Science.gov

Sample records for nosocomial acinetobacter baumannii

  1. Epidemiological Monitoring of Nosocomial Infections Caused by Acinetobacter Baumannii

    PubMed Central

    Custovic, Amer; Smajlovic, Jasmina; Tihic, Nijaz; Hadzic, Sadeta; Ahmetagic, Sead; Hadzagic, Haris

    2014-01-01

    Introduction: Acinetobacter baumannii is a frequent cause of infections in hospitals around the world, which is very difficult to control and treat. It is particularly prevalent in intensive care wards. Aim: The main objective of the research was to establish the application of epidemiological monitoring of nosocomial infections (NIs) caused by A. baumannii in order to determine: the type and distribution of NIs, and to investigate antimicrobial drug resistance of A. baumannii. Material and Methods: 855 patients treated at the Clinic of Anesthesiology and Reanimation, University Clinical Center Tuzla during 2013 were followed prospectively for the development of NIs. Infections caused by A. baumannii were characterized by the anatomical site and antibiotics resistance profile. Results: NIs were registered in 105 patients (12.3%; 855/105). The predominant cause of infection was A. baumannii with an incidence of 51.4% (54/105), followed by ESBL-producing Klebsiella pneumoniae with 15.2% (16/105) of cases, methicillin-resistant Staphylococcus aureus with 8.6% (9/105), and ESBL-producing Proteus mirabilis with 7.6% (8/105). According to the anatomical site, and type of NIs caused by A. baumannii, the most frequent were respiratory infections (74.1%; 40/54). Infections of surgical sites were registered in 11.1% (6/54) of cases, while bloodstream infections in 9.2% (5/54). A. baumannii isolates tested resistant against most antibiotics examined, but showed a high degree of susceptibility to tobramycin (87%; 47/54) and colistin (100%; 54/54). Conclusion: The increasing incidence of multi- and extensively drug-resistant Acinetobacter spp. emphasizes the importance of administration of an adequate antibiotic strategy and the implementation of strict monitoring of the measures for controlling nosocomial infections. PMID:25648217

  2. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity.

    PubMed

    Richards, A M; Abu Kwaik, Y; Lamont, R J

    2015-02-01

    Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of 'Iraqibacter'. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. PMID:25052812

  3. Acinetobacter baumannii

    PubMed Central

    Howard, Aoife; O’Donoghue, Michael; Feeney, Audrey; Sleator, Roy D.

    2012-01-01

    Acinetobacter baumannii is an opportunistic bacterial pathogen primarily associated with hospital-acquired infections. The recent increase in incidence, largely associated with infected combat troops returning from conflict zones, coupled with a dramatic increase in the incidence of multidrug-resistant (MDR) strains, has significantly raised the profile of this emerging opportunistic pathogen. Herein, we provide an overview of the pathogen, discuss some of the major factors that have led to its clinical prominence and outline some of the novel therapeutic strategies currently in development. PMID:22546906

  4. Whole-Genome Sequencing Elucidates Epidemiology of Nosocomial Clusters of Acinetobacter baumannii.

    PubMed

    Willems, Stefanie; Kampmeier, Stefanie; Bletz, Stefan; Kossow, Annelene; Köck, Robin; Kipp, Frank; Mellmann, Alexander

    2016-09-01

    We characterized two epidemiologically similar Acinetobacter baumannii clusters from two separate intensive care units (ICU) using core genome multilocus sequence typing. Clonal spread was confirmed in ICU-1 (12 of 14 isolates shared genotypes); in ICU-2, all genotypes (13 isolates) were diverse, thus excluding transmissions and enabling adequate infection control measures. PMID:27358465

  5. Clonal Diversity of Nosocomial Epidemic Acinetobacter baumannii Strains Isolated in Spain▿

    PubMed Central

    Villalón, Pilar; Valdezate, Sylvia; Medina-Pascual, Maria J.; Rubio, Virginia; Vindel, Ana; Saez-Nieto, Juan A.

    2011-01-01

    Acinetobacter baumannii is one of the major pathogens involved in nosocomial outbreaks. The clonal diversity of 729 epidemic strains isolated from 19 Spanish hospitals (mainly from intensive care units) was analyzed over an 11-year period. Pulsed-field gel electrophoresis (PFGE) identified 58 PFGE types that were subjected to susceptibility testing, rpoB gene sequencing, and multilocus sequence typing (MLST). All PFGE types were multidrug resistant; colistin was the only agent to which all pathogens were susceptible. The 58 PFGE types were grouped into 16 clones based on their genetic similarity (cutoff of 80%). These clones were distributed into one major cluster (cluster D), three medium clusters (clusters A, B, and C), and three minor clusters (clusters E, F, and G). The rpoB gene sequencing and MLST results reflected a clonal distribution, in agreement with the PFGE results. The MLST sequence types (STs) (and their percent distributions) were as follows: ST-2 (47.5%), ST-3 (5.1%), ST-15 (1.7%), ST-32 (1.7%), ST-79 (13.6%), ST-80 (20.3%), and ST-81 (10.2%). ST-79, ST-80, and ST-81 and the alleles cpn60-26 and recA29 are described for the first time. International clones I, II, and III were represented by ST-81, ST-2, and ST-3, respectively. ST-79 and ST-80 could be novel emerging clones. This work confirms PFGE and MLST to be complementary tools in clonality studies. Here PFGE was able to demonstrate the monoclonal pattern of most outbreaks, the inter- and intrahospital transmission of bacteria, and their endemic persistence in some wards. MLST allowed the temporal evolution and spatial distribution of Spanish clones to be monitored and permitted international comparisons to be made. PMID:21177889

  6. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen

    PubMed Central

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica

    2016-01-01

    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control. PMID:26966582

  7. Nosocomial Outbreak of Carbapenem-Resistant Acinetobacter baumannii in Intensive Care Units and Successful Outbreak Control Program

    PubMed Central

    Choi, Won Suk; Kim, Su Hyun; Jeon, Eun Gyong; Son, Myeung Hee; Yoon, Young Kyung; Kim, Jung-Yeon; Kim, Mi Jeong; Sohn, Jang Wook; Kim, Min Ja

    2010-01-01

    Acinetobacter baumannii has been increasingly reported as a significant causative organism of various nosocomial infections. Here we describe an outbreak of carbapenem-resistant A. baumannii (CRAB) in the ICUs of a Korean university hospital, along with a successful outbreak control program. From October 2007 through July 2008, CRAB was isolated from 57 ICU patients. Nineteen patients were diagnosed as being truly infected with CRAB, four of whom were presumed to have died due to CRAB infection, producing a case-fatality rate of 21.1%. In surveillance of the environment and the healthcare workers (HCWs), CRAB was isolated from 24 (17.9%) of 135 environmental samples and seven (10.9%) of 65 HCWs. The pulsed field gel electrophoresis patterns showed that the isolates from patients, HCWs, and the environment were genetically related. Control of the outbreak was achieved by enforcing contact precautions, reducing environmental contamination through massive cleaning, and use of a closed-suctioning system. By August 2008 there were no new cases of CRAB in the ICUs. This study shows that the extensive spread of CRAB can happen through HCWs and the environmental contamination, and that proper strategies including strict contact precautions, massive environmental decontamination, and a closed-suctioning system can be effective for controlling CRAB outbreaks. PMID:20592889

  8. Resistance Markers and Genetic Diversity in Acinetobacter baumannii Strains Recovered from Nosocomial Bloodstream Infections

    PubMed Central

    Martins, Hanoch S. I.; Bomfim, Maria Rosa Q.; França, Rafaela O.; Farias, Luiz M.; Carvalho, Maria Auxiliadora R.; Serufo, José Carlos; Santos, Simone G.

    2014-01-01

    In this study, phenotypic and genotypic methods were used to detect metallo-β-lactamases, cephalosporinases and oxacillinases and to assess genetic diversity among 64 multiresistant Acinetobacter baumannii strains recovered from blood cultures in five different hospitals in Brazil from December 2008 to June 2009. High rates of resistance to imipenem (93.75%) and polymyxin B (39.06%) were observed using the disk diffusion (DD) method and by determining the minimum inhibitory concentration (MIC). Using the disk approximation method, thirty-nine strains (60.9%) were phenotypically positive for class D enzymes, and 51 strains (79.6%) were positive for cephalosporinase (AmpC). Using the E-test, 60 strains (93.75%) were positive for metallo-β-lactamases (MβLs). All strains were positive for at least one of the 10 studied genes; 59 (92.1%) contained blaVIM-1, 79.6% contained blaAmpC, 93.7% contained blaOXA23 and 84.3% contained blaOXA51. Enterobacteria Repetitive Intergenic Consensus (ERIC)-PCR analysis revealed a predominance of certain clones that differed from each other. However, the same band pattern was observed in samples from the different hospitals studied, demonstrating correlation between the genotypic and phenotypic results. Thus, ERIC-PCR is an appropriate method for rapidly clustering genetically related isolates. These results suggest that defined clonal clusters are circulating within the studied hospitals. These results also show that the prevalence of MDR A. baumannii may vary among clones disseminated in specific hospitals, and they emphasize the importance of adhering to appropriate infection control measures. PMID:24477210

