Science.gov

Sample records for noncoding dna elements

  1. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements.

    PubMed

    Schlesinger, Felix; Smith, Andrew D; Gingeras, Thomas R; Hannon, Gregory J; Hodges, Emily

    2013-10-01

    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  2. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements

    PubMed Central

    Schlesinger, Felix; Smith, Andrew D.; Gingeras, Thomas R.; Hannon, Gregory J.; Hodges, Emily

    2013-01-01

    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  3. CRISPR Screens to Discover Functional Noncoding Elements.

    PubMed

    Wright, Jason B; Sanjana, Neville E

    2016-09-01

    A major challenge in genomics is to identify functional elements in the noncoding genome. Recently, pooled clustered regularly interspersed palindromic repeat (CRISPR) mutagenesis screens of noncoding regions have emerged as a novel method for finding elements that impact gene expression and phenotype/disease-relevant biological processes. Here we review and compare different approaches for high-throughput dissection of noncoding elements. PMID:27423542

  4. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

    1999-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  5. DNA Damage-Induced Transcription of Transposable Elements and Long Non-coding RNAs in Arabidopsis Is Rare and ATM-Dependent.

    PubMed

    Wang, Zhenxing; Schwacke, Rainer; Kunze, Reinhard

    2016-08-01

    Induction and mobilization of transposable elements (TEs) following DNA damage or other stresses has been reported in prokaryotes and eukaryotes. Recently it was discovered that eukaryotic TEs are frequently associated with long non-coding RNAs (lncRNAs), many of which are also upregulated by stress. Yet, it is unknown whether DNA damage-induced transcriptional activation of TEs and lncRNAs occurs sporadically or is a synchronized, genome-wide response. Here we investigated the transcriptome of Arabidopsis wild-type (WT) and ataxia telangiectasia mutated (atm) mutant plants 3 h after induction of DNA damage. In WT, expression of 5.2% of the protein-coding genes is ≥2-fold changed, whereas in atm plants, only 2.6% of these genes are regulated, and the response of genes associated with DNA repair, replication, and cell cycle is largely lost. In contrast, only less than 0.6% of TEs and lncRNAs respond to DNA damage in WT plants, and the regulation of ≥95% of them is ATM-dependent. The ATM-downstream factors BRCA1, DRM1, JMJ30, AGO2, and the ATM-independent AGO4 participate in the regulation of individual TEs and lncRNAs. Remarkably, protein-coding genes located adjacent to DNA damage-responsive TEs and lncRNAs are frequently coexpressed, which is consistent with the hypothesis that TEs and lncRNAs located close to genes commonly function as controlling elements. PMID:27150037

  6. Linguistic features of noncoding DNA sequences

    NASA Astrophysics Data System (ADS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C.-K.; Simons, M.; Stanley, H. E.

    1994-12-01

    We extend the Zipf approach to analyzing linguistic texts to the statistical study of DNA base pair sequences, and find that the noncoding regions are more similar to natural languages than the coding regions. We also adapt the Shannon approach to quantifying the ``redundancy'' of a linguistic text in terms of a measurable entropy function, and demonstrate that noncoding regions in eukaryotes display a smaller entropy and larger redundancy B than coding regions, supporting the possibility that noncoding regions of DNA may carry biological information.

  7. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs.

    PubMed

    Glinsky, Gennadi V

    2015-06-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals' genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  8. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  9. "Reverse Genomics" Predicts Function of Human Conserved Noncoding Elements.

    PubMed

    Marcovitz, Amir; Jia, Robin; Bejerano, Gill

    2016-05-01

    Evolutionary changes in cis-regulatory elements are thought to play a key role in morphological and physiological diversity across animals. Many conserved noncoding elements (CNEs) function as cis-regulatory elements, controlling gene expression levels in different biological contexts. However, determining specific associations between CNEs and related phenotypes is a challenging task. Here, we present a computational "reverse genomics" approach that predicts the phenotypic functions of human CNEs. We identify thousands of human CNEs that were lost in at least two independent mammalian lineages (IL-CNEs), and match their evolutionary profiles against a diverse set of phenotypes recently annotated across multiple mammalian species. We identify 2,759 compelling associations between human CNEs and a diverse set of mammalian phenotypes. We discuss multiple CNEs, including a predicted ear element near BMP7, a pelvic CNE in FBN1, a brain morphology element in UBE4B, and an aquatic adaptation forelimb CNE near EGR2, and provide a full list of our predictions. As more genomes are sequenced and more traits are annotated across species, we expect our method to facilitate the interpretation of noncoding mutations in human disease and expedite the discovery of individual CNEs that play key roles in human evolution and development. PMID:26744417

  10. Long noncoding RNA, the methylation of genomic elements and their emerging crosstalk in hepatocellular carcinoma.

    PubMed

    Yuan, Sheng-Xian; Zhang, Jin; Xu, Qing-Guo; Yang, Yuan; Zhou, Wei-Ping

    2016-09-01

    The epigenetic mechanism that incorporates DNA methylation alterations, histone modifications, and non-coding RNA expression has been identified as a major characteristic in distinguishing physiological and pathological settings of cancers including hepatocellular carcinoma (HCC), the third leading cause of mortality related cancer. The advance in methylation modification of chromatin elements (for both genomic DNA and histone tails) and the emerging roles of long noncoding RNA (lncRNA) have given us a better understanding of molecular mechanisms underlying HCC. Recently, methods like genome-wide lncRNA profiling and histone hallmark detection were reported to discover mass tumor-associated lncRNAs epigenetically deregulated by differential chromosome modification, mainly by genomic DNA and histone methylation. Therefore, aberrant methylation modification of certain particular lncRNA genes could be crucial events correlating with unfavorable outcomes in HCC. In addition, amount of lncRNAs could act as a manipulator for DNA methylation or a scaffold for histone modification to affect key signaling pathways in hepatocarcinogenesis. This suggests that methylation modification of chromatin elements may have functional crosstalk with lncRNA. Here, we aim to outline the emerging role of the methylation and lncRNA, and their crosstalk of molecular mechanism. PMID:26282784

  11. Non-coding RNAs in DNA damage response

    PubMed Central

    Liu, Yunhua; Lu, Xiongbin

    2012-01-01

    Genome-wide studies have revealed that human and other mammalian genomes are pervasively transcribed and produce thousands of regulatory non-protein-coding RNAs (ncRNAs), including miRNAs, siRNAs, piRNAs and long non-coding RNAs (lncRNAs). Emerging evidences suggest that these ncRNAs also play a pivotal role in genome integrity and stability via the regulation of DNA damage response (DDR). In this review, we discuss the recent finding on the interplay of ncRNAs with the canonical DDR signaling pathway, with a particular emphasis on miRNAs and lncRNAs. While the expression of ncRNAs is regulated in the DDR, the DDR is also subjected to regulation by those DNA damage-responsive ncRNAs. In addition, the roles of those Dicer- and Drosha-dependent small RNAs produced in the vicinity of double-strand breaks sites are also described. PMID:23226613

  12. Wood identification with PCR targeting noncoding chloroplast DNA.

    PubMed

    Tang, Xiaoshu; Zhao, Guangjie; Ping, Liyan

    2011-12-01

    Wood identification is extremely important in the modern forest industry. It also has significant applications in forensics, as well as in archeology and ecological research. In this study, five universal primer pairs amplifying chloroplast noncoding sequences of 300-1,200 bp were designed. Sequencing these amplicons in combination can lead to reliable identification of logs and wood products to cultivar, ecotype, or even the falling population. These primer pairs work on both gymnosperms and angiosperm trees. They also are potentially applicable to accurately identify shrubs and herbaceous species. In addition, a wood DNA purification method is proposed in which N-phenacylthiazolium bromide (PTB) is used to increase the quality and quantity of extracted DNA. This method was first validated using air-dried timber disks from three different tree species that were felled 4 years ago. The sapwood and outer heartwood provided the best locations for DNA extraction. The method was also successfully applied to extract DNA from the recalcitrant processed white oak wood, randomly selected staves of wine barrels. The single nucleotide polymorphism detected on the oak DNA sequences showed correlation to their geographical origins. PMID:22038094

  13. Junk DNA and the long non-coding RNA twist in cancer genetics

    PubMed Central

    Ling, Hui; Vincent, Kimberly; Pichler, Martin; Fodde, Riccardo; Berindan-Neagoe, Ioana; Slack, Frank J.; Calin, George A

    2015-01-01

    The central dogma of molecular biology states that the flow of genetic information moves from DNA to RNA to protein. However, in the last decade this dogma has been challenged by new findings on non-coding RNAs (ncRNAs) such as microRNAs (miRNAs). More recently, long non-coding RNAs (lncRNAs) have attracted much attention due to their large number and biological significance. Many lncRNAs have been identified as mapping to regulatory elements including gene promoters and enhancers, ultraconserved regions, and intergenic regions of protein-coding genes. Yet, the biological function and molecular mechanisms of lncRNA in human diseases in general and cancer in particular remain largely unknown. Data from the literature suggest that lncRNA, often via interaction with proteins, functions in specific genomic loci or use their own transcription loci for regulatory activity. In this review, we summarize recent findings supporting the importance of DNA loci in lncRNA function, and the underlying molecular mechanisms via cis or trans regulation, and discuss their implications in cancer. In addition, we use the 8q24 genomic locus, a region containing interactive SNPs, DNA regulatory elements and lncRNAs, as an example to illustrate how single nucleotide polymorphism (SNP) located within lncRNAs may be functionally associated with the individual’s susceptibility to cancer. PMID:25619839

  14. Junk DNA and the long non-coding RNA twist in cancer genetics.

    PubMed

    Ling, H; Vincent, K; Pichler, M; Fodde, R; Berindan-Neagoe, I; Slack, F J; Calin, G A

    2015-09-24

    The central dogma of molecular biology states that the flow of genetic information moves from DNA to RNA to protein. However, in the last decade this dogma has been challenged by new findings on non-coding RNAs (ncRNAs) such as microRNAs (miRNAs). More recently, long non-coding RNAs (lncRNAs) have attracted much attention due to their large number and biological significance. Many lncRNAs have been identified as mapping to regulatory elements including gene promoters and enhancers, ultraconserved regions and intergenic regions of protein-coding genes. Yet, the biological function and molecular mechanisms of lncRNA in human diseases in general and cancer in particular remain largely unknown. Data from the literature suggest that lncRNA, often via interaction with proteins, functions in specific genomic loci or use their own transcription loci for regulatory activity. In this review, we summarize recent findings supporting the importance of DNA loci in lncRNA function and the underlying molecular mechanisms via cis or trans regulation, and discuss their implications in cancer. In addition, we use the 8q24 genomic locus, a region containing interactive SNPs, DNA regulatory elements and lncRNAs, as an example to illustrate how single-nucleotide polymorphism (SNP) located within lncRNAs may be functionally associated with the individual's susceptibility to cancer. PMID:25619839

  15. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    SciTech Connect

    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C.; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.

    2015-03-23

    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. In this paper, we use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% of the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Finally, our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  16. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    DOE PAGESBeta

    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C.; et al

    2015-03-23

    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. In this paper, we use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% ofmore » the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Finally, our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.« less

  17. The most frequent short sequences in non-coding DNA.

    PubMed

    Subirana, Juan A; Messeguer, Xavier

    2010-03-01

    The purpose of this work is to determine the most frequent short sequences in non-coding DNA. They may play a role in maintaining the structure and function of eukaryotic chromosomes. We present a simple method for the detection and analysis of such sequences in several genomes, including Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster and Homo sapiens. We also study two chromosomes of man and mouse with a length similar to the whole genomes of the other species. We provide a list of the most common sequences of 9-14 bases in each genome. As expected, they are present in human Alu sequences. Our programs may also give a graph and a list of their position in the genome. Detection of clusters is also possible. In most cases, these sequences contain few alternating regions. Their intrinsic structure and their influence on nucleosome formation are not known. In particular, we have found new features of short sequences in C. elegans, which are distributed in heterogeneous clusters. They appear as punctuation marks in the chromosomes. Such clusters are not found in either A. thaliana or D. melanogaster. We discuss the possibility that they play a role in centromere function and homolog recognition in meiosis. PMID:19966278

  18. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    SciTech Connect

    Walworth, Nathan G.; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, T.; Goodwin, Lynne A.; Kyrpides, Nikos; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.

    2015-04-07

    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance due to its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20-25% less than the average for other cyanobacteria and non-pathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus both in culture and in situ. Transcriptome analysis indicates that 86% of the non-coding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and two fold higher than that found in the gene dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium ncRNA secondary structures were predicted between most culture and metagenomic sequences lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high fidelity replication allowed the unusual ‘inflation’ of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  19. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  20. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    NASA Technical Reports Server (NTRS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  1. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle.

    PubMed

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W; Kozmik, Zbynek; Putnam, Nicholas H; Yu, Jr-Kai; Holland, Linda Z

    2016-01-01

    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120-160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  2. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    PubMed Central

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.

    2016-01-01

    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  3. Elements and machinery of non-coding RNAs: toward their taxonomy

    PubMed Central

    Hirose, Tetsuro; Mishima, Yuichiro; Tomari, Yukihide

    2014-01-01

    Although recent transcriptome analyses have uncovered numerous non-coding RNAs (ncRNAs), their functions remain largely unknown. ncRNAs assemble with proteins and operate as ribonucleoprotein (RNP) machineries, formation of which is thought to be determined by specific fundamental elements embedded in the primary RNA transcripts. Knowledge about the relationships between RNA elements, RNP machinery, and molecular and physiological functions is critical for understanding the diverse roles of ncRNAs and may eventually allow their systematic classification or “taxonomy.” In this review, we catalog and discuss representative small and long non-coding RNA classes, focusing on their currently known (and unknown) RNA elements and RNP machineries. PMID:24731943

  4. Genome defense against exogenous nucleic acids in eukaryotes by non-coding DNA occurs through CRISPR-like mechanisms in the cytosol and the bodyguard protection in the nucleus.

    PubMed

    Qiu, Guo-Hua

    2016-01-01

    In this review, the protective function of the abundant non-coding DNA in the eukaryotic genome is discussed from the perspective of genome defense against exogenous nucleic acids. Peripheral non-coding DNA has been proposed to act as a bodyguard that protects the genome and the central protein-coding sequences from ionizing radiation-induced DNA damage. In the proposed mechanism of protection, the radicals generated by water radiolysis in the cytosol and IR energy are absorbed, blocked and/or reduced by peripheral heterochromatin; then, the DNA damage sites in the heterochromatin are removed and expelled from the nucleus to the cytoplasm through nuclear pore complexes, most likely through the formation of extrachromosomal circular DNA. To strengthen this hypothesis, this review summarizes the experimental evidence supporting the protective function of non-coding DNA against exogenous nucleic acids. Based on these data, I hypothesize herein about the presence of an additional line of defense formed by small RNAs in the cytosol in addition to their bodyguard protection mechanism in the nucleus. Therefore, exogenous nucleic acids may be initially inactivated in the cytosol by small RNAs generated from non-coding DNA via mechanisms similar to the prokaryotic CRISPR-Cas system. Exogenous nucleic acids may enter the nucleus, where some are absorbed and/or blocked by heterochromatin and others integrate into chromosomes. The integrated fragments and the sites of DNA damage are removed by repetitive non-coding DNA elements in the heterochromatin and excluded from the nucleus. Therefore, the normal eukaryotic genome and the central protein-coding sequences are triply protected by non-coding DNA against invasion by exogenous nucleic acids. This review provides evidence supporting the protective role of non-coding DNA in genome defense. PMID:27036064

  5. Non-coding chloroplast DNA for plant molecular systematics at the infrageneric level.

    PubMed

    Böhle, U R; Hilger, H; Cerff, R; Martin, W F

    1994-01-01

    With primers constructed against highly conserved regions of tRNA genes (trnTUGU, trnLUAA and trnFGAA) in chloroplast DNA, we have amplified two different non-coding spacers and one intron from four species within the genus Echium L. (Boraginaceae) and from two confamilial outgroups. The trnTUGU-trnLUAA intergenic spacer contains a greater number of polymorphic sites than the trnLUAA intron or the trnLUAA-trnFGAA intergenic spacer. We analyzed a total of 11 kb of sequence data from this non-coding DNA. Total nucleotide divergence between Echium species is on the order of 1% for these regions, all of which possess infrageneric length polymorphisms. The latter two regions contain indels which occur only in the 14 Macaronesian Island endemic species of Echium studied and suggest that these may form a monophyletic group. PMID:7994117

  6. Differentiating the Protein Coding and Noncoding RNA Segments of DNA Using Shannon Entropy

    NASA Astrophysics Data System (ADS)

    Mazaheri, P.; Shirazi, A. H.; Saeedi, N.; Reza Jafari, G.; Sahimi, Muhammad

    The complexity of DNA sequences is evaluated in order to differentiate between protein-coding and noncoding RNA segments. The method is based on computing the Shannon entropy of the sequences. By comparing the entropy of the original sequence with that of its shuffled one, we identify the source of the difference between the two segments and their relative contributions to the sequence. To demonstrate the method, the DNA sequences of the bacterium Clostridium difficile 630 (G + C = 29.1%) and Bdellovibrio bacteriovorus (G + C = 50.6%) are analyzed, which are representatives of bacteria with unbalanced and balanced nucleotide content, respectively. It is shown that in both bacteria, regardless of nucleotide content, ΔrS — the relative difference of the two entropies — is significantly greater in protein-coding regions, when compared with noncoding RNA segments.

  7. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  8. Estimation of correlations between copy-number variants in non-coding DNA.

    PubMed

    Stamoulis, Catherine

    2011-01-01

    Allelic DNA aberrations across our genome have been associated with normal human genetic heterogeneity as well as with a number of diseases and disorders. When copy-number variations (CNVs) occur in gene-coding regions, known relationships between genes may help us understand correlations between CNVs. However, a large number of these aberrations occur in non-coding, extragenic regions and their correlations may be characterized only quantitatively, e.g., probabilistically, but not functionally. Using a signal processing approach to CNV detection, we identified distributed CNVs in short, non-coding regions across chromosomes and investigated their potential correlations. We estimated predominantly local correlations between CNVs within the same chromosome, and a small number of apparently random long-distance correlations. PMID:22255599

  9. Fractality and entropic scaling in the chromosomal distribution of conserved noncoding elements in the human genome.

    PubMed

    Polychronopoulos, Dimitris; Athanasopoulou, Labrini; Almirantis, Yannis

    2016-06-15

    Conserved non-coding elements (CNEs) are defined using various degrees of sequence identity and thresholds of minimal length. Their conservation frequently exceeds the one observed for protein-coding sequences. We explored the chromosomal distribution of different classes of CNEs in the human genome. We employed two methodologies: the scaling of block entropy and box-counting, with the aim to assess fractal characteristics of different CNE datasets. Both approaches converged to the conclusion that well-developed fractality is characteristic of elements that are either extremely conserved between species or are of ancient origin, i.e. conserved between distant organisms across evolution. Given that CNEs are often clustered around genes, we verified by appropriate gene masking that fractal-like patterns emerge even when elements found in proximity or inside genes are excluded. An evolutionary scenario is proposed, involving genomic events that might account for fractal distribution of CNEs in the human genome as indicated through numerical simulations. PMID:26899868

  10. Non-Coding RNA: Sequence-Specific Guide for Chromatin Modification and DNA Damage Signaling

    PubMed Central

    Francia, Sofia

    2015-01-01

    Chromatin conformation shapes the environment in which our genome is transcribed into RNA. Transcription is a source of DNA damage, thus it often occurs concomitantly to DNA damage signaling. Growing amounts of evidence suggest that different types of RNAs can, independently from their protein-coding properties, directly affect chromatin conformation, transcription and splicing, as well as promote the activation of the DNA damage response (DDR) and DNA repair. Therefore, transcription paradoxically functions to both threaten and safeguard genome integrity. On the other hand, DNA damage signaling is known to modulate chromatin to suppress transcription of the surrounding genetic unit. It is thus intriguing to understand how transcription can modulate DDR signaling while, in turn, DDR signaling represses transcription of chromatin around the DNA lesion. An unexpected player in this field is the RNA interference (RNAi) machinery, which play roles in transcription, splicing and chromatin modulation in several organisms. Non-coding RNAs (ncRNAs) and several protein factors involved in the RNAi pathway are well known master regulators of chromatin while only recent reports show their involvement in DDR. Here, we discuss the experimental evidence supporting the idea that ncRNAs act at the genomic loci from which they are transcribed to modulate chromatin, DDR signaling and DNA repair. PMID:26617633

  11. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis.

    PubMed

    Shaw, Joey; Lickey, Edgar B; Beck, John T; Farmer, Susan B; Liu, Wusheng; Miller, Jermey; Siripun, Kunsiri C; Winder, Charles T; Schilling, Edward E; Small, Randall L

    2005-01-01

    Chloroplast DNA sequences are a primary source of data for plant molecular systematic studies. A few key papers have provided the molecular systematics community with universal primer pairs for noncoding regions that have dominated the field, namely trnL-trnF and trnK/matK. These two regions have provided adequate information to resolve species relationships in some taxa, but often provide little resolution at low taxonomic levels. To obtain better phylogenetic resolution, sequence data from these regions are often coupled with other sequence data. Choosing an appropriate cpDNA region for phylogenetic investigation is difficult because of the scarcity of information about the tempo of evolutionary rates among different noncoding cpDNA regions. The focus of this investigation was to determine whether there is any predictable rate heterogeneity among 21 noncoding cpDNA regions identified as phylogenetically useful at low levels. To test for rate heterogeneity among the different cpDNA regions, we used three species from each of 10 groups representing eight major phylogenetic lineages of phanerogams. The results of this study clearly show that a survey using as few as three representative taxa can be predictive of the amount of phylogenetic information offered by a cpDNA region and that rate heterogeneity exists among noncoding cpDNA regions. PMID:21652394

  12. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silencing in the C. elegans Germline.

    PubMed

    Frøkjær-Jensen, Christian; Jain, Nimit; Hansen, Loren; Davis, M Wayne; Li, Yongbin; Zhao, Di; Rebora, Karine; Millet, Jonathan R M; Liu, Xiao; Kim, Stuart K; Dupuy, Denis; Jorgensen, Erik M; Fire, Andrew Z

    2016-07-14

    Cells benefit from silencing foreign genetic elements but must simultaneously avoid inactivating endogenous genes. Although chromatin modifications and RNAs contribute to maintenance of silenced states, the establishment of silenced regions will inevitably reflect underlying DNA sequence and/or structure. Here, we demonstrate that a pervasive non-coding DNA feature in Caenorhabditis elegans, characterized by 10-base pair periodic An/Tn-clusters (PATCs), can license transgenes for germline expression within repressive chromatin domains. Transgenes containing natural or synthetic PATCs are resistant to position effect variegation and stochastic silencing in the germline. Among endogenous genes, intron length and PATC-character undergo dramatic changes as orthologs move from active to repressive chromatin over evolutionary time, indicating a dynamic character to the An/Tn periodicity. We propose that PATCs form the basis of a cellular immune system, identifying certain endogenous genes in heterochromatic contexts as privileged while foreign DNA can be suppressed with no requirement for a cellular memory of prior exposure. PMID:27374334

  13. MEG3 long noncoding RNA regulates the TGF-β pathway genes through formation of RNA-DNA triplex structures.

    PubMed

    Mondal, Tanmoy; Subhash, Santhilal; Vaid, Roshan; Enroth, Stefan; Uday, Sireesha; Reinius, Björn; Mitra, Sanhita; Mohammed, Arif; James, Alva Rani; Hoberg, Emily; Moustakas, Aristidis; Gyllensten, Ulf; Jones, Steven J M; Gustafsson, Claes M; Sims, Andrew H; Westerlund, Fredrik; Gorab, Eduardo; Kanduri, Chandrasekhar

    2015-01-01

    Long noncoding RNAs (lncRNAs) regulate gene expression by association with chromatin, but how they target chromatin remains poorly understood. We have used chromatin RNA immunoprecipitation-coupled high-throughput sequencing to identify 276 lncRNAs enriched in repressive chromatin from breast cancer cells. Using one of the chromatin-interacting lncRNAs, MEG3, we explore the mechanisms by which lncRNAs target chromatin. Here we show that MEG3 and EZH2 share common target genes, including the TGF-β pathway genes. Genome-wide mapping of MEG3 binding sites reveals that MEG3 modulates the activity of TGF-β genes by binding to distal regulatory elements. MEG3 binding sites have GA-rich sequences, which guide MEG3 to the chromatin through RNA-DNA triplex formation. We have found that RNA-DNA triplex structures are widespread and are present over the MEG3 binding sites associated with the TGF-β pathway genes. Our findings suggest that RNA-DNA triplex formation could be a general characteristic of target gene recognition by the chromatin-interacting lncRNAs. PMID:26205790

  14. MEG3 long noncoding RNA regulates the TGF-β pathway genes through formation of RNA–DNA triplex structures

    PubMed Central

    Mondal, Tanmoy; Subhash, Santhilal; Vaid, Roshan; Enroth, Stefan; Uday, Sireesha; Reinius, Björn; Mitra, Sanhita; Mohammed, Arif; James, Alva Rani; Hoberg, Emily; Moustakas, Aristidis; Gyllensten, Ulf; Jones, Steven J.M.; Gustafsson, Claes M; Sims, Andrew H; Westerlund, Fredrik; Gorab, Eduardo; Kanduri, Chandrasekhar

    2015-01-01

    Long noncoding RNAs (lncRNAs) regulate gene expression by association with chromatin, but how they target chromatin remains poorly understood. We have used chromatin RNA immunoprecipitation-coupled high-throughput sequencing to identify 276 lncRNAs enriched in repressive chromatin from breast cancer cells. Using one of the chromatin-interacting lncRNAs, MEG3, we explore the mechanisms by which lncRNAs target chromatin. Here we show that MEG3 and EZH2 share common target genes, including the TGF-β pathway genes. Genome-wide mapping of MEG3 binding sites reveals that MEG3 modulates the activity of TGF-β genes by binding to distal regulatory elements. MEG3 binding sites have GA-rich sequences, which guide MEG3 to the chromatin through RNA–DNA triplex formation. We have found that RNA–DNA triplex structures are widespread and are present over the MEG3 binding sites associated with the TGF-β pathway genes. Our findings suggest that RNA–DNA triplex formation could be a general characteristic of target gene recognition by the chromatin-interacting lncRNAs. PMID:26205790

  15. Multifractal detrended cross-correlation analysis of coding and non-coding DNA sequences through chaos-game representation

    NASA Astrophysics Data System (ADS)

    Pal, Mayukha; Satish, B.; Srinivas, K.; Rao, P. Madhusudana; Manimaran, P.

    2015-10-01

    We propose a new approach combining the chaos game representation and the two dimensional multifractal detrended cross correlation analysis methods to examine multifractal behavior in power law cross correlation between any pair of nucleotide sequences of unequal lengths. In this work, we analyzed the characteristic behavior of coding and non-coding DNA sequences of eight prokaryotes. The results show the presence of strong multifractal nature between coding and non-coding sequences of all data sets. We found that this integrative approach helps us to consider complete DNA sequences for characterization, and further it may be useful for classification, clustering, identification of class affiliation of nucleotide sequences etc. with high precision.

  16. Transposable Elements: From DNA Parasites to Architects of Metazoan Evolution

    PubMed Central

    Piskurek, Oliver; Jackson, Daniel J.

    2012-01-01

    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty. PMID:24704977

  17. The dark matter of the cancer genome: aberrations in regulatory elements, untranslated regions, splice sites, non-coding RNA and synonymous mutations.

    PubMed

    Diederichs, Sven; Bartsch, Lorenz; Berkmann, Julia C; Fröse, Karin; Heitmann, Jana; Hoppe, Caroline; Iggena, Deetje; Jazmati, Danny; Karschnia, Philipp; Linsenmeier, Miriam; Maulhardt, Thomas; Möhrmann, Lino; Morstein, Johannes; Paffenholz, Stella V; Röpenack, Paula; Rückert, Timo; Sandig, Ludger; Schell, Maximilian; Steinmann, Anna; Voss, Gjendine; Wasmuth, Jacqueline; Weinberger, Maria E; Wullenkord, Ramona

    2016-01-01

    Cancer is a disease of the genome caused by oncogene activation and tumor suppressor gene inhibition. Deep sequencing studies including large consortia such as TCGA and ICGC identified numerous tumor-specific mutations not only in protein-coding sequences but also in non-coding sequences. Although 98% of the genome is not translated into proteins, most studies have neglected the information hidden in this "dark matter" of the genome. Malignancy-driving mutations can occur in all genetic elements outside the coding region, namely in enhancer, silencer, insulator, and promoter as well as in 5'-UTR and 3'-UTR Intron or splice site mutations can alter the splicing pattern. Moreover, cancer genomes contain mutations within non-coding RNA, such as microRNA, lncRNA, and lincRNA A synonymous mutation changes the coding region in the DNA and RNA but not the protein sequence. Importantly, oncogenes such as TERT or miR-21 as well as tumor suppressor genes such as TP53/p53, APC, BRCA1, or RB1 can be affected by these alterations. In summary, coding-independent mutations can affect gene regulation from transcription, splicing, mRNA stability to translation, and hence, this largely neglected area needs functional studies to elucidate the mechanisms underlying tumorigenesis. This review will focus on the important role and novel mechanisms of these non-coding or allegedly silent mutations in tumorigenesis. PMID:26992833

  18. Genetic evidence for conserved non-coding element function across species–the ears have it

    PubMed Central

    Turner, Eric E.; Cox, Timothy C.

    2014-01-01

    Comparison of genomic sequences from diverse vertebrate species has revealed numerous highly conserved regions that do not appear to encode proteins or functional RNAs. Often these “conserved non-coding elements,” or CNEs, can direct gene expression to specific tissues in transgenic models, demonstrating they have regulatory function. CNEs are frequently found near “developmental” genes, particularly transcription factors, implying that these elements have essential regulatory roles in development. However, actual examples demonstrating CNE regulatory functions across species have been few, and recent loss-of-function studies of several CNEs in mice have shown relatively minor effects. In this Perspectives article, we discuss new findings in “fancy” rats and Highland cattle demonstrating that function of a CNE near the Hmx1 gene is crucial for normal external ear development and when disrupted can mimic loss-of function Hmx1 coding mutations in mice and humans. These findings provide important support for conserved developmental roles of CNEs in divergent species, and reinforce the concept that CNEs should be examined systematically in the ongoing search for genetic causes of human developmental disorders in the era of genome-scale sequencing. PMID:24478720

  19. DNA methylation signatures of long intergenic noncoding RNAs in porcine adipose and muscle tissues

    PubMed Central

    Zhou, Zhong-Yin; Li, Aimin; Wang, Li-Gang; Irwin, David M; Liu, Yan-Hu; Xu, Dan; Han, Xu-Man; Wang, Lu; Wu, Shi-Fang; Wang, Li-Xian; Xie, Hai-Bing; Zhang, Ya-Ping

    2015-01-01

    Long intergenic noncoding RNAs (lincRNAs) are one of the major unexplored components of genomes. Here we re-analyzed a published methylated DNA immunoprecipitation sequencing (MeDIP-seq) dataset to characterize the DNA methylation pattern of pig lincRNA genes in adipose and muscle tissues. Our study showed that the methylation level of lincRNA genes was higher than that of mRNA genes, with similar trends observed in comparisons of the promoter, exon or intron regions. Different methylation pattern were observed across the transcription start sites (TSS) of lincRNA and protein-coding genes. Furthermore, an overlap was observed between many lincRNA genes and differentially methylated regions (DMRs) identified among different breeds of pigs, which show different fat contents, sexes and anatomic locations of tissues. We identify a lincRNA gene, linc-sscg3623, that displayed differential methylation levels in backfat between Min and Large White pigs at 60 and 120 days of age. We found that a demethylation process occurred between days 150 and 180 in the Min and Large White pigs, which was followed by remethylation between days 180 and 210. These results contribute to our understanding of the domestication of domestic animals and identify lincRNA genes involved in adipogenesis and muscle development. PMID:26493951

  20. DNA methylation signatures of long intergenic noncoding RNAs in porcine adipose and muscle tissues.

    PubMed

    Zhou, Zhong-Yin; Li, Aimin; Wang, Li-Gang; Irwin, David M; Liu, Yan-Hu; Xu, Dan; Han, Xu-Man; Wang, Lu; Wu, Shi-Fang; Wang, Li-Xian; Xie, Hai-Bing; Zhang, Ya-Ping

    2015-01-01

    Long intergenic noncoding RNAs (lincRNAs) are one of the major unexplored components of genomes. Here we re-analyzed a published methylated DNA immunoprecipitation sequencing (MeDIP-seq) dataset to characterize the DNA methylation pattern of pig lincRNA genes in adipose and muscle tissues. Our study showed that the methylation level of lincRNA genes was higher than that of mRNA genes, with similar trends observed in comparisons of the promoter, exon or intron regions. Different methylation pattern were observed across the transcription start sites (TSS) of lincRNA and protein-coding genes. Furthermore, an overlap was observed between many lincRNA genes and differentially methylated regions (DMRs) identified among different breeds of pigs, which show different fat contents, sexes and anatomic locations of tissues. We identify a lincRNA gene, linc-sscg3623, that displayed differential methylation levels in backfat between Min and Large White pigs at 60 and 120 days of age. We found that a demethylation process occurred between days 150 and 180 in the Min and Large White pigs, which was followed by remethylation between days 180 and 210. These results contribute to our understanding of the domestication of domestic animals and identify lincRNA genes involved in adipogenesis and muscle development. PMID:26493951

  1. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

    2014-01-01

    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  2. Transposable Element Insertions in Long Intergenic Non-Coding RNA Genes

    PubMed Central

    Kannan, Sivakumar; Chernikova, Diana; Rogozin, Igor B.; Poliakov, Eugenia; Managadze, David; Koonin, Eugene V.; Milanesi, Luciano

    2015-01-01

    Transposable elements (TEs) are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA) genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences (TES), followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TES in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the repeat insertion domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and, in particular, fast functional diversification, of lincRNA genes. PMID:26106594

  3. Oncogene regulation. An oncogenic super-enhancer formed through somatic mutation of a noncoding intergenic element.

    PubMed

    Mansour, Marc R; Abraham, Brian J; Anders, Lars; Berezovskaya, Alla; Gutierrez, Alejandro; Durbin, Adam D; Etchin, Julia; Lawton, Lee; Sallan, Stephen E; Silverman, Lewis B; Loh, Mignon L; Hunger, Stephen P; Sanda, Takaomi; Young, Richard A; Look, A Thomas

    2014-12-12

    In certain human cancers, the expression of critical oncogenes is driven from large regulatory elements, called super-enhancers, that recruit much of the cell's transcriptional apparatus and are defined by extensive acetylation of histone H3 lysine 27 (H3K27ac). In a subset of T-cell acute lymphoblastic leukemia (T-ALL) cases, we found that heterozygous somatic mutations are acquired that introduce binding motifs for the MYB transcription factor in a precise noncoding site, which creates a super-enhancer upstream of the TAL1 oncogene. MYB binds to this new site and recruits its H3K27 acetylase-binding partner CBP, as well as core components of a major leukemogenic transcriptional complex that contains RUNX1, GATA-3, and TAL1 itself. Additionally, most endogenous super-enhancers found in T-ALL cells are occupied by MYB and CBP, which suggests a general role for MYB in super-enhancer initiation. Thus, this study identifies a genetic mechanism responsible for the generation of oncogenic super-enhancers in malignant cells. PMID:25394790

  4. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements.

    PubMed

    Guturu, Harendra; Doxey, Andrew C; Wenger, Aaron M; Bejerano, Gill

    2013-12-19

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and 'through-DNA' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex. PMID:24218641

  5. Gammaherpesvirus Small Noncoding RNAs Are Bifunctional Elements That Regulate Infection and Contribute to Virulence In Vivo

    PubMed Central

    Diebel, Kevin W.; Oko, Lauren M.; Medina, Eva M.; Niemeyer, Brian F.; Warren, Cody J.; Claypool, David J.; Tibbetts, Scott A.; Cool, Carlyne D.; Clambey, Eric T.

    2015-01-01

    ABSTRACT Many viruses express noncoding RNAs (ncRNAs). The gammaherpesviruses (γHVs), including Epstein-Barr virus, Kaposi’s sarcoma-associated herpesvirus, and murine γHV68, each contain multiple ncRNA genes, including microRNAs (miRNAs). While these ncRNAs can regulate multiple host and viral processes in vitro, the genetic contribution of these RNAs to infection and pathogenesis remains largely unknown. To study the functional contribution of these RNAs to γHV infection, we have used γHV68, a small-animal model of γHV pathogenesis. γHV68 encodes eight small hybrid ncRNAs that contain both tRNA-like elements and functional miRNAs. These genes are transcribed by RNA polymerase III and are referred to as the γHV68 TMERs (tRNA-miRNA-encoded RNAs). To determine the total concerted genetic contribution of these ncRNAs to γHV acute infection and pathogenesis, we generated and characterized a recombinant γHV68 strain devoid of all eight TMERs. TMER-deficient γHV68 has wild-type levels of lytic replication in vitro and normal establishment of latency in B cells early following acute infection in vivo. In contrast, during acute infection of immunodeficient mice, TMER-deficient γHV68 has reduced virulence in a model of viral pneumonia, despite having an enhanced frequency of virus-infected cells. Strikingly, expression of a single viral tRNA-like molecule, in the absence of all other virus-encoded TMERs and miRNAs, reverses both attenuation in virulence and enhanced frequency of infected cells. These data show that γHV ncRNAs play critical roles in acute infection and virulence in immunocompromised hosts and identify these RNAs as a new potential target to modulate γHV-induced infection and pathogenesis. PMID:25691585

  6. Expression and functional role of a transcribed noncoding RNA with an ultraconserved element in hepatocellular carcinoma.

    PubMed

    Braconi, Chiara; Valeri, Nicola; Kogure, Takayuki; Gasparini, Pierluigi; Huang, Nianyuan; Nuovo, Gerard J; Terracciano, Luigi; Croce, Carlo M; Patel, Tushar

    2011-01-11

    Although expression of non-protein-coding RNA (ncRNA) can be altered in human cancers, their functional relevance is unknown. Ultraconserved regions are noncoding genomic segments that are 100% conserved across humans, mice, and rats. Conservation of gene sequences across species may indicate an essential functional role, and therefore we evaluated the expression of ultraconserved RNAs (ucRNA) in hepatocellular cancer (HCC). The global expression of ucRNAs was analyzed with a custom microarray. Expression was verified in cell lines by real-time PCR or in tissues by in situ hybridization using tissue microarrays. Cellular ucRNA expression was modulated with siRNAs, and the effects on global gene expression and growth of human and murine HCC cells were evaluated. Fifty-six ucRNAs were aberrantly expressed in HepG2 cells compared with nonmalignant hepatocytes. Among these ucRNAs, the greatest change was noted for ultraconserved element 338 (uc.338), which was dramatically increased in human HCC compared with noncancerous adjacent tissues. Although uc.338 is partially located within the poly(rC) binding protein 2 (PCBP2) gene, the transcribed ncRNA encoding uc.338 is expressed independently of PCBP2 and was cloned as a 590-bp RNA gene, termed TUC338. Functional gene annotation analysis indicated predominant effects on genes involved in cell growth. These effects were experimentally demonstrated in both human and murine cells. siRNA to TUC338 decreased both anchorage-dependent and anchorage-independent growth of HCC cells. These studies identify a critical role for TUC338 in regulation of transformed cell growth and of transcribed ultraconserved ncRNA as a unique class of genes involved in the pathobiology of HCC. PMID:21187392

  7. Expression and functional role of a transcribed noncoding RNA with an ultraconserved element in hepatocellular carcinoma

    PubMed Central

    Braconi, Chiara; Valeri, Nicola; Kogure, Takayuki; Gasparini, Pierluigi; Huang, Nianyuan; Nuovo, Gerard J.; Terracciano, Luigi; Croce, Carlo M.; Patel, Tushar

    2011-01-01

    Although expression of non–protein-coding RNA (ncRNA) can be altered in human cancers, their functional relevance is unknown. Ultraconserved regions are noncoding genomic segments that are 100% conserved across humans, mice, and rats. Conservation of gene sequences across species may indicate an essential functional role, and therefore we evaluated the expression of ultraconserved RNAs (ucRNA) in hepatocellular cancer (HCC). The global expression of ucRNAs was analyzed with a custom microarray. Expression was verified in cell lines by real-time PCR or in tissues by in situ hybridization using tissue microarrays. Cellular ucRNA expression was modulated with siRNAs, and the effects on global gene expression and growth of human and murine HCC cells were evaluated. Fifty-six ucRNAs were aberrantly expressed in HepG2 cells compared with nonmalignant hepatocytes. Among these ucRNAs, the greatest change was noted for ultraconserved element 338 (uc.338), which was dramatically increased in human HCC compared with noncancerous adjacent tissues. Although uc.338 is partially located within the poly(rC) binding protein 2 (PCBP2) gene, the transcribed ncRNA encoding uc.338 is expressed independently of PCBP2 and was cloned as a 590-bp RNA gene, termed TUC338. Functional gene annotation analysis indicated predominant effects on genes involved in cell growth. These effects were experimentally demonstrated in both human and murine cells. siRNA to TUC338 decreased both anchorage-dependent and anchorage-independent growth of HCC cells. These studies identify a critical role for TUC338 in regulation of transformed cell growth and of transcribed ultraconserved ncRNA as a unique class of genes involved in the pathobiology of HCC. PMID:21187392

  8. Segmentation of DNA into Coding and Noncoding Regions Based on Recursive Entropic Segmentation and Stop-Codon Statistics

    NASA Astrophysics Data System (ADS)

    Nicorici, Daniel; Astola, Jaakko

    2004-12-01

    Heterogeneous DNA sequences can be partitioned into homogeneous domains that are comprised of the four nucleotides A, C, G, and T and the stop-codons. Recursively, we apply a new entropic segmentation method on DNA sequences using Jensen-Shannon and Jensen-Rényi divergences in order to find the borders between coding and noncoding DNA regions. We have chosen 12- and 18-symbol alphabets that capture (i) the differential nucleotide composition in codons, and (ii) the differential stop-codon composition along all the three phases in both strands of the DNA. The new segmentation method is based on the Jensen-Rényi divergence measure, nucleotide statistics, and stop-codon statistics in both DNA strands. The recursive segmentation process requires no prior training on known datasets. Consequently, for three entire genomes of bacteria, we find that the use of nucleotide composition, stop-codon composition, and Jensen-Rényi divergence improve the accuracy of finding the borders between coding and noncoding regions in DNA sequences.

  9. Defining functional DNA elements in the human genome

    PubMed Central

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  10. [Comparison study on the methods for finding borders between coding and non-coding DNA regions in rice].

    PubMed

    Sun, Yi-Gang; Gao, Lei; Zhang, Zhong-Hua; Xue, Qing-Zhong

    2005-07-01

    Entropy-based divergence measures have provided an impelling tool in evaluating sequence complexity, predicting CpG island, and detecting borders between coding and non-coding DNA regions etc. In this paper, two new divergence measures: the alpha-KL divergence and the alpha-Jensen-Shannon divergence were defined and a coarse-graining vector of amino acids- corresponding codons was proposed according to codons GC-content, in order to improve the computational approach to finding borders between coding and non-coding in rice. A comparison of the accuracies gained by different vectors (the Jensen-Shannon divergence, the Jensen-Renyi divergence, the alpha-KL divergence and the alpha-Jensen -Shannon divergence) showed that recognition efficiency based on the new information measures with the vector coarse-graining increase by 4-5 times than that of Bernaola's method in the 'stop codon' of coding regions in rice. PMID:16120591

  11. BioCode: Two biologically compatible Algorithms for embedding data in non-coding and coding regions of DNA

    PubMed Central

    2013-01-01

    Background In recent times, the application of deoxyribonucleic acid (DNA) has diversified with the emergence of fields such as DNA computing and DNA data embedding. DNA data embedding, also known as DNA watermarking or DNA steganography, aims to develop robust algorithms for encoding non-genetic information in DNA. Inherently DNA is a digital medium whereby the nucleotide bases act as digital symbols, a fact which underpins all bioinformatics techniques, and which also makes trivial information encoding using DNA straightforward. However, the situation is more complex in methods which aim at embedding information in the genomes of living organisms. DNA is susceptible to mutations, which act as a noisy channel from the point of view of information encoded using DNA. This means that the DNA data embedding field is closely related to digital communications. Moreover it is a particularly unique digital communications area, because important biological constraints must be observed by all methods. Many DNA data embedding algorithms have been presented to date, all of which operate in one of two regions: non-coding DNA (ncDNA) or protein-coding DNA (pcDNA). Results This paper proposes two novel DNA data embedding algorithms jointly called BioCode, which operate in ncDNA and pcDNA, respectively, and which comply fully with stricter biological restrictions. Existing methods comply with some elementary biological constraints, such as preserving protein translation in pcDNA. However there exist further biological restrictions which no DNA data embedding methods to date account for. Observing these constraints is key to increasing the biocompatibility and in turn, the robustness of information encoded in DNA. Conclusion The algorithms encode information in near optimal ways from a coding point of view, as we demonstrate by means of theoretical and empirical (in silico) analyses. Also, they are shown to encode information in a robust way, such that mutations have isolated

  12. DNA sequence variation in a non-coding region of low recombination on the human X chromosome.

    PubMed

    Kaessmann, H; Heissig, F; von Haeseler, A; Pääbo, S

    1999-05-01

    DNA sequence variation has become a major source of insight regarding the origin and history of our species as well as an important tool for the identification of allelic variants associated with disease. Comparative sequencing of DNA has to date focused mainly on mitochondrial (mt) DNA, which due to its apparent lack of recombination and high evolutionary rate lends itself well to the study of human evolution. These advantages also entail limitations. For example, the high mutation rate of mtDNA results in multiple substitutions that make phylogenetic analysis difficult and, because mtDNA is maternally inherited, it reflects only the history of females. For the history of males, the non-recombining part of the paternally inherited Y chromosome can be studied. The extent of variation on the Y chromosome is so low that variation at particular sites known to be polymorphic rather than entire sequences are typically determined. It is currently unclear how some forms of analysis (such as the coalescent) should be applied to such data. Furthermore, the lack of recombination means that selection at any locus affects all 59 Mb of DNA. To gauge the extent and pattern of point substitutional variation in non-coding parts of the human genome, we have sequenced 10 kb of non-coding DNA in a region of low recombination at Xq13.3. Analysis of this sequence in 69 individuals representing all major linguistic groups reveals the highest overall diversity in Africa, whereas deep divergences also exist in Asia. The time elapsed since the most recent common ancestor (MRCA) is 535,000+/-119,000 years. We expect this type of nuclear locus to provide more answers about the genetic origin and history of humans. PMID:10319866

  13. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De

    2015-01-01

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  14. DNA methylation patterns of protein-coding genes and long non-coding RNAs in males with schizophrenia

    PubMed Central

    LIAO, QI; WANG, YUNLIANG; CHENG, JIA; DAI, DONGJUN; ZHOU, XINGYU; ZHANG, YUZHENG; LI, JINFENG; YIN, HONGLEI; GAO, SHUGUI; DUAN, SHIWEI

    2015-01-01

    Schizophrenia (SCZ) is one of the most complex mental illnesses affecting ~1% of the population worldwide. SCZ pathogenesis is considered to be a result of genetic as well as epigenetic alterations. Previous studies have aimed to identify the causative genes of SCZ. However, DNA methylation of long non-coding RNAs (lncRNAs) involved in SCZ has not been fully elucidated. In the present study, a comprehensive genome-wide analysis of DNA methylation was conducted using samples from two male patients with paranoid and undifferentiated SCZ, respectively. Methyl-CpG binding domain protein-enriched genome sequencing was used. In the two patients with paranoid and undifferentiated SCZ, 1,397 and 1,437 peaks were identified, respectively. Bioinformatic analysis demonstrated that peaks were enriched in protein-coding genes, which exhibited nervous system and brain functions. A number of these peaks in gene promoter regions may affect gene expression and, therefore, influence SCZ-associated pathways. Furthermore, 7 and 20 lncRNAs, respectively, in the Refseq database were hypermethylated. According to the lncRNA dataset in the NONCODE database, ~30% of intergenic peaks overlapped with novel lncRNA loci. The results of the present study demonstrated that aberrant hypermethylation of lncRNA genes may be an important epigenetic factor associated with SCZ. However, further studies using larger sample sizes are required. PMID:26503909

  15. The non-coding B2 RNA binds to the DNA cleft and active-site region of RNA polymerase II.

    PubMed

    Ponicsan, Steven L; Houel, Stephane; Old, William M; Ahn, Natalie G; Goodrich, James A; Kugel, Jennifer F

    2013-10-01

    The B2 family of short interspersed elements is transcribed into non-coding RNA by RNA polymerase III. The ~180-nt B2 RNA has been shown to potently repress mRNA transcription by binding tightly to RNA polymerase II (Pol II) and assembling with it into complexes on promoter DNA, where it keeps the polymerase from properly engaging the promoter DNA. Mammalian Pol II is an ~500-kDa complex that contains 12 different protein subunits, providing many possible surfaces for interaction with B2 RNA. We found that the carboxy-terminal domain of the largest Pol II subunit was not required for B2 RNA to bind Pol II and repress transcription in vitro. To identify the surface on Pol II to which the minimal functional region of B2 RNA binds, we coupled multi-step affinity purification, reversible formaldehyde cross-linking, peptide sequencing by mass spectrometry, and analysis of peptide enrichment. The Pol II peptides most highly recovered after cross-linking to B2 RNA mapped to the DNA binding cleft and active-site region of Pol II. These studies determine the location of a defined nucleic acid binding site on a large, native, multi-subunit complex and provide insight into the mechanism of transcriptional repression by B2 RNA. PMID:23416138

  16. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    PubMed Central

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong

    2015-01-01

    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity. PMID:26472689

  17. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    NASA Astrophysics Data System (ADS)

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong

    2015-10-01

    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity.

  18. Differential DNA methylation profiles of coding and non-coding genes define hippocampal sclerosis in human temporal lobe epilepsy

    PubMed Central

    Miller-Delaney, Suzanne F.C.; Bryan, Kenneth; Das, Sudipto; McKiernan, Ross C.; Bray, Isabella M.; Reynolds, James P.; Gwinn, Ryder; Stallings, Raymond L.

    2015-01-01

    Temporal lobe epilepsy is associated with large-scale, wide-ranging changes in gene expression in the hippocampus. Epigenetic changes to DNA are attractive mechanisms to explain the sustained hyperexcitability of chronic epilepsy. Here, through methylation analysis of all annotated C-phosphate-G islands and promoter regions in the human genome, we report a pilot study of the methylation profiles of temporal lobe epilepsy with or without hippocampal sclerosis. Furthermore, by comparative analysis of expression and promoter methylation, we identify methylation sensitive non-coding RNA in human temporal lobe epilepsy. A total of 146 protein-coding genes exhibited altered DNA methylation in temporal lobe epilepsy hippocampus (n = 9) when compared to control (n = 5), with 81.5% of the promoters of these genes displaying hypermethylation. Unique methylation profiles were evident in temporal lobe epilepsy with or without hippocampal sclerosis, in addition to a common methylation profile regardless of pathology grade. Gene ontology terms associated with development, neuron remodelling and neuron maturation were over-represented in the methylation profile of Watson Grade 1 samples (mild hippocampal sclerosis). In addition to genes associated with neuronal, neurotransmitter/synaptic transmission and cell death functions, differential hypermethylation of genes associated with transcriptional regulation was evident in temporal lobe epilepsy, but overall few genes previously associated with epilepsy were among the differentially methylated. Finally, a panel of 13, methylation-sensitive microRNA were identified in temporal lobe epilepsy including MIR27A, miR-193a-5p (MIR193A) and miR-876-3p (MIR876), and the differential methylation of long non-coding RNA documented for the first time. The present study therefore reports select, genome-wide DNA methylation changes in human temporal lobe epilepsy that may contribute to the molecular architecture of the epileptic brain. PMID

  19. A novel non-coding RNA lncRNA-JADE connects DNA damage signalling to histone H4 acetylation

    PubMed Central

    Wan, Guohui; Hu, Xiaoxiao; Liu, Yunhua; Han, Cecil; Sood, Anil K; Calin, George A; Zhang, Xinna; Lu, Xiongbin

    2013-01-01

    A prompt and efficient DNA damage response (DDR) eliminates the detrimental effects of DNA lesions in eukaryotic cells. Basic and preclinical studies suggest that the DDR is one of the primary anti-cancer barriers during tumorigenesis. The DDR involves a complex network of processes that detect and repair DNA damage, in which long non-coding RNAs (lncRNAs), a new class of regulatory RNAs, may play an important role. In the current study, we identified a novel lncRNA, lncRNA-JADE, that is induced after DNA damage in an ataxia-telangiectasia mutated (ATM)-dependent manner. LncRNA-JADE transcriptionally activates Jade1, a key component in the HBO1 (human acetylase binding to ORC1) histone acetylation complex. Consequently, lncRNA-JADE induces histone H4 acetylation in the DDR. Markedly higher levels of lncRNA-JADE were observed in human breast tumours in comparison with normal breast tissues. Knockdown of lncRNA-JADE significantly inhibited breast tumour growth in vivo. On the basis of these results, we propose that lncRNA-JADE is a key functional link that connects the DDR to histone H4 acetylation, and that dysregulation of lncRNA-JADE may contribute to breast tumorigenesis. PMID:24097061

  20. Conformational diversity of single-stranded DNA from bacterial repetitive extragenic palindromes: Implications for the DNA recognition elements of transposases.

    PubMed

    Charnavets, Tatsiana; Nunvar, Jaroslav; Nečasová, Iva; Völker, Jens; Breslauer, Kenneth J; Schneider, Bohdan

    2015-10-01

    Repetitive extragenic palindrome (REP)-associated tyrosine transposase enzymes (RAYTs) bind REP DNA domains and catalyze their cleavage. Genomic sequence analyses identify potential noncoding REP sequences associated with RAYT-encoding genes. To probe the conformational space of potential RAYT DNA binding domains, we report here spectroscopic and calorimetric measurements that detect and partially characterize the solution conformational heterogeneity of REP oligonucleotides from six bacterial species. Our data reveal most of these REP oligonucleotides adopt multiple conformations, suggesting that RAYTs confront a landscape of potential DNA substrates in dynamic equilibrium that could be selected, enriched, and/or induced via differential binding. Thus, the transposase-bound DNA motif may not be the predominant conformation of the isolated REP domain. Intriguingly, for several REPs, the circular dichroism spectra suggest guanine tetraplexes as potential alternative or additional RAYT recognition elements, an observation consistent with these REP domains being highly nonrandom, with tetraplex-favoring 5'-G and 3'-C-rich segments. In fact, the conformational heterogeneity of REP domains detected and reported here, including the formation of noncanonical DNA secondary structures, may reflect a general feature required for recognition by RAYT transposases. Based on our biophysical data, we propose guanine tetraplexes as an additional DNA recognition element for binding by RAYT transposase enzymes. PMID:25951997

  1. A strand-specific switch in noncoding transcription switches the function of a Polycomb/Trithorax response element

    PubMed Central

    Trupke, Johanna; Okulski, Helena; Altmutter, Christina; Ruge, Frank; Boidol, Bernd; Kubicek, Stefan; Schmauss, Gerald; Aumayr, Karin; Ruf, Marius; Pospisilik, Andrew; Dimond, Andrew; Senergin, Hasene Basak; Vargas, Marcus L.; Simon, Jeffrey A.; Ringrose, Leonie

    2014-01-01

    Polycomb/Trithorax response elements (PRE/TREs) can switch their function reversibly between silencing and activation, by mechanisms that are poorly understood. Here we show that a switch in forward and reverse noncoding transcription from the Drosophila vestigial (vg) PRE/TRE switches the status of the element between silencing (induced by the forward strand) and activation (induced by the reverse strand). In vitro, both ncRNAs inhibit PRC2 histone methyltransferase activity, but in vivo only the reverse strand binds PRC2. Over-expression of the reverse strand evicts PRC2 from chromatin and inhibits its enzymatic activity. We propose that interactions of RNAs with PRC2 are differentially regulated in vivo, allowing regulated inhibition of local PRC2 activity. Genome-wide analysis shows that strand switching of ncRNAs occurs at several hundred PcG binding sites in fly and vertebrate genomes. This work identifies a novel and potentially widespread class of PRE/TREs that switch function by switching the direction of ncRNA transcription. PMID:25108384

  2. Natural Selection on Coding and Noncoding DNA Sequences Is Associated with Virulence Genes in a Plant Pathogenic Fungus

    PubMed Central

    Rech, Gabriel E.; Sanz-Martín, José M.; Anisimova, Maria; Sukno, Serenella A.; Thon, Michael R.

    2014-01-01

    Natural selection leaves imprints on DNA, offering the opportunity to identify functionally important regions of the genome. Identifying the genomic regions affected by natural selection within pathogens can aid in the pursuit of effective strategies to control diseases. In this study, we analyzed genome-wide patterns of selection acting on different classes of sequences in a worldwide sample of eight strains of the model plant-pathogenic fungus Colletotrichum graminicola. We found evidence of selective sweeps, balancing selection, and positive selection affecting both protein-coding and noncoding DNA of pathogenicity-related sequences. Genes encoding putative effector proteins and secondary metabolite biosynthetic enzymes show evidence of positive selection acting on the coding sequence, consistent with an Arms Race model of evolution. The 5′ untranslated regions (UTRs) of genes coding for effector proteins and genes upregulated during infection show an excess of high-frequency polymorphisms likely the consequence of balancing selection and consistent with the Red Queen hypothesis of evolution acting on these putative regulatory sequences. Based on the findings of this work, we propose that even though adaptive substitutions on coding sequences are important for proteins that interact directly with the host, polymorphisms in the regulatory sequences may confer flexibility of gene expression in the virulence processes of this important plant pathogen. PMID:25193312

  3. Biological function of Foot-and-mouth disease virus non-structural proteins and non-coding elements.

    PubMed

    Gao, Yuan; Sun, Shi-Qi; Guo, Hui-Chen

    2016-01-01

    Foot-and-mouth disease virus (FMDV) represses host translation machinery, blocks protein secretion, and cleaves cellular proteins associated with signal transduction and the innate immune response to infection. Non-structural proteins (NSPs) and non-coding elements (NCEs) of FMDV play a critical role in these biological processes. The FMDV virion consists of capsid and nucleic acid. The virus genome is a positive single stranded RNA and encodes a single long open reading frame (ORF) flanked by a long structured 5'-untranslated region (5'-UTR) and a short 3'-UTR. The ORF is translated into a polypeptide chain and processed into four structural proteins (VP1, VP2, VP3, and VP4), 10 NSPs (L(pro), 2A, 2B, 2C, 3A, 3B1-3, 3C(pro), and 3D(pol)), and some cleavage intermediates. In the past decade, an increasing number of studies have begun to focus on the molecular pathogenesis of FMDV NSPs and NCEs. This review collected recent research progress on the biological functions of these NSPs and NCEs on the replication and host cellular regulation of FMDV to understand the molecular mechanism of host-FMDV interactions and provide perspectives for antiviral strategy and development of novel vaccines. PMID:27334704

  4. Non-coding RNA generated following lariat-debranching mediates targeting of AID to DNA

    PubMed Central

    Zheng, Simin; Vuong, Bao Q.; Vaidyanathan, Bharat; Lin, Jia-Yu; Huang, Feng-Ting; Chaudhuri, Jayanta

    2015-01-01

    SUMMARY Transcription through immunoglobulin switch (S) regions is essential for class switch recombination (CSR) but no molecular function of the transcripts has been described. Likewise, recruitment of activation-induced cytidine deaminase (AID) to S regions is critical for CSR; however, the underlying mechanism has not been fully elucidated. Here, we demonstrate that intronic switch RNA acts in trans to target AID to S region DNA. AID binds directly to switch RNA through G-quadruplexes formed by the RNA molecules. Disruption of this interaction by mutation of a key residue in the putative RNA-binding domain of AID impairs recruitment of AID to S region DNA, thereby abolishing CSR. Additionally, inhibition of RNA lariat processing leads to loss of AID localization to S regions and compromises CSR; both defects can be rescued by exogenous expression of switch transcripts in a sequence-specific manner. These studies uncover an RNA-mediated mechanism of targeting AID to DNA. PMID:25957684

  5. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants.

    PubMed

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo

    2014-02-01

    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the 'Hop stunt viroid' accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  6. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA).

    PubMed

    Miller, Daniel E; Patel, Zubin H; Lu, Xiaoming; Lynch, Arthur T; Weirauch, Matthew T; Kottyan, Leah C

    2016-01-01

    Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical disease or phenotype. For many diseases and traits, most variants are non-coding, and are thus likely to act by impacting subtle, comparatively hard to predict mechanisms controlling gene expression. Here, we describe a general strategic approach to prioritize non-coding variants, and screen them for their function. This approach involves computational prioritization using functional genomic databases followed by experimental analysis of differential binding of transcription factors (TFs) to risk and non-risk alleles. For both electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genetic variants, a synthetic DNA oligonucleotide (oligo) is used to identify factors in the nuclear lysate of disease or phenotype-relevant cells. For EMSA, the oligonucleotides with or without bound nuclear factors (often TFs) are analyzed by non-denaturing electrophoresis on a tris-borate-EDTA (TBE) polyacrylamide gel. For DAPA, the oligonucleotides are bound to a magnetic column and the nuclear factors that specifically bind the DNA sequence are eluted and analyzed through mass spectrometry or with a reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis. This general approach can be widely used to study the function of non-coding genetic variants associated with any disease, trait, or phenotype. PMID:27585267

  7. Noncoding RNAs and Cancer

    PubMed Central

    Naeini, Mozhgan Moslemi; Ardekani, Ali M.

