. Thv-y kept eight or ten dairy cows and a small hierd of cattle. Th-e famrilly herded

Instructional Videos for Unsupervised Harvesting and Learning of Action Examples

DTIC Science & Technology

2014-11-03

collection of image or video anno - tations has been tackled in different ways, but most existing methods still require a human in the loop. The...the views of ARO and NSF. 7. REFERENCES [1] C.-C. Chang and C.- J . Lin. LIBSVM: A library for support vector machines. In ACM Transactions on...feature encoding methods. In BMVC, 2011. [3] J . Chen, Y. Cui, G. Ye, D. Liu, and S.-F. Chang. Event-driven semantic concept discovery by exploiting

History of the Great Patriotic War of the Soviet Union, 1941-1945. Volume 6. Results of the Great Patriotic War,

DTIC Science & Technology

1982-10-06

Under %he peculiar conditions of Second World War this Leninist prediction/forecast completely justified. The process of the nonuniform development of...and resourcefulness were required heroines Ye. G. Mazanik, N. V. Troyan and M. B. Osipovoy in order to select into the very lair of deputy Hitler in...the front, in the rear, in the lair of enemy - to give entire their energy to the work of victory were that decisive force which gave rise to the mass

Modeling, Analysis, and Control of Swarming Agents in a Probabilistic Framework

DTIC Science & Technology

2012-11-01

configurations, which can ultimately lead the swarm towards configurations close to the global minimum of the total potential of interactions. The drawback ...165–171, 1992. [6] H. Ye, H. Wang, and H. Wang, “Stabilization of a PVTOL aircraft and an inertia wheel pendulum using saturation technique,” IEEE...estimate its parameters. The drawback of this approach is that the assumed form of the field can be unrealistic. In the approach that we are presenting here

Translations on Narcotics and Dangerous Drugs, Number 278

DTIC Science & Technology

1976-12-30

present. Cabinet’s decision was announced yesterday by the Minister for business and consumer affairs, Mr Howard, who said the new penalties would be im...BEHIND OPIUM TRAFFICKING Rangoon BOTATAUNG in Burmese 13 Dec 76 p 5 BK /Article by Ye Mya Win: "The Communist Party of Burma Is Doing Good Business ...Lashio, Kunlong and Muse have then sent out their men to buy these goods for redistribution. There is also another business : brandishing their arms

A Nonlinear Model Predictive Control Algorithm for Obstacle Avoidance in Autonomous Ground Vehicles within Unknown Environments

DTIC Science & Technology

2015-04-24

xs , ys , xe , ye ) double EndPo in t s [L...Distribution Statement A. Approved for public release. #26161 350 400 450 100 150 200 250 300 350 400 450 500 550 600 x (m) y (m ) Start Target U0 = 10...longitudinal speed 350 400 450 100 150 200 250 300 350 400 450 500 550 600 x (m) y (m ) Start Target (a) Trajectory 0 5 10 15 0 1 t (s) f ( U0 = 30

Bibliography of Soviet Laser Developments, Number 76, March - April 1985.

DTIC Science & Technology

1986-06-01

515. Andreyeva, O.V.; Sukhanov , V.I.; Khazova, M.V. 0 * Experimental study on the optical characteristics of * developed layers for three-dimensional...holograms. ZNPFA, no. 6, 1985, 435-438. (RZFZA, 85/3L814). 516. Andreyeva, O.V.; Sukhanov , V.I.; Rhazova, M.V. 0 Relationship of the refractive index... Sukhanov , V.I.; Ashcheulov, Yu.V.; Petnikov, A.Ye. (GOI). Method of measuring values of the diffraction * efficiency of 3D phase holograms. OPMPA, no. 4

ONRASIA Scientific Information Bulletin. Volume 17, Number 4, October - December 1992

DTIC Science & Technology

1992-12-01

department tero-technology, and technology location is less congested and much Optical devices chair assessment), and eight endowed greener than that of the...chemi- Tel: +81 3-3481-4411 had been a very good advertisement cal compound design. Some details for Al, and in fact had moved stu- and references are...Point ment for online system. Automatesvolume, of Sale data. setting of parameters when new ter- Daa ye m c t o f Facg (ra ne minal is introduced

Bi-local holography in the SYK model

DOE PAGES

Jevicki, Antal; Suzuki, Kenta; Yoon, Junggi

2016-07-01

We discuss large N rules of the Sachdev-Ye-Kitaev model and the bi-local representation of holography of this theory. This is done by establishing 1/N Feynman rules in terms of bi-local propagators and vertices, which can be evaluated following the recent procedure of Polchinski and Rosenhaus. Lastly, these rules can be interpreted as Witten type diagrams of the dual AdS theory, which we are able to define at IR fixed point and off.

The Legality of al-Qaeda’s Jihad

DTIC Science & Technology

2011-05-19

directly from the Koran in such verses as, “Allah promiseth you much booty that ye will capture, and hath given you this in advance, and hath withheld...jihad and how it is to be divided. According to al- Misri, Muslim men waging jihad are entitled to personal booty and a share of the collective spoils...provided they participated in the battle to the end of it. Eligibility for the personal booty requires that the jihadist overcome enemy resistance

Inversion of Ionospheric Backscatter Radar Data in Order to Map and Model the Ionosphere

DTIC Science & Technology

2006-08-17

M., Wild, J . A., Lester, M., Yeoman, T . K., Milan, S. E., Ye, H., Devlin, J . C., Frey, H. U., and Kikuchi, T ., Interhemispheric asymmetries in the...Devlin, J . and Salim, T ., Evaluation of Digital Generation and Phasing Techniques for Transmitter Signals of the TIGER N.Z. Radar. WARS02 (Workshop on...17. Conde, M. and Dyson, P. L., Thermospheric Vertical Winds Above Mawson , Antarctica, J . Atmos. Terr. Phys., Vol. 57, 589-596, 1995. 18. Conde, M

13TH Scientific Session of the Ukrainian Scientific Research Institute of Eye Diseases Imeni Porf. L. L. Girshman.

DTIC Science & Technology

1960-07-29

changes. A broad application of ascorbic acid in the therapy of inflammatory and degenerative ailments of the cornea was proposed. Ye. M. Orlova...accumulation of cholesterol and phosphatides occurs, leading to an opacity of the fibers. In X-ray cataract the opacity of the fibers apparently occurs...corneal spots and the indices he had developed for repeated transplant of the cornea . The reports of Cand. of Med. Sei. N. I. Pil’man (Kiev; and Cand

Installation Restoration Program. Phase 1. Records Search Andrews AFB. Maryland

DTIC Science & Technology

1985-06-01

red to silvery-qrey, functions ma a conf ining bed. Formation. ~Va plastics thin lonses of pole gray silt. Ann"a Formation. ye (0-210 sand, qrsenieh...the Nanjemoy Formation (a clayey glauconi- tic sand, two to thirty feet thick) and the Marlboro Clay (a plastic clay with silt partings, two to... plastics , empty 55-gallon drums, waste lumber, tires, pipes, and hospital wastes such as unused needles and chemical reagents. In the past, Site D-4 was

Excitatory Amino Acids as Transmitters in the Brain

DTIC Science & Technology

1989-04-30

Amino Acids as Transmitters in the Brain 12 PERSONAL AUTHOR(S) Cotman, C.W. 13a TYPE OF REPORT 1i3b TIME OYERED 14. DATE OF REPORT (Ye, Month, Day) 5s...necenearia i dentf by block number) FIEL.D GROUP SBGOP Excitatory receptors, excitatory amino acids , excitotoxicit N-methyl-D-aspartate, kainate...mediated by excitatory amino acids and their receptors. These receptors participate in both standard synaptic transmission as well as higher order

Observations of the new Camelopardalids meteor shower using a 38.9 MHz radar at Mohe, China

NASA Astrophysics Data System (ADS)

Younger, J. P.; Reid, I. M.; Li, G.; Ning, B.; Hu, L.

2015-06-01

The Camelopardalids meteor shower was predicted to occur for the first time on 24 May 2014, based on optical observations of the comet 209P/LINEAR. Using a 38.9 MHz meteor radar located at Mohe, China, we were able to detect approximately 590 shower meteors originating from an average pre-infall radiant of R.A. = 129.1° ± 9.8°, declination = 79.4° ± 1.6° (J2000) with a geocentric velocity of 16.0 ± 1.6 km s-1. Measurements of the shower duration, direction, velocity, and individual meteor detection heights facilitated a detailed analysis of the parent debris stream. Orbital parameters were calculated including a semi-major axis of 2.86 AU, eccentricity of 0.659, and inclination of 21.1°. Combining orbital parameters with the shower activity duration FWHM of 5.09 h, it was found that the stream has a FWHM of at least 211,000 km at 1 AU, as measured perpendicular to the direction of orbital motion. A comparison of shower meteor detection heights and diffusion coefficient estimates with the sporadic background is consistent the prediction of Ye and Wiegert (Ye, Q., Wiegert, P. [2014]. Mon. Not. R. Astron. Soc. 437, 3283-3287) that Camelopardalid meteoroids are biased towards larger sizes or that Cameloppardalid meteoroids are less fragile than sporadic background meteoroids.

Genetic diversity of Pinus nigra Arn. populations in Southern Spain and Northern Morocco revealed by inter-simple sequence repeat profiles.

PubMed

Rubio-Moraga, Angela; Candel-Perez, David; Lucas-Borja, Manuel E; Tiscar, Pedro A; Viñegla, Benjamin; Linares, Juan C; Gómez-Gómez, Lourdes; Ahrazem, Oussama

2012-01-01

Eight Pinus nigra Arn. populations from Southern Spain and Northern Morocco were examined using inter-simple sequence repeat markers to characterize the genetic variability amongst populations. Pair-wise population genetic distance ranged from 0.031 to 0.283, with a mean of 0.150 between populations. The highest inter-population average distance was between PaCU from Cuenca and YeCA from Cazorla, while the lowest distance was between TaMO from Morocco and MA Sierra Mágina populations. Analysis of molecular variance (AMOVA) and Nei's genetic diversity analyses revealed higher genetic variation within the same population than among different populations. Genetic differentiation (Gst) was 0.233. Cuenca showed the highest Nei's genetic diversity followed by the Moroccan region, Sierra Mágina, and Cazorla region. However, clustering of populations was not in accordance with their geographical locations. Principal component analysis showed the presence of two major groups-Group 1 contained all populations from Cuenca while Group 2 contained populations from Cazorla, Sierra Mágina and Morocco-while Bayesian analysis revealed the presence of three clusters. The low genetic diversity observed in PaCU and YeCA is probably a consequence of inappropriate management since no estimation of genetic variability was performed before the silvicultural treatments. Data indicates that the inter-simple sequence repeat (ISSR) method is sufficiently informative and powerful to assess genetic variability among populations of P. nigra.

Comparative Study of the Effects of Citral on the Growth and Injury of Listeria innocua and Listeria monocytogenes Cells

PubMed Central

Silva-Angulo, Angela B.; Zanini, Surama F.; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio

2015-01-01

This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 102 and 106 cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral. PMID:25643164

Comparative study of the effects of citral on the growth and injury of Listeria innocua and Listeria monocytogenes cells.

PubMed

Silva-Angulo, Angela B; Zanini, Surama F; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio

2015-01-01

This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 10(2) and 10(6) cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral.

Initiator system in holographic photopolymer materials

NASA Astrophysics Data System (ADS)

Ortuño, M.; Fernández, E.; Fuentes, R.; Gallego, S.; Márquez, A.

2010-05-01

The photopolymers with a hydrophilic matrix as poly(vinyl alcohol), PVA, are versatile holographic recording materials in hologram recording experiments. They use water as solvent and they can be made in layers with several thickness. One of the photopolymers more used is composed of acrylamide as polymerizable monomer, PVA and water as binder. The pair: triethanolamine, TEA, and the dye yellowish eosin, YE, is widely used as initiator system due to its high sensitivity and efficiency. TEA is the radical initiator more used with dyes derived from fluorescein as YE because they can generate a radical by redox reaction under dye excitation by light. The dye is bleached in this process because is decomposed in the photoinitiation reaction. The ethylenediaminetetraacetic acid EDTA has a molecular structure very similar to TEA and therefore could replace it in this kind of photopolymers. The 4,4' azo-bis-(4-cyanopentanoic acid), ACPA, is a radical initiator that is soluble in water and usually used in polymerizations in solution with thermal initiation. In this work, we use EDTA and ACPA in order to check their properties as radical initiator in the photochemical reaction that takes place inside the photopolymer while a hologram is being recorded. We will compare the results obtained with those derived from TEA and will evaluate the possibilities for these substances.

Effect of sampling and short isolation methodologies on the recovery of human pathogenic Yersinia enterocolitica from pig tonsils.

PubMed

Van Damme, Inge; Berkvens, Dirk; De Zutter, Lieven

2012-07-01

The objective of this study was to determine the effect of sampling (swab samples compared to destructive samples) on isolation rates of human pathogenic Yersinia enterocolitica from pig tonsils. Moreover, the relative efficiency of different rapid, routinely applicable isolation methods was evaluated. Therefore, swab and destructive samples from tonsils of 120 pigs at slaughter were analyzed in parallel using direct plating and different enrichment methods. Salmonella-Shigella-desoxycholate-calcium chloride (SSDC) agar, cefsulodin-irgasan-novobiocin (CIN) agar, and Yersinia enterocolitica chromogenic medium (YeCM) were used as selective agar media. For enrichment, irgasan-ticarcillin-potassium chlorate (ITC) broth and peptone-sorbitol-bile (PSB) broth were incubated at 25°C for 48 h. Overall, 55 tonsils (45.8%) were positive for Y. enterocolitica bioserotype 4/O:3. Recovery was significantly higher using the destructive method compared to the swabbing method. Direct plating resulted in 47 and 28 Y. enterocolitica-positive destructive and swab samples, respectively. Alkali treatment of PSB and ITC enrichment broths significantly increased recovery of pathogenic Y. enterocolitica from destructive tonsil samples. The performance of YeCM for qualitative and quantitative isolation of pathogenic Y. enterocolitica from pig tonsils was equal to SSDC and CIN. In conclusion, direct plating and ISO 10273: 2003 with minor modifications are suitable and rapid methods for isolation of pathogenic Y. enterocolitica from destructive tonsil samples.

Using runoff slope-break to determine dominate factors of runoff decline in Hutuo River Basin, North China.

PubMed

Tian, Fei; Yang, Yonghui; Han, Shumin

2009-01-01

Water resources in North China have declined sharply in recent years. Low runoff (especially in the mountain areas) has been identified as the main factor. Hutuo River Basin (HRB), a typical up-stream basin in North China with two subcatchments (Ye and Hutuo River Catchments), was investigated in this study. Mann-Kendall test was used to determine the general trend of precipitation and runoff for 1960-1999. Then Sequential Mann-Kendall test was used to establish runoff slope-break from which the beginning point of sharp decline in runoff was determined. Finally, regression analysis was done to illustrate runoff decline via comparison of precipitation-runoff correlation for the period prior to and after sharp runoff decline. This was further verified by analysis of rainy season peak runoff flows. The results are as follows: (1) annual runoff decline in the basin is significant while that of precipitation is insignificant at alpha=0.05 confidence level; (2) sharp decline in runoff in Ye River Catchment (YRC) occurred in 1968 while that in Hutuo River Catchment (HRC) occurred in 1978; (3) based on the regression analysis, human activity has the highest impact on runoff decline in the basin. As runoff slope-breaks in both Catchments strongly coincided with increase in agricultural activity, agricultural water use is considered the dominate factor of runoff decline in the study area.

Iso-migrastatin Titer Improvement in the Engineered Streptomyces lividans SB11002 Strain by Optimization of Fermentation Conditions

PubMed Central

Wu, Xueyun; Yang, Dong; Zhu, Xiangcheng; Feng, Zhiyang; Lv, Zhengbin; Zhang, Yaozhou; Shen, Ben; Xu, Zhinan

2011-01-01

The heterologous production of iso-migrastatin (iso-MGS) was successfully demonstrated in an engineered S. lividans SB11002 strain, which was derived from S. lividans K4–114, following introduction of pBS11001, which harbored the entire mgs biosynthetic gene cluster. However, under similar fermentation conditions, the iso-MGS titer in the engineered strain was significantly lower than that in the native producer - Streptomyces platensis NRRL 18993. To circumvent the problem of low iso-MGS titers and to expand the utility of this heterologous system for iso-MGS biosynthesis and engineering, systematic optimization of the fermentation medium was carried out. The effects of major components in the cultivation medium, including carbon, organic and inorganic nitrogen sources, were investigated using a single factor optimization method. As a result, sucrose and yeast extract were determined to be the best carbon and organic nitrogen sources, resulting in optimized iso-MGS production. Conversely, all other inorganic nitrogen sources evaluated produced various levels of inhibition of iso-MGS production. The final optimized R2YE production medium produced iso-MGS with a titer of 86.5 mg/L, about 3.6-fold higher than that in the original R2YE medium, and 1.5 fold higher than that found within the native S. platensis NRRL 18993 producer. PMID:21625393

The influence of the local structure on proton transport in a solid oxide proton conductor La 0.8 Ba 1.2 GaO 3.9

DOE PAGES

Cheng, Yongqiang; Balachandran, Janakiraman; Bi, Zhonghe; ...

2017-07-18

The local structure around the mobile ions influences their dynamics. The knowledge about the relationship between these properties is of fundamental importance and may lead the way for development of improved solid state ionic conductors. Here, we use inelastic neutron scattering and ab initio modeling to study a representative proton conductor, La 0.8Ba 1.2GaO 3.9, where different local structures are possible for the same stoichiometry. The intrinsic correlations between the local bonding environment and the dynamical behavior of protons are presented. In particular, we identify how the local Ba/La concentration affects the proton vibrational frequencies, hydrogen bond strength, O–H rotationsmore » and in turn long-range proton mobility. Furthermore, possible mechanism for proton transport, through the inter-tetrahedral bond switching, O–H rotations and tetrahedral reorientation is anticipated.« less

China Macroeconomic: Summary Data Banks (China Macroeconomic: Documentation Data Banks. Volume 1. Population Gross Value Output of Agriculture and Industry).

DTIC Science & Technology

1984-11-15

3) IL- R 0 104 em fm r4. N V @f 4 . * N P - 3 a U N I 11 111Bala ---w4f ft ’D " & W. f4p r... ;;W 6.C 4’ 0 4.-49 A B C D EF G H AF25:FH/CNTG3.3GJ...A Sources, see below Load from row 12 to row 54 * - 104 - A B C D E F G H AF09:FK/PCICi.3FD revision 001 6/13/83 17:45 Prices of Industrial Crops Prices...Val Brig Ind Brig Ind Brig Ind (80 pr) (70 pr) (80 pr) (bil RMB)(bil RHB ) (bil RMB) XOBI XOBILK XOBI 1949 N/A N/A N/A 1950 N/A N/A N/A 1951 N/A N/A N/A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Yongqiang; Balachandran, Janakiraman; Bi, Zhonghe

The local structure around the mobile ions influences their dynamics. The knowledge about the relationship between these properties is of fundamental importance and may lead the way for development of improved solid state ionic conductors. Here, we use inelastic neutron scattering and ab initio modeling to study a representative proton conductor, La 0.8Ba 1.2GaO 3.9, where different local structures are possible for the same stoichiometry. The intrinsic correlations between the local bonding environment and the dynamical behavior of protons are presented. In particular, we identify how the local Ba/La concentration affects the proton vibrational frequencies, hydrogen bond strength, O–H rotationsmore » and in turn long-range proton mobility. Furthermore, possible mechanism for proton transport, through the inter-tetrahedral bond switching, O–H rotations and tetrahedral reorientation is anticipated.« less

Control of Next Generation Aircraft and Wind Turbines

NASA Technical Reports Server (NTRS)

Frost, Susan

2010-01-01

The first part of this talk will describe some of the exciting new next generation aircraft that NASA is proposing for the future. These aircraft are being designed to reduce aircraft fuel consumption and environmental impact. Reducing the aircraft weight is one approach that will be used to achieve these goals. A new control framework will be presented that enables lighter, more flexible aircraft to maintain aircraft handling qualities, while preventing the aircraft from exceeding structural load limits. The second part of the talk will give an overview of utility-scale wind turbines and their control. Results of collaboration with Dr. Balas will be presented, including new theory to adaptively control the turbine in the presence of structural modes, with the focus on the application of this theory to a high-fidelity simulation of a wind turbine.

China Report RED FLAG No 13, 1 JULY 1986

DTIC Science & Technology

1986-08-21

who were in Yanan to discuss the draft "Resolution." The group leaders, such as Li Fuchun, Ye Jianying , Nie Rongzhen, Liu Bocheng, and Chen Yi also...its nature is ’leftist’ opportunism. Compared with the two erroneous lines of Chen Duxiu and Li Lisan, this line is more perfect in form, of longer...comrades who had been attacked, including He Mengxiong, Lin Yunan, and Li Qiushi; and pointing out the important significance of the Zunyi meeting in

First Public Report on the Military Academy Chinese People’s Liberation Army Military Pictures Collection (Selected Articles),

DTIC Science & Technology

1986-10-10

Cooperation, by Liu Jienyang, Zhao Rueishan, Ze Fu .......... 35 > A Visit to the Institute of Guided Missile Technology, by Zhang Juzheng, Li Weiliang...4,. *1 .4 9- -I. .p *. .4 I-.- a. S.... .4 11 l.a. 9-.4 *49.4*~*9*~. ° - S’: Key: (1) Analyst Li Xien studies techniques hard in the field in...leader Chairman Hua, Vice Chairmen Ye Jianying , Deng Xiao- ping, Wang Dongxing and other leaders of the party, state and militaryarrived at the

USSR and Eastern Europe Scientific Abstracts, Materials Science and Metallurgy, Number 54

DTIC Science & Technology

1978-06-28

DEFEKTOSKOPIYA in Russian No 2, Feb 78 pp 49-52 manuscript received 28 Feb 77 DEVYATCHENKO, L. D., YESIPOV, I. V. , BATURINA, S. K., KIRILLOVA, G . K...received 10 Apr 77 KARPINOS, D. M., MAKSIMOVICH, G . G ., LYUTYY, YE. M., FILIPOVSKIY, A. V., and KADYROV, V. KH., Physico-Mechanical Institute and the...OBRABOTKI MATERIALOV in Russian No 1, Jan/Feb 78 pp 149-151 manuscript received 20 Jun 77 KARPINOS, D. M. and ZIL’BERBERG, V. G ., Kiev [Abstract] The

Bibliography of Soviet Laser Developments: January - February 1988

DTIC Science & Technology

1989-02-21

Organic Dyes a. Miscellaneous 64. Alekseyeva,V.I.; Butakov,A.L.; Konin,V.N.; Lazareva,T.V.; Mirza,S.Yu.; Savvina,L.P.; Sukhanov ,V.B. 0. Study on the...laser with a longitudinal discharge. IVTAN. Preprint, no. 5-220, 1987, 1-40. (RZFZA, 88/1G508). 122. Yelayev,V.F.; Mirza,S.Yu.; Sukhanov ,V.B.; Troitskiy...Klyachkin,L.Ye.; Sukhanov ,V. L. 0. Technological possibilities for electric decoupling of photodetector mosaic elements used for optical image processing

Combustion Characteristics of Sprays

DTIC Science & Technology

1989-08-01

Lin. T. H.. and Sohrab. S. H. (1987). On the transition oi’diffusion to premixed I’lames in consers.ed ssstem Cornhusio. Flume 68. 73. Mlizutani. Y ...and Nakauima. A. (1973a). Combustion of fuel vapor-drop-air systems: Part 1-Open burner flames. Combust. F/ante 21.14. Mizutani. Y .. and Nakajima. A...AFOSR LES Final Report. AFRPL. Sohrab. S. H.. Ye. Z. Y .. and Law~k C. K. (1984). An experimenial investication on ilame interaction ano the

National Program for Inspection of Non-Federal Dams. Forest Park Upper Dam (MA 00568), Connecticut River Basin, Springfield, Massachusetts. Phase I Inspection Report.

DTIC Science & Technology

1979-09-01

Suburban Rural,Farm___ ’.iod & and 20% Slope: s;teep 20 tied. 2Q% Slight 60%... ______ Fa.rks Nitial P-onlirg xea. 30 Acres; Ave. Depth 6’ lt priuzqt...dam failure? Yes I No .. Character Downstream Valley: Narrow x Wide _ Developed _ _ Rural 70Z Urban 30 , ’ Park Highway WW Railroad .3 k to life and...Location and Type:. Controls___, ’ype;_________________________ Aut~~c *.~n..l . Gperative Yes-___, No___ : W presen~t ’Ye X ,No . Operative Yes-, No___

USSR and Eastern Europe Scientific Abstracts, Engineering and Equipment, Number 39

DTIC Science & Technology

1978-01-30

34 ’\\ v i \\ • . .1 DISTRIBUTION STATEMENT A Approved for Public Release Distribution Unlimited •’••*^.:- v ;;;.-’.i^ 20000405 198 U. S...1034 manuscript received 22 Feb 77 GOLUBINSKIY, A . I., and GOLYBKIN, V . N., Central Aerohydrodynamic Institute imeni N. Ye. Zhukovskiy [Abstract] A ...Russian Vol 232 No 3, 1977 pp 538-541 manuscript received 23 Apr 76 ZHEVNIN, A . A ., and T0L0KN0V, V . I., Moscow Higher Technical School imeni N. E

Bibliography of Soviet Laser Developments, Number 63, January-February 1983.

DTIC Science & Technology

1984-02-01

properties of oxide crystals free of iron ions. Crystal Research and Technology [GDR), no. 7, 1982, 885-889. (RZhF, 1/83, 1D941) 5. Lebedev, V.I., V.A...and Yu.F. Suslov (0). Tellurium films as coatings for output mirrors in CO 2 laser resonators. Sb 1, 36-37. (RZhR, 2/83, 2Ye228) 7. Detectors 185...T.V. Timofeyeva, T.M. Vember, and A.F. Kavtrev (0). Sensitized photorefraction in block polymethylmethacrylate .containing lightly oxidizing anthracene

Unsolved Problems in Evolutionary Theory

DTIC Science & Technology

1967-01-01

finding the probability of survival of a single new mutant). Most natural populations probably satisfy these conditions , as is illustrated by the...Ykl) of small quantities adding to zero. Then under suitable conditions on the function f(x), (3) xi + Yi,t+i = fi(x) + YE yjfi(tf) + O(y yt...It is clear that a sufficient condition for the point x to be locally stable is that all the roots of the matrix, (4) (a j) = ____ should have moduli

Molecular Dissection of the 8 Phase Transcriptional Program Controlled by Cyclin E-P220 NPAT Signaling Pathway

DTIC Science & Technology

2005-04-01

enter S-phase but does not rescue endogenous histone expression (Ye et al. 2003). It is well known that HPV E7 inactivates Rb, the critical regulator...transcription during S-phase (McKnight 2003; Zheng et al. 2003), and with HiNF-P, a transcription factor critical for transactivation of histone H4 genes...CBP/p300 histone acetyltransferase to promote S-phase entry (Wang et al. 2004). Taken together, our work has allowed to demonstrate the critical role of

Analysis of Helicopter Mishaps at Heliports, Airports and Unimproved Sites

DTIC Science & Technology

1991-01-01

Distance ___________ NM A Bearno a_________ ,.~ 400’n 4 Airport Category 5 Airport Certificatton (FAR M39 6 Emergency Plan Tested 7 Months Since...Emergency Plan Tested 1 0 Commerciai service ,0C Ful certrt,catio, 0 ye- 2 0 Reliever 2 [C Limireo certificatior I C 3 0 Ge’e-rai aviation None, Go to block...Aeriai application 8 1Public use 3, instructional (Incluaing air carrer training) 6 -IAerial observation 9 1Ferry A Soecit First PMot Information 87

JPRS Report, East Europe

DTIC Science & Technology

1988-02-24

after that, it was Defense Minister Sokolov and 2 weeks later Lev Saikov, a mem - ber of the Politburo and a central committee secretary, visited...POL1TICHESKOYE OBRAZOVAN1YE in Russian No 12 Dec 87 signed to press 16 Nov 87 pp 114-120 [Article by MSZMP Central Committee Politburo Mem - ber and Central...work" which should above all find its expres- sion in: —the growth of political requirements on party mem - bers; —consolidation of a creative

Frank, We Hardly Knew Ye: The Very Personal Side of Frank Parsons

ERIC Educational Resources Information Center

Pope, Mark; Sveinsdottir, Maria

2005-01-01

This article is a detailing of the limited information available regarding the personal life of Frank Parsons, who is credited with founding the career counseling specialization of modern day professional counseling as well as all professional counseling and the related fields of vocational psychology and counseling psychology in the early 1900s.…

By their genes ye shall know them: genomic signatures of predatory bacteria

PubMed Central

Pasternak, Zohar; Pietrokovski, Shmuel; Rotem, Or; Gophna, Uri; Lurie-Weinberger, Mor N; Jurkevitch, Edouard

2013-01-01

Predatory bacteria are taxonomically disparate, exhibit diverse predatory strategies and are widely distributed in varied environments. To date, their predatory phenotypes cannot be discerned in genome sequence data thereby limiting our understanding of bacterial predation, and of its impact in nature. Here, we define the ‘predatome,' that is, sets of protein families that reflect the phenotypes of predatory bacteria. The proteomes of all sequenced 11 predatory bacteria, including two de novo sequenced genomes, and 19 non-predatory bacteria from across the phylogenetic and ecological landscapes were compared. Protein families discriminating between the two groups were identified and quantified, demonstrating that differences in the proteomes of predatory and non-predatory bacteria are large and significant. This analysis allows predictions to be made, as we show by confirming from genome data an over-looked bacterial predator. The predatome exhibits deficiencies in riboflavin and amino acids biosynthesis, suggesting that predators obtain them from their prey. In contrast, these genomes are highly enriched in adhesins, proteases and particular metabolic proteins, used for binding to, processing and consuming prey, respectively. Strikingly, predators and non-predators differ in isoprenoid biosynthesis: predators use the mevalonate pathway, whereas non-predators, like almost all bacteria, use the DOXP pathway. By defining predatory signatures in bacterial genomes, the predatory potential they encode can be uncovered, filling an essential gap for measuring bacterial predation in nature. Moreover, we suggest that full-genome proteomic comparisons are applicable to other ecological interactions between microbes, and provide a convenient and rational tool for the functional classification of bacteria. PMID:23190728

Ensuring the relocatability of programs in the operational system DOS YeS

NASA Technical Reports Server (NTRS)

Novoseltsev, S. K.; Orlov, I. G.; Chesalin, A. S.