  9. Nosocomial Infection by Sequence Type 357 Multidrug-Resistant Acinetobacter baumannii Isolates in a Neonatal Intensive Care Unit in Daejeon, Korea

    PubMed Central

    Sung, Ji Youn; Cho, Hye Hyun; Kwon, Kye Chul

    2013-01-01

    Acinetobacter baumannii is an important microorganism responsible for a number of nosocomial outbreaks, in particular, in intensive care units (ICUs). We investigated a nosocomial infection caused by multidrug-resistant (MDR) A. baumannii in a neonatal intensive care unit (NICU) in Korea. A. baumannii isolates were characterized using Etest (AB Biodisk, Sweden), two multiplex PCR assays, and multilocus sequence typing (MLST) scheme. PCR and PCR mapping experiments were performed for detecting and characterizing the determinants of antimicrobial resistance. Eight strains isolated from an NICU belonged to European (EU) clone II and revealed only one sequence type (ST), namely, ST357. All the isolates were susceptible to imipenem but were resistant to amikacin, gentamicin, ceftazidime, cefepime, and ciprofloxacin. To the best of our knowledge, this is the first report of a nosocomial infection in an NICU in Korea caused by ST357 MDR/carbapenem-susceptible A. baumannii strains. This result demonstrates that nosocomial outbreaks of MDR/carbapenem-susceptible strains as well as MDR/carbapenem-resistant isolates may occur in NICUs. PMID:23826565

  10. Characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex isolates from nosocomial bloodstream infections in southern Iran.

    PubMed

    Pourabbas, Bahman; Firouzi, Roya; Pouladfar, Gholamreza

    2016-03-01

    Acinetobacter baumannii is an important opportunistic bacterial pathogen responsible for serious infections in hospitalized patients. From a total of 78 consecutive non-repetitive Acinetobacter spp. isolates from patients with blood infections, 61 were carbapenem resistant, which were positive for blaOXA-51-like (96.7%), blaOXA-23-like (77 %), blaOXA-58-like (8.1%) and blaOXA-40-like genes (32.8%) by multiplex PCR. The isolates were identified as A. baumannii (n = 59) and Acinetobacter nosocomialis (n = 2). Also, we found a case of Acinetobacter junii, causing bacteraemia, that possessed the IMP gene. High levels of resistance were observed to fluoroquinolones, aminoglycosides, tigecycline and to the beta-lactam antibiotics, including piperacillin/tazobactam and ampicillin/sulbactam. ISAba1 was present in 96.7% of all Acinetobacter calcoaceticus-baumannii complex (Acb) isolates. Also, 33 (54.1%) and 23 (37.7%) isolates harboured ISAba1 upstream of blaOXA-23-like and blaOXA-51-like genes, respectively, though this was not observed in A. nosocomialis isolates. No relationship was observed between the presence of ISAba1 upstream of oxacillinase genes and the level of carbapenem resistance in all Acb isolates. Only two genes encoding metallo-beta-lactamase (VIM, SPM) were detected in all Acb isolates. This suggests that carbapenem resistance in blood-isolate Acb is mostly due to the presence of acquired carbapenemases. This is the first report from Iran on the identification of A. nosocomialis isolates that possess multiple oxacillinase genes and lack upstream ISAba1. PMID:26747061

  11. Mutations Decreasing Intrinsic β-Lactam Resistance Are Linked to Cell Division in the Nosocomial Pathogen Acinetobacter baumannii.

    PubMed

    Knight, Daniel; Dimitrova, Daniela D; Rudin, Susan D; Bonomo, Robert A; Rather, Philip N

    2016-06-01

    Transposon mutagenesis was used to identify novel determinants of intrinsic β-lactam resistance in Acinetobacter baumannii An EZ-Tn5 transposon insertion in a gene corresponding to the A1S_0225 sequence resulted in a 4-fold decrease in resistance to ampicillin, cefotaxime, imipenem, and ceftriaxone but did not alter resistance to other classes of antibiotics. Based on this phenotype, the gene was designated blhA (β-lactam hypersusceptibility). The blhA::EZ-Tn5 mutation conferred a similar phenotype in A. baumannii strain ATCC 17978. The wild-type blhA gene complemented the blhA::EZTn5 insertion and restored β-lactam resistance levels back to wild-type levels. The blhA mutation also increased β-lactam susceptibility in an adeB adeJ double mutant, indicating that the blhA mutation acted independently of these efflux systems to mediate susceptibility. In addition, mRNA levels for the blaOXA and blaADC β-lactamase genes were not altered by the blhA mutation. The blhA mutation resulted in a prominent cell division and morphological defect, with cells exhibiting a highly elongated phenotype, combined with large bulges in some cells. The blhA gene is unique to Acinetobacter and likely represents a novel gene involved in cell division. Three additional mutations, in zipA, zapA, and ftsK, each of which encode predicted cell division proteins, also conferred increased β-lactam susceptibility, indicating a common link between cell division and intrinsic β-lactam resistance in A. baumannii. PMID:27067318

  12. Laboratory Maintenance of Acinetobacter baumannii.

    PubMed

    Jacobs, Anna C; Zurawski, Daniel V

    2014-01-01

    Acinetobacter baumannii has recently drawn great interest in the microbiology research community due to the increase in clinical antibiotic resistance of this organism, and persistence of this bacterial species in the hospital environment. This unit outlines protocols for the growth and maintenance of A. baumannii in the laboratory. PMID:25367273

  13. Differential susceptibility to carbapenems due to the AdeABC efflux pump among nosocomial outbreak isolates of Acinetobacter baumannii in a Chinese hospital.

    PubMed

    Huang, Lei; Sun, Liying; Xu, Guobing; Xia, Tiean

    2008-11-01

    A nosocomial outbreak of carbapenem-resistant Acinetobacter baumannii occurred from February to November 2004 in the surgical intensive care unit (SICU) and the pediatric intensive care unit (PICU) of our hospital. Two separate clones prevailed, the antimicrobial susceptibility profiles of which were different. The PICU isolates produced OXA-23 oxacillinase, whereas no carbapenemases were detected from SICU isolates. No obvious outer membrane protein change was seen. Efflux pump phenotype was detected from SICU isolates. Efflux pump-encoding gene adeB was positive in these isolates and negative in PICU isolates. Through further study, we found that AdeABC efflux system gene contents were common in the SICU isolates. Then we compared the expression level of adeB in resistant and susceptible isolates using quantitative real-time polymerase chain reaction and found that increased expression of AdeABC efflux pump may play an important role in reduced meropenem susceptibility among A. baumannii in the SICU of our hospital. PMID:18687557

  14. Reservoirs of Non-baumannii Acinetobacter Species

    PubMed Central

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie

    2016-01-01

    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  15. Reservoirs of Non-baumannii Acinetobacter Species.

    PubMed

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie

    2016-01-01

    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  16. First Genome Sequence of a Mexican Multidrug-Resistant Acinetobacter baumannii Isolate

    PubMed Central

    Graña-Miraglia, Lucía; Lozano, Luis; Castro-Jaimes, Semiramis; Cevallos, Miguel A.; Volkow, Patricia

    2016-01-01

    Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide. Here, we present the draft genome of the first multidrug-resistant A. baumannii isolate, sampled from a tertiary hospital in Mexico City. This genome will provide a starting point for studying the genomic diversity of this species in Mexico. PMID:27013043

  17. Place of Colistin-Rifampicin Association in the Treatment of Multidrug-Resistant Acinetobacter Baumannii Meningitis: A Case Study

    PubMed Central

    Souhail, Dahraoui; Bouchra, Belefquih; Belarj, Badia; Laila, Rar; Mohammed, Frikh; Nassirou, Oumarou Mamane; Azeddine, Ibrahimi; Haimeur, Charki; Lemnouer, Abdelhay; Elouennass, Mostafa

    2016-01-01

    Treatment of Acinetobacter baumannii meningitis is an important challenge due to the accumulation of resistance of this bacteria and low meningeal diffusion of several antimicrobial requiring use of an antimicrobial effective combination to eradicate these species. We report a case of Acinetobacter baumannii multidrug-resistant nosocomial meningitis which was successfully treated with intravenous and intrathecal colistin associated with rifampicin. PMID:27064923

  18. Antibacterial sensitivity of Acinetobacter strains isolated from nosocomial infections.

    PubMed

    Karsligil, T; Balci, I; Zer, Y

    2004-01-01

    Acinetobacter species can cause many types of hospital-acquired infection and play an important role in nosocomial pneumonia in intensive care units, skin and wound infections, and meningitis. They are of increasing importance because of their ability to rapidly develop resistance to the major groups of antibiotics. We aimed to determine the antibiotic sensitivity of Acinetobacter strains isolated from, and determined to be the cause of, hospital-acquired infections. A total of 156 cultures of Acinetobacter (strains of A. baumannii [136; 87.2%] and A. iwoffii [20; 12.8%]), were isolated from clinical samples taken from patients in different units of our hospital. Conventional bacterial identification methods and the Sceptor system were used. In the antibiotic sensitivity tests, A. baumannii was susceptible to imipenem (90.4%), norfloxacin (84.5%) and ciprofloxacin (65.4%), and A. iwoffii to amikacin (80.0%), ticarcillin/clavulanic acid (70.0%) and imipenem (60.0%). PMID:15303777