    2009-01-01

    The eukaryotic complexity involves the expression and regulation of genes via RNA-DNA, RNA-RNA, DNA-protein and RNA-protein interactions. Recently, the role of RNA molecules in the regulation of genes in higher organisms has become more evident, especially with the discovery that about 97% of the transcriptional output in higher organisms are represented as noncoding RNAs: rRNA, snoRNAs, tRNA, transposable elements, 5’ and 3’ untranslated regions, introns, intergenic regions and microRNAs. MicroRNAs function by negatively regulating gene expression via degradation or translational inhibition of their target mRNAs and thus participate in a wide variety of physiological and pathological cellular processes including: development, cell proliferation, differentiation, and apoptosis pathways. MicroRNA expression profiles in many types of cancers have been identified. Recent reports have revealed that the expression profiles of microRNAs change in various human cancers and appear to function as oncogenes or tumor suppressors. Abnormal microRNA expression has increasingly become a common feature of human cancers. In this review, we summarize the latest progress on the involvement of microRNAs in different types of cancer and their potential use as potential diagnostic and prognostic tumor biomarkers in the future. PMID:23407615

  8. A genomic screen for long noncoding RNA genes epigenetically silenced by aberrant DNA methylation in colorectal cancer

    PubMed Central

    Kumegawa, Kohei; Maruyama, Reo; Yamamoto, Eiichiro; Ashida, Masami; Kitajima, Hiroshi; Tsuyada, Akihiro; Niinuma, Takeshi; Kai, Masahiro; Yamano, Hiro-o; Sugai, Tamotsu; Tokino, Takashi; Shinomura, Yasuhisa; Imai, Kohzoh; Suzuki, Hiromu

    2016-01-01

    Long noncoding RNAs (lncRNAs) have emerged as key components in multiple cellular processes, although their physiological and pathological functions are not fully understood. To identify cancer-related lncRNAs, we screened for those that are epigenetically silenced in colorectal cancer (CRC). Through a genome-wide analysis of histone modifications in CRC cells, we found that the transcription start sites (TSSs) of 1,027 lncRNA genes acquired trimethylation of histone H3 lysine 4 (H3K4me3) after DNA demethylation. Integrative analysis of chromatin signatures and the DNA methylome revealed that the promoter CpG islands (CGIs) of 66 lncRNA genes contained cancer-specific methylation. By validating the expression and methylation of lncRNA genes in CRC cells, we ultimately identified 20 lncRNAs, including ZNF582-AS1, as targets of epigenetic silencing in CRC. ZNF582-AS1 is frequently methylated in CRC cell lines (87.5%), primary CRCs (77.2%), colorectal adenomas (44.7%) and advanced adenomas (87.8%), suggesting that this methylation is an early event during colorectal tumorigenesis. Methylation of ZNF582-AS1 is associated with poor survival of CRC patients, and ectopic expression of ZNF582-AS1 suppressed colony formation by CRC cells. Our findings offer insight into the association between epigenetic alterations and lncRNA dysregulation in cancer and suggest that ZNF582-AS1 may be a novel tumor-suppressive lncRNA. PMID:27215978

  9. A genomic screen for long noncoding RNA genes epigenetically silenced by aberrant DNA methylation in colorectal cancer.

    PubMed

    Kumegawa, Kohei; Maruyama, Reo; Yamamoto, Eiichiro; Ashida, Masami; Kitajima, Hiroshi; Tsuyada, Akihiro; Niinuma, Takeshi; Kai, Masahiro; Yamano, Hiro-O; Sugai, Tamotsu; Tokino, Takashi; Shinomura, Yasuhisa; Imai, Kohzoh; Suzuki, Hiromu

    2016-01-01

    Long noncoding RNAs (lncRNAs) have emerged as key components in multiple cellular processes, although their physiological and pathological functions are not fully understood. To identify cancer-related lncRNAs, we screened for those that are epigenetically silenced in colorectal cancer (CRC). Through a genome-wide analysis of histone modifications in CRC cells, we found that the transcription start sites (TSSs) of 1,027 lncRNA genes acquired trimethylation of histone H3 lysine 4 (H3K4me3) after DNA demethylation. Integrative analysis of chromatin signatures and the DNA methylome revealed that the promoter CpG islands (CGIs) of 66 lncRNA genes contained cancer-specific methylation. By validating the expression and methylation of lncRNA genes in CRC cells, we ultimately identified 20 lncRNAs, including ZNF582-AS1, as targets of epigenetic silencing in CRC. ZNF582-AS1 is frequently methylated in CRC cell lines (87.5%), primary CRCs (77.2%), colorectal adenomas (44.7%) and advanced adenomas (87.8%), suggesting that this methylation is an early event during colorectal tumorigenesis. Methylation of ZNF582-AS1 is associated with poor survival of CRC patients, and ectopic expression of ZNF582-AS1 suppressed colony formation by CRC cells. Our findings offer insight into the association between epigenetic alterations and lncRNA dysregulation in cancer and suggest that ZNF582-AS1 may be a novel tumor-suppressive lncRNA. PMID:27215978

  10. Iron Deprivation in Synechocystis: Inference of Pathways, Non-coding RNAs, and Regulatory Elements from Comprehensive Expression Profiling

    PubMed Central

    Hernández-Prieto, Miguel A.; Schön, Verena; Georg, Jens; Barreira, Luísa; Varela, João; Hess, Wolfgang R.; Futschik, Matthias E.

    2012-01-01

    Iron is an essential cofactor in many metabolic reactions. Mechanisms controlling iron homeostasis need to respond rapidly to changes in extracellular conditions, but they must also keep the concentration of intracellular iron under strict control to avoid the generation of damaging reactive oxygen species. Due to its role as a redox carrier in photosynthesis, the iron quota in cyanobacteria is about 10 times higher than in model enterobacteria. The molecular details of how such a high quota is regulated are obscure. Here we present experiments that shed light on the iron regulatory system in cyanobacteria. We measured time-resolved changes in gene expression after iron depletion in the cyanobacterium Synechocystis sp. PCC 6803 using a comprehensive microarray platform, monitoring both protein-coding and non-coding transcripts. In total, less than a fifth of all protein-coding genes were differentially expressed during the first 72 hr. Many of these proteins are associated with iron transport, photosynthesis, or ATP synthesis. Comparing our data with three previous studies, we identified a core set of 28 genes involved in iron stress response. Among them were genes important for assimilation of inorganic carbon, suggesting a link between the carbon and iron regulatory networks. Nine of the 28 genes have unknown functions and constitute key targets for further functional analysis. Statistical and clustering analyses identified 10 small RNAs, 62 antisense RNAs, four 5′UTRs, and seven intragenic elements as potential novel components of the iron regulatory network in Synechocystis. Hence, our genome-wide expression profiling indicates an unprecedented complexity in the iron regulatory network of cyanobacteria. PMID:23275872

  11. Spatial organization of active and inactive genes and noncoding DNA within chromosome territories

    PubMed Central

    Mahy, Nicola L.; Perry, Paul E.; Gilchrist, Susan; Baldock, Richard A.; Bickmore, Wendy A.

    2002-01-01

    The position of genes within the nucleus has been correlated with their transcriptional activity. The interchromosome domain model of nuclear organization suggests that genes preferentially locate at the surface of chromosome territories. Conversely, high resolution analysis of chromatin fibers suggests that chromosome territories do not present accessibility barriers to transcription machinery. To clarify the relationship between the organization of chromosome territories and gene expression, we have used fluorescence in situ hybridization to analyze the spatial organization of a contiguous ∼1 Mb stretch of the Wilms' tumor, aniridia, genitourinary anomalies, mental retardation syndrome region of the human genome and the syntenic region in the mouse. These regions contain constitutively expressed genes, genes with tissue-restricted patterns of expression, and substantial regions of intergenic DNA. We find that there is a spatial organization within territories that is conserved between mouse and humans: certain sequences do preferentially locate at the periphery of the chromosome territories in both species. However, we do not detect genes necessarily at the periphery of chromosome territories or at the surface of subchromosomal domains. Intraterritory organization is not different among cell types that express different combinations of the genes under study. Our data demonstrate that transcription of both ubiquitous and tissue-restricted genes is not confined to the periphery of chromosome territories, suggesting that the basal transcription machinery and transcription factors can readily gain access to the chromosome interior. PMID:11994314

  12. Regulation of immunoglobulin class-switch recombination: choreography of noncoding transcription, targeted DNA deamination, and long-range DNA repair.

    PubMed

    Matthews, Allysia J; Zheng, Simin; DiMenna, Lauren J; Chaudhuri, Jayanta

    2014-01-01

    Upon encountering antigens, mature IgM-positive B lymphocytes undergo class-switch recombination (CSR) wherein exons encoding the default Cμ constant coding gene segment of the immunoglobulin (Ig) heavy-chain (Igh) locus are excised and replaced with a new constant gene segment (referred to as "Ch genes", e.g., Cγ, Cɛ, or Cα). The B cell thereby changes from expressing IgM to one producing IgG, IgE, or IgA, with each antibody isotype having a different effector function during an immune reaction. CSR is a DNA deletional-recombination reaction that proceeds through the generation of DNA double-strand breaks (DSBs) in repetitive switch (S) sequences preceding each Ch gene and is completed by end-joining between donor Sμ and acceptor S regions. CSR is a multistep reaction requiring transcription through S regions, the DNA cytidine deaminase AID, and the participation of several general DNA repair pathways including base excision repair, mismatch repair, and classical nonhomologous end-joining. In this review, we discuss our current understanding of how transcription through S regions generates substrates for AID-mediated deamination and how AID participates not only in the initiation of CSR but also in the conversion of deaminated residues into DSBs. Additionally, we review the multiple processes that regulate AID expression and facilitate its recruitment specifically to the Ig loci, and how deregulation of AID specificity leads to oncogenic translocations. Finally, we summarize recent data on the potential role of AID in the maintenance of the pluripotent stem cell state during epigenetic reprogramming. PMID:24507154

  13. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA

    PubMed Central

    Turner, Tychele N.; Hormozdiari, Fereydoun; Duyzend, Michael H.; McClymont, Sarah A.; Hook, Paul W.; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A.; Zody, Michael C.; Nelson, Bradley J.; Huddleston, John; Sandstrom, Richard; Smith, Joshua D.; Hanna, David; Swanson, James M.; Faustman, Elaine M.; Bamshad, Michael J.; Stamatoyannopoulos, John; Nickerson, Deborah A.; McCallion, Andrew S.; Darnell, Robert; Eichler, Evan E.

    2016-01-01

    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  14. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA.

    PubMed

    Turner, Tychele N; Hormozdiari, Fereydoun; Duyzend, Michael H; McClymont, Sarah A; Hook, Paul W; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A; Zody, Michael C; Nelson, Bradley J; Huddleston, John; Sandstrom, Richard; Smith, Joshua D; Hanna, David; Swanson, James M; Faustman, Elaine M; Bamshad, Michael J; Stamatoyannopoulos, John; Nickerson, Deborah A; McCallion, Andrew S; Darnell, Robert; Eichler, Evan E

    2016-01-01

    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  15. A Two-Locus Global DNA Barcode for Land Plants: The Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region

    PubMed Central

    Kress, W. John; Erickson, David L.

    2007-01-01

    Background A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Methodology/Principal Findings Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. Conclusions/Significance A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination. PMID:17551588

  16. Analysis of Five Gene Sets in Chimpanzees Suggests Decoupling between the Action of Selection on Protein-Coding and on Noncoding Elements

    PubMed Central

    Santpere, Gabriel; Carnero-Montoro, Elena; Petit, Natalia; Serra, François; Hvilsom, Christina; Rambla, Jordi; Heredia-Genestar, Jose Maria; Halligan, Daniel L.; Dopazo, Hernan; Navarro, Arcadi; Bosch, Elena

    2015-01-01

    We set out to investigate potential differences and similarities between the selective forces acting upon the coding and noncoding regions of five different sets of genes defined according to functional and evolutionary criteria: 1) two reference gene sets presenting accelerated and slow rates of protein evolution (the Complement and Actin pathways); 2) a set of genes with evidence of accelerated evolution in at least one of their introns; and 3) two gene sets related to neurological function (Parkinson’s and Alzheimer’s diseases). To that effect, we combine human–chimpanzee divergence patterns with polymorphism data obtained from target resequencing 20 central chimpanzees, our closest relatives with largest long-term effective population size. By using the distribution of fitness effect-alpha extension of the McDonald–Kreitman test, we reproduce inferences of rates of evolution previously based only on divergence data on both coding and intronic sequences and also obtain inferences for other classes of genomic elements (untranslated regions, promoters, and conserved noncoding sequences). Our results suggest that 1) the distribution of fitness effect-alpha method successfully helps distinguishing different scenarios of accelerated divergence (adaptation or relaxed selective constraints) and 2) the adaptive history of coding and noncoding sequences within the gene sets analyzed is decoupled. PMID:25977458

  17. Analysis of Five Gene Sets in Chimpanzees Suggests Decoupling between the Action of Selection on Protein-Coding and on Noncoding Elements.

    PubMed

    Santpere, Gabriel; Carnero-Montoro, Elena; Petit, Natalia; Serra, François; Hvilsom, Christina; Rambla, Jordi; Heredia-Genestar, Jose Maria; Halligan, Daniel L; Dopazo, Hernan; Navarro, Arcadi; Bosch, Elena

    2015-06-01

    We set out to investigate potential differences and similarities between the selective forces acting upon the coding and noncoding regions of five different sets of genes defined according to functional and evolutionary criteria: 1) two reference gene sets presenting accelerated and slow rates of protein evolution (the Complement and Actin pathways); 2) a set of genes with evidence of accelerated evolution in at least one of their introns; and 3) two gene sets related to neurological function (Parkinson's and Alzheimer's diseases). To that effect, we combine human-chimpanzee divergence patterns with polymorphism data obtained from target resequencing 20 central chimpanzees, our closest relatives with largest long-term effective population size. By using the distribution of fitness effect-alpha extension of the McDonald-Kreitman test, we reproduce inferences of rates of evolution previously based only on divergence data on both coding and intronic sequences and also obtain inferences for other classes of genomic elements (untranslated regions, promoters, and conserved noncoding sequences). Our results suggest that 1) the distribution of fitness effect-alpha method successfully helps distinguishing different scenarios of accelerated divergence (adaptation or relaxed selective constraints) and 2) the adaptive history of coding and noncoding sequences within the gene sets analyzed is decoupled. PMID:25977458

  18. Non-Coding RNAs in Transcriptional Regulation

    PubMed Central

    Chen, Yung-Chia Ariel; Aravin, Alexei A.

    2015-01-01

    Transcriptional gene silencing guided by small RNAs is a process conserved from protozoa to mammals. Small RNAs loaded into Argonaute family proteins direct repressive histone modifications or DNA cytosine methylation to homologous regions of the genome. Small RNA-mediated transcriptional silencing is required for many biological processes, including repression of transposable elements, maintaining the genome stability/integrity, and epigenetic inheritance of gene expression. Here we will summarize the current knowledge about small RNA biogenesis and mechanisms of transcriptional regulation in plants, Drosophila, C. elegans and mice. Furthermore, a rapidly growing number long non-coding RNAs (lncRNAs) have been implicated as important players in transcription regulation. We will discuss current models for long non-coding RNA-mediated gene regulation. PMID:26120554

  19. Evaluation of IRX Genes and Conserved Noncoding Elements in a Region on 5p13.3 Linked to Families with Familial Idiopathic Scoliosis and Kyphosis

    PubMed Central

    Justice, Cristina M.; Bishop, Kevin; Carrington, Blake; Mullikin, Jim C.; Swindle, Kandice; Marosy, Beth; Sood, Raman; Miller, Nancy H.; Wilson, Alexander F.

    2016-01-01

    Because of genetic heterogeneity present in idiopathic scoliosis, we previously defined clinical subsets (a priori) from a sample of families with idiopathic scoliosis to find genes involved with spinal curvature. Previous genome-wide linkage analysis of seven families with at least two individuals with kyphoscoliosis found linkage (P-value = 0.002) in a 3.5-Mb region on 5p13.3 containing only three known genes, IRX1, IRX2, and IRX4. In this study, the exons of IRX1, IRX2, and IRX4, the conserved noncoding elements in the region, and the exons of a nonprotein coding RNA, LOC285577, were sequenced. No functional sequence variants were identified. An intrafamilial test of association found several associated noncoding single nucleotide variants. The strongest association was with rs12517904 (P = 0.00004), located 6.5 kb downstream from IRX1. In one family, the genotypes of nine variants differed from the reference allele in all individuals with kyphoscoliosis, and two of three individuals with scoliosis, but did not differ from the reference allele in all other genotyped individuals. One of these variants, rs117273909, was located in a conserved noncoding region that functions as an enhancer in mice. To test whether the variant allele at rs117273909 had an effect on enhancer activity, zebrafish transgenesis was performed with overlapping fragments of 198 and 687 bp containing either the wild type or the variant allele. Our data suggests that this region acts as a regulatory element; however, its size and target gene(s) need to be identified to determine its role in idiopathic scoliosis. PMID:27172222

  20. Evaluation of IRX Genes and Conserved Noncoding Elements in a Region on 5p13.3 Linked to Families with Familial Idiopathic Scoliosis and Kyphosis.

    PubMed

    Justice, Cristina M; Bishop, Kevin; Carrington, Blake; Mullikin, Jim C; Swindle, Kandice; Marosy, Beth; Sood, Raman; Miller, Nancy H; Wilson, Alexander F

    2016-01-01

    Because of genetic heterogeneity present in idiopathic scoliosis, we previously defined clinical subsets (a priori) from a sample of families with idiopathic scoliosis to find genes involved with spinal curvature. Previous genome-wide linkage analysis of seven families with at least two individuals with kyphoscoliosis found linkage (P-value = 0.002) in a 3.5-Mb region on 5p13.3 containing only three known genes, IRX1, IRX2, and IRX4 In this study, the exons of IRX1, IRX2, and IRX4, the conserved noncoding elements in the region, and the exons of a nonprotein coding RNA, LOC285577, were sequenced. No functional sequence variants were identified. An intrafamilial test of association found several associated noncoding single nucleotide variants. The strongest association was with rs12517904 (P = 0.00004), located 6.5 kb downstream from IRX1 In one family, the genotypes of nine variants differed from the reference allele in all individuals with kyphoscoliosis, and two of three individuals with scoliosis, but did not differ from the reference allele in all other genotyped individuals. One of these variants, rs117273909, was located in a conserved noncoding region that functions as an enhancer in mice. To test whether the variant allele at rs117273909 had an effect on enhancer activity, zebrafish transgenesis was performed with overlapping fragments of 198 and 687 bp containing either the wild type or the variant allele. Our data suggests that this region acts as a regulatory element; however, its size and target gene(s) need to be identified to determine its role in idiopathic scoliosis. PMID:27172222

  1. Salamander Hox clusters contain repetitive DNA and expanded non-coding regions: a typical Hox structure for non-mammalian tetrapod vertebrates?

    PubMed Central

    2013-01-01

    Hox genes encode transcription factors that regulate embryonic and post-embryonic developmental processes. The expression of Hox genes is regulated in part by the tight, spatial arrangement of conserved coding and non-coding sequences. The potential for evolutionary changes in Hox cluster structure is thought to be low among vertebrates; however, recent studies of a few non-mammalian taxa suggest greater variation than originally thought. Using next generation sequencing of large genomic fragments (>100 kb) from the red spotted newt (Notophthalamus viridescens), we found that the arrangement of Hox cluster genes was conserved relative to orthologous regions from other vertebrates, but the length of introns and intergenic regions varied. In particular, the distance between hoxd13 and hoxd11 is longer in newt than orthologous regions from vertebrate species with expanded Hox clusters and is predicted to exceed the length of the entire HoxD clusters (hoxd13–hoxd4) of humans, mice, and frogs. Many repetitive DNA sequences were identified for newt Hox clusters, including an enrichment of DNA transposon-like sequences relative to non-coding genomic fragments. Our results suggest that Hox cluster expansion and transposon accumulation are common features of non-mammalian tetrapod vertebrates. PMID:23561734

  2. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    PubMed Central

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  3. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) - Definition of a Distinct Class of Begomovirus-Associated Satellites.

    PubMed

    Lozano, Gloria; Trenado, Helena P; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  4. Nuclear Noncoding RNAs and Genome Stability.

    PubMed

    Khanduja, Jasbeer S; Calvo, Isabel A; Joh, Richard I; Hill, Ian T; Motamedi, Mo

    2016-07-01

    In modern molecular biology, RNA has emerged as a versatile macromolecule capable of mediating an astonishing number of biological functions beyond its role as a transient messenger of genetic information. The recent discovery and functional analyses of new classes of noncoding RNAs (ncRNAs) have revealed their widespread use in many pathways, including several in the nucleus. This Review focuses on the mechanisms by which nuclear ncRNAs directly contribute to the maintenance of genome stability. We discuss how ncRNAs inhibit spurious recombination among repetitive DNA elements, repress mobilization of transposable elements (TEs), template or bridge DNA double-strand breaks (DSBs) during repair, and direct developmentally regulated genome rearrangements in some ciliates. These studies reveal an unexpected repertoire of mechanisms by which ncRNAs contribute to genome stability and even potentially fuel evolution by acting as templates for genome modification. PMID:27392145

  5. Sequence Evaluation of FGF and FGFR Gene Conserved Non-Coding Elements in Non-Syndromic Cleft Lip and Palate Cases

    PubMed Central

    Riley, Bridget M.; Murray, Jeffrey C.

    2009-01-01

    Non-syndromic cleft lip and palate (NS CLP) is a complex birth defect resulting from multiple genetic and environmental factors. We have previously reported the sequencing of the coding region of genes in the fibroblast growth factor (FGF) signaling pathway, in which missense and non-sense mutations contribute to approximately 5%–6% NS CLP cases. In this article we report the sequencing of conserved non-coding elements (CNEs) in and around 11 of the FGF and FGFR genes, which identified 55 novel variants. Seven of variants are highly conserved among ≥8 species and 31 variants alter transcription factor binding sites, 8 of which are important for craniofacial development. Additionally, 15 NS CLP patients had a combination of coding mutations and CNE variants, suggesting that an accumulation of variants in the FGF signaling pathway may contribute to clefting. PMID:17963255

  6. Human papillomaviruses in Buschke-Löwenstein tumors: physical state of the DNA and identification of a tandem duplication in the noncoding region of a human papillomavirus 6 subtype.

    PubMed Central

    Boshart, M; zur Hausen, H

    1986-01-01

    Six Buschke-Löwenstein tumors, i.e., highly differentiated squamous cell tumors of the genital region, were shown to contain human papillomavirus 6 (HPV 6) or HPV 11 genomes. The viral DNA was found in an episomal state, including a very small fraction of circular oligomers. HPV 6a and HPV 6d genomes were cloned from two of the tumors. Comparison with HPV 6b, cloned from a benign genital wart (E. -M. de Villiers, L. Gissmann, and H. zur Hausen, J. Virol. 40:932-935, 1981) by restriction mapping and partial sequence analysis, revealed a very high degree of homology with the different HPV 6 subtypes. A tandem duplication of 459 base pairs within the noncoding region of the genome was found in the new subtype HPV 6d. This structural rearrangement in a region containing the putative control elements for early gene transcription might influence the biological potential of that virus. No evidence for rearrangement of this region was found in the HPV DNA from the five other tumors. Images PMID:3009899

  7. An intragenic long noncoding RNA interacts epigenetically with the RUNX1 promoter and enhancer chromatin DNA in hematopoietic malignancies.

    PubMed

    Wang, Hong; Li, Wei; Guo, Rui; Sun, Jingnan; Cui, Jiuwei; Wang, Guanjun; Hoffman, Andrew R; Hu, Ji-Fan

    2014-12-15

    RUNX1, a master regulator of hematopoiesis, is the most commonly perturbed target of chromosomal abnormalities in hematopoietic malignancies. The t(8;21) translocation is found in 30-40% of cases of acute myeloid leukemia (AML). Recent whole-exome sequencing also reveals mutations and deletions of RUNX1 in some solid tumors. We describe a RUNX1-intragenic long noncoding RNA RUNXOR that is transcribed as unspliced transcript from an upstream overlapping promoter. RUNXOR was upregulated in AML samples and in response to Ara-C treatment in vitro. RUNXOR utilizes its 3'-terminal fragment to directly interact with the RUNX1 promoter and enhancers and participates in the orchestration of an intrachromosomal loop. The 3' region of RUNXOR also participates in long-range interchromosomal interactions with chromatin regions that are involved in multiple RUNX1 translocations. These data suggest that RUNXOR noncoding RNA may function as a previously unidentified candidate component that is involved in chromosomal translocation in hematopoietic malignancies. PMID:24752773

  8. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    PubMed

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms. PMID:27281207

  9. Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

    PubMed Central

    Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

    2015-01-01

    Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: http://dx.doi.org/10.7554/eLife.09343.001 PMID:26196146

  10. Fast turnover of genome transcription across evolutionary time exposes entire non-coding DNA to de novo gene emergence

    PubMed Central

    Neme, Rafik; Tautz, Diethard

    2016-01-01

    Deep sequencing analyses have shown that a large fraction of genomes is transcribed, but the significance of this transcription is much debated. Here, we characterize the phylogenetic turnover of poly-adenylated transcripts in a comprehensive sampling of taxa of the mouse (genus Mus), spanning a phylogenetic distance of 10 Myr. Using deep RNA sequencing we find that at a given sequencing depth transcriptome coverage becomes saturated within a taxon, but keeps extending when compared between taxa, even at this very shallow phylogenetic level. Our data show a high turnover of transcriptional states between taxa and that no major transcript-free islands exist across evolutionary time. This suggests that the entire genome can be transcribed into poly-adenylated RNA when viewed at an evolutionary time scale. We conclude that any part of the non-coding genome can potentially become subject to evolutionary functionalization via de novo gene evolution within relatively short evolutionary time spans. DOI: http://dx.doi.org/10.7554/eLife.09977.001 PMID:26836309

  11. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  12. VEZF1 Elements Mediate Protection from DNA Methylation

    PubMed Central

    Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

    2010-01-01

    There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

  13. Conserved Noncoding Elements Follow Power-Law-Like Distributions in Several Genomes as a Result of Genome Dynamics

    PubMed Central

    Polychronopoulos, Dimitris; Sellis, Diamantis; Almirantis, Yannis

    2014-01-01

    Conserved, ultraconserved and other classes of constrained elements (collectively referred as CNEs here), identified by comparative genomics in a wide variety of genomes, are non-randomly distributed across chromosomes. These elements are defined using various degrees of conservation between organisms and several thresholds of minimal length. We here investigate the chromosomal distribution of CNEs by studying the statistical properties of distances between consecutive CNEs. We find widespread power-law-like distributions, i.e. linearity in double logarithmic scale, in the inter-CNE distances, a feature which is connected with fractality and self-similarity. Given that CNEs are often found to be spatially associated with genes, especially with those that regulate developmental processes, we verify by appropriate gene masking that a power-law-like pattern emerges irrespectively of whether elements found close or inside genes are excluded or not. An evolutionary model is put forward for the understanding of these findings that includes segmental or whole genome duplication events and eliminations (loss) of most of the duplicated CNEs. Simulations reproduce the main features of the observed size distributions. Power-law-like patterns in the genomic distributions of CNEs are in accordance with current knowledge about their evolutionary history in several genomes. PMID:24787386

  14. Rheostatic Regulation of the SERCA/Phospholamban Membrane Protein Complex Using Non-Coding RNA and Single-Stranded DNA oligonucleotides

    PubMed Central

    Soller, Kailey J.; Verardi, Raffaello; Jing, Meng; Abrol, Neha; Yang, Jing; Walsh, Naomi; Vostrikov, Vitaly V.; Robia, Seth L.; Bowser, Michael T.; Veglia, Gianluigi

    2015-01-01

    The membrane protein complex between sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) and phospholamban (PLN) is a prime therapeutic target for reversing cardiac contractile dysfunctions caused by calcium mishandling. So far, however, efforts to develop drugs specific for this protein complex have failed. Here, we show that non-coding RNAs and single-stranded DNAs (ssDNAs) interact with and regulate the function of the SERCA/PLN complex in a tunable manner. Both in HEK cells expressing the SERCA/PLN complex, as well as in cardiac sarcoplasmic reticulum preparations, these short oligonucleotides bind and reverse PLN’s inhibitory effects on SERCA, increasing the ATPase’s apparent Ca2+ affinity. Solid-state NMR experiments revealed that ssDNA interacts with PLN specifically, shifting the conformational equilibrium of the SERCA/PLN complex from an inhibitory to a non-inhibitory state. Importantly, we achieved rheostatic control of SERCA function by modulating the length of ssDNAs. Since restoration of Ca2+ flux to physiological levels represents a viable therapeutic avenue for cardiomyopathies, our results suggest that oligonucleotide-based drugs could be used to fine-tune SERCA function to counterbalance the extent of the pathological insults. PMID:26292938

  15. A User's Guide to the Encyclopedia of DNA Elements (ENCODE)

    PubMed Central

    2011-01-01

    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

  16. A user's guide to the encyclopedia of DNA elements (ENCODE).

    PubMed

    2011-04-01

    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

  17. DNA sequence of the maize transposable element Dissociation.

    PubMed

    Döring, H P; Tillmann, E; Starlinger, P

    The DNA sequence of the terminal 4.2 kilobases (kb) of the 30-kb insertion in the endosperm sucrose synthase gene of maize mutant sh-m5933 shows that it comprises two identical 2,040-base pair (bp) segments, one inserted in the reverse direction into the other. We suggest that the 2,040-bp sequence is an example of the transposable element Dissociation described by Barbara McClintock. PMID:6318121

  18. Non-coding genome functions in diabetes.

    PubMed

    Cebola, Inês; Pasquali, Lorenzo

    2016-01-01

    Most of the genetic variation associated with diabetes, through genome-wide association studies, does not reside in protein-coding regions, making the identification of functional variants and their eventual translation to the clinic challenging. In recent years, high-throughput sequencing-based methods have enabled genome-scale high-resolution epigenomic profiling in a variety of human tissues, allowing the exploration of the human genome outside of the well-studied coding regions. These experiments unmasked tens of thousands of regulatory elements across several cell types, including diabetes-relevant tissues, providing new insights into their mechanisms of gene regulation. Regulatory landscapes are highly dynamic and cell-type specific and, being sensitive to DNA sequence variation, can vary with individual genomes. The scientific community is now in place to exploit the regulatory maps of tissues central to diabetes etiology, such as pancreatic progenitors and adult islets. This giant leap forward in the understanding of pancreatic gene regulation is revolutionizing our capacity to discriminate between functional and non-functional non-coding variants, opening opportunities to uncover regulatory links between sequence variation and diabetes susceptibility. In this review, we focus on the non-coding regulatory landscape of the pancreatic endocrine cells and provide an overview of the recent developments in this field. PMID:26438568

  19. An integrated encyclopedia of DNA elements in the human genome.

    PubMed

    2012-09-01

    The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research. PMID:22955616

  20. An Integrated Encyclopedia of DNA Elements in the Human Genome

    PubMed Central

    2012-01-01

    Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall the project provides new insights into the organization and regulation of our genes and genome, and an expansive resource of functional annotations for biomedical research. PMID:22955616

  1. Origin of the human L1 elements: proposed progenitor genes deduced from a consensus DNA sequence.

    PubMed

    Scott, A F; Schmeckpeper, B J; Abdelrazik, M; Comey, C T; O'Hara, B; Rossiter, J P; Cooley, T; Heath, P; Smith, K D; Margolet, L

    1987-10-01

    A consensus sequence for the human long interspersed repeated DNA element, L1Hs (LINE or KpnI sequence), is presented. The sequence contains two open reading frames (ORFs) which are homologous to ORFs in corresponding regions of L1 elements in other species. The L1Hs ORFs are separated by a small evolutionarily nonconserved region. The 5' end of the consensus contains frequent terminators in all three reading frames and has a relatively high GC content with numerous stretches of weak homology with AluI repeats. The 5' ORF extends for a minimum of 723 bp (241 codons). The 3' ORF is 3843 bp (1281 codons) and predicts a protein of 149 kD which has regions of weak homology to the polymerase domain of various reverse transcriptases. The 3' end of the consensus has a 208-bp nonconserved region followed by an adenine-rich end. The organization of the L1Hs consensus sequence resembles the structure of eukaryotic mRNAs except for the noncoding region between ORFs. However, due to base substitutions or truncation most elements appear incapable of producing mRNA that can be translated. Our observation that individual elements cluster into subfamilies on the basis of the presence or absence of blocks of sequence, or by the linkage of alternative bases at multiple positions, suggests that most L1 sequences were derived from a small number of structural genes. An estimate of the mammalian L1 substitution rate was derived and used to predict the age of individual human elements. From this it follows that the majority of human L1 sequences have been generated within the last 30 million years. The human elements studied here differ from each other, yet overall the L1Hs sequences demonstrate a pattern of species-specificity when compared to the L1 families of other mammals. Possible mechanisms that may account for the origin and evolution of the L1 family are discussed. These include pseudogene formation (retroposition), transposition, gene conversion, and RNA recombination. PMID

  2. Genome-wide DNA methylation patterns in LSH mutant reveals de-repression of repeat elements and redundant epigenetic silencing pathways

    PubMed Central

    Yu, Weishi; McIntosh, Carl; Lister, Ryan; Zhu, Iris; Han, Yixing; Ren, Jianke; Landsman, David; Lee, Eunice; Briones, Victorino; Terashima, Minoru; Leighty, Robert; Ecker, Joseph R.

    2014-01-01

    Cytosine methylation is critical in mammalian development and plays a role in diverse biologic processes such as genomic imprinting, X chromosome inactivation, and silencing of repeat elements. Several factors regulate DNA methylation in early embryogenesis, but their precise role in the establishment of DNA methylation at a given site remains unclear. We have generated a comprehensive methylation map in fibroblasts derived from the murine DNA methylation mutant Hells−/− (helicase, lymphoid specific, also known as LSH). It has been previously shown that HELLS can influence de novo methylation of retroviral sequences and endogenous genes. Here, we describe that HELLS controls cytosine methylation in a nuclear compartment that is in part defined by lamin B1 attachment regions. Despite widespread loss of cytosine methylation at regulatory sequences, including promoter regions of protein-coding genes and noncoding RNA genes, overall relative transcript abundance levels in the absence of HELLS are similar to those in wild-type cells. A subset of promoter regions shows increases of the histone modification H3K27me3, suggesting redundancy of epigenetic silencing mechanisms. Furthermore, HELLS modulates CG methylation at all classes of repeat elements and is critical for repression of a subset of repeat elements. Overall, we provide a detailed analysis of gene expression changes in relation to DNA methylation alterations, which contributes to our understanding of the biological role of cytosine methylation. PMID:25170028

  3. Single nucleotide polymorphisms in noncoding regions of Rad51C do not change the risk of unselected breast cancer but they modulate the level of oxidative stress and the DNA damage characteristics: a case-control study.

    PubMed

    Gresner, Peter; Gromadzinska, Jolanta; Jablonska, Ewa; Stepnik, Maciej; Zambrano Quispe, Oscar; Twardowska, Ewa; Wasowicz, Wojciech

    2014-01-01

    Deleterious and missense mutations of RAD51C have recently been suggested to modulate the individual susceptibility to hereditary breast and ovarian cancer and unselected ovarian cancer, but not unselected breast cancer (BrC). We enrolled 132 unselected BrC females and 189 cancer-free female subjects to investigate whether common single nucleotide polymorphisms (SNPs) in non-coding regions of RAD51C modulate the risk of BrC, and whether they affect the level of oxidative stress and the extent/characteristics of DNA damage. Neither SNPs nor reconstructed haplotypes were found to significantly affect the unselected BrC risk. Contrary to this, carriers of rs12946522, rs16943176, rs12946397 and rs17222691 rare-alleles were found to present significantly increased level of blood plasma TBARS compared to respective wild-type homozygotes (p<0.05). Furthermore, these carriers showed significantly decreased fraction of oxidatively generated DNA damage (34% of total damaged DNA) in favor of DNA strand breakage, with no effect on total DNA damage, unlike respective wild-types, among which more evenly distributed proportions between oxidatively damaged DNA (48% of total DNA damage) and DNA strand breakage was found (p<0.0005 for the difference). Such effects were found among both the BrC cases and healthy subjects, indicating that they cannot be assumed as causal factors contributing to BrC development. PMID:25343521

  4. Molecular cloning of amyloid cDNA derived from mRNA of the Alzheimer disease brain: coding and noncoding regions of the fetal precursor mRNA are expressed in the cortex

    SciTech Connect

    Zain, S.B.; Salim, M.; Chou, W.G.; Sajdel-Sulkowska, E.M.; Majocha, R.E.; Marotta, C.A.

    1988-02-01

    To gain insight into factors associated with the excessive accumulation of ..beta..-amyloid in the Alzheimer disease (AD) brain, the present studies were initiated to distinguish between a unique primary structure of the AD-specific amyloid precursor mRNA vis a vis other determinants that may affect amyloid levels. Previous molecular cloning experiments focused on amyloid derived from sources other than AD cases. In the present work, the authors cloned and characterized amyloid cDNA derived directly from AD brain mRNA. Poly(A)/sup +/ RNA from AD cortices was used for the preparation of lambdagt11 recombinant cDNA libraries. An insert of 1564 nucleotides was isolated that included the ..beta..-amyloid domain and corresponded to 75% of the coding region and approx. = 70% of the 3'-noncoding region of the fetal precursor amyloid cDNA reported by others. On RNA blots, the AD amyloid mRNA consisted of a doublet of 3.2 and 3.4 kilobases. In control and AD cases, the amyloid mRNA levels were nonuniform and were independent of glial-specific mRNA levels. Based on the sequence analysis data, they conclude that a segment of the amyloid gene is expressed in the AD cortex as a high molecular weight precursor mRNA with major coding and 3'-noncoding regions that are identical to the fetal brain gene product.

  5. SERE, a widely dispersed bacterial repetitive DNA element.

    PubMed

    Rajashekara, G; Koeuth, T; Nevile, S; Back, A; Nagaraja, K V; Lupski, J R; Kapur, V

    1998-06-01

    The presence of a Salmonella serotype Enteritidis repeat element (SERE) located within the upstream regulatory region of the sefABCD operon encoding fimbrial proteins is reported. DNA dot-blot hybridisation analyses and computerised searches of genetic databases indicate that SERE is well conserved and widely distributed throughout the bacterial and archaeal kingdoms. A SERE-based polymerase chain reaction (SERE-PCR) assay was developed to fingerprint 54 isolates of Enteritidis representing nine distinct phage types and 54 isolates of other Salmonella serotypes. SERE-PCR identified five distinct fingerprint profiles among the 54 Enteritidis isolates; no correlation between phage types and SERE-PCR fingerprint patterns was noticed. SERE-PCR was reproducible, rapid and easy to perform. The results of this investigation suggest that the limited heterogeneity of SERE-PCR fingerprint patterns can be utilised to develop serotype- and serogroup-specific fingerprint patterns for isolates of Enteritidis. PMID:9879967

  6. The dichotomy of p53 regulation by noncoding RNAs.

    PubMed

    Deng, Qipan; Becker, Lindsey; Ma, Xiaodong; Zhong, Xiaoming; Young, Ken; Ramos, Kenneth; Li, Yong

    2014-06-01

    The p53 tumor suppressor gene is the most frequently mutated gene in cancer. Significant progress has been made to discern the importance of p53 in coordinating cellular responses to DNA damage, oncogene activation, and other stresses. Noncoding RNAs are RNA molecules functioning without being translated into proteins. In this work, we discuss the dichotomy of p53 regulation by noncoding RNAs with four unconventional questions. First, is overexpression of microRNAs responsible for p53 inactivation in the absence of p53 mutation? Second, are there somatic mutations in the noncoding regions of the p53 gene? Third, is there a germline mutant in the noncoding regions of the p53 gene that predisposes carriers to cancer? Fourth, can p53 activation mediated by a noncoding RNA mutation cause cancer? This work highlights the prominence of noncoding RNAs in p53 dysregulation and tumorigenesis. PMID:24706938

  7. A Transposable Element within the Non-canonical Telomerase RNA of Arabidopsis thaliana Modulates Telomerase in Response to DNA Damage

    PubMed Central

    Xu, Hengyi; Nelson, Andrew D. L.; Shippen, Dorothy E.

    2015-01-01

    Long noncoding RNAs (lncRNAs) have emerged as critical factors in many biological processes, but little is known about how their regulatory functions evolved. One of the best-studied lncRNAs is TER, the essential RNA template for telomerase reverse transcriptase. We previously showed that Arabidopsis thaliana harbors three TER isoforms: TER1, TER2 and TER2S. TER1 serves as a canonical telomere template, while TER2 is a novel negative regulator of telomerase activity, induced in response to double-strand breaks (DSBs). TER2 contains a 529 nt intervening sequence that is removed along with 36 nt at the RNA 3’ terminus to generate TER2S, an RNA of unknown function. Here we investigate how A. thaliana TER2 acquired its regulatory function. Using data from the 1,001 Arabidopsis genomes project, we report that the intervening sequence within TER2 is derived from a transposable element termed DSB responsive element (DRE). DRE is found in the TER2 loci of most but not all A. thaliana accessions. By analyzing accessions with (TER2) and without DRE (TER2Δ) we demonstrate that this element is responsible for many of the unique properties of TER2, including its enhanced binding to TERT and telomerase inhibitory function. We show that DRE destabilizes TER2, and further that TER2 induction by DNA damage reflects increased RNA stability and not increased transcription. DRE-mediated changes in TER2 stability thus provide a rapid and sensitive switch to fine-tune telomerase enzyme activity. Altogether, our data shows that invasion of the TER2 locus by a small transposon converted this lncRNA into a DNA damage sensor that modulates telomerase enzyme activity in response to genome assault. PMID:26075395

  8. Viral noncoding RNAs: more surprises

    PubMed Central

    Tycowski, Kazimierz T.; Guo, Yang Eric; Lee, Nara; Moss, Walter N.; Vallery, Tenaya K.; Xie, Mingyi

    2015-01-01

    Eukaryotic cells produce several classes of long and small noncoding RNA (ncRNA). Many DNA and RNA viruses synthesize their own ncRNAs. Like their host counterparts, viral ncRNAs associate with proteins that are essential for their stability, function, or both. Diverse biological roles—including the regulation of viral replication, viral persistence, host immune evasion, and cellular transformation—have been ascribed to viral ncRNAs. In this review, we focus on the multitude of functions played by ncRNAs produced by animal viruses. We also discuss their biogenesis and mechanisms of action. PMID:25792595

  9. Long Noncoding RNAs in Cancer Pathways.

    PubMed

    Schmitt, Adam M; Chang, Howard Y

    2016-04-11

    Genome-wide cancer mutation analyses are revealing an extensive landscape of functional mutations within the noncoding genome, with profound effects on the expression of long noncoding RNAs (lncRNAs). While the exquisite regulation of lncRNA transcription can provide signals of malignant transformation, we now understand that lncRNAs drive many important cancer phenotypes through their interactions with other cellular macromolecules including DNA, protein, and RNA. Recent advancements in surveying lncRNA molecular mechanisms are now providing the tools to functionally annotate these cancer-associated transcripts, making these molecules attractive targets for therapeutic intervention in the fight against cancer. PMID:27070700

  10. Movable genetic elements: detection of changes in maize DNA at the Shrunken locus due to the intervention of Ds elements

    SciTech Connect

    Burr, B.; Burr, F.A.

    1980-05-28

    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  11. Movable Genetic Elements: Detection of Changes in Maize DNA at the Shrunken Locus Due to the Intervention of Ds Elements

    DOE R&D Accomplishments Database

    Burr, B.; Burr, F.A.

    1980-05-28

    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  12. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements.

    PubMed

    Prior, Sara; Miousse, Isabelle R; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R; Allen, Antiño R; Raber, Jacob; Tackett, Alan J; Hauer-Jensen, Martin; Nelson, Gregory A; Koturbash, Igor

    2016-10-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2'-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5'-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. PMID:27419368

  13. In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

    SciTech Connect

    Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.

    2006-02-01

    The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

  14. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    SciTech Connect

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole

    2005-09-10

    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  15. Non-coding RNA repertoires in malignant pleural mesothelioma.

    PubMed

    Quinn, Leah; Finn, Stephen P; Cuffe, Sinead; Gray, Steven G

    2015-12-01

    Malignant pleural mesothelioma (MPM) is a rare malignancy, with extremely poor survival rates. There are limited treatment options, with no second line standard of care for those who fail first line chemotherapy. Recent advances have been made to characterise the underlying molecular mechanisms of mesothelioma, in the hope of providing new targets for therapy. With the discovery that non-coding regions of our DNA are more than mere junk, the field of research into non-coding RNAs (ncRNAs) has exploded in recent years. Non-coding RNAs have diverse and important roles in a variety of cellular processes, but are also implicated in malignancy. In the following review, we discuss two types of non-coding RNAs, long non-coding RNAs and microRNAs, in terms of their role in the pathogenesis of MPM and their potential as both biomarkers and as therapeutic targets in this disease. PMID:26791801

  16. Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

    SciTech Connect

    Tully, D.B.; Cidlowski, J.A. )

    1989-03-07

    Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins prior to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.

  17. Transcription regulatory elements are punctuation marks for DNA replication.

    PubMed

    Mirkin, Ekaterina V; Castro Roa, Daniel; Nudler, Evgeny; Mirkin, Sergei M

    2006-05-01

    Collisions between DNA replication and transcription significantly affect genome organization, regulation, and stability. Previous studies have described collisions between replication forks and elongating RNA polymerases. Although replication collisions with the transcription-initiation or -termination complexes are potentially even more important because most genes are not actively transcribed during DNA replication, their existence and mechanisms remained unproven. To address this matter, we have designed a bacterial promoter that binds RNA polymerase and maintains it in the initiating mode by precluding the transition into the elongation mode. By using electrophoretic analysis of replication intermediates, we have found that this steadfast transcription-initiation complex inhibits replication fork progression in an orientation-dependent manner during head-on collisions. Transcription terminators also appeared to attenuate DNA replication, but in the opposite, codirectional orientation. Thus, transcription regulatory signals may serve as "punctuation marks" for DNA replication in vivo. PMID:16670199

  18. cis-active elements from mouse chromosomal DNA suppress simian virus 40 DNA replication.

    PubMed Central

    Hartl, M; Willnow, T; Fanning, E

    1990-01-01

    Simian virus 40 (SV40)-containing DNA was rescued after the fusion of SV40-transformed VLM cells with permissive COS1 monkey cells and cloned, and prototype plasmid clones were characterized. A 2-kilobase mouse DNA fragment fused with the rescued SV40 DNA, and derived from mouse DNA flanking the single insert of SV40 DNA in VLM cells, was sequenced. Insertion of the intact rescued mouse sequence, or two nonoverlapping fragments of it, into wild-type SV40 plasmid DNA suppressed replication of the plasmid in TC7 monkey cells, although the plasmids expressed replication-competent T antigen. Rat cells were transformed with linearized wild-type SV40 plasmid DNA with or without fragments of the mouse DNA in cis. Although all of the rat cell lines expressed approximately equal amounts of T antigen and p53, transformants carrying SV40 DNA linked to either of the same two replication suppressor fragments produced significantly less free SV40 DNA after fusion with permissive cells than those transformed by SV40 DNA without a cellular insert or with a cellular insert lacking suppressor activity. The results suggest that two independent segments of cellular DNA act in cis to suppress SV40 replication in vivo, either as a plasmid or integrated in chromosomal DNA. Images PMID:2159549

  19. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

    PubMed

    Suyama, Mikita; Lathe, Warren C; Bork, Peer

    2005-10-10

    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions. PMID:16182294

  20. The Drosophila P-element KP repressor protein dimerizes and interacts with multiple sites on P-element DNA.

    PubMed

    Lee, C C; Mul, Y M; Rio, D C

    1996-10-01

    Drosophila P elements are mobile DNA elements that encode an 87-kDa transposase enzyme and transpositional repressor proteins. One of these repressor proteins is the 207-amino-acid KP protein which is encoded by a naturally occurring P element with an internal deletion. To study the molecular mechanisms by which KP represses transposition, the protein was expressed, purified, and characterized. We show that the KP protein binds to multiple sites on the ends of P-element DNA, unlike the full-length transposase protein. These sites include the high-affinity transposase binding site, an 11-bp transpositional enhancer, and, at the highest concentrations tested, the terminal 31-hp inverted repeats. The DNA binding domain was localized to the N-terminal 98 amino acids and contains a CCHC sequence, a potential metal binding motif. We also demonstrate that the KP repressor protein can dimerize and contains two protein-protein interaction regions and that this dimerization is essential for high-affinity DNA binding. PMID:8816474

  1. The Drosophila P-element KP repressor protein dimerizes and interacts with multiple sites on P-element DNA.

    PubMed Central

    Lee, C C; Mul, Y M; Rio, D C

    1996-01-01

    Drosophila P elements are mobile DNA elements that encode an 87-kDa transposase enzyme and transpositional repressor proteins. One of these repressor proteins is the 207-amino-acid KP protein which is encoded by a naturally occurring P element with an internal deletion. To study the molecular mechanisms by which KP represses transposition, the protein was expressed, purified, and characterized. We show that the KP protein binds to multiple sites on the ends of P-element DNA, unlike the full-length transposase protein. These sites include the high-affinity transposase binding site, an 11-bp transpositional enhancer, and, at the highest concentrations tested, the terminal 31-hp inverted repeats. The DNA binding domain was localized to the N-terminal 98 amino acids and contains a CCHC sequence, a potential metal binding motif. We also demonstrate that the KP repressor protein can dimerize and contains two protein-protein interaction regions and that this dimerization is essential for high-affinity DNA binding. PMID:8816474

  2. Post-GWAS methodologies for localisation of functional non-coding variants: ANGPTL3

    PubMed Central

    Oldoni, Federico; Palmen, Jutta; Giambartolomei, Claudia; Howard, Philip; Drenos, Fotios; Plagnol, Vincent; Humphries, Steve E.; Talmud, Philippa J.; Smith, Andrew J.P.

    2016-01-01

    Genome-wide association studies have confirmed the involvement of non-coding angiopoietin-like 3 (ANGPTL3) gene variants with coronary artery disease, levels of low-density lipoprotein cholesterol (LDL-C), triglycerides and ANGPTL3 mRNA transcript. Extensive linkage disequilibrium at the locus, however, has hindered efforts to identify the potential functional variants. Using regulatory annotations from ENCODE, combined with functional in vivo assays such as allele-specific formaldehyde-assisted isolation of regulatory elements, statistical approaches including eQTL/lipid colocalisation, and traditional in vitro methodologies including electrophoretic mobility shift assay and luciferase reporter assays, variants affecting the ANGPTL3 regulome were examined. From 253 variants associated with ANGPTL3 mRNA expression, and/or lipid traits, 46 were located within liver regulatory elements and potentially functional. One variant, rs10889352, demonstrated allele-specific effects on DNA-protein interactions, reporter gene expression and chromatin accessibility, in line with effects on LDL-C levels and expression of ANGPTL3 mRNA. The ANGPTL3 gene lies within DOCK7, although the variant is within non-coding regions outside of ANGPTL3, within DOCK7, suggesting complex long-range regulatory effects on gene expression. This study illustrates the power of combining multiple genome-wide datasets with laboratory data to localise functional non-coding variation and provides a model for analysis of regulatory variants from GWAS. PMID:26800306

  3. Post-GWAS methodologies for localisation of functional non-coding variants: ANGPTL3.

    PubMed

    Oldoni, Federico; Palmen, Jutta; Giambartolomei, Claudia; Howard, Philip; Drenos, Fotios; Plagnol, Vincent; Humphries, Steve E; Talmud, Philippa J; Smith, Andrew J P

    2016-03-01

    Genome-wide association studies have confirmed the involvement of non-coding angiopoietin-like 3 (ANGPTL3) gene variants with coronary artery disease, levels of low-density lipoprotein cholesterol (LDL-C), triglycerides and ANGPTL3 mRNA transcript. Extensive linkage disequilibrium at the locus, however, has hindered efforts to identify the potential functional variants. Using regulatory annotations from ENCODE, combined with functional in vivo assays such as allele-specific formaldehyde-assisted isolation of regulatory elements, statistical approaches including eQTL/lipid colocalisation, and traditional in vitro methodologies including electrophoretic mobility shift assay and luciferase reporter assays, variants affecting the ANGPTL3 regulome were examined. From 253 variants associated with ANGPTL3 mRNA expression, and/or lipid traits, 46 were located within liver regulatory elements and potentially functional. One variant, rs10889352, demonstrated allele-specific effects on DNA-protein interactions, reporter gene expression and chromatin accessibility, in line with effects on LDL-C levels and expression of ANGPTL3 mRNA. The ANGPTL3 gene lies within DOCK7, although the variant is within non-coding regions outside of ANGPTL3, within DOCK7, suggesting complex long-range regulatory effects on gene expression. This study illustrates the power of combining multiple genome-wide datasets with laboratory data to localise functional non-coding variation and provides a model for analysis of regulatory variants from GWAS. PMID:26800306

  4. Short palindromic repetitive DNA elements in enterobacteria: a survey.

    PubMed

    Bachellier, S; Clément, J M; Hofnung, M

    1999-01-01

    We present a survey of short palindromic repetitive elements in enterobacteria. Seven families are presented. Five were already known (RSA, IRU, 29-bp repeats, BIMEs and boxC), and their properties are updated; in particular, a new composite element is shown to include the formerly identified boxC repeats. Two repetitions, YPAL1 and YPAL2, found primarily in Yersinia, are described here for the first time. PMID:10673002

  5. Structure of a Thyroid Hormone Receptor DNA-Binding Domain Homodimer Bound to an Inverted Palindrome DNA Response Element

    SciTech Connect

    Chen, Yi; Young, Matthew A.

    2010-10-22

    Thyroid hormone receptor (TR), as a member of the nuclear hormone receptor family, can recognize and bind different classes of DNA response element targets as either a monomer, a homooligomer, or a heterooligomer. We report here the first crystal structure of a homodimer TR DNA-binding domain (DBD) in complex with an inverted repeat class of thyroid response element (TRE). The structure shows a nearly symmetric structure of the TR DBD assembled on the F2 TRE where the base recognition contacts in the homodimer DNA complex are conserved relative to the previously published structure of a TR-9-cis-retinoic acid receptor heterodimer DNA complex. The new structure also reveals that the T-box region of the DBD can function as a structural hinge that enables a large degree of flexibility in the position of the C-terminal extension helix that connects the DBD to the ligand-binding domain. Although the isolated TR DBDs exist as monomers in solution, we have measured highly cooperative binding of the two TR DBD subunits onto the inverted repeat DNA sequence. This suggests that elements of the DBD can influence the specific TR oligomerization at target genes, and it is not just interactions between the ligand-binding domains that are responsible for TR oligomerization at target genes. Mutational analysis shows that intersubunit contacts at the DBD C terminus account for some, but not all, of the cooperative homodimer TR binding to the inverted repeat class TRE.

  6. Capture of flanking DNA by a P element in Drosophila melanogaster: Creation of a transposable element

    SciTech Connect

    Tsubota, Stuart, I.; Huong Dangvu )

    1991-02-01

    A 6.1-kilobase nsertion into the rudimentary (r) gene was cloned and partially sequenced. The insertion consists of a 703-base-pair (bp) P element next to a 5.4-kilobase single-copy sequence. The normal positon of the single-copy sequence is near the tip of the X chromosome. Upon insertion into the r gene, this chimeric element generated an 8-bp target-site duplication, characteristic of P elements. At the non-P-element end of the insertion, the first 8 bp are identical to the first 8 bp of the inverted terminal repeats of the P element. Thus, this element has inverted terminal repeats of 8 bp. This large element can excise from the r gene under conditions of hybrid dysgenesis, which indicates that it behaves like a normal P element. These data support the conclusion that a normally stable single-copy sequence has now become unstable and duplicated within the genome.

  7. Conserved noncoding sequences (CNSs) in higher plants.

    PubMed

    Freeling, Michael; Subramaniam, Shabarinath

    2009-04-01

    Plant conserved noncoding sequences (CNSs)--a specific category of phylogenetic footprint--have been shown experimentally to function. No plant CNS is conserved to the extent that ultraconserved noncoding sequences are conserved in vertebrates. Plant CNSs are enriched in known transcription factor or other cis-acting binding sites, and are usually clustered around genes. Genes that encode transcription factors and/or those that respond to stimuli are particularly CNS-rich. Only rarely could this function involve small RNA binding. Some transcribed CNSs encode short translation products as a form of negative control. Approximately 4% of Arabidopsis gene content is estimated to be both CNS-rich and occupies a relatively long stretch of chromosome: Bigfoot genes (long phylogenetic footprints). We discuss a 'DNA-templated protein assembly' idea that might help explain Bigfoot gene CNSs. PMID:19249238

  8. Novel DNA-binding element within the C-terminal extension of the nuclear receptor DNA-binding domain

    PubMed Central

    Jakób, Michał; Kołodziejczyk, Robert; Orłowski, Marek; Krzywda, Szymon; Kowalska, Agnieszka; Dutko-Gwóźdź, Joanna; Gwóźdź, Tomasz; Kochman, Marian; Jaskólski, Mariusz; Ożyhar, Andrzej

    2007-01-01

    The heterodimer of the ecdysone receptor (EcR) and ultraspiracle (Usp), members of the nuclear receptors superfamily, is considered as the functional receptor for ecdysteroids initiating molting and metamorphosis in insects. Here we report the 1.95 Å structure of the complex formed by the DNA-binding domains (DBDs) the EcR and the Usp, bound to the natural pseudopalindromic response element. Comparison of the structure with that obtained previously, using an idealized response element, shows how the EcRDBD, which has been previously reported to possess extraordinary flexibility, accommodates DNA-induced structural changes. Part of the C-terminal extension (CTE) of the EcRDBD folds into an α-helix whose location in the minor groove does not match any of the locations previously observed for nuclear receptors. Mutational analyses suggest that the α-helix is a component of EcR-box, a novel element indispensable for DNA-binding and located within the nuclear receptor CTE. This element seems to be a general feature of all known EcRs. PMID:17426125

  9. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  10. TFIIIC Bound DNA Elements in Nuclear Organization and Insulation

    PubMed Central

    Kirkland, Jacob G.; Raab, Jesse R.

    2012-01-01

    tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short Interspersed Nuclear Elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer -blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vise versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. \\ PMID:23000638

  11. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    PubMed Central

    Williams, Ryan M.; Kulick, Amanda R.; Yedlapalli, Srilakshmi; Battistella, Louisa; Hajiran, Cyrus J.; Sooter, Letha J.

    2014-01-01

    Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE) specific for bromacil. We have identified one MRE with high affinity (Kd = 9.6 nM) and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device. PMID:25400940

  12. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

    2004-08-01

    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  13. Radiation-induced changes in DNA methylation of repetitive elements in the mouse heart.

    PubMed

    Koturbash, Igor; Miousse, Isabelle R; Sridharan, Vijayalakshmi; Nzabarushimana, Etienne; Skinner, Charles M; Melnyk, Stepan B; Pavliv, Oleksandra; Hauer-Jensen, Martin; Nelson, Gregory A; Boerma, Marjan

    2016-05-01

    DNA methylation is a key epigenetic mechanism, needed for proper control over the expression of genetic information and silencing of repetitive elements. Exposure to ionizing radiation, aside from its strong genotoxic potential, may also affect the methylation of DNA, within the repetitive elements, in particular. In this study, we exposed C57BL/6J male mice to low absorbed mean doses of two types of space radiation-proton (0.1 Gy, 150 MeV, dose rate 0.53 ± 0.08 Gy/min), and heavy iron ions ((56)Fe) (0.5 Gy, 600 MeV/n, dose rate 0.38 ± 0.06 Gy/min). Radiation-induced changes in cardiac DNA methylation associated with repetitive elements were detected. Specifically, modest hypomethylation of retrotransposon LINE-1 was observed at day 7 after irradiation with either protons or (56)Fe. This was followed by LINE-1, and other retrotransposons, ERV2 and SINE B1, as well as major satellite DNA hypermethylation at day 90 after irradiation with (56)Fe. These changes in DNA methylation were accompanied by alterations in the expression of DNA methylation machinery and affected the one-carbon metabolism pathway. Furthermore, loss of transposable elements expression was detected in the cardiac tissue at the 90-day time-point, paralleled by substantial accumulation of mRNA transcripts, associated with major satellites. Given that the one-carbon metabolism pathway can be modulated by dietary modifications, these findings suggest a potential strategy for the mitigation and, possibly, prevention of the negative effects exerted by ionizing radiation on the cardiovascular system. Additionally, we show that the methylation status and expression of repetitive elements may serve as early biomarkers of exposure to space radiation. PMID:26963372

  14. Non-coding RNAs in lung cancer

    PubMed Central

    Ricciuti, Biagio; Mecca, Carmen; Crinò, Lucio; Baglivo, Sara; Cenci, Matteo; Metro, Giulio

    2014-01-01

    The discovery that protein-coding genes represent less than 2% of all human genome, and the evidence that more than 90% of it is actively transcribed, changed the classical point of view of the central dogma of molecular biology, which was always based on the assumption that RNA functions mainly as an intermediate bridge between DNA sequences and protein synthesis machinery. Accumulating data indicates that non-coding RNAs are involved in different physiological processes, providing for the maintenance of cellular homeostasis. They are important regulators of gene expression, cellular differentiation, proliferation, migration, apoptosis, and stem cell maintenance. Alterations and disruptions of their expression or activity have increasingly been associated with pathological changes of cancer cells, this evidence and the prospect of using these molecules as diagnostic markers and therapeutic targets, make currently non-coding RNAs among the most relevant molecules in cancer research. In this paper we will provide an overview of non-coding RNA function and disruption in lung cancer biology, also focusing on their potential as diagnostic, prognostic and predictive biomarkers. PMID:25593996

  15. Functional roles of non-coding Y RNAs

    PubMed Central

    Kowalski, Madzia P.; Krude, Torsten

    2015-01-01

    Non-coding RNAs are involved in a multitude of cellular processes but the biochemical function of many small non-coding RNAs remains unclear. The family of small non-coding Y RNAs is conserved in vertebrates and related RNAs are present in some prokaryotic species. Y RNAs are also homologous to the newly identified family of non-coding stem-bulge RNAs (sbRNAs) in nematodes, for which potential physiological functions are only now emerging. Y RNAs are essential for the initiation of chromosomal DNA replication in vertebrates and, when bound to the Ro60 protein, they are involved in RNA stability and cellular responses to stress in several eukaryotic and prokaryotic species. Additionally, short fragments of Y RNAs have recently been identified as abundant components in the blood and tissues of humans and other mammals, with potential diagnostic value. While the number of functional roles of Y RNAs is growing, it is becoming increasingly clear that the conserved structural domains of Y RNAs are essential for distinct cellular functions. Here, we review the biochemical functions associated with these structural RNA domains, as well as the functional conservation of Y RNAs in different species. The existing biochemical and structural evidence supports a domain model for these small non-coding RNAs that has direct implications for the modular evolution of functional non-coding RNAs. PMID:26159929

  16. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.