1979-01-01

Specific modifications in the Disk Operational System Unified Series to insure the relocatability of programs stored permanently in the core image library is described. A self-relocating method for loading programs into the working memory with re-editing all the programs recorded in the core image library is presented. The modified linkage editor can be included in a relocation dictionary containing data about each address constant at the assembly stage at the request of the programmer. The relocation dictionary increases the dimension of the RL-phase in comparison with the dimension of this same phase when edited by the standard method, making possible the creation of multiphase program complexes. Generation and use of the modified system using Assembly language is described. An example of the use of the system is given, and limitations of the use of the relocatable programs in the modified system are outlined.

Ionospheric Irregularities: Source, Structure, Plasma Processes and Effects on Sensor Systems

DTIC Science & Technology

1989-10-31

modified by using y - ye + w sin 0 sin 0 (20h) some of M orf et al.’s ideas. Fougere [1981] added a set of subroutines which find for each channel, the...correlation analysis has employed the modified Fedor algo- rithm (Fedor. 1967. CFB, this issue]. 3. ALGORITHM FOR THE SPECTRAL ANALYSIS The elements of the...knowledge, this paper presents with the every 240 m along the orbital track [Ifeelis et al., 1981]. Thus above data set the most detailed analysis of

Bibliography of Soviet Laser Developments, Number 22, October-December 1975

DTIC Science & Technology

1976-05-17

medium by a resonant monoc.iromatic field. KE, no. 9, 1975, 1985- 1991 . 33 ^^ W ftHUUUI.ipiU i U.iHJilll»ll«llil*i»Hiiiil..»w I 245...V. Pankratov , A. N. Skachkov, and G. V. Shmerling (0). Kinetics of threshold luminescence and bleaching in SF, and BC1., gases...PANASYUK, YE.L 2,45 PANCHENKO, M.V. 35 PANCHENKO, V. YA. 23 PANCHENKO, YU. M. 90 PANFILOV, V. N. 64 PANIN, V.V. 52,80 PANKRATOV , A.V

Conference Proceedings of The Application of New Technologies to Improve the Delivery of Aerospace and Defence Information Held at Ottawa, Canada on 14-15 September 1983.

DTIC Science & Technology

1984-01-01

S : L : K -W+ ~ ~ : PP: R: ~FAC NAT:BL LANG:Bs IC: 1: T A 4 CQMIT< E INTERNATIONAL DE M<EDECINE ET DE PHARMACIE...PSYCHOLOGIQUES DE STRESS DANS LE VOL SPATIAL CONCEPTS ACTUELS S ,X ADAPTATON UMAINE AU VOL SPATIAL 5 1 8 EVUE INTERNATIONALE DES SERVICES DE _SANT< E ...Teea . l ,ale ol-ti 1te o sta ) aid pagty letIn* Ito lv te ttit 1.- e b26 l s oul, - t I o ottetlil tttd ye -eile .o o -

Bibliography of Soviet Laser Developments, Number 39, January - February 1979.

DTIC Science & Technology

1979-11-01

with quantum size effects in the active layers , produced by a continuous (300 K) gas-transport epi- taxy method from metalloorganic compounds. ZhTF P...Chirikov (0). Efficient waveguide CO2 laser. ZhTF P, no. 1, 1979, 25-28. 62. Gordiyets, B.F., A.I. Gudzenko, and V.Ya. Panchenko (1,2). Solar -pumped...p. (RZhF, 2/79, 2D1412) 266. Belanov, A.S., Ye.M. Dianov, and A.M. Prokhorov (1). Data tcansmission over quasi-single-mode three- layer optical

Dynamic Sequence Assignment.

DTIC Science & Technology

1983-12-01

ISEF;,, YE 5) SET NXT ENTRYIN PLANTO EF RESE LATH DEFENSETOhION ET REET E CNTRON L TO E. FIND EST PS TO THIS DEFENSE ’DEF’UPDATE PS OF THIS LOCATION... cNc 8p & iin Ik - -4 C- coj C4 GoC "p c C4 tnS ’Io V4~ en *1-4C .44 0800 * .. ; J knccC C4>4- 1Sc C4 C4A xll 00 % .... ***~***M******B13 6 . -0 4 )V

Hurricane Impact on Gulf Coast Barriers.

DTIC Science & Technology

1982-01-01

advaince and huge late-ral extent, Frederic de- ye Ii ped a large ,.toriin so rge. After en is~.in g Dauphin [,land, Alabama, Fredi’ric made landfill near...stratification Each set is some 10 to 20 cr0 These fans are characterized byv wide con tinhi-its upper-flow thick . Tahular cross-stratif aioofviblthcnsisa...Note lth ndward mingration swash bars along the fan crest . (See fig 1:3 P’,intFtlicati)n of thi, oblique aerial photo). Photo taken March 12. 19N

Asynchronous Distributed Flow Control Algorithms.

DTIC Science & Technology

1984-10-01

all yeX, y <x. We may think of X as a "feasible" set. The fair allocation vector solves the following set of nested problems. The first problem is to...interval parameters that can be adjusted: the time between a succesful update and the next update attempt, and the time between an unsuccessful attempt...For years she took great delight in being able to tell people , quite truthfully, that she was from Mars. In 1970, she graduated from the University of

Chemical Reactions at the Au/InP Interface.

DTIC Science & Technology

1986-10-15

Chye , et al., 6 using various forms of photoemission spectroscopy and ion-depth profiling techniques, found that extremely thin Au films 3 interacted...Appl. Phys. 50, 1445 (1979). 6) P.W. ChYe , I. Lindau, P. Pianetta, Ci’!. Garner, C.Y. Su and W.E. Spicer, Physical Review B, 19, 5545 (1978). 7) R.F.C...Brilison, C.F. Brucker, A.D. Katnani, N.G. Stoffel, and G. Margaritondo, J.Vac.Soi Technol., 19, 661 (1981). 13) 1. Caznlibel, A.K. Chin , F. Eruanis

Proceedings of the International Conference on The Performance of Off-Road Vehicles and Machines (8th). Volume 2. Held at Cambridge England, on August 5-11, 1984.

DTIC Science & Technology

1984-08-01

various wheel loads and gecoetries an an aid to vehicle design PO04 299 Flotation tires anc subsurface compaction POMl 300 Tractor power selection...soil copatiml steering computer modelling, vehicle -component design , measuremnt of soil and anow properties and soil bin facilitiesi and vehicle... design . 74 ~ Al i~~s W3 *1oe 9e e1 SALilsasifiLed seCUffiY cLataric*Ye ATWop ’ VA .-I rumo. .. nemraa~sociy m v smuAN vnaaz Yswros 1BR.NM 72 Lym AmI

JPRS Report, Soviet Union, Military Affairs.

DTIC Science & Technology

1988-12-29

have a duty to him. [Letter from Nadezhda Nikolayevna Kuzmina , Lenin- gradskaya Oblast] I am raising three sons and the oldest will enter the army...JPRS-UMA-88-023 29 SEPTEMBER 1988 343036 JPRS 010 Soviet Union Military Affairs Wi& i DTK) QUALITY INSPECTED 1 ■v-yx&fJ’&yiCM 5#1fi^wiv«*’* i ?f...Domestic Service, 11 Sep 88] 21 Mobile Quadrant Antennas [Ye. Klinshov, G. Titov.TEKHNIKA I VOORUZHENIYE, Jun 88] 23 AIR FORCE, AIR DEFENSE FORCES

Medical Surveillance Monthly Report (MSMR). Volume 18, Number 08, August 2011

DTIC Science & Technology

2011-08-01

continue, and STI preven- tion eff orts should be reinforced. R E F E R E N C E S 1. Kuper H, Ye W, Broome U, et al. The risk of liver and bile duct ...hepatitis A virus (HAV) causes infl ammatory liver disease (hepatitis) in aff ected individu- als. Th e virus is spread through fecal-oral...ammatory liver disease (hepatitis B) in aff ected individ- uals. Th e virus is spread by percutaneous or mucous membrane exposure to infected blood or

Thickener/Fluid Interaction in Lubricating Greases

DTIC Science & Technology

1984-05-01

I) p V * .’ .. 21 ___ to & - -9 01 o0 lw0 ca 4 C., trn u ’ ri" cU, 23z "iFQ Ig. C14i~~ z NAii W -W_; 24 C49 c - C-, cn4 II 1- .0, co 4 fa1 41 t 1-4...STRNA-YE (DR KAPLAN ) 1 AITN: STECR-TA STRNA-U I APO SEATTLE 98733 NATICK MA 01760 CDR CDR US ARMY RSCH & STDZN GROUP US ARMY RESEARCH OFFICE (EUROPE

Magmas with slab fluid and decompression melting signatures coexisting in the Gulf of Fonseca: Evidence from Isla El Tigre volcano (Honduras, Central America)

NASA Astrophysics Data System (ADS)

Mattioli, Michele; Renzulli, Alberto; Agostini, Samuele; Lucidi, Roberto

2016-01-01

Isla El Tigre volcano is located in the Gulf of Fonseca (Honduras) along the Central America volcanic front, where a significant change in the strike of the volcanic chain is observed. The studied samples of this poorly investigated volcano are mainly subalkaline basic to intermediate lavas (basalts and basaltic andesites) and subordinate subalkaline/alkaline transitional basalts, both having the typical mineralogical and geochemical characteristics of arc volcanic rocks. On the basis of petrographic and geochemical features, two groups of rocks have been distinguished. Lavas from the main volcanic edifice are highly porphyritic and hy-qz normative, and have lower MgO contents (< 5 wt.%). They show significant LILE and LREE enrichments and Nb-Ta depletions, and have a strong slab signature as well as incompatible element contents similar to those of the main front of the adjacent volcanoes in El Salvador and Nicaragua (e.g., Ba/La up to 80). In contrast, lavas from the parasitic cones have higher MgO contents (> 5 wt.%), are ol-hy normative and show lower HFSE depletions relative to LILE and LREE, with lower Ba/La, Ba/Nb and Zr/Nb ratios. This suggests that mantle-derived magmas were not produced by the same process throughout the activity of the volcano. The bulk rock geochemistry and 87Sr/86Sr (0.70373-0.70382), 143Nd/144Nd (0.51298-0.51301), 206Pb/204Pb (18.55-18.58), 207Pb/204Pb (15.54-15.56) and 208Pb/204Pb (38.23-38.26) isotopic data of Isla El Tigre compared with the other volcanoes of the Gulf of Fonseca and all available literature data for Central America suggests that this stratovolcano was mainly built by mantle-derived melts driven by slab-derived fluid-flux melting, while magmas erupted through its parasitic cones have a clear signature of decompression melting with minor slab contribution. The coexistence of these two different mantle melting generation processes is likely related to the complex geodynamic setting of the Gulf of Fonseca, where the

Rice–arsenate interactions in hydroponics: a three-gene model for tolerance

PubMed Central

Norton, Gareth J.; Nigar, Meher; Dasgupta, Tapash; Meharg, Andrew A.; Price, Adam H.

2008-01-01

In this study, the genetic mapping of the tolerance of root growth to 13.3 μM arsenate [As(V)] using the Bala×Azucena population is improved, and candidate genes for further study are identified. A remarkable three-gene model of tolerance is advanced, which appears to involve epistatic interaction between three major genes, two on chromosome 6 and one on chromosome 10. Any combination of two of these genes inherited from the tolerant parent leads to the plant having tolerance. Lists of potential positional candidate genes are presented. These are then refined using whole genome transcriptomics data and bioinformatics. Physiological evidence is also provided that genes related to phosphate transport are unlikely to be behind the genetic loci conferring tolerance. These results offer testable hypotheses for genes related to As(V) tolerance that might offer strategies for mitigating arsenic (As) accumulation in consumed rice. PMID:18453529

Cross-media color reproduction using the frequency-based spatial gamut mapping algorithm based on human color vision

NASA Astrophysics Data System (ADS)

Wu, Guangyuan; Niu, Shijun; Li, Xiaozhou; Hu, Guichun

2018-04-01

Due to the increasing globalization of printing industry, remoting proofing will become the inevitable development trend. Cross-media color reproduction will occur in different color gamuts using remote proofing technologies, which usually leads to the problem of incompatible color gamut. In this paper, to achieve equivalent color reproduction between a monitor and a printer, a frequency-based spatial gamut mapping algorithm is proposed for decreasing the loss of visual color information. The design of algorithm is based on the contrast sensitivity functions (CSF), which exploited CSF spatial filter to preserve luminance of the high spatial frequencies and chrominance of the low frequencies. First we show a general framework for how to apply CSF spatial filter in retention of relevant visual information. Then we compare the proposed framework with HPMINDE, CUSP, Bala's algorithm. The psychophysical experimental results indicated the good performance of the proposed algorithm.

Illumina MiSeq sequencing reveals microbial community in HA process for dyeing wastewater treatment fed with different co-substrates.

PubMed

Xie, Xuehui; Liu, Na; Ping, Jing; Zhang, Qingyun; Zheng, Xiulin; Liu, Jianshe

2018-06-01

In present study, a hydrolysis acidification (HA) reactor was used for simulated dyeing wastewater treatment. Co-substrates included starch, glucose, sucrose, yeast extract (YE) and peptone were fed sequentially into the HA reactor to enhance the HA process effects. The performance of the HA reactor and the microbial community structure in HA process were investigated under different co-substrates conditions. Results showed that different co-substrates had different influences on the performance of HA reactor. The highest decolorization (50.64%) and COD removal rate (60.73%) of the HA reactor were obtained when sucrose was as the co-substrate. And it found that carbon co-substrates starch, glucose and sucrose exhibited better decolorization and higher COD removal efficiency of the HA reactor than the nitrogen co-substrates YE and peptone. Microbial community structure in the HA process was analyzed by Illumina MiSeq sequencing. Results revealed different co-substrates had different influences on the community structure and microbial diversity in HA process. It was considered that sucrose could enrich the species such as Raoultella, Desulfovibrio, Tolumonas, Clostridium, which might be capable of degrading the dyes. Sucrose was considered to be the best co-substrate of enhancing the HA reactor's performance in this study. This work would provide deep insight into the influence of many different co-substrates on HA reactor performance and microbial communities in HA process. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genetic Diversity of Pinus nigra Arn. Populations in Southern Spain and Northern Morocco Revealed By Inter-Simple Sequence Repeat Profiles †

PubMed Central

Rubio-Moraga, Angela; Candel-Perez, David; Lucas-Borja, Manuel E.; Tiscar, Pedro A.; Viñegla, Benjamin; Linares, Juan C.; Gómez-Gómez, Lourdes; Ahrazem, Oussama

2012-01-01

Eight Pinus nigra Arn. populations from Southern Spain and Northern Morocco were examined using inter-simple sequence repeat markers to characterize the genetic variability amongst populations. Pair-wise population genetic distance ranged from 0.031 to 0.283, with a mean of 0.150 between populations. The highest inter-population average distance was between PaCU from Cuenca and YeCA from Cazorla, while the lowest distance was between TaMO from Morocco and MA Sierra Mágina populations. Analysis of molecular variance (AMOVA) and Nei’s genetic diversity analyses revealed higher genetic variation within the same population than among different populations. Genetic differentiation (Gst) was 0.233. Cuenca showed the highest Nei’s genetic diversity followed by the Moroccan region, Sierra Mágina, and Cazorla region. However, clustering of populations was not in accordance with their geographical locations. Principal component analysis showed the presence of two major groups—Group 1 contained all populations from Cuenca while Group 2 contained populations from Cazorla, Sierra Mágina and Morocco—while Bayesian analysis revealed the presence of three clusters. The low genetic diversity observed in PaCU and YeCA is probably a consequence of inappropriate management since no estimation of genetic variability was performed before the silvicultural treatments. Data indicates that the inter-simple sequence repeat (ISSR) method is sufficiently informative and powerful to assess genetic variability among populations of P. nigra. PMID:22754321

Development of cost-effective media to increase the economic potential for larger-scale bioproduction of natural food additives by Lactobacillus rhamnosus , Debaryomyces hansenii , and Aspergillus niger.

PubMed

Salgado, José Manuel; Rodríguez, Noelia; Cortés, Sandra; Domínguez, José Manuel

2009-11-11

Yeast extract (YE) is the most common nitrogen source in a variety of bioprocesses in spite of the high cost. Therefore, the use of YE in culture media is one of the major technical hurdles to be overcome for the development of low-cost fermentation routes, making the search for alternative-cheaper nitrogen sources particularly desired. The aim of the current study is to develop cost-effective media based on corn steep liquor (CSL) and locally available vinasses in order to increase the economic potential for larger-scale bioproduction. Three microorganisms were evaluated: Lactobacillus rhamnosus , Debaryomyces hansenii , and Aspergillus niger . The amino acid profile and protein concentration was relevant for the xylitol and citric acid production by D. hansenii and A. niger , respectively. Metals also played an important role for citric acid production, meanwhile, D. hansenii showed a strong dependence with the initial amount of Mg(2+). Under the best conditions, 28.8 g lactic acid/L (Q(LA) = 0.800 g/L.h, Y(LA/S) = 0.95 g/g), 35.3 g xylitol/L (Q(xylitol) = 0.380 g/L.h, Y(xylitol/S) = 0.69 g/g), and 13.9 g citric acid/L (Q(CA) = 0.146 g/L.h, Y(CA/S) = 0.63 g/g) were obtained. The economic efficiency (E(p/euro)) parameter identify vinasses as a lower cost and more effective nutrient source in comparison to CSL.

A Social Network Analysis of the Chinese Communist Party’s Politburo

DTIC Science & Technology

2013-12-01

Centrality Deng Xiaoping 0.583 0.665 Ye Jianying 0.333 0.454 Li Xiannian 0.333 0.454 Chen Yun 0.313 0.475 Xu Xiangqian 0.292 0.412 Hu Yaobang... Li Keqiang, and the right that China has to great power status in the writings of Liu Yunshan. These moralistic themes are viewed as a reaction by...0.229 0.345 Nie Rongzhen 0.229 0.374 Wan Li 0.208 0.218 Deng Yingchao 0.208 0.374 Zhao Ziyang 0.208 0.345 Table 2. Ideological Model 1–Nodal

Circulation of the Elite in the Chinese Communist Party

DTIC Science & Technology

2014-09-02

the 11th Party Congress. Li Disheng (rank 6) made it to the 11th Congress, but as a Politburo member, and not as a PSC member. Only Ye Jianying (rank 5...2003; Holbig 2009; Holbig and Gilley 2010; Hsu 2001; Lee 2010: Li 2013b; Schubert 2007; Zheng 2003. 4Dittmer 2001, 58; Yue 2008, 82-83. 5Bo 2007; Cho...2008; Dittmer 2001; Fewsmith 2003; Kou and Zang 2014; Li 1994; Li 2012; Lin 2004; Nathan 1973; Shih 2008; Shih et al. 2010; Shih et al. 2012; Tsou and

A Vectorized ’Nearest-Neighbors’ Algorithm of Order N Using a Monotonic Logical Grid

DTIC Science & Technology

1985-05-29

Computational Phy’sics 0 4 May 29 , 1985 This work was supported by the Office of Naval Research. . ~ Q~JUN 1719851- * NAVAL RESEARCH LABORATORY * lit...YE ’.ARK:NGS UNCLASSIFIED_______________ _____ K -. A R, ~ CA7,ON 4, 71CO1, 3 :)-S7R,9U-ON AdA,.A3:L ’Y OF REPOR7Io - EC..ASi.’ CA27 ON., DOWNGAZING...Year. Month. Day) 5 PAGE COUNT Interim FROM -____ Toi__ 1985 May 29 50 𔄀 SuPPILSMENTARY NOTATION This work was supported by the Office of Naval

Dissertations for Degrees in Science and Engineering Defended at USSR Higher Educational Institutions.

DTIC Science & Technology

1960-08-03

copies. 5 PILKOV, Ye. V., Cand Tech Sei — "Study of distortions in the reproduction of color television images in a tube with striated screen...copies0 D0VGÖP0LYY, G. I., Cand Agr Sci — "Peculiarities of the raising of tomato seedlings in food pots in the Ukraine." Khar’kov, 1959, 20 pp (Min of...Order bf Lenin Inst of Engineers of Railroad Transport im Academician V4N. Obraztsov), l50 copies» BARANOVA, K.V., Cand Agr Sei -* » Effectof the

Bibliography of Soviet Laser Developments, Number 87, January-February 1987

DTIC Science & Technology

1987-12-29

laser. OPMPA, no. 1, 1987, 58-59. 84. Sukhanov , 1.1.; Troitskiy, Yu.V.; Yakushkin, S.V. 0 Investigation of a He-Ne laser, generating a beam with a...2Ye498). * 519. Shelekhov, N.S.; Sukhanov , V.I.; Solomatin, Yu.V.;Ashcheulov, Yu.V. (GOI). Investigation of the possibility of obtaining specimens of...G 46,49 SOBOLEV V B 57 SUETIN N V 26 TIMASHOV A V 11 SOCHIVKIN G M 87 SUKHANOV I 1 11 TIMASHOVA L N 60 SOKOLOV A V 107 SUKHANOV V 1 61 TIMERKAYEV B A

The Coast Artillery Journal. Volume 63, Number 6, December 1925

DTIC Science & Technology

1925-12-01

know many of its limitations. ’Vc know that it takcs many rounds from any gun to score a hit upon an airplanc . ’Ye know also that tons and tons of...suspicions, and to try to create an attitude of toleration in the public mind of the peoples of the earth, that is, we submit, a long job, and in the...feared that the partial vacuum thus created wou1d tend to suck in enough gas to be harmfu1 to the observer. Actual trial does not show this to be the case

Strategic Implications of Japan Amending Its Constitution

DTIC Science & Technology

2008-12-09

and Déjà Vu . Before discussing the four scenarios, it is important to make some valid assumptions to further keep the variables at a minimum for the...si a Passive China Reaction Aggressive China Reaction U S Fo rce s R e -D e p lo ye d b a ck to C O N U S IMPERIAL DRAGON POWDER KEG DEJA VUHIDDEN...well as posture itself to participate in collective security arrangements. Déjà Vu . While the previous scenario titles are self-explanatory, the Déjà

Non-Line of Sight-Combined Arms (NLOS-CA) Manpower, Personnel and Logistics Impact Analysis (LIA)

DTIC Science & Technology

1993-11-15

total weight and volume to explosive weight have been used. These measure the size of the round relative to the killing power in the round. On this basis...the weapon system is powered up. (3) Alert Time is that time during which radios are operating, but the system is not powered up. For this analysis...TELEPHONE MANUA: SB-22/PT 1S U99185 UTILITY RECEPTACLE I V31211 TELEPHONE SET TA312 26 V•1788 POWER SUPPLY YE8 HYP-571TSEC 2I N32593 SHOP EQUIP AUTO

Application of Quasi-Lagrangian Diagnostics and FGGE Data in a Study of East-Coast Cyclogenesis.

DTIC Science & Technology

1981-09-01

QUASI-LAGRANGIAN UDIAGNOSTICS AND FGGE DATA IN A STUDY OF EAST-COAST CYCLOGENESIS by Donald A. Roman September 1981 Thesis Advisor: Dr. Carlyle H. Wash...REPORT DOCUMENTATION PAGE DEVFOR COMPLETING FORM I.M9PR UM19 2. GOV? AccaS "@ "mO L.VIPICUTS CA? ALOG MUUNW S TyP =F NOo’BP io OE4. TITLC (nd Sisle . ye i...n.J000 Application of Quasi-Lagrangian Master’s Thesis Diagnostics and FGGE Data in a Study 0#4 September 1981 East-Coast Cyclogenesis C PlaPranIWG

The Influence of Ballistic Damage on the Aeroelastic Characteristics of Lifting Surfaces.

DTIC Science & Technology

1979-07-01

the pressure distribution. The finite-element method, often referred to as a vortex- lattice or doublet- lattice method, divides the lifting surface into...finite-element modeling, such as doublet- lattice , would provide a better understanding of the near-field effects of a damage hole and allow a data base...0.17 0.33 0.50 6.67 0.833 1.00 Figure 42 125 CASE 5 and CASE 5D 0 Ye=.57 = UNDAMAGED M = DAMAGED 0 C3/ C22 CD QCD 6.330,4 0/ Fiue4 02 CASE 5 and CASE

Bibliography of Soviet Laser Developments. Number 70, March - April 1984.

DTIC Science & Technology

1985-06-12

Nagayev, A.l.; Pika-In, V . P Frt1 ze, A.V. (). Spatial light m,-dul-0, , wtb ii- e’rctrostatically controlled e -beam. "lit’. Moskva, 29 Nov - 2 Dec...in a turbulent atmosphere. OPSPA, v . 57, no. 4, 1984, 732-734. 49 e ’Ile 450. Anikeyenko, G.N.; Pavlichenko, 1.0. (VPI). Study on the polarization...B.N.; Shil’nikov, Ye.V. (IPM). Mathematical modeling of e -beam [compared with laser] vaporization of metal. DANKA, v . 272, no. 4, 1983, 835-838. 871

Digital Quantum Simulation of Minimal AdS/CFT.

PubMed

García-Álvarez, L; Egusquiza, I L; Lamata, L; Del Campo, A; Sonner, J; Solano, E

2017-07-28

We propose the digital quantum simulation of a minimal AdS/CFT model in controllable quantum platforms. We consider the Sachdev-Ye-Kitaev model describing interacting Majorana fermions with randomly distributed all-to-all couplings, encoding nonlocal fermionic operators onto qubits to efficiently implement their dynamics via digital techniques. Moreover, we also give a method for probing nonequilibrium dynamics and the scrambling of information. Finally, our approach serves as a protocol for reproducing a simplified low-dimensional model of quantum gravity in advanced quantum platforms as trapped ions and superconducting circuits.

Digital Quantum Simulation of Minimal AdS /CFT

NASA Astrophysics Data System (ADS)

García-Álvarez, L.; Egusquiza, I. L.; Lamata, L.; del Campo, A.; Sonner, J.; Solano, E.

2017-07-01

We propose the digital quantum simulation of a minimal AdS /CFT model in controllable quantum platforms. We consider the Sachdev-Ye-Kitaev model describing interacting Majorana fermions with randomly distributed all-to-all couplings, encoding nonlocal fermionic operators onto qubits to efficiently implement their dynamics via digital techniques. Moreover, we also give a method for probing nonequilibrium dynamics and the scrambling of information. Finally, our approach serves as a protocol for reproducing a simplified low-dimensional model of quantum gravity in advanced quantum platforms as trapped ions and superconducting circuits.