  19. Multidrug-Resistant Acinetobacter spp.: Increasingly Problematic Nosocomial Pathogens

    PubMed Central

    Lee, Kyungwon; Yong, Dongeun; Jeong, Seok Hoon

    2011-01-01

    Pathogenic bacteria have increasingly been resisting to antimicrobial therapy. Recently, resistance problem has been relatively much worsened in Gram-negative bacilli. Acinetobacter spp. are typical nosocomial pathogens causing infections and high mortality, almost exclusively in compromised hospital patients. Acinetobacter spp. are intrinsically less susceptible to antibiotics than Enterobacteriaceae, and have propensity to acquire resistance. A surveillance study in Korea in 2009 showed that resistance rates of Acinetobacter spp. were very high: to fluoroquinolone 67%, to amikacin 48%, to ceftazidime 66% and to imipenem 51%. Carbapenem resistance was mostly due to OXA type carbapenemase production in A. baumannii isolates, whereas it was due to metallo-β-lactamase production in non-baumannii Acinetobacter isolates. Colistin-resistant isolates were rare but started to be isolated in Korea. Currently, the infection caused by multidrug-resistant A. baumannii is among the most difficult ones to treat. Analysis at tertiary care hospital in 2010 showed that among the 1,085 isolates of Acinetobacter spp., 14.9% and 41.8% were resistant to seven, and to all eight antimicrobial agents tested, respectively. It is known to be difficult to prevent Acinetobacter spp. infection in hospitalized patients, because the organisms are ubiquitous in hospital environment. Efforts to control resistant bacteria in Korea by hospitals, relevant scientific societies and government agencies have only partially been successful. We need concerted multidisciplinary efforts to preserve the efficacy of currently available antimicrobial agents, by following the principles of antimicrobial stewardship. PMID:22028150

  20. Blood stream infections caused by Acinetobacter baumannii group in Japan - Epidemiological and clinical investigation.

    PubMed

    Fujikura, Yuji; Yuki, Atsushi; Hamamoto, Takaaki; Kawana, Akihiko; Ohkusu, Kiyofumi; Matsumoto, Tetsuya

    2016-06-01

    Acinetobacter calcoaceticus-Acinetobacter baumannii complex, especially A. baumannii, Acinetobacter pittii and Acinetobacter nosocomialis, constitutes an important group of nosocomial pathogens; however, epidemiological or clinical characteristics and prognosis is limited in Japan. From 2009 to 2013, 47 blood stream infection cases resulting from A. baumannii group were reviewed at the National Defense Medical College, an 800-bed tertiary hospital. To determine the genospecies, further comparative nucleotide sequence analyses of the RNA polymerase b-subunit (rpoB) gene were performed. Sequence analysis of rpoB gene showed that 25 (49.0%), 17 (33.3%) and 5 (9.8%) cases were caused by A. baumannii, A. pittii and A. nosocomialis, respectively. The 30-day and in-hospital mortality rates of A. baumannii were 8.5% and 25.5%, respectively, and there were no significant differences between Acinetobacter species. Clinical characteristics were statistically insignificant. Multidrug-resistant Acinetobacter species were detected in 3 cases (5.9%) with same pulsed-field gel electrophoresis (PFGE) pattern and A. baumannii was less susceptible to amikacin and levofloxacin. In this study, the mortality and clinical characteristics were similar among A. baumannii group isolate cases despite some showing drug resistance. However, identification of Acinetobacter species helps to initiate appropriate antibiotic therapy in earlier treatment phase, because A. baumannii shows some drug resistance. PMID:26993173

  1. Characterization of Acinetobacter baumannii biofilm associated components

    NASA Astrophysics Data System (ADS)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  2. Acinetobacter baumannii: Evolution of Antimicrobial Resistance—Treatment Options

    PubMed Central

    Doi, Yohei; Murray, Gerald L.; Peleg, Anton Y.

    2015-01-01

    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  3. Acinetobacter baumannii: evolution of antimicrobial resistance-treatment options.

    PubMed

    Doi, Yohei; Murray, Gerald L; Peleg, Anton Y

    2015-02-01

    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  4. Identification of Ata, a Multifunctional Trimeric Autotransporter of Acinetobacter baumannii

    PubMed Central

    Bentancor, Leticia V.; Camacho-Peiro, Ana; Bozkurt-Guzel, Cagla; Pier, Gerald B.

    2012-01-01

    Acinetobacter baumannii has recently emerged as a highly troublesome nosocomial pathogen, especially in patients in intensive care units and in those undergoing mechanical ventilation. We have identified a surface protein adhesin of A. baumannii, designated the Acinetobacter trimeric autotransporter (Ata), that contains all of the typical features of trimeric autotransporters (TA), including a long signal peptide followed by an N-terminal, surface-exposed passenger domain and a C-terminal domain encoding 4 β-strands. To demonstrate that Ata encoded a TA, we created a fusion protein in which we replaced the entire passenger domain of Ata with the epitope tag V5, which can be tracked with specific monoclonal antibodies, and demonstrated that the C-terminal 101 amino acids of Ata were capable of exporting the heterologous V5 tag to the surface of A. baumannii in a trimeric form. We found that Ata played a role in biofilm formation and bound to various extracellular matrix/basal membrane (ECM/BM) components, including collagen types I, III, IV, and V and laminin. Moreover, Ata mediated the adhesion of whole A. baumannii cells to immobilized collagen type IV and played a role in the survival of A. baumannii in a lethal model of systemic infection in immunocompetent mice. Taken together, these results reveal that Ata is a TA of A. baumannii involved in virulence, including biofilm formation, binding to ECM/BM proteins, mediating the adhesion of A. baumannii cells to collagen type IV, and contributing to the survival of A. baumannii in a mouse model of lethal infection. PMID:22609912

  5. Post-neurosurgical meningitis caused by acinetobacter baumannii: case series and review of the literature

    PubMed Central

    Ni, Shunlan; Li, Shanshan; Yang, Naibin; Zhang, Sainan; Hu, Danping; Li, Qian; Lu, Mingqin

    2015-01-01

    Background: Acinetobacter baumannii (A. baumannii), a gram-negative bacterium, has now become an important hospital pathogen, which causes various serious nosocomial infections worldwide. Bacterial meningitis is a common complication after neurosurgical operation, and the percentage of A. baumannii meningitis is growing, especially the one resisting multiple drugs. Method: We retrospectively reviewed the cases with postoperative A. baumannii meningitis (PABM) in the First Affiliated Hospital of Wenzhou Medical University from January 2013 to October 2014. And we retrieved the PubMed for cases with PABM and reviewed them. Result: Five cases were included in our retrospective study. Two cases with sensitive A. baumannii and one with multidrug-resistant acinetobacter baumannii (MRAB) were cured, and other two with MRAB died. Conclusion: Intraventricular or intrathecal colistin could be a treatment to the MRAB. PMID:26885152

  6. Epidemiologic and Clinical Impact of Acinetobacter baumannii Colonization and Infection

    PubMed Central

    Villar, Macarena; Cano, María E.; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús

    2014-01-01

    Abstract Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  7. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422).

    PubMed

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago; Cevallos, Miguel A

    2016-01-01

    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  8. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422)

    PubMed Central

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago

    2016-01-01

    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  9. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii

    PubMed Central

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick

    2016-01-01

    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  10. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii.

    PubMed

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick

    2016-01-01

    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  11. Emerging therapies for multidrug resistant Acinetobacter baumannii.

    PubMed

    García-Quintanilla, Meritxell; Pulido, Marina R; López-Rojas, Rafael; Pachón, Jerónimo; McConnell, Michael J

    2013-03-01

    The global emergence of multidrug resistant Acinetobacter baumannii has reduced the number of clinically available antibiotics that retain activity against this pathogen. For this reason, the development of novel prevention and treatment strategies for infections caused by A. baumannii is necessary. Several studies have begun to characterize nonantibiotic approaches that utilize novel mechanisms of action to achieve antibacterial activity. Recent advances in phage therapy, iron chelation therapy, antimicrobial peptides, prophylactic vaccination, photodynamic therapy, and nitric oxide (NO)-based therapies have all been shown to have activity against A. baumannii. However, before these approaches can be used clinically there are still limitations and remaining questions that must be addressed. PMID:23317680

  12. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii

    PubMed Central

    Fàbrega, Anna; Roca, Ignasi; Sánchez-Encinales, Viviana; Vila, Jordi; Pachón, Jerónimo

    2014-01-01

    Acinetobacter baumannii has emerged as a nosocomial pathogen with an increased prevalence of multidrug-resistant strains. The role of the outer membrane protein A (OmpA) in antimicrobial resistance remains poorly understood. In this report, disruption of the ompA gene led to decreased MICs of chloramphenicol, aztreonam, and nalidixic acid. We have characterized, for the first time, the contribution of OmpA in the antimicrobial resistance phenotype of A. baumannii. PMID:24379205

  13. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection

    PubMed Central

    Noto, Michael J.; Boyd, Kelli L.; Burns, William J.; Varga, Matthew G.; Peek, Richard M.