    2015-01-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  17. Sequence analysis of Vicia faba repeated DNA, the FokI repeat element.

    PubMed Central

    Kato, A; Yakura, K; Tanifuji, S

    1984-01-01

    A type of highly repeated DNA sequences present in the genome of Vicia faba was detected by digestion its nuclear DNA with FokI endonuclease and fractionating the digests on polyacrylamide gels. Four fragments of 59, 108, 177 and 246 bp of the FokI repeated sequences were collected from the gels and their primary structures were determined by the method of Maxam and Gilbert. These repeated DNA sequences were shown to be a multiple tandem array of a 59 bp sequence element. And its nucleotide sequence was almost completely conserved among all the sequence members of each the size class and also among these classes. This sequence element consists of a duplet of an about the duplet has an incomplete dyad symmetrical structure. Images PMID:6089113

  18. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae)

    PubMed Central

    2010-01-01

    Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH) ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH) region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead. PMID:20047671

  19. Satellite DNA-like elements associated with genes within euchromatin of the beetle Tribolium castaneum.

    PubMed

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Durđica

    2012-08-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5' untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  20. Hypoxic regulation of the noncoding genome and NEAT1.

    PubMed

    Choudhry, Hani; Mole, David R

    2016-05-01

    Activation of hypoxia pathways is both associated with and contributes to an aggressive phenotype across multiple types of solid cancers. The regulation of gene transcription by hypoxia-inducible factor (HIF) is a key element in this response. HIF directly upregulates the expression of many hundreds of protein-coding genes, which act to both improve oxygen delivery and to reduce oxygen demand. However, it is now becoming apparent that many classes of noncoding RNAs are also regulated by hypoxia, with several (e.g. micro RNAs, long noncoding RNAs and antisense RNAs) under direct transcriptional regulation by HIF. These hypoxia-regulated, noncoding RNAs may act as effectors of the indirect response to HIF by acting on specific coding transcripts or by affecting generic RNA-processing pathways. In addition, noncoding RNAs may also act as modulators of the HIF pathway, either by integrating other physiological responses or, in the case of HIF-regulated, noncoding RNAs, by providing negative or positive feedback and feedforward loops that affect upstream or downstream components of the HIF cascade. These hypoxia-regulated, noncoding transcripts play important roles in the aggressive hypoxic phenotype observed in cancer. PMID:26590207

  1. Hypoxic regulation of the noncoding genome and NEAT1

    PubMed Central

    Choudhry, Hani

    2016-01-01

    Activation of hypoxia pathways is both associated with and contributes to an aggressive phenotype across multiple types of solid cancers. The regulation of gene transcription by hypoxia-inducible factor (HIF) is a key element in this response. HIF directly upregulates the expression of many hundreds of protein-coding genes, which act to both improve oxygen delivery and to reduce oxygen demand. However, it is now becoming apparent that many classes of noncoding RNAs are also regulated by hypoxia, with several (e.g. micro RNAs, long noncoding RNAs and antisense RNAs) under direct transcriptional regulation by HIF. These hypoxia-regulated, noncoding RNAs may act as effectors of the indirect response to HIF by acting on specific coding transcripts or by affecting generic RNA-processing pathways. In addition, noncoding RNAs may also act as modulators of the HIF pathway, either by integrating other physiological responses or, in the case of HIF-regulated, noncoding RNAs, by providing negative or positive feedback and feedforward loops that affect upstream or downstream components of the HIF cascade. These hypoxia-regulated, noncoding transcripts play important roles in the aggressive hypoxic phenotype observed in cancer. PMID:26590207

  2. Whole Genome Duplications and a ‘Function’ for Junk DNA? Facts and Hypotheses

    PubMed Central

    Veitia, Reiner A.; Bottani, Samuel

    2009-01-01

    Background The lack of correlation between genome size and organismal complexity is understood in terms of the massive presence of repetitive and non-coding DNA. This non-coding subgenome has long been called “junk” DNA. However, it might have important functions. Generation of junk DNA depends on proliferation of selfish DNA elements and on local or global DNA duplication followed by genic non-fonctionalization. Methodology/Principal Findings Evidence from genomic analyses and experimental data indicates that Whole Genome Duplications (WGD) are often followed by a return to the diploid state, through DNA deletions and intra/interchromosomal rearrangements. We use simple theoretical models and simulations to explore how a WGD accompanied by sequence deletions might affect the dosage balance often required among several gene products involved in regulatory processes. We find that potential genomic deletions leading to changes in nuclear and cell volume might potentially perturb gene dosage balance. Conclusions/Significance The potentially negative impact of DNA deletions can be buffered if deleted genic DNA is, at least temporarily, replaced by repetitive DNA so that the nuclear/cell volume remains compatible with normal living. Thus, we speculate that retention of non-functionalized non-coding DNA, and replacement of deleted DNA through proliferation of selfish elements, might help avoid dosage imbalances in cycles of polyploidization and diploidization, which are particularly frequent in plants. PMID:20011530

  3. A Land Plant-Specific Transcription Factor Directly Enhances Transcription of a Pathogenic Noncoding RNA Template by DNA-Dependent RNA Polymerase II[OPEN

    PubMed Central

    Qu, Jie; Ji, Shaoyi; Wallace, Andrew J.; Wu, Jian; Li, Yi; Gopalan, Venkat; Ding, Biao

    2016-01-01

    Some DNA-dependent RNA polymerases (DdRPs) possess RNA-dependent RNA polymerase activity, as was first discovered in the replication of Potato spindle tuber viroid (PSTVd) RNA genome in tomato (Solanum lycopersicum). Recent studies revealed that this activity in bacteria and mammals is important for transcriptional and posttranscriptional regulatory mechanisms. Here, we used PSTVd as a model to uncover auxiliary factors essential for RNA-templated transcription by DdRP. PSTVd replication in the nucleoplasm generates (−)-PSTVd intermediates and (+)-PSTVd copies. We found that the Nicotiana benthamiana canonical 9-zinc finger (ZF) Transcription Factor IIIA (TFIIIA-9ZF) as well as its variant TFIIIA-7ZF interacted with (+)-PSTVd, but only TFIIIA-7ZF interacted with (−)-PSTVd. Suppression of TFIIIA-7ZF reduced PSTVd replication, and overexpression of TFIIIA-7ZF enhanced PSTVd replication in planta. Consistent with the locale of PSTVd replication, TFIIIA-7ZF was found in the nucleoplasm and nucleolus, in contrast to the strictly nucleolar localization of TFIIIA-9ZF. Footprinting assays revealed that only TFIIIA-7ZF bound to a region of PSTVd critical for initiating transcription. Furthermore, TFIIIA-7ZF strongly enhanced the in vitro transcription of circular (+)-PSTVd by partially purified Pol II. Together, our results identify TFIIIA-7ZF as a dedicated cellular transcription factor that acts in DdRP-catalyzed RNA-templated transcription, highlighting both the extraordinary evolutionary adaptation of viroids and the potential of DdRPs for a broader role in cellular processes. PMID:27113774

  4. A Land Plant-Specific Transcription Factor Directly Enhances Transcription of a Pathogenic Noncoding RNA Template by DNA-Dependent RNA Polymerase II.

    PubMed

    Wang, Ying; Qu, Jie; Ji, Shaoyi; Wallace, Andrew J; Wu, Jian; Li, Yi; Gopalan, Venkat; Ding, Biao

    2016-05-01

    Some DNA-dependent RNA polymerases (DdRPs) possess RNA-dependent RNA polymerase activity, as was first discovered in the replication of Potato spindle tuber viroid (PSTVd) RNA genome in tomato (Solanum lycopersicum). Recent studies revealed that this activity in bacteria and mammals is important for transcriptional and posttranscriptional regulatory mechanisms. Here, we used PSTVd as a model to uncover auxiliary factors essential for RNA-templated transcription by DdRP PSTVd replication in the nucleoplasm generates (-)-PSTVd intermediates and (+)-PSTVd copies. We found that the Nicotiana benthamiana canonical 9-zinc finger (ZF) Transcription Factor IIIA (TFIIIA-9ZF) as well as its variant TFIIIA-7ZF interacted with (+)-PSTVd, but only TFIIIA-7ZF interacted with (-)-PSTVd. Suppression of TFIIIA-7ZF reduced PSTVd replication, and overexpression of TFIIIA-7ZF enhanced PSTVd replication in planta. Consistent with the locale of PSTVd replication, TFIIIA-7ZF was found in the nucleoplasm and nucleolus, in contrast to the strictly nucleolar localization of TFIIIA-9ZF. Footprinting assays revealed that only TFIIIA-7ZF bound to a region of PSTVd critical for initiating transcription. Furthermore, TFIIIA-7ZF strongly enhanced the in vitro transcription of circular (+)-PSTVd by partially purified Pol II. Together, our results identify TFIIIA-7ZF as a dedicated cellular transcription factor that acts in DdRP-catalyzed RNA-templated transcription, highlighting both the extraordinary evolutionary adaptation of viroids and the potential of DdRPs for a broader role in cellular processes. PMID:27113774

  5. DNA Elements Reducing Transcriptional Gene Silencing Revealed by a Novel Screening Strategy

    PubMed Central

    Ueno, Keiichiro; Ohashi, Yuko; Mitsuhara, Ichiro

    2013-01-01

    Transcriptional gene silencing (TGS)–a phenomenon observed in endogenous genes/transgenes in eukaryotes–is a huge hindrance to transgenic technology and occurs mainly when the genes involved share sequence homology in their promoter regions. TGS depends on chromosomal position, suggesting the existence of genomic elements that suppress TGS. However, no systematic approach to identify such DNA elements has yet been reported. Here, we developed a successful novel screening strategy to identify such elements (anti-silencing regions–ASRs), based on their ability to protect a flanked transgene from TGS. A silenced transgenic tobacco plant in which a subsequently introduced transgene undergoes obligatory promoter-homology dependent TGS in trans allowed the ability of DNA elements to prevent TGS to be used as the screening criterion. We also identified ASRs in a genomic library from a different plant species (Lotus japonicus: a perennial legume); the ASRs include portions of Ty1/copia retrotransposon-like and pararetrovirus-like sequences; the retrotransposon-like sequences also showed interspecies anti-TGS activity in a TGS-induction system in Arabidopsis. Anti-TGS elements could provide effective tools to reduce TGS and ensure proper regulation of transgene expression. Furthermore, the screening strategy described here will also facilitate the efficient identification of new classes of anti-TGS elements. PMID:23382937

  6. Chilean Pitavia more closely related to Oceania and Old World Rutaceae than to Neotropical groups: evidence from two cpDNA non-coding regions, with a new subfamilial classification of the family

    PubMed Central

    Groppo, Milton; Kallunki, Jacquelyn A.; Pirani, José Rubens; Antonelli, Alexandre

    2012-01-01

    Abstract The position of the plant genus Pitavia within an infrafamilial phylogeny of Rutaceae (rue, or orange family) was investigated with the use of two non-coding regions from cpDNA, the trnL-trnF region and the rps16 intron. The only species of the genus, Pitavia punctata Molina, is restricted to the temperate forests of the Coastal Cordillera of Central-Southern Chile and threatened by loss of habitat. The genus traditionally has been treated as part of tribe Zanthoxyleae (subfamily Rutoideae) where it constitutes the monogeneric tribe Pitaviinae. This tribe and genus are characterized by fruits of 1 to 4 fleshy drupelets, unlike the dehiscent fruits typical of the subfamily. Fifty-five taxa of Rutaceae, representing 53 genera (nearly one-third of those in the family) and all subfamilies, tribes, and almost all subtribes of the family were included. Parsimony and Bayesian inference were used to infer the phylogeny; six taxa of Meliaceae, Sapindaceae, and Simaroubaceae, all members of Sapindales, were also used as out-groups. Results from both analyses were congruent and showed Pitavia as sister to Flindersia and Lunasia, both genera with species scattered through Australia, Philippines, Moluccas, New Guinea and the Malayan region, and phylogenetically far from other Neotropical Rutaceae, such as the Galipeinae (Galipeeae, Rutoideae) and Pteleinae (Toddalieae, former Toddalioideae). Additionally, a new circumscription of the subfamilies of Rutaceae is presented and discussed. Only two subfamilies (both monophyletic) are recognized: Cneoroideae (including Dictyolomatoideae, Spathelioideae, Cneoraceae, and Ptaeroxylaceae) and Rutoideae (including not only traditional Rutoideae but also Aurantioideae, Flindersioideae, and Toddalioideae). As a consequence, Aurantioideae (Citrus and allies) is reduced to tribal rank as Aurantieae. PMID:23717188

  7. Mavericks, a novel class of giant transposable elements widespread in eukaryotes and related to DNA viruses.

    PubMed

    Pritham, Ellen J; Putliwala, Tasneem; Feschotte, Cédric

    2007-04-01

    We previously identified a group of atypical mobile elements designated Mavericks from the nematodes Caenorhabditis elegans and C. briggsae and the zebrafish Danio rerio. Here we present the results of comprehensive database searches of the genome sequences available, which reveal that Mavericks are widespread in invertebrates and non-mammalian vertebrates but show a patchy distribution in non-animal species, being present in the fungi Glomus intraradices and Phakopsora pachyrhizi and in several single-celled eukaryotes such as the ciliate Tetrahymena thermophila, the stramenopile Phytophthora infestans and the trichomonad Trichomonas vaginalis, but not detectable in plants. This distribution, together with comparative and phylogenetic analyses of Maverick-encoded proteins, is suggestive of an ancient origin of these elements in eukaryotes followed by lineage-specific losses and/or recurrent episodes of horizontal transmission. In addition, we report that Maverick elements have amplified recently to high copy numbers in T. vaginalis where they now occupy as much as 30% of the genome. Sequence analysis confirms that most Mavericks encode a retroviral-like integrase, but lack other open reading frames typically found in retroelements. Nevertheless, the length and conservation of the target site duplication created upon Maverick insertion (5- or 6-bp) is consistent with a role of the integrase-like protein in the integration of a double-stranded DNA transposition intermediate. Mavericks also display long terminal-inverted repeats but do not contain ORFs similar to proteins encoded by DNA transposons. Instead, Mavericks encode a conserved set of 5 to 9 genes (in addition to the integrase) that are predicted to encode proteins with homology to replication and packaging proteins of some bacteriophages and diverse eukaryotic double-stranded DNA viruses, including a DNA polymerase B homolog and putative capsid proteins. Based on these and other structural similarities, we

  8. Polymorphism of t-specific DNA elements of the proximal part of Mus mouse chromosome 17

    SciTech Connect

    Shustrova, I.V.; Tokarskaya, O.N.; Chekunova, A.I.

    1995-05-01

    To study structural organization and polymorphism of the proximal part of chromosome 17, a hybridization analysis of DNA from mice of different origin was carried out using four t-specific probes. Results of the analysis allow us to conclude that the DNA element copy number is quantitatively unstable and differs in distribution in both newly formed recombinant haplotypes and in wild-type chromosome 17. Probe Tu66 was used to study D17Leh66-element organization of Mus abbotti and Mus hortulanus mice. Three types of D17Leh66-elements were identified in the genomes of these species. The copy number of each type of DNA element varied in the genome of each of four studied species. Homologs to t-specific Tu66 and Tu119 probes were found in the genome of Rattus norvegicus rat. The data obtained are discussed with respect to the evolution of the proximal part of Mus mouse chromosome 17. 29 refs., 5 figs., 2 tabs.

  9. Long noncoding RNAs in hematopoiesis

    PubMed Central

    Zhang, Xu; Hu, Wenqian

    2016-01-01

    Mammalian development is under tight control to ensure precise gene expression. Recent studies reveal a new layer of regulation of gene expression mediated by long noncoding RNAs. These transcripts are longer than 200nt that do not have functional protein coding capacity. Interestingly, many of these long noncoding RNAs are expressed with high specificity in different types of cells, tissues, and developmental stages in mammals, suggesting that they may have functional roles in diverse biological processes. Here, we summarize recent findings of long noncoding RNAs in hematopoiesis, which is one of the best-characterized mammalian cell differentiation processes. Then we provide our own perspectives on future studies of long noncoding RNAs in this field. PMID:27508063

  10. Non-coding RNA in neural function, disease, and aging

    PubMed Central

    Szafranski, Kirk; Abraham, Karan J.; Mekhail, Karim

    2015-01-01

    Declining brain and neurobiological function is arguably one of the most common features of human aging. The study of conserved aging processes as well as the characterization of various neurodegenerative diseases using different genetic models such as yeast, fly, mouse, and human systems is uncovering links to non-coding RNAs. These links implicate a variety of RNA-regulatory processes, including microRNA function, paraspeckle formation, RNA–DNA hybrid regulation, nucleolar RNAs and toxic RNA clearance, amongst others. Here we highlight these connections and reveal over-arching themes or questions related to recently appreciated roles of non-coding RNA in neural function and dysfunction across lifespan. PMID:25806046

  11. Progress and prospects of long noncoding RNAs in lipid homeostasis

    PubMed Central

    Chen, Zheng

    2015-01-01

    Background Long noncoding RNAs (lncRNAs) are a novel group of universally present, non-coding RNAs (>200 nt) that are increasingly recognized as key regulators of many physiological and pathological processes. Scope of review Recent publications have shown that lncRNAs influence lipid homeostasis by controlling lipid metabolism in the liver and by regulating adipogenesis. lncRNAs control lipid metabolism-related gene expression by either base-pairing with RNA and DNA or by binding to proteins. Major conclusions The recent advances and future prospects in understanding the roles of lncRNAs in lipid homeostasis are discussed. PMID:26977388

  12. EBV Noncoding RNAs.

    PubMed

    Skalsky, Rebecca L; Cullen, Bryan R

    2015-01-01

    EBV expresses a number of viral noncoding RNAs (ncRNAs) during latent infection, many of which have known regulatory functions and can post-transcriptionally regulate viral and/or cellular gene expression. With recent advances in RNA sequencing technologies, the list of identified EBV ncRNAs continues to grow. EBV-encoded RNAs (EBERs) , the BamHI-A rightward transcripts (BARTs) , a small nucleolar RNA (snoRNA) , and viral microRNAs (miRNAs) are all expressed during EBV infection in a variety of cell types and tumors. Recently, additional novel EBV ncRNAs have been identified. Viral miRNAs, in particular, have been under extensive investigation since their initial identification over ten years ago. High-throughput studies to capture miRNA targets have revealed a number of miRNA-regulated viral and cellular transcripts that tie into important biological networks. Functions for many EBV ncRNAs are still unknown; however, roles for many EBV miRNAs in latency and in tumorigenesis have begun to emerge. Ongoing mechanistic studies to elucidate the functions of EBV ncRNAs should unravel additional roles for ncRNAs in the viral life cycle. In this chapter, we will discuss our current knowledge of the types of ncRNAs expressed by EBV, their potential roles in viral latency, and their potential involvement in viral pathogenesis. PMID:26428375

  13. Effect of oxidative DNA damage in promoter elements on transcription factor binding.

    PubMed Central

    Ghosh, R; Mitchell, D L

    1999-01-01

    Reactive oxygen species produced by endogenous metabolic activity and exposure to a multitude of exogenous agents impact cells in a variety of ways. The DNA base damage 8-oxodeoxyguanosine (8-oxodG) is a prominent indicator of oxidative stress and has been well-characterized as a premutagenic lesion in mammalian cells and putative initiator of the carcinogenic process. Commensurate with the recent interest in epigenetic pathways of cancer causation we investigated how 8-oxodG alters the interaction between cis elements located on gene promoters and sequence-specific DNA binding proteins associated with these promoters. Consensus binding sequences for the transcription factors AP-1, NF-kappaB and Sp1 were modified site-specifically at guanine residues and electrophoretic mobility shift assays were performed to assess DNA-protein interactions. Our results indicate that whereas a single 8-oxodG was sufficient to inhibit transcription factor binding to AP-1 and Sp1 sequences it had no effect on binding to NF-kappaB, regardless of its position. We conclude from these data that minor alterations in base composition at a crucial position within some, but not all, promoter elements have the ability to disrupt transcription factor binding. The lack of inhibition by damaged NF-kappaB sequences suggests that DNA-protein contact sites may not be as determinative for stable p50 binding to this promoter as other, as yet undefined, structural parameters. PMID:10454620

  14. Nanoparticle-labeled DNA capture elements for detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Holwitt, Eric A.; Parker, Jill E.; Vivekananda, Jeevalatha; Franz, Veronica

    2004-12-01

    Aptamers, synthetic DNA capture elements (DCEs), can be made chemically or in genetically engineered bacteria. DNA capture elements are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare or terrorism agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. The probes can then be conjugated to Quantum Dots and super paramagnetic nanoparticles. The former provide intense, bleach-resistant fluorescent detection of bioagent and the latter provide a means to collect the bioagents with a magnet. The fluorescence can be detected in a flow cytometer, in a fluorescence plate reader, or with a fluorescence microscope. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. DCEs can easily distinguish Bacillus anthracis from its nearest relatives, Bacillus cereus and Bacillus thuringiensis. Development of a high through-put process is currently being investigated.

  15. Modular sequence elements associated with origin regions in eukaryotic chromosomal DNA.

    PubMed Central

    Dobbs, D L; Shaiu, W L; Benbow, R M

    1994-01-01

    We have postulated that chromosomal replication origin regions in eukaryotes have in common clusters of certain modular sequence elements (Benbow, Zhao, and Larson, BioEssays 14, 661-670, 1992). In this study, computer analyses of DNA sequences from six origin regions showed that each contained one or more potential initiation regions consisting of a putative DUE (DNA unwinding element) aligned with clusters of SAR (scaffold associated region), and ARS (autonomously replicating sequence) consensus sequences, and pyrimidine tracts. The replication origins analyzed were from the following loci: Tetrahymena thermophila macronuclear rDNA gene, Chinese hamster ovary dihydrofolate reductase amplicon, human c-myc proto-oncogene, chicken histone H5 gene, Drosophila melanogaster chorion gene cluster on the third chromosome, and Chinese hamster ovary rhodopsin gene. The locations of putative initiation regions identified by the computer analyses were compared with published data obtained using diverse methods to map initiation sites. For at least four loci, the potential initiation regions identified by sequence analysis aligned with previously mapped initiation events. A consensus DNA sequence, WAWTTDDWWWDHWGWHMAWTT, was found within the potential initiation regions in every case. An additional 35 kb of combined flanking sequences from the six loci were also analyzed, but no additional copies of this consensus sequence were found. Images PMID:8041609

  16. The fission yeast CENP-B protein Abp1 prevents pervasive transcription of repetitive DNA elements.

    PubMed

    Daulny, Anne; Mejía-Ramírez, Eva; Reina, Oscar; Rosado-Lugo, Jesus; Aguilar-Arnal, Lorena; Auer, Herbert; Zaratiegui, Mikel; Azorin, Fernando

    2016-10-01

    It is well established that eukaryotic genomes are pervasively transcribed producing cryptic unstable transcripts (CUTs). However, the mechanisms regulating pervasive transcription are not well understood. Here, we report that the fission yeast CENP-B homolog Abp1 plays an important role in preventing pervasive transcription. We show that loss of abp1 results in the accumulation of CUTs, which are targeted for degradation by the exosome pathway. These CUTs originate from different types of genomic features, but the highest increase corresponds to Tf2 retrotransposons and rDNA repeats, where they map along the entire elements. In the absence of abp1, increased RNAPII-Ser5P occupancy is observed throughout the Tf2 coding region and, unexpectedly, RNAPII-Ser5P is enriched at rDNA repeats. Loss of abp1 also results in Tf2 derepression and increased nucleolus size. Altogether these results suggest that Abp1 prevents pervasive RNAPII transcription of repetitive DNA elements (i.e., Tf2 and rDNA repeats) from internal cryptic sites. PMID:27345571

  17. The Contribution of Alu Elements to Mutagenic DNA Double-Strand Break Repair

    PubMed Central

    Streva, Vincent A.; DeFreece, Cecily B.; Hedges, Dale J.; Deininger, Prescott L.

    2015-01-01

    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  18. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P

    1990-01-01

    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  19. Long non-coding RNA PVT1 and cancer.

    PubMed

    Cui, Ming; You, Lei; Ren, Xiaoxia; Zhao, Wenjing; Liao, Quan; Zhao, Yupei

    2016-02-26

    Genome-wide sequencing technologies have led to the identification of many non-coding RNAs and revealed an important role for these molecules in cancer. Although there have been many studies on the role of short non-coding RNAs in cancer, much work remains to characterize the functions of long non-coding RNAs. PVT1, a long non-coding RNA encoded by the human PVT1 gene, is located in the well-known cancer-related region 8q24, also known as the 8q24 'gene desert.' PVT1 has three main molecular mechanisms of action: participating in DNA rearrangements, encoding microRNAs, and interacting with MYC. Studies on the association between PVT1 and cancer have shown that PVT1 is a potential oncogene in a variety of cancer types. However, the underlying molecular mechanisms of PVT1 in cancer remain unknown. Further studies of PVT1 will be required to test the utility of this molecule as a target for cancer diagnosis and therapy, and they should also increase our understanding of the role of long non-coding RNAs in tumorigenesis. PMID:26850852

  20. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    SciTech Connect

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.

    2006-07-06

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  1. A Long Noncoding RNA Regulates Sister Chromatid Cohesion.

    PubMed

    Marchese, Francesco P; Grossi, Elena; Marín-Béjar, Oskar; Bharti, Sanjay Kumar; Raimondi, Ivan; González, Jovanna; Martínez-Herrera, Dannys Jorge; Athie, Alejandro; Amadoz, Alicia; Brosh, Robert M; Huarte, Maite

    2016-08-01

    Long noncoding RNAs (lncRNAs) are involved in diverse cellular processes through multiple mechanisms. Here, we describe a previously uncharacterized human lncRNA, CONCR (cohesion regulator noncoding RNA), that is transcriptionally activated by MYC and is upregulated in multiple cancer types. The expression of CONCR is cell cycle regulated, and it is required for cell-cycle progression and DNA replication. Moreover, cells depleted of CONCR show severe defects in sister chromatid cohesion, suggesting an essential role for CONCR in cohesion establishment during cell division. CONCR interacts with and regulates the activity of DDX11, a DNA-dependent ATPase and helicase involved in DNA replication and sister chromatid cohesion. These findings unveil a direct role for an lncRNA in the establishment of sister chromatid cohesion by modulating DDX11 enzymatic activity. PMID:27477908

  2. Effects of trace elements and pesticides on dephosphorylation of RNA and DNA added to soils

    SciTech Connect

    Frankenberger, W.T. Jr.; Johanson, J.B.; Lund L.J.

    1986-01-01

    This study was carried out to assess the effects of 14 trace elements, 12 herbicides, and two fungicides on dephosphorylation of yeast ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) added to soils (Xerollic Calciorthids and Typic Haploxeralfs). The cumulative amount of ortho phosphate (Pi) released from nucleic acids increased linearly with time of incubation (up to 72 h), decreased with profile depth, and was highly influenced by soil pH. When trace elements were applied and compared by using 2.5 mmol kg/sup -1/ of soil, the average inhibition in dephosphorylation of RNA and DNA in two soils ranged from 17% with Co(II) to 52% with Cu(II). The most effective inhibitors of nucleic acid dephosphorylation were Ag(I), Cu(I), Cd(II), Cu(II), Mn(II), Ni(II), and Pb(II) (avg inhibition greater than or equal to 35%). Other elements that inhibited dephosphorylation of RNA and DNA added to soils included Ba(II), Co(II), Hg(II), Zn(II), Ti(IV), V(IV), and W(VI). When the pesticides were compared by using 5 mg of active ingredient kg/sup -1/ of soil, the average inhibition in nucleic acid dephosphorylation ranged from 14% with butylate to 39% with chloramben. The most effective inhibitors (> 25%) were atrazine, naptalam, chloramben, dicamba, trifluralin, and maneb. Other pesticides that inhibited RNA and DNA dephosphorylation in soils included cyanazine, 2,4-D, dinitroamine, EPTC plus R-25788, alachlor, paraquat, butylate, and captan.

  3. Noncoding DNA, Zipf's law, and language.

    PubMed

    Konopka, A K; Martindale, C

    1995-05-12

    In the report "Continent-ocean chemical heterogeneity in the mantle based on seismic tomography" by Alessandro M. Forte et al. (21 Apr., p. 386), note 14 (p. 388) should have included the following sentence at the end. "We note, however, that this classical measure of significance does not take into account the red spectrum of the observed nonhydrostatic geoid, whose harmonic coefficients cannot be properly regarded as a random distribution; therefore, the statistical significance of the measured correlation coefficient is possibly less than 99%. PMID:7754361

  4. Cotyledon nuclear proteins bind to DNA fragments harboring regulatory elements of phytohemagglutinin genes.

    PubMed Central

    Riggs, C D; Voelker, T A; Chrispeels, M J

    1989-01-01

    The effects of deleting DNA sequences upstream from the phytohemagglutinin-L gene of Phaseolus vulgaris have been examined with respect to the level of gene product produced in the seeds of transgenic tobacco. Our studies indicate that several upstream regions quantitatively modulate expression. Between -1000 and -675, a negative regulatory element reduces expression approximately threefold relative to shorter deletion mutants that do not contain this region. Positive regulatory elements lie between -550 and -125 and, compared with constructs containing only 125 base pairs of upstream sequences (-125), the presence of these two regions can be correlated with a 25-fold and a 200-fold enhancement of phytohemagglutinin-L levels. These experiments were complemented by gel retardation assays, which demonstrated that two of the three regions bind cotyledon nuclear proteins from mid-mature seeds. One of the binding sites maps near a DNA sequence that is highly homologous to protein binding domains located upstream from the soybean seed lectin and Kunitz trypsin inhibitor genes. Competition experiments demonstrated that the upstream regions of a bean beta-phaseolin gene, the soybean seed lectin gene, and an oligonucleotide from the upstream region of the trypsin inhibitor gene can compete differentially for factor binding. We suggest that these legume genes may be regulated in part by evolutionarily conserved protein/DNA interactions. PMID:2535513

  5. Noncoding RNAs in Cancer Immunology.

    PubMed

    Li, Qian; Liu, Qiang

    2016-01-01

    Cancer immunology is the study of interaction between cancer cells and immune system by the application of immunology principle and theory. With the recent approval of several new drugs targeting immune checkpoints in cancer, cancer immunology has become a very attractive field of research and is thought to be the new hope to conquer cancer. This chapter introduces the aberrant expression and function of noncoding RNAs, mainly microRNAs and long noncoding RNAs, in tumor-infiltrating immune cells, and their significance in tumor immunity. It also illustrates how noncoding RNAs are shuttled between tumor cells and immune cells in tumor microenvironments via exosomes or other microvesicles to modulate tumor immunity. PMID:27376738

  6. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine

    PubMed Central

    Williams, Ryan M.; Crihfield, Cassandra L.; Gattu, Srikanth; Holland, Lisa A.; Sooter, Letha J.

    2014-01-01

    Widespread use of the chlorotriazine herbicide, atrazine, has led to serious environmental and human health consequences. Current methods of detecting atrazine contamination are neither rapid nor cost-effective. In this work, atrazine-specific single-stranded DNA (ssDNA) molecular recognition elements (MRE) were isolated. We utilized a stringent Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology that placed the greatest emphasis on what the MRE should not bind to. After twelve rounds of SELEX, an atrazine-specific MRE with high affinity was obtained. The equilibrium dissociation constant (Kd) of the ssDNA sequence is 0.62 ± 0.21 nM. It also has significant selectivity for atrazine over atrazine metabolites and other pesticides found in environmentally similar locations and concentrations. Furthermore, we have detected environmentally relevant atrazine concentrations in river water using this MRE. The strong affinity and selectivity of the selected atrazine-specific ssDNA validated the stringent SELEX methodology and identified a MRE that will be useful for rapid atrazine detection in environmental samples. PMID:25196435

  7. Retrotransposon-associated long non-coding RNAs in mice and men.

    PubMed

    Ganesh, Sravya; Svoboda, Petr

    2016-06-01

    Over a half of mammalian genomes is occupied by repetitive elements whose ability to provide functional sequences, move into new locations, and recombine underlies the so-called genome plasticity. At the same time, mobile elements exemplify selfish DNA, which is expanding in the genome at the expense of the host. The selfish generosity of mobile genetic elements is in the center of research interest as it offers insights into mechanisms underlying evolution and emergence of new genes. In terms of numbers, with over 20,000 in count, protein-coding genes make an outstanding >2 % minority. This number is exceeded by an ever-growing list of genes producing long non-coding RNAs (lncRNAs), which do not encode for proteins. LncRNAs are a dynamically evolving population of genes. While it is not yet clear what fraction of lncRNAs represents functionally important ones, their features imply that many lncRNAs emerge at random as new non-functional elements whose functionality is acquired through natural selection. Here, we explore the intersection of worlds of mobile genetic elements (particularly retrotransposons) and lncRNAs. In addition to summarizing essential features of mobile elements and lncRNAs, we focus on how retrotransposons contribute to lncRNA evolution, structure, and function in mammals. PMID:27044413

  8. DANIO-CODE: Toward an Encyclopedia of DNA Elements in Zebrafish

    PubMed Central

    2016-01-01

    Abstract The zebrafish has emerged as a model organism for genomics studies. The symposium “Toward an encyclopedia of DNA elements in zebrafish” held in London in December 2014, was coorganized by Ferenc Müller and Fiona Wardle. This meeting is a follow-up of a similar previous workshop held 2 years earlier and represents a push toward the formalization of a community effort to annotate functional elements in the zebrafish genome. The meeting brought together zebrafish researchers, bioinformaticians, as well as members of established consortia, to exchange scientific findings and experience, as well as to discuss the initial steps toward the formation of a DANIO-CODE consortium. In this study, we provide the latest updates on the current progress of the consortium's efforts, opening up a broad invitation to researchers to join in and contribute to DANIO-CODE. PMID:26671609

  9. Regulation of Transcription by Long Noncoding RNAs

    PubMed Central

    Bonasio, Roberto; Shiekhattar, Ramin

    2014-01-01

    Over the past decade there has been a greater understanding of genomic complexity in eukaryotes ushered in by the immense technological advances in high-throughput sequencing of DNA and its corresponding RNA transcripts. This has resulted in the realization that beyond protein-coding genes, there are a large number of transcripts that do not encode for proteins and, therefore, may perform their function through RNA sequences and/or through secondary and tertiary structural determinants. This review is focused on the latest findings on a class of noncoding RNAs that are relatively large (>200 nucleotides), display nuclear localization, and use different strategies to regulate transcription. These are exciting times for discovering the biological scope and the mechanism of action for these RNA molecules, which have roles in dosage compensation, imprinting, enhancer function, and transcriptional regulation, with a great impact on development and disease. PMID:25251851

  10. Long noncoding RNAs in innate immunity

    PubMed Central

    Zhang, Yuan; Cao, Xuetao

    2016-01-01

    Long noncoding RNAs (lncRNAs) have been shown to play important roles in immune cell development and immune responses through different mechanisms, such as dosage compensation, imprinting, enhancer function, and transcriptional regulation. Although the functions of most lncRNAs are unclear, some lncRNAs have been found to control transcriptional or post-transcriptional regulation of the innate and adaptive immune responses via new methods of protein–protein interactions or pairing with DNA and RNA. Interestingly, increasing evidence has elucidated the importance of lncRNAs in the interaction between hosts and pathogens. In this review, an overview of the lncRNAs modes of action, as well as the important and diversified roles of lncRNAs in immunity, are provided, and an emerging paradigm of lncRNAs in regulating innate immune responses is highlighted. PMID:26277893

  11. Noncoding RNAs in Endocrine Malignancy

    PubMed Central

    Kentwell, Jessica; Gundara, Justin S.

    2014-01-01

    Only recently has it been uncovered that the mammalian transcriptome includes a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. Among numerous kinds of ncRNAs, short noncoding RNAs, such as microRNAs, have been extensively investigated with regard to their biogenesis, function, and importance in carcinogenesis. Long noncoding RNAs (lncRNAs) have only recently been implicated in playing a key regulatory role in cancer biology. The deregulation of ncRNAs has been demonstrated to have important roles in the regulation and progression of cancer development. In this review, we describe the roles of both short noncoding RNAs (including microRNAs, small nuclear RNAs, and piwi-interacting RNAs) and lncRNAs in carcinogenesis and outline the possible underlying genetic mechanisms, with particular emphasis on clinical applications. The focus of our review includes studies from the literature on ncRNAs in traditional endocrine-related cancers, including thyroid, parathyroid, adrenal gland, and gastrointestinal neuroendocrine malignancies. The current and potential future applications of ncRNAs in clinical cancer research is also discussed, with emphasis on diagnosis and future treatment. PMID:24718512

  12. Conserved Noncoding Sequences Highlight Shared Components of Regulatory Networks in Dicotyledonous Plants[W

    PubMed Central

    Baxter, Laura; Jironkin, Aleksey; Hickman, Richard; Moore, Jay; Barrington, Christopher; Krusche, Peter; Dyer, Nigel P.; Buchanan-Wollaston, Vicky; Tiskin, Alexander; Beynon, Jim; Denby, Katherine; Ott, Sascha

    2012-01-01

    Conserved noncoding sequences (CNSs) in DNA are reliable pointers to regulatory elements controlling gene expression. Using a comparative genomics approach with four dicotyledonous plant species (Arabidopsis thaliana, papaya [Carica papaya], poplar [Populus trichocarpa], and grape [Vitis vinifera]), we detected hundreds of CNSs upstream of Arabidopsis genes. Distinct positioning, length, and enrichment for transcription factor binding sites suggest these CNSs play a functional role in transcriptional regulation. The enrichment of transcription factors within the set of genes associated with CNS is consistent with the hypothesis that together they form part of a conserved transcriptional network whose function is to regulate other transcription factors and control development. We identified a set of promoters where regulatory mechanisms are likely to be shared between the model organism Arabidopsis and other dicots, providing areas of focus for further research. PMID:23110901

  13. Chemical Elemental Distribution and Soil DNA Fingerprints Provide the Critical Evidence in Murder Case Investigation

    PubMed Central

    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea

    2011-01-01

    Background The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. Methodology/Principal Findings The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Conclusions Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping. PMID:21674041

  14. An ARS element inhibits DNA replication through a SIR2-dependent mechanism.

    PubMed

    Crampton, Amber; Chang, FuJung; Pappas, Donald L; Frisch, Ryan L; Weinreich, Michael

    2008-04-25

    During G1 phase, a prereplicative complex (pre-RC) that determines where DNA synthesis initiates forms at origins. The Sir2p histone deacetylase inhibits pre-RC assembly at a subset of origins, suggesting that Sir2p inhibits DNA replication through a unique aspect of origin structure. Here, we identified five SIR2-sensitive origins on chromosomes III and VI. Linker scan analysis of two origins indicated that they share a common organization, including an inhibitory sequence positioned 3' to the sites of origin recognition complex (ORC) binding and pre-RC assembly. This inhibitory sequence (I(S)) required SIR2 for its activity, suggesting that SIR2 inhibits origins through this sequence. Furthermore, I(S) elements occurred within positioned nucleosomes, and Abf1p-mediated exclusion of nucleosomes from the origin abrogated the inhibition. These data suggest that Sir2p and I(S) elements inhibit origin activity by promoting an unfavorable chromatin structure for pre-RC assembly. PMID:18439895

  15. Transcription factor interactions: Selectors of positive or negative regulation from a single DNA element

    SciTech Connect

    Diamond, M.I.; Miner, J.N.; Yoshinaga, S.K.; Yamamoto, K.R. )

    1990-09-14

    The mechanism by which a single factor evokes opposite regulatory effects from a specific DNA sequence is not well understood. In this study, a 25-base pair element that resides upstream of the mouse proliferin gene was examined; it conferred on linked promoters either positive or negative glucocorticoid regulation, depending upon physiological context. This sequence, denoted a composite glucocorticoid response element (GRE), was bound selective in vitro both by the glucocorticoid receptor and by c-Jun and c-Fos, components of the phorbol ester-activated AP-1 transcription factor. Indeed, c-Jun and c-Fos served as selectors of hormone responsiveness: the composite GRE was inactive in the absence of c-Jun, whereas it conferred a positive glucocorticoid effect in the presence of c-Jun, and a negative glucocorticoid effect in the presence of c-Jun and relatively high levels of c-Fos. The receptor also interacted selectively with c-Jun in vitro. A general model for composite GRE action is proposed that invokes both DNA binding and protein-protein interactions by receptor and nonreceptor factors.

  16. Altered Response Hierarchy and Increased T-Cell Breadth upon HIV-1 Conserved Element DNA Vaccination in Macaques

    PubMed Central

    Kulkarni, Viraj; Valentin, Antonio; Rosati, Margherita; Alicea, Candido; Singh, Ashish K.; Jalah, Rashmi; Broderick, Kate E.; Sardesai, Niranjan Y.; Le Gall, Sylvie; Mothe, Beatriz; Brander, Christian; Rolland, Morgane; Mullins, James I.; Pavlakis, George N.; Felber, Barbara K.

    2014-01-01

    HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24gag elements (CE) induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist. PMID:24465991

  17. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    PubMed

    Kulkarni, Viraj; Valentin, Antonio; Rosati, Margherita; Alicea, Candido; Singh, Ashish K; Jalah, Rashmi; Broderick, Kate E; Sardesai, Niranjan Y; Le Gall, Sylvie; Mothe, Beatriz; Brander, Christian; Rolland, Morgane; Mullins, James I; Pavlakis, George N; Felber, Barbara K

    2014-01-01

    HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag) elements (CE) induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag) increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist. PMID:24465991

  18. Noncoding RNA Gas5 Is a Growth Arrest and Starvation-Associated Repressor of the Glucocorticoid Receptor

    PubMed Central

    Kino, Tomoshige; Hurt, Darrell E.; Ichijo, Takamasa; Nader, Nancy; Chrousos, George P.

    2010-01-01

    The availability of nutrients influences cellular growth and survival by affecting gene transcription. Glucocorticoids also influence gene transcription and have diverse activities on cell growth, energy expenditure, and survival. We found that the growth arrest-specific 5 (Gas5) noncoding RNA, which is abundant in cells whose growth has been arrested due to lack of nutrients or growth factors, sensitized cells to apoptosis by suppressing glucocorticoid-mediated induction of several responsive genes, including the one encoding cellular inhibitor of apoptosis 2. Gas5 bound to the DNA-binding domain of the glucocorticoid receptor (GR) by acting as a decoy “glucocorticoid response element (GRE)”, thus, competing with DNA GREs for binding to the GR. We conclude that Gas5 is a ribo-repressor of the GR, influencing cell survival and metabolic activities during starvation by modulating the transcriptional activity of the GR. PMID:20124551

  19. GAGA factor binding to DNA via a single trinucleotide sequence element.

    PubMed Central

    Wilkins, R C; Lis, J T

    1998-01-01

    GAGA transcription factor (GAF) is an essential protein in Drosophila , important for the transcriptional regulation of numerous genes. GAF binds to GA repeats in the promoters of these genes via a DNA-binding domain containing a single zinc finger. While GAF binding sites are typically composed of 3.5 GA repeats, the Drosophila hsp70 gene contains much smaller elements, some of which are as little as three bases (GAG) in length. Interestingly, the binding of GAF to more distant trinucleotide elements is relatively strong and not appreciably affected by the removal of larger GA arrays in the promoter. Moreover, a simple synthetic GAG sequence is sufficient to bind GAF in vitro . Here we directly compare the affinity of GAF for different sequence elements by immunoprecipitation and gel mobility shift analysis. Furthermore, our measures of the concentration of GAF in vivo indicate that it is a highly abundant nuclear protein, prevalent enough to occupy a sizable fraction of correspondingly abundant trinucleotide sites. PMID:9592153

  20. The 3' noncoding region of beta-globin mRNA is not essential for in vitro translation.

    PubMed Central

    Kronenberg, M N; Roberts, B E; Efstratiadis, A

    1979-01-01

    Rabbit beta globin DNA sequence, excised from plasmid pbetaG1, directs in vitro synthesis of beta-globin in a transcription-translation cell-free system, even after specific elimination of the entire 3'-noncoding region. A DNA restriction fragment carrying this 3' noncoding region and hybridized to globin mRNA cannot arrest the cell-free translation of beta-globin mRNA. Images PMID:424286

  1. A Collection of Conserved Noncoding Sequences to Study Gene Regulation in Flowering Plants1[OPEN

    PubMed Central

    2016-01-01

    Transcription factors (TFs) regulate gene expression by binding cis-regulatory elements, of which the identification remains an ongoing challenge owing to the prevalence of large numbers of nonfunctional TF binding sites. Powerful comparative genomics methods, such as phylogenetic footprinting, can be used for the detection of conserved noncoding sequences (CNSs), which are functionally constrained and can greatly help in reducing the number of false-positive elements. In this study, we applied a phylogenetic footprinting approach for the identification of CNSs in 10 dicot plants, yielding 1,032,291 CNSs associated with 243,187 genes. To annotate CNSs with TF binding sites, we made use of binding site information for 642 TFs originating from 35 TF families in Arabidopsis (Arabidopsis thaliana). In three species, the identified CNSs were evaluated using TF chromatin immunoprecipitation sequencing data, resulting in significant overlap for the majority of data sets. To identify ultraconserved CNSs, we included genomes of additional plant families and identified 715 binding sites for 501 genes conserved in dicots, monocots, mosses, and green algae. Additionally, we found that genes that are part of conserved mini-regulons have a higher coherence in their expression profile than other divergent gene pairs. All identified CNSs were integrated in the PLAZA 3.0 Dicots comparative genomics platform (http://bioinformatics.psb.ugent.be/plaza/versions/plaza_v3_dicots/) together with new functionalities facilitating the exploration of conserved cis-regulatory elements and their associated genes. The availability of this data set in a user-friendly platform enables the exploration of functional noncoding DNA to study gene regulation in a variety of plant species, including crops. PMID:27261064

  2. A Collection of Conserved Noncoding Sequences to Study Gene Regulation in Flowering Plants.

    PubMed

    Van de Velde, Jan; Van Bel, Michiel; Vaneechoutte, Dries; Vandepoele, Klaas

    2016-08-01

    Transcription factors (TFs) regulate gene expression by binding cis-regulatory elements, of which the identification remains an ongoing challenge owing to the prevalence of large numbers of nonfunctional TF binding sites. Powerful comparative genomics methods, such as phylogenetic footprinting, can be used for the detection of conserved noncoding sequences (CNSs), which are functionally constrained and can greatly help in reducing the number of false-positive elements. In this study, we applied a phylogenetic footprinting approach for the identification of CNSs in 10 dicot plants, yielding 1,032,291 CNSs associated with 243,187 genes. To annotate CNSs with TF binding sites, we made use of binding site information for 642 TFs originating from 35 TF families in Arabidopsis (Arabidopsis thaliana). In three species, the identified CNSs were evaluated using TF chromatin immunoprecipitation sequencing data, resulting in significant overlap for the majority of data sets. To identify ultraconserved CNSs, we included genomes of additional plant families and identified 715 binding sites for 501 genes conserved in dicots, monocots, mosses, and green algae. Additionally, we found that genes that are part of conserved mini-regulons have a higher coherence in their expression profile than other divergent gene pairs. All identified CNSs were integrated in the PLAZA 3.0 Dicots comparative genomics platform (http://bioinformatics.psb.ugent.be/plaza/versions/plaza_v3_dicots/) together with new functionalities facilitating the exploration of conserved cis-regulatory elements and their associated genes. The availability of this data set in a user-friendly platform enables the exploration of functional noncoding DNA to study gene regulation in a variety of plant species, including crops. PMID:27261064

  3. Noncoding RNAs in breast cancer.

    PubMed

    Lo, Pang-Kuo; Wolfson, Benjamin; Zhou, Xipeng; Duru, Nadire; Gernapudi, Ramkishore; Zhou, Qun

    2016-05-01

    The mammalian transcriptome has recently been revealed to encompass a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. MicroRNAs (miRNAs), the best studied of the short noncoding RNAs (sncRNAs), have been extensively characterized with regard to their biogenesis, function and importance in tumorigenesis. Another class of sncRNAs called piwi-interacting RNAs (piRNAs) has also gained attention recently in cancer research owing to their critical role in stem cell regulation. Long noncoding RNAs (lncRNAs) of >200 nucleotides in length have recently emerged as key regulators of developmental processes, including mammary gland development. lncRNA dysregulation has also been implicated in the development of various cancers, including breast cancer. In this review, we describe and discuss the roles of sncRNAs (including miRNAs and piRNAs) and lncRNAs in the initiation and progression of breast tumorigenesis, with a focus on outlining the molecular mechanisms of oncogenic and tumor-suppressor ncRNAs. Moreover, the current and potential future applications of ncRNAs to clinical breast cancer research are also discussed, with an emphasis on ncRNA-based diagnosis, prognosis and future therapeutics. PMID:26685283

  4. Close sequence comparisons are sufficient to identify human cis-regulatory elements.

    PubMed

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M; Couronne, Olivier; Pennacchio, Len A

    2006-07-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons. To address this problem, we identified evolutionarily conserved noncoding regions in primate, mammalian, and more distant comparisons using a uniform approach (Gumby) that facilitates unbiased assessment of the impact of evolutionary distance on predictive power. We benchmarked computational predictions against previously identified cis-regulatory elements at diverse genomic loci and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using an in vivo enhancer assay in transgenic mice. Human regulatory elements were identified with acceptable sensitivity (53%-80%) and true-positive rate (27%-67%) by comparison with one to five other eutherian mammals or six other simian primates. More distant comparisons (marsupial, avian, amphibian, and fish) failed to identify many of the empirically defined functional noncoding elements. Our results highlight the practical utility of close sequence comparisons, and the loss of sensitivity entailed by more distant comparisons. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole-genome comparative analysis that explains most of the observations from empirical benchmarking. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for in vivo testing at embryonic time points. PMID:16769978

  5. A novel transcriptional element in circular DNA monomers of the duck hepatitis B virus.

    PubMed

    Beckel-Mitchener, A; Summers, J

    1997-10-01

    We report the presence of two elements, pet and net, that are required for proper transcription of the duck hepatitis B virus (DHBV). These regions were previously identified by using plasmid clones of the virus in transient expression assays (M. Huang and J. Summers, J. Virol. 68:1564-1572, 1994). In this study, we further analyzed these regions by using in vitro-synthesized circular DHBV DNA monomers to mimic the authentic transcriptional template. We observed that pet was required for pregenome transcription from circular viral monomers, and in the absence of pet-dependent transcription, expression of the viral envelope genes was increased. We found that deletion of net in circularized DNA monomers led to the production of abnormally long transcripts due to a failure to form 3' ends during transcription. In addition, we report the presence of a net-like region in the mammalian hepadnavirus woodchuck hepatitis virus. These results are consistent with a model that net is a region involved in transcription termination and that in DHBV, pet is required for transcription complexes to read through this region during the first pass through net. PMID:9311882

  6. Chromatin immunoprecipitation reveals that the 180-bp satellite repeat is the key functional DNA element of Arabidopsis thaliana centromeres.

    PubMed Central

    Nagaki, Kiyotaka; Talbert, Paul B; Zhong, Cathy Xiaoyan; Dawe, R Kelly; Henikoff, Steven; Jiang, Jiming

    2003-01-01

    The centromeres of Arabidopsis thaliana chromosomes contain megabases of complex DNA consisting of numerous types of repetitive DNA elements. We developed a chromatin immunoprecipitation (ChIP) technique using an antibody against the centromeric H3 histone, HTR12, in Arabidopsis. ChIP assays showed that the 180-bp centromeric satellite repeat was precipitated with the antibody, suggesting that this repeat is the key component of the centromere/kinetochore complex in Arabidopsis. PMID:12663558

  7. Sequence, Genomic Distribution and DNA Modification of a Mu1 Element from Non-Mutator Maize Stocks

    PubMed Central

    Chandler, V. L.; Talbert, L. E.; Raymond, F.

    1988-01-01

    The increased mutation rate of Mutator stocks of maize has been shown to be the result of transposition of Mu elements. One element, Mu1, is present in 10-60 copies in Mutator stocks and approximately 0-3 copies in non-Mutator stocks. The sequence, structure and genomic distribution of an intact Mu1 element cloned from the non-Mutator inbred line B37 has been determined. The sequence of this element, termed Mu1.4-B37, is identical to Mu1 and it is flanked by 9-bp direct repeats indicative of a target site duplication. Mu1.4-B37 is not in the same genomic location in all stocks, which further suggests that it transposed into its genomic location in B37. We previously reported that in genomic DNA this element is modified such that certain methylation-sensitive restriction enzymes will not cut sites within the element. This is similar to that observed for Mu elements in Mutator stocks that have lost activity. We report herein that the Mu1.4-B37 element loses its modification and becomes accessible to digestion when placed in an active Mutator stock by genetic crosses. This suggests that factors conditioning unmodified elements are dominant in the initial cross between Mutator and non-Mutator stocks. In F(2) individuals that have subsequently lost Mutator activity the Mu1.4-B37 element again becomes modified as do most of the Mu elements in the stock. Thus, the modification state of the Mu1.4-B37 element and the other Mu1-like elements correlates with Mutator activity. We hypothesize that factor(s) within an active Mutator stock may inhibit the modification of Mu elements, and that this activity is missing in non-Mutator stocks and may become limiting in certain Mutator stocks resulting in DNA modification. PMID:2842229

  8. Turnover of R1 (Type I) and R2 (Type Ii) Retrotransposable Elements in the Ribosomal DNA of Drosophila Melanogaster

    PubMed Central

    Jakubczak, J. L.; Zenni, M. K.; Woodruff, R. C.; Eickbush, T. H.

    1992-01-01

    R1 and R2 are distantly related non-long terminal repeat retrotransposable elements each of which inserts into a specific site in the 28S rRNA genes of most insects. We have analyzed aspects of R1 and R2 abundance and sequence variation in 27 geographical isolates of Drosophila melanogaster. The fraction of 28S rRNA genes containing these elements varied greatly between strains, 17-67% for R1 elements and 2-28% for R2 elements. The total percentage of the rDNA repeats inserted ranged from 32 to 77%. The fraction of the rDNA repeats that contained both of these elements suggested that R1 and R2 exhibit neither an inhibition of nor preference for insertion into a 28S gene already containing the other type of element. Based on the conservation of restriction sites in the elements of all strains, and sequence analysis of individual elements from three strains, nucleotide divergence is very low for R1 and R2 elements within or between strains (<0.6%). This sequence uniformity is the expected result of the forces of concerted evolution (unequal crossovers and gene conversion) which act on the rRNA genes themselves. Evidence for the role of retrotransposition in the turnover of R1 and R2 was obtained by using naturally occurring 5' length polymorphisms of the elements as markers for independent transposition events. The pattern of these different length 5' truncations of R1 and R2 was found to be diverse and unique to most strains analyzed. Because recombination can only, with time, amplify or eliminate those length variants already present, the diversity found in each strain suggests that retrotransposition has played a critical role in maintaining these elements in the rDNA repeats of D. melanogaster. PMID:1317313

  9. Noncoding origins of anthropoid traits and a new null model of transposon functionalization.

    PubMed

    del Rosario, Ricardo C H; Rayan, Nirmala Arul; Prabhakar, Shyam

    2014-09-01

    Little is known about novel genetic elements that drove the emergence of anthropoid primates. We exploited the sequencing of the marmoset genome to identify 23,849 anthropoid-specific constrained (ASC) regions and confirmed their robust functional signatures. Of the ASC base pairs, 99.7% were noncoding, suggesting that novel anthropoid functional elements were overwhelmingly cis-regulatory. ASCs were highly enriched in loci associated with fetal brain development, motor coordination, neurotransmission, and vision, thus providing a large set of candidate elements for exploring the molecular basis of hallmark primate traits. We validated ASC192 as a primate-specific enhancer in proliferative zones of the developing brain. Unexpectedly, transposable elements (TEs) contributed to >56% of ASCs, and almost all TE families showed functional potential similar to that of nonrepetitive DNA. Three L1PA repeat-derived ASCs displayed coherent eye-enhancer function, thus demonstrating that the "gene-battery" model of TE functionalization applies to enhancers in vivo. Our study provides fundamental insights into genome evolution and the origins of anthropoid phenotypes and supports an elegantly simple new null model of TE exaptation. PMID:25043600

  10. Noncoding origins of anthropoid traits and a new null model of transposon functionalization

    PubMed Central

    del Rosario, Ricardo C.H.; Rayan, Nirmala Arul

    2014-01-01

    Little is known about novel genetic elements that drove the emergence of anthropoid primates. We exploited the sequencing of the marmoset genome to identify 23,849 anthropoid-specific constrained (ASC) regions and confirmed their robust functional signatures. Of the ASC base pairs, 99.7% were noncoding, suggesting that novel anthropoid functional elements were overwhelmingly cis-regulatory. ASCs were highly enriched in loci associated with fetal brain development, motor coordination, neurotransmission, and vision, thus providing a large set of candidate elements for exploring the molecular basis of hallmark primate traits. We validated ASC192 as a primate-specific enhancer in proliferative zones of the developing brain. Unexpectedly, transposable elements (TEs) contributed to >56% of ASCs, and almost all TE families showed functional potential similar to that of nonrepetitive DNA. Three L1PA repeat-derived ASCs displayed coherent eye-enhancer function, thus demonstrating that the “gene-battery” model of TE functionalization applies to enhancers in vivo. Our study provides fundamental insights into genome evolution and the origins of anthropoid phenotypes and supports an elegantly simple new null model of TE exaptation. PMID:25043600

  11. A Molecular Chipper technology for CRISPR sgRNA library generation and functional mapping of noncoding regions

    PubMed Central

    Cheng, Jijun; Roden, Christine A.; Pan, Wen; Zhu, Shu; Baccei, Anna; Pan, Xinghua; Jiang, Tingting; Kluger, Yuval; Weissman, Sherman M.; Guo, Shangqin; Flavell, Richard A.; Ding, Ye; Lu, Jun

    2016-01-01

    Clustered regularly-interspaced palindromic repeats (CRISPR)-based genetic screens using single-guide-RNA (sgRNA) libraries have proven powerful to identify genetic regulators. Applying CRISPR screens to interrogate functional elements in noncoding regions requires generating sgRNA libraries that are densely covering, and ideally inexpensive, easy to implement and flexible for customization. Here we present a Molecular Chipper technology for generating dense sgRNA libraries for genomic regions of interest, and a proof-of-principle screen that identifies novel cis-regulatory domains for miR-142 biogenesis. The Molecular Chipper approach utilizes a combination of random fragmentation and a type III restriction enzyme to derive a densely covering sgRNA library from input DNA. Applying this approach to 17 microRNAs and their flanking regions and with a reporter for miR-142 activity, we identify both the pre-miR-142 region and two previously unrecognized cis-domains important for miR-142 biogenesis, with the latter regulating miR-142 processing. This strategy will be useful for identifying functional noncoding elements in mammalian genomes. PMID:27025950

  12. sup 1 H NMR studies of DNA recognition by the glucocorticoid receptor: Complex of the DNA binding domain with a half-site response element

    SciTech Connect

    Remerowski, M.L.; Kellenbach, E.; Boelens, R.; Kaptein, R. ); van der Marel, G.A.; van Boom, J.H. ); Maler, B.A.; Yamamoto, K.R. )

    1991-12-17

    The complex of the rat glucocorticoid receptor (GR) DNA binding domain (DBD) and half-site sequence of the consensus glucocorticoid response element (GRE) has been studied by two-dimensional {sup 1}H NMR spectroscopy. The DNA fragment is a 10 base-pair oligonucleotide, 5{prime}d(GCTGTTCTGC)3{prime}{center dot}5{prime}d-(GCAGAACAGC)3{prime}, containing the stronger binding GRE half-site hexamer, with GC base pairs at each end. The 93-residue GR-DBD contains an 86-residue segment corresponding to residues 440-525 of the rat GR. Eleven NOE cross peaks between the protein and DNA have been identified, and changes in the chemical shift of the DNA protons upon complex formation have been analyzed. Using these protein-DNA contact points, it can be concluded that (1) the 'recognition helix' formed by residues C460-E469 lies in the major groove of the DNA; (2) the GR-DBD is oriented on the GRE half-site such that residues A477-D481, forming the so-called D-loop, are available for protein-protein interaction in the GR-DBD dimer on the intact consensus GRE; and (3) the 5-methyl of the second thymine in the half-site and valine 462 interact, confirming indirect evidence that both play an important role in GR-DBD DNA binding.