Molecular Approach to Hypothalamic Rhythms

DTIC Science & Technology

1998-06-24

PAGE • PuDiic reoorttnc DUTCH p gather.r.q ar.c n-untai ; COHeCtJO-■ -:r ;-v-rrr.^! ; Davis hiopwa.-, ioiie 1 ■ 1. AGENCY USE AFRL-SR-BL-TR...the same neurons? eharacter"ed „™ „eer ye3f1V 6d ,y the sl" P -^ueing lipid oleamide. He have precursor exeinslvelv H = ’", "^ "W"«1...mapped the anatomical distribution of the degradative enzyme for oleamide within the brain. To identify neuronal populations activated in vivo by 3

Composite Service Life Prediction via Fiber Bundle Testing. Evaluation of Testing Equipment and Data Acquisition System

DTIC Science & Technology

1986-12-01

PREDICTION VIA FIBER BUNDLE TESTING-EVALUATION OF TESTING EQUIPMENT JD DATA ACQUISITION SYSTEM PERSONAL AUTHOR(S) Petridis Dimitrios M. i *y?e o j report...experiencing a known number of filament failures per bundle. The results of this investigation are relevant to man-safe applications as in composite pressure...single filament r’iber testing and can become more 29 3> C o - Pwo PwS ?w4 Pw3 Pw2 Pwl PSD Ps5 PS4 Ps3 Ps2 PS! homoiogous correspondence t ~ to Life ( Laqt

Quantum criticality and duality in the Sachdev-Ye-Kitaev/AdS2 chain

NASA Astrophysics Data System (ADS)

Jian, Shao-Kai; Xian, Zhuo-Yu; Yao, Hong

2018-05-01

We show that the quantum critical point (QCP) between a diffusive metal and ferromagnetic (or antiferromagnetic) phases in the SYK chain has a gravitational description corresponding to the double-trace deformation in an AdS2 chain. Specifically, by studying a double-trace deformation of a Z2 scalar in an AdS2 chain where the Z2 scalar is dual to the order parameter in the SYK chain, we find that the susceptibility and renormalization group equation describing the QCP in the SYK chain can be exactly reproduced in the holographic model. Our results suggest that the infrared geometry in the gravity theory dual to the diffusive metal of the SYK chain is also an AdS2 chain. We further show that the transition in SYK model captures universal information about double-trace deformation in generic black holes with near horizon AdS2 space-time.

Calcium sulfoaluminate (Ye'elimite) hydration in the presence of gypsum, calcite, and vaterite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hargis, Craig W.; Telesca, Antonio; Monteiro, Paulo J.M., E-mail: monteiro@ce.berkeley.edu

Six calcium sulfoaluminate-based cementitious systems composed of calcium sulfoaluminate, calcite, vaterite, and gypsum were cured as pastes and mortars for 1, 7, 28 and 84 days. Pastes were analyzed with X-ray diffraction, thermogravimetric and differential thermal analyses. Mortars were tested for compressive strength, dimensional stability and setting time. Furthermore, pastes with a water/cementitious material mass ratio of 0.80 were tested for heat evolution during the first 48 h by means of isothermal conduction calorimetry. It has been found that: (1) both calcite and vaterite reacted with monosulfoaluminate to give monocarboaluminate and ettringite, with vaterite being more reactive; (2) gypsum loweredmore » the reactivity of both carbonates; (3) expansion was reduced by calcite and vaterite, irrespective of the presence of gypsum; and (4) both carbonates increased compressive strength in the absence of gypsum and decreased compressive strength less in the presence of gypsum, with vaterite's action more effective than that of calcite.« less

X-Ray Computed Tomography Reveals the Response of Root System Architecture to Soil Texture1[OPEN

PubMed Central

Rogers, Eric D.; Monaenkova, Daria; Mijar, Medhavinee; Goldman, Daniel I.

2016-01-01

Root system architecture (RSA) impacts plant fitness and crop yield by facilitating efficient nutrient and water uptake from the soil. A better understanding of the effects of soil on RSA could improve crop productivity by matching roots to their soil environment. We used x-ray computed tomography to perform a detailed three-dimensional quantification of changes in rice (Oryza sativa) RSA in response to the physical properties of a granular substrate. We characterized the RSA of eight rice cultivars in five different growth substrates and determined that RSA is the result of interactions between genotype and growth environment. We identified cultivar-specific changes in RSA in response to changing growth substrate texture. The cultivar Azucena exhibited low RSA plasticity in all growth substrates, whereas cultivar Bala root depth was a function of soil hardness. Our imaging techniques provide a framework to study RSA in different growth environments, the results of which can be used to improve root traits with agronomic potential. PMID:27208237

Petroleum degradation by Pseudomonas sp. ZS1 is impeded in the presence of antagonist Alcaligenes sp. CT10.

PubMed

Liang, Jibei; Cheng, Tao; Huang, Yi; Liu, Jianhua

2018-05-28

Enhanced bioremediation is a favorable approach for petroleum pollutant cleanup, which depends on the growth of oil-eating microorganisms. In this study, we show that, by using the modified T-RFLP (mT-RFLP) methodology, one of the four major microbial populations derived from oil sludge has failed to propagate in MS medium supplemented with 2% yeast extract (YE). rDNA sequence-based analysis indicated that the four populations were Donghicola sp. CT5, Bacillus sp. CT6, Alcaligenes sp. CT10, and Pseudomonas sp. ZS1. Four purified strains grow well individually in MS medium supplemented with 2% YE, suggesting that ZS1 growth is antagonized by other strains. Co-growth analysis using mT-RFLP methodology and plate inhibitory assay indicated that ZS1 exhibited antagonistic effect against CT5 and CT6. On the other hand, co-growth analysis and plate inhibition assay showed that CT10 antagonized against ZS1. To investigate the potential compounds responsible for the antagonism, supernatant of CT10 culture was subjected to GC-MS analysis. Analysis indicated that CT10 produced a number of antimicrobial compounds including cyclodipeptide c-(L-Pro-L-Phe), which was known to inhibit the growth of Pseudomonas sp. Growth test using the purified c-(L-Pro-L-Phe) from CT10 confirmed its inhibitory activity. We further showed that, using both gravimetric and GC analysis, CT10 antagonism against the oil-eating ZS1 led to the diminishing of crude oil degradation. Together, our results indicate that bioremediation can be affected by environmental antagonists.

N-Glycosylation Improves the Pepsin Resistance of Histidine Acid Phosphatase Phytases by Enhancing Their Stability at Acidic pHs and Reducing Pepsin's Accessibility to Its Cleavage Sites

PubMed Central

Niu, Canfang; Luo, Huiying; Shi, Pengjun; Huang, Huoqing; Wang, Yaru; Yang, Peilong

2015-01-01

N-Glycosylation can modulate enzyme structure and function. In this study, we identified two pepsin-resistant histidine acid phosphatase (HAP) phytases from Yersinia kristensenii (YkAPPA) and Yersinia rohdei (YrAPPA), each having an N-glycosylation motif, and one pepsin-sensitive HAP phytase from Yersinia enterocolitica (YeAPPA) that lacked an N-glycosylation site. Site-directed mutagenesis was employed to construct mutants by altering the N-glycosylation status of each enzyme, and the mutant and wild-type enzymes were expressed in Pichia pastoris for biochemical characterization. Compared with those of the N-glycosylation site deletion mutants and N-deglycosylated enzymes, all N-glycosylated counterparts exhibited enhanced pepsin resistance. Introduction of the N-glycosylation site into YeAPPA as YkAPPA and YrAPPA conferred pepsin resistance, shifted the pH optimum (0.5 and 1.5 pH units downward, respectively) and improved stability at acidic pH (83.2 and 98.8% residual activities at pH 2.0 for 1 h). Replacing the pepsin cleavage sites L197 and L396 in the immediate vicinity of the N-glycosylation motifs of YkAPPA and YrAPPA with V promoted their resistance to pepsin digestion when produced in Escherichia coli but had no effect on the pepsin resistance of N-glycosylated enzymes produced in P. pastoris. Thus, N-glycosylation may improve pepsin resistance by enhancing the stability at acidic pH and reducing pepsin's accessibility to peptic cleavage sites. This study provides a strategy, namely, the manipulation of N-glycosylation, for improvement of phytase properties for use in animal feed. PMID:26637601

Topographic Map of Quadrangles 3560 and 3562, Sir-Band (402), Khawja-Jir (403), and Bala-Murghab (404) Quadrangles, Afghanistan

USGS Publications Warehouse

Bohannon, Robert G.

2006-01-01

This map was produced from several larger digital datasets. Topography was derived from Shuttle Radar Topography Mission (SRTM) 85-meter digital data. Gaps in the original dataset were filled with data digitized from contours on 1:200,000-scale Soviet General Staff Sheets (1978-1997). Contours were generated by cubic convolution averaged over four pixels using TNTmips surface-modeling capabilities. Minor artifacts resulting from the auto-contouring technique are present. Streams were auto-generated from the SRTM data in TNTmips as flow paths. Flow paths were limited in number by their Horton value on a quadrangle-by-quadrangle basis. Peak elevations were averaged over an area measuring 85 m by 85 m (represented by one pixel), and they are slightly lower than the highest corresponding point on the ground. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Because cultural features were not derived from the SRTM base, they do not match it precisely. Province boundaries are not exactly located. This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (Afghan Geological Survey) quadrangles covering Afghanistan. The maps for any given quadrangle have the same open-file number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The open-file report (OFR) numbers for each quadrangle range in sequence from 1092 - 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

The Sale of FX Aircraft to Taiwan,

DTIC Science & Technology

1982-02-01

A« ii 4J -r-i cr. u CO U O H oi 4-1 4-1 JS k4 cr. CO 3 1 E C li iH u -H CM CO 01 UH 1...31, 1981, pp. U1-U2 (Xinhua, "Ye Jianying Explains Policy Concerning Return of Taiwan to Mother- land and Peaceful Reunification"). FBIS, People’s...Industrial Potential" (Fei-ohan knai-t’ing tzu- li she-ohi ahien-tsu hsien-shih wo kuo ahun-shih kung-yeh ch’ien- li ), October 9, 1980. , "The U.S. Defense

Chinese-English Rocketry Dictionary. Volume 3

DTIC Science & Technology

1979-03-01

xiezhen diania 14] Q i. plate tank 1’? yangil yanghuara $, anodic oxidation process 18 yangji yinji dianya I3 A.j - I t anode -cathode voltage...talo Gu Yin yin aao ou Ylng Yin ta’u Ou YU You taluan cuan Yuing Yawg talui cul 341 tau tm yuan ruan toa ’Wg Cown Yft ye. tfu tu Yfln t’tian tuant...tanhuang Jiahe mopian 94f X laE f(4 ’m’. #j spring-loaded membrane 14 tanhuang Jiaju A1 A -)t spring clawp 15 tanhuang Jianshendian A1 &c A V -’P spring

Advanced Imaging Tracker

DTIC Science & Technology

1982-06-01

3oijsteii 14.) v ilson f3 1vj Ar inj~on, VA Ž222JY L. or p AtLnZ: -,iii~iarn Ouriey I d.LU ýu ndoldt i~d txlJlýjLuqucqe, 14,, f. /A i’ Atun : ý...34ivision iY) LiOX d /M ye I v - iv i S i 01-1 I ,/L i r ic u .L Lbr~ J o-r y At~rlt -lex earker 1.i nj .on, A½iI r -I efnLi.) DL-4 NAS’A Aines Atun

A Systems Evaluation of the Environmental Impact of the Aubrey Reservoir Project on Elm Fork of the Trinity River in North Texas.

DTIC Science & Technology

1972-06-01

JUN 72 L C FITZPATRICK , R L ABSHI RE. L G KNOX D AC W 3-72-C-X052 4 mhhho hhEEE I lffllffllfNOlf NElf mohEEEEEshhhEE EhmhhEEEmhEEEE mhEmhEEEEEmhhI...C-0052, on 30 June 1972. I f’v IabnC Wer’Ye td so; itsj 81 3 3 063 - I _rj_,CLASSIFICATION OF THIS PAGE (When Dole Kntored) REPORT DOCUMENTATION PAGE...Engineers June 1972 Engineering Division, Plng Br, SWFED-P I . NUMBER OFPAGES P. 0. Box 17300, Fort Worth, Texas 76102 339 14. MONITORING AGENCY NAME

Open quantum random walk in terms of quantum Bernoulli noise

NASA Astrophysics Data System (ADS)

Wang, Caishi; Wang, Ce; Ren, Suling; Tang, Yuling

2018-03-01

In this paper, we introduce an open quantum random walk, which we call the QBN-based open walk, by means of quantum Bernoulli noise, and study its properties from a random walk point of view. We prove that, with the localized ground state as its initial state, the QBN-based open walk has the same limit probability distribution as the classical random walk. We also show that the probability distributions of the QBN-based open walk include those of the unitary quantum walk recently introduced by Wang and Ye (Quantum Inf Process 15:1897-1908, 2016) as a special case.

Transaction Design Specification Medical Exam Databases System (MED) update Transaction

DTIC Science & Technology

1986-12-01

8217RECOFD IN 51) 73. CORONARY SFAS1 SITE ;CHAR X(6) IN 7:) 74* CORONARY FLAQUES (RECO D IN 51) 75. CCFONARY PLAOUE 3ITE ,CHAR K(60 IN 74) 76* FCT DIAMETER...KETOSTEROIDS YE HYDROXYCARTICOSTEROIDS YO 24 HR URINE TOTAL VOLUME MA URINE OSMOLALITY MB SERUM OSMOLALITY MC 24HR URINE TOTAL VOLUME ZE SERUM COPPER FBS TO...RHEUMATOID FACTOR PA N P -2 2 ANTINUCLEAR ANTIBODY PB N P -2 2 0 FREE FATTY ACIDS QA 5 9 57 200 MG% SERUM COPPER RA 30 70 130 300 JG% URINE COPPER RBM 10 30 90

Normal Modes of a Lagrangian System Constrained in a Potential Well.

DTIC Science & Technology

1983-12-01

A’ -137 948 NORMAL MODES OF A LFHbRANGIAN SYSTEM CONSTRAINED INvi P0TENTIAL WELL(U WISCONSNN UNIV-MADISON MATHEMATICS RESEARCH CENTER V EN DEC F1...Carolina 27709 DT FLE OP Y UNIVERSITY OF WISCONSIN-MADISON MATHEMATICS RESEARCH CENTER NORMAL MODES OF A LAGRANGIAN SYSTEM CONSTRAINED IN A POTENTIAL WELL...respect to the norm lYE [f i + 2 yi )dtl/ 0 Since H I(S’ 1 n’) C CO(S, fle ), then the set A 1 0 is an open set in H1 (lf’) The periodic solution of

Flavor Oscillations in the Supernova Hot Bubble Region: Nonlinear Effects of Neutrino Background

NASA Astrophysics Data System (ADS)

Pastor, Sergio; Raffelt, Georg

2002-10-01

The neutrino flux close to a supernova core contributes substantially to neutrino refraction so that flavor oscillations become a nonlinear phenomenon. One unexpected consequence is efficient flavor transformation for antineutrinos in a region where only neutrinos encounter a Mikheyev-Smirnov-Wolfenstein resonance or vice versa. Contrary to previous studies we find that in the neutrino-driven wind the electron fraction Ye always stays below 0.5, corresponding to a neutron-rich environment as required by r-process nucleosynthesis. The relevant range of masses and mixing angles includes the region indicated by LSND, but not the atmospheric or solar oscillation parameters.

Flavor oscillations in the supernova hot bubble region: nonlinear effects of neutrino background.

PubMed

Pastor, Sergio; Raffelt, Georg

2002-11-04

The neutrino flux close to a supernova core contributes substantially to neutrino refraction so that flavor oscillations become a nonlinear phenomenon. One unexpected consequence is efficient flavor transformation for antineutrinos in a region where only neutrinos encounter a Mikheyev-Smirnov-Wolfenstein resonance or vice versa. Contrary to previous studies we find that in the neutrino-driven wind the electron fraction Y(e) always stays below 0.5, corresponding to a neutron-rich environment as required by r-process nucleosynthesis. The relevant range of masses and mixing angles includes the region indicated by LSND, but not the atmospheric or solar oscillation parameters.

Including the biogeochemical impacts of deforestation increases projected warming of climate

NASA Astrophysics Data System (ADS)

Scott, Catherine; Monks, Sarah; Spracklen, Dominick; Arnold, Stephen; Forster, Piers; Rap, Alexandru; Carslaw, Kenneth; Chipperfield, Martyn; Reddington, Carly; Wilson, Christopher

2016-04-01

Forests cover almost one third of the Earth's land area and their distribution is changing as a result of human activities. The presence, and removal, of forests affects the climate in many ways, with the net climate impact of deforestation dependent upon the relative strength of these effects (Betts, 2000; Bala et al., 2007; Davin and de Noblet-Ducoudré, 2010). In addition to controlling the surface albedo and exchanging carbon dioxide (CO2) and moisture with the atmosphere, vegetation emits biogenic volatile organic compounds (BVOCs), which lead to the formation of biogenic secondary organic aerosol (SOA) and alter the oxidative capacity of the atmosphere, affecting ozone (O3) and methane (CH4) concentrations. In this work, we combine a land-surface model with a chemical transport model, a global aerosol model, and a radiative transfer model to compare several radiative impacts of idealised deforestation scenarios in the present day. We find that the simulated reduction in biogenic SOA production, due to complete global deforestation, exerts a positive combined aerosol radiative forcing (RF) of between +308.0 and +362.7 mW m-2; comprised of a direct radiative effect of between +116.5 and +165.0 mW m-2, and a first aerosol indirect effect of between +191.5 and +197.7 mW m-2. We find that the reduction in O3 exerts a negative RF of -150.7 mW m-2 and the reduction in CH4 results in a negative RF of -76.2 mWm-2. When the impacts on biogenic SOA, O3 and CH4 are combined, global deforestation exerts an overall positive RF of between +81.1 and +135.9 mW m-2 through changes to short-lived climate forcers (SLCF). Taking these additional biogeochemical impacts into account increases the net positive RF of complete global deforestation, due to changes in CO2 and surface albedo, by 7-11%. Overall, our work suggests that deforestation has a stronger warming impact on climate than previously thought. References: Bala, G. et al., 2007. Combined climate and carbon-cycle effects

The Poor Ye Need Not Have with You; Lessons from the War on Poverty.

ERIC Educational Resources Information Center

Levine, Robert A.

The book provides a dichotomy of the general technique of problem handling in the United States; i.e., getting even or punishing the adversary, and the reverse of this, problem solving; and discusses the two aspects in the context of the war on poverty. The second and third chapters discuss various definitions of the Poor, and provide objectives…

Prime Contract Awards by Service Category and Federal Supply Classification, Fiscal Years 1976, 1977, 1978, 1979.

DTIC Science & Technology

1980-06-30

284 1.090 LEASE RENTAL OF EQ’BRUSHTS-PAI NTS - SEA ,ER NA HA H4A 162 1.06I LEASE -REtITAL OF EQ’CDNTAINERS-PACKA I NO MA HA MA 29 1.083 LEAS’E RENTAL OF...DOLAARSI IFIS C AL YE9ARII PROC URCHIN T PROSRAM ------------------------------- 1976 1977 1676 1979 AIRFRAME& AND RELATED ASSEMBLIES AND SPARES...39 I 5 - ", M V PAT(r :If AMA:TRDA LFIRE ER42 0441 230 26 * 3920 FIAT II R P EQIIFICPT1O’L-R O.ED:𔃻.6NT1 2, sea 1.4 2533 31.30 WRE. HOAE REAC TOP5RCO

The Aluminum Ship Evaluation Model (ASEM) Static Test Results

DTIC Science & Technology

1983-12-01

8217- -- fC1 (-10,o 1 3 7-1 -69 6 12 960.00 9869 30 0 t SAME 22 R2A:CM7 9-E1 2 23 9 11 -69 822 - 41 fta 𔃼 2S87 98- 3 35 19 I 30 SOME 12 244𔄂 9 ES0 0 0 1 SAME...YE 0D . 0 0 -40 -:0 0 246 344412; FMD 4-A-AS YES 0 1 0. 01 00 _ 0 A 0 204 848117I8 047 YSI .- 0 0 1 -60-A7 1 24 ;41:0 4-A44 YES 0 I 0. 0100 ’-0 -FC 249

The Renewal Equation for Markov Renewal Processes with Applications to Storage Models.

DTIC Science & Technology

1986-05-01

2.21) = pt(Bf(jO,A))v(EO, tD )+I(6=O)[:P(YnkB,T nkTnkk~t’Ynk-kiY) -2pO(Bn(j0 ,A))v([O,tJ3 if ye (j09A), with p, v as in corollary 2.2, and y and 6 are...S.) max ( max (S n-S )+(S n-S n 0~. l 5j:n no 0 14_XM nk -n: j!nk 0kI n n Thus, for all w 4EA, Z (wlmax( max (S -S.),x +S 1=0. (3.4) l,n 0 1j n 0

Solution of the mean spherical approximation for polydisperse multi-Yukawa hard-sphere fluid mixture using orthogonal polynomial expansions

NASA Astrophysics Data System (ADS)

Kalyuzhnyi, Yurij V.; Cummings, Peter T.

2006-03-01

The Blum-Høye [J. Stat. Phys. 19 317 (1978)] solution of the mean spherical approximation for a multicomponent multi-Yukawa hard-sphere fluid is extended to a polydisperse multi-Yukawa hard-sphere fluid. Our extension is based on the application of the orthogonal polynomial expansion method of Lado [Phys. Rev. E 54, 4411 (1996)]. Closed form analytical expressions for the structural and thermodynamic properties of the model are presented. They are given in terms of the parameters that follow directly from the solution. By way of illustration the method of solution is applied to describe the thermodynamic properties of the one- and two-Yukawa versions of the model.

An NQR Study of TNT Characteristics.

DTIC Science & Technology

1977-09-01

RDX , HMX , a r d some of t he heavy me t al 3~~: id~.s h~~’n for rn.nn ye.~rs been use d as rn~~lit~~ry nii p lns i n’t-~~~~, Thr p h y s i c a l...ambient temperatures of more than one coexisting crystal phase. This polymorphism is known to occur in TNT , HMX and PbN3, and is responsible for a...specific problems of TNT polymorphism and phase transitions were researched . This is one of the problems which is relevant to present day concerns . The

Wood Joist Floors: Probabilistic Analysis of Joist Stiffness Measured at Retail Lumberyards.

DTIC Science & Technology

1982-10-01

me.er maltsmctiued. Rad then a o minrama onotboo, Other species.) A 2 by 8 stamped S-ORN denotes that It was we choe to thsude m xcept for de variabls tha...t4- * 70 2.00 6o 0." 0,t50 -nO.16" 50 ~60 la -. 03 A .0.6 40 .: s 3.62 30040 2.70 20 - 30 10 20 0 . I * I Ip I * p . a10 .50 .60 .70 .80 .90 1.00...34kthstavrageft ye protely ere t. A discussion of the procedures for "idealizing," which considers variability in the histograms on thickness, width

JPRS Report, Science & Technology, USSR: Computers

DTIC Science & Technology

1987-09-10

O H V 01 Ü C Q) ö H n) in u At A2 Af A2 SC-S5SI A3 A4...At A2 20 Af A2 At 42 -55" A4 ) A3 A4 -555e i Ü .■•; sj <, .^ ^ u o ca to <u u o u CM cfl u u C dJ u u to O i-l 4J tii... O C Q) ß l-l tfl !Z> O Key: A. Multiplex channel. The input of subchannel A of the YeS-5568 disk controller is connected to the first

Corrosion Modeling and Testing of Riveted Aluminum Alloy Panel

DTIC Science & Technology

2012-08-28

Curve Measurement • V-I measurement using rotating disk electrode ( RDE ) captures mass transport contribution • Mass transport can be important for...curve measurement needed Rotating Disk Electrode ( RDE ) y = 0.0353x + 0.1796 0 10 20 30 40 50 60 70 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0 5 10 15 B ou nd...ar y la ye r t hi ck ne ss , um D iff us io n Li m ite d C ur re nt ( m A /c m 2 ) Rotation Rate, w1/2 (radian s-1)1/2 Cu RDE Tests IL, mA

Experiment to measure vacuum birefringence: Conceptual design

NASA Astrophysics Data System (ADS)

Mueller, Guido; Tanner, David; Doebrich, Babette; Poeld, Jan; Lindner, Axel; Willke, Benno

2016-03-01

Vacuum birefringence is another lingering challenge which will soon become accessible to experimental verification. The effect was first calculated by Euler and Heisenberg in 1936 and is these days described as a one-loop correction to the differential index of refraction between light which is polarized parallel and perpendicular to an external magnetic field. Our plan is to realize (and slightly modify) an idea which was originally published by Hall, Ye, and Ma using advanced LIGO and LISA technology and the infrastructure of the ALPS light-shining-through-walls experiment following the ALPS IIc science run. This work is supported by the Deutsche Forschungsgemeinschaft and the Heising-Simons Foundation.

Bibliography of Soviet Laser Developments, Number 62, November-December 1982.

DTIC Science & Technology

1983-10-30

A V ill UBOV V S 26 VODOVATOV I A 76 TITOV YE A 34,96 USOVA N A 1 VOZOT B 16 TRAL’ V A 113 USTINOY N D 12,59 VOLCHENOK V 1 17 TODUA...of single pulse lasing. ZhPS, v . 37, no. 5, 1982, 741-748. 3. Zaskal’ko, O.P., and l.G. Rudoy (1). Giant pulse lasing without a resonator. ZhETF P, v ...2534. b. Er 3+ 8. Kaminskiy, A.A. (13).- Staged lasing from Er3 ions in YAlO 3crytal a4 4 1 IV 4 4a 3/2--:--3/2 ’~ A +111/2-1-

Joint Logistics Commanders Precision Optics Study

DTIC Science & Technology

1987-06-19

DOCUMENTATION PAGE 11IFORE couri- EIING FORM YI T I (-’a 1.61100~) TYEor arFPO. a PERIOD t’V.Fi.(( JoI-rT PRECISION OPTICS TECHINIC.AL GROUP FINHAL I PRVOr kG...34*m rtlds ortw d ta.4 i r’f. Wu Uuuai mkidu*~s @9 o pndct praade by Ow MfsKM 9W fidsder ~Ye bevwil Af cnot ei ’ for ,tWta &.Vtionitt it ts" diviate wi...Canada Austria Belgium i):E ( upec If, Price Quald ’ILy Input coz:b: capital other (specify) DelIvery (lead-time) Foo1 uc rv Ice Resea: ’, capatiliity Csto

Fluorescein sodium-guided surgery of a brain abscess: A case report

PubMed Central

Höhne, Julius; Brawanski, Alexander; Schebesch, Karl-Michael

2016-01-01

Background: Up to now, the feasibility and benefit of using fluorescein sodium under a dedicated surgical microscope filter (YE560, YELLOW 560 nm filter, Carl Zeiss Meditec, Germany) has never been clinically evaluated in infectious disorders of the brain. Case Description: Here, we report the case of a male patient with a brain abscess in the right parietal lobe that was removed under fluorescence-guidance (intravenous administration of fluorescein sodium 10%, 5 mg/kg bodyweight). The abscess capsule showed intensive yellow fluorescent staining, while − under white light − the cortex appeared normal. Conclusion: This technique may improve the identification and surgical removal of brain abscesses. PMID:28031990

Perfection and Entry: An Example,

DTIC Science & Technology

1983-07-01

p(t),a(t)) 0 I t=fi I (2) - t-1 H ([p,a]) = (I - C) I h (p(t),a(t)) E t-1 E The stationary equilibrium outcomes of such a game are those strategy...aSO41 SuOwe seP! JO ague4:pxO a4) aMP)! 03 s! asodind Ja4aIL ye~s leuossajoid sll ol asias e se uoiejodioj) puell a4. Aq partssi ate siaded saiuaS...does not 1). reduce the set of equilibrium outcomes in the discounted gamelJ. The essential features of the market situation required to produce the phe

Towards a bulk description of higher spin SYK

NASA Astrophysics Data System (ADS)

González, Hernán A.; Grumiller, Daniel; Salzer, Jakob

2018-05-01

We consider on the bulk side extensions of the Sachdev-Ye-Kitaev (SYK) model to Yang-Mills and higher spins. To this end we study generalizations of the Jackiw-Teitelboim (JT) model in the BF formulation. Our main goal is to obtain generalizations of the Schwarzian action, which we achieve in two ways: by considering the on-shell action supplemented by suitable boundary terms compatible with all symmetries, and by applying the Lee-Wald-Zoupas formalism to analyze the symplectic structure of dilaton gravity. We conclude with a discussion of the entropy (including log-corrections from higher spins) and a holographic dictionary for the generalized SYK/JT correspondence.

Maps of Quadrangles 3870 and 3770, Maymayk (211), Jamarj-I-Bala (212), Faydz-Abad (217), and Parkhaw (218) Quadrangles, Afghanistan

USGS Publications Warehouse

,

2007-01-01

By selecting one of the four series options shown below, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively, the user will be taken to that map.