    2015-01-01

    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9−/− mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9−/− mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii. PMID:26238713

  14. Inverse PCR for subtyping of Acinetobacter baumannii carrying ISAba1.

    PubMed

    Kim, Shukho; Park, Yun-Ju; Kim, Jungmin

    2016-05-01

    Acinetobacter baumannii has been prevalent in nosocomial infections, often causing outbreaks in intensive care units. ISAba1 is an insertion sequence that has been identified only in A. baumannii and its copy number varies among strains. It has been reported that ISAba1 provides a promoter for bla OXA-51-like, bla OXA-23-like, and bla ampC, which are associated with the resistance of A. baumannii to carbapenems and cephalosporins. The main purpose of this study was to develop a novel inverse PCR method capable of typing A. baumannii strains. The method involves three major steps: cutting of genomic DNA with a restriction enzyme, ligation, and PCR. In the first step, bacterial genomic DNA was digested with DpnI. In the second step, the digested genomic DNAs were ligated to form intramolecular circular DNAs. In the last step, the ligated circular DNAs were amplified by PCR with primers specific for ISAba1 and the amplified PCR products were electrophoresed. Twenty-two clinical isolates of A. baumannii were used for the evaluation of the inverse PCR (iPCR) typing method. Dendrogram analysis revealed two major clusters, similar to pulsed-field gel electrophoresis (PFGE) results. Three ISAba1-associated genes - bla ampC, bla OXA-66-like, and csuD - were amplified and detected in the clinical isolates. This novel iPCR typing method is comparable to PFGE in its ability to discriminate A. baumannii strains, and is a promising molecular epidemiological tool for investigating A. baumannii carrying ISAba1. PMID:27095456

  15. Virstatin inhibits biofilm formation and motility of Acinetobacter baumannii

    PubMed Central

    2014-01-01

    Background Acinetobacter baumannii has emerged as an opportunistic nosocomial pathogen causing infections worldwide. One reason for this emergence is due to its natural ability to survive in the hospital environment, which may be explained by its capacity to form biofilms. Cell surface appendages are important determinants of the A. baumannii biofilm formation and as such constitute interesting targets to prevent the development of biofilm-related infections. A chemical agent called virstatin was recently described to impair the virulence of Vibrio cholerae by preventing the expression of its virulence factor, the toxin coregulated pilus (type IV pilus). The objective of this work was to investigate the potential effect of virstatin on A. baumannii biofilms. Results After a dose–response experiment, we determined that 100 μM virstatin led to an important decrease (38%) of biofilms formed by A. baumannii ATCC17978 grown under static mode. We demonstrated that the production of biofilms grown under dynamic mode was also delayed and reduced. The biofilm susceptibility to virstatin was then tested for 40 clinical and reference A. baumannii strains. 70% of the strains were susceptible to virstatin (with a decrease of 10 to 65%) when biofilms grew in static mode, whereas 60% of strains respond to the treatment when their biofilms grew in dynamic mode. As expected, motility and atomic force microscopy experiments showed that virstatin acts on the A. baumannii pili biogenesis. Conclusions By its action on pili biogenesis, virstatin demonstrated a very promising antibiofilm activity affecting more than 70% of the A. baumannii clinical isolates. PMID:24621315

  16. Prevalence of Aminoglycoside Resistance Genes in Acinetobacter baumannii Isolates

    PubMed Central

    Aliakbarzade, Katayun; Farajnia, Safar; Karimi Nik, Ashraf; Zarei, Farzaneh; Tanomand, Asghar

    2014-01-01

    Background: Acinetobacter baumannii is one of the major causes of nosocomial infections and is resistant to most available antibiotics. Aminoglycosides remain as drugs of choice for treatment of Acinetobacter infections yet resistance to aminoglycosides has increased in the recent years. Objectives: The present study investigated the prevalence of genes encoding aminoglycoside-modifying enzymes in A. baumannii strains isolated from patients of Tabriz city, northwest of Iran. Materials and Methods: A total of 103 Acinetobacter isolates were collected from Imam Reza Hospital of Tabriz University of medical sciences. Antimicrobial susceptibility patterns of the isolates to different antimicrobial agents including cephalosporins, gentamicin, amikacin, tobramycin, colistin and polymyxin, were evaluated by the disc diffusion method. The frequency of aminoglycoside modifying enzymes encoding genes aacC1, aphA6, aadA1 and aadB was analyzed by the PCR method. Results: Antimicrobial susceptibility analysis showed that the highest resistance was towards beta−lactam antibiotics including cephalosporins whereas the highest sensitivity was observed towards colistin (77%) and polymyxin (84%). The resistance rate to aminoglycosides was 81%, 86% and 63% for amikacin, gentamicin and tobramycin, respectively. The PCR results showed that among the 103 A. baumannii isolates, 56 (65.11 %) were positive for aacC1, 52 (60.46 %) for aphA6, 24 (27.9 %) for aadA1 and 16 (18.6 %) for aadB resistant genes. Conclusions: The results of this study indicated that the genes encoding aminoglycoside-modifying enzymes are prevalent in A. baumannii isolates in the study region, which highlighted the necessity of considering preventive measures to control dissemination of these resistance genes. PMID:25632323

  17. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride

    PubMed Central

    Narayanan, Amoolya; Nair, Meera S.; Karumathil, Deepti P.; Baskaran, Sangeetha A.; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni

    2016-01-01

    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections. PMID:27375572

  18. Extrahuman Epidemiology of Acinetobacter baumannii in Lebanon

    PubMed Central

    Rafei, Rayane; Hamze, Monzer; Pailhoriès, Hélène; Eveillard, Matthieu; Marsollier, Laurent; Joly-Guillou, Marie-Laure; Dabboussi, Fouad

    2015-01-01

    The presence of Acinetobacter baumannii outside hospitals is still a controversial issue. The objective of our study was to explore the extrahospital epidemiology of A. baumannii in Lebanon. From February 2012 to October 2013, a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed by cultural methods for the presence of A. baumannii. Species identification was performed by rpoB gene sequencing. Antibiotic susceptibility was investigated, and the A. baumannii population was studied by two genotyping approaches: multilocus sequence typing (MLST) and blaOXA-51 sequence-based typing (SBT). A. baumannii was detected in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates showed a susceptible phenotype against most of the antibiotics tested and lacked carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. MLST analysis revealed the presence of 36 sequence types (STs), among which 24 were novel STs reported for the first time in this study. blaOXA-51 SBT showed the presence of 34 variants, among which 21 were novel and all were isolated from animal origins. Finally, 30 isolates had new partial rpoB sequences and were considered putative new Acinetobacter species. In conclusion, animals can be a potential reservoir for A. baumannii and the dissemination of new emerging carbapenemases. The roles of the novel animal clones identified in community-acquired infections should be investigated. PMID:25616788

  19. The Complete Genome and Phenome of a Community-Acquired Acinetobacter baumannii

    PubMed Central

    Farrugia, Daniel N.; Elbourne, Liam D. H.; Hassan, Karl A.; Eijkelkamp, Bart A.; Tetu, Sasha G.; Brown, Melissa H.; Shah, Bhumika S.; Peleg, Anton Y.; Mabbutt, Bridget C.; Paulsen, Ian T.

    2013-01-01

    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections. PMID:23527001

  20. Acinetobacter baumannii Genes Required for Bacterial Survival during Bloodstream Infection

    PubMed Central

    Subashchandrabose, Sargurunathan; Smith, Sara; DeOrnellas, Valerie; Crepin, Sebastien; Kole, Monica; Zahdeh, Carina

    2015-01-01

    ABSTRACT Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance

  1. Evaluation of Parameters for High Efficiency Transformation of Acinetobacter baumannii

    PubMed Central

    Yildirim, Suleyman; Thompson, Mitchell G.; Jacobs, Anna C.; Zurawski, Daniel V.; Kirkup, Benjamin C.