  13. Identification and analysis of mouse non-coding RNA using transcriptome data.

    PubMed

    Zhao, Yuhui; Liu, Wanfei; Zeng, Jingyao; Liu, Shoucheng; Tan, Xinyu; Aljohi, Hasanawad; Hu, Songnian

    2016-06-01

    Transcripts are expressed spatially and temporally and they are very complicated, precise and specific; however, most studies are focused on protein-coding related genes. Recently, massively parallel cDNA sequencing (RNA-seq) has emerged to be a new and promising tool for transcriptome research, and numbers of non-coding RNAs, especially lincRNAs, have been widely identified and well characterized as important regulators of diverse biological processes. In this study, we used ultra-deep RNA-seq data from 15 mouse tissues to study the diversity and dynamic of non-coding RNAs in mouse. Using our own criteria, we identified totally 16,249 non-coding genes (21,569 non-coding RNAs) in mouse. We annotated these non-coding RNAs by diverse properties and found non-coding RNAs are generally shorter, have fewer exons, express in lower level and are more strikingly tissue-specific compared with protein-coding genes. Moreover, these non-coding RNAs show significant enrichment with transcriptional initiation and elongation signals including histone modifications (H3K4me3, H3K27me3 and H3K36me3), RNAPII binding sites and CAGE tags. The gene set enrichment analysis (GSEA) result revealed several sets of lincRNAs associated with diverse biological processes such as immune effector process, muscle development and sexual reproduction. Taken together, this study provides a more comprehensive annotation of mouse non-coding RNAs and gives an opportunity for future functional and evolutionary study of mouse non-coding RNAs. PMID:26944582

  14. RNA exosome regulated long non-coding RNA transcription controls super-enhancer activity

    PubMed Central

    Pefanis, Evangelos; Wang, Jiguang; Rothschild, Gerson; Lim, Junghyun; Kazadi, David; Sun, Jianbo; Federation, Alexander; Chao, Jaime; Elliott, Oliver; Liu, Zhi-Ping; Economides, Aris N.; Bradner, James E.; Rabadan, Raul; Basu, Uttiya

    2015-01-01

    We have ablated the cellular RNA degradation machinery in differentiated B cells and pluripotent embryonic stem (ES) cells by conditional mutagenesis of core (Exosc3) and nuclear RNase (Exosc10) components of RNA exosome and identified a vast number of long non-coding RNAs (lncRNAs) and enhancer RNAs (eRNAs) with emergent functionality. Unexpectedly, eRNA-expressing regions accumulate R-loop structures upon RNA exosome ablation, thus demonstrating the role of RNA exosome in resolving deleterious DNA/RNA hybrids arising from active enhancers. We have uncovered a distal divergent eRNA-expressing element (lncRNA-CSR) engaged in long-range DNA interactions and regulating IgH 3’ regulatory region super-enhancer function. CRISPRCas9 mediated ablation of lncRNA-CSR transcription decreases its chromosomal looping-mediated association with the IgH 3’regulatory region super-enhancer and leads to decreased class switch recombination efficiency. We propose that the RNA exosome protects divergently transcribed lncRNA expressing enhancers, by resolving deleterious transcription-coupled secondary DNA structures, while also regulating long-range super-enhancer chromosomal interactions important for cellular function. PMID:25957685

  15. RNA exosome-regulated long non-coding RNA transcription controls super-enhancer activity.

    PubMed

    Pefanis, Evangelos; Wang, Jiguang; Rothschild, Gerson; Lim, Junghyun; Kazadi, David; Sun, Jianbo; Federation, Alexander; Chao, Jaime; Elliott, Oliver; Liu, Zhi-Ping; Economides, Aris N; Bradner, James E; Rabadan, Raul; Basu, Uttiya

    2015-05-01

    We have ablated the cellular RNA degradation machinery in differentiated B cells and pluripotent embryonic stem cells (ESCs) by conditional mutagenesis of core (Exosc3) and nuclear RNase (Exosc10) components of RNA exosome and identified a vast number of long non-coding RNAs (lncRNAs) and enhancer RNAs (eRNAs) with emergent functionality. Unexpectedly, eRNA-expressing regions accumulate R-loop structures upon RNA exosome ablation, thus demonstrating the role of RNA exosome in resolving deleterious DNA/RNA hybrids arising from active enhancers. We have uncovered a distal divergent eRNA-expressing element (lncRNA-CSR) engaged in long-range DNA interactions and regulating IgH 3' regulatory region super-enhancer function. CRISPR-Cas9-mediated ablation of lncRNA-CSR transcription decreases its chromosomal looping-mediated association with the IgH 3' regulatory region super-enhancer and leads to decreased class switch recombination efficiency. We propose that the RNA exosome protects divergently transcribed lncRNA expressing enhancers by resolving deleterious transcription-coupled secondary DNA structures, while also regulating long-range super-enhancer chromosomal interactions important for cellular function. PMID:25957685

  16. Retrotransposable elements R1 and R2 in the rDNA units of Drosophila mercatorum: abnormal abdomen revisited.

    PubMed Central

    Malik, H S; Eickbush, T H

    1999-01-01

    R1 and R2 retrotransposable elements are stable components of the 28S rRNA genes of arthropods. While each retrotransposition event leads to incremental losses of rDNA unit expression, little is known about the selective consequences of these elements on the host genome. Previous reports suggested that in the abnormal abdomen (aa) phenotype of Drosophila mercatorum, high levels of rDNA insertions (R1) in conjunction with the under-replication locus (ur), enable the utilization of different ecological conditions via a population level shift to younger age. We have sequenced the R1 and R2 elements of D. mercatorum and show that the levels of R1- and R2-inserted rDNA units were inaccurately scored in the original studies of aa, leading to several misinterpretations. In particular, contrary to earlier reports, aa flies differentially underreplicate R1- and R2-inserted rDNA units, like other species of Drosophila. However, aa flies do not undergo the lower level of underreplication of their functional rDNA units (general underreplication) that is seen in wild-type strains. The lack of general underreplication is expected to confer a selective advantage and, thus, can be interpreted as an adaptation to overcome high levels of R1 and R2 insertions. These results allow us to reconcile some of the apparently contradictory effects of aa and the bobbed phenotype found in other species of Drosophila. PMID:9927458

  17. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.

    PubMed Central

    Pérez-González, C E; Eickbush, T H

    2001-01-01

    The mobile elements R1 and R2 insert specifically into the rRNA gene locus (rDNA locus) of arthropods, a locus known to undergo concerted evolution, the recombinational processes that preserve the sequence homogeneity of all repeats. To monitor how rapidly individual R1 and R2 insertions are turned over in the rDNA locus by these processes, we have taken advantage of the many 5' truncation variants that are generated during the target-primed reverse transcription mechanism used by these non-LTR retrotransposons for their integration. A simple PCR assay was designed to reveal the pattern of the 5' variants present in the rDNA loci of individual X chromosomes in a population of Drosophila simulans. Each rDNA locus in this population was found to have a large, unique collection of 5' variants. Each variant was present at low copy number, usually one copy per chromosome, and was seldom distributed to other chromosomes in the population. The failure of these variants to spread to other units in the same rDNA locus suggests a strong recombinational bias against R1 and R2 that results in the individual copies of these elements being rapidly lost from the rDNA locus. This bias suggests a significantly higher frequency of R1 and R2 retrotransposition than we have previously suggested. PMID:11514447

  18. HIV-1 p24(gag) derived conserved element DNA vaccine increases the breadth of immune response in mice.

    PubMed

    Kulkarni, Viraj; Rosati, Margherita; Valentin, Antonio; Ganneru, Brunda; Singh, Ashish K; Yan, Jian; Rolland, Morgane; Alicea, Candido; Beach, Rachel Kelly; Zhang, Gen-Mu; Le Gall, Sylvie; Broderick, Kate E; Sardesai, Niranjan Y; Heckerman, David; Mothe, Beatriz; Brander, Christian; Weiner, David B; Mullins, James I; Pavlakis, George N; Felber, Barbara K

    2013-01-01

    Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag) region according to two principles: the immunogen must (i) include strictly conserved elements of the virus that cannot mutate readily, and (ii) exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag) DNA immunogens that express 7 highly Conserved Elements (CE) of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site'), together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag) DNA induced poor, CD4(+) mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+) and CD8(+) T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag), which recognize the virus encoded p24(gag) protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+) and CD8(+) T cells to additional regions of Gag compared to vaccination with p55(gag) DNA, achieving maximal cross-clade reactive cellular and humoral responses. PMID:23555935

  19. Alteration of C-MYB DNA binding to cognate responsive elements in HL-60 variant cells

    PubMed Central

    Gaillard, C; Le Rouzic, E; Créminon, C; Perbal, B

    2002-01-01

    Aims: To establish whether the MYB protein expressed in HL-60 variant cells, which are cells resistant to 12-O-tetradecanoylphorbol-13-acetate (TPA) induced differentiation, is able to bind MYB recognition elements (MREs) involved in the transcriptional regulation of myb target genes. In addition, to determine whether alterations in the binding of the MYB protein to MREs affects HL-60 cell proliferation and differentiation. Methods: Nuclear extracts of HL-60 variant cells exhibiting different degrees of resistance to TPA induced monocytic differentiation were used in electrophoretic mobility shift experiments (EMSAs), bandshift experiments performed with labelled oliogonucleotides containing the MYB consensus binding sequences. Results: The MYB protein contained in nuclear extracts from HL-60 variant cells did not bind efficiently to the MYB recognition elements identified in the mim-1 and PR264 promoters. Molecular cloning of the myb gene and analysis of the MYB protein expressed in the HL-60 variant cells established that the lack of binding did not result from a structural alteration of MYB in these cells. The lack of MRE binding did not abrogate the ability of variant HL-60s to proliferate and to undergo differentiation. Furthermore, the expression of the PR264/SC35 splicing factor was not affected as a result of the altered MYB DNA binding activity. Conclusions: Because the MYB protein expressed in HL-60 variant cells did not appear to be structurally different from the MYB protein expressed in parental HL-60 cells, it is possible that the HL-60 variant cells contain a MYB binding inhibitory factor (MBIF) that interferes with MYB binding on MREs. The increased proliferation rate of HL-60 variant cells and their reduced serum requirement argues against the need for direct MYB binding in the regulation of cell growth. PMID:12354938

  20. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    PubMed Central

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-01-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  1. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.

    PubMed

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-08-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  2. Retroposons do jump: a B2 element recently integrated in an 18S rDNA gene.

    PubMed Central

    Oberbäumer, I

    1992-01-01

    Several cDNA clones were isolated from cDNA libraries constructed with mRNA longer than 28S RNA from the murine cell line PYS-2/12. The plasmids have inserts containing 1-1.2 kb of the ribosomal 5' external transcribed spacer followed by nearly 700 nt of sequence for 18S rRNA and ending with a B2 element (retroposon). The cloned sequence differed in a few positions from published ribosomal sequences. The 3' adjacent genomic sequence was obtained by polymerase chain reaction (PCR) and showed that the B2 element has a poly(A) tail of about 50 nt and is surrounded by perfect direct repeats of 15 nt. Analysis of genomic DNA from several murine cell lines revealed that PYS cells contain at least one copy of 18S RNA with the B2 element which is not present in the genome of other murine cell lines derived from the same teratocarcinoma. Similarly, rRNA transcripts containing the B2 element were only detected in PYS cells. According to the publication dates of the different cell lines, the B2 element must have been integrated into an rRNA transcription unit during the years 1970 through 1974 thus proving that retroposons (SINEs) can still be inserted into the genome in our times. Images PMID:1311830

  3. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    SciTech Connect

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng

    2008-01-04

    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage.

  4. An active DNA transposon nDart causing leaf variegation and mutable dwarfism and its related elements in rice.

    PubMed

    Tsugane, Kazuo; Maekawa, Masahiko; Takagi, Kyoko; Takahara, Hiroyuki; Qian, Qian; Eun, Chang-Ho; Iida, Shigeru

    2006-01-01

    While characterized mutable alleles caused by DNA transposons have been abundant in maize since the discovery of Dissociation conferring variegation by Barbara McClintock, only a few mutable alleles have been described in rice even though the rice genome contains various transposons. Here, we show that a spontaneous mutable virescent allele, pyl-v, is caused by the disruption of the nuclear-coded essential chloroplast protease gene, OsClpP5, due to insertion of a 607-bp non-autonomous DNA transposon, non-autonomous DNA-based active rice transposon one (nDart1), belonging to the hAT superfamily. The transposition of nDart1 can be induced by crossing with a line containing an autonomous element, aDart, and stabilized by segregating out of aDart. We also identified a novel mutable dwarf allele thl-m caused by an insertion of nDart1. The japonica cultivar Nipponbare carries no aDart, although it contains epigenetically silenced Dart element(s), which can be activated by 5-azacytidine. Nipponbare bears four subgroups of about 3.6-kb Dart-like sequences, three of which contain potential transposase genes, and around 3.6-kb elements without an apparent transposase gene, as well as three subgroups of about 0.6-kb nDart1-related elements that are all internal deletions of the Dart-like sequences. Both nDart1 and 3.6-kb Dart-like elements were also present in indica varieties 93-11 and Kasalath. nDart1 appears to be the most active mutagen among nDart1-related elements contributing to generating natural variations. A candidate for an autonomous element, aDart, and a possible application of nDart1 for transposon tagging are discussed. PMID:16367953

  5. Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements.

    PubMed

    Telorac, Jonas; Prykhozhij, Sergey V; Schöne, Stefanie; Meierhofer, David; Sauer, Sascha; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H

    2016-07-27

    Out of the myriad of potential DNA binding sites of the glucocorticoid receptor (GR) found in the human genome, only a cell-type specific minority is actually bound, indicating that the presence of a recognition sequence alone is insufficient to specify where GR binds. Cooperative interactions with other transcription factors (TFs) are known to contribute to binding specificity. Here, we reasoned that sequence signals preventing GR recruitment to certain loci provide an alternative means to confer specificity. Motif analyses uncovered candidate Negative Regulatory Sequences (NRSs) that interfere with genomic GR binding. Subsequent functional analyses demonstrated that NRSs indeed prevent GR binding to nearby response elements. We show that NRS activity is conserved across species, found in most tissues and that they also interfere with the genomic binding of other TFs. Interestingly, the effects of NRSs appear not to be a simple consequence of changes in chromatin accessibility. Instead, we find that NRSs interact with proteins found at sub-nuclear structures called paraspeckles and that these proteins might mediate the repressive effects of NRSs. Together, our studies suggest that the joint influence of positive and negative sequence signals partition the genome into regions where GR can bind and those where it cannot. PMID:27016732

  6. Development of two highly sensitive forensic sex determination assays based on human DYZ1 and Alu repetitive DNA elements.

    PubMed

    Fazi, Amanda; Gobeski, Brianne; Foran, David

    2014-11-01

    Sex determination is a critical component of forensic identification, the standard genetic method for which is detection of the single copy amelogenin gene that has differing homologues on the X and Y chromosomes. However, this assay may not be sensitive enough when DNA samples are minute or highly compromised, thus other strategies for sex determination are needed. In the current research, two ultrasensitive sexing assays, based on real-time PCR and pyrosequencing, were developed targeting the highly repetitive elements DYZ1 on the Y chromosome and Alu on the autosomes. The DYZ1/Alu strategy was compared to amelogenin for overall sensitivity based on high molecular weight and degraded DNA, followed by assaying the sex of 34 touch DNA samples and DNA from 30 hair shafts. The real-time DYZ1/Alu assay proved to be approximately 1500 times more sensitive than its amelogenin counterpart based on high molecular weight DNA, and even more sensitive when sexing degraded DNA. The pyrosequencing DYZ1/Alu assay correctly sexed 26 of the touch DNAs, compared to six using amelogenin. Hair shaft DNAs showed equally improved sexing results using the DYZ1/Alu assays. Overall, both DYZ1/Alu assays were far more sensitive and accurate than was the amelogenin assay, and thus show great utility for sexing poor quality and low quantity DNA evidence. PMID:25168471

  7. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

    PubMed Central

    Li, Yue; Xie, Changchun; Murphy, Susan K.; Skaar, David; Nye, Monica; Vidal, Adriana C.; Cecil, Kim M.; Dietrich, Kim N.; Puga, Alvaro; Jirtle, Randy L.; Hoyo, Cathrine

    2015-01-01

    30 to 78 months. Conclusions: Our findings provide evidence that early childhood lead exposure results in sex-dependent and gene-specific DNA methylation differences in the DMRs of PEG3, IGF2/H19, and PLAGL1/HYMAI in adulthood. Citation: Li Y, Xie C, Murphy SK, Skaar D, Nye M, Vidal AC, Cecil KM, Dietrich KN, Puga A, Jirtle RL, Hoyo C. 2016. Lead exposure during early human development and DNA methylation of imprinted gene regulatory elements in adulthood. Environ Health Perspect 124:666–673; http://dx.doi.org/10.1289/ehp.1408577 PMID:26115033

  8. Generalized Levy-walk model for DNA nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Simons, M.; Stanley, H. E.

    1993-01-01

    We propose a generalized Levy walk to model fractal landscapes observed in noncoding DNA sequences. We find that this model provides a very close approximation to the empirical data and explains a number of statistical properties of genomic DNA sequences such as the distribution of strand-biased regions (those with an excess of one type of nucleotide) as well as local changes in the slope of the correlation exponent alpha. The generalized Levy-walk model simultaneously accounts for the long-range correlations in noncoding DNA sequences and for the apparently paradoxical finding of long subregions of biased random walks (length lj) within these correlated sequences. In the generalized Levy-walk model, the lj are chosen from a power-law distribution P(lj) varies as lj(-mu). The correlation exponent alpha is related to mu through alpha = 2-mu/2 if 2 < mu < 3. The model is consistent with the finding of "repetitive elements" of variable length interspersed within noncoding DNA.

  9. Genetic variation in regulatory DNA elements: the case of OCA2 transcriptional regulation.

    PubMed

    Visser, Mijke; Kayser, Manfred; Grosveld, Frank; Palstra, Robert-Jan

    2014-03-01

    Mutations within the OCA2 gene or the complete absence of the OCA2 protein leads to oculocutaneous albinism type 2. The OCA2 protein plays a central role in melanosome biogenesis, and it is a strong determinant of the eumelanin content in melanocytes. Transcript levels of the OCA2 gene are strongly correlated with pigmentation intensities. Recent studies demonstrated that the transcriptional level of OCA2 is to a large extent determined by the noncoding SNP rs12913832 located 21.5 kb upstream of the OCA2 gene promoter. In this review, we discuss current hypotheses and the available data on the mechanism of OCA2 transcriptional regulation and how this is influenced by genetic variation. Finally, we will explore how future epigenetic studies can be used to advance our insight into the functional biology that connects genetic variation to human pigmentation. PMID:24387780

  10. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  11. Noncoding Regulatory RNAs in Hematopoiesis.

    PubMed

    Jeong, M; Goodell, M A

    2016-01-01

    Hematopoiesis is a dynamic process in which blood cells are continuously generated from hematopoietic stem cells (HSCs). The regulatory mechanisms controlling HSC fate have been studied extensively over the past several decades. Although many protein-coding genes have been shown to regulate hematopoietic differentiation, additional levels of HSC regulation are not well studied. Advances in deep sequencing have revealed many new classes of regulatory noncoding RNAs (ncRNAs), such as enhancer RNAs and antisense ncRNAs. Functional analysis of some of these ncRNAs has provided insights into the molecular mechanisms that regulate hematopoietic development and disease. In this review, we summarize recent advances in our understanding of functional regulatory ncRNAs associated with hematopoietic self-renewal and differentiation, as well as those dysregulated ncRNAs involved in hematologic malignancies. PMID:27137659

  12. Noncoding RNPs of Viral Origin

    PubMed Central

    Steitz, Joan; Borah, Sumit; Cazalla, Demian; Fok, Victor; Lytle, Robin; Mitton-Fry, Rachel; Riley, Kasandra; Samji, Tasleem

    2011-01-01

    SUMMARY Like their host cells, many viruses produce noncoding (nc)RNAs. These show diversity with respect to time of expression during viral infection, length and structure, protein-binding partners and relative abundance compared with their host-cell counterparts. Viruses, with their limited genomic capacity, presumably evolve or acquire ncRNAs only if they selectively enhance the viral life cycle or assist the virus in combating the host’s response to infection. Despite much effort, identifying the functions of viral ncRNAs has been extremely challenging. Recent technical advances and enhanced understanding of host-cell ncRNAs promise accelerated insights into the RNA warfare mounted by this fascinating class of RNPs. PMID:20719877

  13. Noncoding RNPs of viral origin.

    PubMed

    Steitz, Joan; Borah, Sumit; Cazalla, Demian; Fok, Victor; Lytle, Robin; Mitton-Fry, Rachel; Riley, Kasandra; Samji, Tasleem

    2011-03-01

    Like their host cells, many viruses produce noncoding (nc)RNAs. These show diversity with respect to time of expression during viral infection, length and structure, protein-binding partners and relative abundance compared with their host-cell counterparts. Viruses, with their limited genomic capacity, presumably evolve or acquire ncRNAs only if they selectively enhance the viral life cycle or assist the virus in combating the host's response to infection. Despite much effort, identifying the functions of viral ncRNAs has been extremely challenging. Recent technical advances and enhanced understanding of host-cell ncRNAs promise accelerated insights into the RNA warfare mounted by this fascinating class of RNPs. PMID:20719877

  14. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  15. Conserved Non-Coding Sequences are Associated with Rates of mRNA Decay in Arabidopsis

    PubMed Central

    Spangler, Jacob B.; Feltus, Frank Alex

    2013-01-01

    Steady-state mRNA levels are tightly regulated through a combination of transcriptional and post-transcriptional control mechanisms. The discovery of cis-acting DNA elements that encode these control mechanisms is of high importance. We have investigated the influence of conserved non-coding sequences (CNSs), DNA patterns retained after an ancient whole genome duplication event, on the breadth of gene expression and the rates of mRNA decay in Arabidopsis thaliana. The absence of CNSs near α duplicate genes was associated with a decrease in breadth of gene expression and slower mRNA decay rates while the presence CNSs near α duplicates was associated with an increase in breadth of gene expression and faster mRNA decay rates. The observed difference in mRNA decay rate was fastest in genes with CNSs in both non-transcribed and transcribed regions, albeit through an unknown mechanism. This study supports the notion that some Arabidopsis CNSs regulate the steady-state mRNA levels through post-transcriptional control mechanisms and that CNSs also play a role in controlling the breadth of gene expression. PMID:23675377

  16. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  17. Interpreting noncoding genetic variation in complex traits and human disease.

    PubMed

    Ward, Lucas D; Kellis, Manolis

    2012-11-01

    Association studies provide genome-wide information about the genetic basis of complex disease, but medical research has focused primarily on protein-coding variants, owing to the difficulty of interpreting noncoding mutations. This picture has changed with advances in the systematic annotation of functional noncoding elements. Evolutionary conservation, functional genomics, chromatin state, sequence motifs and molecular quantitative trait loci all provide complementary information about the function of noncoding sequences. These functional maps can help with prioritizing variants on risk haplotypes, filtering mutations encountered in the clinic and performing systems-level analyses to reveal processes underlying disease associations. Advances in predictive modeling can enable data-set integration to reveal pathways shared across loci and alleles, and richer regulatory models can guide the search for epistatic interactions. Lastly, new massively parallel reporter experiments can systematically validate regulatory predictions. Ultimately, advances in regulatory and systems genomics can help unleash the value of whole-genome sequencing for personalized genomic risk assessment, diagnosis and treatment. PMID:23138309

  18. Analysis of Usp DNA binding domain targeting reveals critical determinants of the ecdysone receptor complex interaction with the response element.

    PubMed

    Grad, I; Niedziela-Majka, A; Kochman, M; Ozyhar, A

    2001-07-01

    The steroid hormone, 20-hydroxyecdysone (20E), directs Drosophila metamorphosis via a heterodimeric receptor formed by two members of the nuclear hormone receptors superfamily, the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. Our previous study [Niedziela-Majka, A., Kochman, M., Ozyhar, A. (2000) Eur. J. Biochem. 267, 507-519] on EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) suggested that UspDBD may act as a specific anchor that preferentially binds the 5' half-site of the pseudo-palindromic response element from the hsp27 gene promoter and thus locates the heterocomplex in the defined orientation. Here, we analyzed in detail the determinants of the UspDBD interaction with the hsp27 element. The roles of individual amino acids in the putative DNA recognition alpha helix and the roles of the base pairs of the UspDBD target sequence have been probed by site-directed mutagenesis. The results show how the hsp27 element specifies UspDBD binding and thus the polar assembly of the UspDBD/EcRDBD heterocomplex. It is suggested how possible nucleotide deviations within the 5' half-site of the element may be used for the fine-tuning of the 20E-response element specificity and consequently the physiological response. PMID:11432742

  19. Long noncoding RNAs are rarely translated in two human cell lines.

    PubMed

    Bánfai, Balázs; Jia, Hui; Khatun, Jainab; Wood, Emily; Risk, Brian; Gundling, William E; Kundaje, Anshul; Gunawardena, Harsha P; Yu, Yanbao; Xie, Ling; Krajewski, Krzysztof; Strahl, Brian D; Chen, Xian; Bickel, Peter; Giddings, Morgan C; Brown, James B; Lipovich, Leonard

    2012-09-01

    Data from the Encyclopedia of DNA Elements (ENCODE) project show over 9640 human genome loci classified as long noncoding RNAs (lncRNAs), yet only ~100 have been deeply characterized to determine their role in the cell. To measure the protein-coding output from these RNAs, we jointly analyzed two recent data sets produced in the ENCODE project: tandem mass spectrometry (MS/MS) data mapping expressed peptides to their encoding genomic loci, and RNA-seq data generated by ENCODE in long polyA+ and polyA- fractions in the cell lines K562 and GM12878. We used the machine-learning algorithm RuleFit3 to regress the peptide data against RNA expression data. The most important covariate for predicting translation was, surprisingly, the Cytosol polyA- fraction in both cell lines. LncRNAs are ~13-fold less likely to produce detectable peptides than similar mRNAs, indicating that ~92% of GENCODE v7 lncRNAs are not translated in these two ENCODE cell lines. Intersecting 9640 lncRNA loci with 79,333 peptides yielded 85 unique peptides matching 69 lncRNAs. Most cases were due to a coding transcript misannotated as lncRNA. Two exceptions were an unprocessed pseudogene and a bona fide lncRNA gene, both with open reading frames (ORFs) compromised by upstream stop codons. All potentially translatable lncRNA ORFs had only a single peptide match, indicating low protein abundance and/or false-positive peptide matches. We conclude that with very few exceptions, ribosomes are able to distinguish coding from noncoding transcripts and, hence, that ectopic translation and cryptic mRNAs are rare in the human lncRNAome. PMID:22955977

  20. Noncoding RNAs: Emerging Players in Muscular Dystrophies

    PubMed Central

    2014-01-01

    The fascinating world of noncoding RNAs has recently come to light, thanks to the development of powerful sequencing technologies, revealing a variety of RNA molecules playing important regulatory functions in most, if not all, cellular processes. Many noncoding RNAs have been implicated in regulatory networks that are determinant for skeletal muscle differentiation and disease. In this review, we outline the noncoding RNAs involved in physiological mechanisms of myogenesis and those that appear dysregulated in muscle dystrophies, also discussing their potential use as disease biomarkers and therapeutic targets. PMID:24729974

  1. A conserved MCM single-stranded DNA binding element is essential for replication initiation

    PubMed Central

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-01-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001 PMID:24692448

  2. Hormone stimulation of androgen receptor mediates dynamic changes in DNA methylation patterns at regulatory elements

    PubMed Central

    Dhiman, Vineet K.; Attwood, Kristopher; Campbell, Moray J.; Smiraglia, Dominic J.

    2015-01-01

    DNA methylation is an epigenetic modification that contributes to stable gene silencing by interfering with the ability of transcriptional regulators to bind to DNA. Recent findings have revealed that hormone stimulation of certain nuclear receptors induces rapid, dynamic changes in DNA methylation patterns alongside transcriptional responses at a subset of target loci, over time. However, the ability of androgen receptor (AR) to dynamically regulate gene transcription is relatively under-studied and its role in the regulation of DNA methylation patterns remains to be elucidated. Here we demonstrate in normal prostate cells that hormone stimulated AR activity results in dynamic changes in the transcription rate and DNA methylation patterns at the AR target genes, TIPARP and SGK1. Time-resolved chromatin immunoprecipitation experiments on the SGK1 locus reveals dynamic recruitment of AR and RNA Polymerase II, as well as the recruitment of proteins involved in the DNA demethylation process, TET1 and TDG. Furthermore, the presence of DNA methylation at dynamic regions inhibits protein binding and transcriptional activity of SGK1. These findings establish AR activity as a contributing factor to the dynamic regulation of DNA methylation patterns at target genes in prostate biology and infer further complexity involved in nuclear receptor mediation of transcriptional regulation. PMID:26646795

  3. NONCODE 2016: an informative and valuable data source of long non-coding RNAs

    PubMed Central

    Zhao, Yi; Li, Hui; Fang, Shuangsang; Kang, Yue; wu, Wei; Hao, Yajing; Li, Ziyang; Bu, Dechao; Sun, Ninghui; Zhang, Michael Q.; Chen, Runsheng

    2016-01-01

    NONCODE (http://www.bioinfo.org/noncode/) is an interactive database that aims to present the most complete collection and annotation of non-coding RNAs, especially long non-coding RNAs (lncRNAs). The recently reduced cost of RNA sequencing has produced an explosion of newly identified data. Revolutionary third-generation sequencing methods have also contributed to more accurate annotations. Accumulative experimental data also provides more comprehensive knowledge of lncRNA functions. In this update, NONCODE has added six new species, bringing the total to 16 species altogether. The lncRNAs in NONCODE have increased from 210 831 to 527,336. For human and mouse, the lncRNA numbers are 167,150 and 130,558, respectively. NONCODE 2016 has also introduced three important new features: (i) conservation annotation; (ii) the relationships between lncRNAs and diseases; and (iii) an interface to choose high-quality datasets through predicted scores, literature support and long-read sequencing method support. NONCODE is also accessible through http://www.noncode.org/. PMID:26586799

  4. LARVA: an integrative framework for large-scale analysis of recurrent variants in noncoding annotations

    PubMed Central

    Lochovsky, Lucas; Zhang, Jing; Fu, Yao; Khurana, Ekta; Gerstein, Mark

    2015-01-01

    In cancer research, background models for mutation rates have been extensively calibrated in coding regions, leading to the identification of many driver genes, recurrently mutated more than expected. Noncoding regions are also associated with disease; however, background models for them have not been investigated in as much detail. This is partially due to limited noncoding functional annotation. Also, great mutation heterogeneity and potential correlations between neighboring sites give rise to substantial overdispersion in mutation count, resulting in problematic background rate estimation. Here, we address these issues with a new computational framework called LARVA. It integrates variants with a comprehensive set of noncoding functional elements, modeling the mutation counts of the elements with a β-binomial distribution to handle overdispersion. LARVA, moreover, uses regional genomic features such as replication timing to better estimate local mutation rates and mutational hotspots. We demonstrate LARVA's effectiveness on 760 whole-genome tumor sequences, showing that it identifies well-known noncoding drivers, such as mutations in the TERT promoter. Furthermore, LARVA highlights several novel highly mutated regulatory sites that could potentially be noncoding drivers. We make LARVA available as a software tool and release our highly mutated annotations as an online resource (larva.gersteinlab.org). PMID:26304545

  5. Noncoding RNAs and pancreatic cancer

    PubMed Central

    Peng, Juan-Fei; Zhuang, Yan-Yan; Huang, Feng-Ting; Zhang, Shi-Neng

    2016-01-01

    Noncoding RNAs (ncRNAs) represent a class of RNA molecules that typically do not code for proteins. Emerging data suggest that ncRNAs play an important role in several physiological and pathological conditions such as cancer. The best-characterized ncRNAs are the microRNAs (miRNAs), which are short, approximately 22-nucleotide sequences of RNA of approximately 22-nucleotide in length that regulate gene expression at the posttranscriptional level, through transcript degradation or translational repression. MiRNAs can function as master gene regulators, impacting a variety of cellular pathways important to normal cellular functions as well as cancer development and progression. In addition to miRNAs, long ncRNAs, which are transcripts longer than 200 nucleotides, have recently emerged as novel drivers of tumorigenesis. However, the molecular mechanisms of their regulation and function, and the significance of other ncRNAs such as piwi-interacting RNAs in pancreas carcinogenesis are largely unknown. This review summarizes the growing body of evidence supporting the vital roles of ncRNAs in pancreatic cancer, focusing on their dysregulation through both genetic and epigenetic mechanisms, and highlighting the promise of ncRNAs in diagnostic and therapeutic applications of pancreatic cancer. PMID:26811626

  6. Long noncoding RNAs and neuroblastoma

    PubMed Central

    Pandey, Gaurav Kumar; Kanduri, Chandrasekhar

    2015-01-01

    Neuroblastoma is a disease that affects infants and despite intense multimodal therapy, high-risk patients have low survival rates (<50%). In recent years long noncoding RNAs (lncRNAs) have become the cutting edge of cancer research with inroads made in understanding their roles in multiple cancer types, including prostate and breast cancers. The roles of lncRNAs in neuroblastoma have just begun to be elucidated. This review summarises where we are with regards to lncRNAs in neuroblastoma. The known mechanistic roles of lncRNAs during neuroblastoma pathogenesis are discussed, as well as the relationship between lncRNA expression and the differentiation capacity of neuroblastoma cells. We speculate about the use of some of these lncRNAs, such as those mapping to the 6p22 hotspot, as biomarkers for neuroblastoma prognosis and treatment. This novel way of thinking about both neuroblastoma and lncRNAs brings a new perspective to the prognosis and treatment of high-risk patients. PMID:26087192

  7. A new large-DNA-fragment delivery system based on integrase activity from an integrative and conjugative element.

    PubMed

    Miyazaki, Ryo; van der Meer, Jan Roelof

    2013-07-01

    During the past few decades, numerous plasmid vectors have been developed for cloning, gene expression analysis, and genetic engineering. Cloning procedures typically rely on PCR amplification, DNA fragment restriction digestion, recovery, and ligation, but increasingly, procedures are being developed to assemble large synthetic DNAs. In this study, we developed a new gene delivery system using the integrase activity of an integrative and conjugative element (ICE). The advantage of the integrase-based delivery is that it can stably introduce a large DNA fragment (at least 75 kb) into one or more specific sites (the gene for glycine-accepting tRNA) on a target chromosome. Integrase recombination activity in Escherichia coli is kept low by using a synthetic hybrid promoter, which, however, is unleashed in the final target host, forcing the integration of the construct. Upon integration, the system is again silenced. Two variants with different genetic features were produced, one in the form of a cloning vector in E. coli and the other as a mini-transposable element by which large DNA constructs assembled in E. coli can be tagged with the integrase gene. We confirmed that the system could successfully introduce cosmid and bacterial artificial chromosome (BAC) DNAs from E. coli into the chromosome of Pseudomonas putida in a site-specific manner. The integrase delivery system works in concert with existing vector systems and could thus be a powerful tool for synthetic constructions of new metabolic pathways in a variety of host bacteria. PMID:23686268

  8. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.

    PubMed

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  9. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

    PubMed Central

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  10. [The influence of transposable elements on genome size].

    PubMed

    Biémont, Christian; Vieira, Cristina

    2004-01-01

    Genome size displays an important variability between species without any direct link to complexity. This paradox, so-called "C value paradox", now becomes understood as resulting from a differential abundance of numerous repeated sequences, among which transposable elements. Genomes indeed contain a important proportion of such sequences (95 % of DNA in man, about 45 % of which are transposable elements, up to 99 % of DNA in some plants). While most investigations until now are focalized on genes or coding sequences, which thus represent a small part of the genome, more attention now is dedicated on so-called non-coding sequences. Transposable elements, which are capable of moving around in genomes, inducing mutations, chromosomal rearrangements, gene expression regulations, thus appear as major actors in diversity and evolution. We present here a brief review of the most prominent acquisition in this expanding domain. PMID:15969348

  11. HDA6 Directly Interacts with DNA Methyltransferase MET1 and Maintains Transposable Element Silencing in Arabidopsis1[W][OA

    PubMed Central

    Liu, Xuncheng; Yu, Chun-Wei; Duan, Jun; Luo, Ming; Wang, Koching; Tian, Gang; Cui, Yuhai; Wu, Keqiang

    2012-01-01

    The molecular mechanism of how the histone deacetylase HDA6 participates in maintaining transposable element (TE) silencing in Arabidopsis (Arabidopsis thaliana) is not yet defined. In this study, we show that a subset of TEs was transcriptionally reactivated and that TE reactivation was associated with elevated histone H3 and H4 acetylation as well as increased H3K4Me3 and H3K4Me2 in hda6 mutants. Decreased DNA methylation of the TEs was also detected in hda6 mutants, suggesting that HDA6 silences the TEs by regulating histone acetylation and methylation as well as the DNA methylation status of the TEs. Similarly, transcripts of some of these TEs were also increased in the methyltransferase1 (met1) mutant, with decreased DNA methylation. Furthermore, H4 acetylation, H3K4Me3, H3K4Me2, and H3K36Me2 were enriched at the coregulated TEs in the met1 and hda6 met1 mutants. Protein-protein interaction analysis indicated that HDA6 physically interacts with MET1 in vitro and in vivo, and further deletion analysis demonstrated that the carboxyl-terminal region of HDA6 and the bromo-adjacent homology domain of MET1 were responsible for the interaction. These results suggested that HDA6 and MET1 interact directly and act together to silence TEs by modulating DNA methylation, histone acetylation, and histone methylation status. PMID:21994348

  12. Identification and characterization of methylation-dependent/independent DNA regulatory elements in the human SLC9B1 gene

    PubMed Central

    Kumar, Priya L.; James, Paul F.

    2015-01-01

    The human NHEDC1 (hNHEDC1) protein is thought to be essential for sperm motility and fertility however the mechanisms regulating its gene expression are largely unknown. In this study we have identified multiple DNA regulatory elements in the 5′ end of the gene encoding hNHEDC1 (SLC9B1) and have explored the role that DNA methylation at these elements plays in the regulation of its expression. We first show that the full-length hNHEDC1 protein is testis-specific for the tissues that we tested and that it localizes to the cells of the seminiferous tubules. In silico analysis of the SLC9B1 gene locus identified two putative promoters (P1 and P2) and two CpG islands - CpGI (overlapping with P1) and CpGII (intragenic) - at the 5′ end of the gene. By deletion analysis of P1, we show that the region from −23bp to +200bp relative to the transcription start site (TSS) is sufficient for optimal promoter activity in a germ cell line. Additionally, in vitro methylation of the P1 (the −500bp to +200bp region relative to the TSS) abolishes its activity in germ cells and somatic cells strongly suggesting that DNA methylation at this promoter could regulate SLC9B1 expression. Furthermore, bisulfite-sequencing analysis of the P1/CpGI uncovered reduced methylation in the testis vs. lung whereas CpGII displayed no differences in methylation between these two tissues. Additionally, treatment of HEK 293 cells with 5-Aza2-Deoxycytidine led to upregulation of NHEDC1 transcript and reduced methylation in the promoter CpGI. Finally, we have uncovered both enhancer and silencer functions of the intragenic SLC9B1 CpGII. In all, our data suggests that SLC9B1 gene expression could be regulated via a concerted action of DNA methylation-dependent and independent mechanisms mediated by these multiple DNA regulatory elements. PMID:25701605

  13. Exploration of noncoding sequences in metagenomes.

    PubMed

    Tobar-Tosse, Fabián; Rodríguez, Adrián C; Vélez, Patricia E; Zambrano, María M; Moreno, Pedro A

    2013-01-01

    Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore, some metagenome regulatory or structural information could be discarded. In this work we analyzed 23 whole metagenomes, including coding and noncoding sequences using the following sequence patterns: (G+C) content, Codon Usage (Cd), Trinucleotide Usage (Tn), and functional assignments for ORF prediction. Herein, we present evidence of a high proportion of noncoding sequences discarded in common similarity-based methods in metagenomics, and the kind of relevant information present in those. We found a high density of trinucleotide repeat sequences (TRS) in noncoding sequences, with a regulatory and adaptive function for metagenome communities. We present associations between trinucleotide values and gene function, where metagenome clustering correlate with microorganism adaptations and kinds of metagenomes. We propose here that noncoding sequences have relevant information to describe metagenomes that could be considered in a whole metagenome analysis in order to improve their organization, classification protocols, and their relation with the environment. PMID:23536879

  14. Exploration of Noncoding Sequences in Metagenomes

    PubMed Central

    Tobar-Tosse, Fabián; Rodríguez, Adrián C.; Vélez, Patricia E.; Zambrano, María M.; Moreno, Pedro A.

    2013-01-01

    Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore, some metagenome regulatory or structural information could be discarded. In this work we analyzed 23 whole metagenomes, including coding and noncoding sequences using the following sequence patterns: (G+C) content, Codon Usage (Cd), Trinucleotide Usage (Tn), and functional assignments for ORF prediction. Herein, we present evidence of a high proportion of noncoding sequences discarded in common similarity-based methods in metagenomics, and the kind of relevant information present in those. We found a high density of trinucleotide repeat sequences (TRS) in noncoding sequences, with a regulatory and adaptive function for metagenome communities. We present associations between trinucleotide values and gene function, where metagenome clustering correlate with microorganism adaptations and kinds of metagenomes. We propose here that noncoding sequences have relevant information to describe metagenomes that could be considered in a whole metagenome analysis in order to improve their organization, classification protocols, and their relation with the environment. PMID:23536879

  15. Noncoding RNAs in Beta Cell Biology

    PubMed Central

    Singer, Ruth A.; Arnes, Luis; Sussel, Lori

    2015-01-01

    Purpose of Review The identification and characterization of essential islet transcription factors have improved our understanding of β cell development, provided insights into many of the cellular dysfunctions related to diabetes, and facilitated the successful generation of β cells from alternative cell sources. Recently, noncoding RNAs have emerged as a novel set of molecules that may represent missing components of the known islet regulatory pathways. The purpose of this review is to highlight studies that have implicated noncoding RNAs as important regulators of pancreas cell development and β cell function. Recent Findings Disruption of essential components of the microRNA processing machinery, in addition to misregulation of individual miRNAs, has revealed the importance of microRNAs in pancreas development and β cell function. Furthermore, over 1000 islet-specific long noncoding RNAs have been identified in mouse and human islets, suggesting that this class of noncoding molecules will also play important functional roles in the β cell. Summary The analysis of noncoding RNAs in the pancreas will provide important new insights into pancreatic regulatory processes that will improve our ability to understand and treat diabetes and may facilitate the generation of replacement β cells from alternative cell sources. PMID:25692923

  16. Epigenetic conservation at gene regulatory elements revealed by non-methylated DNA profiling in seven vertebrates.

    PubMed

    Long, Hannah K; Sims, David; Heger, Andreas; Blackledge, Neil P; Kutter, Claudia; Wright, Megan L; Grützner, Frank; Odom, Duncan T; Patient, Roger; Ponting, Chris P; Klose, Robert J

    2013-01-01

    Two-thirds of gene promoters in mammals are associated with regions of non-methylated DNA, called CpG islands (CGIs), which counteract the repressive effects of DNA methylation on chromatin. In cold-blooded vertebrates, computational CGI predictions often reside away from gene promoters, suggesting a major divergence in gene promoter architecture across vertebrates. By experimentally identifying non-methylated DNA in the genomes of seven diverse vertebrates, we instead reveal that non-methylated islands (NMIs) of DNA are a central feature of vertebrate gene promoters. Furthermore, NMIs are present at orthologous genes across vast evolutionary distances, revealing a surprising level of conservation in this epigenetic feature. By profiling NMIs in different tissues and developmental stages we uncover a unifying set of features that are central to the function of NMIs in vertebrates. Together these findings demonstrate an ancient logic for NMI usage at gene promoters and reveal an unprecedented level of epigenetic conservation across vertebrate evolution. DOI:http://dx.doi.org/10.7554/eLife.00348.001. PMID:23467541

  17. Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

    ERIC Educational Resources Information Center

    Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo

    2006-01-01

    We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

  18. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

    1995-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  19. Statistical properties of DNA sequences

    NASA Astrophysics Data System (ADS)

    Peng, C.-K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

    1995-02-01

    We review evidence supporting the idea that the DNA sequence in genese containing non-coding regions is correlated, and that the correlation is remarkably long range - indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the “non-stationarity” feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33 301 coding and 29 453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  20. Ubiquitous and neuronal DNA-binding proteins interact with a negative regulatory element of the human hypoxanthine phosphoribosyltransferase gene.

    PubMed Central

    Rincón-Limas, D E; Amaya-Manzanares, F; Niño-Rosales, M L; Yu, Y; Yang, T P; Patel, P I

    1995-01-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene is constitutively expressed at low levels in all tissues but at higher levels in the brain; the significance and mechanism of this differential expression are unknown. We previously identified a 182-bp element (hHPRT-NE) within the 5'-flanking region of the human HPRT (hHPRT) gene, which is involved not only in conferring neuronal specificity but also in repressing gene expression in nonneuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation. We also mapped the binding sites for both complexes to a 60-bp region (Ff; positions -510 to -451) which, when analyzed in transfection assays, functioned as a repressor element analogous to the full-length hHPRT-NE sequence. Methylation interference footprintings revealed a minimal unique DNA motif, 5'-GGAAGCC-3', as the binding site for nuclear proteins from both neuronal and nonneuronal sources. However, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the associations of these two complexes. Moreover, UV cross-linking experiments showed that both complexes are formed by the association of several different proteins. Taken together, these data suggest that differential interaction of DNA-binding factors with this regulatory element plays a crucial role in the brain-preferential expression of the gene, and they should lead to the isolation of transcriptional regulators important in neuronal expression of the HPRT gene. PMID:8524221

  1. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons

    PubMed Central

    Tourasse, Nicolas J.; Stabell, Fredrik B.; Kolstø, Anne-Brit

    2014-01-01

    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron–IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  2. Effect of Environmental Chemical Stress on Nuclear Noncoding RNA Involved in Epigenetic Control

    PubMed Central

    Arrigo, Patrizio; Pulliero, Alessandra

    2015-01-01

    In the last decade the role of noncoding RNAs (ncRNAs) emerges not only as key elements of posttranscriptional gene silencing, but also as important players of epigenetic regulation. New kind and new functions of ncRNAs are continuously discovered and one of their most important roles is the mediation of environmental signals, both physical and chemical. The activity of cytoplasmic short ncRNA is extensively studied, in spite of the fact that their function and role in the nuclear compartment are not yet completely unraveled. Cellular nucleus contains a multiplicity of long and short ncRNAs controlling at different levels transcriptional and epigenetic processes. In addition, some ncRNAs are involved in RNA editing and quality control. In this paper we review the existing knowledge dealing with how chemical stressors can influence the functionality of short nuclear ncRNAs. Furthermore, we perform bioinformatics analyses indicating that chemical environmental stressors not only induce DNA damage but also influence the mechanism of ncRNAs production and control. PMID:26339639

  3. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  4. Non-coding RNAs: Classification, Biology and Functioning.

    PubMed

    Hombach, Sonja; Kretz, Markus

    2016-01-01

    One of the long-standing principles of molecular biology is that DNA acts as a template for transcription of messenger RNAs, which serve as blueprints for protein translation. A rapidly growing number of exceptions to this rule have been reported over the past decades: they include long known classes of RNAs involved in translation such as transfer RNAs and ribosomal RNAs, small nuclear RNAs involved in splicing events, and small nucleolar RNAs mainly involved in the modification of other small RNAs, such as ribosomal RNAs and transfer RNAs. More recently, several classes of short regulatory non-coding RNAs, including piwi-associated RNAs, endogenous short-interfering RNAs and microRNAs have been discovered in mammals, which act as key regulators of gene expression in many different cellular pathways and systems. Additionally, the human genome encodes several thousand long non-protein coding RNAs >200 nucleotides in length, some of which play crucial roles in a variety of biological processes such as epigenetic control of chromatin, promoter-specific gene regulation, mRNA stability, X-chromosome inactivation and imprinting. In this chapter, we will introduce several classes of short and long non-coding RNAs, describe their diverse roles in mammalian gene regulation and give examples for known modes of action. PMID:27573892

  5. Non-coding RNAs: the architects of eukaryotic complexity.

    PubMed

    Mattick, J S

    2001-11-01

    Around 98% of all transcriptional output in humans is non-coding RNA. RNA-mediated gene regulation is widespread in higher eukaryotes and complex genetic phenomena like RNA interference, co-suppression, transgene silencing, imprinting, methylation, and possibly position-effect variegation and transvection, all involve intersecting pathways based on or connected to RNA signaling. I suggest that the central dogma is incomplete, and that intronic and other non-coding RNAs have evolved to comprise a second tier of gene expression in eukaryotes, which enables the integration and networking of complex suites of gene activity. Although proteins are the fundamental effectors of cellular function, the basis of eukaryotic complexity and phenotypic variation may lie primarily in a control architecture composed of a highly parallel system of trans-acting RNAs that relay state information required for the coordination and modulation of gene expression, via chromatin remodeling, RNA-DNA, RNA-RNA and RNA-protein interactions. This system has interesting and perhaps informative analogies with small world networks and dataflow computing. PMID:11713189

  6. DNA sequences of Alu elements indicate a recent replacement of the human autosomal genetic complement

    SciTech Connect

    Knight, A.; Deininger, P.L.; Batzer, M.A.

    1996-04-30

    DNA sequences of neutral nuclear autosomal loci, compared across diverse human populations, provide a previously untapped perspective into the mode and tempo of the emergence of modern humans and a critical comparison with published clonally inherited mitochondrial DNA and Y chromosome measurements of human diversity. We obtained over 55 kilobases of sequence from three autosomal loci encompassing Alu repeats for representatives of diverse human populations as well as orthologous sequences for other hominoid species at one of these loci. Nucleotide diversity was exceedingly low. Most individuals and populations were identical. Only a single nucleotide difference distinguished presumed ancestral alleles from descendants. These results differ from those expected if alleles from divergent archaic populations were maintained through multiregional continuity. The observed virtual lack of sequence polymorphism is the signature of a recent single origin for modern humans, with general replacement of archaic populations. 47 refs., 2 figs., 1 tab.

  7. DNA sequences of Alu elements indicate a recent replacement of the human autosomal genetic complement.

    PubMed Central

    Knight, A; Batzer, M A; Stoneking, M; Tiwari, H K; Scheer, W D; Herrera, R J; Deininger, P L

    1996-01-01

    DNA sequences of neutral nuclear autosomal loci, compared across diverse human populations, provide a previously untapped perspective into the mode and tempo of the emergence of modern humans and a critical comparison with published clonally inherited mitochondrial DNA and Y chromosome measurements of human diversity. We obtained over 55 kilobases of sequence from three autosomal loci encompassing Alu repeats for representatives of diverse human populations as well as orthologous sequences for other hominoid species at one of these loci. Nucleotide diversity was exceedingly low. Most individuals and populations were identical. Only a single nucleotide difference distinguished presumed ancestral alleles from descendants. These results differ from those expected if alleles from divergent archaic populations were maintained through multiregional continuity. The observed virtual lack of sequence polymorphism is the signature of a recent single origin for modern humans, with general replacement of archaic populations. PMID:8633071

  8. Survey sequencing reveals elevated DNA transposon activity, novel elements, and variation in repetitive landscapes among vesper bats.

    PubMed

    Pagán, Heidi J T; Macas, Jiří; Novák, Petr; McCulloch, Eve S; Stevens, Richard D; Ray, David A

    2012-01-01

    The repetitive landscapes of mammalian genomes typically display high Class I (retrotransposon) transposable element (TE) content, which usually comprises around half of the genome. In contrast, the Class II (DNA transposon) contribution is typically small (<3% in model mammals). Most mammalian genomes exhibit a precipitous decline in Class II activity beginning roughly 40 Ma. The first signs of more recently active mammalian Class II TEs were obtained from the little brown bat, Myotis lucifugus, and are reflected by higher genome content (~5%). To aid in determining taxonomic limits and potential impacts of this elevated Class II activity, we performed 454 survey sequencing of a second Myotis species as well as four additional taxa within the family Vespertilionidae and an outgroup species from Phyllostomidae. Graph-based clustering methods were used to reconstruct the major repeat families present in each species and novel elements were identified in several taxa. Retrotransposons remained the dominant group with regard to overall genome mass. Elevated Class II TE composition (3-4%) was observed in all five vesper bats, while less than 0.5% of the phyllostomid reads were identified as Class II derived. Differences in satellite DNA and Class I TE content are also described among vespertilionid taxa. These analyses present the first cohesive description of TE evolution across closely related mammalian species, revealing genome-scale differences in TE content within a single family. PMID:22491057

  9. Viral Noncoding RNAs in Cancer Biology.

    PubMed

    Li, Zhi; Fu, Shujun; Sun, Lun-Quan

    2016-01-01

    Over 12 % of all human cancers are caused by oncoviruses, primarily including Epstein-Barr virus (EBV), high-risk human papillomaviruses (HPVs), hepatitis B and C viruses (HBV and HCV, respectively), and Kaposi's sarcoma herpesvirus (KSHV). In addition to viral oncoproteins, a variety of noncoding RNAs (ncRNAs) produced by oncoviruses have been recognized as important cofactors that contribute to the oncogenic events. In this chapter, we will focus on the recent understanding of the long and short noncoding RNAs, as well as microRNAs of the viruses, and discuss their roles in the biology of multistep oncogenesis mediated by established human oncoviruses. PMID:27376743

  10. Long Noncoding RNA: Recent Updates in Atherosclerosis

    PubMed Central

    Li, Hao; Zhu, Hongming; Ge, Junbo

    2016-01-01

    Long noncoding RNAs belong to a class of noncoding RNAs longer than 200 nucleotides with the epigenetic regulation potential. As a novel molecular regulator, lncRNAs are often dysregulated in various pathological conditions and display multiple functions in a wide range of biological processes. Given that recent studies have indicated that lncRNAs are involved in atherosclerosis-related smooth muscle cell, endothelial cell, macrophage and lipid metabolism regulation, it is pertinent to understand the potential function of lncRNAs in atherosclerosis development. This review will highlight the recent updates of lncRNAs in atherogenesis and also discuss their potential roles as novel therapeutic targets. PMID:27314829

  11. The non-coding RNAs as riboregulators

    PubMed Central

    Erdmann, Volker A.; Barciszewska, Miroslawa Z.; Szymanski, Maciej; Hochberg, Abraham; Groot, Nathan de; Barciszewski, Jan

    2001-01-01

    The non-coding RNAs database (http://biobases.ibch.poznan.pl/ncRNA/) contains currently available data on RNAs, which do not have long open reading frames and act as riboregulators. Non-coding RNAs are involved in the specific recognition of cellular nucleic acid targets through complementary base pairing to control cell growth and differentiation. Some of them are connected with several well known developmental and neuro­behavioral disorders. We have divided them into four groups. This paper is a short introduction to the database and presents its latest, updated edition. PMID:11125087

  12. Promiscuous DNA: horizontal transfer of transposable elements and why it matters for eukaryotic evolution.

    PubMed

    Schaack, Sarah; Gilbert, Clément; Feschotte, Cédric

    2010-09-01

    Horizontal transfer is the passage of genetic material between genomes by means other than parent-to-offspring inheritance. Although the transfer of genes is thought to be crucial in prokaryotic evolution, few instances of horizontal gene transfer have been reported in multicellular eukaryotes; instead, most cases involve transposable elements. With over 200 cases now documented, it is possible to assess the importance of horizontal transfer for the evolution of transposable elements and their host genomes. We review criteria for detecting horizontal transfers and examine recent examples of the phenomenon, shedding light on its mechanistic underpinnings, including the role of host-parasite interactions. We argue that the introduction of transposable elements by horizontal transfer in eukaryotic genomes has been a major force propelling genomic variation and biological innovation. PMID:20591532

  13. Promiscuous DNA: horizontal transfer of transposable elements and why it matters for eukaryotic evolution

    PubMed Central

    Schaack, Sarah; Gilbert, Clément; Feschotte, Cédric

    2010-01-01

    Horizontal transfer is the passage of genetic material between genomes by means other than parent-to-offspring inheritance. Although the transfer of genes is thought to be crucial in prokaryotic evolution, few instances of horizontal gene transfer have been reported in multicellular eukaryotes; instead, most cases involve transposable elements. With over 200 cases now documented, it is possible to assess the importance of horizontal transfer for the evolution of transposable elements and their host genomes. We review criteria for detecting horizontal transfers and examine recent examples of the phenomenon, shedding light on its mechanistic underpinnings, including the role of host-parasite interactions. We argue that the introduction of transposable elements by horizontal transfer in eukaryotic genomes has been a major force propelling genomic variation and biological innovation. PMID:20591532

  14. Deep Investigation of Arabidopsis thaliana Junk DNA Reveals a Continuum between Repetitive Elements and Genomic Dark Matter

    PubMed Central

    Maumus, Florian; Quesneville, Hadi

    2014-01-01

    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant. PMID:24709859

  15. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    NASA Astrophysics Data System (ADS)

    Štísová, Viktorie; Goffinont, Stephane; Spotheim-Maurizot, Melanie; Davídková, Marie

    2010-08-01

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERα, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with γ rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  16. From adjacent activation in Escherichia coli and DNA cyclization to eukaryotic enhancers: the elements of a puzzle

    PubMed Central

    Amouyal, Michèle

    2014-01-01

    Deoxyribonucleic acid cyclization, Escherichia coli lac repressor binding to two spaced lac operators and repression enhancement can be successfully used for a better understanding of the conditions required for interaction between eukaryotic enhancers and the machinery of transcription initiation. Chronologically, the DNA looping model has first accounted for the properties initially defining enhancers, i.e., independence of action with distance or orientation with respect to the start of transcription. It has also predicted enhancer activity or its disruption at short distance (site orientation, alignment between promoter and enhancer sites), with high-order complexes of protein, or with transcription factor concentrations close or different from the wild-type situation. In another step, histones have been introduced into the model to further adapt it to eukaryotes. They in fact favor DNA cyclization in vitro. The resulting DNA compaction might explain the difference counted in base pairs in the distance of action between eukaryotic transcription enhancers and prokaryotic repression enhancers. The lac looping system provides a potential tool for analysis of this discrepancy and of chromatin state directly in situ. Furthermore, as predicted by the model, the contribution of operators O2 and O3 to repression of the lac operon clearly depends on the lac repressor level in the cell and is prevented in strains overproducing lac repressor. By extension, gene regulation especially that linked to cell fate, should also depend on transcription factor levels, providing a potential tool for cellular therapy. In parallel, a new function of the O1–O3 loop completes the picture of lac repression. The O1–O3 loop would at the same time ensure high efficiency of repression, inducibility through the low-affinity sites and limitation of the level of repressor through self-repression of the lac repressor. Last, the DNA looping model can be successfully adapted to the enhancer

  17. Challenges in the analysis of long noncoding RNA functionality.

    PubMed

    Leone, Sergio; Santoro, Raffaella

    2016-08-01

    Long noncoding RNA (lncRNA) are emerging as important regulators of diverse biological functions. Although mechanistic models are starting to emerge, it is also clear that the lncRNA field needs appropriate model systems in order to better elucidate the functions of lncRNA and their roles in both physiological and pathological conditions. The field of lncRNA is new, and the biochemical and genetic methods used to address function and mechanisms of lncRNA have only recently been developed or adapted from techniques used to investigate protein-coding genes. In this review, we discuss the strengths and weaknesses of available techniques for the analysis of chromatin-associated lncRNA and emerging models for the recruitment to specific genomic sites such as triple-helix, RNA-protein-DNA recognition and proximity-guided search models. PMID:27417130

  18. From Transcriptome to Noncoding RNAs: Implications in ALS Mechanism.

    PubMed

    Gagliardi, Stella; Milani, Pamela; Sardone, Valentina; Pansarasa, Orietta; Cereda, Cristina

    2012-01-01

    In the last years, numerous studies have focused on understanding the metabolism of RNA and its implication in disease processes but abnormal RNA metabolism is still unknown. RNA plays a central role in translating genetic information into proteins and in many other catalytic and regulatory tasks. Recent advances in the study of RNA metabolism revealed complex pathways for the generation and maintenance of functional RNA in amyotrophic lateral sclerosis (ALS). Interestingly, perturbations in RNA processing have been described in ALS at various levels such as gene transcription, mRNA stabilization, transport, and translational regulations. In this paper, we will discuss the alteration of RNA profile in ALS disease, starting from transcription, the first step leading to gene expression, through the posttranscriptional regulation, including RNA/DNA binding proteins and aberrant exon splicing to protein noncoding RNAs, as lncRNA and microRNA. PMID:22778949

  19. Making a long story short: noncoding RNAs and chromosome change

    PubMed Central

    Brown, J D; Mitchell, S E; O'Neill, R J

    2012-01-01

    As important as the events that influence selection for specific chromosome types in the derivation of novel karyotypes, are the events that initiate the changes in chromosome number and structure between species, and likewise polymorphisms, variants and disease states within species. Although once thought of as transcriptional ‘noise', noncoding RNAs (ncRNAs) are now recognized as important mediators of epigenetic regulation and chromosome stability. Here we highlight recent work that illustrates the influence short and long ncRNAs have as participants in the function and stability of chromosome regions such as centromeres, telomeres, evolutionary breakpoints and fragile sites. We summarize recent evidence that ncRNAs can facilitate chromosome change and present mechanisms by which ncRNAs create DNA breaks. Finally, we present hypotheses on how they may create novel karyotypes and thus affect chromosome evolution. PMID:22072070

  20. Noncoding RNAs: Regulators of the Mammalian Transcription Machinery.

    PubMed

    Eidem, Tess M; Kugel, Jennifer F; Goodrich, James A

    2016-06-19

    Transcription by RNA polymerase II (Pol II) is required to produce mRNAs and some noncoding RNAs (ncRNAs) within mammalian cells. This coordinated process is precisely regulated by multiple factors, including many recently discovered ncRNAs. In this perspective, we will discuss newly identified ncRNAs that facilitate DNA looping, regulate transcription factor binding, mediate promoter-proximal pausing of Pol II, and/or interact with Pol II to modulate transcription. Moreover, we will discuss new roles for ncRNAs, as well as a novel Pol II RNA-dependent RNA polymerase activity that regulates an ncRNA inhibitor of transcription. As the multifaceted nature of ncRNAs continues to be revealed, we believe that many more ncRNA species and functions will be discovered. PMID:26920110

  1. Non-coding RNAs in mammalian sexual development.

    PubMed

    McFarlane, L; Wilhelm, D

    2009-01-01

    The present decade is witnessing a paradigm shift in our understanding of gene regulation. RNA, once relegated to an intermediary between DNA and protein, has emerged as a key contributor in the coordination of complex developmental pathways. For sexually reproducing organisms, propagation of the species is accomplished via an elaborate sexual phenotype. In mammals this consists of a highly complex cell lineage that has the capacity for intricate self-differentiation whilst maintaining the potential to generate all cell types upon fertilization. In addition, mammals possess a diverse range of somatic reproductive tissues and organs that often undergo dynamic morphological changes in response to a variety of external and internal cues. Although the protein component required to mediate these processes continues to be vigorously investigated, it is becoming increasingly apparent that an understanding of the non-coding RNA (ncRNA) component is required to develop a comprehensive picture of mammalian sexual development. PMID:20197714

  2. Identification of Regulatory DNA Elements Using Genome-wide Mapping of DNase I Hypersensitive Sites during Tomato Fruit Development.