Rising risk of type 2 diabetes among inhabitants of Jamnagar, Gujarat: A cross-sectional survey

PubMed Central

Sharma, Rohit; Prajapati, Pradeep Kumar

2015-01-01

Introduction: Undoubtedly, diabetes is an incremental threat for the world health and substantial evidence now suggest that diabetes is strongly associated with patients’ unhealthy lifestyle, behavioral patterns, and socioeconomic changes. Treatment modalities, in particular to this disease differs from patient to patient. In Ayurveda, this individuality is decided on the basis of Prakriti, Vaya, Bala, Desha etc., and hence it is essential to know these factors for successful management of diseases. Aim: To assess the role of demographic profile, changes in life style habits, dietary patterns, occupational and social background in increasing prevalence of type 2 diabete mellitus (DM) at Jamnagar region. Materials and Methods: A cross-sectional survey study was conducted on randomly selected 350 diabetic patients of Jamnagar region. A survey proforma was prepared and detailed history of each patient fulfilling the diagnostic criteria was taken along with demographic profile. Observations and Conclusion: The obtained data reveals that, certain faulty dietary and life style regimes of this region are responsible in manifestation of DM. Its magnitude and low awareness warrants appropriate public health interventions for its effective control. PMID:26730132

A Mathematical Study on “Additive Technique” Versus “Branch and Bound Technique” for Solving Binary Programming Problem

NASA Astrophysics Data System (ADS)

Sufahani, Suliadi; Ghazali Kamardan, M.; Saifullah Rusiman, Mohd; Mohamad, Mahathir; Khalid, Kamil; Ali, Maselan; Khalid, Kamal; Nawawi, MKM; Ahmad, Asmala

2018-04-01

A solid body needs adequate supplements from nourishment that we eat each day. Eating pretty much than what our body needs will prompt lack of healthy sustenance (under-nourishment and over-nourishment). In Malaysia, a few reviews have been directed to examine the wholesome status of Malaysians, particularly among youngsters and youths. However there are different methods for taking care of the menu arranging issue and in this paper Binary Programming (BP) is executed. Separately, “Additive Technique (AT)” and “Branch and Bound Technique (BBT)” are utilized as a part of BP. Both methodologies utilize diverse systems and might yield distinctive ideal arrangements. Along these lines, this study expects to build up a scientific model for eating regimen arranging that meets the essential supplement admission and look at the outcomes yield through additive substance and branch and bound methodologies. The information was gathered from different all inclusive schools and furthermore from the Ministry of Education. The model was illuminated by utilizing the Balas Algorithm through AT and Binary Programming through BBT.

X-Ray Computed Tomography Reveals the Response of Root System Architecture to Soil Texture.

PubMed

Rogers, Eric D; Monaenkova, Daria; Mijar, Medhavinee; Nori, Apoorva; Goldman, Daniel I; Benfey, Philip N

2016-07-01

Root system architecture (RSA) impacts plant fitness and crop yield by facilitating efficient nutrient and water uptake from the soil. A better understanding of the effects of soil on RSA could improve crop productivity by matching roots to their soil environment. We used x-ray computed tomography to perform a detailed three-dimensional quantification of changes in rice (Oryza sativa) RSA in response to the physical properties of a granular substrate. We characterized the RSA of eight rice cultivars in five different growth substrates and determined that RSA is the result of interactions between genotype and growth environment. We identified cultivar-specific changes in RSA in response to changing growth substrate texture. The cultivar Azucena exhibited low RSA plasticity in all growth substrates, whereas cultivar Bala root depth was a function of soil hardness. Our imaging techniques provide a framework to study RSA in different growth environments, the results of which can be used to improve root traits with agronomic potential. © 2016 American Society of Plant Biologists. All Rights Reserved.

Contribution of corresponding member of the USSR Academy of Sciences Ye. A. Korovin to the science of international space law. Anniversary of corresponding member of the USSR Academy of Sciences, Professor Ye. A. Korovin

NASA Technical Reports Server (NTRS)

Zhukov, G. P.

1980-01-01

The Soviet Union's participation in the solution of international legal problems as space flights became possible is reviewed with emphasis on the efforts of the most prominent Soviet international lawyer. Some of the professor's 230 writings are highlighted.

Identification of lactobacilli with inhibitory effect on biofilm formation by pathogenic bacteria on stainless steel surfaces.

PubMed

Ait Ouali, Fatma; Al Kassaa, Imad; Cudennec, Benoit; Abdallah, Marwan; Bendali, Farida; Sadoun, Djamila; Chihib, Nour-Eddine; Drider, Djamel

2014-11-17

Two hundred and thirty individual clones of microorganisms were recovered from milk tanks and milking machine surfaces at two distinct farms (Bejaja City, Algeria). Of these clones, 130 were identified as lactic acid bacteria (LAB). In addition Escherichia coli, Salmonella, Staphylococcus aureus and Pseudomonas aeruginosa species were identified in the remaining 100 isolates-spoilage isolate. These isolates were assayed for ability to form biofilms. S. aureus, Lactobacillus brevis strains LB1F2, LB14F1 and LB15F1, and Lactobacillus pentosus strains LB2F2 and LB3F2 were identified as the best biofilm formers. Besides, these LAB isolates were able to produce proteinaceous substances with antagonism against the aforementioned spoilage isolates, when grown in MRS or TSB-YE media. During the screening, L. pentosus LB3F2 exhibited the highest antibacterial activity when grown in TSB-YE medium at 30 °C. Additionally, L. pentosus LB3F2 was able to strongly hamper the adhesion of S. aureus SA3 on abiotic surfaces as polystyrene and stainless steel slides. LAB isolates did not show any hemolytic activity and all of them were sensitive to different families of antibiotic tested. It should be pointed out that LB3F2 isolate was not cytotoxic on the intestinal cells but could stimulate their metabolic activity. This report unveiled the potential of LB1F2, LB14F1, LB15F1, LB2F2, and LB3F2 isolates to be used as natural barrier or competitive exclusion organism in the food processing sector as well as a positive biofilm forming bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Age and gender patterns of thyroid cancer incidence in Ukraine depending on thyroid radiation doses from radioactive iodine exposure after the Chornobyl NPP accident.

PubMed

Fuzik, M M; Prysyazhnyuk, A Y; Shibata, Y; Romanenko, A Y; Fedorenko, Z P; Gudzenko, N A; Gulak, L O; Trotsyuk, N K; Goroh, Y L; Khukhrianska, O M; Sumkina, O V; Saenko, V A; Yamashita, S

2013-01-01

The objective of this study was to investigate the thyroid cancer incidence in a whole territory of Ukraine and to clear up its age and gender patterns depending on average regional (oblast) thyroid doses from radioactive iodine due to the Chornobyl accident. MATERIALS AND METHODS. On the basis of average accumulated thyroid doses from radioactive iodine the geographical regions of Ukraine with low and high average thyroid doses were identified for a comparative analysis performance. Methods of descriptive epidemiology were used. The level and dynamics of thyroid cancer incidence were analyzed in different gender and age groups (both for attained age and age at the moment of the Chornobyl accident). Results of this study confirmed the radiation excess of thyroid cancer in individuals who were children and adolescents in 1986. Some excess was observed in elder age groups too. Especial situation was observed in female age group 40-49 at the moment of the Chornobyl accident i.e. the age-specific thyroid cancer incidence rates were significantly higher in "high exposure" regions comparing with "low exposure" ones during all years of observation within 1989-2009. A probable radiation excess of thyroid cancer was suggested not only in children and adolescents but also in adult age groups. In elder age groups this excess was less expressed and manifested after a longer period of time. The origin of the phenomenon in female age group of 40-49 is unclear now. Hypothesis of combined effect of radiation and natural changing of hormonal status in this age should be checked in the future studies. Fuzik M. M, Prysyazhnyuk A. Ye, Shibata Y., Romanenko A. Yu., Fedorenko Z. P., Gudzenko N. A., Gulak L. O., Trotsyuk N. K., Goroh Ye. L., Khukhrianska O. M., Sumkina O. V., Saenko V. A., Yamashita Sh., 2013.

Resonant spin-flavor conversion of supernova neutrinos: Dependence on presupernova models and future prospects

NASA Astrophysics Data System (ADS)

Ando, Shin'ichiro; Sato, Katsuhiko

2003-07-01

We study the resonant spin-flavor (RSF) conversion of supernova neutrinos, which is induced by the interaction between the nonzero neutrino magnetic moment and the supernova magnetic fields, and its dependence on presupernova models. As the presupernova models, we adopt the latest ones by Woosley, Heger, and Weaver, and, further, models with both solar and zero metallicity are investigated. Since the (1-2Ye) profile of the new presupernova models, which is responsible for the RSF conversion, suddenly drops at the resonance region, the completely adiabatic RSF conversion is not realized, even if μνB0=(10-12μB)(1010 G), where B0 is the strength of the magnetic field at the surface of the iron core. In particular for the model with zero metallicity, the conversion is highly nonadiabatic in the high energy region, reflecting the (1-2Ye) profile of the model. In calculating the flavor conversion, we find that the shock wave propagation, which changes density profiles drastically, is a much more severe problem than it is for the pure Mikheyev-Smirnov-Wolfenstein (MSW) conversion case. This is because the RSF effect occurs at a far deeper region than the MSW effect. To avoid the uncertainty concerning the shock propagation, we restrict our discussion to 0.5 s after the core bounce (and for more conservative discussion, 0.25 s), during which the shock wave is not expected to affect the RSF region. We also evaluate the energy spectrum at the Super-Kamiokande detector for various models using the calculated conversion probabilities, and find that it is very difficult to obtain useful information on the supernova metallicities and magnetic fields or on the neutrino magnetic moment from the supernova neutrino observation. Future prospects are also discussed.

Structure of the metal-dependent deacetylase LpxC from Yersinia enterocolitica complexed with the potent inhibitor CHIR-090 .

PubMed

Cole, Kathryn E; Gattis, Samuel G; Angell, Heather D; Fierke, Carol A; Christianson, David W

2011-01-18

The first committed step of lipid A biosynthesis is catalyzed by UDP-(3-O-((R)-3-hydroxymyristoyl))-N-acetylglucosamine deacetylase, a metal-dependent deacetylase also known as LpxC. Because lipid A is essential for bacterial viability, the inhibition of LpxC is an appealing therapeutic strategy for the treatment of Gram-negative bacterial infections. Here we report the 1.79 Å resolution X-ray crystal structure of LpxC from Yersinia enterocolitica (YeLpxC) complexed with the potent hydroxamate inhibitor CHIR-090. This enzyme is a nearly identical orthologue of LpxC from Yersinia pestis (99.7% sequence identity), the pathogen that causes bubonic plague. Similar to the inhibition of LpxC from Escherichia coli, CHIR-090 inhibits YeLpxC via a two-step slow, tight-binding mechanism with an apparent K(i) of 0.54 ± 0.14 nM followed by conversion of the E·I to E·I* species with a rate constant of 0.11 ± 0.01 min(-1). The structure of the LpxC complex with CHIR-090 shows that the inhibitor hydroxamate group chelates the active site zinc ion, and the "tail" of the inhibitor binds in the hydrophobic tunnel in the active site. This hydrophobic tunnel is framed by a βαβ subdomain that exhibits significant conformational flexibility as it accommodates inhibitor binding. CHIR-090 displays a 27 mm zone of inhibition against Y. enterocolitica in a Kirby-Bauer antibiotic assay, which is comparable to its reported activity against other Gram-negative species including E. coli and Pseudomonas aeruginosa. This study demonstrates that the inhibition of LpxC should be explored as a potential therapeutic and/or prophylatic response to infection by weaponized Yersinia species.

Magnetoassociation of KRb Feshbach molecules

NASA Astrophysics Data System (ADS)

Cumby, Tyler; Perreault, John; Shewmon, Ruth; Jin, Deborah

2010-03-01

I will discuss experiments in which we study the creation of ^40K^87Rb Feshbach molecules via magnetoassociation. We measure the molecule number as a function of the magnetic-field sweep rate through the interspecies Feshbach resonance and explore the dependence of association on the initial atom gas conditions. This study of the Feshbach molecule creation process may be relevant to the production of ultracold polar molecules, where magnetoassociated Feshbach molecules can be a crucial first step [1].[4pt] [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science, 2008, 322, 231- 235.

Magnetoassociation of KRb Feshbach molecules

NASA Astrophysics Data System (ADS)

Cumby, Tyler; Perreault, John; Shewmon, Ruth; Jin, Deborah

2010-03-01

I will discuss experiments in which we study the creation of ^40K^87Rb Feshbach molecules via magnetoassociation. We measure the molecule number as a function of the magnetic-field sweep rate through the interspecies Feshbach resonance and explore the dependence of association on the initial atom gas conditions. This study of the Feshbach molecule creation process may be relevant to the production of ultracold polar molecules, where magnetoassociated Feshbach molecules can be a crucial first step [1].[4pt] [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science, 2008, 322, 231-235.

An Examination of Target Tracking in the Antisubmarine Warfare Systems Evaluation Tool (ASSET)

DTIC Science & Technology

1991-09-01

fnCorC- Ingi Ing?)))) WX CY) Calt) (dlat2 Ccosl.±sp lat2 C) (if 0- C. diet dIng? 0.0001) (proqa (if (- flag 0) (proqa (if f- ding 0) (proqa (if (c latl...x Y)) (if (or C brg 90) Cbzg 2101) fsetq rnq C- cat? dIng)) Csetq tag (abs C/ diet Cco&Lisp brgC C C Csetq rng tC 60.1077 rng)) (list rag brgC C;let...Xdus i .X KetO : 0 yea 0 0 vi : .- (-2ln(md(I ))) cod 2rad(l ( i +Xd ye n .- (-2.n(rd(I)))n 2- rnd(I ) +Ydis n ,Vet V .xp -aA 4A,- - .k .H- it .- vx

Analysis and Improvement of Large Payload Bidirectional Quantum Secure Direct Communication Without Information Leakage

NASA Astrophysics Data System (ADS)

Liu, Zhi-Hao; Chen, Han-Wu

2018-02-01

As we know, the information leakage problem should be avoided in a secure quantum communication protocol. Unfortunately, it is found that this problem does exist in the large payload bidirectional quantum secure direct communication (BQSDC) protocol (Ye Int. J. Quantum. Inf. 11(5), 1350051 2013) which is based on entanglement swapping between any two Greenberger-Horne-Zeilinger (GHZ) states. To be specific, one half of the information interchanged in this protocol is leaked out unconsciously without any active attack from an eavesdropper. Afterward, this BQSDC protocol is revised to the one without information leakage. It is shown that the improved BQSDC protocol is secure against the general individual attack and has some obvious features compared with the original one.

Water Quality Management Studies, Lake Seminole, February-December 1979. Phase II.

DTIC Science & Technology

1982-12-01

Carbon, Dissolved Organtc X X X X X X X Carbon. Total Organic I I X I X X" X Carbon Dioxide I X X X X X X I trogen. Total Amonia I X I X X X I Nitrogen...were less than 1 mg S04/1. During Phase I and Phase II there were no distinctive trends in measured carbon dioxide levels. However, there was a tendency...6. so 0 To CARSON DIOXIDE (MG C02.01. 0 1.3 Re 1. Re 0. 2* 0 NITROGEN. TOTAL AMMONIA IMG N/’LI 0.02 < 0.02 < 0.02 CO (002 ’ NITROG01. NITPATE.NITT2lYE

Oliver E. Buckley Condensed Matter Prize: Emergent gravity from interacting Majorana modes

NASA Astrophysics Data System (ADS)

Kitaev, Alexei

I will describe a concrete many-body Hamiltonian that exhibits some features of a quantum black hole. The Sachdev-Ye-Kitaev model is a system of N >> 1 Majorana modes that are all coupled by random 4-th order terms. The problem admits an approximate dynamic mean field solution. At low temperatures, there is a fluctuating collective mode that corresponds to reparametrization of time. The effective action for this mode is equivalent to dilaton gravity in two space-time dimensions. Some important questions are how to quantize the reparametrization mode in Lorentzian time, include dissipative effects, and understand this system from the quantum information perspective. Supported by the Simons Foundation, Award Number 376205.

National Program for Inspection of Non-Federal Dams. Union Meadows Dam, (N.H. 00222), State Number 241.05, Piscataqua River Basin, Wakefield, New Hampshire. Phase I Inspection Report.

DTIC Science & Technology

1979-11-01

inspection, Union Meadows Dam is in good 3-1 condition. Trees growing on thc - e-ast bar-,k of tne discharge channel between the damn and State Route 16T...Vernon A. Know ttOn On the mornin, 01 Novem-,ber 14, 1 9t8, 1 - isitedl L:nion eaw to check a leak oni the lef-t abutmentL ol: thc spillw;oy Thke...8217t 1 .Ce ev-:-r: f ive ye -rs. c)ai.,i3tanft ri1th -. ,m pt~qnt ijlt&vi.-i~ 1-s-’ctor is na ex-oert an ’-i-t~~i~~r~.iK"., cbd sinflt you wiII be

Medical Physics Panel Discussion

NASA Astrophysics Data System (ADS)

Guèye, Paul; Avery, Steven; Baird, Richard; Soares, Christopher; Amols, Howard; Tripuraneni, Prabhakar; Majewski, Stan; Weisenberger, Drew

2006-03-01

The panel discussion will explore opportunities and vistas in medical physics research and practice, medical imaging, teaching medical physics to undergraduates, and medical physics curricula as a recruiting tool for physics departments. Panel members consist of representatives from NSBP (Paul Guèye and Steven Avery), NIH/NIBIB (Richard Baird), NIST (Christopher Soares), AAPM (Howard Amols), ASTRO (Prabhakar Tripuraneni), and Jefferson Lab (Stan Majewski and Drew Weisenberger). Medical Physicists are part of Departments of Radiation Oncology at hospitals and medical centers. The field of medical physics includes radiation therapy physics, medical diagnostic and imaging physics, nuclear medicine physics, and medical radiation safety. It also ranges from basic researcher (at college institutions, industries, and laboratories) to applications in clinical environments.

[Briefly analysis on academic origins of traditional Chinese medicine dispensing].

PubMed

Zhao, Xue-Min; Zhang, Xiao-Juan; Zhai, Hua-Qiang; Jin, Shi-Yuan

2014-04-01

Through collecting and collating the development process of traditional Chinese medicine dispensing, the development of modern Chinese medicine dispensing on the basis of experience could be promoted. "Heyaofenji", "Hehe", " Heji" in ancient Chinese medicine, herbal medicine literature and law were collected, and then things were sorted out according to traditional Chinese medicine dispensing theory, skills and legal norms. Firstly, "Tang Ye Jing Fa" is the earliest book which marks the rudiment of traditional Chinese medicine dispensing. Secondly, traditional Chinese medicine dispensing theory formed in "Shen Nong's herbal classic". Thirdly, Zhang Zhongjing's "Treatise on Febrile Diseases" marked the formation of Chinese medicine dispensing skills. Lastly, Provisions in Tang Dynasty law marks the development of traditional Chinese medicine dispensing.

Topographic Map of Quadrangles 3770 and 3870, Maymayk (211), Jamarj-I-Bala (212), Faydz-Abad (217), and Parkhaw (218) Quadrangles, Afghanistan

USGS Publications Warehouse

Bohannon, Robert G.

2006-01-01

This map was produced from several larger digital datasets. Topography was derived from Shuttle Radar Topography Mission (SRTM) 85-meter digital data. Gaps in the original dataset were filled with data digitized from contours on 1:200,000-scale Soviet General Staff Sheets (1978-1997). Contours were generated by cubic convolution averaged over four pixels using TNTmips surface-modeling capabilities. Minor artifacts resulting from the auto-contouring technique are present. Streams were auto-generated from the SRTM data in TNTmips as flow paths. Flow paths were limited in number by their Horton value on a quadrangle-by-quadrangle basis. Peak elevations were averaged over an area measuring 85 m by 85 m (represented by one pixel), and they are slightly lower than the highest corresponding point on the ground. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Because cultural features were not derived from the SRTM base, they do not match it precisely. Province boundaries are not exactly located. This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (Afghan Geological Survey) quadrangles covering Afghanistan. The maps for any given quadrangle have the same open-file number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The open-file report (OFR) numbers for each quadrangle range in sequence from 1092 - 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

False-Color-Image Map of Quadrangles 3560 and 3562, Sir Band (402), Khawja-Jir (403), and Bala-Murghab (404) Quadrangles, Afghanistan

USGS Publications Warehouse

Davis, Philip A.; Turner, Kenzie J.

2007-01-01

This map is a false-color rendition created from Landsat 7 Enhanced Thematic Mapper Plus imagery collected between 1999 and 2002. The false colors were generated by applying an adaptive histogram equalization stretch to Landsat bands 7 (displayed in red), 4 (displayed in green), and 2 (displayed in blue). These three bands contain most of the spectral differences provided by Landsat imagery and, therefore, provide the most discrimination between surface materials. Landsat bands 4 and 7 are in the near-infrared and short-wave-infrared regions, respectively, where differences in absorption of sunlight by different surface materials are more pronounced than in visible wavelengths. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Cultural features were not derived from the Landsat base and consequently do not match it precisely. This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (U.S. Geological Survey/Afghan Geological Survey) quadrangles covering Afghanistan. The maps for any given quadrangle have the same open-file report (OFR) number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The OFR numbers range in sequence from 1092 to 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

Geologic Map of Quadrangles 3870 and 3770, Maymayk (211), Jamarj-I-Bala (212), Faydz-Abad (217), and Parkhaw (218) Quadrangles, Afghanistan

USGS Publications Warehouse

Bohannon, Robert G.; Stoeser, Douglas B.

2007-01-01

This map was produced from several larger digital datasets. Topography was derived from Shuttle Radar Topography Mission (SRTM) 85-meter digital data. Gaps in the original dataset were filled with data digitized from contours on 1:200,000-scale Soviet General Staff Sheets (1978-1997). Contours were generated by cubic convolution averaged over four pixels using TNTmips surface-modeling capabilities. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Geologic data and the international boundary of Afghanistan were taken directly from Abdullah and Chmyriov (1977). It is the primary intent of the U.S. Geological Survey (USGS) to present the geologic data in a useful format while making them publicly available. These data represent the state of geologic mapping in Afghanistan as of 2005, although the original map was released in the late 1970s (Abdullah and Chmyriov, 1977). The USGS has made no attempt to modify original geologic map-unit boundaries and faults; however, modifications to map-unit symbology, and minor modifications to map-unit descriptions, have been made to clarify lithostratigraphy and to modernize terminology. The generation of a Correlation of Map Units (CMU) diagram required interpretation of the original data, because no CMU diagram was presented by Abdullah and Chmyriov (1977). This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (Afghan Geological Survey) quadrangles shown on the index map. The maps for any given quadrangle have the same open-file report (OFR) number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The OFR numbers range in sequence from 1092 to 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

Natural-Color-Image Map of Quadrangles 3560 and 3562, Sir Band (402), Khawja-Jir (403), and Bala-Murghab (404) Quadrangles, Afghanistan

USGS Publications Warehouse

Davis, Philip A.; Turner, Kenzie J.

2007-01-01

This map is a natural-color rendition created from Landsat 7 Enhanced Thematic Mapper Plus imagery collected between 1999 and 2002. The natural colors were generated using calibrated red-, green-, and blue-wavelength Landsat image data, which were correlated with red, green, and blue values of corresponding picture elements in MODIS (Moderate Resolution Imaging Spectrometer) 'true color' mosaics of Afghanistan. These mosaics have been published on http://www.truecolorearth.com and modified to match more closely the Munsell colors of sampled surfaces. Peak elevations are derived from Shuttle Radar Topography Mission (SRTM) digital data, averaged over a pixel representing an area of 85 m2, and they are slightly lower than the highest corresponding local point. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Cultural features were not derived from the Landsat base and consequently do not match it precisely. This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (U.S. Geological Survey/Afghan Geological Survey) quadrangles covering Afghanistan. The maps for any given quadrangle have the same open-file report (OFR) number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The OFR numbers range in sequence from 1092 to 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

Phenomenological extraction of two-photon exchange amplitudes from elastic electron-proton scattering cross section data

NASA Astrophysics Data System (ADS)

Qattan, I. A.

2017-05-01

Background: The inconsistency in the results obtained from the Rosenbluth separation method and the high-Q2 recoil polarization results on the ratio μpGEp/GMp implies a systematic difference between the two techniques. Several studies suggest that missing higher-order radiative corrections to elastic electron-proton scattering cross section σR(ɛ ,Q2) and in particular hard two-photon-exchange (TPE) contributions could account for the discrepancy. Purpose: In this work, I improve on and extend to low and high Q2 values the extractions of the ɛ dependence of the real parts of the TPE amplitudes relative to the magnetic form factor, as well as the ratio Pl/PlBorn(ɛ ,Q2) by using world data on σR(ɛ ,Q2) with an emphasis on precise new data covering the low-momentum region which is sensitive to the large-scale structure of the nucleon. Method: I combine cross section and polarization measurements of elastic electron-proton scattering to extract the TPE amplitudes. Because the recoil polarization data were confirmed "experimentally" to be essentially independent of ɛ , I constrain the ratio Pt/Pl(ɛ ,Q2) to its ɛ -independent term (Born value) by setting the TPE contributions to zero. This allows for the amplitude YM(ɛ ,Q2) and σR(ɛ ,Q2) to be expressed in terms of the remaining two amplitudes YE(ɛ ,Q2) and Y3(ɛ ,Q2) which in turn are parametrized as second-order polynomials in ɛ and Q2 to reserve as possible the linearity of σR(ɛ ,Q2) as well as to account for possible nonlinearities in the TPE amplitudes. Furthermore, I impose the Regge limit which ensures the vanishing of the TPE contributions to σR(ɛ ,Q2) and the TPE amplitudes in the limit ɛ →1 . Results: I provide simple parametrizations of the TPE amplitudes, along with an estimate of the fit uncertainties. The extracted TPE amplitudes are compared with previous phenomenological extractions and TPE calculations. The Pl/PlBorn ratio is extracted by using the new parametrizations of the TPE

Seed Placement into Veggie Pods

NASA Image and Video Library

2018-02-27

Dr. Ye Zhang, a project scientists, places seeds in Veggie Passive Orbital Nutrient Delivery System (PONDS) units inside a laboratory at the Space Station Processing Facility at NASA's Kennedy Space Center in Florida. Veggie PONDS is a direct follow-on to the Veg-01 and Veg-03 hardware and plant growth validation tests. The primary goal of this newly developed plant growing system, Veggie PONDS, is to demonstrate uniform plant growth. PONDS units have features that are designed to mitigate microgravity effects on water distribution, increase oxygen exchange and provide sufficient room for root zone growth. PONDS is planned for use during Veg-04 and Veg-05 on the International Space Station after the Veggie PONDS Validation flights on SpaceX-14 and OA-9.

Retracted: Long-term copper toxicity in apple trees (Malus pumila Mill) and bioaccumulation in fruits.

PubMed

Sun, Bai-Ye; Kan, Shi-Hong; Zhang, Yan-Zong; Wu, Jun; Deng, Shi-Huai; Liu, Chun-Sheng; Yang, Gang

2010-01-15

The following article from Environmental Toxicology, 'Long-term Copper Toxicity in Apple Trees (Malus pumila Mill) and Bioaccumulation in Fruits' by Bai-Ye Sun, Shi- Hong Kan, Yan-Zong Zhang, Jun Wu, Shi-Huai Deng, Chun-Sheng Liu and Gang Yang, published online on January 15, 2010 in Wiley InterScience (www.interscience.wiley.com; DOI: 10.1002/tox.20565), has been retracted by agreement between the authors, the journal Editor in Chief, Dr. Paul Tchounwou, and Wiley Periodicals, Inc. The retraction has been agreed at the request of the authors due to overlap with 'Copper Toxicity and Bioaccumulation in Chinese Cabbage (Brassica pekinensis Rupr.)' by Zhi-Ting Xiong and Hai Wang, published in Environmental Toxicology, Volume 20, pages 188-194, 2005.

Aftershocks to Philippine quake found within nearby megathrust fault

NASA Astrophysics Data System (ADS)

Schultz, Colin

2013-02-01

On 31 August 2012 a magnitude 7.6 earthquake ruptured deep beneath the sea floor of the Philippine Trench, a powerful intraplate earthquake centered seaward of the plate boundary. In the wake of the main shock, sensors detected a flurry of aftershocks, counting 110 in total. Drawing on seismic wave observations and rupture mechanisms calculated for the aftershocks, Ye et al. found that many were located near the epicenter of the main intraplate quake but at shallower depth; all involved normal faulting. Some shallow thrusting aftershocks were located farther to the west, centered within the potentially dangerous megathrust fault formed by the subduction of the Philippine Sea plate beneath the Philippine microplate, the piece of crust housing the Philippine Islands.