    2016-01-01

    Acinetobacter baumannii is an emerging, nosocomial pathogen that is poorly characterized due to a paucity of genetic tools and methods. While whole genome sequence data from several epidemic and environmental strains have recently become available, the functional characterization of genes is significantly lagging. Efficient transformation is one of the first steps to develop molecular tools that can be used to address these shortcomings. Here we report parameters allowing high efficiency transformation of A. baumannii. Using a multi-factorial experimental design we found that growth phase, voltage, and resistance all significantly contribute to transformation efficiency. The highest efficiency (4.3 × 108 Transformants/μg DNA) was obtained at the stationary growth phase of the bacterium (OD 6.0) using 25 ng of plasmid DNA under 100 Ohms resistance and 1.7 kV/cm voltage. The optimized electroporation parameters reported here provide a useful tool for genetic manipulation of A. baumannii. PMID:26911658

  2. Molecular epidemiology of Acinetobacter baumannii in central intensive care unit in Kosova Teaching Hospital.

    PubMed

    Raka, Lul; Kalenć, Smilja; Bosnjak, Zrinka; Budimir, Ana; Katić, Stjepan; Sijak, Dubravko; Mulliqi-Osmani, Gjyle; Zoutman, Dick; Jaka, Arbëresha

    2009-12-01

    Infections caused by bacteria of genus Acinetobacter pose a significant health care challenge worldwide. Information on molecular epidemiological investigation of outbreaks caused by Acinetobacter species in Kosova is lacking. The present investigation was carried out to enlight molecular epidemiology of Acinetobacter baumannii in the Central Intensive Care Unit (CICU) of a University hospital in Kosova using pulse field gel electrophoresis (PFGE). During March - July 2006, A. baumannii was isolated from 30 patients, of whom 22 were infected and 8 were colonised. Twenty patients had ventilator-associated pneumonia, one patient had meningitis, and two had coinfection with bloodstream infection and surgical site infection. The most common diagnoses upon admission to the ICU were politrauma and cerebral hemorrhage. Bacterial isolates were most frequently recovered from endotracheal aspirate (86.7%). First isolation occurred, on average, on day 8 following admission (range 1-26 days). Genotype analysis of A. baumannii isolates identified nine distinct PFGE patterns, with predominance of PFGE clone E represented by isolates from 9 patients. Eight strains were resistant to carbapenems. The genetic relatedness of Acinetobacter baumannii was high, indicating cross-transmission within the ICU setting. These results emphasize the need for measures to prevent nosocomial transmission of A. baumannii in ICU. PMID:20464330

  3. Acinetobacter baumannii: Emergence of a Successful Pathogen

    PubMed Central

    Peleg, Anton Y.; Seifert, Harald; Paterson, David L.

    2008-01-01

    Acinetobacter baumannii has emerged as a highly troublesome pathogen for many institutions globally. As a consequence of its immense ability to acquire or upregulate antibiotic drug resistance determinants, it has justifiably been propelled to the forefront of scientific attention. Apart from its predilection for the seriously ill within intensive care units, A. baumannii has more recently caused a range of infectious syndromes in military personnel injured in the Iraq and Afghanistan conflicts. This review details the significant advances that have been made in our understanding of this remarkable organism over the last 10 years, including current taxonomy and species identification, issues with susceptibility testing, mechanisms of antibiotic resistance, global epidemiology, clinical impact of infection, host-pathogen interactions, and infection control and therapeutic considerations. PMID:18625687

  4. Analysis on distribution features and drug resistance of clinically isolated Acinetobacter baumannii

    PubMed Central

    Ren, Guangming; Zhou, Min; Ding, Ning; Zhou, Ning; Li, Qingling

    2016-01-01

    The aim of the present study was to examine the clinical distribution and drug resistance of Acinetobacter baumannii infection, and provide evidence of clinical medication as well as the prophylaxis for the treatment of drug resistance bacteria. In total, 306 Acinetobacter baumanniis selected from routine culture were collected between January 2012 and December 2013, to analyze the distributions among clinical specimens and wards and their drug resistance state. Of the 306 Acinetobacter baumanniis, the main distribution of specimens was sputum, accounting for 77.78%. The distribution of administrative office was dominated by intensive care unit with a proportion of 40.0% in 2012, which rapidly increased to 60.9% in 2013, followed by neurosurgery, respiration medicine and orthopedics with proportions of 23, 12 and 9.0% in 2012 and 9.71, 8.74 and 3.88% in 2013, respectively. The Acinetobacter baumannii's drug resistance rate of Tazobactam and Piperacillin was increased from 68.0% in 2012 to 71.36% in 2013. At the same time, the drug resistance rate of imipenem was enhanced from 66.0% in 2012 to 72.81% in 2013. By 2013, the drug resistance rates of penbritin, ceftizoxime, cefotetan and macrodantin reached ≤100%. In conclusion, Acinetobacter baumannii mainly causes respiratory tract infection with severe drug resistance. The drug resistance of Acinetobacter baumannii was mainly manifested as multidrug resistance or even pan-drug resistance with an obvious increasing trend of tolerance. Thus, it is necessary to prevent and treat nosocomial infection, to minimize usage of antibiotics and to standardize medical operating, to reduce the increase in persistence. PMID:27602085

  5. Identification and Characterization of a Glycosyltransferase Involved in Acinetobacter baumannii Lipopolysaccharide Core Biosynthesis▿

    PubMed Central

    Luke, Nicole R.; Sauberan, Shauna L.; Russo, Thomas A.; Beanan, Janet M.; Olson, Ruth; Loehfelm, Thomas W.; Cox, Andrew D.; St. Michael, Frank; Vinogradov, Evgeny V.; Campagnari, Anthony A.

    2010-01-01

    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  6. Identification and characterization of a glycosyltransferase involved in Acinetobacter baumannii lipopolysaccharide core biosynthesis.

    PubMed

    Luke, Nicole R; Sauberan, Shauna L; Russo, Thomas A; Beanan, Janet M; Olson, Ruth; Loehfelm, Thomas W; Cox, Andrew D; St Michael, Frank; Vinogradov, Evgeny V; Campagnari, Anthony A

    2010-05-01

    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  7. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil

    2016-01-01

    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  8. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii.

    PubMed

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil

    2016-01-01

    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  9. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool

    PubMed Central

    Diancourt, Laure; Passet, Virginie; Nemec, Alexandr; Dijkshoorn, Lenie; Brisse, Sylvain

    2010-01-01

    Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections. PMID:20383326

  10. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Miyasaki, Yoko; Rabenstein, John D; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M; Kittell, Patricia Emmett; Morgan, Margie A; Nichols, Wesley Stephen; Van Benschoten, M M; Hardy, William David; Liu, George Y

    2013-01-01

    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii. PMID:23630600

  11. Antimicrobial Resistance of Acinetobacter baumannii to Imipenem in Iran: A Systematic Review and Meta-Analysis

    PubMed Central

    Pourhajibagher, Maryam; Hashemi, Farhad B.; Pourakbari, Babak; Aziemzadeh, Masoud; Bahador, Abbas

    2016-01-01

    Imipenem-resistant multi-drug resistant (IR-MDR) Acinetobacter baumannii has been emerged as a morbidity successful nosocomial pathogen throughout the world.To address imipenem being yet the most effective antimicrobial agent against A. baumannii to control outbreaks and treat patients, a systematic review and meta-analysis was performed to evaluate the prevalence of IR-MDR A. baumannii. We systematically searched Web of Science, PubMed, MEDLINE, Science Direct, EMBASE, Scopus, Cochrane Library, Google Scholar, and Iranian databases to identify studies addressing the antibiotic resistance of A. baumannii to imipenem and the frequency of MDR strains in Iran. Out of 58 articles and after a secondary screening using inclusion and exclusion criteria and on the basis of title and abstract evaluation, 51 studies were selected for analysis. The meta-analysis revealed that 55% [95% confidence interval (CI), 53.0–56.5] of A. baumannii were resistant to imipenem and 74% (95% CI, 61.3–83.9) were MDR. The MDR A. baumannii population in Iran is rapidly changing toward a growing resistance to imipenem. Our findings highlight the critical need for a comprehensive monitoring and infection control policy as well as a national susceptibility review program that evaluates IR-MDR A. baumannii isolates from various parts of Iran. PMID:27099638

  12. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Ramage, Elizabeth; Weiss, Eli J.; Radey, Matthew; Hayden, Hillary S.; Held, Kiara G.; Huse, Holly K.; Zurawski, Daniel V.; Brittnacher, Mitchell J.; Manoil, Colin

    2015-01-01

    ABSTRACT Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCE Acinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains. PMID:25845845

  13. Predictors of mortality in solid-organ transplant recipients with infections caused by Acinetobacter baumannii.

    PubMed

    Liu, Hua; Ye, Qifa; Wan, Qiquan; Zhou, Jiandang

    2015-01-01

    Acinetobacter baumannii can cause a serious infection in solid-organ transplant (SOT) recipients, and more data on A. baumannii infection is needed. We sought to investigate the epidemiology and distribution of A. baumannii isolates in SOT recipients. We also investigated the risk factors for overall in-hospital mortality and infection-related 30-day mortality using multivariate logistic regression analysis. A double-center retrospective study of SOT recipients who were infected with A. baumannii between January 2003 and January 2015 was conducted. A total of 71 individuals developed 93 episodes of A. baumannii infection, with a mean age of 44.5 years (44.5±11.9 years). Ninety percent of recipients had nosocomial origin A. baumannii infection, with the bloodstream as the most common site of infection (32.4%). Septic shock developed in 23.9% (17 of 71) of all recipients with A. baumannii infection. Morbidity and mortality rates of A. baumannii infections were high in SOT recipients. The incidence rate of A. baumannii infection in SOT recipients was 3.9% (71 of 1,821). Overall in-hospital mortality and infection-related 30-day mortality were 53.5% (38 of 71) and 40.8% (29 of 71), respectively. Risk factors independently associated with overall in-hospital mortality were mechanical ventilation at onset of A. baumannii infection (odds ratio [OR] 6.29, 95% confidence interval [CI] 1.48-26.85; P=0.013), liver or liver-kidney transplantation (OR 15.33, 95% CI 1.82-129.18; P=0.012), and late-onset A. baumannii infection (OR 7.61, 95% CI 1.07-54.36; P=0.043). A platelet count <50,000/mm(3) (OR 12.76, 95% CI 1.28-126.81; P=0.030) and mechanical ventilation at onset of A. baumannii infection (OR 189.98, 95% CI 13.23-2,728.81; P<0.001) were identified as independent risk factors for infection-related 30-day mortality. In conclusion, the morbidity and mortality rates of A. baumannii infections were high in SOT recipients. Mechanical ventilation at onset of A. baumannii

  14. Epidemiologic and clinical impact of Acinetobacter baumannii colonization and infection: a reappraisal.

    PubMed

    Villar, Macarena; Cano, María E; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús

    2014-07-01

    Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  15. A mouse model of Acinetobacter baumannii-associated pneumonia using a clinically isolated hypervirulent strain.