    PubMed

    Qiu, Zhengkun; Li, Ren; Zhang, Shuaibin; Wang, Ketao; Xu, Meng; Li, Jiayang; Du, Yongchen; Yu, Hong; Cui, Xia

    2016-08-01

    Development and ripening of tomato fruit are precisely controlled by transcriptional regulation, which depends on the orchestrated accessibility of regulatory proteins to promoters and other cis-regulatory DNA elements. This accessibility and its effect on gene expression play a major role in defining the developmental process. To understand the regulatory mechanism and functional elements modulating morphological and anatomical changes during fruit development, we generated genome-wide high-resolution maps of DNase I hypersensitive sites (DHSs) from the fruit tissues of the tomato cultivar "Moneymaker" at 20 days post anthesis as well as break stage. By exploring variation of DHSs across fruit development stages, we pinpointed the most likely hypersensitive sites related to development-specific genes. By detecting binding motifs on DHSs of these development-specific genes or genes in the ascorbic acid biosynthetic pathway, we revealed the common regulatory elements contributing to coordinating gene transcription of plant ripening and specialized metabolic pathways. Our results contribute to a better understanding of the regulatory dynamics of genes involved in tomato fruit development and ripening. PMID:27250572

  3. Linear Amplification Mediated PCR – Localization of Genetic Elements and Characterization of Unknown Flanking DNA

    PubMed Central

    Gabriel, Richard; Kutschera, Ina; Bartholomae, Cynthia C; von Kalle, Christof; Schmidt, Manfred

    2014-01-01

    Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with integrating vector systems. Due to the stable integration of retroviral vectors, integration sites can be used to study the clonal fate of individual cells and their progeny. LAM- PCR for the first time provided evidence that leukemia in gene therapy treated patients originated from provirus induced overexpression of a neighboring proto-oncogene. The high sensitivity and specificity of LAM-PCR compared to existing methods like inverse PCR and ligation mediated (LM)-PCR is achieved by an initial preamplification step (linear PCR of 100 cycles) using biotinylated vector specific primers which allow subsequent reaction steps to be carried out on solid phase (magnetic beads). LAM-PCR is currently the most sensitive method available to identify unknown DNA which is located in the proximity of known DNA. Recently, a variant of LAM-PCR has been developed that circumvents restriction digest thus abrogating retrieval bias of integration sites and enables a comprehensive analysis of provirus locations in host genomes. The following protocol explains step-by-step the amplification of both 3’- and 5’- sequences adjacent to the integrated lentiviral vector. PMID:24998871

  4. Long noncoding RNAs in prostate cancer: mechanisms and applications

    PubMed Central

    Li, Chunlai; Yang, Liuqing; Lin, Chunru

    2014-01-01

    A large proportion of the control of gene expression in humans is mediated by noncoding elements in the genome. Long noncoding RNAs (lncRNAs) have emerged as a new class of pivotal regulatory components, orchestrating extensive cellular processes and connections. LncRNAs play various roles from chromatin modification to alternative splicing and post-transcriptional processing and are involved in almost all aspects of eukaryotic regulation. LncRNA-based mechanisms modulate cell fates during development, and their dysregulation underscores many human disorders, especially cancer, through chromosomal translocation, deletion, and nucleotide expansions. Recent studies demonstrate that multiple prostate cancer risk loci are associated with lncRNAs and that ectopic expression of these transcripts triggers a cascade of cellular events driving tumor initiation and progression. The recent increased rate of discovery of lncRNAs has been leveraged for application in clinical strategies such as novel biomarkers and therapeutic targets. Despite this potential, many issues remain to be addressed in this fast-growing field. PMID:27308347

  5. The complete mitochondrial genome of the grand jackknife clam, Solen grandis (Bivalvia: Solenidae): a novel gene order and unusual non-coding region.

    PubMed

    Yuan, Yang; Li, Qi; Kong, Lingfeng; Yu, Hong

    2012-02-01

    Molluscs in general, and bivalves in particular, exhibit an extraordinary degree of mitochondrial gene order variation when compared with other metazoans. The complete mitochondrial genome of Solen grandis (Bivalvia: Solenidae) was determined using long-PCR and genome walking techniques. The entire mitochondrial genome sequence of S. grandis is 16,784 bp in length, and contains 36 genes including 12 protein-coding genes (atp8 is absent), 2 ribosomal RNAs, and 22 tRNAs. All genes are encoded on the same strand. Compared with other species, it bears a novel gene order. Besides these, we find a peculiar non-coding region of 435 bp with a microsatellite-like (TA)(12) element, poly-structures and many hairpin structures. In contrast to the available heterodont mitochondrial genomes from GenBank, the complete mtDNA of S. grandis has the shortest cox3 gene, and the longest atp6, nad4, nad5 genes. PMID:21598108

  6. Nongenic, bidirectional transcription precedes and may promote developmental DNA deletion in Tetrahymena thermophila

    PubMed Central

    Chalker, Douglas L.; Yao, Meng-Chao

    2001-01-01

    A large number of DNA segments are excised from the chromosomes of the somatic nucleus during development of Tetrahymena thermophila. How these germline-limited sequences are recognized and excised is still poorly understood. We have found that many of these noncoding DNAs are transcribed during nuclear development. Transcription of the germline-limited M element occurs from both DNA strands and results in heterogeneous transcripts of < 200 b to > 1 kb. Transcripts are most abundant when developing micro- and macronuclei begin their differentiation. Transcription is normally restricted to unrearranged DNA of micronuclei and/or developing nuclei, but germline-limited DNAs can induce their own transcription when placed into somatic macronuclei. Brief actinomycin D treatment of conjugating cells blocked M-element excision, providing evidence that transcription is important for efficient DNA rearrangement. We propose that transcription targets these germline-limited sequences for elimination by altering chromatin to ensure their accessibility to the excision machinery. PMID:11358871

  7. Sequence analysis of the 3' non-coding region of mouse immunoglobulin light chain messenger RNA.

    PubMed Central

    Hamlyn, P H; Gillam, S; Smith, M; Milstein, C

    1977-01-01

    Using an oligonucleotide d(pT10-C-A) as primer, cDNA has been transcribed from the 3' non-coding region of mouse immunoglobulin light chain mRNA and sequenced by a modification1 of the 'plus-minus' gel method2. The sequence obtained has partially corrected and extended a previously obtained sequence3. The new data contains an unusual sequence in which a trinucleotide is repeated seven times. Images PMID:405661

  8. The decalog of long non-coding RNA involvement in cancer diagnosis and monitoring.

    PubMed

    Kunej, Tanja; Obsteter, Jana; Pogacar, Ziva; Horvat, Simon; Calin, George Adrian

    2014-12-01

    Long non-coding RNAs (lncRNAs) are transcripts without protein-coding capacity; initially regarded as "transcriptional noise", lately they have emerged as essential factors in both cell biology and mechanisms of disease. In this article, we present basic knowledge of lncRNA molecular mechanisms, associated physiological processes and cancer association, as well as their diagnostic and therapeutic value in the form of a decalog: (1) Non-coding RNAs (ncRNAs) are transcripts without protein-coding capacity divided by size (short and long ncRNAs), function (housekeeping RNA and regulatory RNA) and direction of transcription (sense/antisense, bidirectional, intronic and intergenic), containing a broad range of molecules with diverse properties and functions, such as messenger RNA, transfer RNA, microRNA and long non-coding RNAs. (2) Long non-coding RNAs are implicated in many molecular mechanisms, such as transcriptional regulation, post-transcriptional regulation and processing of other short ncRNAs. (3) Long non-coding RNAs play an important role in many physiological processes such as X-chromosome inactivation, cell differentiation, immune response and apoptosis. (4) Long non-coding RNAs have been linked to hallmarks of cancer: (a) sustaining proliferative signaling; (b) evading growth suppressors; (c) enabling replicative immortality; (d) activating invasion and metastasis; (e) inducing angiogenesis; (f) resisting cell death; and (g) reprogramming energy metabolism. (5) Regarding their impact on cancer cells, lncRNAs are divided into two groups: oncogenic and tumor-suppressor lncRNAs. (6) Studies of lncRNA involvement in cancer usually analyze deregulated expression patterns at the RNA level as well as the effects of single nucleotide polymorphisms and copy number variations at the DNA level. (7) Long non-coding RNAs have potential as novel biomarkers due to tissue-specific expression patterns, efficient detection in body fluids and high stability. (8) LncRNAs serve

  9. Genomic Organization of Repetitive DNA Elements and Its Implications for the Chromosomal Evolution of Channid Fishes (Actinopterygii, Perciformes).

    PubMed

    Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Villa, Mateo Andres; de Oliveira, Ezequiel Aguiar; Tanomtong, Alongklod; Yano, Cassia Fernanda; Supiwong, Weerayuth; Chaveerach, Arunrat

    2015-01-01

    Channid fishes, commonly referred to as "snakeheads", are currently very important in Asian fishery and aquaculture due to the substantial decline in natural populations because of overexploitation. A large degree of chromosomal variation has been found in this family, mainly through the use of conventional cytogenetic investigations. In this study, we analyzed the karyotype structure and the distribution of 7 repetitive DNA sequences in several Channa species from different Thailand river basins. The aim of this study was to investigate the chromosomal differentiation among species and populations to improve upon the knowledge of its biodiversity and evolutionary history. Rearrangements, such as pericentric inversions, fusions and polyploidization, appear to be important events during the karyotypic evolution of this genus, resulting in the chromosomal diversity observed among the distinct species and even among populations of the same species. In addition, such variability is also increased by the genomic dynamism of repetitive elements, particularly by the differential distribution and accumulation of rDNA sequences on chromosomes. This marked diversity is likely linked to the lifestyle of the snakehead fishes and their population fragmentation, as already identified for other fish species. The karyotypic features highlight the biodiversity of the channid fishes and justify a taxonomic revision of the genus Channa, as well as of the Channidae family as a whole, as some nominal species may actually constitute species complexes. PMID:26067030

  10. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium. PMID:20640386

  11. Genomic Organization of Repetitive DNA Elements and Its Implications for the Chromosomal Evolution of Channid Fishes (Actinopterygii, Perciformes)

    PubMed Central

    Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Villa, Mateo Andres; de Oliveira, Ezequiel Aguiar; Tanomtong, Alongklod; Yano, Cassia Fernanda; Supiwong, Weerayuth; Chaveerach, Arunrat

    2015-01-01

    Channid fishes, commonly referred to as “snakeheads”, are currently very important in Asian fishery and aquaculture due to the substantial decline in natural populations because of overexploitation. A large degree of chromosomal variation has been found in this family, mainly through the use of conventional cytogenetic investigations. In this study, we analyzed the karyotype structure and the distribution of 7 repetitive DNA sequences in several Channa species from different Thailand river basins. The aim of this study was to investigate the chromosomal differentiation among species and populations to improve upon the knowledge of its biodiversity and evolutionary history. Rearrangements, such as pericentric inversions, fusions and polyploidization, appear to be important events during the karyotypic evolution of this genus, resulting in the chromosomal diversity observed among the distinct species and even among populations of the same species. In addition, such variability is also increased by the genomic dynamism of repetitive elements, particularly by the differential distribution and accumulation of rDNA sequences on chromosomes. This marked diversity is likely linked to the lifestyle of the snakehead fishes and their population fragmentation, as already identified for other fish species. The karyotypic features highlight the biodiversity of the channid fishes and justify a taxonomic revision of the genus Channa, as well as of the Channidae family as a whole, as some nominal species may actually constitute species complexes. PMID:26067030

  12. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  13. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    SciTech Connect

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  14. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy

    2015-07-01

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  15. Induction of transcription within chromosomal DNA loops flanked by MAR elements causes an association of loop DNA with the nuclear matrix

    PubMed Central

    Iarovaia, Olga V.; Akopov, Sergey B.; Nikolaev, Lev G.; Sverdlov, Eugene D.; Razin, Sergey V.

    2005-01-01

    The spatial organization of an ∼170 kb region of human chromosome 19, including CD22 and GPR40–GPR43 genes, was studied using in situ hybridization of a set of cosmid and PAC probes with nuclear halos prepared from proliferating and differentiated HL60 cells. The whole region under study was found to be looped out into the nuclear halo in proliferating cells. It is likely that the loop observed was attached to the nuclear matrix via MAR elements present at the flanks of the area under study. Upon dimethyl sulfoxide-induced differentiation of the cells the looped fragment became associated with the nuclear matrix. This change in the spatial organization correlated with the activation of transcription of at least two (CD22 and GPR43) genes present within the loop. The data obtained are discussed in the framework of the hypothesis postulating that the spatial organization of chromosomal DNA is maintained via constitutive (basic) and facultative (transcription-related) interactions of the latter with the nuclear matrix. PMID:16049024

  16. Induction of transcription within chromosomal DNA loops flanked by MAR elements causes an association of loop DNA with the nuclear matrix.

    PubMed

    Iarovaia, Olga V; Akopov, Sergey B; Nikolaev, Lev G; Sverdlov, Eugene D; Razin, Sergey V

    2005-01-01

    The spatial organization of an approximately 170 kb region of human chromosome 19, including CD22 and GPR40-GPR43 genes, was studied using in situ hybridization of a set of cosmid and PAC probes with nuclear halos prepared from proliferating and differentiated HL60 cells. The whole region under study was found to be looped out into the nuclear halo in proliferating cells. It is likely that the loop observed was attached to the nuclear matrix via MAR elements present at the flanks of the area under study. Upon dimethyl sulfoxide-induced differentiation of the cells the looped fragment became associated with the nuclear matrix. This change in the spatial organization correlated with the activation of transcription of at least two (CD22 and GPR43) genes present within the loop. The data obtained are discussed in the framework of the hypothesis postulating that the spatial organization of chromosomal DNA is maintained via constitutive (basic) and facultative (transcription-related) interactions of the latter with the nuclear matrix. PMID:16049024

  17. Birthweight, maternal weight trajectories and global DNA methylation of LINE-1 repetitive elements.

    PubMed

    Michels, Karin B; Harris, Holly R; Barault, Ludovic

    2011-01-01

    Low birthweight, premature birth, intrauterine growth retardation, and maternal malnutrition have been related to an increased risk of cardiovascular disease, type 2 diabetes mellitus, obesity, and neuropsychiatric disorders later in life. Conversely, high birthweight has been linked to future risk of cancer. Global DNA methylation estimated by the methylation of repetitive sequences in the genome is an indicator of susceptibility to chronic diseases. We used data and biospecimens from an epigenetic birth cohort to explore the association between trajectories of fetal and maternal weight and LINE-1 methylation in 319 mother-child dyads. Newborns with low or high birthweight had significantly lower LINE-1 methylation levels in their cord blood compared to normal weight infants after adjusting for gestational age, sex of the child, maternal age at delivery, and maternal smoking during pregnancy (p = 0.007 and p = 0.036, respectively), but the magnitude of the difference was small. Infants born prematurely also had lower LINE-1 methylation levels in cord blood compared to term infants, and this difference, though small, was statistically significant (p = 0.004). We did not find important associations between maternal prepregnancy BMI or gestational weight gain and global methylation of the cord blood or fetal placental tissue. In conclusion, we found significant differences in cord blood LINE-1 methylation among newborns with low and high birthweight as well as among prematurely born infants. Future studies may elucidate whether chromosomal instabilities or other functional consequences of these changes contribute to the increased risk of chronic diseases among individuals with these characteristics. PMID:21980406

  18. Exploring the Secrets of Long Noncoding RNAs

    PubMed Central

    Quan, Mingyang; Chen, Jinhui; Zhang, Deqiang

    2015-01-01

    High-throughput sequencing has revealed that the majority of RNAs have no capacity to encode protein. Among these non-coding transcripts, recent work has focused on the roles of long noncoding RNAs (lncRNAs) of >200 nucleotides. Although many of their attributes, such as patterns of expression, remain largely unknown, lncRNAs have key functions in transcriptional, post-transcriptional, and epigenetic gene regulation; Also, new work indicates their functions in scaffolding ribonuclear protein complexes. In plants, genome-wide identification of lncRNAs has been conducted in several species, including Zea mays, and recent research showed that lncRNAs regulate flowering time in the photoperiod pathway, and function in nodulation. In this review, we discuss the basic mechanisms by which lncRNAs regulate key cellular processes, using the large body of knowledge on animal and yeast lncRNAs to illustrate the significance of emerging work on lncRNAs in plants. PMID:25764159

  19. Relationship of long noncoding RNA and viruses.

    PubMed

    Ding, Yao-Zhong; Zhang, Zhong-Wang; Liu, Ya-Li; Shi, Chong-Xu; Zhang, Jie; Zhang, Yong-Guang

    2016-04-01

    Long noncoding (lnc)RNAs comprise a diverse group of transcripts including large intervening noncoding (linc)RNAs, natural antisense transcripts (NATs) and intronic lncRNAs. The functions and mechanisms of more than 200 lncRNAs have been studied in vitro and the results suggest that lncRNAs may be molecular markers of prognosis in cancer patients. Some lncRNAs can promote virus replication and allow escape from cytosolic surveillance to suppress antiviral immunity. For example, lncRNA can cause persistent infection by Theiler's virus, and microRNA (miR)-27a/b is important for efficient murine cytomegalovirus (MCMV) replication. The available evidence suggests that lncRNAs may be potential targets of novel antiviral drugs. PMID:26826341

  20. Long noncoding RNAs in hematopoietic malignancies.

    PubMed

    Rodríguez-Malavé, Norma I; Rao, Dinesh S

    2016-05-01

    Recent years have witnessed the discovery of several classes of noncoding RNAs (ncRNAs), which are indispensable for the regulation of cellular processes. Many of these RNAs are regulatory in nature with functions in gene expression regulation such as piwi-interacting RNAs, small interfering RNAs and micro RNAs. Long noncoding RNAs (lncRNAs) comprise the most recently characterized class. LncRNAs are involved in transcriptional regulation, chromatin remodeling, imprinting, splicing, and translation, among other critical functions in the cell. Recent studies have elucidated the importance of lncRNAs in hematopoietic development. Dysregulation of lncRNA expression is a feature of various diseases and cancers, and is also seen in hematopoietic malignancies. This article focuses on lncRNAs that have been implicated in the pathogenesis of hematopoietic malignancies. PMID:26612601

  1. Linking Long Noncoding RNA Localization and Function.

    PubMed

    Chen, Ling-Ling

    2016-09-01

    Recent studies have revealed the regulatory potential of many long noncoding RNAs (lncRNAs). Most lncRNAs, like mRNAs, are transcribed by RNA polymerase II and are capped, polyadenylated, and spliced. However, the subcellular fates of lncRNAs are distinct and the mechanisms of action are diverse. Investigating the mechanisms that determine the subcellular fate of lncRNAs has the potential to provide new insights into their biogenesis and specialized functions. PMID:27499234

  2. Long Noncoding RNA Regulation of Pluripotency

    PubMed Central

    Ballarino, Monica

    2016-01-01

    Pluripotent stem cells (PSCs) represent a unique kind of stem cell, as they are able to indefinitely self-renew and hold the potential to differentiate into any derivative of the three germ layers. As such, human Embryonic Stem Cells (hESCs) and human induced Pluripotent Stem Cells (hiPSCs) provide a unique opportunity for studying the earliest steps of human embryogenesis and, at the same time, are of great therapeutic interest. The molecular mechanisms underlying pluripotency represent a major field of research. Recent evidence suggests that a complex network of transcription factors, chromatin regulators, and noncoding RNAs exist in pluripotent cells to regulate the balance between self-renewal and multilineage differentiation. Regulatory noncoding RNAs come in two flavors: short and long. The first class includes microRNAs (miRNAs), which are involved in the posttranscriptional regulation of cell cycle and differentiation in PSCs. Instead, long noncoding RNAs (lncRNAs) represent a heterogeneous group of long transcripts that regulate gene expression at transcriptional and posttranscriptional levels. In this review, we focus on the role played by lncRNAs in the maintenance of pluripotency, emphasizing the interplay between lncRNAs and other pivotal regulators in PSCs. PMID:26697072

  3. Noncoding RNAs of Plant Viruses and Viroids: Sponges of Host Translation and RNA Interference Machinery.

    PubMed

    Miller, W Allen; Shen, Ruizhong; Staplin, William; Kanodia, Pulkit

    2016-03-01

    Noncoding sequences in plant viral genomes are well-known to control viral replication and gene expression in cis. However, plant viral and viroid noncoding (nc)RNA sequences can also regulate gene expression acting in trans, often acting like 'sponges' that bind and sequester host cellular machinery to favor viral infection. Noncoding sequences of small subgenomic (sg)RNAs of Barley yellow dwarf virus (BYDV) and Red clover necrotic mosaic virus (RCNMV) contain a cap-independent translation element that binds translation initiation factor eIF4G. We provide new evidence that a sgRNA of BYDV can globally attenuate host translation, probably by sponging eIF4G. Subgenomic ncRNA of RCNMV is generated via 5' to 3' degradation by a host exonuclease. The similar noncoding subgenomic flavivirus (sf)RNA, inhibits the innate immune response, enhancing viral pathogenesis. Cauliflower mosaic virus transcribes massive amounts of a 600-nt ncRNA, which is processed into small RNAs that overwhelm the host's RNA interference (RNAi) system. Viroids use the host RNAi machinery to generate viroid-derived ncRNAs that inhibit expression of host defense genes by mimicking a microRNA. More examples of plant viral and viroid ncRNAs are likely to be discovered, revealing fascinating new weaponry in the host-virus arms race. PMID:26900786

  4. Non-coding RNAs Functioning in Colorectal Cancer Stem Cells.

    PubMed

    Fanale, Daniele; Barraco, Nadia; Listì, Angela; Bazan, Viviana; Russo, Antonio

    2016-01-01

    In recent years, the hypothesis of the presence of tumor-initiating cancer stem cells (CSCs) has received a considerable support. This model suggested the existence of CSCs which, thanks to their self-renewal properties, are able to drive the expansion and the maintenance of malignant cell populations with invasive and metastatic potential in cancer. Increasing evidence showed the ability of such cells to acquire self-renewal, multipotency, angiogenic potential, immune evasion, symmetrical and asymmetrical divisions which, along with the presence of several DNA repair mechanisms, further enhance their oncogenic potential making them highly resistant to common anticancer treatments. The main signaling pathways involved in the homeostasis of colorectal (CRC) stem cells are the Wnt, Notch, Sonic Hedgehog, and Bone Morfogenic Protein (BMP) pathways, which are mostly responsible for all the features that have been widely referred to stem cells. The same pathways have been identified in colorectal cancer stem cells (CRCSCs), conferring a more aggressive phenotype compared to non-stem CRC cells. Recently, several evidences suggested that non-coding RNAs (ncRNAs) may play a crucial role in the regulation of different biological mechanisms in CRC, by modulating the expression of critical stem cell transcription factors that have been found active in CSCs. In this chapter, we will discuss the involvement of ncRNAs, especially microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), in stemness acquisition and maintenance by CRCSCs, through the regulation of pathways modulating the CSC phenotype and growth, carcinogenesis, differentiation, and epithelial to mesenchymal transition (EMT). PMID:27573896

  5. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

    PubMed Central

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia

    2013-01-01

    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  6. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein.

    PubMed

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4-DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3-DNA complex. PMID:27250333

  7. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    NASA Astrophysics Data System (ADS)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy

    2016-05-01

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4-DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3-DNA complex.

  8. The role of an inverted CCAAT element in transcriptional activation of the human DNA topoisomerase IIalpha gene by heat shock.

    PubMed

    Furukawa, M; Uchiumi, T; Nomoto, M; Takano, H; Morimoto, R I; Naito, S; Kuwano, M; Kohno, K

    1998-04-24

    Expression of the DNA topoisomerase IIalpha (topoIIalpha) gene is highly sensitive to various environmental stimuli including heat shock. The amount of topoIIalpha mRNA was increased 1.5-3-fold 6-24 h after exposure of T24 human urinary bladder cancer cells to heat shock stress at 43 degreesC for 1 h. The effect of heat shock on the transcriptional activity of the human topoIIalpha gene promoter was investigated by transient transfection of T24 cells with luciferase reporter plasmids containing various lengths of the promoter sequence. The transcriptional activity of the full-length promoter (nucleotides (nt) -295 to +85) and of three deletion constructs (nt -197 to +85, -154 to +85, and -74 to +85) was increased approximately 3-fold 24 h after heat shock stress. In contrast, the transcriptional activity of the minimal promoter (nt -20 to +85), which lacks the first inverted CCAAT element (ICE1), the GC box, and the heat shock element located between nt -74 and -21, was not increased by heat shock. Furthermore, the transcriptional activity of promoter constructs containing mutations in the GC box or heat shock element, but not that of a construct containing mutations in ICE1, was significantly increased by heat shock. Electrophoretic mobility shift assays revealed reduced binding of a nuclear factor to an oligonucleotide containing ICE1 when nuclear extracts were derived from cells cultured for 3-24 h after heat shock. No such change in factor binding was apparent with an oligonucleotide containing the heat shock element of the topoIIalpha gene promoter. Finally, in vivo footprint analysis of the topoIIalpha gene promoter revealed that two G residues of ICE1 that were protected in control cells became sensitive to dimethyl sulfate modification after heat shock. These results suggest that transcriptional activation of the topoIIalpha gene by heat shock requires the release of a negative regulatory factor from ICE1. PMID:9553115

  9. Kaposi's sarcoma-associated herpesvirus Rta tetramers make high-affinity interactions with repetitive DNA elements in the Mta promoter to stimulate DNA binding of RBP-Jk/CSL.

    PubMed

    Palmeri, Diana; Carroll, Kyla Driscoll; Gonzalez-Lopez, Olga; Lukac, David M

    2011-11-01

    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 [HHV-8]) is the etiologic agent of Kaposi's sarcoma (KS) and lymphoproliferative diseases. We previously demonstrated that the KSHV lytic switch protein Rta stimulates DNA binding of the cellular RBP-Jk/CSL protein, the nuclear component of the Notch pathway, on Rta target promoters. In the current study, we define the promoter requirements for formation of transcriptionally productive Rta/RBP-Jk/DNA complexes. We show that highly pure Rta footprints 7 copies of a previously undescribed repetitive element in the promoter of the essential KSHV Mta gene. We have termed this element the "CANT repeat." CANT repeats are found on both strands of DNA and have a consensus sequence of ANTGTAACANT(A/T)(A/T)T. We demonstrate that Rta tetramers make high-affinity interactions (i.e., nM) with 64 bp of the Mta promoter but not single CANT units. The number of CANT repeats, their presence in palindromes, and their positions relative to the RBP-Jk binding site determine the optimal target for Rta stimulation of RBP-Jk DNA binding and formation of ternary Rta/RBP-Jk/DNA complexes. DNA binding and tetramerization mutants of Rta fail to stimulate RBP-Jk DNA binding. Our chromatin immunoprecipitation assays show that RBP-Jk DNA binding is broadly, but selectively, stimulated across the entire KSHV genome during reactivation. We propose a model in which tetramerization of Rta allows it to straddle RBP-Jk and contact repeat units on both sides of RBP-Jk. Our study integrates high-affinity Rta DNA binding with the requirement for a cellular transcription factor in Rta transactivation. PMID:21880753

  10. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1.

    PubMed Central

    Zhang, W; Wagner, B J; Ehrenman, K; Schaefer, A W; DeMaria, C T; Crater, D; DeHaven, K; Long, L; Brewer, G

    1993-01-01

    The degradation of some proto-oncogene and lymphokine mRNAs is controlled in part by an AU-rich element (ARE) in the 3' untranslated region. It was shown previously (G. Brewer, Mol. Cell. Biol. 11:2460-2466, 1991) that two polypeptides (37 and 40 kDa) copurified with fractions of a 130,000 x g postribosomal supernatant (S130) from K562 cells that selectively accelerated degradation of c-myc mRNA in a cell-free decay system. These polypeptides bound specifically to the c-myc and granulocyte-macrophage colony-stimulating factor 3' UTRs, suggesting they are in part responsible for selective mRNA degradation. In the present work, we have purified the RNA-binding component of this mRNA degradation activity, which we refer to as AUF1. Using antisera specific for these polypeptides, we demonstrate that the 37- and 40-kDa polypeptides are immunologically cross-reactive and that both polypeptides are phosphorylated and can be found in a complex(s) with other polypeptides. Immunologically related polypeptides are found in both the nucleus and the cytoplasm. The antibodies were also used to clone a cDNA for the 37-kDa polypeptide. This cDNA contains an open reading frame predicted to produce a protein with several features, including two RNA recognition motifs and domains that potentially mediate protein-protein interactions. These results provide further support for a role of this protein in mediating ARE-directed mRNA degradation. Images PMID:8246982

  11. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  12. Molecular mechanisms of long noncoding RNAs on gastric cancer.

    PubMed

    Li, Tianwen; Mo, Xiaoyan; Fu, Liyun; Xiao, Bingxiu; Guo, Junming

    2016-02-23

    Long noncoding RNAs (lncRNAs) are non-protein coding transcripts longer than 200 nucleotides. Aberrant expression of lncRNAs has been found associated with gastric cancer, one of the most malignant tumors. By complementary base pairing with mRNAs or forming complexes with RNA binding proteins (RBPs), some lncRNAs including GHET1, MALAT1, and TINCR may mediate mRNA stability and splicing. Other lncRNAs, such as BC032469, GAPLINC, and HOTAIR, participate in the competing endogenous RNA (ceRNA) network. Under certain circumstances, ANRIL, GACAT3, H19, MEG3, and TUSC7 exhibit their biological roles by associating with microRNAs (miRNAs). By recruiting histone-modifying complexes, ANRIL, FENDRR, H19, HOTAIR, MALAT1, and PVT1 may inhibit the transcription of target genes in cis or trans. Through these mechanisms, lncRNAs form RNA-dsDNA triplex. CCAT1, GAPLINC, GAS5, H19, MEG3, and TUSC7 play oncogenic or tumor suppressor roles by correlated with tumor suppressor P53 or onco-protein c-Myc, respectively. In conclusion, interaction with DNA, RNA and proteins is involved in lncRNAs' participation in gastric tumorigenesis and development. PMID:26788991

  13. Molecular mechanisms of long noncoding RNAs on gastric cancer

    PubMed Central

    Li, Tianwen; Mo, Xiaoyan; Fu, Liyun; Xiao, Bingxiu; Guo, Junming

    2016-01-01

    Long noncoding RNAs (lncRNAs) are non-protein coding transcripts longer than 200 nucleotides. Aberrant expression of lncRNAs has been found associated with gastric cancer, one of the most malignant tumors. By complementary base pairing with mRNAs or forming complexes with RNA binding proteins (RBPs), some lncRNAs including GHET1, MALAT1, and TINCR may mediate mRNA stability and splicing. Other lncRNAs, such as BC032469, GAPLINC, and HOTAIR, participate in the competing endogenous RNA (ceRNA) network. Under certain circumstances, ANRIL, GACAT3, H19, MEG3, and TUSC7 exhibit their biological roles by associating with microRNAs (miRNAs). By recruiting histone-modifying complexes, ANRIL, FENDRR, H19, HOTAIR, MALAT1, and PVT1 may inhibit the transcription of target genes in cis or trans. Through these mechanisms, lncRNAs form RNA-dsDNA triplex. CCAT1, GAPLINC, GAS5, H19, MEG3, and TUSC7 play oncogenic or tumor suppressor roles by correlated with tumor suppressor P53 or onco-protein c-Myc, respectively. In conclusion, interaction with DNA, RNA and proteins is involved in lncRNAs’ participation in gastric tumorigenesis and development. PMID:26788991

  14. Environmental Health and Long Non-coding RNAs.

    PubMed

    Karlsson, Oskar; Baccarelli, Andrea A

    2016-09-01

    An individual's risk of developing a common disease typically depends on an interaction of genetic and environmental factors. Epigenetic research is uncovering novel ways through which environmental factors such as diet, air pollution, and chemical exposure can affect our genes. DNA methylation and histone modifications are the most commonly studied epigenetic mechanisms. The role of long non-coding RNAs (lncRNAs) in epigenetic processes has been more recently highlighted. LncRNAs are defined as transcribed RNA molecules greater than 200 nucleotides in length with little or no protein-coding capability. While few functional lncRNAs have been well characterized to date, they have been demonstrated to control gene regulation at every level, including transcriptional gene silencing via regulation of the chromatin structure and DNA methylation. This review aims to provide a general overview of lncRNA function with a focus on their role as key regulators of health and disease and as biomarkers of environmental exposure. PMID:27234044

  15. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

    PubMed

    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

    2016-05-01

    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  16. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  17. PICSAR: Long Noncoding RNA in Cutaneous Squamous Cell Carcinoma.

    PubMed

    Luo, Yunhai; Morgan, Stefanie L; Wang, Kevin C

    2016-08-01

    It is increasingly evident that long noncoding RNAs may play the roles of both oncogenes and tumor suppressors during cancer development. A new study from Piipponen et al. provides evidence that a long noncoding RNA, PICSAR, promotes cutaneous squamous cell carcinoma development through activation of extracellular signal-regulated kinase signaling. Because specific inhibition of PICSAR suppresses tumor growth, this long noncoding RNA may serve as a useful diagnostic marker and therapeutic target for cutaneous squamous cell carcinoma. PMID:27450499

  18. Coding DNA repeated throughout intergenic regions of the Arabidopsis thaliana genome: Evolutionary footprints of RNA silencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pyknons are non-random sequence patterns significantly repeated throughout non-coding genomic DNA that also appear at least once among genes. They are interesting because they portend an unforeseen connection between coding and non-coding DNA. Pyknons have only been discovered in the human genome,...

  19. Physical chromosome mapping of repetitive DNA sequences in Nile tilapia Oreochromis niloticus: evidences for a differential distribution of repetitive elements in the sex chromosomes.

    PubMed

    Ferreira, Irani A; Martins, Cesar

    2008-06-01

    Repetitive DNAs have been extensively applied as physical chromosome markers on comparative studies, identification of chromosome rearrangements and sex chromosomes, chromosome evolution analysis, and applied genetics. Here we report the characterization of repetitive DNA sequences from the Nile tilapia (Oreochromis niloticus) genome by construction and screening of plasmid library enriched with repetitive DNAs, analysis of a BAC-based physical map, and hybridization to chromosomes. The physical mapping of BACs enriched with repetitive sequences and C(o)t-1 DNA (DNA enriched for highly and moderately repetitive DNA sequences) to chromosomes using FISH showed a predominant distribution of repetitive elements in the centromeric and telomeric regions and along the entire length of the largest chromosome pair (X and Y sex chromosomes) of the species. The distribution of repetitive DNAs differed significantly between the p arm of X and Y chromosomes. These findings suggest that repetitive DNAs have had an important role in the differentiation of sex chromosomes. PMID:17395473

  20. A G/C-rich DNA-regulatory element controls positive expression of the sea urchin Lytechinus pictus aboral ectoderm-specific LpS1 gene.

    PubMed

    Wang, W; Klein, W H

    1996-02-01

    The LpS1 beta gene of Lytechinus pictus is activated at the late cleavage stage about 12 hr after fertilization. LpS1 beta transcripts accumulate exclusively in aboral ectoderm lineages. LpS1 beta is thus a classic example of a gene whose expression is tightly controlled both temporally and spatially during early development. Previous studies on the LpS1 beta promoter identified two G-string DNA elements, one proximal and one distal to the LpS1 beta transcriptional start site, which bind to an ectoderm-enriched nuclear factor. In this report, we show that the ectoderm G-string factor binds to a G/C-rich region larger than the G-string itself and that the binding of the G-string factor requires sequences immediately downstream from the G-string. These downstream sequences are essential for full promoter activity. Two regions of 5'-flanking DNA are required for positive control of LpS1 beta, region I from base pairs -762 to -511, and region II, which includes the G/C-rich element, from base pairs -108 to -61. Region I also contains a mesenchyme cell repressor element. The results indicate that LpS1 beta expression is regulated positively in ectoderm cells and negatively in mesenchyme cells. Similar positive and negative control mechanisms regulate the expression of the related Spec genes of Strongylocentrotus purpuratus, but in this gene family the DNA elements are entirely different. We hypothesize that cis-regulatory elements are evolutionarily dynamic and that many different combinations of DNA elements are capable of given rise to aboral ectoderm-specific expression. PMID:8634141

  1. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  2. DNA fingerprinting of Lactobacillus crispatus strain CTV-05 by repetitive element sequence-based PCR analysis in a pilot study of vaginal colonization.

    PubMed

    Antonio, May A D; Hillier, Sharon L

    2003-05-01

    Lactobacillus crispatus is one of the predominant hydrogen peroxide (H(2)O(2))-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identified to the species level by using whole-chromosome probe DNA hybridization. The DNAs from L. crispatus, L. jensenii, L. gasseri, and an as-yet-unnamed H(2)O(2)-negative Lactobacillus species designated 1086V were subjected to rep-PCR. The results of gel electrophoresis and ethidium bromide staining of the DNA fingerprints obtained were compared. L. crispatus CTV-05 had a unique DNA fingerprint compared to all other lactobacilli. DNA fingerprints for 27 production lots of L. crispatus sampled from 1994 through 2001 were identical to that of the original strain isolated in 1993, suggesting strain stability. In a pilot study of nine women, this DNA fingerprinting method distinguished CTV-05 from other endogenous vaginal lactobacilli prior to and after vaginal capsule use. rep-PCR DNA fingerprinting is useful for strain typing and for evaluating longitudinal loss or acquisition of vaginal lactobacilli used as probiotics. PMID:12734221

  3. DNA Fingerprinting of Lactobacillus crispatus Strain CTV-05 by Repetitive Element Sequence-Based PCR Analysis in a Pilot Study of Vaginal Colonization

    PubMed Central

    Antonio, May A. D.; Hillier, Sharon L.

    2003-01-01

    Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identified to the species level by using whole-chromosome probe DNA hybridization. The DNAs from L. crispatus, L. jensenii, L. gasseri, and an as-yet-unnamed H2O2-negative Lactobacillus species designated 1086V were subjected to rep-PCR. The results of gel electrophoresis and ethidium bromide staining of the DNA fingerprints obtained were compared. L. crispatus CTV-05 had a unique DNA fingerprint compared to all other lactobacilli. DNA fingerprints for 27 production lots of L. crispatus sampled from 1994 through 2001 were identical to that of the original strain isolated in 1993, suggesting strain stability. In a pilot study of nine women, this DNA fingerprinting method distinguished CTV-05 from other endogenous vaginal lactobacilli prior to and after vaginal capsule use. rep-PCR DNA fingerprinting is useful for strain typing and for evaluating longitudinal loss or acquisition of vaginal lactobacilli used as probiotics. PMID:12734221

  4. Genomic DNA nanoparticles rescue rhodopsin-associated retinitis pigmentosa phenotype.

    PubMed

    Han, Zongchao; Banworth, Marcellus J; Makkia, Rasha; Conley, Shannon M; Al-Ubaidi, Muayyad R; Cooper, Mark J; Naash, Muna I

    2015-06-01

    Mutations in the rhodopsin gene cause retinal degeneration and clinical phenotypes including retinitis pigmentosa (RP) and congenital stationary night blindness. Effective gene therapies have been difficult to develop, however, because generating precise levels of rhodopsin expression is critical; overexpression causes toxicity, and underexpression would result in incomplete rescue. Current gene delivery strategies routinely use cDNA-based vectors for gene targeting; however, inclusion of noncoding components of genomic DNA (gDNA) such as introns may help promote more endogenous regulation of gene expression. Here we test the hypothesis that inclusion of genomic sequences from the rhodopsin gene can improve the efficacy of rhodopsin gene therapy in the rhodopsin knockout (RKO) mouse model of RP. We utilize our compacted DNA nanoparticles (NPs), which have the ability to transfer larger and more complex genetic constructs, to deliver murine rhodopsin cDNA or gDNA. We show functional and structural improvements in RKO eyes for up to 8 months after NP-mediated gDNA but not cDNA delivery. Importantly, in addition to improvements in rod function, we observe significant preservation of cone function at time points when cones in the RKO model are degenerated. These results suggest that inclusion of native expression elements, such as introns, can significantly enhance gene expression and therapeutic efficacy and may become an essential option in the array of available gene delivery tools. PMID:25713057

  5. Sizing up long non-coding RNAs

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2012-01-01

    Long noncoding RNAs (lncRNAs) play a key role in many important areas of epigenetics, stem cell biology, cancer, signaling and brain function. This emerging class of RNAs constitutes a large fraction of the transcriptome, with thousands of new lncRNAs reported each year. The molecular mechanisms of these RNAs are not well understood. Currently, very little structural data exist. We review the available lncRNA sequence and secondary structure data. Since almost no tertiary information is available for lncRNAs, we review crystallographic structures for other RNA systems and discuss the possibilities for lncRNAs in the context of existing constraints. PMID:23267412

  6. Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature

    PubMed Central

    Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya

    2006-01-01

    Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5′ non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5′ non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages. PMID:16936310

  7. A Dual Model for Prioritizing Cancer Mutations in the Non-coding Genome Based on Germline and Somatic Events

    PubMed Central

    Li, Jia; Poursat, Marie-Anne; Drubay, Damien; Motz, Arnaud; Saci, Zohra; Morillon, Antonin; Michiels, Stefan; Gautheret, Daniel

    2015-01-01

    We address here the issue of prioritizing non-coding mutations in the tumoral genome. To this aim, we created two independent computational models. The first (germline) model estimates purifying selection based on population SNP data. The second (somatic) model estimates tumor mutation density based on whole genome tumor sequencing. We show that each model reflects a different set of constraints acting either on the normal or tumor genome, and we identify the specific genome features that most contribute to these constraints. Importantly, we show that the somatic mutation model carries independent functional information that can be used to narrow down the non-coding regions that may be relevant to cancer progression. On this basis, we identify positions in non-coding RNAs and the non-coding parts of mRNAs that are both under purifying selection in the germline and protected from mutation in tumors, thus introducing a new strategy for future detection of cancer driver elements in the expressed non-coding genome. PMID:26588488

  8. Postproliferative transcription of the rat osteocalcin gene is reflected by vitamin D-responsive developmental modifications in protein-DNA interactions at basal and enhancer promoter elements.

    PubMed Central

    Owen, T A; Bortell, R; Shalhoub, V; Heinrichs, A; Stein, J L; Stein, G S; Lian, J B

    1993-01-01

    In the osteocalcin (OC) gene promoter, both independent positive and negative regulatory elements, as well as others with contiguous [TATA/glucocorticoid-responsive elements (GRE)] or overlapping [TATA/GRE, vitamin D-responsive enhancer elements (VDRE)/AP-1, and OC box/AP-1] domains, are sites for modifications in protein-DNA interactions. In the present studies, we have examined nuclear protein extracts from fetal rat calvarial cells that undergo a developmental sequence of bone cell differentiation. Our results demonstrate modifications in protein-DNA interactions that relate to the developmental stages of the osteoblast and support developmental regulation of OC gene transcription. Basal expression of the OC gene is associated with sequence-specific protein-DNA interactions at the OC box, VDRE, and TATA/GRE box. Distinct differences are observed in proliferating osteoblasts, where the OC gene is not transcribed compared to postproliferative, differentiated osteoblasts that transcribe the OC gene. Furthermore, the protein-DNA complexes that reflect hormonal control are also developmentally regulated, mediating both the transcriptionally active and repressed states of the OC gene. For example, in proliferating osteoblasts, a vitamin D receptor-antibody-sensitive complex is formed that is different from the DNA binding complex induced by vitamin D postproliferatively when the OC gene is transcribed. Mutational analysis of the steroid hormone binding domain and the overlapping AP-1 site at the VDRE supports mutually exclusive occupancy by Fos-Jun heterodimers and vitamin D receptor. Such protein-DNA interactions at the VDRE are consistent with repression of competency for vitamin D-mediated transcriptional enhancement in proliferating osteoblasts expressing high levels of Fos and Jun. Images PMID:8381969

  9. Gene Expression of Protein-Coding and Non-Coding RNAs Related to Polyembryogenesis in the Parasitic Wasp, Copidosoma floridanum

    PubMed Central

    Inoue, Hiroki; Yoshimura, Jin; Iwabuchi, Kikuo

    2014-01-01

    Polyembryony is a unique form of development in which many embryos are clonally produced from a single egg. Polyembryony is known to occur in many animals, but the underlying genetic mechanism responsible is unknown. In a parasitic wasp, Copidosoma floridanum, polyembryogenesis is initiated during the formation and division of the morula. In the present study, cDNA libraries were constructed from embryos at the cleavage and subsequent primary morula stages, times when polyembryogenesis is likely to be controlled genetically. Of 182 and 263 cDNA clones isolated from these embryos, 38% and 70%, respectively, were very similar to protein-coding genes obtained from BLAST analysis and 55 and 65 clones, respectively, were stage-specific. In our libraries we also detected a high frequency of long non-coding RNA. Some of these showed stage-specific expression patterns in reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis. The stage-specificity of expression implies that these protein-coding and non-coding genes are related to polyembryogenesis in C. floridanum. The non-coding genes are not similar to any known non-coding RNAs and so are good candidates as regulators of polyembryogenesis. PMID:25469914

  10. Boundary Associated Long Noncoding RNA Mediates Long-Range Chromosomal Interactions

    PubMed Central

    Nwigwe, Ifeoma Jane; Kim, Yoon Jung; Wacker, David A.; Kim, Tae Hoon

    2015-01-01

    CCCTC binding factor (CTCF) is involved in organizing chromosomes into mega base-sized, topologically associated domains (TADs) along with other factors that define sub-TAD organization. CTCF-Cohesin interactions have been shown to be critical for transcription insulation activity as it stabilizes long-range interactions to promote proper gene expression. Previous studies suggest that heterochromatin boundary activity of CTCF may be independent of Cohesin, and there may be additional mechanisms for defining topological domains. Here, we show that a boundary site we previously identified known as CTCF binding site 5 (CBS5) from the homeotic gene cluster A (HOXA) locus exhibits robust promoter activity. This promoter activity from the CBS5 boundary element generates a long noncoding RNA that we designate as boundary associated long noncoding RNA-1 (blncRNA1). Functional characterization of this RNA suggests that the transcript stabilizes long-range interactions at the HOXA locus and promotes proper expression of HOXA genes. Additionally, our functional analysis also shows that this RNA is not needed in the stabilization of CTCF-Cohesin interactions however CTCF-Cohesin interactions are critical in the transcription of blncRNA1. Thus, the CTCF-associated boundary element, CBS5, employs both Cohesin and noncoding RNA to establish and maintain topologically associated domains at the HOXA locus. PMID:26302455

  11. Posttranscriptional gene regulation by long noncoding RNA.

    PubMed

    Yoon, Je-Hyun; Abdelmohsen, Kotb; Gorospe, Myriam

    2013-10-01

    Eukaryotic cells transcribe a vast number of noncoding RNA species. Among them, long noncoding RNAs (lncRNAs) have been widely implicated in the regulation of gene transcription. However, examples of posttranscriptional gene regulation by lncRNAs are emerging. Through extended base-pairing, lncRNAs can stabilize or promote the translation of target mRNAs, while partial base-pairing facilitates mRNA decay or inhibits target mRNA translation. In the absence of complementarity, lncRNAs can suppress precursor mRNA splicing and translation by acting as decoys of RNA-binding proteins or microRNAs and can compete for microRNA-mediated inhibition leading to increased expression of the mRNA. Through these regulatory mechanisms, lncRNAs can elicit differentiation, proliferation, and cytoprotective programs, underscoring the rising recognition of lncRNA roles in human disease. In this review, we summarize the mechanisms of posttranscriptional gene regulation by lncRNAs identified until now. PMID:23178169

  12. Long Noncoding RNAs: Past, Present, and Future

    PubMed Central

    Kung, Johnny T. Y.; Colognori, David; Lee, Jeannie T.

    2013-01-01

    Long noncoding RNAs (lncRNAs) have gained widespread attention in recent years as a potentially new and crucial layer of biological regulation. lncRNAs of all kinds have been implicated in a range of developmental processes and diseases, but knowledge of the mechanisms by which they act is still surprisingly limited, and claims that almost the entirety of the mammalian genome is transcribed into functional noncoding transcripts remain controversial. At the same time, a small number of well-studied lncRNAs have given us important clues about the biology of these molecules, and a few key functional and mechanistic themes have begun to emerge, although the robustness of these models and classification schemes remains to be seen. Here, we review the current state of knowledge of the lncRNA field, discussing what is known about the genomic contexts, biological functions, and mechanisms of action of lncRNAs. We also reflect on how the recent interest in lncRNAs is deeply rooted in biology’s longstanding concern with the evolution and function of genomes. PMID:23463798

  13. Tackling Structures of Long Noncoding RNAs

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2013-01-01

    RNAs are important catalytic machines and regulators at every level of gene expression. A new class of RNAs has emerged called long non-coding RNAs, providing new insights into evolution, development and disease. Long non-coding RNAs (lncRNAs) predominantly found in higher eukaryotes, have been implicated in the regulation of transcription factors, chromatin-remodeling, hormone receptors and many other processes. The structural versatility of RNA allows it to perform various functions, ranging from precise protein recognition to catalysis and metabolite sensing. While major housekeeping RNA molecules have long been the focus of structural studies, lncRNAs remain the least characterized class, both structurally and functionally. Here, we review common methodologies used to tackle RNA structure, emphasizing their potential application to lncRNAs. When considering the complexity of lncRNAs and lack of knowledge of their structure, chemical probing appears to be an indispensable tool, with few restrictions in terms of size, quantity and heterogeneity of the RNA molecule. Probing is not constrained to in vitro analysis and can be adapted to high-throughput sequencing platforms. Significant efforts have been applied to develop new in vivo chemical probing reagents, new library construction protocols for sequencing platforms and improved RNA prediction software based on the experimental evidence. PMID:24304541

  14. Tackling structures of long noncoding RNAs.

    PubMed

    Novikova, Irina V; Hennelly, Scott P; Sanbonmatsu, Karissa Y

    2013-01-01

    RNAs are important catalytic machines and regulators at every level of gene expression. A new class of RNAs has emerged called long non-coding RNAs, providing new insights into evolution, development and disease. Long non-coding RNAs (lncRNAs) predominantly found in higher eukaryotes, have been implicated in the regulation of transcription factors, chromatin-remodeling, hormone receptors and many other processes. The structural versatility of RNA allows it to perform various functions, ranging from precise protein recognition to catalysis and metabolite sensing. While major housekeeping RNA molecules have long been the focus of structural studies, lncRNAs remain the least characterized class, both structurally and functionally. Here, we review common methodologies used to tackle RNA structure, emphasizing their potential application to lncRNAs. When considering the complexity of lncRNAs and lack of knowledge of their structure, chemical probing appears to be an indispensable tool, with few restrictions in terms of size, quantity and heterogeneity of the RNA molecule. Probing is not constrained to in vitro analysis and can be adapted to high-throughput sequencing platforms. Significant efforts have been applied to develop new in vivo chemical probing reagents, new library construction protocols for sequencing platforms and improved RNA prediction software based on the experimental evidence. PMID:24304541

  15. Structure based approaches for targeting non-coding RNAs with small molecules

    PubMed Central

    Shortridge, Matthew D.; Varani, Gabriele

    2015-01-01

    The increasing appreciation of the central role of non-coding RNAs (miRNAs and long non coding RNAs) in chronic and degenerative human disease makes them attractive therapeutic targets. This would not be unprecedented: the bacterial ribosomal RNA is a mainstay for antibacterial treatment, while the conservation and functional importance of viral RNA regulatory elements has long suggested they would constitute attractive targets for new antivirals. Oligonucleotide-based chemistry has obvious appeals but also considerable pharmacological limitations that are yet to be addressed satisfactorily. Recent studies identifying small molecules targeting non-coding RNAs may provide an alternative approach to oligonucleotide methods. Here we review recent work investigating new structural and chemical principles for targeting RNA with small molecules. PMID:25687935

  16. Transcriptional induction of IFN-gamma-responsive genes is modulated by DNA surrounding the interferon stimulation response element.

    PubMed Central

    Strehlow, I; Decker, T

    1992-01-01

    The 9/27 and GBP mRNAs are both inducible by Interferon-gamma (IFN-gamma). The promoters of both genes contain an Interferon Stimulation Response Element (ISRE), but while the GBP gene is strongly induced transcriptionally by IFN-gamma the response of the 9/27 promoter is very weak. We investigated the molecular basis for this difference. The different IFN-gamma-responsiveness was found to have more than one reason. First, 9/27 promoter DNA was unable to bind the Gamma Interferon Activation Factor (GAF) with a single high affinity site. It efficiently competed for the association of the GAF with the GBP promoter but this competition was due to the presence of two low affinity sites, the ISRE and an ISRE-like sequence, suggesting that the GAS and ISRE, though both having clear preferences for specific proteins, may nevertheless share a certain degree of structural homology. Second, the 9/27 and GBP ISREs differed markedly in their affinities for regulatory proteins (ISGFs 1,2,3) and the GBP ISRE was more potent in mediating IFN-gamma-induced promoter activity in transient transfection. Third and most importantly, however, the strong difference between the IFN-gamma response of the two promoters was mainly due to the sequences surrounding the ISRE: the positive-acting GAS on one side and sequences with silencing properties 5' and 3' of the 9/27 ISRE on the other side. The data thus show mechanisms to both up- and down-regulate the activity of the ISRE. Images PMID:1508672

  17. A Repetitive DNA Element Regulates Expression of the Helicobacter pylori Sialic Acid Binding Adhesin by a Rheostat-like Mechanism

    PubMed Central

    Vallström, Anna; Olofsson, Annelie; Öhman, Carina; Rakhimova, Lena; Borén, Thomas; Engstrand, Lars; Brännström, Kristoffer; Arnqvist, Anna

    2014-01-01

    During persistent infection, optimal expression of bacterial factors is required to match the ever-changing host environment. The gastric pathogen Helicobacter pylori has a large set of simple sequence repeats (SSR), which constitute contingency loci. Through a slipped strand mispairing mechanism, the SSRs generate heterogeneous populations that facilitate adaptation. Here, we present a model that explains, in molecular terms, how an intergenically located T-tract, via slipped strand mispairing, operates with a rheostat-like function, to fine-tune activity of the promoter that drives expression of the sialic acid binding adhesin, SabA. Using T-tract variants, in an isogenic strain background, we show that the length of the T-tract generates multiphasic output from the sabA promoter. Consequently, this alters the H. pylori binding to sialyl-Lewis x receptors on gastric mucosa. Fragment length analysis of post-infection isolated clones shows that the T-tract length is a highly variable feature in H. pylori. This mirrors the host-pathogen interplay, where the bacterium generates a set of clones from which the best-fit phenotypes are selected in the host. In silico and functional in vitro analyzes revealed that the length of the T-tract affects the local DNA structure and thereby binding of the RNA polymerase, through shifting of the axial alignment between the core promoter and UP-like elements. We identified additional genes in H. pylori, with T- or A-tracts positioned similar to that of sabA, and show that variations in the tract length likewise acted as rheostats to modulate cognate promoter output. Thus, we propose that this generally applicable mechanism, mediated by promoter-proximal SSRs, provides an alternative mechanism for transcriptional regulation in bacteria, such as H. pylori, which possesses a limited repertoire of classical trans-acting regulatory factors. PMID:24991812

  18. Development and validation of InnoQuant™, a sensitive human DNA quantitation and degradation assessment method for forensic samples using high copy number mobile elements Alu and SVA.

    PubMed

    Pineda, Gina M; Montgomery, Anne H; Thompson, Robyn; Indest, Brooke; Carroll, Marion; Sinha, Sudhir K

    2014-11-01

    There is a constant need in forensic casework laboratories for an improved way to increase the first-pass success rate of forensic samples. The recent advances in mini STR analysis, SNP, and Alu marker systems have now made it possible to analyze highly compromised samples, yet few tools are available that can simultaneously provide an assessment of quantity, inhibition, and degradation in a sample prior to genotyping. Currently there are several different approaches used for fluorescence-based quantification assays which provide a measure of quantity and inhibition. However, a system which can also assess the extent of degradation in a forensic sample will be a useful tool for DNA analysts. Possessing this information prior to genotyping will allow an analyst to more informatively make downstream decisions for the successful typing of a forensic sample without unnecessarily consuming DNA extract. Real-time PCR provides a reliable method for determining the amount and quality of amplifiable DNA in a biological sample. Alu are Short Interspersed Elements (SINE), approximately 300bp insertions which are distributed throughout the human genome in large copy number. The use of an internal primer to amplify a segment of an Alu element allows for human specificity as well as high sensitivity when compared to a single copy target. The advantage of an Alu system is the presence of a large number (>1000) of fixed insertions in every human genome, which minimizes the individual specific variation possible when using a multi-copy target quantification system. This study utilizes two independent retrotransposon genomic targets to obtain quantification of an 80bp "short" DNA fragment and a 207bp "long" DNA fragment in a degraded DNA sample in the multiplex system InnoQuant™. The ratio of the two quantitation values provides a "Degradation Index", or a qualitative measure of a sample's extent of degradation. The Degradation Index was found to be predictive of the observed loss

  19. An expanding universe of the non-coding genome in cancer biology

    PubMed Central

    Xue, Bin; He, Lin

    2014-01-01

    Neoplastic transformation is caused by accumulation of genetic and epigenetic alterations that ultimately convert normal cells into tumor cells with uncontrolled proliferation and survival, unlimited replicative potential and invasive growth [Hanahan,D. et al. (2011) Hallmarks of cancer: the next generation. Cell, 144, 646–674]. Although the majority of the cancer studies have focused on the functions of protein-coding genes, emerging evidence has started to reveal the importance of the vast non-coding genome, which constitutes more than 98% of the human genome. A number of non-coding RNAs (ncRNAs) derived from the ‘dark matter’ of the human genome exhibit cancer-specific differential expression and/or genomic alterations, and it is increasingly clear that ncRNAs, including small ncRNAs and long ncRNAs (lncRNAs), play an important role in cancer development by regulating protein-coding gene expression through diverse mechanisms. In addition to ncRNAs, nearly half of the mammalian genomes consist of transposable elements, particularly retrotransposons. Once depicted as selfish genomic parasites that propagate at the expense of host fitness, retrotransposon elements could also confer regulatory complexity to the host genomes during development and disease. Reactivation of retrotransposons in cancer, while capable of causing insertional mutagenesis and genome rearrangements to promote oncogenesis, could also alter host gene expression networks to favor tumor development. Taken together, the functional significance of non-coding genome in tumorigenesis has been previously underestimated, and diverse transcripts derived from the non-coding genome could act as integral functional components of the oncogene and tumor suppressor network. PMID:24747961

  20. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons

    SciTech Connect

    Xiong, Y.; Eickbush, T.H.

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. The authors present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. The authors therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons.