The Schwarzian theory — origins

NASA Astrophysics Data System (ADS)

Mertens, Thomas G.

2018-05-01

In this paper we further study the 1d Schwarzian theory, the universal low-energy limit of Sachdev-Ye-Kitaev models, using the link with 2d Liouville theory. We provide a path-integral derivation of the structural link between both theories, and study the relation between 3d gravity, 2d Jackiw-Teitelboim gravity, 2d Liouville and the 1d Schwarzian. We then generalize the Schwarzian double-scaling limit to rational models, relevant for SYK-type models with internal symmetries. We identify the holographic gauge theory as a 2d BF theory and compute correlators of the holographically dual 1d particle-on-a-group action, decomposing these into diagrammatic building blocks, in a manner very similar to the Schwarzian theory.

Cumulative Author Index for Soviet Laser Bibliographies Nos. 67-93, September 1983-February 1989

DTIC Science & Technology

1990-02-01

91:62 ABRAHOV A YU 82:30 91:26 92:30 ABAKUOV V N 68:66 73:84 78:82 ABRAMOV 0 I 67:57 72:79 77:46 82:55 86: 15 88:70 ADALIYEV A E 75:9 ABRAHOV 0 V 90...75;68 93:77 ABRAMYAN ’T 0 70:52,72 ABDULLAYEV D A 74:36 ABRAHYAN YE A 70:99 ABDULIAYEV E A 91:25 ABRASIIIN V N 76:54 79:34 81:39 ABDULLAYEV F KH 86...LOYI,; V N S 67:71 91:53 ABSALYAHOVA E KI 87:84 ABDU[JHAIOV I G 90:108 ABSATAROVA N G 93:44 A8DUJL’tANIV R R 71:59 75:82 ABIJBAKIRUV A S 74:30 76:32 90

Introduction to watershed ecosystem services: Chapter 1

USGS Publications Warehouse

Hall, Jefferson S.; Stallard, Robert F.; Kirn, Vanessa

2015-01-01

Humans derive a great number of goods and services from terrestrial ecosystems (Millennium Ecosystem Assessment, 2003, 2005). Some, like timber, fruits, bush meat, and other forest based food stuffs, are evident but others are not so obvious. Increasingly policy makers have realized the importance of forests and other ecosystems in sequestering carbon, as clearing of once vibrant vegetation or draining of swamps releases carbon dioxide (U.S. DOE, 2012) and where planting trees – particularly in the tropics - takes carbon dioxide out of the atmosphere (Bala et al., 2007). Scientists and conservationists have long called our attention to the value of Neotropical landscapes for biodiversity conservation as forests and other ecosystems harbor vast numbers of species. In recent decades conservationists and policy makers have also highlighted the potential of forests and other ecosystems to regulate stream flows (Ibáñez et al., 2002, Laurance, 2007 but also see Calder et al., 2007) and play a role in assuring clean water (Uriarte et al., 2011). All of these goods and services are part of what is collectively referred to as ecosystem services or goods and services that are provided to humanity through the unimpeded natural function of the ecosystem.

Estimation of Tooth Size Discrepancies among Different Malocclusion Groups.

PubMed

Hasija, Narender; Bala, Madhu; Goyal, Virender

2014-05-01

Regards and Tribute: Late Dr Narender Hasija was a mentor and visionary in the light of knowledge and experience. We pay our regards with deepest gratitude to the departed soul to rest in peace. Bolton's ratios help in estimating overbite, overjet relationships, the effects of contemplated extractions on posterior occlusion, incisor relationships and identification of occlusal misfit produced by tooth size discrepancies. To determine any difference in tooth size discrepancy in anterior as well as overall ratio in different malocclusions and comparison with Bolton's study. After measuring the teeth on all 100 patients, Bolton's analysis was performed. Results were compared with Bolton's means and standard deviations. The results were also subjected to statistical analysis. Results show that the mean and standard deviations of ideal occlusion cases are comparable with those Bolton but, when the mean and standard deviation of malocclusion groups are compared with those of Bolton, the values of standard deviation are higher, though the mean is comparable. How to cite this article: Hasija N, Bala M, Goyal V. Estimation of Tooth Size Discrepancies among Different Malocclusion Groups. Int J Clin Pediatr Dent 2014;7(2):82-85.

"This Is London, How D'ye Like It?": Teaching the Streets in Eighteenth-Century London

ERIC Educational Resources Information Center

McGraw, Ken

2017-01-01

As a professor of eighteenth-century British Literature I am often tasked (like my colleagues in other areas) with constructing a period based syllabus that "represents" this portion of literary history. Every semester, without fail, I am befuddled by the word "represents." How, exactly, do I want to "represent" the…

VizieR Online Data Catalog: IRX-β relation of HII regions in NGC628 (Ye+, 2016)

NASA Astrophysics Data System (ADS)

Ye, C.; Zou, H.; Lin, L.; Lian, J.; Hu, N.; Kong, X.

2016-10-01

NGC 628 has been observed by the PPAK IFS Nearby Galaxies Survey (PINGS) performed by the 3.5m telescope of the Calar Alto Observatory. The IFU provides a sampling of 2.7", an optical wavelength range of 3700-7000Å with a spectral resolution of ~8Å. The final data set comprises 11094 individual spectra, and the typical spatial resolution is about 3.5"-4". The slice image at the Hα wavelength is used to determine HII regions. FUV and near-UV (NUV) images of NGC 628 were taken by the Galaxy Evolution Explorer (GALEX), which are centered at wavelengths of 1516 and 2267Å. IR images were taken by Spitzer IRAC (3.6um, 8.0um) and MIPS (24um). The spatial resolutions of UV and IR images are 4.3", 5.3", 1.9", 2.8", and 6.4", respectively. We obtain these images from the data release website of Local Volume Legacy (LVL) survey DR5 (Dale+, 2009, J/ApJ/703/517; http://irsa.ipac.caltech.edu/data/SPITZER/LVL/). (2 data files).

Volatile, Trace Element and Isotopic Variations of Mafic Arc Volcanic Rocks from Nicaragua and Costa Rica

NASA Astrophysics Data System (ADS)

Hoernle, K.; Sadofsky, S.; Nichols, H.; Portnyagin, M.; van den Bogaard, P.; Alvarado, G.

2003-12-01

Quaternary volcanic rocks from the Central American Volcanic Arc in central Nicaragua and central Costa Rica exhibit major differences in their volatile, trace element and isotopic compositions. Olivine-hosted melt inclusions in Nicaraguan volcanic rocks with high Fo contents (>73) extend to high H2O (up to 5.3%), S (10-6860 ppm) and Cl (490-2340 ppm) contents. The volcanic rocks have high ratios of fluid mobile to fluid immobile elements such as Ba/La (65-122), Ba/Th (484-1304) and U/La (0.08-0.17). Additionally, they have 143Nd/144Nd (0.51300-0.51307) similar to normal mid-ocean-ridge basalts (N-MORB) from the East Pacific Rise (EPR), but 87Sr/86Sr (0.7035-0.7042) ratios are much higher than those found in fresh EPR glasses. Pb isotopic compositions of the samples (e.g. 206Pb/204Pb = 18.5-19.0, 207Pb/204Pb = 15.52-15.58) form an array between EPR basalts and subducted sediments. The volatile, trace element and isotope data are consistent with mixing of fluids highly enriched in fluid-mobile elements from subducted sediments with a N-MORB-type mantle wedge to produce the Nicaraguan volcanic rocks. In contrast, olivine-hosted melt inclusions (Fo >82) in Costa Rican volcanic rocks show a similar range in H2O (up to 5.1%) to Nicaraguan inclusions but overall have lower S (0-1340 ppm) and Cl (10-790 ppm) contents. Costa Rican lavas also have lower Ba/La (7-35), Ba/Th (55-338), U/La (0.02-0.12), 87Sr/86Sr (0.7035-0.7038) and 143Nd/144Nd (0.51292-0.51301) than Nicaraguan lavas, but 87Sr/86Sr and Pb isotope ratios (e.g. 206Pb/204Pb = 19.02-19.32) are more radiogenic than in Nicaragua and than usually found in fresh EPR MORB. Our data are consistent with the presence of Galapagos Hotspot-type components in the source of the central Costa Rican volcanic rocks, derived from the subducting Galapagos Hotspot Track and from Galapagos-type material entering the mantle wedge through a slab tear or window (Abratis and Worner, 2000; Geology). The estimated volume of volcanic rocks

The Optical Spectrum of SrOH Re-Visited Zeeman Effect, High-Resolution Spectroscopy and Franck-Condon Factors.

NASA Astrophysics Data System (ADS)

Nguyen, Trung; Kokkin, Damian L.; Steimle, Timothy; Kozyryev, Ivan; Doyle, John M.

2015-06-01

Motivated by a diverse range of applications in physics and chemistry, currently there is great interest in the cooling of molecules to very low temperatures (≤1 mK). Direct laser cooling has been previously demonstrated for the diatomic radicals SrF, YO, and CaF, and most recently a three-dimensional magneto-optical trap (MOT) of SrF molecules was achieved. To determine the possibility of laser cooling for polyatomic molecules containing three or more atoms, detailed information is required about their Franck-Condon factors (FCFs) for emission from the excited states of interest. Here we report on the high-resolution laser excitation spectra, recorded field-free and in the presence of a static magnetic field, and on the dispersed fluorescence (DF) spectra for the A^2Π1/2 ← X^2σ^+ and B^2σ^+ ← X ^2σ^+ electronic transitions of SrOH. The DF spectra were analyzed to precisely determine FCFs and compared with values predicted using a normal coordinate GF matrix approach. The recorded Zeeman spectra were analyzed to determine the magnetic moments. Implication for proposed laser cooling and trapping experiments for SrOH will be presented. E.S. Shuman, J.F. Barry and D. DeMille, Nature 467, 820 (2010) J.F. Barry, E.S. Shuman, E.B. Norrgard and D. DeMille, Phys. Rev. Lett. 108, 103002 (2012) M.T. Hummon, M. Yeo, B.K. Stuhl, A.L. Collopy, Y. Xia, and J. Ye, Phys. Rev. Lett. 110, 143001 (2013) M. Yeo, M.T. Hummon, A.L. Collopy, B. Yan, B. Hemmerling, E. Chae, J.M. Doyle, and J. Ye, arXiv:1501.04683 (2015) V. Zhelyazkova, A. Cournol, T.E. Wall, A. Matsushima, J.J. Hudson, E.A. Hinds, M.R. Tarbutt, and B.E. Sauer, Phys. Rev. A 89, 053416 (2014) J.F. Barry, D.J. McCarron, E.B. Norrgard, M.H. Steinecker and D. DeMille, Nature 512, 286 (2014) D.J. McCarron, E.B. Norrgard, M.H. Steinecker and D. DeMille, arXiv:1412.8220 (2014)

Improving culture media for the isolation of Clostridium difficile from compost.

PubMed

Dharmasena, Muthu; Jiang, Xiuping

2018-06-01

This study was to optimize the detection methods for Clostridium difficile from the animal manure-based composts. Both autoclaved and unautoclaved dairy composts were inoculated with a 12-h old suspension of a non-toxigenic C. difficile strain (ATCC 43593) and then plated on selected agar for vegetative cells and endospores. Six types of enrichment broths supplemented with taurocholate and l-cysteine were assessed for detecting a low level of artificially inoculated C. difficile (ca. 5 spores/g) from dairy composts. The efficacy of selected enrichment broths was further evaluated by isolating C. difficile from 29 commercial compost samples. Our results revealed that using heat-shock was more effective than using ethanol-shock for inducing endospore germination, and the highest endospore count (p < 0.05) was yielded at 60 °C for 25 min. C. difficile agar base, supplemented with 0.1% l-cysteine, 7% defibrinated horse blood, and cycloserine-cefoxitin (CDA-CYS-H-CC agar) was the best medium (p < 0.05) for recovering vegetative cells from compost. C. difficile endospore populations from both types of composts enumerated on both CDA-CYS-H-CC agar supplemented with 0.1% sodium taurocholate (CDA-CYS-H-CC-T agar) and brain heart infusion agar supplemented with 0.5% yeast extract, 0.1% l-cysteine, cycloserine-cefoxitin, and 0.1% sodium taurocholate (BHIA-YE-CYS-CC-T agar) media were not significantly different from each other (p > 0.05). Overall, enrichment of inoculated compost samples in broths containing moxalactam-norfloxacin (MN) produced significantly higher (p < 0.05) spore counts than in non-selective broths or broths supplemented with CC. Enrichment in BHIB-YE-CYS-MN-T broth followed by culturing on an agar containing 7% horse blood and 0.1% taurocholate provided a more sensitive and selective combination of media for detecting a low population of C. difficile from environmental samples with high background microflora. Copyright © 2018

Seed Placement into Veggie Pods

NASA Image and Video Library

2018-02-27

From left, Matthew Romeyn and Dr. Ye Zhang, project scientists, place seeds in Veggie Passive Orbital Nutrient Delivery System (PONDS) units inside a laboratory at the Space Station Processing Facility at NASA’s Kennedy Space Center in Florida. Veggie PONDS is a direct follow-on to the Veg-01 and Veg-03 hardware and plant growth validation tests. The primary goal of this newly developed plant growing system, Veggie PONDS, is to demonstrate uniform plant growth. PONDS units have features that are designed to mitigate microgravity effects on water distribution, increase oxygen exchange and provide sufficient room for root zone growth. PONDS is planned for use during Veg-04 and Veg-05 on the International Space Station after the Veggie PONDS Validation flights on SpaceX-14 and OA-9.

Infrared-thermography imaging system multiapplications for manufacturing

NASA Astrophysics Data System (ADS)

Stern, Sharon A.

1990-03-01

Imaging systems technology has been utilized traditionally for diagnosing structural envelope or insulation problems in the general thermographic comunity. Industrially, new applications for utilizing thermal imaging technology have been developed i n pred i cti ve/preventi ye mai ntenance and prod uct moni tori ng prociures at Eastman Kodak Company, the largest photographic manufacturering producer in the world. In the manufacturing processes used at Eastman Kodak Company, new applications for thermal imaging include: (1) Fluid transfer line insulation (2) Web coating drying uniformity (3) Web slitter knives (4) Heating/cooling coils (5) Overheated tail bearings, and (6) Electrical phase imbalance. The substantial cost benefits gained from these applications of infrared thermography substantiate the practicality of this approach and indicate the desirability of researching further appl i cati ons.

The importance of leaf- and litter-feeding invertebrates as sources of animal protein for the Amazonian Amerindians.

PubMed

Paoletti, M G; Dufour, D L; Cerda, H; Torres, F; Pizzoferrato, L; Pimentel, D

2000-11-22

At least 32 Amerindian groups in the Amazon basin use terrestrial invertebrates as food. Leaf- and litter-consuming invertebrates provide the more important, underestimated food sources for many Amerindian groups. Further, litter-consuming earthworms are also an important food resource for the Ye'Kuana (also known as Makiritare) in the Alto Orinoco (Amazonas, Venezuela). By selecting these small invertebrates the Amerindians are choosing their animal food from those food webs in the rainforest which have the highest energy flow and which constitute the greatest renewable stock of readily available nutrients. Here we show that the consumption of leaf- and litter-feeding invertebrates as a means of recovering protein, fat and vitamins by the forest-living peoples offers a new perspective for the development of sustainable animal food production within the paradigm of biodiversity maintenance.

False-Color-Image Map of Quadrangles 3870 and 3770, Maymayk (211), Jamarj-I-Bala (212), Faydz-Abad (217), and Parkhaw (218) Quadrangles, Afghanistan

USGS Publications Warehouse

Davis, Philip A.; Turner, Kenzie J.

2007-01-01

This map is a false-color rendition created from Landsat 7 Enhanced Thematic Mapper Plus imagery collected between 1999 and 2002. The false colors were generated by applying an adaptive histogram equalization stretch to Landsat bands 7 (displayed in red), 4 (displayed in green), and 2 (displayed in blue). These three bands contain most of the spectral differences provided by Landsat imagery and, therefore, provide the most discrimination between surface materials. Landsat bands 4 and 7 are in the near-infrared and short-wave-infrared regions, respectively, where differences in absorption of sunlight by different surface materials are more pronounced than in visible wavelengths. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Cultural features were not derived from the Landsat base and consequently do not match it precisely. This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (U.S. Geological Survey/Afghan Geological Survey) quadrangles covering Afghanistan. The maps for any given quadrangle have the same open-file report (OFR) number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The OFR numbers range in sequence from 1092 to 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

Natural-Color-Image Map of Quadrangles 3870 and 3770, Maymayk (211), Jamarj-I-Bala (212), Faydz-Abad (217), and Parkhaw (218) Quadrangles, Afghanistan

USGS Publications Warehouse

Davis, Philip A.; Turner, Kenzie J.

2007-01-01

This map is a natural-color rendition created from Landsat 7 Enhanced Thematic Mapper Plus imagery collected between 1999 and 2002. The natural colors were generated using calibrated red-, green-, and blue-wavelength Landsat image data, which were correlated with red, green, and blue values of corresponding picture elements in MODIS (Moderate Resolution Imaging Spectrometer) 'true color' mosaics of Afghanistan. These mosaics have been published on http://www.truecolorearth.com and modified to match more closely the Munsell colors of sampled surfaces. Peak elevations are derived from Shuttle Radar Topography Mission (SRTM) digital data, averaged over a pixel representing an area of 85 m2, and they are slightly lower than the highest corresponding local point. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Cultural features were not derived from the Landsat base and consequently do not match it precisely. This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (U.S. Geological Survey/Afghan Geological Survey) quadrangles covering Afghanistan. The maps for any given quadrangle have the same open-file report (OFR) number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The OFR numbers range in sequence from 1092 to 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

Avast Ye Salty Dogs: Salt damage in the context of coastal residential construction and historical maritime timbers

Treesearch

Grant T. Kirker; Samuel L. Zelinka; Leandro Passarini

2016-01-01

Salt damage is a frequent problem in wood exposed to seawater and other saline environments. Symptoms of salt damage are often referred to as fuzzy wood and have been historically considered non-structural damage, but a growing number of customer inquiries have prompted a re-evaluation of this phenomenon. This paper details several case studies involving salt damage,...

Comparative evaluation of effect of use of toothbrush with paste and munident on levels of Streptococcus mutans and gingival health in children: An in vivo study.

PubMed

Shetty, Rashmi N; Shetty, Sowmya B; Janardhanan, Sruthi; Shetty, Shamila; Shetty, Sharan; Raj, Kiran

2017-01-01

Dental caries is a multifactorial disease which has a deleterious effect on the oral cavity. Improper oral hygiene habits are a cause for the same. The aim of this study was to compare the antibacterial efficacy of Munident, an Ayurvedic (herbal) dentifrice with commercially available toothpaste. A total of forty subjects between the age group 9 and 12 years, resident of Bala Yeshu Nilaya Bhavan, Mangalore, Karnataka, India, were chosen for our study. They were divided into two groups containing twenty subjects in each; Group 1 for standard toothpaste and Group 2 for Munident. The decayed, missing, and filled teeth scores were noted from each subject. Group 1 was instructed to brush the teeth using commercially available toothpaste and Group 2 was instructed to brush using commercially available Munident (herbal) dentifrice. Both the groups brushed the teeth using soft variety of tooth brush. The gingival bleeding index and salivary Streptococcus mutans count were noted pre- and post-brushimg for both groups. The results obtained were subjected to statistical analysis. Munident (herbal) dentifrice showed better efficacy in comparison to toothpaste in terms of gingival bleeding index and salivary S. mutans count. Munident (herbal) dentifrice has better gingival bleeding index compared to standard formulation of toothpaste. Hence, the practice of using herbal dentifrice should be encouraged.

Rice-arsenate interactions in hydroponics: whole genome transcriptional analysis.

PubMed

Norton, Gareth J; Lou-Hing, Daniel E; Meharg, Andrew A; Price, Adam H

2008-01-01

Rice (Oryza sativa) varieties that are arsenate-tolerant (Bala) and -sensitive (Azucena) were used to conduct a transcriptome analysis of the response of rice seedlings to sodium arsenate (AsV) in hydroponic solution. RNA extracted from the roots of three replicate experiments of plants grown for 1 week in phosphate-free nutrient with or without 13.3 muM AsV was used to challenge the Affymetrix (52K) GeneChip Rice Genome array. A total of 576 probe sets were significantly up-regulated at least 2-fold in both varieties, whereas 622 were down-regulated. Ontological classification is presented. As expected, a large number of transcription factors, stress proteins, and transporters demonstrated differential expression. Striking is the lack of response of classic oxidative stress-responsive genes or phytochelatin synthases/synthatases. However, the large number of responses from genes involved in glutathione synthesis, metabolism, and transport suggests that glutathione conjugation and arsenate methylation may be important biochemical responses to arsenate challenge. In this report, no attempt is made to dissect differences in the response of the tolerant and sensitive variety, but analysis in a companion article will link gene expression to the known tolerance loci available in the BalaxAzucena mapping population.

Estimation of Tooth Size Discrepancies among Different Malocclusion Groups

PubMed Central

Bala, Madhu; Goyal, Virender

2014-01-01

ABSTRACT Regards and Tribute: Late Dr Narender Hasija was a mentor and visionary in the light of knowledge and experience. We pay our regards with deepest gratitude to the departed soul to rest in peace. Bolton’s ratios help in estimating overbite, overjet relationships, the effects of contemplated extractions on posterior occlusion, incisor relationships and identification of occlusal misfit produced by tooth size discrepancies. Aim: To determine any difference in tooth size discrepancy in anterior as well as overall ratio in different malocclusions and comparison with Bolton’s study. Materials and methods: After measuring the teeth on all 100 patients, Bolton’s analysis was performed. Results were compared with Bolton’s means and standard deviations. The results were also subjected to statistical analysis. Results show that the mean and standard deviations of ideal occlusion cases are comparable with those Bolton but, when the mean and standard deviation of malocclusion groups are compared with those of Bolton, the values of standard deviation are higher, though the mean is comparable. How to cite this article: Hasija N, Bala M, Goyal V. Estimation of Tooth Size Discrepancies among Different Malocclusion Groups. Int J Clin Pediatr Dent 2014;7(2):82-85. PMID:25356005

Model Independent Determination of Electron Fraction for Individual SNIa

NASA Astrophysics Data System (ADS)

De, Soma; Timmes, F.; Hawley, W.; Chamulak, D.; Athanassiadou, T.; Jack, D.; Calder, A.; Brown, E.; Townsley, D.

2013-01-01

Ye of individual supernova Type Ia at the time of explosion by using the silicon, sulfur, and calcium features from single epoch and multi-epoch spectra near maximum light. Most one-dimensional Chandrasekhar mass models of supernova Type Ia in the single-degenerate scenario produce their intermediate-mass elements in a burn to quasi-nuclear statistical equilibrium between the mass shells 0.8 and 1.1 M. We find a near linear dependence of the intermediate-mass element nuclear yields on the white dwarf’s initial metallicity from such SNe Ia explosion models, and the effect this dependence has on synthetic spectra near maximum light. We demonstrate that these metallicity signatures are only due to material achieving the necessary thermodynamic conditions. In addition, we find that global abundance of silicon is insensitive to change in metallicity but sulfur and calcium abundances change significantly

Gossip.

PubMed

1994-09-07

• It's easy to mock, I know, and we all have our own little peculiarities, but there's a new magazine out aimed specifically at collectors of phone cards. Yes, Publishing reports that Telecard Collector International is about to hit the streets, complete with the obligatory glamorous woman on the front to boost sales. In this case, the woman is Julia Swalha - Saffi, in Absolutely Fabulous - who is obviously a phonecard fan. (Whatever would Patsy say?) But titter ye not. 'Overall, this is an infuriatingly compulsive read,' says Publishing. And with some cards apparently reaching asking prices of £950, the anorak brigade obviously knows a thing or two. But before you start hanging on to all those cards you feed into the nursing home phone, be warned. They apparently increase in value if they are unused. Fabulous.

Universal Faraday Rotation in HgTe Wells with Critical Thickness

NASA Astrophysics Data System (ADS)

Shuvaev, A.; Dziom, V.; Kvon, Z. D.; Mikhailov, N. N.; Pimenov, A.

2016-09-01

The universal value of the Faraday rotation angle close to the fine structure constant (α ≈1 /137 ) is experimentally observed in thin HgTe quantum wells with a thickness on the border between trivial insulating and the topologically nontrivial Dirac phases. The quantized value of the Faraday angle remains robust in the broad range of magnetic fields and gate voltages. Dynamic Hall conductivity of the holelike carriers extracted from the analysis of the transmission data shows a theoretically predicted universal value of σx y=e2/h , which is consistent with the doubly degenerate Dirac state. On shifting the Fermi level by the gate voltage, the effective sign of the charge carriers changes from positive (holes) to negative (electrons). The electronlike part of the dynamic response does not show quantum plateaus and is well described within the classical Drude model.

Dynamical thermalization in isolated quantum dots and black holes

NASA Astrophysics Data System (ADS)

Kolovsky, Andrey R.; Shepelyansky, Dima L.

2017-01-01

We study numerically a model of quantum dot with interacting fermions. At strong interactions with small conductance the model is reduced to the Sachdev-Ye-Kitaev black-hole model while at weak interactions and large conductance it describes a Landau-Fermi liquid in a regime of quantum chaos. We show that above the Åberg threshold for interactions there is an onset of dynamical themalization with the Fermi-Dirac distribution describing the eigenstates of an isolated dot. At strong interactions in the isolated black-hole regime there is also the onset of dynamical thermalization with the entropy described by the quantum Gibbs distribution. This dynamical thermalization takes place in an isolated system without any contact with a thermostat. We discuss the possible realization of these regimes with quantum dots of 2D electrons and cold ions in optical lattices.

A hybridized formulation for the weak Galerkin mixed finite element method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mu, Lin; Wang, Junping; Ye, Xiu

This paper presents a hybridized formulation for the weak Galerkin mixed finite element method (WG-MFEM) which was introduced and analyzed in Wang and Ye (2014) for second order elliptic equations. The WG-MFEM method was designed by using discontinuous piecewise polynomials on finite element partitions consisting of polygonal or polyhedral elements of arbitrary shape. The key to WG-MFEM is the use of a discrete weak divergence operator which is defined and computed by solving inexpensive problems locally on each element. The hybridized formulation of this paper leads to a significantly reduced system of linear equations involving only the unknowns arising frommore » the Lagrange multiplier in hybridization. Optimal-order error estimates are derived for the hybridized WG-MFEM approximations. In conclusion, some numerical results are reported to confirm the theory and a superconvergence for the Lagrange multiplier.« less

A hybridized formulation for the weak Galerkin mixed finite element method

DOE PAGES

Mu, Lin; Wang, Junping; Ye, Xiu

2016-01-14

This paper presents a hybridized formulation for the weak Galerkin mixed finite element method (WG-MFEM) which was introduced and analyzed in Wang and Ye (2014) for second order elliptic equations. The WG-MFEM method was designed by using discontinuous piecewise polynomials on finite element partitions consisting of polygonal or polyhedral elements of arbitrary shape. The key to WG-MFEM is the use of a discrete weak divergence operator which is defined and computed by solving inexpensive problems locally on each element. The hybridized formulation of this paper leads to a significantly reduced system of linear equations involving only the unknowns arising frommore » the Lagrange multiplier in hybridization. Optimal-order error estimates are derived for the hybridized WG-MFEM approximations. In conclusion, some numerical results are reported to confirm the theory and a superconvergence for the Lagrange multiplier.« less

Spline Approximation of Thin Shell Dynamics

NASA Technical Reports Server (NTRS)

delRosario, R. C. H.; Smith, R. C.

1996-01-01

A spline-based method for approximating thin shell dynamics is presented here. While the method is developed in the context of the Donnell-Mushtari thin shell equations, it can be easily extended to the Byrne-Flugge-Lur'ye equations or other models for shells of revolution as warranted by applications. The primary requirements for the method include accuracy, flexibility and efficiency in smart material applications. To accomplish this, the method was designed to be flexible with regard to boundary conditions, material nonhomogeneities due to sensors and actuators, and inputs from smart material actuators such as piezoceramic patches. The accuracy of the method was also of primary concern, both to guarantee full resolution of structural dynamics and to facilitate the development of PDE-based controllers which ultimately require real-time implementation. Several numerical examples provide initial evidence demonstrating the efficacy of the method.

Thermodynamic properties and static structure factor for a Yukawa fluid in the mean spherical approximation.