    PubMed

    Harris, Greg; Kuo Lee, Rhonda; Lam, Christopher K; Kanzaki, Gregory; Patel, Girishchandra B; Xu, H Howard; Chen, Wangxue

    2013-08-01

    Acinetobacter baumannii is an important emerging pathogen in health care-acquired infections and is responsible for severe nosocomial and community-acquired pneumonia. Currently available mouse models of A. baumannii pneumonia show poor colonization with little to no extrapulmonary dissemination. Here, we describe a mouse model of A. baumannii pneumonia using a clinical isolate (LAC-4 strain) that reliably reproduces the most relevant features of human pulmonary A. baumannii infection and pathology. Using this model, we have shown that LAC-4 infection induced rapid bacterial replication in the lungs, significant extrapulmonary dissemination, and severe bacteremia by 24 h postintranasal inoculation. Infected mice showed severe bronchopneumonia and dilatation and inflammatory cell infiltration in the perivascular space. More significantly, 100% of C57BL/6 and BALB/c mice succumbed to 10(8) CFU of LAC-4 inoculation within 48 h. When this model was used to assess the efficacy of antimicrobials, all mice treated with imipenem and tigecycline survived a lethal intranasal challenge, with minimal clinical signs and body weight loss. Moreover, intranasal immunization of mice with formalin-fixed LAC-4 protected 40% of mice from a lethal (100× 100% lethal dose) intraperitoneal challenge. Thus, this model offers a reproducible acute course of A. baumannii pneumonia without requiring additional manipulation of host immune status, which will facilitate the development of therapeutic agents and vaccines against A. baumannii pneumonia in humans. PMID:23689726

  16. Acinetobacter baumannii-Associated Skin and Soft Tissue Infections: Recognizing a Broadening Spectrum of Disease*

    PubMed Central

    Guerrero, Dubert M.; Perez, Federico; Conger, Nicholas G.; Solomkin, Joseph S.; Adams, Mark D.; Rather, Philip N.

    2010-01-01

    Abstract Background Acinetobacter baumannii is gaining importance as a cause of nosocomial infections, but its role in skin and soft tissue infection (SSTI) is not well defined. As a result of the outbreak of A. baumannii occurring in military personnel in Iraq and Afghanistan, reports of severe wound infections and SSTI caused by this pathogen are increasing in frequency. Methods We describe four cases of monomicrobial and polymicrobial A. baumannii–associated necrotizing SSTI accompanied by A. baumannii bacteremia and offer a review of similar experiences published in the literature. Results Our comparative analysis reveals four unique features associated with necrotizing SSTI associated with A. baumannii: i) Occurs in hosts with underlying comorbidities (e.g., trauma, cirrhosis); ii) is often accompanied by bacteremia; iii) multiple drug resistance and the presence of co-pathogens frequently complicated treatment (64% of cases); iv) the cases reported here and in our review required surgical debridement (84% of cases) and led to substantial mortality (∼30%). Conclusions As the prevalence of A. baumannii continues to increase in our health care system, SSTIs caused by this organism may become more common. Clinicians must be aware that the spectrum of disease caused by A. baumannii could include severe necrotizing SSTI and that vigilance for potential complications is necessary. PMID:19788383

  17. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.

    PubMed

    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi

    2016-08-10

    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates. PMID:27234880

  18. Translation Elongation Factor Tuf of Acinetobacter baumannii Is a Plasminogen-Binding Protein

    PubMed Central

    Koenigs, Arno; Zipfel, Peter F.; Kraiczy, Peter

    2015-01-01

    Acinetobacter baumannii is an important nosocomial pathogen, causing a variety of opportunistic infections of the skin, soft tissues and wounds, urinary tract infections, secondary meningitis, pneumonia and bacteremia. Over 63% of A. baumannii infections occurring in the United States are caused by multidrug resistant isolates, and pan-resistant isolates have begun to emerge that are resistant to all clinically relevant antibiotics. The complement system represents the first line of defense against invading pathogens. However, many A. baumannii isolates, especially those causing severe bacteremia are resistant to complement-mediated killing, though the underlying mechanisms remain poorly understood. Here we show for the first time that A. baumannii binds host-derived plasminogen and we identify the translation elongation factor Tuf as a moonlighting plasminogen-binding protein that is exposed on the outer surface of A. baumannii. Binding of plasminogen to Tuf is at least partly dependent on lysine residues and ionic interactions. Plasminogen, once bound to Tuf can be converted to active plasmin and proteolytically degrade fibrinogen as well as the key complement component C3b. Thus, Tuf acts as a multifunctional protein that may contribute to virulence of A. baumannii by aiding in dissemination and evasion of the complement system. PMID:26230848

  19. [Emerging Acinetobacter baumannii infections and factors favouring their occurrence].

    PubMed

    Eveillard, M; Joly-Guillou, M-L

    2012-10-01

    During the last decade, Acinetobacter baumannii (AB) has been increasingly responsible for infections occurring in three particular contexts (in terms of patients and environment). Community AB pneumonia is severe infections, mainly described around the Indian Ocean, and which mainly concern patients with major co-morbidities. AB is also responsible for infections occurring among soldiers wounded in action during operations conducted in Iraq or Afghanistan. Lastly, this bacterium is responsible for infections occurring among casualties from natural disasters like earthquakes and tsunamis. Those infections are often due to multidrug-resistant strains, which can be implicated in nosocomial outbreaks when patients are hospitalized in a local casualty department or during their repatriation thereafter. The source of the contaminations which lead to AB infections following injuries (warfare or natural disasters) is still poorly known. Three hypotheses are usually considered: a contamination of wounds with environmental bacteria, a wound contamination from a previous cutaneous or oropharyngeal endogenous reservoir, or hospital acquisition. The implication of telluric or agricultural primary reservoirs in human AB infections is a common hypothesis which remains to be demonstrated by further specifically designed studies. PMID:21963271

  20. Genetic Determinants of Intrinsic Colistin Tolerance in Acinetobacter baumannii

    PubMed Central

    Hood, M. Indriati; Becker, Kyle W.; Roux, Christelle M.; Dunman, Paul M.

    2013-01-01

    Acinetobacter baumannii is a leading cause of multidrug-resistant infections worldwide. This organism poses a particular challenge due to its ability to acquire resistance to new antibiotics through adaptation or mutation. This study was undertaken to determine the mechanisms governing the adaptability of A. baumannii to the antibiotic colistin. Screening of a transposon mutant library identified over 30 genes involved in inducible colistin resistance in A. baumannii. One of the genes identified was lpsB, which encodes a glycosyltransferase involved in lipopolysaccharide (LPS) synthesis. We demonstrate that loss of LpsB function results in increased sensitivity to both colistin and cationic antimicrobial peptides of the innate immune system. Moreover, LpsB is critical for pathogenesis in a pulmonary model of infection. Taken together, these data define bacterial processes required for intrinsic colistin tolerance in A. baumannii and underscore the importance of outer membrane structure in both antibiotic resistance and the pathogenesis of A. baumannii. PMID:23230287

  1. Detection of viable antibiotic-resistant/sensitive Acinetobacter baumannii in indoor air by propidium monoazide quantitative polymerase chain reaction.

    PubMed

    Tseng, C-C; Hsiao, P-K; Chang, K-C; Cheng, C-C; Yiin, L-M; Hsieh, C-J

    2015-10-01

    Acinetobacter baumannii represents a significant cause of nosocomial infections. Therefore, we combined real-time quantitative polymerase chain reaction (PCR) with the propidium monoazide (PMA-qPCR) to assess the feasibility of detecting viable, airborne A. baumannii. The biological collection efficiencies of three samplers for collecting airborne A. baumannii were evaluated by PMA-qPCR in a chamber study. After sampling, the effects of storage in collection fluid on A. baumannii were evaluated. The results showed that the culturable ratio of A. baumannii measured using the culture method was significantly correlated with the viable ratio measured using PMA-qPCR, but was not significantly correlated with the qPCR results. It was indicated that the AGI-30 impinger and the BioSampler were much more effective than the Nuclepore filter sampler for collecting airborne A. baumannii. The storage temperature was critical for aerosol samples, as the loss of viable A. baumannii was minimized when the PMA-bound DNA was stored at -20°C or if the collected cells were stored at 4°C and subsequently processed by PMA-qPCR within 1 month. The PMA-qPCR method was also to distinguish between colistin-sensitive and colistin-resistant A. baumannii, and no colistin-sensitive A. baumannii was detected by PMA-qPCR upon treatment of the BioSampler collection medium with 2 μg/ml colistin for 5 min. PMID:25283547

  2. Modulating Acinetobacter baumannii biofilm development with molecules containing 3,4,5-trimethoxy-N,N',N'-trimethylbenzohydrazide moiety.