  1. Quantitative Trait Loci Identify Functional Noncoding Variation in Cancer

    PubMed Central

    Heyn, Holger

    2016-01-01

    The interpretation of noncoding alterations in cancer genomes presents an unresolved problem in cancer studies. While the impact of somatic variations in protein-coding regions is widely accepted, noncoding aberrations are mostly considered as passenger events. However, with the advance of genome-wide profiling strategies, alterations outside the coding context entered the focus, and multiple examples highlight the role of gene deregulation as cancer-driving events. This review describes the implication of noncoding alterations in oncogenesis and provides a theoretical framework for the identification of causal somatic variants using quantitative trait loci (QTL) analysis. Assuming that functional noncoding alterations affect quantifiable regulatory processes, somatic QTL studies constitute a valuable strategy to pinpoint cancer gene deregulation. Eventually, the comprehensive identification and interpretation of coding and noncoding alterations will guide our future understanding of cancer biology. PMID:26938653

  2. Towards structural classification of long non-coding RNAs.

    PubMed

    Sanbonmatsu, Karissa Y

    2016-01-01

    While long non-coding RNAs play key roles in disease and development, few structural studies have been performed to date for this emerging class of RNAs. Previous structural studies are reviewed, and a pipeline is presented to determine secondary structures of long non-coding RNAs. Similar to riboswitches, experimentally determined secondary structures of long non-coding RNAs for one species, may be used to improve sequence/structure alignments for other species. As riboswitches have been classified according to their secondary structure, a similar scheme could be used to classify long non-coding RNAs. This article is part of a Special Issue titled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. PMID:26537437

  3. Disruption of a Large Intergenic Noncoding RNA in Subjects with Neurodevelopmental Disabilities

    PubMed Central

    Talkowski, Michael E.; Maussion, Gilles; Crapper, Liam; Rosenfeld, Jill A.; Blumenthal, Ian; Hanscom, Carrie; Chiang, Colby; Lindgren, Amelia; Pereira, Shahrin; Ruderfer, Douglas; Diallo, Alpha B.; Lopez, Juan Pablo; Turecki, Gustavo; Chen, Elizabeth S.; Gigek, Carolina; Harris, David J.; Lip, Va; An, Yu; Biagioli, Marta; MacDonald, Marcy E.; Lin, Michael; Haggarty, Stephen J.; Sklar, Pamela; Purcell, Shaun; Kellis, Manolis; Schwartz, Stuart; Shaffer, Lisa G.; Natowicz, Marvin R.; Shen, Yiping; Morton, Cynthia C.; Gusella, James F.; Ernst, Carl

    2012-01-01

    Large intergenic noncoding (linc) RNAs represent a newly described class of ribonucleic acid whose importance in human disease remains undefined. We identified a severely developmentally delayed 16-year-old female with karyotype 46,XX,t(2;11)(p25.1;p15.1)dn in the absence of clinically significant copy number variants (CNVs). DNA capture followed by next-generation sequencing of the translocation breakpoints revealed disruption of a single noncoding gene on chromosome 2, LINC00299, whose RNA product is expressed in all tissues measured, but most abundantly in brain. Among a series of additional, unrelated subjects referred for clinical diagnostic testing who showed CNV affecting this locus, we identified four with exon-crossing deletions in association with neurodevelopmental abnormalities. No disruption of the LINC00299 coding sequence was seen in almost 14,000 control subjects. Together, these subjects with disruption of LINC00299 implicate this particular noncoding RNA in brain development and raise the possibility that, as a class, abnormalities of lincRNAs may play a significant role in human developmental disorders. PMID:23217328

  4. Long and Short Non-Coding RNAs as Regulators of Hematopoietic Differentiation

    PubMed Central

    Morceau, Franck; Chateauvieux, Sébastien; Gaigneaux, Anthoula; Dicato, Mario; Diederich, Marc

    2013-01-01

    Genomic analyses estimated that the proportion of the genome encoding proteins corresponds to approximately 1.5%, while at least 66% are transcribed, suggesting that many non-coding DNA-regions generate non-coding RNAs (ncRNAs). The relevance of these ncRNAs in biological, physiological as well as in pathological processes increased over the last two decades with the understanding of their implication in complex regulatory networks. This review particularly focuses on the involvement of two large families of ncRNAs, namely microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) in the regulation of hematopoiesis. To date, miRNAs have been widely studied, leading to a wealth of data about processing, regulation and mechanisms of action and more specifically, their involvement in hematopoietic differentiation. Notably, the interaction of miRNAs with the regulatory network of transcription factors is well documented whereas roles, regulation and mechanisms of lncRNAs remain largely unexplored in hematopoiesis; this review gathers current data about lncRNAs as well as both potential and confirmed roles in normal and pathological hematopoiesis. PMID:23860209

  5. Long and short non-coding RNAs as regulators of hematopoietic differentiation.

    PubMed

    Morceau, Franck; Chateauvieux, Sébastien; Gaigneaux, Anthoula; Dicato, Mario; Diederich, Marc

    2013-01-01

    Genomic analyses estimated that the proportion of the genome encoding proteins corresponds to approximately 1.5%, while at least 66% are transcribed, suggesting that many non-coding DNA-regions generate non-coding RNAs (ncRNAs). The relevance of these ncRNAs in biological, physiological as well as in pathological processes increased over the last two decades with the understanding of their implication in complex regulatory networks. This review particularly focuses on the involvement of two large families of ncRNAs, namely microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) in the regulation of hematopoiesis. To date, miRNAs have been widely studied, leading to a wealth of data about processing, regulation and mechanisms of action and more specifically, their involvement in hematopoietic differentiation. Notably, the interaction of miRNAs with the regulatory network of transcription factors is well documented whereas roles, regulation and mechanisms of lncRNAs remain largely unexplored in hematopoiesis; this review gathers current data about lncRNAs as well as both potential and confirmed roles in normal and pathological hematopoiesis. PMID:23860209

  6. A general function of noncoding polynucleotide sequences. Mass binding of transconformational proteins.

    PubMed

    Zuckerkandl, E

    1981-05-22

    It is proposed that a general function of noncoding DNA and RNA sequences in higher organisms (intergenic and intervening sequences) is to provide multiple binding sites over long stretches of polynucleotide for certain types of regulatory proteins. Through the building up or abolishing of high-order structures, these proteins either sequester sites for the control of, e.g., transcription or make the sites available to local molecular signals. If this is to take place, the existence of a 'c-value paradox' becomes a requirement. Multiple binding sites for a given protein may recur in the form of a sequence 'motif' that is variable within certain limits. Noncoding sequences of the chickens ovalbumin gene furnish an appropriate example of a sequence motif. GAAAATT. Its improbably high frequency and significant periodicity are both absent from the coding sequences of the same gene and from the noncoding sequences of a differently controlled gene in the same organisms, the preproinsulin gene. This distribution of a sequence motif is in keeping with the concepts outlined. Low specificity of sequences that bind protein is likely to be compatible with highly specific conformational changes. PMID:6789141

  7. Deciphering the function of non-coding RNAs in prostate cancer.

    PubMed

    Ramalho-Carvalho, João; Fromm, Bastian; Henrique, Rui; Jerónimo, Carmen

    2016-06-01

    The advent of next-generation sequencing methods is fuelling the discovery of multiple non-coding RNA transcripts with direct implication in cell biology and homeostasis. This new layer of biological regulation seems to be of particular importance in human pathogenesis, including cancer. The aberrant expression of ncRNAs is a feature of prostate cancer, as they promote tumor-suppressive or oncogenic activities, controlling multicellular events leading to carcinogenesis and tumor progression. From the small RNAs involved in the RNAi pathway to the long non-coding RNAs controlling chromatin remodeling, alternative splicing, and DNA repair, the non-coding transcriptome represents the significant majority of transcriptional output. As such, ncRNAs appear as exciting new diagnostic, prognostic, and therapeutic tools. However, additional work is required to characterize the RNA species, their functions, and their applicability to clinical practice in oncology. In this review, we summarize the most important features of ncRNA biology, emphasizing its relevance in prostate carcinogenesis and its potential for clinical applications. PMID:27221068

  8. Cutting edge: a cis-acting DNA element targets AID-mediated sequence diversification to the chicken Ig light chain gene locus.

    PubMed

    Kothapalli, Nagarama; Norton, Darrell D; Fugmann, Sebastian D

    2008-02-15

    Somatic hypermutation and gene conversion are two closely related processes that increase the diversity of the primary Ig repertoire. Both processes are initiated by the activation-induced cytidine deaminase that converts cytosine residues to uracils in a transcription-dependent manner; these lesions are subsequently fixed in the genome by direct replication and error-prone DNA repair. Two alternative mechanisms were proposed to explain why this mutagenic activity is targeted almost exclusively to Ig loci: 1) specific cis-acting DNA sequences; or 2) very high levels of Ig gene transcription. In this study we now identify a novel 3' regulatory region in the chicken Ig light chain gene containing not only a classical transcriptional enhancer but also cis-acting DNA elements essential for targeting activation-induced cytidine deaminase-mediated sequence diversification to this locus. PMID:18250404

  9. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae) from white, black and clear water rivers of the Amazon basin

    PubMed Central

    dos Santos, Fabíola Araújo; Marques, Diego Ferreira; Terencio, Maria Leandra; Feldberg, Eliana; Rodrigues, Luís Reginaldo R.

    2016-01-01

    Abstract Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3) in populations from the Amazonas river (white water), the Negro river (black water) and the Tapajós river (clear water), in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics) in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments. PMID:27007897

  10. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae) from white, black and clear water rivers of the Amazon basin.

    PubMed

    Santos, Fabíola Araújo Dos; Marques, Diego Ferreira; Terencio, Maria Leandra; Feldberg, Eliana; Rodrigues, Luís Reginaldo R

    2016-03-01

    Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3) in populations from the Amazonas river (white water), the Negro river (black water) and the Tapajós river (clear water), in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics) in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments. PMID:27007897

  11. A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

    PubMed Central

    León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

  12. Locus-specific DNA methylation analysis of retrotransposons in ES, somatic and cancer cells using High-Throughput Targeted Repeat Element Bisulfite Sequencing

    PubMed Central

    Bakshi, Arundhati; Ekram, Muhammad B.; Kim, Joomyeong

    2014-01-01

    DNA methylation is a major epigenetic mark associated with multiple aspects of retrotransposons within the mammalian genome. In order to study DNA methylation of a large number of retrotransposons on an individual-locus basis, we have developed a new protocol termed High-Throughput Targeted Repeat Element Bisulfite Sequencing (HT-TREBS) (Ekram and Kim, 2014 [1]). We have used this technique to characterize the locus-specific patterns of DNA methylation of 4799 members of the mouse IAP LTR (Intracisternal A Particle Long Terminal Repeat) retrotransposon family in embryonic stem, somatic and Neuro2A cells (Bakshi and Kim, 2014 [2]). Here we describe in detail the sample preparation and bioinformatics analyses used for these studies. The somatic cell data may be accessed under GEO accession number GSE49222. The ES and Neuro2A data are deposited under GEO accession number GSE60007. PMID:25554740

  13. Amino acid sequence homology between Piv, an essential protein in site-specific DNA inversion in Moraxella lacunata, and transposases of an unusual family of insertion elements.

    PubMed Central

    Lenich, A G; Glasgow, A C

    1994-01-01

    Deletion analysis of the subcloned DNA inversion region of Moraxella lacunata indicates that Piv is the only M. lacunata-encoded factor required for site-specific inversion of the tfpQ/tfpI pilin segment. The predicted amino acid sequence of Piv shows significant homology solely with the transposases/integrases of a family of insertion sequence elements, suggesting that Piv is a novel site-specific recombinase. Images PMID:8021196

  14. Long non-coding RNAs in cancer drug resistance development.

    PubMed

    Majidinia, Maryam; Yousefi, Bahman

    2016-09-01

    The presence or emergence of chemoresistance in tumor cells is a major burden in cancer therapy. While drug resistance is a multifactorial phenomenon arising from altered membrane transport of drugs, altered drug metabolism, altered DNA repair, reduced apoptosis rate and alterations of drug metabolism, it can also be linked to genetic and epigenetic factors. Long non-coding RNAs (lncRNAs) have important regulatory roles in many aspects of genome function including gene transcription, splicing, and epigenetics as well as biological processes involved in cell cycle, cell differentiation, development, and pluripotency. As such, it may not be surprising that some lncRNAs have been recently linked to carcinogenesis and drug resistance/sensitivity. Research is accelerating to decipher the exact molecular mechanism of lncRNA-regulated drug resistance and its therapeutic implications. In this article, we will review the structure, biogenesis, and mode of action of lncRNAs. Then, the involvement of lncRNAs in drug resistance will be discussed in detail. PMID:27427176

  15. Codon optimization and woodchuck hepatitis virus posttranscriptional regulatory element enhance the immune responses of DNA vaccines against infectious bursal disease virus in chickens.

    PubMed

    Li, Kai; Gao, Li; Gao, Honglei; Qi, Xiaole; Gao, Yulong; Qin, Liting; Wang, Yongqiang; Wang, Xiaomei

    2013-08-01

    The present study was undertaken to evaluate the protective efficacy of DNA vaccines against infectious bursal disease virus (IBDV) in chickens and to determine whether codon optimization and the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) could improve the immunogenicity of the DNA vaccines. The VP2, VP243 and codon-optimized VP243 genes of IBDV were cloned into pCAGGS vector, and designated as pCAGVP2, pCAGVP243 and pCAGoptiVP243, respectively. Plasmids pCAGWVP243 and pCAGWoptiVP243 carrying the WPRE elements were also constructed as DNA vaccines. To evaluate vaccine efficacy, 2-week-old chickens were injected intramuscularly with the constructed plasmids twice at 2-week intervals and challenged with very virulent IBDV 2 weeks post-boost. Plasmid pCAGVP243 induced better immune responses than pCAGVP2. Chickens immunized with pCAGoptiVP243 and pCAGWVP243 had higher levels of antibody titers, lymphoproliferation responses and cytokine production compared with pCAGVP243. Furthermore, plasmid pCAGWoptiVP243 induced the highest levels of immune responses among the groups. After challenged, DNA vaccines pCAGVP2, pCAGVP243, pCAGoptiVP243, pCAGWVP243 and pCAGWoptiVP243 conferred protection for 33%, 60%, 80%, 87% and 100% of chickens, respectively, as evidenced by the absence of clinical signs, mortality, and bursal atrophy. These results indicate that codon optimization and WPRE could enhance the protective efficacy of DNA vaccines against IBDV and these two approaches could work together synergistically in a single DNA vaccine. PMID:23631937

  16. S phase-specific DNA-binding proteins interacting with the Hex and Oct motifs in type I element of the wheat histone H3 promoter.

    PubMed

    Minami, M; Meshi, T; Iwabuchi, M

    2000-01-11

    The type I element (CCACGTCANCGATCCGCG), consisting of the Hex motif (CCACGTCA) and the reverse-oriented Oct motif (GATCCGCG), is necessary and sufficient to confer the S phase-specific transcription of the wheat histone H3 (TH012) gene. The transcriptional regulation via the type I element is thought to occur through interactions between transcription factors which bind specifically to the Hex and Oct motifs. Here we report S phase-specific DNA-binding proteins interacting with the type I element in partially synchronized wheat cultured cells. Hex motif-binding proteins found here resembled HBP-1a, as reported previously in terms of DNA-binding specificity. DNA-binding activities of the HBP-1a-like proteins were modulated by phosphorylation/dephosphorylation. In the electrophoretic mobility shift assay of the wheat nuclear extract, we also found three Oct motif-specific binding proteins, named OBRF (octamer-binding regulatory factor)-1, -2 and -3. One of the HBP-1a-like proteins and OBRF-1 appeared predominantly at the S phase. Thus, it was supposed that these two factors play a crucial role in the S phase-specific regulation of wheat histone gene expression. PMID:10675046

  17. Pathological ribonuclease H1 causes R-loop depletion and aberrant DNA segregation in mitochondria

    PubMed Central

    Akman, Gokhan; Desai, Radha; Bailey, Laura J.; Yasukawa, Takehiro; Dalla Rosa, Ilaria; Durigon, Romina; Holmes, J. Bradley; Moss, Chloe F.; Mennuni, Mara; Houlden, Henry; Hanna, Michael G.; Pitceathly, Robert D. S.; Spinazzola, Antonella; Holt, Ian J.

    2016-01-01

    The genetic information in mammalian mitochondrial DNA is densely packed; there are no introns and only one sizeable noncoding, or control, region containing key cis-elements for its replication and expression. Many molecules of mitochondrial DNA bear a third strand of DNA, known as “7S DNA,” which forms a displacement (D-) loop in the control region. Here we show that many other molecules contain RNA as a third strand. The RNA of these R-loops maps to the control region of the mitochondrial DNA and is complementary to 7S DNA. Ribonuclease H1 is essential for mitochondrial DNA replication; it degrades RNA hybridized to DNA, so the R-loop is a potential substrate. In cells with a pathological variant of ribonuclease H1 associated with mitochondrial disease, R-loops are of low abundance, and there is mitochondrial DNA aggregation. These findings implicate ribonuclease H1 and RNA in the physical segregation of mitochondrial DNA, perturbation of which represents a previously unidentified disease mechanism. PMID:27402764

  18. Distinct Expression of Long Non-Coding RNAs in an Alzheimer's Disease Model.

    PubMed

    Lee, Doo Young; Moon, Jangsup; Lee, Soon-Tae; Jung, Keun-Hwa; Park, Dong-Kyu; Yoo, Jung-Seok; Sunwoo, Jun-Sang; Byun, Jung-Ick; Shin, Jung-Won; Jeon, Daejong; Jung, Ki-Young; Kim, Manho; Lee, Sang Kun; Chu, Kon

    2015-01-01

    With the recent advancement in transcriptome-wide profiling approach, numerous non-coding transcripts previously unknown have been identified. Among the non-coding transcripts, long non-coding RNAs (lncRNAs) have received increasing attention for their capacity to modulate transcriptional regulation. Although alterations in the expressions of non-coding RNAs have been studied in Alzheimer's disease (AD), most research focused on the involvement of microRNAs, and comprehensive expression profiling of lncRNAs in AD has been lacking. In this study, microarray analysis was performed to procure the expression profile of lncRNAs dysregulated in a triple transgenic model of AD (3xTg-AD). A total of 4,622 lncRNAs were analyzed: 205 lncRNAs were significantly dysregulated in 3xTg-AD compared with control mice, and 230 lncRNAs were significantly dysregulated within 3xTg-AD in an age-dependent manner (≥2.0-fold, p < 0.05). Among these, 27 and 15 lncRNAs, respectively, had adjacent protein-coding genes whose expressions were also significantly dysregulated. A majority of these lncRNAs and their adjacent genes shared the same direction of dysregulation. For these pairs of lncRNAs and adjacent genes, significant Gene Ontology terms were DNA-dependent regulation of transcription, transcription regulator activity, and embryonic organ morphogenesis. One of the most highly upregulated lncRNAs had a 395 bp core sequence that overlapped with multiple chromosomal regions. This is the first study that comprehensively identified dysregulated lncRNAs in 3xTg-AD mice and will likely facilitate the development of therapeutics targeting lncRNAs in AD. PMID:25624420

  19. Multisubunit RNA Polymerases IV and V: Purveyors of Non-Coding RNA for Plant Gene Silencing

    SciTech Connect

    Haag, Jeremy R.; Pikaard, Craig S.

    2011-08-01

    In all eukaryotes, nuclear DNA-dependent RNA polymerases I, II and III synthesize the myriad RNAs that are essential for life. Remarkably, plants have evolved two additional multisubunit RNA polymerases, RNA polymerases IV and V, which orchestrate non-coding RNA-mediated gene silencing processes affecting development, transposon taming, antiviral defence and allelic crosstalk. Biochemical details concerning the templates and products of RNA polymerases IV and V are lacking. However, their subunit compositions reveal that they evolved as specialized forms of RNA polymerase II, which provides the unique opportunity to study the functional diversification of a eukaryotic RNA polymerase family.

  20. Emerging roles of non-coding RNAs in brain evolution, development, plasticity and disease

    PubMed Central

    Qureshi, Irfan A.; Mehler, Mark F.

    2012-01-01

    Novel classes of small and long non-coding RNAs (ncRNAs) are being characterized at a rapid pace, driven by recent paradigm shifts in our understanding of genomic architecture, regulation and transcriptional output, as well as by innovations in sequencing technologies and computational and systems biology. These ncRNAs can interact with DNA, RNA and protein molecules; engage in diverse structural, functional and regulatory activities; and have roles in nuclear organization and transcriptional, post-transcriptional and epigenetic processes. This expanding inventory of ncRNAs is implicated in mediating a broad spectrum of processes including brain evolution, development, synaptic plasticity and disease pathogenesis. PMID:22814587

  1. Non-coding RNAs as the bridge between epigenetic mechanisms, lineages and domains of life

    PubMed Central

    Sela, Mor; Kloog, Yoel; Rechavi, Oded

    2014-01-01

    Many cases of heritable environmental responses have been documented but the underlying mechanisms are largely unknown. Recently, inherited RNA interference has been shown to act as a multigenerational genome surveillance apparatus. We suggest that inheritance of regulatory RNAs is at the root of many other epigenetic phenomena, the trigger that induces other epigenetic mechanisms, such as the depositing of histone modifications and DNA methylation. In addition, we explore the possibility that interacting organisms influence each other's transcriptomes by exchanging heterologous non-coding RNAs. PMID:24882818

  2. [SIGNIFICANCE OF NONCODING RNA IN BREAST CANCER].

    PubMed

    Sato, Fumiaki

    2015-11-01

    Noncoding RNA (ncRNA) has a crucial role in the molecular mechanisms of malignant features of breast cancer. This review outlines the biological and clinical significance of well-investigated microRNAs including let-7, miR-21, miR-200, miR-15/16, miR-155, and miR-221/222, and long ncRNAs such as H19, LSINCT5, HOTAIR, and GAS5. The biological roles of microRNAs secreted in the exosome are also described. Combined analysis of mRNA and ncRNA will help to develop the field of genetic diagnosis of breast cancer. PMID:26845889

  3. Noncoder: a web interface for exon array-based detection of long non-coding RNAs

    PubMed Central

    Gellert, Pascal; Ponomareva, Yuliya; Braun, Thomas; Uchida, Shizuka

    2013-01-01

    Due to recent technical developments, a high number of long non-coding RNAs (lncRNAs) have been discovered in mammals. Although it has been shown that lncRNAs are regulated differently among tissues and disease statuses, functions of these transcripts are still unknown in most cases. GeneChip Exon 1.0 ST Arrays (exon arrays) from Affymetrix, Inc. have been used widely to profile genome-wide expression changes and alternative splicing of protein-coding genes. Here, we demonstrate that re-annotation of exon array probes can be used to profile expressions of tens of thousands of lncRNAs. With this annotation, a detailed inspection of lncRNAs and their isoforms is possible. To allow for a general usage to the research community, we developed a user-friendly web interface called ‘noncoder’. By uploading CEL files from exon arrays and with a few mouse clicks and parameter settings, exon array data will be normalized and analysed to identify differentially expressed lncRNAs. Noncoder provides the detailed annotation information of lncRNAs and is equipped with unique features to allow for an efficient search for interesting lncRNAs to be studied further. The web interface is available at http://noncoder.mpi-bn.mpg.de. PMID:23012263

  4. Noncoding RNAs in diabetes vascular complications.

    PubMed

    Beltrami, Cristina; Angelini, Timothy G; Emanueli, Costanza

    2015-12-01

    Diabetes mellitus is the most common metabolic disorder and is recognised as a dominant health threat of our time. Diabetes induces a widespread damage of the macro- and microvasculature in different organs and tissues and disrupts the endogenous vascular repair mechanisms, thus causing diffuse and severe complications. Moreover, diabetic patients respond poorly to surgical interventions aiming to "revascularise" (i.e., to restore blood flow supply) the ischemic myocardium or lower limbs. The molecular causes underpinning diabetes vascular complications are still underappreciated and druggable molecular targets for therapeutic interventions have not yet clearly emerged. Moreover, diabetes itself and diabetes complications are often silent killers, requiring new prognostic, diagnostic and predictive biomarkers for use in the clinical practice. Noncoding RNA (ncRNAs) are emerging as new fundamental regulators of gene expression. The small microRNAs (miRNAs, miRs) have opened the field capturing the attention of basic and clinical scientists for their potential to become new therapeutic targets and clinical biomarkers. More recently, long ncRNAs (lncRNAs) have started to be actively investigated, leading to first exciting reports, which further suggest their important and yet largely unexplored contribution to vascular physiology and disease. This review introduces the different ncRNA types and focuses at the ncRNA roles in diabetes vascular complications. Furthermore, we discuss the potential value of ncRNAs as clinical biomarkers, and we examine the possibilities for therapeutic intervention targeting ncRNs in diabetes. This article is part of a Special Issue titled: Non-coding RNAs. PMID:25536178

  5. The specificity of long noncoding RNA expression.

    PubMed

    Gloss, Brian S; Dinger, Marcel E

    2016-01-01

    Over the last decade, long noncoding RNAs (lncRNAs) have emerged as a fundamental molecular class whose members play pivotal roles in the regulation of the genome. The observation of pervasive transcription of mammalian genomes in the early 2000s sparked a revolution in the understanding of information flow in eukaryotic cells and the incredible flexibility and dynamic nature of the transcriptome. As a molecular class, distinct loci yielding lncRNAs are set to outnumber those yielding mRNAs. However, like many important discoveries, the road leading to uncovering this diverse class of molecules that act through a remarkable repertoire of mechanisms, was not a straight one. The same characteristic that most distinguishes lncRNAs from mRNAs, i.e. their developmental-stage, tissue-, and cell-specific expression, was one of the major impediments to their discovery and recognition as potentially functional regulatory molecules. With growing numbers of lncRNAs being assigned to biological functions, the specificity of lncRNA expression is now increasingly recognized as a characteristic that imbues lncRNAs with great potential as biomarkers and for the development of highly targeted therapeutics. Here we review the history of lncRNA research and how technological advances and insight into biological complexity have gone hand-in-hand in shaping this revolution. We anticipate that as increasing numbers of these molecules, often described as the dark matter of the genome, are characterized and the structure-function relationship of lncRNAs becomes better understood, it may ultimately be feasible to decipher what these non-(protein)-coding genes encode. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. PMID:26297315

  6. Non-coding landscapes of colorectal cancer

    PubMed Central

    Ragusa, Marco; Barbagallo, Cristina; Statello, Luisa; Condorelli, Angelo Giuseppe; Battaglia, Rosalia; Tamburello, Lucia; Barbagallo, Davide; Di Pietro, Cinzia; Purrello, Michele

    2015-01-01

    For two decades Vogelstein’s model has been the paradigm for describing the sequence of molecular changes within protein-coding genes that would lead to overt colorectal cancer (CRC). This model is now too simplistic in the light of recent studies, which have shown that our genome is pervasively transcribed in RNAs other than mRNAs, denominated non-coding RNAs (ncRNAs). The discovery that mutations in genes encoding these RNAs [i.e., microRNAs (miRNAs), long non-coding RNAs, and circular RNAs] are causally involved in cancer phenotypes has profoundly modified our vision of tumour molecular genetics and pathobiology. By exploiting a wide range of different mechanisms, ncRNAs control fundamental cellular processes, such as proliferation, differentiation, migration, angiogenesis and apoptosis: these data have also confirmed their role as oncogenes or tumor suppressors in cancer development and progression. The existence of a sophisticated RNA-based regulatory system, which dictates the correct functioning of protein-coding networks, has relevant biological and biomedical consequences. Different miRNAs involved in neoplastic and degenerative diseases exhibit potential predictive and prognostic properties. Furthermore, the key roles of ncRNAs make them very attractive targets for innovative therapeutic approaches. Several recent reports have shown that ncRNAs can be secreted by cells into the extracellular environment (i.e., blood and other body fluids): this suggests the existence of extracellular signalling mechanisms, which may be exploited by cells in physiology and pathology. In this review, we will summarize the most relevant issues on the involvement of cellular and extracellular ncRNAs in disease. We will then specifically describe their involvement in CRC pathobiology and their translational applications to CRC diagnosis, prognosis and therapy. PMID:26556998

  7. Long noncoding RNAs: Lessons from genomic imprinting.

    PubMed

    Kanduri, Chandrasekhar

    2016-01-01

    Genomic imprinting has been a great resource for studying transcriptional and post-transcriptional-based gene regulation by long noncoding RNAs (lncRNAs). In this article, I overview the functional role of intergenic lncRNAs (H19, IPW, and MEG3), antisense lncRNAs (Kcnq1ot1, Airn, Nespas, Ube3a-ATS), and enhancer lncRNAs (IG-DMR eRNAs) to understand the diverse mechanisms being employed by them in cis and/or trans to regulate the parent-of-origin-specific expression of target genes. Recent evidence suggests that some of the lncRNAs regulate imprinting by promoting intra-chromosomal higher-order chromatin compartmentalization, affecting replication timing and subnuclear positioning. Whereas others act via transcriptional occlusion or transcriptional collision-based mechanisms. By establishing genomic imprinting of target genes, the lncRNAs play a critical role in important biological functions, such as placental and embryonic growth, pluripotency maintenance, cell differentiation, and neural-related functions such as synaptic development and plasticity. An emerging consensus from the recent evidence is that the imprinted lncRNAs fine-tune gene expression of the protein-coding genes to maintain their dosage in cell. Hence, lncRNAs from imprinted clusters offer insights into their mode of action, and these mechanisms have been the basis for uncovering the mode of action of lncRNAs in several other biological contexts. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. PMID:26004516

  8. Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element.

    PubMed

    Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf

    2014-10-01

    Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit. PMID:25286939

  9. Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum

    PubMed Central

    Hong, Ka Lok; Yancey, Kailey; Battistella, Luisa; Williams, Ryan M.; Hickey, Katherine M.; Bostick, Chris D.; Gannett, Peter M.; Sooter, Letha J.

    2015-01-01

    Exotoxin A is one of the virulence factors of Pseudomonas aeruginosa, a bacterium that can cause infections resulting in adverse health outcomes and increased burden to health care systems. Current methods of diagnosing P. aeruginosa infections are time consuming and can require significant preparation of patient samples. This study utilized a novel variation of the Systematic Evolution of Ligand by Exponential Enrichment, Decoy-SELEX, to identify an Exotoxin A specific single-stranded DNA (ssDNA) molecular recognition element (MRE). Its emphasis is on increasing stringency in directing binding toward free target of interest and at the same time decreasing binding toward negative targets. A ssDNA MRE with specificity and affinity was identified after fourteen rounds of Decoy-SELEX. Utilizing surface plasmon resonance measurements, the determined equilibrium dissociation constant (Kd) of the MRE is between 4.2 µM and 4.5 µM, and is highly selective for Exotoxin A over negative targets. A ssDNA MRE modified sandwich enzyme-linked immunosorbent assay (ELISA) has been developed and achieved sensitive detection of Exotoxin A at nanomolar concentrations in human serum. This study has demonstrated the proof-of-principle of using a ssDNA MRE as a clinical diagnostic tool. PMID:26636098

  10. The 5' and 3' ends of alphavirus RNAs – non-coding is not non-functional

    PubMed Central

    Hyde, Jennifer L.; Chen, Rubing; Trobaugh, Derek W.; Diamond, Michael S.; Weaver, Scott C.; Klimstra, William B.; Wilusz, Jeffrey

    2015-01-01

    The non-coding regions found at the 5' and 3' ends of alphavirus genomes regulate viral gene expression, replication, translation and virus-host interactions, which have significant implications for viral evolution, host range, and pathogenesis. The functions of these non-coding regions are mediated by a combination of linear sequence and structural elements. The capped 5' untranslated region (UTR) contains promoter elements, translational regulatory sequences that modulate dependence on cellular translation factors, and structures that help to avoid innate immune defenses. The polyadenylated 3' UTR contains highly conserved sequence elements for viral replication, binding sites for cellular miRNAs that determine cell tropism, host range, and pathogenesis, and conserved binding regions for a cellular protein that influences viral RNA stability. Nonetheless, there are additional conserved elements in non-coding regions of the virus (e.g., the repeated sequence elements in the 3' UTR) whose function remains obscure. Thus, key questions remain as to the function of these short yet influential untranslated segments of alphavirus RNAs. PMID:25630058

  11. A modular system of DNA enhancer elements mediates tissue-specific activation of transcription by high dietary zinc in C. elegans

    PubMed Central

    Roh, Hyun Cheol; Dimitrov, Ivan; Deshmukh, Krupa; Zhao, Guoyan; Warnhoff, Kurt; Cabrera, Daniel; Tsai, Wendy; Kornfeld, Kerry

    2015-01-01

    Zinc is essential for biological systems, and aberrant zinc metabolism is implicated in a broad range of human diseases. To maintain homeostasis in response to fluctuating levels of dietary zinc, animals regulate gene expression; however, mechanisms that mediate the transcriptional response to fluctuating levels of zinc have not been fully defined. Here, we identified DNA enhancer elements that mediate intestine-specific transcriptional activation in response to high levels of dietary zinc in C. elegans. Using bioinformatics, we characterized an evolutionarily conserved enhancer element present in multiple zinc-inducible genes, the high zinc activation (HZA) element. The HZA was consistently adjacent to a GATA element that mediates expression in intestinal cells. Functional studies using transgenic animals demonstrated that this modular system of DNA enhancers mediates tissue-specific transcriptional activation in response to high levels of dietary zinc. We used this information to search the genome and successfully identified novel zinc-inducible genes. To characterize the mechanism of enhancer function, we demonstrated that the GATA transcription factor ELT-2 and the mediator subunit MDT-15 are necessary for zinc-responsive transcriptional activation. These findings define new mechanisms of zinc homeostasis and tissue-specific regulation of transcription. PMID:25552416

  12. Vertebrate paralogous conserved noncoding sequences may be related to gene expressions in brain.

    PubMed

    Matsunami, Masatoshi; Saitou, Naruya

    2013-01-01

    Vertebrate genomes include gene regulatory elements in protein-noncoding regions. A part of gene regulatory elements are expected to be conserved according to their functional importance, so that evolutionarily conserved noncoding sequences (CNSs) might be good candidates for those elements. In addition, paralogous CNSs, which are highly conserved among both orthologous loci and paralogous loci, have the possibility of controlling overlapping expression patterns of their adjacent paralogous protein-coding genes. The two-round whole-genome duplications (2R WGDs), which most probably occurred in the vertebrate common ancestors, generated large numbers of paralogous protein-coding genes and their regulatory elements. These events could contribute to the emergence of vertebrate features. However, the evolutionary history and influences of the 2R WGDs are still unclear, especially in noncoding regions. To address this issue, we identified paralogous CNSs. Region-focused Basic Local Alignment Search Tool (BLAST) search of each synteny block revealed 7,924 orthologous CNSs and 309 paralogous CNSs conserved among eight high-quality vertebrate genomes. Paralogous CNSs we found contained 115 previously reported ones and newly detected 194 ones. Through comparisons with VISTA Enhancer Browser and available ChIP-seq data, one-third (103) of paralogous CNSs detected in this study showed gene regulatory activity in the brain at several developmental stages. Their genomic locations are highly enriched near the transcription factor-coding regions, which are expressed in brain and neural systems. These results suggest that paralogous CNSs are conserved mainly because of maintaining gene expression in the vertebrate brain. PMID:23267051

  13. Long noncoding RNAs: functional surprises from the RNA world

    PubMed Central

    Wilusz, Jeremy E.; Sunwoo, Hongjae; Spector, David L.

    2009-01-01

    Most of the eukaryotic genome is transcribed, yielding a complex network of transcripts that includes tens of thousands of long noncoding RNAs with little or no protein-coding capacity. Although the vast majority of long noncoding RNAs have yet to be characterized thoroughly, many of these transcripts are unlikely to represent transcriptional “noise” as a significant number have been shown to exhibit cell type-specific expression, localization to subcellular compartments, and association with human diseases. Here, we highlight recent efforts that have identified a myriad of molecular functions for long noncoding RNAs. In some cases, it appears that simply the act of noncoding RNA transcription is sufficient to positively or negatively affect the expression of nearby genes. However, in many cases, the long noncoding RNAs themselves serve key regulatory roles that were assumed previously to be reserved for proteins, such as regulating the activity or localization of proteins and serving as organizational frameworks of subcellular structures. In addition, many long noncoding RNAs are processed to yield small RNAs or, conversely, modulate how other RNAs are processed. It is thus becoming increasingly clear that long noncoding RNAs can function via numerous paradigms and are key regulatory molecules in the cell. PMID:19571179

  14. Functional annotation of the vlinc class of non-coding RNAs using systems biology approach

    PubMed Central

    Laurent, Georges St.; Vyatkin, Yuri; Antonets, Denis; Ri, Maxim; Qi, Yao; Saik, Olga; Shtokalo, Dmitry; de Hoon, Michiel J.L.; Kawaji, Hideya; Itoh, Masayoshi; Lassmann, Timo; Arner, Erik; Forrest, Alistair R.R.; Nicolas, Estelle; McCaffrey, Timothy A.; Carninci, Piero; Hayashizaki, Yoshihide; Wahlestedt, Claes; Kapranov, Philipp

    2016-01-01

    Functionality of the non-coding transcripts encoded by the human genome is the coveted goal of the modern genomics research. While commonly relied on the classical methods of forward genetics, integration of different genomics datasets in a global Systems Biology fashion presents a more productive avenue of achieving this very complex aim. Here we report application of a Systems Biology-based approach to dissect functionality of a newly identified vast class of very long intergenic non-coding (vlinc) RNAs. Using highly quantitative FANTOM5 CAGE dataset, we show that these RNAs could be grouped into 1542 novel human genes based on analysis of insulators that we show here indeed function as genomic barrier elements. We show that vlincRNAs genes likely function in cis to activate nearby genes. This effect while most pronounced in closely spaced vlincRNA–gene pairs can be detected over relatively large genomic distances. Furthermore, we identified 101 vlincRNA genes likely involved in early embryogenesis based on patterns of their expression and regulation. We also found another 109 such genes potentially involved in cellular functions also happening at early stages of development such as proliferation, migration and apoptosis. Overall, we show that Systems Biology-based methods have great promise for functional annotation of non-coding RNAs. PMID:27001520

  15. Intragenic transcription of a noncoding RNA modulates expression of ASP3 in budding yeast

    PubMed Central

    Huang, Yu-Ching; Chen, Hung-Ta; Teng, Shu-Chun

    2010-01-01

    Inter- and intragenic noncoding transcription is widespread in eukaryotic genomes; however, the purpose of these types of transcription is still poorly understood. Here, we show that intragenic sense-oriented transcription within the budding yeast ASP3 coding region regulates a constitutively and immediately accessible promoter for the transcription of full-length ASP3. Expression of this short intragenic transcript is independent of GATA transcription factors, which are essential for the activation of full-length ASP3, and independent of RNA polymerase II (RNAPII). Furthermore, we found that an intragenic control element is required for the expression of this noncoding RNA (ncRNA). Continuous expression of the short ncRNA maintains a high level of trimethylation of histone H3 at lysine 4 (H3K4me3) at the ASP3 promoter and makes this region more accessible for RNAPII to transcribe the full-length ASP3. Our results show for the first time that intragenic noncoding transcription promotes gene expression. PMID:20817754

  16. Functional annotation of the vlinc class of non-coding RNAs using systems biology approach.

    PubMed

    Laurent, Georges St; Vyatkin, Yuri; Antonets, Denis; Ri, Maxim; Qi, Yao; Saik, Olga; Shtokalo, Dmitry; de Hoon, Michiel J L; Kawaji, Hideya; Itoh, Masayoshi; Lassmann, Timo; Arner, Erik; Forrest, Alistair R R; Nicolas, Estelle; McCaffrey, Timothy A; Carninci, Piero; Hayashizaki, Yoshihide; Wahlestedt, Claes; Kapranov, Philipp

    2016-04-20

    Functionality of the non-coding transcripts encoded by the human genome is the coveted goal of the modern genomics research. While commonly relied on the classical methods of forward genetics, integration of different genomics datasets in a global Systems Biology fashion presents a more productive avenue of achieving this very complex aim. Here we report application of a Systems Biology-based approach to dissect functionality of a newly identified vast class of very long intergenic non-coding (vlinc) RNAs. Using highly quantitative FANTOM5 CAGE dataset, we show that these RNAs could be grouped into 1542 novel human genes based on analysis of insulators that we show here indeed function as genomic barrier elements. We show that vlincRNAs genes likely function incisto activate nearby genes. This effect while most pronounced in closely spaced vlincRNA-gene pairs can be detected over relatively large genomic distances. Furthermore, we identified 101 vlincRNA genes likely involved in early embryogenesis based on patterns of their expression and regulation. We also found another 109 such genes potentially involved in cellular functions also happening at early stages of development such as proliferation, migration and apoptosis. Overall, we show that Systems Biology-based methods have great promise for functional annotation of non-coding RNAs. PMID:27001520

  17. Identification of expressed and conserved human noncoding RNAs

    PubMed Central

    Nielsen, Morten Muhlig; Tehler, Disa; Vang, Søren; Sudzina, Frantisek; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Lund, Anders H.; Pedersen, Jakob Skou

    2014-01-01

    The past decade has shown mammalian genomes to be pervasively transcribed and identified thousands of noncoding (nc) transcripts. It is currently unclear to what extent these transcripts are of functional importance, as experimental functional evidence exists for only a small fraction. Here, we characterize the expression and evolutionary conservation properties of 12,115 known and novel nc transcripts, including structural RNAs, long nc RNAs (lncRNAs), antisense RNAs, EvoFold predictions, ultraconserved elements, and expressed nc regions. Expression levels are evaluated across 12 human tissues using a custom-designed microarray, supplemented with RNAseq. Conservation levels are evaluated at both the base level and at the syntenic level. We combine these measures with epigenetic mark annotations to identify subsets of novel nc transcripts that show characteristics similar to known functional ncRNAs. Few novel nc transcripts show both high expression and conservation levels. However, overall, we observe a positive correlation between expression and both conservation and epigenetic annotations, suggesting that a subset of the expressed transcripts are under purifying selection and likely functional. The identified subsets of expressed and conserved novel nc transcripts may form the basis for further functional characterization. PMID:24344320

  18. Loss of Conserved Noncoding RNAs in Genomes of Bacterial Endosymbionts.

    PubMed

    Matelska, Dorota; Kurkowska, Malgorzata; Purta, Elzbieta; Bujnicki, Janusz M; Dunin-Horkawicz, Stanislaw

    2016-02-01

    The genomes of intracellular symbiotic or pathogenic bacteria, such as of Buchnera, Mycoplasma, and Rickettsia, are typically smaller compared with their free-living counterparts. Here we showed that noncoding RNA (ncRNA) families, which are conserved in free-living bacteria, frequently could not be detected by computational methods in the small genomes. Statistical tests demonstrated that their absence is not an artifact of low GC content or small deletions in these small genomes, and thus it was indicative of an independent loss of ncRNAs in different endosymbiotic lineages. By analyzing the synteny (conservation of gene order) between the reduced and nonreduced genomes, we revealed instances of protein-coding genes that were preserved in the reduced genomes but lost cis-regulatory elements. We found that the loss of cis-regulatory ncRNA sequences, which regulate the expression of cognate protein-coding genes, is characterized by the reduction of secondary structure formation propensity, GC content, and length of the corresponding genomic regions. PMID:26782934

  19. Loss of Conserved Noncoding RNAs in Genomes of Bacterial Endosymbionts

    PubMed Central

    Matelska, Dorota; Kurkowska, Malgorzata; Purta, Elzbieta; Bujnicki, Janusz M.; Dunin-Horkawicz, Stanislaw

    2016-01-01

    The genomes of intracellular symbiotic or pathogenic bacteria, such as of Buchnera, Mycoplasma, and Rickettsia, are typically smaller compared with their free-living counterparts. Here we showed that noncoding RNA (ncRNA) families, which are conserved in free-living bacteria, frequently could not be detected by computational methods in the small genomes. Statistical tests demonstrated that their absence is not an artifact of low GC content or small deletions in these small genomes, and thus it was indicative of an independent loss of ncRNAs in different endosymbiotic lineages. By analyzing the synteny (conservation of gene order) between the reduced and nonreduced genomes, we revealed instances of protein-coding genes that were preserved in the reduced genomes but lost cis-regulatory elements. We found that the loss of cis-regulatory ncRNA sequences, which regulate the expression of cognate protein-coding genes, is characterized by the reduction of secondary structure formation propensity, GC content, and length of the corresponding genomic regions. PMID:26782934

  20. The Landscape of Long Noncoding RNAs in the Human Transcriptome

    PubMed Central

    Iyer, Matthew K.; Niknafs, Yashar S.; Malik, Rohit; Singhal, Udit; Sahu, Anirban; Hosono, Yasuyuki; Barrette, Terrence R.; Prensner, John R.; Evans, Joseph R.; Zhao, Shuang; Poliakov, Anton; Cao, Xuhong; Dhanasekaran, Saravana M.; Wu, Yi-Mi; Robinson, Dan R.; Beer, David G.; Feng, Felix Y.; Iyer, Hariharan K.; Chinnaiyan, Arul M.

    2015-01-01

    Long non-coding RNAs (lncRNAs) are emerging as important regulators of tissue physiology and disease processes including cancer. In order to delineate genome-wide lncRNA expression, we curated 7,256 RNA-Seq libraries from tumors, normal tissues, and cell lines comprising over 43 terabases of sequence from 25 independent studies. We applied ab initio assembly methodology to this dataset, yielding a consensus human transcriptome of 91,013 expressed genes. Over 68% (58,648) of genes were classified as lncRNAs, of which 79% (48,952) were previously unannotated. About 1% (597) of the lncRNAs harbored ultraconserved elements and 7% (3,900) overlapped disease-associated single nucleotide polymorphisms (SNPs). To prioritize lineage-specific, disease-associated lncRNA expression we employed non-parametric differential expression testing and nominated 7,942 lineage- or cancer-associated lncRNA genes. The lncRNA landscape characterized here may shed light into normal biology and cancer pathogenesis, and be valuable for future biomarker development. PMID:25599403

  1. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element.

    PubMed

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R

    2009-11-01

    The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 angstrom resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 angstrom, alpha = beta = gamma = 90 degrees. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit. PMID:19923727

  2. Transposable elements and G-quadruplexes.

    PubMed

    Kejnovsky, Eduard; Tokan, Viktor; Lexa, Matej

    2015-09-01

    A significant part of eukaryotic genomes is formed by transposable elements (TEs) containing not only genes but also regulatory sequences. Some of the regulatory sequences located within TEs can form secondary structures like hairpins or three-stranded (triplex DNA) and four-stranded (quadruplex DNA) conformations. This review focuses on recent evidence showing that G-quadruplex-forming sequences in particular are often present in specific parts of TEs in plants and humans. We discuss the potential role of these structures in the TE life cycle as well as the impact of G-quadruplexes on replication, transcription, translation, chromatin status, and recombination. The aim of this review is to emphasize that TEs may serve as vehicles for the genomic spread of G-quadruplexes. These non-canonical DNA structures and their conformational switches may constitute another regulatory system that, together with small and long non-coding RNA molecules and proteins, contribute to the complex cellular network resulting in the large diversity of eukaryotes. PMID:26403244

  3. Junk DNA: Prospects for Oral Cancer Research.

    PubMed

    Sarode, Gargi S; Sarode, Sachin C; Patil, Shankargouda; Anand, Rahul

    2016-01-01

    About 98% of human genes are transcribed into noncoding ribonucleic acid (RNA), which is known by the name of "junk DNA." Unlike its name, it has been proved by now that junk deoxyribonucleic acid (DNA) can have some functional activities. PMID:27207194

  4. The strain-specific cis-acting element of beet curly top geminivirus DNA replication maps to the directly repeated motif of the ori.

    PubMed

    Choi, I R; Stenger, D C

    1996-12-01

    Strains of beet curly top geminivirus (BCTV) possess distinct cis- and trans-acting replication specificity elements which are not separately interchangeable among strains. Analysis of the replication competency of chimeric BCTV genomes, in which portions of the origin of DNA replication (ori) were derived from heterologous BCTV strains, have permitted identification of an essential cis-acting element governing strain-specific replication in a subgroup II geminivirus. Our studies indicate that the cis-acting element responsible for strain-specific replication properties resides within the directly repeated motif of the BCTV ori. Transient replication assays conducted in leaf disks and complementation experiments conducted in whole plants indicated that the trans-acting replication specificity element, residing within the amino-terminal region of the C1 Rep protein, may recognize and replicate a chimeric BCTV genome containing a heterologous ori so long as all or portions of the core element of the directly repeated motif are derived from the same strain as the Rep protein. As Rep protein binding to the core element of the directly repeated motif has been demonstrated by others to be essential for replication of subgroup III geminiviruses, our results support the hypothesis that replication specificity of subgroup II viruses is governed by processes similar to that of subgroup III viruses. However, a second cis-acting element of the ori, which appears to contribute to subgroup III virus replication specificity, does not seem to be required for replication specificity among the subgroup II viruses examined. Nonetheless, a potential role for a second cis-acting element in the BCTV ori contributing to maximal replication cannot be excluded. PMID:8941329

  5. Decitabine alters the expression of Mecp2 isoforms via dynamic DNA methylation at the Mecp2 regulatory elements in neural stem cells

    PubMed Central

    2013-01-01

    Background Aberrant MeCP2 expression in brain is associated with neurodevelopmental disorders including autism. In the brain of stressed mouse and autistic human patients, reduced MeCP2 expression is correlated with Mecp2/MECP2 promoter hypermethylation. Altered expression of MeCP2 isoforms (MeCP2E1 and MeCP2E2) is associated with neurological disorders, highlighting the importance of proper regulation of both isoforms. While known regulatory elements (REs) within the MECP2/Mecp2 promoter and intron 1 are involved in MECP2/Mecp2 regulation, Mecp2 isoform-specific regulatory mechanisms are unknown. We hypothesized that DNA methylation at these REs may impact the expression of Mecp2 isoforms. Methods We used a previously characterized in vitro differentiating neural stem cell (NSC) system to investigate the interplay between Mecp2 isoform-specific expression and DNA methylation at the Mecp2 REs. We studied altered expression of Mecp2 isoforms, affected by global DNA demethylation and remethylation, induced by exposure and withdrawal of decitabine (5-Aza-2′-deoxycytidine). Further, we performed correlation analysis between DNA methylation at the Mecp2 REs and the expression of Mecp2 isoforms after decitabine exposure and withdrawal. Results At different stages of NSC differentiation, Mecp2 isoforms showed reciprocal expression patterns associated with minor, but significant changes in DNA methylation at the Mecp2 REs. Decitabine treatment induced Mecp2e1/MeCP2E1 (but not Mecp2e2) expression at day (D) 2, associated with DNA demethylation at the Mecp2 REs. In contrast, decitabine withdrawal downregulated both Mecp2 isoforms to different extents at D8, without affecting DNA methylation at the Mecp2 REs. NSC cell fate commitment was minimally affected by decitabine under tested conditions. Expression of both isoforms negatively correlated with methylation at specific regions of the Mecp2 promoter, both at D2 and D8. The correlation between intron 1 methylation and Mecp

  6. Noncoding RNAs in Regulation of Cancer Metabolic Reprogramming.

    PubMed

    Yang, Dongdong; Sun, Linchong; Li, Zhaoyong; Gao, Ping

    2016-01-01

    Since the description of the Warburg effect 90 years ago, metabolic reprogramming has been gradually recognized as a major hallmark of cancer cells. Mounting evidence now indicates that cancer is a kind of metabolic disease, quite distinct from conventional perception. While metabolic alterations in cancer cells have been extensively observed in glucose, lipid, and amino acid metabolisms, its underlying regulatory mechanisms are still poorly understood. Noncoding RNA, also known as the "dark matter in life," functions through various mechanisms at RNA level regulating different biological pathways. The last two decades have witnessed the booming of noncoding RNA study on microRNA (miRNA), long noncoding RNA (lncRNA), circular RNA (circRNA), PIWI-interacting RNA (piRNA), etc. In this chapter, we will discuss the regulatory roles of noncoding RNAs on cancer metabolism. PMID:27376736

  7. Systematic classification of non-coding RNAs by epigenomic similarity

    PubMed Central

    2013-01-01

    Background Even though only 1.5% of the human genome is translated into proteins, recent reports indicate that most of it is transcribed into non-coding RNAs (ncRNAs), which are becoming the subject of increased scientific interest. We hypothesized that examining how different classes of ncRNAs co-localized with annotated epigenomic elements could help understand the functions, regulatory mechanisms, and relationships among ncRNA families. Results We examined 15 different ncRNA classes for statistically significant genomic co-localizations with cell type-specific chromatin segmentation states, transcription factor binding sites (TFBSs), and histone modification marks using GenomeRunner (http://www.genomerunner.org). P-values were obtained using a Chi-square test and corrected for multiple testing using the Benjamini-Hochberg procedure. We clustered and visualized the ncRNA classes by the strength of their statistical enrichments and depletions. We found piwi-interacting RNAs (piRNAs) to be depleted in regions containing activating histone modification marks, such as H3K4 mono-, di- and trimethylation, H3K27 acetylation, as well as certain TFBSs. piRNAs were further depleted in active promoters, weak transcription, and transcription elongation regions, and enriched in repressed and heterochromatic regions. Conversely, transfer RNAs (tRNAs) were depleted in heterochromatin regions and strongly enriched in regions containing activating H3K4 di- and trimethylation marks, H2az histone variant, and a variety of TFBSs. Interestingly, regions containing CTCF insulator protein binding sites were associated with tRNAs. tRNAs were also enriched in the active, weak and poised promoters and, surprisingly, in regions with repetitive/copy number variations. Conclusions Searching for statistically significant associations between ncRNA classes and epigenomic elements permits detection of potential functional and/or regulatory relationships among ncRNA classes, and suggests cell

  8. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  9. A brief history of the status of transposable elements: from junk DNA to major players in evolution.

    PubMed

    Biémont, Christian

    2010-12-01

    The idea that some genetic factors are able to move around chromosomes emerged more than 60 years ago when Barbara McClintock first suggested that such elements existed and had a major role in controlling gene expression and that they also have had a major influence in reshaping genomes in evolution. It was many years, however, before the accumulation of data and theories showed that this latter revolutionary idea was correct although, understandably, it fell far short of our present view of the significant influence of what are now known as "transposable elements" in evolution. In this article, I summarize the main events that influenced my thinking about transposable elements as a young scientist and the influence and role of these specific genomic elements in evolution over subsequent years. Today, we recognize that the findings about genomic changes affected by transposable elements have considerably altered our view of the ways in which genomes evolve and work. PMID:21156958

  10. Circulating Non-coding RNA as Biomarkers in Colorectal Cancer.

    PubMed

    Ferracin, Manuela; Lupini, Laura; Mangolini, Alessandra; Negrini, Massimo

    2016-01-01

    Recent studies suggested that colorectal cancer influences the types and quantity of nucleic acids - especially microRNAs - detected in the bloodstream. Concentration of circulating (cell-free) microRNAs, and possibly of other non-coding RNAs, could therefore serve as valuable colorectal cancer biomarker and could deliver insight into the disease process. This chapter addresses the recent discoveries on circulating microRNA and long non-coding RNA as diagnostic or prognostic biomarkers in colorectal cancer. PMID:27573900

  11. The Chinese Hamster Dihydrofolate Reductase Replication Origin Beta Is Active at Multiple Ectopic Chromosomal Locations and Requires Specific DNA Sequence Elements for Activity

    PubMed Central

    Altman, Amy L.; Fanning, Ellen

    2001-01-01

    To identify cis-acting genetic elements essential for mammalian chromosomal DNA replication, a 5.8-kb fragment from the Chinese hamster dihydrofolate reductase (DHFR) locus containing the origin beta (ori-β) initiation region was stably transfected into random ectopic chromosomal locations in a hamster cell line lacking the endogenous DHFR locus. Initiation at ectopic ori-β in uncloned pools of transfected cells was measured using a competitive PCR-based nascent strand abundance assay and shown to mimic that at the endogenous ori-β region in Chinese hamster ovary K1 cells. Initiation activity of three ectopic ori-β deletion mutants was reduced, while the activity of another deletion mutant was enhanced. The results suggest that a 5.8-kb fragment of the DHFR ori-β region is sufficient to direct initiation and that specific DNA sequences in the ori-β region are required for efficient initiation activity. PMID:11158297

  12. AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.

    PubMed

    Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos

    2015-09-01

    The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)). PMID:26122210

  13. Gene activation-associated long noncoding RNAs function in mouse preimplantation development

    PubMed Central

    Hamazaki, Nobuhiko; Uesaka, Masahiro; Nakashima, Kinichi; Agata, Kiyokazu; Imamura, Takuya

    2015-01-01

    In mice, zygotic activation occurs for a wide variety of genes, mainly at the 2-cell stage. Long noncoding RNAs (lncRNAs) are increasingly being recognized as modulators of gene expression. In this study, directional RNA-seq of MII oocytes and 2-cell embryos identified more than 1000 divergently transcribed lncRNA/mRNA gene pairs. Expression of these bidirectional promoter-associated noncoding RNAs (pancRNAs) was strongly associated with the upregulation of their cognate genes. Conversely, knockdown of three abundant pancRNAs led to reduced mRNA expression, accompanied by sustained DNA methylation even in the presence of enzymes responsible for DNA demethylation. In particular, microinjection of siRNA against the abundant pancRNA partner of interleukin 17d (Il17d) mRNA at the 1-cell stage caused embryonic lethality, which was rescued by supplying IL17D protein in vitro at the 4-cell stage. Thus, this novel class of lncRNAs can modulate the transcription machinery in cis to activate zygotic genes and is important for preimplantation development. PMID:25633350

  14. A Machine Learning Approach for Accurate Annotation of Noncoding RNAs

    PubMed Central

    Liu, Chunmei; Wang, Zhi

    2016-01-01

    Searching genomes to locate noncoding RNA genes with known secondary structure is an important problem in bioinformatics. In general, the secondary structure of a searched noncoding RNA is defined with a structure model constructed from the structural alignment of a set of sequences from its family. Computing the optimal alignment between a sequence and a structure model is the core part of an algorithm that can search genomes for noncoding RNAs. In practice, a single structure model may not be sufficient to capture all crucial features important for a noncoding RNA family. In this paper, we develop a novel machine learning approach that can efficiently search genomes for noncoding RNAs with high accuracy. During the search procedure, a sequence segment in the searched genome sequence is processed and a feature vector is extracted to represent it. Based on the feature vector, a classifier is used to determine whether the sequence segment is the searched ncRNA or not. Our testing results show that this approach is able to efficiently capture crucial features of a noncoding RNA family. Compared with existing search tools, it significantly improves the accuracy of genome annotation. PMID:26357266

  15. Noncoding RNAs, Emerging Regulators in Root Endosymbioses.

    PubMed

    Lelandais-Brière, Christine; Moreau, Jérémy; Hartmann, Caroline; Crespi, Martin

    2016-03-01

    Endosymbiosis interactions allow plants to grow in nutrient-deficient soil environments. The arbuscular mycorrhizal (AM) symbiosis is an ancestral interaction between land plants and fungi, whereas nitrogen-fixing symbioses are highly specific for certain plants, notably major crop legumes. The signaling pathways triggered by specific lipochitooligosaccharide molecules involved in these interactions have common components that also overlap with plant root development. These pathways include receptor-like kinases, transcription factors (TFs), and various intermediate signaling effectors, including noncoding (nc)RNAs. These latter molecules have emerged as major regulators of gene expression and small ncRNAs, composed of micro (mi)RNAs and small interfering (si)RNAs, are known to control gene expression at transcriptional (chromatin) or posttranscriptional levels. In this review, we describe exciting recent data connecting variants of conserved si/miRNAs with the regulation of TFs, such as NSP2, NFY-A1, auxin-response factors, and AP2-like proteins, known to be involved in symbiosis. The link between hormonal regulations and these si- and miRNA-TF nodes is proposed in a model in which different feedback loops or regulations controlling endosymbiosis signaling are integrated. The diversity and emerging regulatory networks of young legume miRNAs are also highlighted. PMID:26894282

  16. Non-coding RNAs and atherosclerosis

    PubMed Central

    Fernández-Hernando, Carlos

    2014-01-01

    Non-coding RNAs (ncRNAs) represent a class of RNA molecules that typically do not code for proteins. Emerging data suggest that ncRNAs play an important role in several physiological and pathological conditions such as cancer and cardiovascular diseases (CVDs) including atherosclerosis. The best-characterized ncRNAs are the microRNAs (miRNAs), which are small, ~22 nucleotide (nt) sequences of RNA that regulate gene expression at the posttranscriptional level through transcript degradation or translational repression. MiRNAs control several aspects of atherosclerosis including endothelial cell, vascular smooth cell, and macrophage functions as well as lipoprotein metabolism. Apart from miRNAs, recently ncRNAs, especially long ncRNAs (lncRNAs), have emerged as important potential regulators of the progression of atherosclerosis. However, the molecular mechanism of their regulation and function as well as significance of other ncRNAs such as small nucleolar RNAs (snoRNAs) during atherogenesis is largely unknown. In this review, we summarize the recent findings in the field, highlighting the importance of ncRNAs in atherosclerosis and discuss their potential use as therapeutic targets in CVDs. PMID:24623179

  17. Residue Substitutions Near the Redox Center of Bacillus subtilis Spx Affect RNA Polymerase Interaction, Redox Control, and Spx-DNA Contact at a Conserved cis-Acting Element

    PubMed Central

    Lin, Ann A.; Walthers, Don

    2013-01-01

    Spx, a member of the ArsC protein family, is a regulatory factor that interacts with RNA polymerase (RNAP). It is highly conserved in Gram-positive bacteria and controls transcription on a genome-wide scale in response to oxidative stress. The structural requirements for RNAP interaction and promoter DNA recognition by Spx were examined through mutational analysis. Residues near the CxxC redox disulfide center of Spx functioned in RNAP α subunit interaction and in promoter DNA binding. R60E and C10A mutants were shown previously to confer defects in transcriptional activation, but both were able to interact with RNAP. R92, which is conserved in ArsC-family proteins, is likely involved in redox control of Spx, as the C10A mutation, which blocks disulfide formation, was epistatic to the R92A mutation. The R91A mutation reduced transcriptional activation and repression, suggesting a defect in RNAP interaction, which was confirmed by interaction assays using an epitope-tagged mutant protein. Protein-DNA cross-linking detected contact between RNAP-bound Spx and the AGCA element at −44 that is conserved in Spx-controlled genes. This interaction caused repositioning of the RNAP σA subunit from a −35-like element upstream of the trxB (thioredoxin reductase) promoter to positions −36 and −11 of the core promoter. The study shows that RNAP-bound Spx contacts a conserved upstream promoter sequence element when bound to RNAP. PMID:23813734

  18. Electrostatic and Hydrophobic Interactions Mediate Single-Stranded DNA Recognition and Acta2 Repression by Purine-Rich Element-Binding Protein B.