PubMed

Montes-Perez, J; Cruz-Vera, A; Herrera, J N

2011-12-01

This work presents the full analytic expressions for the thermodynamic properties and the static structure factor for a hard sphere plus 1-Yukawa fluid within the mean spherical approximation. To obtain these properties of the fluid type Yukawa analytically it was necessary to solve an equation of fourth order for the scaling parameter on a large scale. The physical root of this equation was determined by imposing physical conditions. The results of this work are obtained from seminal papers of Blum and Høye. We show that is not necessary the use the series expansion to solve the equation for the scaling parameter. We applied our theoretical result to find the thermodynamic and the static structure factor for krypton. Our results are in good agreement with those obtained in an experimental form or by simulation using the Monte Carlo method.

Fine Grained Chaos in AdS2 Gravity

NASA Astrophysics Data System (ADS)

Haehl, Felix M.; Rozali, Moshe

2018-03-01

Quantum chaos can be characterized by an exponential growth of the thermal out-of-time-order four-point function up to a scrambling time u^*. We discuss generalizations of this statement for certain higher-point correlation functions. For concreteness, we study the Schwarzian theory of a one-dimensional time reparametrization mode, which describes two-dimensional anti-de Sitter space (AdS2 ) gravity and the low-energy dynamics of the Sachdev-Ye-Kitaev model. We identify a particular set of 2 k -point functions, characterized as being both "maximally braided" and "k -out of time order," which exhibit exponential growth until progressively longer time scales u^*(k)˜(k -1 )u^*. We suggest an interpretation as scrambling of increasingly fine grained measures of quantum information, which correspondingly take progressively longer time to reach their thermal values.

Fine Grained Chaos in AdS_{2} Gravity.

PubMed

Haehl, Felix M; Rozali, Moshe

2018-03-23

Quantum chaos can be characterized by an exponential growth of the thermal out-of-time-order four-point function up to a scrambling time u[over ^]_{*}. We discuss generalizations of this statement for certain higher-point correlation functions. For concreteness, we study the Schwarzian theory of a one-dimensional time reparametrization mode, which describes two-dimensional anti-de Sitter space (AdS_{2}) gravity and the low-energy dynamics of the Sachdev-Ye-Kitaev model. We identify a particular set of 2k-point functions, characterized as being both "maximally braided" and "k-out of time order," which exhibit exponential growth until progressively longer time scales u[over ^]_{*}^{(k)}∼(k-1)u[over ^]_{*}. We suggest an interpretation as scrambling of increasingly fine grained measures of quantum information, which correspondingly take progressively longer time to reach their thermal values.

The Hamburg/ESO R-process Enhanced Star survey (HERES). XI. The highly r-process-enhanced star CS 29497-004

NASA Astrophysics Data System (ADS)

Hill, V.; Christlieb, N.; Beers, T. C.; Barklem, P. S.; Kratz, K.-L.; Nordström, B.; Pfeiffer, B.; Farouqi, K.

2017-11-01

We report an abundance analysis for the highly r-process-enhanced (r-II) star CS 29497-004, a very metal-poor giant with solar system Teff = 5013 K and [Fe/H] = -2.85, whose nature was initially discovered in the course of the HERES project. Our analysis is based on high signal-to-noise ratio, high-resolution (R 75 000) VLT/UVES spectra and MARCS model atmospheres under the assumption of local thermodynamic equilibrium, and obtains abundance measurements for a total of 46 elements, 31 of which are neutron-capture elements. As is the case for the other 25 r-II stars currently known, the heavy-element abundance pattern of CS 29497-004 well-matches a scaled solar system second peak r-process-element abundance pattern. We confirm our previous detection of Th, and demonstrate that this star does not exhibit an "actinide boost". Uranium is also detected (log ɛ(U) = -2.20 ± 0.30), albeit with a large measurement error that hampers its use as a precision cosmo-chronometer. Combining the various elemental chronometer pairs that are available for this star, we derive a mean age of 12.2 ± 3.7 Gyr using the theoretical production ratios from published waiting-point approximation models. We further explore the high-entropy wind model (Farouqi et al. 2010, ApJ, 712, 1359) production ratios arising from different neutron richness of the ejecta (Ye), and derive an age of 13.7 ± 4.4 Gyr for a best-fitting Ye = 0.447. The U/Th nuclei-chronometer is confirmed to be the most resilient to theoretical production ratios and yields an age of 16.5 ± 6.6 Gyr. Lead (Pb) is also tentatively detected in CS 29497-004, at a level compatible with a scaled solar r-process, or with the theoretical expectations for a pure r-process in this star. Based on observations collected at the European Southern Observatory, Paranal, Chile (Proposal Number 170.D-0010).Table B.1 is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http

China cuts energy intensity, but overall energy growth continues, report notes

NASA Astrophysics Data System (ADS)

Showstack, Randy

2012-02-01

A new report states that China has cut its energy intensity—defined as energy use per unit of economic output—by 19.1% from 2006 to 2010, reversing the previous upward trend. However, energy use and carbon emissions in the country continue to grow sharply, according to the Climate Policy Initiative's (CPI) Annual Review of Low-Carbon Development in China: 2010, the second of such reports. China nearly hit its goal of a 20% target reduction in energy intensity during that time period, which spanned the country's eleventh Five-Year Period (FYP) for social and economic development, but during that same period energy-related growth in carbon dioxide (CO2) emissions in China increased by 33.6%, from 5.15 billion tons to 6.88 billion tons, said Qi Ye, CPI's Beijing office director, at a 2 February briefing held at the Brookings Institution in Washington, D. C.

Swift and NuSTAR observations of GW170817: Detection of a blue kilonova

DOE PAGES

Evans, P. A.; Cenko, S. B.; Kennea, J. A.; ...

2017-10-16

With the first direct detection of merging black holes in 2015, the era of gravitational wave (GW) astrophysics began. However, a complete picture of compact object mergers requires the detection of an electromagnetic (EM) counterpart. Here, we report ultraviolet (UV) and x-ray observations by Swift and the Nuclear Spectroscopic Telescope ARray (NuSTAR) of the EM counterpart of the binary neutron star merger GW 170817. The bright, rapidly fading ultraviolet emission indicates a high mass (≈ 0.03 solar masses) wind-driven outflow with moderate electron fraction (Ye ≈ 0.27). Combined with the x-ray limits, we favor an observer viewing angle of ≈30°more » away from the orbital rotation axis, which avoids both obscuration from the heaviest elements in the orbital plane and a direct view of any ultra-relativistic, highly collimated ejecta (a γ-ray burst afterglow).« less

Numerical method for solution of systems of non-stationary spatially one-dimensional nonlinear differential equations

NASA Technical Reports Server (NTRS)

Morozov, S. K.; Krasitskiy, O. P.

1978-01-01

A computational scheme and a standard program is proposed for solving systems of nonstationary spatially one-dimensional nonlinear differential equations using Newton's method. The proposed scheme is universal in its applicability and its reduces to a minimum the work of programming. The program is written in the FORTRAN language and can be used without change on electronic computers of type YeS and BESM-6. The standard program described permits the identification of nonstationary (or stationary) solutions to systems of spatially one-dimensional nonlinear (or linear) partial differential equations. The proposed method may be used to solve a series of geophysical problems which take chemical reactions, diffusion, and heat conductivity into account, to evaluate nonstationary thermal fields in two-dimensional structures when in one of the geometrical directions it can take a small number of discrete levels, and to solve problems in nonstationary gas dynamics.

An Updated Nuclear Equation of State for Neutron Stars and Supernova Simulations

NASA Astrophysics Data System (ADS)

Meixner, M. A.; Mathews, G. J.; Dalhed, H. E.; Lan, N. Q.

2011-10-01

We present an updated and improved Equation of State based upon the framework originally developed by Bowers & Wilson. The details of the EoS and improvements are described along with a description of how to access this EOS for numerical simulations. Among the improvements are an updated compressibility based upon recent measurements, the possibility of the formation of proton excess (Ye> 0.5) material and an improved treatment of the nuclear statistical equilibrium and the transition to pasta nuclei as the density approaches nuclear matter density. The possibility of a QCD chiral phase transition is also included at densities above nuclear matter density. We show comparisons of this EOS with the other two publicly available equations of state used in supernova collapse simulations. The advantages of the present EoS is that it is easily amenable to phenomenological parameterization to fit observed explosion properties and to accommodate new physical parameters.

Swift and NuSTAR observations of GW170817: Detection of a blue kilonova

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, P. A.; Cenko, S. B.; Kennea, J. A.

With the first direct detection of merging black holes in 2015, the era of gravitational wave (GW) astrophysics began. However, a complete picture of compact object mergers requires the detection of an electromagnetic (EM) counterpart. Here, we report ultraviolet (UV) and x-ray observations by Swift and the Nuclear Spectroscopic Telescope ARray (NuSTAR) of the EM counterpart of the binary neutron star merger GW 170817. The bright, rapidly fading ultraviolet emission indicates a high mass (≈ 0.03 solar masses) wind-driven outflow with moderate electron fraction (Ye ≈ 0.27). Combined with the x-ray limits, we favor an observer viewing angle of ≈30°more » away from the orbital rotation axis, which avoids both obscuration from the heaviest elements in the orbital plane and a direct view of any ultra-relativistic, highly collimated ejecta (a γ-ray burst afterglow).« less

Site-selective doping and superconductivity in (La1-yPry)(Ba2-xLax)Cu3O7+δ

NASA Astrophysics Data System (ADS)

Mitzi, D. B.; Feffer, P. T.; Newsam, J. M.; Webb, D. J.; Klavins, P.; Jacobson, A. J.; Kapitulnik, A.

1988-10-01

Samples in the quaternary system (La1-yPry)(Ba2-xLax)Cu3O7+δ have been prepared and characterized using x-ray and neutron diffraction, thermogravimetric analysis, and transport and magnetic measurements. Pr substitutes on the oxygen-depleted La layers for y>0.0, while La substitutes on the Ba sites for x>0.0. The effect of doping on each site is inferred to be primarily local, affecting immediately adjacent Cu-O layers. The similar suppression of superconductivity that accompanies doping on each of the two distinct sites apparently correlates with the degree of oxidation of the Cu-O sheets (and not the chains), indicating that the sheets support the high temperature superconductivity. Comparison of orthorhombic and tetragonal samples with similar Ba:La ratios (and y=0) demonstrates that the orthorhombic phase yields the largest Meissner signals and highest transition temperatures in the La(Ba2-xLax)Cu3O7+δ system. The effect on superconductivity of oxygen-vacancy configuration in the Cu-O chain layers is proposed to derive, indirectly, from their influence on the Cu-O sheets. In addition, optimally superconducting La(Ba2-xLax)Cu3O7+δ samples exhibit interesting normal-state magnetic properties, with a paramagnetic susceptibility that decreases steadily with temperature between 350 K and Tc.

Changes in root hydraulic conductivity facilitate the overall hydraulic response of rice (Oryza sativa L.) cultivars to salt and osmotic stress.

PubMed

Meng, Delong; Fricke, Wieland

2017-04-01

The aim of the present work was to assess the significance of changes in root AQP gene expression and hydraulic conductivity (Lp) in the regulation of water balance in two hydroponically-grown rice cultivars (Azucena, Bala) which differ in root morphology, stomatal regulation and aquaporin (AQP) isoform expression. Plants were exposed to NaCl (25 mM, 50 mM) and osmotic stress (5%, 10% PEG6000). Root Lp was determined for exuding root systems (osmotic forces driving water uptake; 'exudation Lp') and transpiring plants (hydrostatic forces dominating; 'transpiration-Lp'). Gene expression was analysed by qPCR. Stress treatments caused a consistent and significant decrease in plant growth, transpirational water loss, stomatal conductance, shoot-to-root surface area ratio and root Lp. Comparison of exudation-with transpiration-Lp supported a significant contribution of AQP-facilitated water flow to root water uptake. Changes in root Lp in response to treatments were correlated much stronger with root morphological characteristics, such as the number of main and lateral roots, surface area ratio of root to shoot and plant transpiration rate than with AQP gene expression. Changes in root Lp, involving AQP function, form an integral part of the plant hydraulic response to stress and facilitate changes in the root-to-shoot surface area ratio, transpiration and stomatal conductance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

A genome-wide association study of a global rice panel reveals resistance in Oryza sativa to root-knot nematodes

PubMed Central

Dimkpa, Stanley O. N.; Lahari, Zobaida; Shrestha, Roshi; Douglas, Alex; Gheysen, Godelieve; Price, Adam H.

2016-01-01

The root-knot nematode Meloidogyne graminicola is one of the most serious nematode pests worldwide and represents a major constraint on rice production. While variation in the susceptibility of Asian rice (Oryza sativa) exists, so far no strong and reliable resistance has been reported. Quantitative trait loci for partial resistance have been reported but no underlying genes have been tagged or cloned. Here, 332 accessions of the Rice Diversity Panel 1 were assessed for gall formation, revealing large variation across all subpopulations of rice and higher susceptibility in temperate japonica accessions. Accessions Khao Pahk Maw and LD 24 appeared to be resistant, which was confirmed in large pot experiments where no galls were observed. Detailed observations on these two accessions revealed no nematodes inside the roots 2 days after inoculation and very few females after 17 days (5 in Khao Pahk Maw and <1 in LD 24, in comparison with >100 in the susceptible controls). These two cultivars appear ideal donors for breeding root-knot nematode resistance. A genome-wide association study revealed 11 quantitative trait loci, two of which are close to epistatic loci detected in the Bala x Azucena population. The discussion highlights a small number of candidate genes worth exploring further, in particular many genes with lectin domains and genes on chromosome 11 with homology to the Hordeum Mla locus. PMID:26552884

Search performance is better predicted by tileability than presence of a unique basic feature.

PubMed

Chang, Honghua; Rosenholtz, Ruth

2016-08-01

Traditional models of visual search such as feature integration theory (FIT; Treisman & Gelade, 1980), have suggested that a key factor determining task difficulty consists of whether or not the search target contains a "basic feature" not found in the other display items (distractors). Here we discriminate between such traditional models and our recent texture tiling model (TTM) of search (Rosenholtz, Huang, Raj, Balas, & Ilie, 2012b), by designing new experiments that directly pit these models against each other. Doing so is nontrivial, for two reasons. First, the visual representation in TTM is fully specified, and makes clear testable predictions, but its complexity makes getting intuitions difficult. Here we elucidate a rule of thumb for TTM, which enables us to easily design new and interesting search experiments. FIT, on the other hand, is somewhat ill-defined and hard to pin down. To get around this, rather than designing totally new search experiments, we start with five classic experiments that FIT already claims to explain: T among Ls, 2 among 5s, Q among Os, O among Qs, and an orientation/luminance-contrast conjunction search. We find that fairly subtle changes in these search tasks lead to significant changes in performance, in a direction predicted by TTM, providing definitive evidence in favor of the texture tiling model as opposed to traditional views of search.

Air radioactivity levels following the Fukushima reactor accident measured at the Laboratoire Souterrain de Modane, France.

PubMed

Loaiza, P; Brudanin, V; Piquemal, F; Reyss, J-L; Stekl, I; Warot, G; Zampaolo, M

2012-12-01

The radioactivity levels in the air of the radionuclides released by the Fukushima accident were measured at the Laboratoire Souterrain de Modane, in the South-East of France, during the period 25 March-18 April 2011. Air-filters from the ventilation system exposed for one or two days were measured using low-background gamma-ray spectrometry. In this paper we present the activity concentrations obtained for the radionuclides (131)I, (132)Te, (134)Cs, (137)Cs, (95)Nb, (95)Zr, (106)Ru, (140)Ba/La and (103)Ru. The activity concentration of (131)I was of the order of 100 μBq/m(3), more than 100 times higher than the activities of other fission products. The highest activities of (131)I were measured as a first peak on 30 March and a second peak on 3-4 April. The activity concentrations of (134)Cs and (137)Cs varied from 5 to 30 μBq/m(3). The highest activity concentration recorded for Cs corresponded to the same period as for (131)I, with a peak on 2-3 April. The results of the radioactivity concentration levels in grass and mushrooms exposed to the air in the Modane region were also measured. Activity concentrations of (131)I of about 100 mBq/m(2) were found in grass. Copyright © 2012 Elsevier Ltd. All rights reserved.

Applicability and importance of Caraka’s concept of Aaturaparijnana Hetawah in understanding a patient

PubMed Central

Wadher, Rupesh; Dwivedi, Rambabu R.

2012-01-01

Many concepts in Ayurveda are untouched or unexplored till date. One of such concepts to understand the healthy and unhealthy persons is that of the Aaturaparijnana Hetawah (APH), which is only mentioned in Caraka Samhita. The descriptions about Dushya, Desha, Bala, Kala, Prakriti, etc. are mentioned very briefly in all the classics. But no standard figure or pattern is maintained while considering them. It is only in the description of Aaturaparijnana Hetawah mentioned in Vimana Sthana that all the factors are pre-arranged in a chronological order to understand an individual according to one’s Desha as from birth till grown up stage, and also to understand about the illness and most common disorders. In this article, it is aimed at presenting an in-depth evaluation about description of Aaturaparijnana Hetawah in Ayurveda. For this study, the references of Aturaparijnana Hetu have been collected through the Ayurvedic texts along with their commentaries. By making use of 14 factors described in Aaturaparijnana Hetawah, it is possible to have an in depth understanding about the patient’s nature and factors that may be contributing to his health and illness. Aaturaparijnana Hetawah helps in an in-depth understanding of a patient’s disease and heath status. More in-depth evaluation studies and application in the modern medical science should be done in order to avail the benefits of this approach. PMID:23559788

Search performance is better predicted by tileability than presence of a unique basic feature

PubMed Central

Chang, Honghua; Rosenholtz, Ruth

2016-01-01

Traditional models of visual search such as feature integration theory (FIT; Treisman & Gelade, 1980), have suggested that a key factor determining task difficulty consists of whether or not the search target contains a “basic feature” not found in the other display items (distractors). Here we discriminate between such traditional models and our recent texture tiling model (TTM) of search (Rosenholtz, Huang, Raj, Balas, & Ilie, 2012b), by designing new experiments that directly pit these models against each other. Doing so is nontrivial, for two reasons. First, the visual representation in TTM is fully specified, and makes clear testable predictions, but its complexity makes getting intuitions difficult. Here we elucidate a rule of thumb for TTM, which enables us to easily design new and interesting search experiments. FIT, on the other hand, is somewhat ill-defined and hard to pin down. To get around this, rather than designing totally new search experiments, we start with five classic experiments that FIT already claims to explain: T among Ls, 2 among 5s, Q among Os, O among Qs, and an orientation/luminance-contrast conjunction search. We find that fairly subtle changes in these search tasks lead to significant changes in performance, in a direction predicted by TTM, providing definitive evidence in favor of the texture tiling model as opposed to traditional views of search. PMID:27548090

Topological Defects in Double Exchange Materials and Anomalous Hall Resistance.

NASA Astrophysics Data System (ADS)

Calderón, M. J.; Brey, L.

2000-03-01

Recently it has been proposed that the anomalous Hall effect observed in Double Exchange materials is due to Berry phase effects caused by carrier hopping in a nontrivial spins background (J.Ye et al.) Phys.Rev.Lett. 83, 3737 1999.In order to study this possibility we have performed Monte Carlo simulations of the Double Exchange model and we have computed, as a function of the temperature, the number of topological defects in the system and the internal gauge magnetic field associated with these defects. In the simplest Double Exchange model the gauge magnetic field is random, and its average value is zero. The inclusion in the problem of spin-orbit coupling privileges the opposite direction of the magnetization and an anomalous Hall resistance (AHR) effect arises. We have computed the AHR, and we have obtained its temperature dependence. In agreement with previous experiments we obtain that AHR increases exponentially at low temperature and presents a maximum at a temperature slightly higher than the critical temperature.

Scrambling of quantum information in quantum many-body systems

NASA Astrophysics Data System (ADS)

Iyoda, Eiki; Sagawa, Takahiro

2018-04-01

We systematically investigate scrambling (or delocalizing) processes of quantum information encoded in quantum many-body systems by using numerical exact diagonalization. As a measure of scrambling, we adopt the tripartite mutual information (TMI) that becomes negative when quantum information is delocalized. We clarify that scrambling is an independent property of the integrability of Hamiltonians; TMI can be negative or positive for both integrable and nonintegrable systems. This implies that scrambling is a separate concept from conventional quantum chaos characterized by nonintegrability. Specifically, we argue that there are a few exceptional initial states that do not exhibit scrambling, and show that such exceptional initial states have small effective dimensions. Furthermore, we calculate TMI in the Sachdev-Ye-Kitaev (SYK) model, a fermionic toy model of quantum gravity. We find that disorder does not make scrambling slower but makes it smoother in the SYK model, in contrast to many-body localization in spin chains.

Antiviral anthraquinones and azaphilones produced by an endophytic fungus Nigrospora sp. from Aconitum carmichaeli.

PubMed

Zhang, Shou-Peng; Huang, Rong; Li, Fang-Fang; Wei, Hong-Xia; Fang, Xiao-Wei; Xie, Xiao-Song; Lin, Dong-Guo; Wu, Shao-Hua; He, Jian

2016-07-01

A new hydroanthraquinone derivative, 6-O-demethyl-4-dehydroxyaltersolanol A (1), and two new azaphilones, 8,11-didehydrochermesinone B (6) and (7S)-7-hydroxy-3,7-dimethyl-isochromene-6,8-dione (8), along with five known analogues (2-5 and 7), were isolated from the culture broth of Nigrospora sp. YE3033, an endophytic fungus obtained from Aconitum carmichaeli. Their structures were elucidated on the basis of spectroscopic analyses. Biological activity test indicated that compounds 1-3, and 7 exhibited the inhibitory effects on influenza viral strain of A/Puerto Rico/8/34 (H1N1) with the IC50 values of 2.59, 8.35, 7.82, and 0.80μg/mL, respectively, while the low cytotoxicity of 7 with the CC50 value of 184.75μg/mL, displaying a promising potential of 7 in the development of anti-influenza A virus drugs. Copyright © 2016 Elsevier B.V. All rights reserved.

Physico-chemical mechanisms involved in the acceleration of the hydration of calcium sulfoaluminate cement by lithium ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cau Dit Coumes, Céline, E-mail: celine.cau-dit-coumes@cea.fr; Dhoury, Mélanie; Champenois, Jean-Baptiste

This work investigates the influence of lithium ions on the hydration at 25 °C of two calcium sulfoaluminate (CSA) cements comprising 0 or 10% gypsum. Small concentrations of lithium salts (LiOH, LiNO{sub 3}) accelerate the early hydration of both CSA cements either in paste or in diluted and stirred suspension. The effect of the lithium cation is much stronger than its counter-ion. Hydration is accelerated by an increase in the lithium concentration up to 30 μmol Li/g of the used CSA cement (with a high ye'elimite content), and then levels off. The postulated mechanism relies on a fast precipitation ofmore » amorphous Li-containing Al(OH){sub 3}, which acts as seeds for accelerating the precipitation of amorphous Al(OH){sub 3} that speeds up the whole hydration process. This process seems to be closely related to the one involved in the acceleration of the hydration of calcium aluminate cement by lithium ions.« less

Prospects of gold mineralization in the Gilgit-Baltistan Province of Pakistan

NASA Astrophysics Data System (ADS)

Shah, M. T.; Khan, S. D.; Tahirkheli, T.; Ahmad, L.; Miandad, S.; Rehman, A. U.; Ali, L.

2012-12-01

Gilgit-Baltistan province is the northern most province of Pakistan having its eastern, northern and western boarders with India, China and Afghanistan respectively. The geology of this province is unique as it has the spectacular tectonic entities of Asiatic plate (AP), Indian plate (IP) and the Kohistan-Ladakh arc (KLA). The Northern Suture Zone (NSZ) or Main Karakoram Thrust (MKT) separate the KLA from AP in the north while the Maim Mantle Thrust (MMT) separate the KLA from IP in the south. These different tectonic events have generated various types of igneous and metamorphic rocks in the form of gigantic mountain chains in the region. Considering the metallogenic provinces related to such types of tectonic environments world over, it can be suggested that the Gigit-Baltistan province may have the potential for the occurrence of economic mineral deposits. The present study is the follow-up of the previous studies for exploration of gold and base metals conducted by the Austrominerals and the Pakistan Mineral Development Corporation (PMDC) in the region. On the basis of PMDC extensive stream sediments geochemical survey of the province and delineated number of anomalous catchment areas for gold mineralization. In order to find the source bed-rock of gold, we have identified various alteration zones in these catchment areas by applying Remote sensing techniques by using both multispectral (LANDSAT, ASTER and Geoeye) and hyperspectral (Hyperion) data. Most of the alteration zones were found in steep high altitude inaccessible terrains. During this study, few of the accessible alteration zones in Golo Das, Bagrot valley, Shigri Bala, Machulu and Ranthak areas were selected for geological filed work and collection of proper samples from the alteration zones and host rocks for the identification of possible gold mineralization. In all these localities, the alteration zones are present along shear zones where the sulfide mineralization commonly occurs in the form of

Geologic Map of Quadrangles 3560, 3562, and 3662, Sir Band (402), Khawja-Jir (403), Bala-Murghab (404), and Darah-I-Shor-I-Karamandi (122) Quadrangles, Afghanistan

USGS Publications Warehouse

McKinney, Kevin C.; Lidke, David J.

2007-01-01

This map was produced from several larger digital datasets. Topography was derived from Shuttle Radar Topography Mission (SRTM) 85-meter digital data. Gaps in the original dataset were filled with data digitized from contours on 1:200,000-scale Soviet General Staff Sheets (1978-1997). Contours were generated by cubic convolution averaged over four pixels using TNTmips surface-modeling capabilities. Cultural data were extracted from files downloaded from the Afghanistan Information Management Service (AIMS) Web site (http://www.aims.org.af). The AIMS files were originally derived from maps produced by the Afghanistan Geodesy and Cartography Head Office (AGCHO). Geologic data and the international boundary of Afghanistan were taken directly from Abdullah and Chmyriov (1977). It is the primary intent of the U.S. Geological Survey (USGS) to present the geologic data in a useful format while making them publicly available. These data represent the state of geologic mapping in Afghanistan as of 2005, although the original map was released in the late 1970s (Abdullah and Chmyriov, 1977). The USGS has made no attempt to modify original geologic map-unit boundaries and faults; however, modifications to map-unit symbology, and minor modifications to map-unit descriptions, have been made to clarify lithostratigraphy and to modernize terminology. The generation of a Correlation of Map Units (CMU) diagram required interpretation of the original data, because no CMU diagram was presented by Abdullah and Chmyriov (1977). This map is part of a series that includes a geologic map, a topographic map, a Landsat natural-color-image map, and a Landsat false-color-image map for the USGS/AGS (Afghan Geological Survey) quadrangles shown on the index map. The maps for any given quadrangle have the same open-file report (OFR) number but a different letter suffix, namely, -A, -B, -C, and -D for the geologic, topographic, Landsat natural-color, and Landsat false-color maps, respectively. The OFR numbers range in sequence from 1092 to 1123. The present map series is to be followed by a second series, in which the geology is reinterpreted on the basis of analysis of remote-sensing data, limited fieldwork, and library research. The second series is to be produced by the USGS in cooperation with the AGS and AGCHO.

Environmental history and tephrostratigraphy at Carp Lake, southwestern Columbia Basin, Washington, USA

USGS Publications Warehouse

Whitlock, C.; Sarna-Wojcicki, A. M.; Bartlein, P.J.; Nickmann, R.J.

2000-01-01

Sediment cores from Carp Lake provide a pollen record of the last ca. 125,000 years that helps disclose vegetational and climatic conditions from the present day to the previous interglaciation (120-133 ka). The core also contained 15 tephra layers, which were characterised by electron-microprobe analysis of volcanic glass shards. Identified tephra include Mount St. Helens Ye, 3.69 ka; Mazama ash bed, 7.54 ka; Mount St. Helens layer C, 35-50 ka; an unnamed Mount St. Helens tephra, 75-150 ka; the tephra equivalent of layer E at Pringle Falls, Oregon, <218 ka; and an andesitic tephra layer similar to that at Tulelake, California, 174 ka. Ten calibrated radiocarbon ages and the ages of Mount St. Helens Ye, Mazama ash, and the unnamed Mount St. Helens tephra were used to develop an age-depth model. This model was refined by also incorporating the age of marine oxygen isotope stage (IS) boundary 4/5 (73.9 ka) and the age of IS-5e (125 ka). The justification for this age-model is based on an analysis of the pollen record and lithologic data. The pollen record is divided into 11 assemblage zones that describe alternations between periods of montane conifer forest, pine forest, and steppe. The previous interglacial period (IS-5e) supported temperate xerothermic forests of pine and oak and a northward and westward expansion of steppe and juniper woodland, compared to their present occurrence. The period from 83 to 117 ka contains intervals of pine forest and parkland alternating with pine-spruce forest, suggesting shifts from cold humid to cool temperate conditions. Between 73 and 83 ka, a forest of oak, hemlock, Douglas-fir, and fir was present that has no modem analogue. It suggests warm wet summers and cool wet winters. Cool humid conditions during the mid-Wisconsin interval supported mixed conifer forest with Douglas-fir and spruce. The glacial interval featured cold dry steppe, with an expansion of spruce in the late-glacial. Xerothermic communities prevailed in the

Cerebral impact of prenatal irradiation by 131I: an experimental model of clinical neuroradioembryological effects.