    PubMed

    Sambanthamoorthy, Karthik; Hickman, Mark; Pattabiraman, Nagarajan; Palys, Thomas; Wagar, Eric J

    2015-01-01

    In recent years, Acinetobacter baumannii has emerged as a major cause of nosocomial infections, including infections of implanted medical devices. The treatment of infections caused by A. baumannii has been severely hampered due to their frequent resistance to currently available antibiotics, and most importantly the ability of A. baumannii to form biofilms, which plays a significant role in both persistence and antibiotic resistance. The inherent resistance of A. baumannii biofilms to host defenses and antimicrobial agents necessitates the search for novel approaches to deter biofilm formation. Here, we report our findings on nine compounds identified from structure-activity relationship (SAR) studies on an antibiofilm compound LP3134 that was reported earlier by Biofouling2014, 30, 17. Compounds were evaluated for antibiofilm and anti-adherence activities against A. baumannii. The ability of the compounds to prevent biofilm development on urinary catheters was studied. Growth curve experiments indicated that compounds did not affect the planktonic growth of A. baumannii. All compounds inhibited A. baumannii biofilm development as well as impacting early adhesion on abiotic surfaces. Seven compounds were able to deter biofilm development on silicone catheters. Due to the continued rise of emerging multidrug-resistant A. baumannii, results from this study provide foundation for further development of these molecules to treat A. baumannii infections in wounds and medical devices. PMID:25881818

  3. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China

    PubMed Central

    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang

    2016-01-01

    Background Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. Material/Methods Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. Results The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). Conclusions The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  4. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China.

    PubMed

    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang

    2016-01-01

    BACKGROUND Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. MATERIAL AND METHODS Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. RESULTS The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). CONCLUSIONS The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  5. Wide Dissemination of GES-Type Carbapenemases in Acinetobacter baumannii Isolates in Kuwait

    PubMed Central

    Bonnin, Rémy A.; Rotimi, Vincent O.; Al Hubail, Mona; Gasiorowski, Elise; Al Sweih, Noura; Poirel, Laurent

    2013-01-01

    Acinetobacter baumannii is an opportunistic pathogen that is an important source of nosocomial infections. Production of extended-spectrum β-lactamases (ESBLs) of the GES type in A. baumannii has been increasingly reported, and some of these GES-type enzymes possess some carbapenemase activity. Our aim was to analyze the resistance determinants and the clonal relationships of carbapenem-nonsusceptible A. baumannii clinical isolates recovered from hospitals in Kuwait. A total of 63 isolates were analyzed, and all were found to be positive for blaGES-type genes. One isolate harbored the blaGES-14 gene encoding an ESBL with significant carbapenemase activity, whereas the other isolates harbored the blaGES-11 ESBL gene. Thirty-three isolates coharbored the blaOXA-23 and blaGES-11 genes. Analyses of the genetic locations indicated that the blaGES-11/-14 genes were plasmid located. It is noteworthy that the blaOXA-23 and blaGES-11 genes were colocated onto a single plasmid. Nine different pulsotypes were observed among the 63 isolates. This study showed the emergence of GES-type ESBLs in A. baumannii in Kuwait, further suggesting that the Middle East region might be a reservoir for carbapenemase-producing A. baumannii. PMID:23089751

  6. Novel Engineered Peptides of a Phage Lysin as Effective Antimicrobials against Multidrug-Resistant Acinetobacter baumannii.

    PubMed

    Thandar, Mya; Lood, Rolf; Winer, Benjamin Y; Deutsch, Douglas R; Euler, Chad W; Fischetti, Vincent A

    2016-05-01

    Acinetobacter baumannii is a Gram-negative bacterial pathogen responsible for a range of nosocomial infections. The recent rise and spread of multidrug-resistant A. baumannii clones has fueled a search for alternative therapies, including bacteriophage endolysins with potent antibacterial activities. A common feature of these lysins is the presence of a highly positively charged C-terminal domain with a likely role in promoting outer membrane penetration. In the present study, we show that the C-terminal amino acids 108 to 138 of phage lysin PlyF307, named P307, alone were sufficient to kill A. baumannii (>3 logs). Furthermore, P307 could be engineered for improved activity, the most active derivative being P307SQ-8C (>5-log kill). Both P307 and P307SQ-8C showed high in vitro activity against A. baumannii in biofilms. Moreover, P307SQ-8C exhibited MICs comparable to those of levofloxacin and ceftazidime and acted synergistically with polymyxin B. Although the peptides were shown to kill by disrupting the bacterial cytoplasmic membrane, they did not lyse human red blood cells or B cells; however, serum was found to be inhibitory to lytic activity. In a murine model of A. baumannii skin infection, P307SQ-8C reduced the bacterial burden by ∼2 logs in 2 h. This study demonstrates the prospect of using peptide derivatives from bacteriophage lysins to treat topical infections and remove biofilms caused by Gram-negative pathogens. PMID:26856847

  7. Identification and Characterization of Type II Toxin-Antitoxin Systems in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Jurėnaitė, Milda; Markuckas, Arvydas

    2013-01-01

    Acinetobacter baumannii is an opportunistic pathogen that causes nosocomial infections. Due to the ability to persist in the clinical environment and rapidly acquire antibiotic resistance, multidrug-resistant A. baumannii clones have spread in medical units in many countries in the last decade. The molecular basis of the emergence and spread of the successful multidrug-resistant A. baumannii clones is not understood. Bacterial toxin-antitoxin (TA) systems are abundant genetic loci harbored in low-copy-number plasmids and chromosomes and have been proposed to fulfill numerous functions, from plasmid stabilization to regulation of growth and death under stress conditions. In this study, we have performed a thorough bioinformatic search for type II TA systems in genomes of A. baumannii strains and estimated at least 15 possible TA gene pairs, 5 of which have been shown to be functional TA systems. Three of them were orthologs of bacterial and archaeal RelB/RelE, HicA/HicB, and HigB/HigA systems, and others were the unique SplT/SplA and CheT/CheA TA modules. The toxins of all five TA systems, when expressed in Escherichia coli, inhibited translation, causing RNA degradation. The HigB/HigA and SplT/SplA TA pairs of plasmid origin were highly prevalent in clinical multidrug-resistant A. baumannii isolates from Lithuanian hospitals belonging to the international clonal lineages known as European clone I (ECI) and ECII. PMID:23667234

  8. The Nod1, Nod2, and Rip2 Axis Contributes to Host Immune Defense against Intracellular Acinetobacter baumannii Infection

    PubMed Central

    Bist, Pradeep; Dikshit, Neha; Koh, Tse Hsien; Mortellaro, Alessandra; Tan, Thuan Tong

    2014-01-01

    Acinetobacter baumannii is a major extensively drug-resistant lethal human nosocomial bacterium. However, the host innate immune mechanisms controlling A. baumannii are not well understood. Although viewed as an extracellular pathogen, A. baumannii can also invade and survive intracellularly. However, whether host innate immune pathways sensing intracellular bacteria contribute to immunity against A. baumannii is not known. Here, we provide evidence for the first time that intracellular antibacterial innate immune receptors Nod1 and Nod2, and their adaptor Rip2, play critical roles in the sensing and clearance of A. baumannii by human airway epithelial cells in vitro. A. baumannii infection upregulated Rip2 expression. Silencing of Nod1, Nod2, and Rip2 expression profoundly increased intracellular invasion and prolonged the multiplication and survival of A. baumannii in lung epithelial cells. Notably, the Nod1/2-Rip2 axis did not contribute to the control of A. baumannii infection of human macrophages, indicating that they play cell type-specific roles. The Nod1/2-Rip2 axis was needed for A. baumannii infection-induced activation of NF-κB but not mitogen-activated protein kinases. Moreover, the Nod1/2-Rip2 axis was critical to induce optimal cytokine and chemokine responses to A. baumannii infection. Mechanistic studies showed that the Nod1/2 pathway contributed to the innate control of A. baumannii infection through the production of β-defensin 2 by airway epithelial cells. This study revealed new insights into the immune control of A. baumannii and may contribute to the development of effective immune therapeutics and vaccines against A. baumannii. PMID:24366254

  9. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates.

    PubMed

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil

    2016-01-01

    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  10. Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: Mechanisms and epidemiology.