    PubMed

    Rumora, Amy E; Ferris, Lauren A; Wheeler, Tamar R; Kelm, Robert J

    2016-05-17

    Myofibroblast differentiation is characterized by an increased level of expression of cytoskeletal smooth muscle α-actin. In human and murine fibroblasts, the gene encoding smooth muscle α-actin (Acta2) is tightly regulated by a network of transcription factors that either activate or repress the 5' promoter-enhancer in response to environmental cues signaling tissue repair and remodeling. Purine-rich element-binding protein B (Purβ) suppresses the expression of Acta2 by cooperatively interacting with the sense strand of a 5' polypurine sequence containing an inverted MCAT cis element required for gene activation. In this study, we evaluated the chemical basis of nucleoprotein complex formation between the Purβ repressor and the purine-rich strand of the MCAT element in the mouse Acta2 promoter. Quantitative single-stranded DNA (ssDNA) binding assays conducted in the presence of increasing concentrations of monovalent salt or anionic detergent suggested that the assembly of a high-affinity nucleoprotein complex is driven by a combination of electrostatic and hydrophobic interactions. Consistent with the results of pH titration analysis, site-directed mutagenesis revealed several basic amino acid residues in the intermolecular (R267) and intramolecular (K82 and R159) subdomains that are essential for Purβ transcriptional repressor function in Acta2 promoter-reporter assays. In keeping with their diminished Acta2 repressor activity in fibroblasts, purified Purβ variants containing an R267A mutation exhibited reduced binding affinity for purine-rich ssDNA. Moreover, certain double and triple-point mutants were also defective in binding to the Acta2 corepressor protein, Y-box-binding protein 1. Collectively, these findings establish the repertoire of noncovalent interactions that account for the unique structural and functional properties of Purβ. PMID:27064749

  19. Conservation and tissue-specific transcription patterns of long noncoding RNAs

    PubMed Central

    Ward, Melanie; McEwan, Callum; Mills, James D; Janitz, Michael

    2015-01-01

    Abstract Over the past decade, the focus of molecular biology has shifted from being predominately DNA and protein-centric to having a greater appreciation of RNA. It is now accepted that the genome is pervasively transcribed in tissue- and cell-specific manner, to produce not only protein-coding RNAs, but also an array of noncoding RNAs (ncRNAs). Many of these ncRNAs have been found to interact with DNA, protein and other RNA molecules where they exert regulatory functions. Long ncRNAs (lncRNAs) are a subclass of ncRNAs that are particularly interesting due to their cell-specific and species-specific expression patterns and unique conservation patterns. Currently, individual lncRNAs have been classified functionally; however, for the vast majority the functional relevance is unknown. To better categorize lncRNAs, an understanding of their specific expression patterns and evolutionary constraints are needed. PMID:27335896

  20. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome

    PubMed Central

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A.

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  1. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  2. Noncoding RNAs, cytokines, and inflammation-related diseases.

    PubMed

    Marques-Rocha, José Luiz; Samblas, Mirian; Milagro, Fermin I; Bressan, Josefina; Martínez, J Alfredo; Marti, Amelia

    2015-09-01

    Chronic inflammation is involved in the onset and development of many diseases, including obesity, atherosclerosis, type 2 diabetes, osteoarthritis, autoimmune and degenerative diseases, asthma, periodontitis, and cirrhosis. The inflammation process is mediated by chemokines, cytokines, and different inflammatory cells. Although the molecules and mechanisms that regulate this primary defense mechanism are not fully understood, recent findings offer a putative role of noncoding RNAs, especially microRNAs (miRNAs), in the progression and management of the inflammatory response. These noncoding RNAs are crucial for the stability and maintenance of gene expression patterns that characterize some cell types, tissues, and biologic responses. Several miRNAs, such as miR-126, miR-132, miR-146, miR-155, and miR-221, have emerged as important transcriptional regulators of some inflammation-related mediators. Additionally, little is known about the involvement of long noncoding RNAs, long intergenic noncoding RNAs, and circular RNAs in inflammation-mediated processes and the homeostatic imbalance associated with metabolic disorders. These noncoding RNAs are emerging as biomarkers with diagnosis value, in prognosis protocols, or in the personalized treatment of inflammation-related alterations. In this context, this review summarizes findings in the field, highlighting those noncoding RNAs that regulate inflammation, with emphasis on recognized mediators such as TNF-α, IL-1, IL-6, IL-18, intercellular adhesion molecule 1, VCAM-1, and plasminogen activator inhibitor 1. The down-regulation or antagonism of the noncoding RNAs and the administration of exogenous miRNAs could be, in the near future, a promising therapeutic strategy in the treatment of inflammation-related diseases. PMID:26065857

  3. Portraying breast cancers with long noncoding RNAs.

    PubMed

    Van Grembergen, Olivier; Bizet, Martin; de Bony, Eric J; Calonne, Emilie; Putmans, Pascale; Brohée, Sylvain; Olsen, Catharina; Guo, Mingzhou; Bontempi, Gianluca; Sotiriou, Christos; Defrance, Matthieu; Fuks, François

    2016-09-01

    Evidence is emerging that long noncoding RNAs (lncRNAs) may play a role in cancer development, but this role is not yet clear. We performed a genome-wide transcriptional survey to explore the lncRNA landscape across 995 breast tissue samples. We identified 215 lncRNAs whose genes are aberrantly expressed in breast tumors, as compared to normal samples. Unsupervised hierarchical clustering of breast tumors on the basis of their lncRNAs revealed four breast cancer subgroups that correlate tightly with PAM50-defined mRNA-based subtypes. Using multivariate analysis, we identified no less than 210 lncRNAs prognostic of clinical outcome. By analyzing the coexpression of lncRNA genes and protein-coding genes, we inferred potential functions of the 215 dysregulated lncRNAs. We then associated subtype-specific lncRNAs with key molecular processes involved in cancer. A correlation was observed, on the one hand, between luminal A-specific lncRNAs and the activation of phosphatidylinositol 3-kinase, fibroblast growth factor, and transforming growth factor-β pathways and, on the other hand, between basal-like-specific lncRNAs and the activation of epidermal growth factor receptor (EGFR)-dependent pathways and of the epithelial-to-mesenchymal transition. Finally, we showed that a specific lncRNA, which we called CYTOR, plays a role in breast cancer. We confirmed its predicted functions, showing that it regulates genes involved in the EGFR/mammalian target of rapamycin pathway and is required for cell proliferation, cell migration, and cytoskeleton organization. Overall, our work provides the most comprehensive analyses for lncRNA in breast cancers. Our findings suggest a wide range of biological functions associated with lncRNAs in breast cancer and provide a foundation for functional investigations that could lead to new therapeutic approaches. PMID:27617288

  4. Portraying breast cancers with long noncoding RNAs

    PubMed Central

    Van Grembergen, Olivier; Bizet, Martin; de Bony, Eric J.; Calonne, Emilie; Putmans, Pascale; Brohée, Sylvain; Olsen, Catharina; Guo, Mingzhou; Bontempi, Gianluca; Sotiriou, Christos; Defrance, Matthieu; Fuks, François

    2016-01-01

    Evidence is emerging that long noncoding RNAs (lncRNAs) may play a role in cancer development, but this role is not yet clear. We performed a genome-wide transcriptional survey to explore the lncRNA landscape across 995 breast tissue samples. We identified 215 lncRNAs whose genes are aberrantly expressed in breast tumors, as compared to normal samples. Unsupervised hierarchical clustering of breast tumors on the basis of their lncRNAs revealed four breast cancer subgroups that correlate tightly with PAM50-defined mRNA-based subtypes. Using multivariate analysis, we identified no less than 210 lncRNAs prognostic of clinical outcome. By analyzing the coexpression of lncRNA genes and protein-coding genes, we inferred potential functions of the 215 dysregulated lncRNAs. We then associated subtype-specific lncRNAs with key molecular processes involved in cancer. A correlation was observed, on the one hand, between luminal A–specific lncRNAs and the activation of phosphatidylinositol 3-kinase, fibroblast growth factor, and transforming growth factor–β pathways and, on the other hand, between basal-like–specific lncRNAs and the activation of epidermal growth factor receptor (EGFR)–dependent pathways and of the epithelial-to-mesenchymal transition. Finally, we showed that a specific lncRNA, which we called CYTOR, plays a role in breast cancer. We confirmed its predicted functions, showing that it regulates genes involved in the EGFR/mammalian target of rapamycin pathway and is required for cell proliferation, cell migration, and cytoskeleton organization. Overall, our work provides the most comprehensive analyses for lncRNA in breast cancers. Our findings suggest a wide range of biological functions associated with lncRNAs in breast cancer and provide a foundation for functional investigations that could lead to new therapeutic approaches. PMID:27617288

  5. 3D-Trajectories Adopted by Coding and Regulatory DNA Elements: First-Passage Times for Genomic Interactions

    PubMed Central

    Lucas, Joseph S.; Zhang, Yaojun; Dudko, Olga K.; Murre, Cornelis

    2014-01-01

    SUMMARY During B lymphocyte development, immunoglobulin heavy chain variable (VH), diversity (DH) and joining (JH) segments assemble to generate a diverse antigen receptor repertoire. Here we have marked the distal VH and DH-JH-Eμ regions with Tet-operator binding sites and traced their 3D-trajectories in pro-B cells transduced with a retrovirus encoding Tet-repressor-EGFP. We found that these elements displayed fractional Langevin motion (fLm) due to the viscoelastic hindrance from the surrounding network of proteins and chromatin fibers. Using fractional Langevin dynamics modeling, we found that, with high probability, DHJH elements reach a VH element within minutes. Spatial confinement emerged as the dominant parameter that determined the frequency of such encounters. We propose that the viscoelastic nature of the nuclear environment causes coding elements and regulatory elements to bounce back and forth in a spring-like fashion until specific genomic interactions are established and that spatial confinement of topological domains largely controls first-passage times for genomic interactions. PMID:24998931

  6. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Clostridium difficile Toxin B and Sensitive Detection in Human Fecal Matter

    PubMed Central

    Maher, Eamonn; Williams, Ryan M.; Sooter, Letha J.

    2015-01-01

    Toxin B is one of the major virulence factors of Clostridium difficile, a bacterium that is responsible for a significant number of diarrhea cases in acute care settings. Due to the prevalence of C. difficile induced diarrhea, rapid and correct diagnosis is crucial in the disease management. In this study, we have employed a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE) specific for toxin B. At the end of the 12-round selection, one MRE with high affinity (Kd = 47.3 nM) for toxin B was identified. The selected MRE demonstrated low cross binding activities on negative targets: bovine serum albumin, Staphylococcus aureus alpha toxin, Pseudomonas aeruginosa exotoxin A, and cholera toxin of Vibrio cholera. A modified sandwich ELISA assay was developed utilizing the selected ssDNA MRE as the antigen capturing element and achieved a sensitive detection of 50 nM of toxin B in human fecal preparations. PMID:25734010

  7. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.

    2015-01-01

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  8. Serum Levels of Selected Vitamins and Trace Elements in Nigerian Consumers of Alcoholic Beverage: A Suggestion for DNA Hypomethylation.

    PubMed

    Ude, A N; Edem, V F; Onifade, A A; Arinola, O G

    2016-01-01

    Folic acid, vitamins and Zinc play essential role in DNA methylation but alcohol consumption is known to affectthe levels of these micronutrients leading to risk of developing various illnesses and certain cancers. This study determinedthe levels of DNA methylation dependent-micronutrients (folate, vitamin B12, vitamin B6, zinc and selenium) andhomocysteine as a suggestion for DNA methylation status in Nigerian alcohol consumers compared with non-consumers ofalcohol. Venous blood (5ml) was obtained from thirty-four males that consume alcoholic beverages for at least 10 years andthirty-two male controls that did not consume alcoholic beverages at least 10 years. Serum concentrations of folate, vitaminB12, vitamin B6, homocysteine (Hcy), selenium (Se) and zinc (Zn) were determined using High Performance LiquidChromatography (HPLC) and Atomic Absorption Spectrophotometry (AAS) as appropriate. Independent Student t-test wasused to compare the mean values between alcohol consumers and control. Mean differences were considered significant atp<0.05. The mean serum levels of Zn and Se were significantly raised in alcohol consumers when compared with nonalcohol consumers while the mean levels of Vitamin B6 and Hcy were significantly reduced in alcohol consumers whencompared with non-alcohol consumers. There were no statistically significant differences in the mean serum levels ofVitamin B12 and folate in alcohol consumers when compared with non-alcohol consumers. Since vitamin B6 and Hcy arerequired for DNA methylation, reduced vitamin B6 and Hcy levels in consumers of alcoholic beverages might suggest DNAhypomethylation in alcohol consumers. PMID:27574771

  9. Select Prenatal Environmental Exposures and Subsequent Alterations of Gene-Specific and Repetitive Element DNA Methylation in Fetal Tissues

    PubMed Central

    Green, Benjamin B.; Marsit, Carmen J.

    2015-01-01

    Strong evidence implicates maternal environmental exposures in contributing to adverse outcomes during pregnancy and later in life through the developmental origins of health and disease hypothesis. Recent research suggests these effects are mediated through the improper regulation of DNA methylation in offspring tissues, specifically placental tissue, which plays a critical role in fetal development. This article reviews the relevant literature relating DNA methylation in multiple tissues at or near delivery to several prenatal environmental toxicants and stressors, including cigarette smoke, endocrine disruptors, heavy metals, as well as maternal diet. These human studies expand upon previously reported outcomes in animal model interventions and include effects on both imprinted and non-imprinted genes. We have also noted some of the strengths and limitations in the approaches used, and consider the appropriate interpretation of these findings in terms of their effect size and their relationship to differential gene expression and potential health outcomes. The studies suggest an important role of DNA methylation in mediating the effects of the intrauterine environment on children’s health and a need for additional research to better clarify the role of this epigenetic mechanism as well as others. PMID:26231362

  10. Different cis-acting DNA elements control expression of the human apolipoprotein AI gene in different cell types

    SciTech Connect

    Sastry, K.; Seedorf, U.; Karathanasis, S.K.

    1988-02-01

    In mammals, the gene coding for apolipoprotein AI (apoAI), a protein of the plasma lipid transport system, is expressed only in the liver and the intestine. A series of plasmids containing various lengths of sequences flanking the 5' end of the human apoAI gene were constructed and assayed for transient expression after introduction into cultured human hepatoma 9HepG2), colon carcinoma (Caco-2), and epithelial (HeLa) cells. The results showed that while most of these constructs are expressed in HepG2 and Caco-2 cells, none of them is expressed in HeLa cells. In addition, the results indicated that a DNA segment located between nucleotides -256 and -41 upstream from the transcription start site of this gene is necessary and sufficient for maximal levels of expression in HepG2 but not in Caco-2 cells, while a DNA segment located between nucleotides -2052 and -192 is required for maximal levels of expression in Caco-2 cells. Moreover, it was shown that the -256 to -41 DNA segment functions as a hepatoma cell-specific transcriptional enhancer with both homologous and heterologous promoters. These results indicate that different cis- and possibly trans-acting factors are involved in the establishment and subsequent regulation of expression of the apoAI gene in the mammalian liver and intestine.

  11. Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion.

    PubMed

    Chen, Yongheng; Zhang, Xiaojun; Dantas Machado, Ana Carolina; Ding, Yuan; Chen, Zhuchu; Qin, Peter Z; Rohs, Remo; Chen, Lin

    2013-09-01

    The p53 core domain binds to response elements (REs) that contain two continuous half-sites as a cooperative tetramer, but how p53 recognizes discontinuous REs is not well understood. Here we describe the crystal structure of the p53 core domain bound to a naturally occurring RE located at the promoter of the Bcl-2-associated X protein (BAX) gene, which contains a one base-pair insertion between the two half-sites. Surprisingly, p53 forms a tetramer on the BAX-RE that is nearly identical to what has been reported on other REs with a 0-bp spacer. Each p53 dimer of the tetramer binds in register to a half-site and maintains the same protein-DNA interactions as previously observed, and the two dimers retain all the protein-protein contacts without undergoing rotation or translation. To accommodate the additional base pair, the DNA is deformed and partially disordered around the spacer region, resulting in an apparent unwinding and compression, such that the interactions between the dimers are maintained. Furthermore, DNA deformation within the p53-bound BAX-RE is confirmed in solution by site-directed spin labeling measurements. Our results provide a structural insight into the mechanism by which p53 binds to discontinuous sites with one base-pair spacer. PMID:23836939

  12. Resurrection of DNA function in vivo from an extinct genome.

    PubMed

    Pask, Andrew J; Behringer, Richard R; Renfree, Marilyn B

    2008-01-01

    There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine), obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity. PMID:18493600

  13. Resurrection of DNA Function In Vivo from an Extinct Genome

    PubMed Central

    Pask, Andrew J.; Behringer, Richard R.; Renfree, Marilyn B.

    2008-01-01

    There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine), obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity. PMID:18493600

  14. Evolutionary annotation of conserved long non-coding RNAs in major mammalian species.

    PubMed

    Bu, DeChao; Luo, HaiTao; Jiao, Fei; Fang, ShuangSang; Tan, ChengFu; Liu, ZhiYong; Zhao, Yi

    2015-08-01

    Mammalian genomes contain tens of thousands of long non-coding RNAs (lncRNAs) that have been implicated in diverse biological processes. However, the lncRNA transcriptomes of most mammalian species have not been established, limiting the evolutionary annotation of these novel transcripts. Based on RNA sequencing data from six tissues of nine species, we built comprehensive lncRNA catalogs (4,142-42,558 lncRNAs) covering the major mammalian species. Compared to protein- coding RNAs, expression of lncRNAs exhibits striking lineage specificity. Notably, although 30%-99% human lncRNAs are conserved across different species on DNA locus level, only 20%-27% of these conserved lncRNA loci are detected to transcription, which represents a stark contrast to the proportion of conserved protein-coding genes (48%-80%). This finding provides a valuable resource for experimental scientists to study the mechanisms of lncRNAs. Moreover, we constructed lncRNA expression phylogenetic trees across nine mammals and demonstrated that lncRNA expression profiles can reliably determine phylogenic placement in a manner similar to their coding counterparts. Our data also reveal that the evolutionary rate of lncRNA expression varies among tissues and is significantly higher than those for protein-coding genes. To streamline the processes of browsing lncRNAs and detecting their evolutionary statuses, we integrate all the data produced in this study into a database named PhyloNONCODE (http://www.bioinfo.org/phyloNoncode). Our work starts to place mammalian lncRNAs in an evolutionary context and represent a rich resource for comparative and functional analyses of this critical layer of genome. PMID:26117828

  15. Mechanistic and Kinetic Differences between Reverse Transcriptases of Vpx Coding and Non-coding Lentiviruses*

    PubMed Central

    Lenzi, Gina M.; Domaoal, Robert A.; Kim, Dong-Hyun; Schinazi, Raymond F.; Kim, Baek

    2015-01-01

    Among lentiviruses, HIV Type 2 (HIV-2) and many simian immunodeficiency virus (SIV) strains replicate rapidly in non-dividing macrophages, whereas HIV Type 1 (HIV-1) replication in this cell type is kinetically delayed. The efficient replication capability of HIV-2/SIV in non-dividing cells is induced by a unique, virally encoded accessory protein, Vpx, which proteasomally degrades the host antiviral restriction factor, SAM domain- and HD domain-containing protein 1 (SAMHD1). SAMHD1 is a dNTPase and kinetically suppresses the reverse transcription step of HIV-1 in macrophages by hydrolyzing and depleting cellular dNTPs. In contrast, Vpx, which is encoded by HIV-2/SIV, kinetically accelerates reverse transcription by counteracting SAMHD1 and then elevating cellular dNTP concentration in non-dividing cells. Here, we conducted the pre-steady-state kinetic analysis of reverse transcriptases (RTs) from two Vpx non-coding and two Vpx coding lentiviruses. At all three sites of the template tested, the two RTs of the Vpx non-coding viruses (HIV-1) displayed higher kpol values than the RTs of the Vpx coding HIV-2/SIV, whereas there was no significant difference in the Kd values of these two groups of RTs. When we employed viral RNA templates that induce RT pausing by their secondary structures, the HIV-1 RTs showed more efficient DNA synthesis through pause sites than the HIV-2/SIV RTs, particularly at low dNTP concentrations found in macrophages. This kinetic study suggests that RTs of the Vpx non-coding HIV-1 may have evolved to execute a faster kpol step, which includes the conformational changes and incorporation chemistry, to counteract the limited dNTP concentration found in non-dividing cells and still promote efficient viral reverse transcription. PMID:26483545

  16. Mechanistic and Kinetic Differences between Reverse Transcriptases of Vpx Coding and Non-coding Lentiviruses.

    PubMed

    Lenzi, Gina M; Domaoal, Robert A; Kim, Dong-Hyun; Schinazi, Raymond F; Kim, Baek

    2015-12-11

    Among lentiviruses, HIV Type 2 (HIV-2) and many simian immunodeficiency virus (SIV) strains replicate rapidly in non-dividing macrophages, whereas HIV Type 1 (HIV-1) replication in this cell type is kinetically delayed. The efficient replication capability of HIV-2/SIV in non-dividing cells is induced by a unique, virally encoded accessory protein, Vpx, which proteasomally degrades the host antiviral restriction factor, SAM domain- and HD domain-containing protein 1 (SAMHD1). SAMHD1 is a dNTPase and kinetically suppresses the reverse transcription step of HIV-1 in macrophages by hydrolyzing and depleting cellular dNTPs. In contrast, Vpx, which is encoded by HIV-2/SIV, kinetically accelerates reverse transcription by counteracting SAMHD1 and then elevating cellular dNTP concentration in non-dividing cells. Here, we conducted the pre-steady-state kinetic analysis of reverse transcriptases (RTs) from two Vpx non-coding and two Vpx coding lentiviruses. At all three sites of the template tested, the two RTs of the Vpx non-coding viruses (HIV-1) displayed higher kpol values than the RTs of the Vpx coding HIV-2/SIV, whereas there was no significant difference in the Kd values of these two groups of RTs. When we employed viral RNA templates that induce RT pausing by their secondary structures, the HIV-1 RTs showed more efficient DNA synthesis through pause sites than the HIV-2/SIV RTs, particularly at low dNTP concentrations found in macrophages. This kinetic study suggests that RTs of the Vpx non-coding HIV-1 may have evolved to execute a faster kpol step, which includes the conformational changes and incorporation chemistry, to counteract the limited dNTP concentration found in non-dividing cells and still promote efficient viral reverse transcription. PMID:26483545

  17. Identification of a novel cis-regulatory element essential for immune tolerance.

    PubMed

    LaFlam, Taylor N; Seumois, Grégory; Miller, Corey N; Lwin, Wint; Fasano, Kayla J; Waterfield, Michael; Proekt, Irina; Vijayanand, Pandurangan; Anderson, Mark S

    2015-11-16

    Thymic central tolerance is essential to preventing autoimmunity. In medullary thymic epithelial cells (mTECs), the Autoimmune regulator (Aire) gene plays an essential role in this process by driving the expression of a diverse set of tissue-specific antigens (TSAs), which are presented and help tolerize self-reactive thymocytes. Interestingly, Aire has a highly tissue-restricted pattern of expression, with only mTECs and peripheral extrathymic Aire-expressing cells (eTACs) known to express detectable levels in adults. Despite this high level of tissue specificity, the cis-regulatory elements that control Aire expression have remained obscure. Here, we identify a highly conserved noncoding DNA element that is essential for Aire expression. This element shows enrichment of enhancer-associated histone marks in mTECs and also has characteristics of being an NF-κB-responsive element. Finally, we find that this element is essential for Aire expression in vivo and necessary to prevent spontaneous autoimmunity, reflecting the importance of this regulatory DNA element in promoting immune tolerance. PMID:26527800

  18. Conserved Noncoding Sequences Regulate lhx5 Expression in the Zebrafish Forebrain

    PubMed Central

    Sun, Liu; Chen, Fengjiao; Peng, Gang

    2015-01-01

    The LIM homeobox family protein Lhx5 plays important roles in forebrain development in the vertebrates. The lhx5 gene exhibits complex temporal and spatial expression patterns during early development but its transcriptional regulation mechanisms are not well understood. Here, we have used transgenesis in zebrafish in order to define regulatory elements that drive lhx5 expression in the forebrain. Through comparative genomic analysis we identified 10 non-coding sequences conserved in five teleost species. We next examined the enhancer activities of these conserved non-coding sequences with Tol2 transposon mediated transgenesis. We found a proximately located enhancer gave rise to robust reporter EGFP expression in the forebrain regions. In addition, we identified an enhancer located at approximately 50 kb upstream of lhx5 coding region that is responsible for reporter gene expression in the hypothalamus. We also identify an enhancer located approximately 40 kb upstream of the lhx5 coding region that is required for expression in the prethalamus (ventral thalamus). Together our results suggest discrete enhancer elements control lhx5 expression in different regions of the forebrain. PMID:26147098

  19. Genomic DNA nanoparticles rescue rhodopsin-associated retinitis pigmentosa phenotype

    PubMed Central

    Han, Zongchao; Banworth, Marcellus J.; Makkia, Rasha; Conley, Shannon M.; Al-Ubaidi, Muayyad R.; Cooper, Mark J.; Naash, Muna I.

    2015-01-01

    Mutations in the rhodopsin gene cause retinal degeneration and clinical phenotypes including retinitis pigmentosa (RP) and congenital stationary night blindness. Effective gene therapies have been difficult to develop, however, because generating precise levels of rhodopsin expression is critical; overexpression causes toxicity, and underexpression would result in incomplete rescue. Current gene delivery strategies routinely use cDNA-based vectors for gene targeting; however, inclusion of noncoding components of genomic DNA (gDNA) such as introns may help promote more endogenous regulation of gene expression. Here we test the hypothesis that inclusion of genomic sequences from the rhodopsin gene can improve the efficacy of rhodopsin gene therapy in the rhodopsin knockout (RKO) mouse model of RP. We utilize our compacted DNA nanoparticles (NPs), which have the ability to transfer larger and more complex genetic constructs, to deliver murine rhodopsin cDNA or gDNA. We show functional and structural improvements in RKO eyes for up to 8 months after NP-mediated gDNA but not cDNA delivery. Importantly, in addition to improvements in rod function, we observe significant preservation of cone function at time points when cones in the RKO model are degenerated. These results suggest that inclusion of native expression elements, such as introns, can significantly enhance gene expression and therapeutic efficacy and may become an essential option in the array of available gene delivery tools.— Han, Z., Banworth, M. J., Makkia, R., Conley, S. M., Al-Ubaidi, M. R., Cooper, M. J., Naash, M. I. Genomic DNA nanoparticles rescue rhodopsin-associated retinitis pigmentosa phenotype. PMID:25713057

  20. PVT1: a rising star among oncogenic long noncoding RNAs.

    PubMed

    Colombo, Teresa; Farina, Lorenzo; Macino, Giuseppe; Paci, Paola

    2015-01-01

    It is becoming increasingly clear that short and long noncoding RNAs critically participate in the regulation of cell growth, differentiation, and (mis)function. However, while the functional characterization of short non-coding RNAs has been reaching maturity, there is still a paucity of well characterized long noncoding RNAs, even though large studies in recent years are rapidly increasing the number of annotated ones. The long noncoding RNA PVT1 is encoded by a gene that has been long known since it resides in the well-known cancer risk region 8q24. However, a couple of accidental concurrent conditions have slowed down the study of this gene, that is, a preconception on the primacy of the protein-coding over noncoding RNAs and the prevalent interest in its neighbor MYC oncogene. Recent studies have brought PVT1 under the spotlight suggesting interesting models of functioning, such as competing endogenous RNA activity and regulation of protein stability of important oncogenes, primarily of the MYC oncogene. Despite some advancements in modelling the PVT1 role in cancer, there are many questions that remain unanswered concerning the precise molecular mechanisms underlying its functioning. PMID:25883951

  1. PVT1: A Rising Star among Oncogenic Long Noncoding RNAs

    PubMed Central

    Colombo, Teresa; Farina, Lorenzo; Macino, Giuseppe; Paci, Paola

    2015-01-01

    It is becoming increasingly clear that short and long noncoding RNAs critically participate in the regulation of cell growth, differentiation, and (mis)function. However, while the functional characterization of short non-coding RNAs has been reaching maturity, there is still a paucity of well characterized long noncoding RNAs, even though large studies in recent years are rapidly increasing the number of annotated ones. The long noncoding RNA PVT1 is encoded by a gene that has been long known since it resides in the well-known cancer risk region 8q24. However, a couple of accidental concurrent conditions have slowed down the study of this gene, that is, a preconception on the primacy of the protein-coding over noncoding RNAs and the prevalent interest in its neighbor MYC oncogene. Recent studies have brought PVT1 under the spotlight suggesting interesting models of functioning, such as competing endogenous RNA activity and regulation of protein stability of important oncogenes, primarily of the MYC oncogene. Despite some advancements in modelling the PVT1 role in cancer, there are many questions that remain unanswered concerning the precise molecular mechanisms underlying its functioning. PMID:25883951

  2. Functions of noncoding RNAs in neural development and neurological diseases

    PubMed Central

    Bian, Shan; Sun, Tao

    2011-01-01

    The development of the central nervous system (CNS) relies on precisely orchestrated gene expression regulation. Dysregualtion of both genetic and environmental factors can affect proper CNS development and results in neurological diseases. Recent studies have shown that similar to protein coding genes, noncoding RNA molecules have a significant impact on normal CNS development and on causes and progression of human neurological disorders. In this review, we have highlighted discoveries of functions of noncoding RNAs, in particular microRNAs and long noncoding RNAs, in neural development and neurological diseases. Emerging evidence has shown that microRNAs play an essential role in many aspects of neural development, such as proliferation of neural stem cells and progenitors, neuronal differentiation, maturation and synaptogenesis. Misregulation of microRNAs is associated with some mental disorders and neurodegeneration diseases. In addition, long noncoding RNAs are found to play a role in neural development by regulating expression of protein coding genes. Therefore, examining noncoding RNA-mediated gene regulations has revealed novel mechanisms of neural development and provided new insights into the etiology of human neurological diseases. PMID:21969146

  3. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  4. Global Analysis of DNA Methylation Variation in Adipose Tissue from Twins Reveals Links to Disease-Associated Variants in Distal Regulatory Elements

    PubMed Central

    Grundberg, Elin; Meduri, Eshwar; Sandling, Johanna K.; Hedman, Åsa K.; Keildson, Sarah; Buil, Alfonso; Busche, Stephan; Yuan, Wei; Nisbet, James; Sekowska, Magdalena; Wilk, Alicja; Barrett, Amy; Small, Kerrin S.; Ge, Bing; Caron, Maxime; Shin, So-Youn; Ahmadi, Kourosh R.; Ainali, Chrysanthi; Barrett, Amy; Bataille, Veronique; Bell, Jordana T.; Buil, Alfonso; Deloukas, Panos; Dermitzakis, Emmanouil T.; Dimas, Antigone S.; Durbin, Richard; Glass, Daniel; Grundberg, Elin; Hassanali, Neelam; Hedman, Åsa K.; Ingle, Catherine; Knowles, David; Krestyaninova, Maria; Lindgren, Cecilia M.; Lowe, Christopher E.; McCarthy, Mark I.; Meduri, Eshwar; di Meglio, Paola; Min, Josine L.; Montgomery, Stephen B.; Nestle, Frank O.; Nica, Alexandra C.; Nisbet, James; O’Rahilly, Stephen; Parts, Leopold; Potter, Simon; Sandling, Johanna; Sekowska, Magdalena; Shin, So-Youn; Small, Kerrin S.; Soranzo, Nicole; Spector, Tim D.; Surdulescu, Gabriela; Travers, Mary E.; Tsaprouni, Loukia; Tsoka, Sophia; Wilk, Alicja; Yang, Tsun-Po; Zondervan, Krina T.; Lathrop, Mark; Dermitzakis, Emmanouil T.; McCarthy, Mark I.; Spector, Timothy D.; Bell, Jordana T.; Deloukas, Panos

    2013-01-01

    Epigenetic modifications such as DNA methylation play a key role in gene regulation and disease susceptibility. However, little is known about the genome-wide frequency, localization, and function of methylation variation and how it is regulated by genetic and environmental factors. We utilized the Multiple Tissue Human Expression Resource (MuTHER) and generated Illumina 450K adipose methylome data from 648 twins. We found that individual CpGs had low variance and that variability was suppressed in promoters. We noted that DNA methylation variation was highly heritable (h2median = 0.34) and that shared environmental effects correlated with metabolic phenotype-associated CpGs. Analysis of methylation quantitative-trait loci (metQTL) revealed that 28% of CpGs were associated with nearby SNPs, and when overlapping them with adipose expression quantitative-trait loci (eQTL) from the same individuals, we found that 6% of the loci played a role in regulating both gene expression and DNA methylation. These associations were bidirectional, but there were pronounced negative associations for promoter CpGs. Integration of metQTL with adipose reference epigenomes and disease associations revealed significant enrichment of metQTL overlapping metabolic-trait or disease loci in enhancers (the strongest effects were for high-density lipoprotein cholesterol and body mass index [BMI]). We followed up with the BMI SNP rs713586, a cg01884057 metQTL that overlaps an enhancer upstream of ADCY3, and used bisulphite sequencing to refine this region. Our results showed widespread population invariability yet sequence dependence on adipose DNA methylation but that incorporating maps of regulatory elements aid in linking CpG variation to gene regulation and disease risk in a tissue-dependent manner. PMID:24183450

  5. Maternal phthalate exposure during pregnancy is associated with DNA methylation of LINE-1 and Alu repetitive elements in Mexican-American children.

    PubMed

    Huen, Karen; Calafat, Antonia M; Bradman, Asa; Yousefi, Paul; Eskenazi, Brenda; Holland, Nina

    2016-07-01

    Phthalates are frequently used in personal care products and plasticizers and phthalate exposure is ubiquitous in the US population. Exposure to phthalates during critical periods in utero has been associated with a variety of adverse health outcomes but the biological mechanisms linking these exposures with disease are not well characterized. In this study, we examined the relationship of in utero phthalate exposure with repetitive element DNA methylation, an epigenetic marker of genome instability, in children from the longitudinal birth cohort CHAMACOS. Methylation of Alu and long interspersed nucleotide elements (LINE-1) was determined using pyrosequencing of bisulfite-treated DNA isolated from whole blood samples collected from newborns and 9 year old children (n=355). Concentrations of eleven phthalate metabolites were measured in urine collected from pregnant mothers at 13 and 26 weeks gestation. We found a consistent inverse association between prenatal concentrations of monoethyl phthalate, the most frequently detected urinary metabolite, with cord blood methylation of Alu repeats (β(95%CI): -0.14 (-0.28,0.00) and -0.16 (-0.31, -0.02)) for early and late pregnancy, respectively, and a similar but weaker association with LINE-1 methylation. Additionally, increases in urinary concentrations of di-(2-ethylhexyl) phthalate metabolites during late pregnancy were associated with lower levels of methylation of Alu repeats in 9 year old blood (significant p-values ranged from 0.003 to 0.03). Our findings suggest that prenatal exposure to some phthalates may influence differences in repetitive element methylation, highlighting epigenetics as a plausible biological mechanism through which phthalates may affect health. PMID:27019040

  6. New insights on the transcriptional regulation of CD69 gene through a potent enhancer located in the conserved non-coding sequence 2.

    PubMed

    Laguna, Teresa; Notario, Laura; Pippa, Raffaella; Fontela, Miguel G; Vázquez, Berta N; Maicas, Miren; Aguilera-Montilla, Noemí; Corbí, Ángel L; Odero, María D; Lauzurica, Pilar

    2015-08-01

    The CD69 type II C-type lectin is one of the earliest indicators of leukocyte activation acting in lymphocyte migration and cytokine secretion. CD69 expression in hematopoietic lineage undergoes rapid changes depending on the cell-lineage, the activation state or the localization of the cell where it is expressed, suggesting a complex and tightly controlled regulation. Here we provide new insights on the transcriptional regulation of CD69 gene in mammal species. Through in silico studies, we analyzed several regulatory features of the 4 upstream conserved non-coding sequences (CNS 1-4) previously described, confirming a major function of CNS2 in the transcriptional regulation of CD69. In addition, multiple transcription binding sites are identified in the CNS2 region by DNA cross-species conservation analysis. By functional approaches we defined a core region of 226bp located within CNS2 as the main enhancer element of CD69 transcription in the hematopoietic cells analyzed. By chromatin immunoprecipitation, binding of RUNX1 to the core-CNS2 was shown in a T cell line. In addition, we found an activating but not essential role of RUNX1 in CD69 gene transcription by site-directed mutagenesis and RNA silencing, probably through the interaction with this potent enhancer specifically in the hematopoietic lineage. In summary, in this study we contribute with new evidences to the landscape of the transcriptional regulation of the CD69 gene. PMID:25801305

  7. Long Non-coding RNA ANRIL and Polycomb in Human Cancers and Cardiovascular Disease

    PubMed Central

    Aguilo, Francesca; Cecilia, Serena Di; Walsh, Martin J.

    2015-01-01

    The long non-coding RNA CDKN2B-AS1, commonly referred to as the Antisense Non-coding RNA in the INK4 Locus (ANRIL), is a 3.8-kb-long RNA transcribed from the short arm of human chromosome 9 on p21.3 that overlaps a critical region encompassing three major tumor suppressor loci juxtaposed to the INK4b-ARF-INK4a gene cluster and the methyl-thioadenosine phosphorylase (MTAP) gene. Genome-wide association studies have identified this region with a remarkable and growing number of disease-associated DNA alterations and single nucleotide polymorphisms, which corresponds to increased susceptibility to human disease. Recent attention has been devoted on whether these alterations in the ANRIL sequence affect its expression levels and/or its splicing transcript variation, and in consequence, global cellular homeostasis. Moreover, recent evidence postulates that ANRIL not only can regulate their immediate genomic neighbors in cis, but also has the capacity to regulate additional loci in trans. This action would further increase the complexity for mechanisms imposed through ANRIL and furthering the scope of this lncRNA in disease pathogenesis. In this chapter, we summarize the most recent findings on the investigation of ANRIL and provide a perspective on the biological and clinical significance of ANRIL as a putative biomarker, specifically, its potential role in directing cellular fates leading to cancer and cardiovascular disease. PMID:26220772

  8. Non-coding RNA: what is functional and what is junk?

    PubMed Central

    Palazzo, Alexander F.; Lee, Eliza S.

    2015-01-01

    The genomes of large multicellular eukaryotes are mostly comprised of non-protein coding DNA. Although there has been much agreement that a small fraction of these genomes has important biological functions, there has been much debate as to whether the rest contributes to development and/or homeostasis. Much of the speculation has centered on the genomic regions that are transcribed into RNA at some low level. Unfortunately these RNAs have been arbitrarily assigned various names, such as “intergenic RNA,” “long non-coding RNAs” etc., which have led to some confusion in the field. Many researchers believe that these transcripts represent a vast, unchartered world of functional non-coding RNAs (ncRNAs), simply because they exist. However, there are reasons to question this Panglossian view because it ignores our current understanding of how evolution shapes eukaryotic genomes and how the gene expression machinery works in eukaryotic cells. Although there are undoubtedly many more functional ncRNAs yet to be discovered and characterized, it is also likely that many of these transcripts are simply junk. Here, we discuss how to determine whether any given ncRNA has a function. Importantly, we advocate that in the absence of any such data, the appropriate null hypothesis is that the RNA in question is junk. PMID:25674102

  9. Identification of novel long non-coding RNAs in triple-negative breast cancer

    PubMed Central

    Yu, Wenjie; Wang, Wenmin; Xu, Dong; Yan, Xinqiang; Chen, Beibei; Yu, Longyao; Li, Jicheng; Chen, Xiaobing; Ding, Kan; Cao, Feilin

    2015-01-01

    Triple-negative breast carcinomas (TNBC) are characterized by particularly poor outcomes, and there are no established markers significantly associated with prognosis. Long non-coding RNAs (lncRNAs) are subclass of noncoding RNAs that have been recently shown to play critical roles in cancer biology. However, little is known about their mechanistic role in TNBC pathogenesis. In this report, we investigated the expression patterns of lncRNAs from TNBC tissues and matched normal tissues with Agilent Human lncRNA array. We identified 1,758 lncRNAs and 1,254 mRNAs that were differentially expressed (≥ 2-fold change), indicating that many lncRNAs are significantly upregulated or downregulated in TNBC. Among these, XR_250621.1 and NONHSAT125629 were the most upregulated and downregulated lncRNAs respectively. qRT-PCR was employed to validate the microarray analysis findings, and results were consistent with the data from the microarrays. GO and KEGG pathway analysis were applied to explore the potential lncRNAs functions, some pathways including microtubule motor activity and DNA replication were identified in TNBC pathogenesis. Our study revealed that a set of lncRNAs were differentially expressed in TNBC tissues, suggesting that they may play role in TNBC. These results shed light on lncRNAs’ biological functions and provide useful information for exploring potential therapeutic targets for breast cancer. PMID:26078338

  10. Partial Hepatectomy Induced Long Noncoding RNA Inhibits Hepatocyte Proliferation during Liver Regeneration

    PubMed Central

    Huang, Lulu; Damle, Sagar S.; Booten, Sheri; Singh, Priyam; Sabripour, Mahyar; Hsu, Jeff; Jo, Minji; Katz, Melanie; Watt, Andy; Hart, Christopher E.; Freier, Susan M.; Monia, Brett P.; Guo, Shuling

    2015-01-01

    Liver regeneration after partial hepatectomy (PHx) is a complex and well-orchestrated biological process in which synchronized cell proliferation is induced in response to the loss of liver mass. To define long noncoding RNAs (lncRNAs) that participate in the regulation of liver regeneration, we performed microarray analysis and identified more than 400 lncRNAs exhibiting significantly altered expression. Of these, one lncRNA, LncPHx2 (Long noncoding RNA induced by PHx 2), was highly upregulated during liver regeneration. Depletion of LncPHx2 during liver regeneration using antisense oligonucleotides led to a transient increase in hepatocyte proliferation and more rapid liver regeneration. Gene expression analysis showed that LncPHx2 depletion resulted in upregulation of mRNAs encoding proteins known to promote cell proliferation, including MCM components, DNA polymerases, histone proteins, and transcription factors. LncPHx2 interacts with the mRNAs of MCM components, making it a candidate to regulate the expression of MCMs and other genes post-transcriptionally. Collectively, our data demonstrate that LncPHx2 is a key lncRNA that participates in a negative feedback loop modulating hepatocyte proliferation through RNA-RNA interactions. PMID:26207833

  11. Comprehensive Reconstruction and Visualization of Non-Coding Regulatory Networks in Human

    PubMed Central

    Bonnici, Vincenzo; Russo, Francesco; Bombieri, Nicola; Pulvirenti, Alfredo; Giugno, Rosalba

    2014-01-01

    Research attention has been powered to understand the functional roles of non-coding RNAs (ncRNAs). Many studies have demonstrated their deregulation in cancer and other human disorders. ncRNAs are also present in extracellular human body fluids such as serum and plasma, giving them a great potential as non-invasive biomarkers. However, non-coding RNAs have been relatively recently discovered and a comprehensive database including all of them is still missing. Reconstructing and visualizing the network of ncRNAs interactions are important steps to understand their regulatory mechanism in complex systems. This work presents ncRNA-DB, a NoSQL database that integrates ncRNAs data interactions from a large number of well established on-line repositories. The interactions involve RNA, DNA, proteins, and diseases. ncRNA-DB is available at http://ncrnadb.scienze.univr.it/ncrnadb/. It is equipped with three interfaces: web based, command-line, and a Cytoscape app called ncINetView. By accessing only one resource, users can search for ncRNAs and their interactions, build a network annotated with all known ncRNAs and associated diseases, and use all visual and mining features available in Cytoscape. PMID:25540777

  12. Comprehensive reconstruction and visualization of non-coding regulatory networks in human.

    PubMed

    Bonnici, Vincenzo; Russo, Francesco; Bombieri, Nicola; Pulvirenti, Alfredo; Giugno, Rosalba

    2014-01-01

    Research attention has been powered to understand the functional roles of non-coding RNAs (ncRNAs). Many studies have demonstrated their deregulation in cancer and other human disorders. ncRNAs are also present in extracellular human body fluids such as serum and plasma, giving them a great potential as non-invasive biomarkers. However, non-coding RNAs have been relatively recently discovered and a comprehensive database including all of them is still missing. Reconstructing and visualizing the network of ncRNAs interactions are important steps to understand their regulatory mechanism in complex systems. This work presents ncRNA-DB, a NoSQL database that integrates ncRNAs data interactions from a large number of well established on-line repositories. The interactions involve RNA, DNA, proteins, and diseases. ncRNA-DB is available at http://ncrnadb.scienze.univr.it/ncrnadb/. It is equipped with three interfaces: web based, command-line, and a Cytoscape app called ncINetView. By accessing only one resource, users can search for ncRNAs and their interactions, build a network annotated with all known ncRNAs and associated diseases, and use all visual and mining features available in Cytoscape. PMID:25540777

  13. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-01-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  14. New Perspectives on DNA and RNA Triplexes As Effectors of Biological Activity.

    PubMed

    Bacolla, Albino; Wang, Guliang; Vasquez, Karen M

    2015-12-01

    Since the first description of the canonical B-form DNA double helix, it has been suggested that alternative DNA, DNA-RNA, and RNA structures exist and act as functional genomic elements. Indeed, over the past few years it has become clear that, in addition to serving as a repository for genetic information, genomic DNA elicits biological responses by adopting conformations that differ from the canonical right-handed double helix, and by interacting with RNA molecules to form complex secondary structures. This review focuses on recent advances on three-stranded (triplex) nucleic acids, with an emphasis on DNA-RNA and RNA-RNA interactions. Emerging work reveals that triplex interactions between noncoding RNAs and duplex DNA serve as platforms for delivering site-specific epigenetic marks critical for the regulation of gene expression. Additionally, an increasing body of genetic and structural studies demonstrates that triplex RNA-RNA interactions are essential for performing catalytic and regulatory functions in cellular nucleoprotein complexes, including spliceosomes and telomerases, and for enabling protein recoding during programmed ribosomal frameshifting. Thus, evidence is mounting that DNA and RNA triplex interactions are implemented to perform a range of diverse biological activities in the cell, some of which will be discussed in this review. PMID:26700634

  15. Role of Non-Coding RNAs in the Transgenerational Epigenetic Transmission of the Effects of Reprotoxicants

    PubMed Central

    Larriba, Eduardo; del Mazo, Jesús

    2016-01-01

    Non-coding RNAs (ncRNAs) are regulatory elements of gene expression and chromatin structure. Both long and small ncRNAs can also act as inductors and targets of epigenetic programs. Epigenetic patterns can be transmitted from one cell to the daughter cell, but, importantly, also through generations. Diversity of ncRNAs is emerging with new and surprising roles. Functional interactions among ncRNAs and between specific ncRNAs and structural elements of the chromatin are drawing a complex landscape. In this scenario, epigenetic changes induced by environmental stressors, including reprotoxicants, can explain some transgenerationally-transmitted phenotypes in non-Mendelian ways. In this review, we analyze mechanisms of action of reprotoxicants upon different types of ncRNAs and epigenetic modifications causing transgenerationally transmitted characters through germ cells but affecting germ cells and reproductive systems. A functional model of epigenetic mechanisms of transgenerational transmission ncRNAs-mediated is also proposed. PMID:27023531

  16. Non-coding RNAs in Mammary Gland Development and Disease.

    PubMed

    Sandhu, Gurveen K; Milevskiy, Michael J G; Wilson, Wesley; Shewan, Annette M; Brown, Melissa A

    2016-01-01

    Non-coding RNAs (ncRNAs) are untranslated RNA molecules that function to regulate the expression of numerous genes and associated biochemical pathways and cellular functions. NcRNAs include small interfering RNAs (siRNAs), microRNAs (miRNAs), PIWI-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs) and long non-coding RNAs (lncRNAs). They participate in the regulation of all developmental processes and are frequently aberrantly expressed or functionally defective in disease. This Chapter will focus on the role of ncRNAs, in particular miRNAs and lncRNAs, in mammary gland development and disease. PMID:26659490

  17. Long Noncoding RNAs: Fresh Perspectives into the RNA world

    PubMed Central

    Yang, Lin; Froberg, John E.; Lee, Jeannie T.

    2014-01-01

    Large scale mapping of transcriptomes has revealed significant levels of transcriptional activity within both unannotated and annotated regions of the genome. Interestingly, many of the novel transcripts demonstrate tissue-specific expression and some level of sequence conservation across species, but most have low protein-coding potential. Here we describe progress in identifying and characterizing long noncoding RNAs and review how these transcripts interact with other biological molecules to regulate diverse cellular processes. We also preview emerging techniques that will help advance the discovery and characterization of novel transcripts. Finally, we discuss the role of long non-coding RNAs in disease and therapeutics. PMID:24290031

  18. Archaeal Haloarcula californiae Icosahedral Virus 1 Highlights Conserved Elements in Icosahedral Membrane-Containing DNA Viruses from Extreme Environments

    PubMed Central

    Demina, Tatiana A.; Pietilä, Maija K.; Svirskaitė, Julija; Ravantti, Janne J.; Atanasova, Nina S.; Bamford, Dennis H.

    2016-01-01

    ABSTRACT Despite their high genomic diversity, all known viruses are structurally constrained to a limited number of virion morphotypes. One morphotype of viruses infecting bacteria, archaea, and eukaryotes is the tailless icosahedral morphotype with an internal membrane. Although it is considered an abundant morphotype in extreme environments, only seven such archaeal viruses are known. Here, we introduce Haloarcula californiae icosahedral virus 1 (HCIV-1), a halophilic euryarchaeal virus originating from salt crystals. HCIV-1 also retains its infectivity under low-salinity conditions, showing that it is able to adapt to environmental changes. The release of progeny virions resulting from cell lysis was evidenced by reduced cellular oxygen consumption, leakage of intracellular ATP, and binding of an indicator ion to ruptured cell membranes. The virion contains at least 12 different protein species, lipids selectively acquired from the host cell membrane, and a 31,314-bp-long linear double-stranded DNA (dsDNA). The overall genome organization and sequence show high similarity to the genomes of archaeal viruses in the Sphaerolipoviridae family. Phylogenetic analysis based on the major conserved components needed for virion assembly—the major capsid proteins and the packaging ATPase—placed HCIV-1 along with the alphasphaerolipoviruses in a distinct, well-supported clade. On the basis of its virion morphology and sequence similarities, most notably, those of its core virion components, we propose that HCIV-1 is a member of the PRD1-adenovirus structure-based lineage together with other sphaerolipoviruses. This addition to the lineage reinforces the notion of the ancient evolutionary links observed between the viruses and further highlights the limits of the choices found in nature for formation of a virion. PMID:27435460

  19. Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

    PubMed Central

    Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael

    2013-01-01

    Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

  20. Emerging role of long noncoding RNAs as regulators of innate immune cell development and inflammatory gene expression.

    PubMed

    Elling, Roland; Chan, Jennie; Fitzgerald, Katherine A

    2016-03-01

    The innate immune system represents the first line of defense during infection and is initiated by the detection of conserved microbial products by germline-encoded pattern recognition receptors (PRRs). Sensing through PRRs induces broad transcriptional changes that elicit powerful inflammatory responses. Tight regulation of these processes depends on multiple regulatory checkpoints, including noncoding RNA species such as microRNAs. In addition, long noncoding RNAs (lncRNAs) have recently gained attention as important regulators of gene expression acting through versatile interactions with DNA, RNA, or proteins. As such, these RNAs have a multitude of mechanisms to modulate gene expression. Here, we summarize recent advances in this rapidly moving and evolving field. We highlight the contribution of lncRNAs to both the development and activation of innate immune cells, whether it is in the nucleus, where lncRNAs alter the transcription of target genes through interaction with transcription factors, chromatin-modifying complexes or heterogeneous ribonucleoprotein complexes, or in the cytosol where they can control the stability of target mRNAs. In addition, we discuss experimental approaches required to comprehensively investigate the function of a candidate noncoding RNA locus, including loss-of-function approaches encompassing genomic deletions, RNA interference, locked nucleic acids, and various adaptions of the CRISPR/Cas9 technology. PMID:26820238

  1. Analysis of genetic elements controlling Staphylococcus aureus lrgAB expression: potential role of DNA topology in SarA regulation.

    PubMed

    Fujimoto, D F; Brunskill, E W; Bayles, K W

    2000-09-01

    Penicillin-induced killing and murein hydrolase activity in Staphylococcus aureus are dependent on a variety of regulatory elements, including the LytSR two-component regulatory system and the virulence factor regulators Agr and Sar. The LytSR effects on these processes can be explained, in part, by the recent finding that a LytSR-regulated operon, designated lrgAB, affects murein hydrolase activity and penicillin tolerance. To examine the regulation of lrgAB expression in greater detail, we performed Northern blot and promoter fusion analyses. Both methods revealed that Agr and Sar, like LytSR, positively regulate lrgAB expression. A mutation in the agr locus reduced lrgAB expression approximately sixfold, while the sar mutation reduced lrgAB expression to undetectable levels. cis-acting regulatory elements involved in lrgAB expression were identified by fusing various fragments of the lrgAB promoter region to the xylE reporter gene and integrating these constructs into the chromosome. Catechol 2,3-dioxygenase assays identified DNA sequences, including an inverted repeat and intrinsic bend sites, that contribute to maximal lrgAB expression. Confirmation of the importance of the inverted repeat was achieved by demonstrating that multiple copies of the inverted repeat reduced lrgAB promoter activity, presumably by titrating out a positive regulatory factor. The results of this study demonstrate that lrgAB expression responds to a variety of positive regulatory factors and suggest that specific DNA topology requirements are important for optimal expression. PMID:10940023

  2. Tumorigenesis by Meis1 overexpression is accompanied by a change of DNA target-sequence specificity which allows binding to the AP-1 element.

    PubMed

    Dardaei, Leila; Penkov, Dmitry; Mathiasen, Lisa; Bora, Pranami; Morelli, Marco J; Blasi, Francesco

    2015-09-22

    Meis1 overexpression induces tumorigenicity but its activity is inhibited by Prep1 tumor suppressor. Why does overexpression of Meis1 cause cancer and how does Prep1 inhibit? Tumor profiling and ChIP-sequencing data in a genetically-defined set of cell lines show that: 1) The number of Meis1 and Prep1 DNA binding sites increases linearly with their concentration resulting in a strong increase of "extra" target genes. 2) At high concentration, Meis1 DNA target specificity changes such that the most enriched consensus becomes that of the AP-1 regulatory element, whereas the specific OCTA consensus is not enriched because diluted within the many extra binding sites. 3) Prep1 inhibits Meis1 tumorigenesis preventing the binding to many of the "extra" genes containing AP-1 sites. 4) The overexpression of Prep1, but not of Meis1, changes the functional genomic distribution of the binding sites, increasing seven fold the number of its "enhancer" and decreasing its "promoter" targets. 5) A specific Meis1 "oncogenic" and Prep1 "tumor suppressing" signature has been identified selecting from the pool of genes bound by each protein those whose expression was modified uniquely by the "tumor-inducing" Meis1 or tumor-inhibiting Prep1 overexpression. In both signatures, the enriched gene categories are the same and are involved in signal transduction. However, Meis1 targets stimulatory genes while Prep1 targets genes that inhibit the tumorigenic signaling pathways. PMID:26259236

  3. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  4. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  5. A novel imprinted transgene located near a repetitive element that exhibits allelic imbalance in DNA methylation during early development.

    PubMed

    Uchiyama, Koji; Watanabe, Daisuke; Hayasaka, Michiko; Hanaoka, Kazunori

    2014-12-01

    A mouse line carrying a lacZ transgene driven by the human EEF1A1/EF1 alpha promoter was established. Although the promoter is known to show ubiquitous activity, only paternal transgene alleles were expressed, resulting in a transgene imprinting. At mid-gestation, the promoter sequence was differentially methylated, hypomethylated for paternal and hypermethylated for maternal alleles. In germline, the promoter was a typical differentially methylated region. After fertilization, however, both alleles were hypermethylated. Thus, the differential methylation of the promoter required for transgene imprinting was re-established during later embryonic development independently of the germline differential methylation. Furthermore, also a retroelement promoter closely-flanking imprinted transgene and its wild type counterpart displayed similar differential methylation during early development. The retroelement promoter was methylated differentially also in germline, but in an opposite pattern to the embryonic differential methylation. These results suggest that there might be an unknown epigenetic regulation inducing transgene imprinting independently of DNA methylation in the transgene insertion site. Then, besides CpG dinucleotides, non-CpG cytosines of the retroelement promoter were highly methylated especially in the transgene-active mid-gestational embryos, suggesting that an unusual epigenetic regulation might protect the active transgene against de novo methylation occurring generally in mid-gestational embryo. PMID:25389047

  6. Multiple human papillomavirus type 16 glucocorticoid response elements functional for transformation, transient expression, and DNA-protein interactions.