PubMed

Talko, V V; Loganovsky, K M; Drozd, I P; Tukalenko, Ye V; Loganovska, T K; Nechayev, S Yu; Masiuk, S V; Prokhorova, Ye M

2017-12-01

hemisphere hippocampus. Decreased theta band spectral power (4-7 Hz range) of cerebral bioelectrical activity in the left frontotemporal area is suggestive of hippocampal dysfunction mainly in dominant hemisphere of prenatally irradiated persons. Disorders of hippocam pal neurogenesis due to prenatal exposure by radioactive iodine can be a biologic basis here. Innovative approach es in social adaptation, psychoprophylaxis and psychorehabilitation involve the maximum effective application and development of just the most developed psychological and cognitive abilities in survivors. V. V. Talko, K. M. Loganovsky, I. P. Drozd, Ye. V. Tukalenko, T. K. Loganovska, S. Yu. Nechayev, S. V. Masiuk, Ye. M. Prokhorova.

Can (should) theories of crowding be unified?

PubMed Central

Agaoglu, Mehmet N.; Chung, Susana T. L.

2016-01-01

Objects in clutter are difficult to recognize, a phenomenon known as crowding. There is little consensus on the underlying mechanisms of crowding, and a large number of models have been proposed. There have also been attempts at unifying the explanations of crowding under a single model, such as the weighted feature model of Harrison and Bex (2015) and the texture synthesis model of Rosenholtz and colleagues (Balas, Nakano, & Rosenholtz, 2009; Keshvari & Rosenholtz, 2016). The goal of this work was to test various models of crowding and to assess whether a unifying account can be developed. Adopting Harrison and Bex's (2015) experimental paradigm, we asked observers to report the orientation of two concentric C-stimuli. Contrary to the predictions of their model, observers' recognition accuracy was worse for the inner C-stimulus. In addition, we demonstrated that the stimulus paradigm used by Harrison and Bex has a crucial confounding factor, eccentricity, which limits its usage to a very narrow range of stimulus parameters. Nevertheless, reporting the orientations of both C-stimuli in this paradigm proved very useful in pitting different crowding models against each other. Specifically, we tested deterministic and probabilistic versions of averaging, substitution, and attentional resolution models as well as the texture synthesis model. None of the models alone was able to explain the entire set of data. Based on these findings, we discuss whether the explanations of crowding can (should) be unified. PMID:27936273

A genome-wide association study of a global rice panel reveals resistance in Oryza sativa to root-knot nematodes.

PubMed

Dimkpa, Stanley O N; Lahari, Zobaida; Shrestha, Roshi; Douglas, Alex; Gheysen, Godelieve; Price, Adam H

2016-02-01

The root-knot nematode Meloidogyne graminicola is one of the most serious nematode pests worldwide and represents a major constraint on rice production. While variation in the susceptibility of Asian rice (Oryza sativa) exists, so far no strong and reliable resistance has been reported. Quantitative trait loci for partial resistance have been reported but no underlying genes have been tagged or cloned. Here, 332 accessions of the Rice Diversity Panel 1 were assessed for gall formation, revealing large variation across all subpopulations of rice and higher susceptibility in temperate japonica accessions. Accessions Khao Pahk Maw and LD 24 appeared to be resistant, which was confirmed in large pot experiments where no galls were observed. Detailed observations on these two accessions revealed no nematodes inside the roots 2 days after inoculation and very few females after 17 days (5 in Khao Pahk Maw and <1 in LD 24, in comparison with >100 in the susceptible controls). These two cultivars appear ideal donors for breeding root-knot nematode resistance. A genome-wide association study revealed 11 quantitative trait loci, two of which are close to epistatic loci detected in the Bala x Azucena population. The discussion highlights a small number of candidate genes worth exploring further, in particular many genes with lectin domains and genes on chromosome 11 with homology to the Hordeum Mla locus. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Performance Simulation of Unipolar InAs/InAs1-x Sb x Type-II Superlattice Photodetector

NASA Astrophysics Data System (ADS)

Singh, Anand; Pal, Ravinder

2018-05-01

This paper reports performance simulation of a unipolar tunable band gap InAs-InAsSb type-II superlattice (T2SL) infrared photodetector. The generation-recombination and surface leakage currents limit the performance of T2SL photodiodes. Unipolar nBn device design incorporating a suitable barrier layer in the diode structure is taken to suppress the Auger recombination and tunneling currents. At low reverse bias, the generation-recombination current is negligible in the absence of a depletion region, but the dark current is dominated by the diffusion current at higher operation temperatures. The composition, band alignment, barrier width, doping level and thickness of the absorber region are optimized here to achieve low dark current and high quantum efficiency at elevated operating temperatures. Thin unipolar T2SL absorbers are placed in a resonant cavity to enhance photon-material interaction, thus allowing complete absorption in a thinner detector element. It leads to the reduction in the detector volume for lower dark current without affecting the quantum efficiency. It shows an improvement in the quantum efficiency and reduction in the dark current. Dark current density ˜ 10-5 A/cm2 is achievable with low absorber thickness of 2 μm and effective lifetime of 250 ns in the InAs/InAs0.6Sb0.4/B-AlAs1-x Sb x long wave length T2SL detector at 110 K.

Pre-natal counselling and diagnosis in Down's syndrome.

PubMed

Papp, Z

1973-01-01

Today Down's syndrome is recognizable on the basis of its clinical c haracteristics in infants. According to present knowledge, Down's syndr ome can be classified cytogenetically into 4 groups: regular trisomy, translocational trisomy, mosaic forms and double trisomies. Knowledge of the karyotype is used in genetic counselling for further prevention of Down's syndrome in unborn fetuses. Prenatal chromosome analyses, a form of intrauterine diagnosis, has been used in Hungary since 1968. The average incidence of Down's syndrome has been estimated at 1.5:1000 among newborns. The mother's age and genetic deviations are determinant s in whether or not the syndrome will occur. The risk of Down's syndrome increases from 1 per 1000 in mothers under 30 to 10-20 per 1000 in mothers over 45. Since risk increases with the mother's age amniocen tesis should be routinely performed in pregnancies of older mothers. In the case of trisomy verified by intrauterine diagnosis, termination of pregnancy is advised. If population cytogenetic investigations are practiced, the carriers of the balanced translocation will be revealed and within a few years there will be only 3 indications for amniocentesis: 1) in cases of mother's advanced age, 2) in cases of bala nced translocation carrier and 3) in cases of a previously affected chil d disregarding the parental karyotypes. The expected risk of Down's syn drome predictable from available data if higher than 1-5% justifies intr auterine chromosome analysis.

Concept of Sukha (comfort) mentioned in Dhatusarata (tissue excellence) w.s.r. to vocational guidance.

PubMed

Waghulade, Hemangini; Harit, Mahesh Kumar

2014-01-01

Agni (digestive fire), Prakruti (constitution), Dhatusarata (tissue excellence), Dosha (bio-energies) are the specialties of Ayurveda on which diagnosis, treatment and research are based. The description of Dhatusarata (tissue excellence) has been given under Dashavidha Pariksha (tenfold examination) in Charak Samhita, Viman Sthana, 8(th) chapter. Some qualities, which are mentioned in Dhatusarata are difficult to assess, e.g. Sukha, Aishwarya, Upabhoga, Bala, etc., There is a need to develop some quantitative parameters to measure these qualities according to tissue excellence i.e. Dhatusarata. By assessing Dhatu Sarata, one can judge the true strength of a particular Dhatu but only the ability or strength is not enough to get success; the liking or interest is also essential to achieve success. The purpose of this study is to elaborate the concept of Dhatusarata and reveal different aspects of Sukha according to the quality of that particular Dhatu in context of vocational guidance. It will help to establish interrelationship between Dhatusarata and vocational guidance. It will be assessed whether this Sukha quality is merely happiness or having different shades according to the excellence of Dhatus and whether this study is useful in guiding the person to choose appropriate profession, which will be according to his liking and ability. It has been concluded that shades of Sukha quality varies with particular Dhatusaras, which may be helpful in guiding a suitable profession to an individual which will be according to his ability and liking i.e. Sukha for intimate success.

A review of the 2005 Kashmir earthquake-induced landslides; from a remote sensing prospective

NASA Astrophysics Data System (ADS)

Shafique, Muhammad; van der Meijde, Mark; Khan, M. Asif

2016-03-01

The 8th October 2005 Kashmir earthquake, in northern Pakistan has triggered thousands of landslides, which was the second major factor in the destruction of the build-up environment, after earthquake-induced ground shaking. Subsequent to the earthquake, several researchers from home and abroad applied a variety of remote sensing techniques, supported with field observations, to develop inventories of the earthquake-triggered landslides, analyzed their spatial distribution and subsequently developed landslide-susceptibility maps. Earthquake causative fault rupture, geology, anthropogenic activities and remote sensing derived topographic attributes were observed to have major influence on the spatial distribution of landslides. These were subsequently used to develop a landslide susceptibility map, thereby demarcating the areas prone to landsliding. Temporal studies monitoring the earthquake-induced landslides shows that the earthquake-induced landslides are stabilized, contrary to earlier belief, directly after the earthquake. The biggest landslide induced dam, as a result of the massive Hattian Bala landslide, is still posing a threat to the surrounding communities. It is observed that remote sensing data is effectively and efficiently used to assess the landslides triggered by the Kashmir earthquake, however, there is still a need of more research to understand the mechanism of intensity and distribution of landslides; and their continuous monitoring using remote sensing data at a regional scale. This paper, provides an overview of remote sensing and GIS applications, for the Kashmir-earthquake triggered landslides, derived outputs and discusses the lessons learnt, advantages, limitations and recommendations for future research.

Effect of Processing on the Microflora of Norwegian Seaweed Meal, with Observations on Sporendonema minutum (Høye) Frank and Hess

PubMed Central

Sieburth, John McN.; Jensen, Arne

1967-01-01

Meal from the brown seaweed Ascophyllum nodosum (L.) Le Jol. is mainly used as an animal feed supplement. Since moist weed often develops a marked mold growth and since little was known about the microflora of seaweed meal, a cultural procedure was developed to enumerate the populations of bacteria, yeasts, and molds of seaweed meals manufactured by different drying processes. The microflora could be supported by a variety of media varying in levels of nutrition and in the source and concentration of salts. Fresh weed contained less than 103 bacteria and less than 102 yeasts and molds per g (dry weight). The type and extent of microbial populations in seaweed meal appeared to be dependent upon the method of seaweed drying. Rotary drum-drying at temperatures decreasing from 800 to 80 C maintained or reduced the microbial populations to 103 organisms per g (dry weight). Although meals with high nutritional quality can be obtained with warm air- or rock-dried weed, these conditions can also permit bacterial and mold development. Extended rock-drying in variable weather conditions and prolonged storage of moist weed, both of which decrease the nutritional quality, also lead to high bacterial numbers and to a marked development of the halophilic brown mold Sporendonema minutum which attained populations of 108 viable spores per g of dried weed. A poultry diet containing 5% badly molded weed had no apparent toxic or growth-depressing effect when fed to chicks. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:6069160

Volatile contents of mafic-to-intermediate magmas at San Cristóbal volcano in Nicaragua

NASA Astrophysics Data System (ADS)

Robidoux, P.; Aiuppa, A.; Rotolo, S. G.; Rizzo, A. L.; Hauri, E. H.; Frezzotti, M. L.

2017-02-01

batches, saturated in volatiles, at depths of 3.8-7.4 km, and (2) the ascent of more-differentiated and cogenetic volatile-poor basaltic andesites during historic-present eruptions, having longer residence times in the shallowest (< 3.4 km) and hence coolest regions of the magmatic plumbing system. We also report the first measurements of the compositions of noble-gas isotopes (He, Ne, and Ar) in fluid inclusions in olivine and pyroxene crystals. While the measured 40Ar/36Ar ratios (300-304) and 4He/20Ne ratios (9-373) indicate some degree of air contamination, the 3He/4He ratios (7.01-7.20 Ra) support a common mantle source for Holocene basalts and historic-present basaltic andesites. The magmatic source is interpreted as generated by a primitive MORB-like mantle, that is influenced to variable extents by distinct slab fluid components for basalts (Ba/La 76 and U/Th 0.8) and basaltic andesites (Ba/La 86 and U/Th 1.0) in addition to effects of magma differentiation. These values for the geochemical markers are particularly high, and their correlation with strong plume CO2/S ratios from San Cristóbal is highly consistent with volatile recycling at the CAVA subduction zone, where sediment involvement in mantle fluids influences the typical relatively C-rich signature of volcanic gases in Nicaragua.

Comment on papers ``Effect of Ag substitution on the transport property and magnetoresistance of LaMnO3'' [J. Magn. Magn. Mater. 248 (2002) 26] and ``Possible magnetic phase separation in Ru-doped La0.67Ca0.33O3'' [J. Magn. Magn. Mater. 257 (2003) 195

NASA Astrophysics Data System (ADS)

Rozenberg, E.

2004-03-01

In recent papers Ye et al. (J. Magn. Magn. Mater. 248 (2002) 26) and Lakshmi et al. (J. Magn. Magn. Mater. 257 (2003) 195) reported the characteristic features of electrical resistivity ( ρ) versus temperature ( T) dependences of polycrystalline-doped manganites La 1- xAg xMnO 3 and La 0.67Ca 0.33Mn 1- xRu xO 3. Infact, two peaks on ρ( T) curve coexist: broad one at some Tmax below the Curie points ( TC) of these compounds and a sharp peak near TC. Authors interpreted such coexistence as an evidence of electronic/magnetic phase separation in the above-noted systems below its TC. It is shown in this comment that such an interpretation is obviously invalid for La 1- xAg xMnO 3 system and is very questionable for La 0.67Ca 0.33Mn 1- xRu xO 3. The simplest and natural reason for the appearance of considered features on ρ( T) dependences of polycrystalline manganites is the well-known grain-boundary effects.

The bound states of ultracold KRb molecules

NASA Astrophysics Data System (ADS)

Julienne, Paul; Hanna, Thomas

2009-03-01

Recently ultracold vibrational ground state ^40K^87Rb polar molecules have been made using magnetoassociation of two cold atoms to a weakly bound Feshbach molecule, followed by a two-color optical STIRAP process to transfer molecules to the molecular ground state [1]. We have used accurate potential energy curves for the singlet and triplet states of the KRb molecule [2] with coupled channels calculations to calculate all of the bound states of the ^40K^87Rb molecule as a function of magnetic field from the cold atom collision threshold to the v=0 ground state. We have also developed approximate models for understanding the changing properties of the molecular bound states as binding energy increases. Some overall conclusions from these calculations will be presented. [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science, 2008, 322, 231--235. [2] A. Pashov, O. Docenko, M. Tamanis, R. Ferber, H. Kn"ockel, and E. Tiemann, Phys. Rev. A, 2007, 76, 022511.

Electric manipulation of ultracold polar ^40K^87Rb molecules in a magnetic field

NASA Astrophysics Data System (ADS)

Quéméner, Goulven; Bohn, John

2009-05-01

Ultracold fermionic polar molecules of ^40K^87Rb in their absolute rovibronic ground state (v=0,n=0,^1σ) have been created recently [1] in a magnetic trap and open new perspectives to create fermionic degenerate gases of polar molecules. To achieve this goal, it is very important to understand the collisional properties of such molecules under magnetic and electric fields. In our presentation, we investigate ground state fermionic ^40K^87Rb + ^40K^87Rb collisions in the presence of a magnetic field and explore the possibility to control these collisions when an electric field is applied. We will explore the main physical processes that can lead to such manipulation. This problem is complicated by the Zeeman and Stark splitting of all levels of the polar molecules and by the possibility of forming ^40K2 + ^87Rb2 chemical products. 1 - K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Pe'er, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science 322, 231 (2008).

Elicitor and nitrogen applications to Garnacha, Graciano and Tempranillo vines: effect on grape amino acid composition.

PubMed

Gutiérrez-Gamboa, Gastón; Portu, Javier; López, Rosa; Santamaría, Pilar; Garde-Cerdán, Teresa

2018-04-01

Elicitors and nitrogen foliar applications to vineyards could regulate grape nitrogen composition, which has an important effect on grape and wine quality. Thus the aim of this research was to study the effect of foliar elicitor treatments, methyl jasmonate (MeJ) and yeast extract (YE), and foliar nitrogen applications, urea (Ur) and phenylalanine (Phe), to Garnacha, Graciano and Tempranillo vines on grape amino acid composition. The results showed that elicitor and nitrogen foliar applications to Garnacha and Tempranillo grapevines decreased the must amino acid concentration. However, Phe application to these two grapevines increased the must Phe content. The treatments applied to Graciano grapevines barely effected the grape amino acid content. According to the percentage of variance attributable, the variety had a higher impact on the must amino acid composition than the treatments and their interaction, except in certain amino acids such as Phe. The influence of elicitor and nitrogen foliar applications to grapevines on grape amino acid concentration was strongly conditioned by the variety. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Forward orbital evolution of the Vesta Family with and without the Yarkovsky effect

NASA Astrophysics Data System (ADS)

Wlodarczyk, Ireneusz; Leliwa-Kopystynski, Jacek

2018-02-01

Vesta family members (VFMs), totally 17164, were selected by means of hierarchical clustering method (HCM) from the data base containing 393347 synthetic proper elements of numbered asteroids from the ASTDyS Catalogue (2015) updated in May 5, 2015. Keplerian elements from the Lowell Catalogue (2015) were used for studying orbital evolution of all 17164 VFMs in the time interval 1 Gy forward. Two cases were considered: evolution pass without the Yarkovsky effect (YN) and evolution pass with it (YY). It has been found that swarm of asteroids disperses about 28 times more efficient for the case YY than in the case YN. Efficiency of dispersion was studied versus semiaxis of asteroids relative to Vesta (smaller or larger than semiaxis of Vesta) as well as versus the sizes of asteroids. Weak relationships between size and efficiency of dispersion on YE have been found for the both cases YN and YY. The loss of number of the asteroids from VF weakly depends on their sizes. The total lost by number as well by mass is about 10% per 1 Gy.

Urea enhances cell lysis of Schizosaccharomyces pombe ura4 mutants.

PubMed

Nishino, Kohei; Kushima, Misaki; Kaino, Tomohiro; Matsuo, Yasuhiro; Kawamukai, Makoto

2017-07-01

Cell lysis is induced in Schizosaccharomyces pombe ∆ura4 cells grown in YPD medium, which contains yeast extract, polypeptone, and glucose. To identify the medium components that induce cell lysis, we first tested various kinds of yeast extracts from different suppliers. Cell lysis of ∆ura4 cells on YE medium was observed when yeast extracts from OXOID, BD, Oriental, and Difco were used, but not when using yeast extract from Kyokuto. To determine which compounds induced cell lysis, we subjected yeast extract and polypeptone to GC-MS analysis. Ten kinds of compounds were detected in OXOID and BD yeast extracts, but not in Kyokuto yeast extract. Among them was urea, which was also present in polypeptone, and it clearly induced cell lysis. Deletion of the ure2 gene, which is responsible for utilizing urea, abolished the lytic effect of urea. The effect of urea was suppressed by deletion of pub1, and a similar phenotype was observed in the presence of polypeptone. Thus, urea is an inducer of cell lysis in S. pombe ∆ura4 cells.

[Analysis on regularity of prescriptions in "a guide to clinical practice with medical record" for diarrhoea based on traditional Chinese medicine inheritance support system].

PubMed

He, Lan-Juan; Zhu, Xiang-Dong

2016-06-01

To analyze the regularities of prescriptions in "a guide to clinical practice with medical record" (Ye Tianshi) for diarrhoea based on traditional Chinese medicine inheritance support system(V2.5), and provide a reference for further research and development of new traditional Chinese medicines in treating diarrhoea. Traditional Chinese medicine inheritance support system was used to build a prescription database of Chinese medicines for diarrhoea. The software integration data mining method was used to analyze the prescriptions according to "four natures", "five flavors" and "meridians" in the database and achieve frequency statistics, syndrome distribution, prescription regularity and new prescription analysis. An analysis on 94 prescriptions for diarrhoea was used to determine the frequencies of medicines in prescriptions, commonly used medicine pairs and combinations, and achieve 13 new prescriptions. This study indicated that the prescriptions for diarrhoea in "a guide to clinical practice with medical record" are mostly of eliminating dampness and tonifying deficienccy, with neutral drug property, sweet, bitter or hot in flavor, and reflecting the treatment principle of "activating spleen-energy and resolving dampness". Copyright© by the Chinese Pharmaceutical Association.

Use of propranolol in a remote region of rural Guatemala to treat a large facial infantile haemangioma.

PubMed

Goldberg, Vera; Martinez, Boris; Cnop, Katia; Rohloff, Peter

2017-05-16

We present a female infant with a right-sided facial and neck haemangioma, from a remote, resource-poor community in rural Guatemala. She received first-line treatment, propranolol, with marked reduction in tumour size and erythema. Treatment was stopped after 35 weeks due to recurrent diarrhoea and sustained weight loss. Propranolol can be used to safely treat infants with haemangiomas in remote, rural communities if there is adequate follow-up, education and communication. Periocular haemangiomas should be treated promptly to avoid visual impairment. Infants with large facial haemangiomas should be screened for P osterior fossa anomalies, H emangioma, A rterial anomalies, C ardiac anomalies, and E ye anomalies (PHACE) syndrome, and specialists should be involved. The case also highlights the difficulty of providing treatment for a complex illness when basic health needs, such as food security and water sanitation, are limited. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Tensorial Gross-Neveu models

NASA Astrophysics Data System (ADS)

Benedetti, Dario; Carrozza, Sylvain; Gurau, Razvan; Sfondrini, Alessandro

2018-01-01

We define and study various tensorial generalizations of the Gross-Neveu model in two dimensions, that is, models with four-fermion interactions and G 3 symmetry, where we take either G = U( N) or G = O( N). Such models can also be viewed as two-dimensional generalizations of the Sachdev-Ye-Kitaev model, or more precisely of its tensorial counterpart introduced by Klebanov and Tarnopolsky, which is in part our motivation for studying them. Using the Schwinger-Dyson equations at large- N, we discuss the phenomenon of dynamical mass generation and possible combinations of couplings to avoid it. For the case G = U( N),we introduce an intermediate field representation and perform a stability analysis of the vacua. It turns out that the only apparently viable combination of couplings that avoids mass generation corresponds to an unstable vacuum. The stable vacuum breaks U( N)3 invariance, in contradiction with the Coleman-Mermin-Wagner theorem, but this is an artifact of the large- N expansion, similar to the breaking of continuous chiral symmetry in the chiral Gross-Neveu model.

Description and texts for the auxiliary programs for processing video information on the YeS computer. Part 3: Test program 2

NASA Technical Reports Server (NTRS)

Borisenko, V. I., G.g.; Stetsenko, Z. A.

1980-01-01

The functions were discribed and the operating instructions, the block diagram and the proposed versions are given for modifying the program in order to obtain the statistical characteristics of multi-channel video information. The program implements certain man-machine methods for investigating video information. It permits representation of the material and its statistical characteristics in a form which is convenient for the user.

Prevalence and Molecular Characterization of Plasmid-mediated Extended-Spectrum β-Lactamase Genes (balaTEM, blaCTX and blASHV) Among Urinary Escherichia coli Clinical Isolates in Mashhad, Iran

PubMed Central

Nakhaei Moghaddam, Mahboobeh; Forghanifard, Mohammad Mahdi; Moshrefi, Sheila

2012-01-01

Objective(s) Extended-spectrum beta-lactamase (ESBL) producing bacteria have an important role in nosocomial infections. Due to the limited availability of information about the molecular epidemiology of ESBL producing bacteria in Mashhad, we decided to investigate about TEM, CTX and SHV ESBLs among urinary Escherichia coli isolates in Mashhad, a city in northeast Iran. Materials and Methods One hundred and eleven clinical isolates of E. coli were diagnosed from hospitalized patients in 2009. After performing antibiogram and phenotypic confirmation test, polymerase chain reaction (PCR) was performed by blaTEM, blaSHV and blaCTX primers and restriction digestion was carried out using PstI and TaqI (Fermentas-Lithuania) for confirmation. Results ESBL producers of E. coli isolates were 33.3%. Among 37 ESBL-producing isolates, 35 (94.6%), 21 (56.8%) and 5 (13.5%) were shown to have blaCTX, blaTEM and blaSHV, genes respectively. Co-resistance to non-beta lactam antibiotics was observed more with ESBL producers (P < 0.05). Conclusion The results showed that the studied ESBL genes are found with high prevalence and among them blaCTX is more widespread in urine E. coli isolates in Mashhad. PMID:23493415

Single-atom cavity QED and optomicromechanics

NASA Astrophysics Data System (ADS)

Wallquist, M.; Hammerer, K.; Zoller, P.; Genes, C.; Ludwig, M.; Marquardt, F.; Treutlein, P.; Ye, J.; Kimble, H. J.

2010-02-01

In a recent publication [K. Hammerer, M. Wallquist, C. Genes, M. Ludwig, F. Marquardt, P. Treutlein, P. Zoller, J. Ye, and H. J. Kimble, Phys. Rev. Lett. 103, 063005 (2009)] we have shown the possibility to achieve strong coupling of the quantized motion of a micron-sized mechanical system to the motion of a single trapped atom. In the proposed setup the coherent coupling between a SiN membrane and a single atom is mediated by the field of a high finesse cavity and can be much larger than the relevant decoherence rates. This makes the well-developed tools of cavity quantum electrodynamics with single atoms available in the realm of cavity optomechanics. In this article we elaborate on this scheme and provide detailed derivations and technical comments. Moreover, we give numerical as well as analytical results for a number of possible applications for transfer of squeezed or Fock states from atom to membrane as well as entanglement generation, taking full account of dissipation. In the limit of strong-coupling the preparation and verification of nonclassical states of a mesoscopic mechanical system is within reach.

Insight into the validity of Leptobrachium guangxiense (Anura: Megophryidae): evidence from mitochondrial DNA sequences and morphological characters.

PubMed

Chen, Weicai; Zhang, Wei; Zhou, Shichu; Li, Ning; Huang, Yong; Mo, Yunming

2013-01-01

Lepobrachiun guangxiense Fei, Mo, Ye and Jiang, 2009 (Anura: Megophryidae), is presently thought to be endemic to Shangsi, Guangxi Province, China. A molecular phylogenetic analysis and morphological data were performed to gain insight into the phylogenetic position of this species. Maximum parsimony, maximum likelihood, and Bayesian inference methods were employed to reconstruct phylogenetic relationship, using 1914 bp of sequences from mtDNA genes of 12S rRNA, tRNAVal and 16S rRNA. Topologies revealed that L. guangxiense and Tam Dao (Vietnam) L. chapaense lineage (3A) formed a monophyletic group with well-supported values. The uncorrected p-distance of ~1.4k bp 16S rRNA data-sets between Tam Dao L. chapaense lineage (3A) and L. guangxiense is only 0.1%. Morphologically, L. guangxiense and Tam Dao L. chapaense lineage (3A) shared the same characters, and are distinguishable from "true" L. chapaense from the type locality in Sa Pa, Vietnam. Based on morphological characters and mitochondrial DNA, we suggested that the Tam Dao lineages of L. chapaense are conspecific with L. guangxiense. This represents a range extension for L. guangxiense, and a new country record for Vietnam.

Matrix effects on organic pollutants analysis in marine sediment

NASA Astrophysics Data System (ADS)

Azis, M. Y.; Asia, L.; Piram, A.; Buchari, B.; Doumenq, P.; Setiyanto, H.

2018-05-01

Interference from the matrix sample can influence of the accurate analytical method. Accelerated Solvent Extraction and their purification methods were tried to separate the organic micropollutants respectively in marine sediment. Those matrix were as organic pollutants evaluation in marine environment. Polychlorinated Biphenyls (PCBs) and Organochlorine pesticides (OCPs) are two examples organic pollutant in environment which are carcinogenic and mutagenic. Marine sediments are important matrices of information regarding the human activities in coastal areas as well as the fate and behavior of organic pollutants, which are persistent in long-term. This research purpose to evaluate the matrice effect and the recovery from marine sediment spiking with several standar solution and deuterium of molecular target from organic pollutants in not polluted sample of sediment. Matrice samples was tested from indicate in unpolluted location. The methods were evaluated with standard calibration curve (linearity < 0.999, LOQ various ranged 0.5-1000 pg.μL-1 and LOD > LOQ). Recovery (YE) relative, Matrice Effect (ME) relative correction with deuteriated standar were evaluated the interference the matrix. Interference effect for OCPs compounds were higher than PCBs in marine sediment.

Simulation of Quantum Many-Body Dynamics for Generic Strongly-Interacting Systems

NASA Astrophysics Data System (ADS)

Meyer, Gregory; Machado, Francisco; Yao, Norman

2017-04-01

Recent experimental advances have enabled the bottom-up assembly of complex, strongly interacting quantum many-body systems from individual atoms, ions, molecules and photons. These advances open the door to studying dynamics in isolated quantum systems as well as the possibility of realizing novel out-of-equilibrium phases of matter. Numerical studies provide insight into these systems; however, computational time and memory usage limit common numerical methods such as exact diagonalization to relatively small Hilbert spaces of dimension 215 . Here we present progress toward a new software package for dynamical time evolution of large generic quantum systems on massively parallel computing architectures. By projecting large sparse Hamiltonians into a much smaller Krylov subspace, we are able to compute the evolution of strongly interacting systems with Hilbert space dimension nearing 230. We discuss and benchmark different design implementations, such as matrix-free methods and GPU based calculations, using both pre-thermal time crystals and the Sachdev-Ye-Kitaev model as examples. We also include a simple symbolic language to describe generic Hamiltonians, allowing simulation of diverse quantum systems without any modification of the underlying C and Fortran code.

The La Silla-QUEST Kuiper Belt Survey

NASA Astrophysics Data System (ADS)

Rabinowitz, David; Schwamb, Megan E.; Hadjiyska, Elena; Tourtellotte, Suzanne

2012-11-01

We describe the instrumentation and detection software and characterize the detection efficiency of an automated, all-sky, southern-hemisphere search for Kuiper Belt Objects (KBOs) brighter than R mag 21.4. The search relies on Yale University's 160 Megapixel QUEST camera, previously used for the successful surveys at Palomar that detected most of the distant dwarf planets, and now installed on the ESO 1.0 m Schmidt telescope at La Silla, Chile. Extensive upgrades were made to the telescope control system to support automation, and significant improvements were made to the camera. To date, 63 new KBOs have been discovered, including a new member of the Haumea collision family (2009 YE7) and a new distant object with an inclination exceeding 70° (2010 WG9). In a survey covering ~7500 deg2, we have thus far detected 77 KBOs and Centaurs, more than any other full-hemisphere search to date. Using a pattern of dithered pointings, we demonstrate a search efficiency exceeding 80%. We are currently on track to complete the southern-sky survey and detect any bright KBOs that have eluded detection from the north.

Ethanol production from glycerol using immobilized Pachysolen tannophilus during microaerated repeated-batch fermentor culture.

PubMed

Cha, Hye-Geun; Kim, Yi-Ok; Choi, Woon Yong; Kang, Do-Hyung; Lee, Hyeon-Yong; Jung, Kyung-Hwan

2015-03-01

Herein, we established a repeated-batch process for ethanol production from glycerol by immobilized Pachysolen tannophilus. The aim of this study was to develop a more practical and applicable ethanol production process for biofuel. In particular, using industrial-grade medium ingredients, the microaeration rate was optimized for maximization of the ethanol production, and the relevant metabolic parameters were then analyzed. The microaeration rate of 0.11 vvm, which is far lower than those occurring in a shaking flask culture, was found to be the optimal value for ethanol production from glycerol. In addition, it was found that, among those tested, Celite was a more appropriate carrier for the immobilization of P. tannophilus to induce production of ethanol from glycerol. Finally, through a repeated-batch culture, the ethanol yield (Ye/g) of 0.126 ± 0.017 g-ethanol/g-glycerol (n = 4) was obtained, and this value was remarkably comparable with a previous report. In the future, it is expected that the results of this study will be applied for the development of a more practical and profitable long-term ethanol production process, thanks to the industrial-grade medium preparation, simple immobilization method, and easy repeated-batch operation.

Neutrino Astrophysics in Slowly Rotating Spacetimes Permeated by Nonlinear Electrodynamics Fields

NASA Astrophysics Data System (ADS)

Mosquera Cuesta, Herman J.

2017-02-01

Many theoretical and astrophysical arguments involve consideration of the effects of super strong electromagnetic fields and the rotation during the late stages of core-collapse supernovae. In what follows, we solve Einstein field equations that are minimally coupled to an arbitrary (current-free) Born-Infeld nonlinear Lagrangian L(F,G) of electrodynamics (NLED) in the slow rotation regime a ≪ r+ (outer horizon size), up to first order in a/r. We cross-check the physical properties of such NLED spacetime w.r.t. against the Maxwell one. A study case on both neutrino flavor ({ν }e\\to {ν }μ ,{ν }τ ) oscillations and flavor+helicity (spin) flip ({ν }e\\to {\\overline{ν }}μ ,τ ) gyroscopic precession proves that in the spacetime of a slowly rotating nonlinear charged black hole (RNCBH), the neutrino dynamics translates into a positive enhancement of the r-process (reduction of the electron fraction Ye < 0.5). Consequently, it guarantees successful hyperluminous core-collapse supernova explosions due to the enlargement of the number and amount of decaying nuclide species. This posits that, as far as the whole luminosity is concerned, hypernovae will be a proof of the formation of astrophysical RNCBH.

Formation and variation of the atmospheric heat source over the Tibetan Plateau and its climate effects

NASA Astrophysics Data System (ADS)

Wu, Guoxiong; He, Bian; Duan, Anmin; Liu, Yimin; Yu, Wei

2017-10-01

To cherish the memory of the late Professor Duzheng YE on what would have been his 100th birthday, and to celebrate his great accomplishment in opening a new era of Tibetan Plateau (TP) meteorology, this review paper provides an assessment of the atmospheric heat source (AHS) over the TP from different data resources, including observations from local meteorological stations, satellite remote sensing data, and various reanalysis datasets. The uncertainty and applicability of these heat source data are evaluated. Analysis regarding the formation of the AHS over the TP demonstrates that it is not only the cause of the atmospheric circulation, but is also a result of that circulation. Based on numerical experiments, the review further demonstrates that land-sea thermal contrast is only one part of the monsoon story. The thermal forcing of the Tibetan-Iranian Plateau plays a significant role in generating the Asian summer monsoon (ASM), i.e., in addition to pumping water vapor from sea to land and from the lower to the upper troposphere, it also generates a subtropical monsoon-type meridional circulation subject to the angular momentum conservation, providing an ascending-air large-scale background for the development of the ASM.

Laboratory modeling of dust impact detection by the Cassini spacecraft

NASA Astrophysics Data System (ADS)

Nouzák, L.; Hsu, S.; Malaspina, D.; Thayer, F. M.; Ye, S.-Y.; Pavlů, J.; Němeček, Z.; Šafránková, J.; Sternovsky, Z.

2018-07-01

The paper presents laboratory investigations of the response of a scaled down model of the Cassini spacecraft to impacts of submicron iron grains accelerated to velocities 5-25 km/s. The aim of the study is to help in a detailed analysis and interpretation of signals provided by the RPWS (Radio Wave Plasma Science) instrument that were attributed to dust impacts onto RPWS antennas or spacecraft body. The paper describes the experimental set-up, discusses its limitations, and presents the first results. Both monopole and dipole antenna configurations are investigated. We demonstrate that the amplitude and polarity of the impulse signals recorded by antenna amplifiers depend on the voltages applied onto the antennas or the spacecraft body and briefly introduce the mechanism leading to the signal generation. The experimental results support the recent suggestion by Ye et al. (2016) that antennas operated in a dipole mode are greatly insensitive to dust impacts on the spacecraft body. The pre-peak phenomenon, commonly observed in space, is also reproduced in the measurements and explained as the induced charge on the antenna from the impact plasma cloud that is becoming non-neutral due to the escape of the faster electrons.

Emergency Medical Service (EMS) Utilization by Syrian Refugees Residing in Ankara, Turkey.

PubMed

Altıner, Ali Osman; Yeşil, Sıdıka Tekeli

2018-04-01

Introduction Many Syrians have left their country and migrated to other countries since March 2011, due to the civil war. As of March 2016, a total of 2,747,946 Syrian refugees had immigrated to Turkey. Some Syrian refugees have been living in camps, while 2,475,134 have been living in metropolitan areas, such as Ankara. Study Objective This study investigated Emergency Medical Service (EMS) utilization among Syrian refugees residing in Ankara. This study was a descriptive, cross-sectional database analysis using data obtained from the Department of EMS of the Ankara Provincial Health Directorate. Five stations in the Altındağ region of Ankara responded to 42% of all calls from Syrian refugees. Prehospital EMS in Ankara have been used mostly by Syrian refugees younger than 18-years-old. Study findings also suggest that medical staff in regions where Syrian refugees are likely to be treated should be supported and provided with the ability to overcome language barriers and cultural differences. Altıner AO , Tekeli Yeşil S . Emergency Medical Service (EMS) utilization by Syrian refugees residing in Ankara, Turkey. Prehosp Disaster Med. 2018;33(2):160-164.

"Freely Ye Have Received, Freely Give" (Matthew 10: 8)--How Giving Away Religious Digital Books Influences the Print Sales of Those Books

ERIC Educational Resources Information Center

Hilton, John, III.

2010-01-01

Lack of access prevents many from benefiting from educational resources. Digital technologies now enable educational resources, such as books, to be openly available to those with access to the Internet. This study examined the financial viability of a religious publisher's putting free digital versions of eight of its books on the Internet. The…

New insights on Ba overabundance in open clusters. Evidence for the intermediate neutron-capture process at play?

NASA Astrophysics Data System (ADS)

Mishenina, T.; Pignatari, M.; Carraro, G.; Kovtyukh, V.; Monaco, L.; Korotin, S.; Shereta, E.; Yegorova, I.; Herwig, F.

2015-02-01

Recently, an increasing number of studies were devoted to measure the abundances of neutron-capture elements heavier than iron in stars belonging to Galactic Open Clusters (OCs). OCs span a sizeable range in metallicity (-0.6 ≤ [Fe/H] ≤ +0.4), and they show abundances of light elements similar to disc stars of the same age. A different pattern is observed for heavy elements. A large scatter is observed for Ba, with most OCs showing [Ba/Fe] and [Ba/La] overabundant with respect to the Sun. The origin of this overabundance is not clearly understood. With the goal of providing new observational insights, we determined radial velocities, atmospheric parameters and chemical composition of 27 giant stars members of five OCs: Cr 110, Cr 261, NGC 2477, NGC 2506 and NGC 5822. We used high-resolution spectra obtained with the UVES spectrograph at European Southern Observatory Paranal. We perform a detailed spectroscopic analysis of these stars to measure the abundance of up to 22 elements per star. We study the dependence of element abundance on metallicity and age with unprecedented detail, complementing our analysis with data culled from the literature. We confirm the trend of Ba overabundance in OCs, and show its large dispersion for clusters younger than ˜4 Gyr. Finally, the implications of our results for stellar nucleosynthesis are discussed. We show in this work that the Ba enrichment compared to other neutron-capture elements in OCs cannot be explained by the contributions from the slow neutron-capture process and the rapid neutron-capture process. Instead, we argue that this anomalous signature can be explained by assuming an additional contribution by the intermediate neutron-capture process.

Genesis of post-collisional calc-alkaline and alkaline granitoids in Qiman Tagh, East Kunlun, China

NASA Astrophysics Data System (ADS)

Yu, Miao; Feng, Chengyou; Zhao, Yiming; Li, Daxin

2015-12-01

The post-collisional magmatism of Qiman Tagh is characterized by the intrusion of voluminous intermediate to felsic granitoids, including syenogranite, monzogranite, granodiorite, tonalite and diorite. The granitoids can be divided into two magmatic suites: Calc-alkaline (CA) and alkaline (Alk), which were emplaced from ~ 236 Ma to ~ 204 Ma. The CA suite contains metaluminous granodiorites and monzogranites. Typical Qiman Tagh CA granodiorites show moderately fractionated REE patterns ((La/Yb)N = 4.35-25.11) with significant negative Eu anomalies (Eu/Eu* = 0.54-1.34), and the primitive mantle-normalized spidergrams show strong depletion of Nb and Sr. The Qiman Tagh CA monzogranites show similar fractionated REE patterns ((La/Yb)N = 2.70-13.5) with less prominent negative Eu anomalies, and the chondrite-normalized spidergrams show strongly depleted Ba, Nb and Sr. The Alk suite, including syenogranite, is highly potassic (K2O/Na2O = 1.09-3.56) and peraluminous (A/CNK = 0.91-1.06). Compared to typical Qiman Tagh CA granodiorites, the Qiman Tagh Alk granitoids can be distinguished by their higher Rb, Nb, Ga/Al, FeO*/MgO, Y/Sr and Rb/Sr, as well as their lower Mg#, MgO, CaO, Al2O3, Sr, Co, V, Eu/Eu*, Ba/Nb, La/Nb, Ba/La and Ce/Nb. The Qiman Tagh CA rocks were most likely to be derived from the partial melting of garnet-amphibolite-facies rocks in the lower crust, leaving behind anhydrous granulite-facies rocks with plagioclase and garnet in the residue. The Alk rocks may have formed by the continued partial melting of granulite-facies rocks at elevated temperatures (> 830 °C).

Comparison of settling particles and sediments at IMAGES coring site in the northwestern North Pacific — Effect of resuspended particles on paleorecords

NASA Astrophysics Data System (ADS)

Kawahata, Hodaka; Minoshima, Kayo; Ishizaki, Yui; Yamaoka, Kyoko; Gupta, Lallan P.; Nagao, Masayuki; Kuroyanagi, Azumi

2009-12-01

In order to understand settling process of particles in high sedimentation area, one mooring of sediment trap was deployed right above the IMAGES coring site in the northwestern North Pacific. In spite of two large maxima of settling particle fluxes in June-July 2002 and October-early January 2003, organic matter (OM) and carbonate showed higher peaks in June-July while lithogenics showed a large peak in October-early January with degraded OM (low aspartic acid/beta-alanine (Asp/Bala) and glutamic acid/gamma-aminobutyric (Glu/Gaba) ratios). Fresh OM production peaked in June-July 2002 and April-May 2003. Thus a large export production occurred in spring-early summer (April-June). Alkenone production was enhanced mainly in June-July. The mean alkenone SST of the settling particles was rather consistent with the observed annual mean SST and alkenone SST determined from the surface sediments. On the other hand, the maximum lithogenic flux along with the degradation of OM indicated that a significant amount of resuspended matter contaminated the bottom sediments. Based upon idealized model, the current and settling speeds make fractionation by size and density of resuspended particles during the settling process. Accumulation rates of lithogenics were ~ 5 times those in the sediment traps, which indicate large contribution of resuspended particles to settling particles especially during October-early January, when the Tsugaru current showed high current speed. These observations call our attention to carefully reconstruct paleo-environments based upon lithogenics and several other proxies such as biogenic silica, which would be biased for example in the record of IMAGES core at Site Shimokita located on the gentle continental slope.

Atmospheric Transport Modelling confining potential source location of East-Asian radionuclide detections in May 2010

NASA Astrophysics Data System (ADS)

Ross, J. Ole; Ceranna, Lars

2016-04-01

The radionuclide component of the International Monitoring System (IMS) to verify compliance with the Comprehensive Nuclear-Test-Ban Treaty (CTBT) is in place to detect tiny traces of fission products from nuclear explosions in the atmosphere. The challenge for the interpretation of IMS radionuclide data is to discriminate radionuclide sources of CTBT relevance against emissions from nuclear facilities. Remarkable activity concentrations of Ba/La-140 occurred at the IMS radionuclide stations RN 37 (Okinawa) and RN 58 (Ussurysk) mid of May 2010. In those days also an elevated Xe-133 level was measured at RN 38 (Takasaki). Additional regional measurements of radioxenon were reported in the press and further analyzed in various publications. The radionuclide analysis gives evidence for the presence of a nuclear fission source between 10 and 12 May 2010. Backward Atmospheric Transport Modelling (ATM) with HYSPLIT driven by 0.2° ECMWF meteorological data for the IMS samples indicates that, assuming a single source, a wide range of source regions is possible including the Korean Peninsula, the Sea of Japan (East Sea), and parts of China and Russia. Further confinement of the possible source location can be provided by atmospheric backtracking for the assumed sampling periods of the reported regional xenon measurements. New studies indicate a very weak seismic event at the DPRK test site on early 12 May 2010. Forward ATM for a pulse release caused by this event shows fairly good agreement with the observed radionuclide signature. Nevertheless, the underlying nuclear fission scenario remains quite unclear and speculative even if assuming a connection between the waveform and the radionuclide event.

Cryosalt Formation in Delaminated Clays

NASA Astrophysics Data System (ADS)

Yeşilbaş, Merve; Boily, Jean-François

2017-04-01

-montmorillonite at hosting hydrohalite, the results of this study can be used to suggest that delaminated Na-montmorillonite sheets encapsulate the salt solutions and by preventing sublimation of water, promotes crystallization of hydrohalite. As delamination is not possible in Ca-montmorillonite, water more readily sublimated from the system, leaving behind a dry Ca-montmorillonite/NaCl assemblage. As such, this work identified processes through which clay minerals can affect the formation of cryosalts that are not only of importance to terrestrial environments of the cryosphere but also to atmospheric processes involving dust aerosols. [1] Yeşilbaş, M. and Boily, J.-F. (2016), Scientific Reports. 6, 32136. [2] Yeşilbaş, M. and Boily, J.-F. (2016), J. Phys. Chem. Lett. 7, 2849-2855. [3] Wagner, R., Möhler O., Schnaiter, M. (2012), 33, 8557-8571.

Changes in Lava Compositions and With Time From the Eocene Through the Miocene for the Mariana Forearc

NASA Astrophysics Data System (ADS)

Reagan, M. K.; Mohler, D.; Brian, H.; Hickey-Vargas, R.; Hanan, B.

2003-12-01

We are investigating the evolution of volcanism in the Mariana arc from the initiation of subduction of the Pacific plate beneath the Philippine plate in the Eocene through the Miocene. The oldest lavas in the Mariana fore-arc region are a ca 49 Ma tholeiite to boninite sequence from DSDP sites 458 and 459. These tholeiites have NMORB-like REE, HFSE, and Th concentrations, but are enriched in LIL elements, Pb, and U. The capping boninite-series glasses have similar slab-derived trace element abundance patterns, but lower and flatter REE contents (1-2 x PUM). 40Ar/39Ar ages obtained on boninite series lavas from Guam stretch back to 44Ma. These lavas have U-shaped REE patterns and HREE concentrations about 3-8 x PUM. La/Nb decrease and Hf/Sm increase with increasing Ba/La for both the DSDP and Guam lavas. Pb isotope values plot within fields defined by Pacific plate lavas and volcanogenic sediments (Meijer, 1976, GSA Bull., v. 87; Pearce et al., 1999, J. Petrol., v. 40). Hf and Pb isotopic compositions change consistently with Hf/Sm and Ba/La ratios for lavas from the DSDP sites, but not for those from Guam. The data suggest either that little of the Pb in these lavas was derived from subducting sediments, or that the contrast in Pb isotopes between lavas from Guam and slab fluids was inconsequential. The source of the DSDP site lavas was similar to a Pacific or transitional Pacific-Indian Ocean MORB-source. Fluxed melting at high-P generated the tholeiites. Boninites were generated at low-P by continued fluxed melting. The mantle source for the boninite-series lavas from Guam was less depleted. Progressive fluxed melting here apparently occurred with less mantle upwelling. In both locations, the variations in La/Nb and perhaps the Hf/Sm ratios appear to be related to changes in the residual mantle source mineralogy with progressive melting. Rhyolites erupted on Saipan at 45- 46 Ma are unusually high in silica for an oceanic island arc setting. These lavas are

Don't abandon hope all ye who enter here: The protective role of formal mentoring and learning processes on burnout in correctional officers.

PubMed

Farnese, M L; Barbieri, B; Bellò, B; Bartone, P T

2017-01-01

Within a Job Demands-Resources Model framework, formal mentoring can be conceived as a job resource expressing the organization's support for new members, which may prevent their being at risk for burnout. This research aims at understanding the protective role of formal mentoring on burnout, through the effect of increasing learning personal resources. Specifically, we hypothesized that formal mentoring enhances newcomers' learning about job and social domains related to the new work context, thus leading to lower burnout. In order to test the hypotheses, a multiple regression analysis using the bootstrapping method was used. Based on a questionnaire administered to 117 correctional officer newcomers who had a formal mentor assigned, our results confirm that formal mentoring exerts a positive influence on newcomers' adjustment, and that this in turn exerts a protective influence against burnout onset by reducing cynicism and interpersonal stress and also enhancing the sense of personal accomplishment. Confirming previous literature's suggestions, supportive mentoring and effective socialization seem to represent job and personal resources that are protective against burnout. This study provides empirical support for this relation in the prison context.

The First School for Young Astronomers Organized by ESO and the Astronomical Council of the USSR Acadeny of Sciences

NASA Astrophysics Data System (ADS)

D'Odorico, S.

1987-12-01

The first international school for young astronomers organized jointly by ESO and the Astronomical Council of the USSR Academy of Sciences took place from the 22nd to the 29th of September at the Byurakan Astrophysical Observatory of the Academy of Sciences of Armenia and was dedicated to "Observations with Large Telescopes". It was appropriately closed with a oneday visit to the Special Astrophysical Observatory at Zelenchukskaja, in northern Caucasus, home of the 6-m telescope, the largest in the world. The lecturers came from ESO and from the Soviet Union; the 45 participants were from ESO member states, from Bulgaria, Czechoslovakia, the German Democratic Republic, Poland, Spain and the USSR. After the welcome addresses by Academician V.A. Ambartsumian and by E. Ye Khachikian, Chairman of the Local Organizing Committee, the school was opened by M. Tarenghi of ESO who spoke on the characteristics of existing ESO telescopes and on the innovative features of the ESO 3.5-m New Technology Telescope, to be erected at La Silla next year. H. A. Abrahamian and J.A. Stepanian of the Byurakan Observatory presented the Byurakan 2.6-m telescope and the 1-m Schmidt respectively, illustrating the scientific programmes carried out in the recent past and presently at these two facilities.

Analysis of 2-alkylcyclobutanones in cashew nut, nutmeg, apricot kernel, and pine nut samples: re-evaluating the uniqueness of 2-alkylcyclobutanones for irradiated food identification.

PubMed

Leung, Elvis M K; Tang, Phyllis N Y; Ye, Yuran; Chan, Wan

2013-10-16

2-Alkylcyclobutanones (2-ACBs) have long been considered as unique radiolytic products that can be used as indicators for irradiated food identification. A recent report on the natural existence of 2-ACB in non-irradiated nutmeg and cashew nut samples aroused worldwide concern because it contradicts the general belief that 2-ACBs are specific to irradiated food. The goal of this study is to test the natural existence of 2-ACBs in nut samples using our newly developed liquid chromatography-tandem mass spectrometry (LC-MS/MS) method with enhanced analytical sensitivity and selectivity ( Ye , Y. ; Liu , H. ; Horvatovich , P. ; Chan , W. Liquid chromatography-electrospray ionization tandem mass spectrometric analysis of 2-alkylcyclobutanones in irradiated chicken by precolumn derivatization with hydroxylamine . J. Agric. Food Chem. 2013 , 61 , 5758 - 5763 ). The validated method was applied to identify 2-dodecylcyclobutanone (2-DCB) and 2-tetradecylcyclobutanone (2-TCB) in nutmeg, cashew nut, pine nut, and apricot kernel samples (n = 22) of different origins. Our study reveals that 2-DCB and 2-TCB either do not exist naturally or exist at concentrations below the detection limit of the existing method. Thus, 2-DCB and 2-TCB are still valid to be used as biomarkers for identifying irradiated food.

Towards fundamental understanding of ultracold KRb

NASA Astrophysics Data System (ADS)

Kotochigova, Svetlana

2009-05-01

The recent formation of ultracold KRb molecules in their absolute rovibrational ground state [1] has created great promise for study of collective phenomena that rely on the long-range interactions between polar molecules. Here we discuss the theoretical analysis of various essential properties of the KRb molecules [2] that accompanied these experimental advances. This analysis is based on multi-channel bound-state calculations of both ground and excited electronic states. We have found that the theoretical hyperfine and Zeeman mixed X^1&+circ; and a^3&+circ; vibrational structure shows excellent agreement with the experimentally observed structure. In addition, multi-channel calculations of the rovibrational structure of the excited state potentials have allowed us to find the optimal transitions to the lowest v=0 vibrational levels. Finally, we examine the dynamic polarizability of vibrationally cold KRb molecules as a function of laser frequency. Based on this knowledge, laser frequencies can be selected to minimize decoherence from loss of molecules due to spontaneous or laser-induced transitions. [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science 322, 231 (2008). [2] S. Kotochigova, E. Tiesinga, and P. S. Julienne, submitted to New J. Phys. (2009).

Immaturity of the Oculomotor Saccade and Vergence Interaction in Dyslexic Children: Evidence from a Reading and Visual Search Study

PubMed Central

Bucci, Maria Pia; Nassibi, Naziha; Gerard, Christophe-Loic; Bui-Quoc, Emmanuel; Seassau, Magali

2012-01-01

Studies comparing binocular eye movements during reading and visual search in dyslexic children are, at our knowledge, inexistent. In the present study we examined ocular motor characteristics in dyslexic children versus two groups of non dyslexic children with chronological/reading age-matched. Binocular eye movements were recorded by an infrared system (mobileEBT®, e(ye)BRAIN) in twelve dyslexic children (mean age 11 years old) and a group of chronological age-matched (N = 9) and reading age-matched (N = 10) non dyslexic children. Two visual tasks were used: text reading and visual search. Independently of the task, the ocular motor behavior in dyslexic children is similar to those reported in reading age-matched non dyslexic children: many and longer fixations as well as poor quality of binocular coordination during and after the saccades. In contrast, chronological age-matched non dyslexic children showed a small number of fixations and short duration of fixations in reading task with respect to visual search task; furthermore their saccades were well yoked in both tasks. The atypical eye movement's patterns observed in dyslexic children suggest a deficiency in the visual attentional processing as well as an immaturity of the ocular motor saccade and vergence systems interaction. PMID:22438934

Convection Destroys the Core/Mantle Structure in Hybrid C/O/Ne White Dwarfs

NASA Astrophysics Data System (ADS)

Brooks, Jared; Schwab, Josiah; Bildsten, Lars; Quataert, Eliot; Paxton, Bill

2017-01-01

A hybrid C/O/Ne white dwarf (WD)—an unburned C/O core surrounded by an O/Ne/Na mantle—can be formed if the carbon flame is quenched in a super-AGB star or white dwarf merger remnant. We show that this segregated hybrid structure becomes unstable to rapid mixing within 2000 years of the onset of WD cooling. Carbon burning includes a weak reaction that removes electrons, resulting in a lower electron-to-baryon ratio ({Y}{{e}}) in the regions processed by carbon burning compared to the unburned C/O core, making the O/Ne mantle denser than the C/O core as the WD cools. This is unstable to efficient mixing. We use the results of {\\mathtt{MESA}} models with different size C/O cores to quantify the rate at which the cores mix with the mantle as they cool. In all cases, we find that the WDs undergo significant core/mantle mixing on timescales shorter than the time available to grow the WD to the Chandrasekhar mass (MCh) by accretion. As a result, hybrid WDs that reach MCh due to later accretion will have lower central carbon fractions than assumed thus far. We briefly discuss the implications of these results for the possibility of SNe Ia from hybrid WDs.

Characterizing and Improving Distributed Intrusion Detection Systems.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hurd, Steven A; Proebstel, Elliot P.

2007-11-01

Due to ever-increasing quantities of information traversing networks, network administrators are developing greater reliance upon statistically sampled packet information as the source for their intrusion detection systems (IDS). Our research is aimed at understanding IDS performance when statistical packet sampling is used. Using the Snort IDS and a variety of data sets, we compared IDS results when an entire data set is used to the results when a statistically sampled subset of the data set is used. Generally speaking, IDS performance with statistically sampled information was shown to drop considerably even under fairly high sampling rates (such as 1:5). Characterizingmore » and Improving Distributed Intrusion Detection Systems4AcknowledgementsThe authors wish to extend our gratitude to Matt Bishop and Chen-Nee Chuah of UC Davis for their guidance and support on this work. Our thanks are also extended to Jianning Mai of UC Davis and Tao Ye of Sprint Advanced Technology Labs for their generous assistance.We would also like to acknowledge our dataset sources, CRAWDAD and CAIDA, without which this work would not have been possible. Support for OC48 data collection is provided by DARPA, NSF, DHS, Cisco and CAIDA members.« less