    PubMed Central

    Mittal, R; Pater, A; Pater, M M

    1993-01-01

    We have previously shown that human papillomavirus type 16 (HPV-16) can efficiently transform primary baby rat kidney cells in the presence of the steroid hormones progesterone and the glucocorticoid dexamethasone. To study this effect of hormone, different combinations of the previously identified glucocorticoid response element (GRE) at nucleotide 7640 of HPV-16 and the other two GREs that we have recently identified, at nucleotides 7385 and 7474, were mutated. The previously described GRE and the other two GREs were shown to be functional for the induction of transformation by dexamethasone. In addition, transient assays in cervical HeLa cells demonstrated the functional importance of the three individual GREs. Assays for in vitro interaction demonstrated the specific binding of a 97-kDa protein, the glucocorticoid receptor, to both recently identified HPV-16 GREs. Images PMID:8394465

  7. PCAT-1, a long noncoding RNA, regulates BRCA2 and controls homologous recombination in cancer.

    PubMed

    Prensner, John R; Chen, Wei; Iyer, Matthew K; Cao, Qi; Ma, Teng; Han, Sumin; Sahu, Anirban; Malik, Rohit; Wilder-Romans, Kari; Navone, Nora; Logothetis, Christopher J; Araujo, John C; Pisters, Louis L; Tewari, Ashutosh K; Canman, Christine E; Knudsen, Karen E; Kitabayashi, Naoki; Rubin, Mark A; Demichelis, Francesca; Lawrence, Theodore S; Chinnaiyan, Arul M; Feng, Felix Y

    2014-03-15

    Impairment of double-stranded DNA break (DSB) repair is essential to many cancers. However, although mutations in DSB repair proteins are common in hereditary cancers, mechanisms of impaired DSB repair in sporadic cancers remain incompletely understood. Here, we describe the first role for a long noncoding RNA (lncRNA) in DSB repair in prostate cancer. We identify PCAT-1, a prostate cancer outlier lncRNA, which regulates cell response to genotoxic stress. PCAT-1 expression produces a functional deficiency in homologous recombination through its repression of the BRCA2 tumor suppressor, which, in turn, imparts a high sensitivity to small-molecule inhibitors of PARP1. These effects reflected a posttranscriptional repression of the BRCA2 3'UTR by PCAT-1. Our observations thus offer a novel mechanism of "BRCAness" in sporadic cancers. PMID:24473064

  8. Long non-coding RNAs: a new frontier in the study of human diseases.

    PubMed

    Shi, Xuefei; Sun, Ming; Liu, Hongbing; Yao, Yanwen; Song, Yong

    2013-10-10

    With the development of whole genome and transcriptome sequencing technologies, long noncoding RNAs (lncRNAs) have received increased attention. Multiple studies indicate that lncRNAs act not only as the intermediary between DNA and protein but also as important protagonists of cellular functions. LncRNAs can regulate gene expression in many ways, including chromosome remodeling, transcription and post-transcriptional processing. Moreover, the dysregulation of lncRNAs has increasingly been linked to many human diseases, especially in cancers. Here, we reviewed the rapidly advancing field of lncRNAs and described the relationship between the dysregulation of lncRNAs and human diseases, highlighting the specific roles of lncRNAs in human diseases. PMID:23791884

  9. Non-coding RNAs as direct and indirect modulators of epigenetic regulation

    PubMed Central

    Peschansky, Veronica J; Wahlestedt, Claes

    2014-01-01

    Epigenetic regulation of gene expression is an increasingly well-understood concept that explains much of the contribution of an organism’s environment and experience to its biology. However, discussion persists as to which mechanisms can be classified as epigenetic. Ongoing research continues to uncover novel pathways, including the important role of non-protein coding RNA transcripts in epigenetic gene regulation. We know that the majority of human and other mammalian transcripts are not translated but that many of these are nonetheless functional. These non-coding RNAs (ncRNAs) can be short (< 200 nt) or long (< 200 nt) and are further classified by genomic origin and mechanism of action. We discuss examples of ncRNAs that interact with histone modifying complexes or DNA methyltransferases to regulate gene expression, others that are targets of these epigenetic mechanisms, and propose a model in which such transcripts feed back into an epigenetic regulatory network. PMID:24739571

  10. Incredible RNA: Dual Functions of Coding and Noncoding.

    PubMed

    Nam, Jin-Wu; Choi, Seo-Won; You, Bo-Hyun

    2016-05-31

    Since the RNA world hypothesis was proposed, a large number of regulatory noncoding RNAs (ncRNAs) have been identified in many species, ranging from microorganisms to mammals. During the characterization of these newly discovered RNAs, RNAs having both coding and noncoding functions were discovered, and these were considered bifunctional RNAs. The recent use of computational and high-throughput experimental approaches has revealed increasing evidence of various sources of bifunctional RNAs, such as protein-coding mRNAs with a noncoding isoform and long ncRNAs bearing a small open reading frame. Therefore, the genomic diversity of Janus-faced RNA molecules that have dual characteristics of coding and noncoding indicates that the functional roles of RNAs have to be revisited in cells on a genome-wide scale. Such studies would allow us to further understand the complex gene-regulatory network in cells. In this review, we discuss three major genomic sources of bifunctional RNAs and present a handful of examples of bifunctional RNA along with their functional roles. PMID:27137091

  11. Incredible RNA: Dual Functions of Coding and Noncoding

    PubMed Central

    Nam, Jin-Wu; Choi, Seo-Won; You, Bo-Hyun

    2016-01-01

    Since the RNA world hypothesis was proposed, a large number of regulatory noncoding RNAs (ncRNAs) have been identified in many species, ranging from microorganisms to mammals. During the characterization of these newly discovered RNAs, RNAs having both coding and noncoding functions were discovered, and these were considered bifunctional RNAs. The recent use of computational and high-throughput experimental approaches has revealed increasing evidence of various sources of bifunctional RNAs, such as protein-coding mRNAs with a noncoding isoform and long ncRNAs bearing a small open reading frame. Therefore, the genomic diversity of Janus-faced RNA molecules that have dual characteristics of coding and noncoding indicates that the functional roles of RNAs have to be revisited in cells on a genome-wide scale. Such studies would allow us to further understand the complex gene-regulatory network in cells. In this review, we discuss three major genomic sources of bifunctional RNAs and present a handful of examples of bifunctional RNA along with their functional roles. PMID:27137091

  12. Non-coding RNAs in cancer brain metastasis.

    PubMed

    Wu, Kerui; Sharma, Sambad; Venkat, Suresh; Liu, Keqin; Zhou, Xiaobo; Watabe, Kounosuke

    2016-01-01

    More than 90% of cancer death is attributed to metastatic disease, and the brain is one of the major metastatic sites of melanoma, colon, renal, lung and breast cancers. Despite the recent advancement of targeted therapy for cancer, the incidence of brain metastasis is increasing. One reason is that most therapeutic drugs can't penetrate blood-brain-barrier and tumor cells find the brain as sanctuary site. In this review, we describe the pathophysiology of brain metastases to introduce the latest understandings of metastatic brain malignancies. This review also particularly focuses on non-coding RNAs and their roles in cancer brain metastasis. Furthermore, we discuss the roles of the extracellular vesicles as they are known to transport information between cells to initiate cancer cell-microenvironment communication. The potential clinical translation of non-coding RNAs as a tool for diagnosis and for treatment is also discussed in this review. At the end, the computational aspects of non-coding RNA detection, the sequence and structure calculation and epigenetic regulation of non-coding RNA in brain metastasis are discussed. PMID:26709907

  13. Noncoding RNAs in Growth and Death of Cancer Cells.

    PubMed

    Liu, Anfei; Liu, Shanrong

    2016-01-01

    The mammalian genomes are mostly comprised of noncoding genes. And mammalian genomes are characterized by pervasive expression of different types of noncoding RNAs (ncRNAs). In sharp contrast to previous collections, these ncRNAs show strong purifying selection evolutionary conservation. Previous studies indicated that only a small fraction of the mammalian genome codes for messenger RNAs destined to be translated into peptides or proteins, and it is generally assumed that a large portion of transcribed sequences-including pseudogenes and several classes of ncRNAs-do not give rise to peptides or proteins. However, ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding. Moreover, these observations highlight a potentially large and complex set of biologically regulated translational events from transcripts formerly thought to lack coding potential. Furthermore, accumulating evidence from previous studies has suggested that the novel translation products exhibit temporal regulation similar to that of proteins known to be involved in many biological activity processes. In this review, we focus on the coding potential of noncoding genes and ncRNAs. We also sketched the possible mechanisms for their coding activities. Overall, our review provides new insights into the word of central dogma and is an expansive resource of functional annotations for biomedical research. At last, the outcome of the majority of the translation events and their potential biological purpose remain an intriguing topic for future investigation. PMID:27376734

  14. Beyond the proteome: non-coding regulatory RNAs

    PubMed Central

    Szymański, Maciej; Barciszewski, Jan

    2002-01-01

    A variety of RNA molecules have been found over the last 20 years to have a remarkable range of functions beyond the well-known roles of messenger, ribosomal and transfer RNAs. Here, we present a general categorization of all non-coding RNAs and briefly discuss the ones that affect transcription, translation and protein function. PMID:12049667

  15. Noncoding RNAs, Emerging Regulators of Skeletal Muscle Development and Diseases

    PubMed Central

    Nie, Mao; Deng, Zhong-Liang; Liu, Jianming; Wang, Da-Zhi

    2015-01-01

    A healthy and independent life requires skeletal muscles to maintain optimal function throughout the lifespan, which is in turn dependent on efficient activation of processes that regulate muscle development, homeostasis, and metabolism. Thus, identifying mechanisms that modulate these processes is of crucial priority. Noncoding RNAs (ncRNAs), including microRNAs (miRNAs) and long noncoding RNAs (lncRNAs), have emerged as a class of previously unrecognized transcripts whose importance in a wide range of biological processes and human disease is only starting to be appreciated. In this review, we summarize the roles of recently identified miRNAs and lncRNAs during skeletal muscle development and pathophysiology. We also discuss several molecular mechanisms of these noncoding RNAs. Undoubtedly, further systematic understanding of these noncoding RNAs' functions and mechanisms will not only greatly expand our knowledge of basic skeletal muscle biology, but also significantly facilitate the development of therapies for various muscle diseases, such as muscular dystrophies, cachexia, and sarcopenia. PMID:26258142

  16. Functional non-coding RNAs derived from the flavivirus 3' untranslated region.

    PubMed

    Clarke, B D; Roby, J A; Slonchak, A; Khromykh, A A

    2015-08-01

    Flaviviruses are single-stranded positive sense RNA enveloped viruses. The flavivirus genus includes important human pathogens such as dengue virus (DENV), West Nile virus (WNV), yellow fever virus (YFV), Japanese encephalitis virus (JEV), tick-borne encephalitis virus (TBEV), and Murray Valley encephalitis virus (MVEV). In addition to the viral proteins and viral genomic RNA, flaviviruses produce at least two functional non-coding RNAs derived from the 3' untranslated region (3'UTR), the subgenomic flavivirus RNA (sfRNA) and a putative WNV miRNA (KUN-miR-1). In this review we summarize published data from studies with WNV, YFV, DENV, JEV, and MVEV on sfRNA production following incomplete degradation of the viral genomic RNA by the cellular 5'-3' exoribonuclease 1 (XRN1), RNA structural elements involved in stalling XRN1 to generate sfRNA, and functions of sfRNA in modulating cellular mRNA decay and RNAi pathways as well as in modulating anti-viral type I interferon response. In addition, we also summarize data on the mechanisms of biogenesis of 3'UTR-derived KUN-miR-1 and its function in WNV replication in mosquito host, along with recent findings on a discovery of a second potential flaviviral miRNA vsRNA5, derived from the 3'UTR of DENV. This review thus summarizes the known mechanisms of generation and the functions of flaviviral 3'UTR-derived non-coding RNAs. PMID:25660582

  17. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells

    PubMed Central

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory

    2016-01-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5′ mRNA-like features, including capping and 5′UTR length. On the other hand, nonpolysomal “free cytoplasmic” lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  18. Volatile evolution of long noncoding RNA repertoires: mechanisms and biological implications

    PubMed Central

    Kapusta, Aurélie; Feschotte, Cédric

    2014-01-01

    Thousands of genes encoding long noncoding RNAs (lncRNAs) have been identified in all vertebrate genomes thus far examined. The list of lncRNAs partaking in arguably important biochemical, cellular, and developmental activities is steadily growing. However, it is increasingly clear that lncRNA repertoires are subject to weak functional constraint and rapid turnover during vertebrate evolution. Here we discuss some of the factors that may explain this apparent paradox, including relaxed constraint on sequence to maintain lncRNA structure/function, extensive redundancy in the regulatory circuits in which lncRNAs act, as well as adaptive and non-adaptive forces such as genetic drift. We explore the molecular mechanisms promoting the birth and rapid evolution of lncRNA genes with an emphasis on the influence of bidirectional transcription and transposable elements, two pervasive features of vertebrate genomes. Together these properties reveal a remarkably dynamic and malleable noncoding transcriptome, which may represent an important source of robustness and evolvability. PMID:25218058

  19. Structural architecture of the human long non-coding RNA, steroid receptor RNA activator.

    PubMed

    Novikova, Irina V; Hennelly, Scott P; Sanbonmatsu, Karissa Y

    2012-06-01

    While functional roles of several long non-coding RNAs (lncRNAs) have been determined, the molecular mechanisms are not well understood. Here, we report the first experimentally derived secondary structure of a human lncRNA, the steroid receptor RNA activator (SRA), 0.87 kB in size. The SRA RNA is a non-coding RNA that coactivates several human sex hormone receptors and is strongly associated with breast cancer. Coding isoforms of SRA are also expressed to produce proteins, making the SRA gene a unique bifunctional system. Our experimental findings (SHAPE, in-line, DMS and RNase V1 probing) reveal that this lncRNA has a complex structural organization, consisting of four domains, with a variety of secondary structure elements. We examine the coevolution of the SRA gene at the RNA structure and protein structure levels using comparative sequence analysis across vertebrates. Rapid evolutionary stabilization of RNA structure, combined with frame-disrupting mutations in conserved regions, suggests that evolutionary pressure preserves the RNA structural core rather than its translational product. We perform similar experiments on alternatively spliced SRA isoforms to assess their structural features. PMID:22362738

  20. Structural architecture of the human long non-coding RNA, steroid receptor RNA activator

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2012-01-01

    While functional roles of several long non-coding RNAs (lncRNAs) have been determined, the molecular mechanisms are not well understood. Here, we report the first experimentally derived secondary structure of a human lncRNA, the steroid receptor RNA activator (SRA), 0.87 kB in size. The SRA RNA is a non-coding RNA that coactivates several human sex hormone receptors and is strongly associated with breast cancer. Coding isoforms of SRA are also expressed to produce proteins, making the SRA gene a unique bifunctional system. Our experimental findings (SHAPE, in-line, DMS and RNase V1 probing) reveal that this lncRNA has a complex structural organization, consisting of four domains, with a variety of secondary structure elements. We examine the coevolution of the SRA gene at the RNA structure and protein structure levels using comparative sequence analysis across vertebrates. Rapid evolutionary stabilization of RNA structure, combined with frame-disrupting mutations in conserved regions, suggests that evolutionary pressure preserves the RNA structural core rather than its translational product. We perform similar experiments on alternatively spliced SRA isoforms to assess their structural features. PMID:22362738

  1. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells.

    PubMed

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A; Johnson, Rory

    2016-06-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5' mRNA-like features, including capping and 5'UTR length. On the other hand, nonpolysomal "free cytoplasmic" lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  2. CTCF cooperates with noncoding RNA MYCNOS to promote neuroblastoma progression through facilitating MYCN expression.

    PubMed

    Zhao, X; Li, D; Pu, J; Mei, H; Yang, D; Xiang, X; Qu, H; Huang, K; Zheng, L; Tong, Q

    2016-07-01

    Previous studies have indicated the important roles of MYCN in tumorigenesis and progression of neuroblastoma (NB), the most common extracranial solid tumor derived from neural crest in childhood. However, the regulatory mechanisms of MYCN expression in NB still remain largely unknown. In this study, through mining public microarray databases and analyzing the cis-regulatory elements and chromatin immunoprecipitation data sets, we identified CCCTC-binding factor (CTCF) as a crucial transcription factor facilitating the MYCN expression in NB. RNA immunoprecipitation, RNA electrophoretic mobility shift assay, RNA pull down and in vitro binding assay indicated the physical interaction between CTCF and MYCN opposite strand (MYCNOS), a natural noncoding RNA surrounding the MYNC promoter. Gain- and loss-of-function studies revealed that MYCNOS facilitated the recruitment of CTCF to its binding sites within the MYCN promoter to induce chromatin remodeling, resulting in enhanced MYCN levels and altered downstream gene expression, in cultured NB cell lines. CTCF cooperated with MYCNOS to suppress the differentiation and promote the growth, invasion and metastasis of NB cells in vitro and in vivo. In clinical NB tissues and cell lines, CTCF and MYCNOS were upregulated and positively correlated with MYCN expression. CTCF was an independent prognostic factor for unfavorable outcome of NB, and patients with high MYCNOS expression had lower survival probability. Taken together, these results demonstrate that CTCF cooperates with noncoding RNA MYCNOS to exhibit oncogenic activity that affects the aggressiveness and progression of NB through transcriptional upregulation of MYCN. PMID:26549029

  3. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  4. Non-coding stem-bulge RNAs are required for cell proliferation and embryonic development in C. elegans

    PubMed Central

    Kowalski, Madzia P.; Baylis, Howard A.; Krude, Torsten

    2015-01-01

    ABSTRACT Stem bulge RNAs (sbRNAs) are a family of small non-coding stem-loop RNAs present in Caenorhabditis elegans and other nematodes, the function of which is unknown. Here, we report the first functional characterisation of nematode sbRNAs. We demonstrate that sbRNAs from a range of nematode species are able to reconstitute the initiation of chromosomal DNA replication in the presence of replication proteins in vitro, and that conserved nucleotide sequence motifs are essential for this function. By functionally inactivating sbRNAs with antisense morpholino oligonucleotides, we show that sbRNAs are required for S phase progression, early embryonic development and the viability of C. elegans in vivo. Thus, we demonstrate a new and essential role for sbRNAs during the early development of C. elegans. sbRNAs show limited nucleotide sequence similarity to vertebrate Y RNAs, which are also essential for the initiation of DNA replication. Our results therefore establish that the essential function of small non-coding stem-loop RNAs during DNA replication extends beyond vertebrates. PMID:25908866

  5. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

    PubMed Central

    2012-01-01

    Background Etoposide (epipodophyllotoxin) is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs). However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L.) genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36) and two protein-encoding genes (Homeobox and CDPK-related genes) were detected in the etoposide-treated plants (S0 generation) in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae) and the indica cultivar (93-11). DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36). Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2) of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar genotoxic stress on

  6. Uncovering RNA Editing Sites in Long Non-Coding RNAs

    PubMed Central

    Picardi, Ernesto; D’Erchia, Anna Maria; Gallo, Angela; Montalvo, Antonio; Pesole, Graziano

    2014-01-01

    RNA editing is an important co/post-transcriptional molecular process able to modify RNAs by nucleotide insertions/deletions or substitutions. In human, the most common RNA editing event involves the deamination of adenosine (A) into inosine (I) through the adenosine deaminase acting on RNA proteins. Although A-to-I editing can occur in both coding and non-coding RNAs, recent findings, based on RNA-seq experiments, have clearly demonstrated that a large fraction of RNA editing events alter non-coding RNAs sequences including untranslated regions of mRNAs, introns, long non-coding RNAs (lncRNAs), and low molecular weight RNAs (tRNA, miRNAs, and others). An accurate detection of A-to-I events occurring in non-coding RNAs is of utmost importance to clarify yet unknown functional roles of RNA editing in the context of gene expression regulation and maintenance of cell homeostasis. In the last few years, massive transcriptome sequencing has been employed to identify putative RNA editing changes at genome scale. Despite several efforts, the computational prediction of A-to-I sites in complete eukaryotic genomes is yet a challenging task. We have recently developed a software package, called REDItools, in order to simplify the detection of RNA editing events from deep sequencing data. In the present work, we show the potential of our tools in recovering A-to-I candidates from RNA-Seq experiments as well as guidelines to improve the RNA editing detection in non-coding RNAs, with specific attention to the lncRNAs. PMID:25538940

  7. Non-coding RNAs: Therapeutic Strategies and Delivery Systems.

    PubMed

    Ling, Hui

    2016-01-01

    The vast majority of the human genome is transcribed into RNA molecules that do not code for proteins, which could be small ones approximately 20 nucleotide in length, known as microRNAs, or transcripts longer than 200 bp, defined as long noncoding RNAs. The prevalent deregulation of microRNAs in human cancers prompted immediate interest on the therapeutic value of microRNAs as drugs and drug targets. Many features of microRNAs such as well-defined mechanisms, and straightforward oligonucleotide design further make them attractive candidates for therapeutic development. The intensive efforts of exploring microRNA therapeutics are reflected by the large body of preclinical studies using oligonucleotide-based mimicking and blocking, culminated by the recent entry of microRNA therapeutics in clinical trial for several human diseases including cancer. Meanwhile, microRNA therapeutics faces the challenge of effective and safe delivery of nucleic acid therapeutics into the target site. Various chemical modifications of nucleic acids and delivery systems have been developed to increase targeting specificity and efficacy, and reduce the associated side effects including activation of immune response. Recently, long noncoding RNAs become attractive targets for therapeutic intervention because of their association with complex and delicate phenotypes, and their unconventional pharmaceutical activities such as capacity of increasing output of proteins. Here I discuss the general therapeutic strategies targeting noncoding RNAs, review delivery systems developed to maximize noncoding RNA therapeutic efficacy, and offer perspectives on the future development of noncoding RNA targeting agents for colorectal cancer. PMID:27573903

  8. The Arginine/Lysine-Rich Element within the DNA-Binding Domain Is Essential for Nuclear Localization and Function of the Intracellular Pathogen Resistance 1.

    PubMed

    Yao, Kezhen; Wu, Yongyan; Chen, Qi; Zhang, Zihan; Chen, Xin; Zhang, Yong

    2016-01-01

    The mouse intracellular pathogen resistance 1 (Ipr1) gene plays important roles in mediating host immunity and previous work showed that it enhances macrophage apoptosis upon mycobacterium infection. However, to date, little is known about the regulation pattern of Ipr1 action. Recent studies have investigated the protein-coding genes and microRNAs regulated by Ipr1 in mouse macrophages, but the structure and the functional motif of the Ipr1 protein have yet to be explored. In this study, we analyzed the domains and functional motif of the Ipr1 protein. The resulting data reveal that Ipr1 protein forms a homodimer and that the Sp100-like domain mediates the targeting of Ipr1 protein to nuclear dots (NDs). Moreover, we found that an Ipr1 mutant lacking the classic nuclear localization signal (cNLS) also translocated into the nuclei, suggesting that the cNLS is not the only factor that directs Ipr1 nuclear localization. Additionally, mechanistic studies revealed that an arginine/lysine-rich element within the DNA-binding domain (SAND domain) is critical for Ipr1 binding to the importin protein receptor NPI-1, demonstrating that this element plays an essential role in mediating the nuclear localization of Ipr1 protein. Furthermore, our results show that this arginine/lysine-rich element contributes to the transcriptional regulation and apoptotic activity of Ipr1. These findings highlight the structural foundations of Ipr1 action and provide new insights into the mechanism of Ipr1-mediated resistance to mycobacterium. PMID:27622275

  9. Candida albicans repetitive elements display epigenetic diversity and plasticity

    PubMed Central

    Freire-Benéitez, Verónica; Price, R. Jordan; Tarrant, Daniel; Berman, Judith; Buscaino, Alessia

    2016-01-01

    Transcriptionally silent heterochromatin is associated with repetitive DNA. It is poorly understood whether and how heterochromatin differs between different organisms and whether its structure can be remodelled in response to environmental signals. Here, we address this question by analysing the chromatin state associated with DNA repeats in the human fungal pathogen Candida albicans. Our analyses indicate that, contrary to model systems, each type of repetitive element is assembled into a distinct chromatin state. Classical Sir2-dependent hypoacetylated and hypomethylated chromatin is associated with the rDNA locus while telomeric regions are assembled into a weak heterochromatin that is only mildly hypoacetylated and hypomethylated. Major Repeat Sequences, a class of tandem repeats, are assembled into an intermediate chromatin state bearing features of both euchromatin and heterochromatin. Marker gene silencing assays and genome-wide RNA sequencing reveals that C. albicans heterochromatin represses expression of repeat-associated coding and non-coding RNAs. We find that telomeric heterochromatin is dynamic and remodelled upon an environmental change. Weak heterochromatin is associated with telomeres at 30 °C, while robust heterochromatin is assembled over these regions at 39 °C, a temperature mimicking moderate fever in the host. Thus in C. albicans, differential chromatin states controls gene expression and epigenetic plasticity is linked to adaptation. PMID:26971880

  10. Variation in vertebrate cis-regulatory elements in evolution and disease.

    PubMed

    Douglas, Adam Thomas; Hill, Robert D

    2014-01-01

    Much of the genetic information that drives animal diversity lies within the vast non-coding regions of the genome. Multi-species sequence conservation in non-coding regions of the genome flags important regulatory elements and more recently, techniques that look for functional signatures predicted for regulatory sequences have added to the identification of thousands more. For some time, biologists have argued that changes in cis-regulatory sequences creates the basic genetic framework for evolutionary change. Recent advances support this notion and show that there is extensive genomic variability in non-coding regulatory elements associated with trait variation, speciation and disease. PMID:25764334

  11. Variation in Vertebrate Cis-Regulatory Elements in Evolution and Disease.

    PubMed

    Douglas, Adam T; Hill, Robert E

    2014-05-01

    Much of the genetic information that drives animal diversity lies within the vast non-coding regions of the genome. Multi-species sequence conservation in non-coding regions of the genome flags important regulatory elements and more recently, techniques that look for functional signatures predicted for regulatory sequences have added to the identification of thousands more. For some time, biologists have argued that changes in cis-regulatory sequences creates the basic genetic framework for evolutionary change. Recent advances support this notion and show that there is extensive genomic variability in non-coding regulatory elements associated with trait variation, speciation and disease. PMID:24802895

  12. Variation in Vertebrate Cis-Regulatory Elements in Evolution and Disease

    PubMed Central

    Douglas, Adam Thomas; Hill, Robert E

    2014-01-01

    Much of the genetic information that drives animal diversity lies within the vast non-coding regions of the genome. Multi-species sequence conservation in non-coding regions of the genome flags important regulatory elements and more recently, techniques that look for functional signatures predicted for regulatory sequences have added to the identification of thousands more. For some time, biologists have argued that changes in cis-regulatory sequences creates the basic genetic framework for evolutionary change. Recent advances support this notion and show that there is extensive genomic variability in non-coding regulatory elements associated with trait variation, speciation and disease. PMID:25764334

  13. Bipartite geminivirus host adaptation determined cooperatively by coding and noncoding sequences of the genome.

    PubMed

    Petty, I T; Carter, S C; Morra, M R; Jeffrey, J L; Olivey, H E

    2000-11-25

    Bipartite geminiviruses are small, plant-infecting viruses with genomes composed of circular, single-stranded DNA molecules, designated A and B. Although they are closely related genetically, individual bipartite geminiviruses frequently exhibit host-specific adaptation. Two such viruses are bean golden mosaic virus (BGMV) and tomato golden mosaic virus (TGMV), which are well adapted to common bean (Phaseolus vulgaris) and Nicotiana benthamiana, respectively. In previous studies, partial host adaptation was conferred on BGMV-based or TGMV-based hybrid viruses by separately exchanging open reading frames (ORFs) on DNA A or DNA B. Here we analyzed hybrid viruses in which all of the ORFs on both DNAs were exchanged except for AL1, which encodes a protein with strictly virus-specific activity. These hybrid viruses exhibited partial transfer of host-adapted phenotypes. In contrast, exchange of noncoding regions (NCRs) upstream from the AR1 and BR1 ORFs did not confer any host-specific gain of function on hybrid viruses. However, when the exchangeable ORFs and NCRs from TGMV were combined in a single BGMV-based hybrid virus, complete transfer of TGMV-like adaptation to N. benthamiana was achieved. Interestingly, the reciprocal TGMV-based hybrid virus displayed only partial gain of function in bean. This may be, in part, the result of defective virus-specific interactions between TGMV and BGMV sequences present in the hybrid, although a potential role in adaptation to bean for additional regions of the BGMV genome cannot be ruled out. PMID:11080490

  14. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-01-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes’ transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions. PMID:26275223

  15. The MluI cell cycle box (MCB) motifs, but not damage-responsive elements (DREs), are responsible for the transcriptional induction of the rhp51+ gene in response to DNA replication stress.

    PubMed

    Sartagul, Wugangerile; Zhou, Xin; Yamada, Yuki; Ma, Ning; Tanaka, Katsunori; Furuyashiki, Tomoyuki; Ma, Yan

    2014-01-01

    DNA replication stress induces the transcriptional activation of rhp51+, a fission yeast recA homolog required for repair of DNA double strand breaks. However, the mechanism by which DNA replication stress activates rhp51+ transcription is not understood. The promoter region of rhp51+ contains two damage-responsive elements (DREs) and two MluI cell cycle box (MCB) motifs. Using luciferase reporter assays, we examined the role of these elements in rhp51+ transcription. The full-length rhp51+ promoter and a promoter fragment containing MCB motifs only, but not a fragment containing DREs, mediated transcriptional activation upon DNA replication stress. Removal of the MCB motifs from the rhp51+ promoter abolished the induction of rhp51+ transcription by DNA replication stress. Consistent with a role for MCB motifs in rhp51+ transcription activation, deletion of the MBF (MCB-binding factor) co-repressors Nrm1 and Yox1 precluded rhp51+ transcriptional induction in response to DNA replication stress. Using cells deficient in checkpoint signaling molecules, we found that the Rad3-Cds1/Chk1 pathway partially mediated rhp51+ transcription in response to DNA replication stress, suggesting the involvement of unidentified checkpoint signaling pathways. Because MBF is critical for G1/S transcription, we examined how the cell cycle affected rhp51+ transcription. The transcription of rhp51+ and cdc18+, an MBF-dependent G1/S gene, peaked simultaneously in synchronized cdc25-22 cells. Furthermore, DNA replication stress maintained transcription of rhp51+ similarly to cdc18+. Collectively, these results suggest that MBF and its regulators mediate rhp51+ transcription in response to DNA replication stress, and underlie rhp51+ transcription at the G1/S transition. PMID:25372384

  16. Tumorigenesis by Meis1 overexpression is accompanied by a change of DNA target-sequence specificity which allows binding to the AP-1 element

    PubMed Central

    Dardaei, Leila; Penkov, Dmitry; Mathiasen, Lisa; Bora, Pranami; Morelli, Marco J.; Blasi, Francesco

    2015-01-01

    Meis1 overexpression induces tumorigenicity but its activity is inhibited by Prep1 tumor suppressor. Why does overexpression of Meis1 cause cancer and how does Prep1 inhibit? Tumor profiling and ChIP-sequencing data in a genetically-defined set of cell lines show that: 1) The number of Meis1 and Prep1 DNA binding sites increases linearly with their concentration resulting in a strong increase of “extra” target genes. 2) At high concentration, Meis1 DNA target specificity changes such that the most enriched consensus becomes that of the AP-1 regulatory element, whereas the specific OCTA consensus is not enriched because diluted within the many extra binding sites. 3) Prep1 inhibits Meis1 tumorigenesis preventing the binding to many of the “extra” genes containing AP-1 sites. 4) The overexpression of Prep1, but not of Meis1, changes the functional genomic distribution of the binding sites, increasing seven fold the number of its “enhancer” and decreasing its “promoter” targets. 5) A specific Meis1 “oncogenic” and Prep1 “tumor suppressing” signature has been identified selecting from the pool of genes bound by each protein those whose expression was modified uniquely by the “tumor-inducing” Meis1 or tumor-inhibiting Prep1 overexpression. In both signatures, the enriched gene categories are the same and are involved in signal transduction. However, Meis1 targets stimulatory genes while Prep1 targets genes that inhibit the tumorigenic signaling pathways. PMID:26259236

  17. Phorbol ester treatment to mice inhibits DNA binding of the TCDD inducible nuclear dioxin-receptor to Cyp1A1 enhancer elements

    SciTech Connect

    Okino, S.T.; Tukey, R.H. )

    1991-03-15

    The treatment of C57BL/6 mice with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) results in transcriptional activation of the Cyp1A1 and Cyp1A2 genes. Quantitation of mRNA levels and transcription rates demonstrate that post-transcriptional mechanisms are not involved in TCDD induction of the Cyp1A genes. The induction of the Cyp1A genes by TCDD occurs following ligand binding to the dioxin-receptor and accumulation of the ligand-receptor complex in the nucleus. The administration of the tumor promoting agent 12-O-tetradecanoylphorbol-13-acetate (TPA) before or in combination with the administration of TCDD inhibits transcriptional activation of the Cyp1A genes. To analyze the mechanism of this inhibition, methods were developed to determine if the DNA binding potential of the nuclear dioxin-receptor was impaired. Using an oligonucleotide covering the Cyp1A1 xenobiotic responsive element (XRE), gel retardation assays demonstrated that within 1 hour, TCDD induces a nuclear DNA binding protein. This bonding is completely inhibited when incubated with excess XRE. Transcriptional increases in the Cyp1A1 and Cyp1A2 gene follow the appearance of the nuclear dioxin-receptor. When TPA is administered together with TCDD, the ligand dependent accumulation of the nuclear dioxin-receptor is abolished. Similar results are observed if TPA is administered prior to treatment with TCDD. These results indicate that TPA inhibits TCDD induced activation of the Cyp1A genes through a receptor mediated mechanism.

  18. Riboswitches. Sequestration of a two-component response regulator by a riboswitch-regulated noncoding RNA.

    PubMed

    Mellin, J R; Koutero, Mikael; Dar, Daniel; Nahori, Marie-Anne; Sorek, Rotem; Cossart, Pascale

    2014-08-22

    Riboswitches are ligand-binding elements contained within the 5' untranslated regions of bacterial transcripts, which generally regulate expression of downstream open reading frames. Here, we show that in Listeria monocytogenes, a riboswitch that binds vitamin B12 controls expression of a noncoding regulatory RNA, Rli55. Rli55, in turn, controls expression of the eut genes, whose products enable ethanolamine utilization and require B12 as a cofactor. Defects in ethanolamine utilization, or in its regulation by Rli55, significantly attenuate Listeria virulence in mice. Rli55 functions by sequestering the two-component response regulator EutV by means of a EutV-binding site contained within the RNA. Thus, Rli55 is a riboswitch-regulated member of the small group of regulatory RNAs that function by sequestering a protein and reveals a distinctive mechanism of signal integration in bacterial gene regulation. PMID:25146292

  19. Long non-coding RNAs and cancer: a new frontier of translational research?

    PubMed Central

    Spizzo, R; Almeida, MI; Colombatti, A; Calin, GA

    2012-01-01

    Tiling array and novel sequencing technologies have made available the transcription profile of the entire human genome. However, the extent of transcription and the function of genetic elements that occur outside of protein-coding genes, particularly those involved in disease, are still a matter of debate. In this review, we focus on long non-coding RNAs (lncRNAs) that are involved in cancer. We define lncRNAs and present a cancer-oriented list of lncRNAs, list some tools (for example, public databases) that classify lncRNAs or that scan genome spans of interest to find whether known lncRNAs reside there, and describe some of the functions of lncRNAs and the possible genetic mechanisms that underlie lncRNA expression changes in cancer, as well as current and potential future applications of lncRNA research in the treatment of cancer. PMID:22266873

  20. Long noncoding RNAs in cancer: mechanisms of action and technological advancements.

    PubMed

    Bartonicek, Nenad; Maag, Jesper L V; Dinger, Marcel E

    2016-01-01

    The previous decade has seen long non-coding RNAs (lncRNAs) rise from obscurity to being defined as a category of genetic elements, leaving its mark on the field of cancer biology. With the current number of curated lncRNAs increasing by 10,000 in the last five years, the field is moving from annotation of lncRNA expression in various tumours to understanding their importance in the key cancer signalling networks and characteristic behaviours. Here, we summarize the previously identified as well as recently discovered mechanisms of lncRNA function and their roles in the hallmarks of cancer. Furthermore, we identify novel technologies for investigation of lncRNA properties and their function in carcinogenesis, which will be important for their translation to the clinic as novel biomarkers and therapeutic targets. PMID:27233618

  1. [DNA methylation in obesity].

    PubMed

    Pokrywka, Małgorzata; Kieć-Wilk, Beata; Polus, Anna; Wybrańska, Iwona

    2014-01-01

    The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes), have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA) synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described. PMID:25531701

  2. Noncoding RNA transcription targets AID to divergently transcribed loci in B cells

    PubMed Central

    Pefanis, Evangelos; Wang, Jiguang; Rothschild, Gerson; Lim, Junghyun; Chao, Jaime; Rabadan, Raul; Economides, Aris N.; Basu, Uttiya

    2015-01-01

    The vast majority of the mammalian genome has the potential to expressnoncoding RNA (ncRNA). The 11-subunit RNA exosome complex is the main source of cellular 3′–5′ exoribonucleolytic activity and potentially regulates the mammalian noncoding transcriptome1. Here we generated a mouse model in which the essential subunit Exosc3 of the RNA exosome complex can be conditionally deleted. Exosc3-deficient B cells lack the ability to undergo normal levels of class switch recombination and somatic hypermutation, two mutagenic DNA processes used to generate antibody diversity via the B-cell mutator protein activation-induced cytidine deaminase (AID)2,3. The transcriptome of Exosc3-deficient B cells has revealed the presence of many novel RNA exosome substrate ncRNAs. RNA exosome substrate RNAs include xTSS-RNAs, transcription start site (TSS)-associated antisense transcripts that can exceed 500 base pairs in length and are transcribed divergently from cognate coding gene transcripts. xTSS-RNAs are most strongly expressed at genes that accumulate AID-mediated somatic mutations and/or are frequent translocation partners of DNA double-strand breaks generated at Igh in B cells4,5. Strikingly, translocations near TSSs or within gene bodies occur over regions of RNA exosome substrate ncRNA expression. These RNA exosome-regulated, antisense-transcribed regions of the B-cell genome recruit AID and accumulate single-strand DNA structures containing RNA–DNA hybrids. We propose that RNA exosome regulation of ncRNA recruits AID to single-strand DNA-forming sites of antisense and divergent transcription in the B-cell genome, thereby creating a link between ncRNA transcription and overall maintenance of B-cell genomic integrity. PMID:25119026

  3. Functional analysis of the human annexin A5 gene promoter: a downstream DNA element and an upstream long terminal repeat regulate transcription.

    PubMed Central

    Carcedo, M T; Iglesias, J M; Bances, P; Morgan, R O; Fernandez, M P

    2001-01-01

    Human annexin A5 is a ubiquitous protein implicated in diverse signal transduction processes associated with cell growth and differentiation, and its gene regulation is an important component of this function. Promoter transcriptional activity was determined for a wide 5' portion of the human annexin A5 gene, from bp -1275 to +79 relative to the most 5' of several discrete transcription start points. Transfection experiments carried out in HeLa cells identified the segment from bp -202 to +79 as the minimal promoter conferring optimal transcriptional activity. Two canonical Sp1 sites in the immediate 5' flanking region of a CpG island were required for significant transcription. Strong repressive activity in the distal promoter region between bp -717 to -1153 was attributed to the presence of an endogenous retroviral long terminal repeat, homologous with long terminal repeat 47B. The downstream sequence from bp position +31 to +79 in untranslated exon 1 was also essential for transcription, as its deletion from any of the plasmid constructs abolished activity in transfection assays. Electrophoretic mobility-shift assays, Southwestern-blot analysis and affinity chromatography were used to identify a protein doublet of relative molecular mass 35 kDa that bound an octanucleotide palindromic sequence in exon 1. The DNA cis-element resembled an E-box, but did not bind higher molecular mass transcription factors, such as upstream stimulatory factor or activator protein 4. The discovery of a downstream element crucial for annexin A5 gene transcription, and its interaction with a potentially novel transcription factor or complex, may provide a clue to understanding the initiation of transcription by TATA-less, multiple start site promoters. PMID:11368787

  4. Identification of a large noncoding RNA in extremophilic eubacteria

    PubMed Central

    Puerta-Fernandez, Elena; Barrick, Jeffrey E.; Roth, Adam; Breaker, Ronald R.

    2006-01-01

    We have discovered a large and highly conserved RNA motif that typically resides in a noncoding section of a multigene messenger RNA in extremophilic Gram-positive eubacteria. RNAs of this class adopt an ornate secondary structure, are large compared with most other noncoding RNAs, and have been identified only in certain extremophilic bacteria. These ornate, large, extremophilic (OLE) RNAs have a length of ≈610 nucleotides, and the 35 representatives examined exhibit extraordinary conservation of nucleotide sequence and base pairing. Structural probing of the OLE RNA from Bacillus halodurans corroborates a complex secondary structure model predicted from comparative sequence analysis. The patterns of structural conservation, and its unique phylogenetic distribution, suggest that OLE RNA carries out a complex and critical function only in certain extremophilic bacteria. PMID:17164334

  5. Circulating long noncoding RNAs as novel biomarkers of human diseases.

    PubMed

    Jiang, Xiaoying; Lei, Ronghui; Ning, Qilan

    2016-07-01

    Long noncoding RNAs (lncRNAs) are a kind of noncoding RNAs which are longer than ˜200 nucleotides, lacking of protein-encoding capacity and are implicated in the pathogenesis of various diseases. Recently, it was demonstrated that lncRNAs could be released into the circulation and be stable in blood. Circulating lncRNAs have been reported to have potential in distinguishing patients from healthy individuals. Therefore, the detection of circulating lncRNAs may be valuable for improving the diagnosis and prognosis of various diseases. This review summarized the current understanding of circulating lncRNAs as novel biomarkers of various human diseases, such as cancer, cardiovascular diseases, nervous system diseases and other diseases, which highlighted the significance of circulating lncRNAs as novel diagnostic and prognostic biomarkers of human diseases. PMID:27347748

  6. Structure and Gene-Silencing Mechanisms of Small Noncoding RNAs

    NASA Astrophysics Data System (ADS)

    Chu, Chia-Ying; Rana, Tariq M.

    Small (19-31-nucleotides) noncoding RNAs were identified in the past 10 years for their distinct function in gene silencing. The best known gene-silencing phenomenon, RNA interference (RNAi), is triggered in a sequence-specific manner by endogenously produced or exogenously introduced small doubled-stranded RNAs. As knowledge of the structure and function of the RNAi machinery has expanded, this phenomenon has become a powerful tool for biochemical research; it has enormous potential for therapeutics. This chapter summarizes significant aspects of three major classes of small noncoding, regulatory RNAs: small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). Here, we focus on the biogenesis of these small RNAs, their structural features and coupled effectors as well as the mechanisms of each small regulatory RNA pathway which reveal fascinating ways by which gene silencing is controlled and fine-tuned at an epigenetic level.

  7. Long non-coding RNAs and hepatocellular carcinoma

    PubMed Central

    YU, FU-JUN; ZHENG, JIAN-JIAN; DONG, PEI-HONG; FAN, XIAO-MING

    2015-01-01

    Recent advances in next-generation sequencing technology in transcriptome analysis have helped identify numerous non-coding RNAs. The long non-coding RNA (lncRNA) is commonly defined as an RNA molecule with a length of 200 bp-100 kbp that lacks protein-coding potential. LncRNAs play a critical role in the regulation of gene expression, including chromatin modification, transcription and post-transcriptional processing. It has been confirmed that dysregulation of lncRNAs is associated with a number of human diseases, particularly tumors. In this study, we focused on the most extensively investigated lncRNAs in hepatocellular carcinoma (HCC). The biological functions and molecular mechanisms of the majority of lncRNAs have yet to be investigated. The improved knowledge on lncRNAs in HCC may help identify lncRNAs that may be used as novel prognostic markers and therapeutic targets. PMID:25469263

  8. Sequence and structure-specific elements of HERG mRNA determine channel synthesis and trafficking efficiency

    PubMed Central

    Sroubek, Jakub; Krishnan, Yamini; McDonald, Thomas V.

    2013-01-01

    Human ether-á-gogo-related gene (HERG) encodes a potassium channel that is highly susceptible to deleterious mutations resulting in susceptibility to fatal cardiac arrhythmias. Most mutations adversely affect HERG channel assembly and trafficking. Why the channel is so vulnerable to missense mutations is not well understood. Since nothing is known of how mRNA structural elements factor in channel processing, we synthesized a codon-modified HERG cDNA (HERG-CM) where the codons were synonymously changed to reduce GC content, secondary structure, and rare codon usage. HERG-CM produced typical IKr-like currents; however, channel synthesis and processing were markedly different. Translation efficiency was reduced for HERG-CM, as determined by heterologous expression, in vitro translation, and polysomal profiling. Trafficking efficiency to the cell surface was greatly enhanced, as assayed by immunofluorescence, subcellular fractionation, and surface labeling. Chimeras of HERG-NT/CM indicated that trafficking efficiency was largely dependent on 5′ sequences, while translation efficiency involved multiple areas. These results suggest that HERG translation and trafficking rates are independently governed by noncoding information in various regions of the mRNA molecule. Noncoding information embedded within the mRNA may play a role in the pathogenesis of hereditary arrhythmia syndromes and could provide an avenue for targeted therapeutics.—Sroubek, J., Krishnan, Y., McDonald, T V. Sequence- and structure-specific elements of HERG mRNA determine channel synthesis and trafficking efficiency. PMID:23608144

  9. Functional annotation of non-coding sequence variants

    PubMed Central

    Ritchie, Graham R. S.; Dunham, Ian; Zeggini, Eleftheria; Flicek, Paul

    2016-01-01

    Identifying functionally relevant variants against the background of ubiquitous genetic variation is a major challenge in human genetics. For variants that fall in protein-coding regions our understanding of the genetic code and splicing allow us to identify likely candidates, but interpreting variants that fall outside of genic regions is more difficult. Here we present a new tool, GWAVA, which supports prioritisation of non-coding variants by integrating a range of annotations. PMID:24487584

  10. Oncogenic long noncoding RNA FAL1 in human cancer

    PubMed Central

    Zhong, Xiaomin; Hu, Xiaowen; Zhang, Lin

    2015-01-01

    Long non-coding RNAs (lncRNAs) are defined as RNA transcripts larger than 200 nucleotides that do not appear to have protein-coding potential. Accumulating evidence indicates that lncRNAs are involved in tumorigenesis. Our work reveals that lncRNA FAL1 (focally amplified lncRNA on chromosome 1) is frequently and focally amplified in human cancers and mediates oncogenic functions. PMID:27308441

  11. Transcription control by long non-coding RNAs

    PubMed Central

    Faust, Tyler

    2012-01-01

    Non-coding RNAs have been found to regulate many cellular processes and thus expand the functional genetic repertoire contained within the genome. With the recent advent of genomic tools, it is now evident that these RNA molecules play central regulatory roles in many transcriptional programs. Here we discuss how they are targeted to promoters in several cases and how they operate at specific points in the transcription cycle to precisely control gene expression. PMID:22414755

  12. Dysregulation of non-coding RNAs in gastric cancer

    PubMed Central

    Yang, Qing; Zhang, Ren-Wen; Sui, Peng-Cheng; He, Hai-Tao; Ding, Lei

    2015-01-01

    Gastric cancer (GC) is one of the most common cancers in the world and a significant threat to the health of patients, especially those from China and Japan. The prognosis for patients with late stage GC receiving the standard of care treatment, including surgery, chemotherapy and radiotherapy, remains poor. Developing novel treatment strategies, identifying new molecules for targeted therapy, and devising screening techniques to detect this cancer in its early stages are needed for GC patients. The discovery of non-coding RNAs (ncRNAs), primarily microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), helped to elucidate the mechanisms of tumorigenesis, diagnosis and treatment of GC. Recently, significant research has been conducted on non-coding RNAs and how the regulatory dysfunction of these RNAs impacts the tumorigenesis of GC. In this study, we review papers published in the last five years concerning the dysregulation of non-coding RNAs, especially miRNAs and lncRNAs, in GC. We summarize instances of aberrant expression of the ncRNAs in GC and their effect on survival-related events, including cell cycle regulation, AKT signaling, apoptosis and drug resistance. Additionally, we evaluate how ncRNA dysregulation affects the metastatic process, including the epithelial-mesenchymal transition, stem cells, transcription factor activity, and oncogene and tumor suppressor expression. Lastly, we determine how ncRNAs affect angiogenesis in the microenvironment of GC. We further discuss the use of ncRNAs as potential biomarkers for use in clinical screening, early diagnosis and prognosis of GC. At present, no ideal ncRNAs have been identified as targets for the treatment of GC. PMID:26494954

  13. Right ventricular long noncoding RNA expression in human heart failure

    PubMed Central

    Guo, Yan; Su, Yan Ru; Clark, Travis; Brittain, Evan; Absi, Tarek; Maltais, Simon; Hemnes, Anna

    2015-01-01

    Abstract The expression of long noncoding RNAs (lncRNAs) in human heart failure (HF) has not been widely studied. Using RNA sequencing (RNA-Seq), we compared lncRNA expression in 22 explanted human HF hearts with lncRNA expression in 5 unused donor human hearts. We used Cufflinks to identify isoforms and DESeq to identify differentially expressed genes. We identified the noncoding RNAs by cross-reference to Ensembl release 73 (Genome Reference Consortium human genome build 37) and explored possible functional roles using a variety of online tools. In HF hearts, RNA-Seq identified 84,793 total messenger RNA coding and noncoding different transcripts, including 13,019 protein-coding genes, 2,085 total lncRNA genes, and 1,064 pseudogenes. By Ensembl noncoding RNA categories, there were 48 lncRNAs, 27 pseudogenes, and 30 antisense RNAs for a total of 105 differentially expressed lncRNAs in HF hearts. Compared with donor hearts, HF hearts exhibited differential expression of 7.7% of protein-coding genes, 3.7% of lncRNAs (including pseudogenes), and 2.5% of pseudogenes. There were not consistent correlations between antisense lncRNAs and parent genes and between pseudogenes and parent genes, implying differential regulation of expression. Exploratory in silico functional analyses using online tools suggested a variety of possible lncRNA regulatory roles. By providing a comprehensive profile of right ventricular polyadenylated messenger RNA transcriptome in HF, RNA-Seq provides an inventory of differentially expressed lncRNAs, including antisense transcripts and pseudogenes, for future mechanistic study. PMID:25992278

  14. A new avenue for obtaining insight into the functional characteristics of long noncoding RNAs associated with estrogen receptor signaling

    PubMed Central

    Wu, Liangcai; Xu, Qianqian; Zhang, Haohai; Li, Ming; Zhu, Chengpei; Jiang, Minjie; Sang, Xinting; Zhao, Yi; Sun, Qiang; Zhao, Haitao

    2016-01-01

    Estrogen receptor signalling plays important regulatory roles in multiple mammalian physiological processes. Dysregulation of estrogen receptor (ER) expression and/or its associated signalling pathway is strongly associated with the development, progression, transition, and endocrine-resistance of breast cancer. Non-coding transcripts are essential regulators of almost every level of gene regulation. However, few long non-coding transcripts (lncRNAs) associated with the estrogen receptor signalling pathway have been well-described. We used array-based methods to identify 33 estrogen receptor agitation-related (ERAR) lncRNAs. A coding–non-coding gene co-expression network analysis suggested that 15 ERAR lncRNAs were associated with mitosis, DNA damage, and DNA repair. Kaplan–Meier analysis indicated that five ERAR lncRNAs selected using the Random Forest-Recursive Feature Elimination algorithm were significantly correlated with endocrine resistance-free survival and distant metastasis-free survival as well as disease free survival. Our results suggest that ERAR lncRNAs may serve as novel biomarkers for guiding breast cancer treatment and prognosis. Furthermore, our findings reveal a new avenue by which estrogen receptor signalling can be further explored. PMID:27539025

  15. Noncoding RNAs as regulators of cardiomyocyte proliferation and death.

    PubMed

    Piccoli, Maria-Teresa; Gupta, Shashi Kumar; Thum, Thomas

    2015-12-01

    Cardiovascular diseases are currently the main cause of morbidity and mortality worldwide. Ischemic heart disease, in particular, is responsible for the majority of cardiac-related deaths. Given the negligible regenerative potential of the human myocardium, there is a strong need for therapeutic strategies aiming at enhancing cardiomyocyte survival and proliferation following injury or at inhibiting their death. MicroRNAs (miRNAs) are small non-coding RNA molecules regulating gene expression at a post-transcriptional level with important functions in cardiovascular physiology and disease. It has been demonstrated that miRNAs can influence the ability of cardiomyocytes to enter the cell cycle and/or escape from death pathways. Additionally, long non coding-RNAs could be involved in such pathways. This review summarizes recent evidences on noncoding RNAs regulating proliferation and death of cardiomyocytes representing a future therapeutic for the treatment of heart diseases. This article is part of a Special Issue entitled SI: Non-coding RNAs. PMID:25665459

  16. Dissecting noncoding and pathogen RNA–protein interactomes

    PubMed Central

    Flynn, Ryan A.; Martin, Lance; Spitale, Robert C.; Do, Brian T.; Sagan, Selena M.; Zarnegar, Brian; Qu, Kun; Khavari, Paul A.; Quake, Stephen R.; Sarnow, Peter

    2015-01-01

    RNA–protein interactions are central to biological regulation. Cross-linking immunoprecipitation (CLIP)-seq is a powerful tool for genome-wide interrogation of RNA–protein interactomes, but current CLIP methods are limited by challenging biochemical steps and fail to detect many classes of noncoding and nonhuman RNAs. Here we present FAST-iCLIP, an integrated pipeline with improved CLIP biochemistry and an automated informatic pipeline for comprehensive analysis across protein coding, noncoding, repetitive, retroviral, and nonhuman transcriptomes. FAST-iCLIP of Poly-C binding protein 2 (PCBP2) showed that PCBP2-bound CU-rich motifs in different topologies to recognize mRNAs and noncoding RNAs with distinct biological functions. FAST-iCLIP of PCBP2 in hepatitis C virus-infected cells enabled a joint analysis of the PCBP2 interactome with host and viral RNAs and their interplay. These results show that FAST-iCLIP can be used to rapidly discover and decipher mechanisms of RNA–protein recognition across the diversity of human and pathogen RNAs. PMID:25411354

  17. Long noncoding RNAs in aging and age-related diseases.

    PubMed

    Kour, Sukhleen; Rath, Pramod C

    2016-03-01

    Aging is the universal, intrinsic, genetically-controlled, evolutionarily-conserved and time-dependent intricate biological process characterised by the cumulative decline in the physiological functions and their coordination in an organism after the attainment of adulthood resulting in the imbalance of neurological, immunological and metabolic functions of the body. Various biological processes and mechanisms along with altered levels of mRNAs and proteins have been reported to be involved in the progression of aging. It is one of the major risk factors in the patho-physiology of various diseases and disorders. Recently, the discovery of pervasive transcription of a vast pool of heterogeneous regulatory noncoding RNAs (ncRNAs), including small ncRNAs (sncRNAs) and long ncRNAs (lncRNAs), in the mammalian genome have provided an alternative way to study and explore the missing links in the aging process, its mechanism(s) and related diseases in a whole new dimension. The involvement of small noncoding RNAs in aging and age-related diseases have been extensively studied and recently reviewed. However, lncRNAs, whose function is far less explored in relation to aging, have emerged as a class of major regulators of genomic functions. Here, we have described some examples of known as well as novel lncRNAs that have been implicated in the progression of the aging process and age-related diseases. This may further stimulate research on noncoding RNAs and the aging process. PMID:26655093

  18. The Landscape of long non-coding RNA classification

    PubMed Central

    St Laurent, Georges; Wahlestedt, Claes; Kapranov, Philipp

    2015-01-01

    Advances in the depth and quality of transcriptome sequencing have revealed many new classes of long non-coding RNAs (lncRNAs). lncRNA classification has mushroomed to accommodate these new findings, even though the real dimensions and complexity of the non-coding transcriptome remain unknown. Although evidence of functionality of specific lncRNAs continues to accumulate, conflicting, confusing, and overlapping terminology has fostered ambiguity and lack of clarity in the field in general. The lack of fundamental conceptual un-ambiguous classification framework results in a number of challenges in the annotation and interpretation of non-coding transcriptome data. It also might undermine integration of the new genomic methods and datasets in an effort to unravel function of lncRNA. Here, we review existing lncRNA classifications, nomenclature, and terminology. Then we describe the conceptual guidelines that have emerged for their classification and functional annotation based on expanding and more comprehensive use of large systems biology-based datasets. PMID:25869999

  19. The tumour hypoxia induced non-coding transcriptome.

    PubMed

    Choudhry, Hani; Harris, Adrian L; McIntyre, Alan

    2016-01-01

    Recent investigations have highlighted the importance of the non-coding genome in regions of hypoxia in tumours. Such regions are frequently found in solid tumours, and are associated with worse patient survival and therapy resistance. Hypoxia stabilises the transcription factors, hypoxia inducible factors (HIF1α and HIF2α) which coordinate transcriptomic changes that occur in hypoxia. The changes in gene expression induced by HIF1α and HIF2α contribute to many of the hallmarks of cancer phenotypes and enable tumour growth, survival and invasion in the hypoxic tumour microenvironment. Non-coding RNAs, in particular microRNAs (miRNAs), which regulate mRNA stability and translation, and long-non-coding RNAs (lncRNAs), which have diverse functions including chromatin modification and transcriptional regulation, are also important in enabling the key hypoxia regulated processes. They have roles in the regulation of metabolism, angiogenesis, autophagy, invasion and metastasis in the hypoxic microenvironment. Furthermore, HIF1α and HIF2α expression and stabilisation are also regulated by both miRNAs and lncRNAs. Here we review the recent developments in the expression, regulation and functions of miRNAs, lncRNAs and other non-coding RNA classes in tumour hypoxia. PMID:26806607

  20. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements

    PubMed Central

    Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K.

    2015-01-01

    Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for

  1. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.

    PubMed

    Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K

    2015-07-01

    Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for

  2. Identification of a long non-coding RNA gene, growth hormone secretagogue receptor opposite strand, which stimulates cell migration in non-small cell lung cancer cell lines.

    PubMed

    Whiteside, Eliza J; Seim, Inge; Pauli, Jana P; O'Keeffe, Angela J; Thomas, Patrick B; Carter, Shea L; Walpole, Carina M; Fung, Jenny N T; Josh, Peter; Herington, Adrian C; Chopin, Lisa K

    2013-08-01

    The molecular mechanisms involved in non‑small cell lung cancer tumourigenesis are largely unknown; however, recent studies have suggested that long non-coding RNAs (lncRNAs) are likely to play a role. In this study, we used public databases to identify an mRNA-like, candidate long non-coding RNA, GHSROS (GHSR opposite strand), transcribed from the antisense strand of the ghrelin receptor gene, growth hormone secretagogue receptor (GHSR). Quantitative real-time RT-PCR revealed higher expression of GHSROS in lung cancer tissue compared to adjacent, non-tumour lung tissue. In common with many long non-coding RNAs, GHSROS is 5' capped and 3' polyadenylated (mRNA-like), lacks an extensive open reading frame and harbours a transposable element. Engineered overexpression of GHSROS stimulated cell migration in the A549 and NCI-H1299 non-small cell lung cancer cell lines, but suppressed cell migration in the Beas-2B normal lung-derived bronchoepithelial cell line. This suggests that GHSROS function may be dependent on the oncogenic context. The identification of GHSROS, which is expressed in lung cancer and stimulates cell migration in lung cancer cell lines, contributes to the growing number of non-coding RNAs that play a role in the regulation of tumourigenesis and metastatic cancer progression. PMID:23722988

  3. Detecting conserved regulatory elements with the model genome of the Japanese puffer fish, Fugu rubripes.

    PubMed Central

    Aparicio, S; Morrison, A; Gould, A; Gilthorpe, J; Chaudhuri, C; Rigby, P; Krumlauf, R; Brenner, S

    1995-01-01

    Comparative vertebrate genome sequencing offers a powerful method for detecting conserved regulatory sequences. We propose that the compact genome of the teleost Fugu rubripes is well suited for this purpose. The evolutionary distance of teleosts from other vertebrates offers the maximum stringency for such evolutionary comparisons. To illustrate the comparative genome approach for F. rubripes, we use sequence comparisons between mouse and Fugu Hoxb-4 noncoding regions to identify conserved sequence blocks. We have used two approaches to test the function of these conserved blocks. In the first, homologous sequences were deleted from a mouse enhancer, resulting in a tissue-specific loss of activity when assayed in transgenic mice. In the second approach, Fugu DNA sequences showing homology to mouse sequences were tested for enhancer activity in transgenic mice. This strategy identified a neural element that mediates a subset of Hoxb-4 expression that is conserved between mammals and teleosts. The comparison of noncoding vertebrate sequences with those of Fugu, coupled to a transgenic bioassay, represents a general approach suitable for many genome projects. Images Fig. 2 Fig. 3 Fig. 4 PMID:7878040

  4. Response of the bacteriophage T4 replisome to non-coding lesions and regression of a stalled replication fork

    PubMed Central

    Nelson, Scott W.; Benkovic, Stephen J.

    2010-01-01

    DNA is constantly damaged by endogenous and exogenous agents. The resulting DNA lesions have the potential to halt the progression of the replisome, possibly leading to replication fork collapse. Here, we examine the effect of a non-coding DNA lesion in either the leading or lagging strand template on the bacteriophage T4 replisome. A damaged base in the lagging strand template does not affect the progression of the replication fork. Instead, the stalled lagging strand polymerase recycles from the lesion and initiates synthesis of the new Okazaki fragment upstream from the damaged base. In contrast, when the replisome encounters a blocking lesion in the leading strand template, the replication fork only travels approximately 1 kb beyond the point of the DNA lesion before complete replication fork collapse. The primosome and lagging strand polymerase remain active during this period and an Okazaki fragment is synthesized beyond the point of the leading strand lesion. There is no evidence for a new priming event on the leading strand template. Instead, the DNA structure that is produced by the stalled replication fork is a substrate for the DNA repair helicase, UvsW. UvsW catalyzes the regression of a stalled replication fork into a “chicken foot” structure that has been postulated to be an intermediate in an error-free lesion bypass pathway. PMID:20600127

  5. New Perspectives on DNA and RNA Triplexes As Effectors of Biological Activity

    PubMed Central

    Bacolla, Albino; Wang, Guliang; Vasquez, Karen M.

    2015-01-01

    Since the first description of the canonical B-form DNA double helix, it has been suggested that alternative DNA, DNA–RNA, and RNA structures exist and act as functional genomic elements. Indeed, over the past few years it has become clear that, in addition to serving as a repository for genetic information, genomic DNA elicits biological responses by adopting conformations that differ from the canonical right-handed double helix, and by interacting with RNA molecules to form complex secondary structures. This review focuses on recent advances on three-stranded (triplex) nucleic acids, with an emphasis on DNA–RNA and RNA–RNA interactions. Emerging work reveals that triplex interactions between noncoding RNAs and duplex DNA serve as platforms for delivering site-specific epigenetic marks critical for the regulation of gene expression. Additionally, an increasing body of genetic and structural studies demonstrates that triplex RNA–RNA interactions are essential for performing catalytic and regulatory functions in cellular nucleoprotein complexes, including spliceosomes and telomerases, and for enabling protein recoding during programmed ribosomal frameshifting. Thus, evidence is mounting that DNA and RNA triplex interactions are implemented to perform a range of diverse biological activities in the cell, some of which will be discussed in this review. PMID:26700634

  6. A λ Cro-Like Repressor Is Essential for the Induction of Conjugative Transfer of SXT/R391 Elements in Response to DNA Damage

    PubMed Central

    Poulin-Laprade, Dominic

    2015-01-01

    ABSTRACT Integrative and conjugative elements (ICEs) of the SXT/R391 family are the main contributors to acquired multidrug resistance in the seventh pandemic lineage of Vibrio cholerae, the etiological agent of the diarrheal disease cholera. Conjugative transfer of SXT/R391 ICEs is triggered by antibiotics and agents promoting DNA damage through RecA-dependent autoproteolysis of SetR, an ICE-encoded λ CI-like repressor. Here, we describe the role of CroS, a distant λ Cro homolog, as a key component contributing to the regulation of expression of the activator SetCD that orchestrates the expression of the conjugative transfer genes. We show that deletion of croS abolishes the SOS response-dependent induction of SXT despite the presence of a functional setR gene. Using quantitative reverse transcription-PCR and lacZ reporter assays, we also show that CroS represses setR and setCD expression by binding to operator sites shared with SetR. Furthermore, we provide evidence of an additional operator site bound by SetR and CroS. Finally, we show that SetCD expression generates a positive feedback loop due to SXT excision and replication in a fraction of the cell population. Together, these results refine our understanding of the genetic regulation governing the propagation of major vectors of multidrug resistance. IMPORTANCE Healthcare systems worldwide are challenged by an alarming drug resistance crisis caused by the massive and rapid propagation of antibiotic resistance genes and the associated emergence of multidrug-resistant pathogenic bacteria. SXT/R391 ICEs contribute to this phenomenon not only in clinical and environmental vibrios but also in several members of the family Enterobacteriaceae. We have identified and characterized here the regulator CroS as a key factor in the stimulation of conjugative transfer of these ICEs in response to DNA-damaging agents. We have also untangled conflicting evidence regarding autoactivation of transfer by the master activator

  7. Prohead RNA: a noncoding viral RNA of novel structure and function.

    PubMed

    Hill, Alyssa C; Bartley, Laura E; Schroeder, Susan J

    2016-07-01

    Prohead RNA (pRNA) is an essential component of the powerful Φ29-like bacteriophage DNA packaging motor. However, the specific role of this unique RNA in the Φ29 packaging motor remains unknown. This review examines pRNA as a noncoding RNA of novel structure and function. In order to highlight the reasons for exploring the structure and function of pRNA, we (1) provide an overview of Φ