    PubMed

    Potron, Anaïs; Poirel, Laurent; Nordmann, Patrice

    2015-06-01

    Multidrug resistance is quite common among non-fermenting Gram-negative rods, in particular among clinically relevant species including Pseudomonas aeruginosa and Acinetobacter baumannii. These bacterial species, which are mainly nosocomial pathogens, possess a diversity of resistance mechanisms that may lead to multidrug or even pandrug resistance. Extended-spectrum β-lactamases (ESBLs) conferring resistance to broad-spectrum cephalosporins, carbapenemases conferring resistance to carbapenems, and 16S rRNA methylases conferring resistance to all clinically relevant aminoglycosides are the most important causes of concern. Concomitant resistance to fluoroquinolones, polymyxins (colistin) and tigecycline may lead to pandrug resistance. The most important mechanisms of resistance in P. aeruginosa and A. baumannii and their most recent dissemination worldwide are detailed here. PMID:25857949

  11. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil

    2016-01-01

    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  12. Membrane-permeabilizing activity of reverse-amide 2-aminoimidazole antibiofilm agents against Acinetobacter baumannii.

    PubMed

    Stowe, Sean D; Thompson, Richele J; Peng, Lingling; Su, Zhaoming; Blackledge, Meghan S; Draughn, G Logan; Coe, William H; Johannes, Eva; Lapham, Valerie K; Mackenzie, John; Melander, Christian; Cavanagh, John

    2015-01-01

    Acinetobacter baumannii has quickly become one of the most insidious and prevalent nosocomial infections. Recently, the reverse-amide class of 2-aminoimidazole compounds (RA-2AI) was found both to prevent A. baumannii biofilm formation and also to disperse preexisting formations, putatively through interactions with cytosolic response regulators. Here we focus on how this class of antibiofilm agent traverses cellular membranes. Following the discovery of dosage-dependent growth rate changes, the cellular effects of RA-2AI were investigated using a combination of molecular assays and microscopic techniques. It was found that RA-2AI exposure has measureable effects on the bacterial membranes, resulting in a period of increased permeability and visible structural aberrations. Based on these results, we propose a model that describes how the structure of RA-2AI allows it to insert itself into and disrupt the fluidity of the membrane, creating an opportunity for increased molecular permeability. PMID:25348099

  13. Acinetobacter baumannii Infection and IL-17 Mediated Immunity

    PubMed Central

    Yan, Zihe; Yang, Junjun; Hu, Renjing; Hu, Xichi; Chen, Kong

    2016-01-01

    Acinetobacter baumannii is a significant cause of severe hospital-acquired infections with a recent rise in multidrug-resistant infections involving traumatic wounds of military personnel. The interleukin-17 (IL-17) pathway is essential for neutrophil recruitment in response to a variety of pathogens, while the control of A. baumannii infection is known to be dependent on neutrophils. This suggests that IL-17 may play an important role in A. baumannii infection; however, this has yet to be studied. Here, we summarize the recent advances in understanding the host-pathogen interaction of A. baumannii and propose a potential role of the IL-17 pathway in generating a protective immune response. PMID:26977122

  14. OmpA Binding Mediates the Effect of Antimicrobial Peptide LL-37 on Acinetobacter baumannii

    PubMed Central

    Lin, Ming-Feng; Tsai, Pei-Wen; Chen, Jeng-Yi; Lin, Yun-You; Lan, Chung-Yu

    2015-01-01

    Multidrug-resistant Acinetobacter baumannii has recently emerged as an important pathogen in nosocomial infection; thus, effective antimicrobial regimens are urgently needed. Human antimicrobial peptides (AMPs) exhibit multiple functions and antimicrobial activities against bacteria and fungi and are proposed to be potential adjuvant therapeutic agents. This study examined the effect of the human cathelicidin-derived AMP LL-37 on A. baumannii and revealed the underlying mode of action. We found that LL-37 killed A. baumannii efficiently and reduced cell motility and adhesion. The bacteria-killing effect of LL-37 on A. baumannii was more efficient compared to other AMPs, including human ß–defensin 3 (hBD3) and histatin 5 (Hst5). Both flow cytometric analysis and immunofluorescence staining showed that LL-37 bound to A. baumannii cells. Moreover, far-western analysis demonstrated that LL-37 could bind to the A. baumannii OmpA (AbOmpA) protein. An ELISA assay indicated that biotin-labelled LL-37 (BA-LL37) bound to the AbOmpA74-84 peptide in a dose-dependent manner. Using BA-LL37 as a probe, the ~38 kDa OmpA signal was detected in the wild type but the ompA deletion strain did not show the protein, thereby validating the interaction. Finally, we found that the ompA deletion mutant was more sensitive to LL-37 and decreased cell adhesion by 32% compared to the wild type. However, ompA deletion mutant showed a greatly reduced adhesion defect after LL-37 treatment compared to the wild strain. Taken together, this study provides evidence that LL-37 affects A. baumannii through OmpA binding. PMID:26484669

  15. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China

    PubMed Central

    Li, Puyuan; Niu, Wenkai; Li, Huan; Lei, Hong; Liu, Wei; Zhao, Xiangna; Guo, Leijing; Zou, Dayang; Yuan, Xin; Liu, Huiying; Yuan, Jing; Bai, Changqing

    2015-01-01

    Acinetobacter baumannii is an important opportunistic pathogen associated with a variety of nosocomial infections. A rapid and sensitive molecular detection in clinical isolates is quite needed for the appropriate therapy and outbreak control of A. baumannii. Group 2 carbapenems have been considered the agents of choice for the treatment of multiple drug-resistant A. baumannii. But the prevalence of carbapenem-resistant A. baumannii (CRAB) has been steadily increasing in recent years. Here, we developed a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of A. baumannii in clinical samples by using high-specificity primers of the blaOXA-51 gene. Then we investigated the OXA-carbapenemases molecular epidemiology of A. baumannii isolates in two comprehensive hospitals in Beijing. The results showed that the LAMP assay could detect target DNA within 60 min at 65°C. The detection limit was 50 pg/μl, which was about 10-fold greater than that of PCR. Furthermore, this method could distinguish A. baumannii from the homologous A. nosocomialis and A. pittii. A total of 228 positive isolates were identified by this LAMP-based method for A. baumannii from 335 intensive care unit patients with clinically suspected multi-resistant infections in two hospitals in Beijing. The rates of CRAB are on the rise and are slowly becoming a routine phenotype for A. baumannii. Among the CRABs, 92.3% harbored both the blaOXA-23 and blaOXA-51 genes. Thirty-three pulsotypes were identified by pulsed-field gel electrophoresis, and the majority belonged to clone C. In conclusion, the LAMP method developed for detecting A. baumannii was faster and simpler than conventional PCR and has great potential for both point-of-care testing and basic research. We further demonstrated a high distribution of class D carbapenemase-encoding genes, mainly OXA-23, which presents an emerging threat in hospitals in China. PMID:26441924

  16. Phylogenetic and genomic diversity in isolates from the globally distributed Acinetobacter baumannii ST25 lineage

    PubMed Central

    Sahl, Jason W.; Del Franco, Mariateresa; Pournaras, Spyros; Colman, Rebecca E.; Karah, Nabil; Dijkshoorn, Lenie; Zarrilli, Raffaele

    2015-01-01

    Acinetobacter baumannii is a globally distributed nosocomial pathogen that has gained interest due to its resistance to most currently used antimicrobials. Whole genome sequencing (WGS) and phylogenetics has begun to reveal the global genetic diversity of this pathogen. The evolution of A. baumannii has largely been defined by recombination, punctuated by the emergence and proliferation of defined clonal lineages. In this study we sequenced seven genomes from the sequence type (ST)25 lineage and compared them to 12 ST25 genomes deposited in public databases. A recombination analysis identified multiple genomic regions that are homoplasious in the ST25 phylogeny, indicating active or historical recombination. Genes associated with antimicrobial resistance were differentially distributed between ST25 genomes, which matched our laboratory-based antimicrobial susceptibility typing. Differences were also observed in biofilm formation between ST25 isolates, which were demonstrated to produce significantly more extensive biofilm than an isolate from the ST1 clonal lineage. These results demonstrate that within A. baumannii, even a fairly recently derived monophyletic lineage can still exhibit significant genotypic and phenotypic diversity. These results have implications for associating outbreaks with sequence typing as well as understanding mechanisms behind the global propagation of successful A. baumannii lineages. PMID:26462752

  17. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace

    PubMed Central

    Roca, Ignasi; Espinal, Paula; Vila-Farrés, Xavier; Vila, Jordi

    2012-01-01

    During the past few decades Acinetobacter baumannii has evolved from being a commensal dweller of health-care facilities to constitute one of the most annoying pathogens responsible for hospitalary outbreaks and it is currently considered one of the most important nosocomial pathogens. In a prevalence study of infections in intensive care units conducted among 75 countries of the five continents, this microorganism was found to be the fifth most common pathogen. Two main features contribute to the success of A. baumannii: (i) A. baumannii exhibits an outstanding ability to accumulate a great variety of resistance mechanisms acquired by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, integrons, transposons, or resistant islands, making this microorganism multi- or pan-drug-resistant and (ii) The ability to survive in the environment during prolonged periods of time which, combined with its innate resistance to desiccation and disinfectants, makes A. baumannii almost impossible to eradicate from the clinical setting. In addition, its ability to produce biofilm greatly contributes to both persistence and resistance. In this review, the pathogenesis of the infections caused by this microorganism as well as the molecular bases of antibacterial resistance and clinical aspects such as treatment and potential future therapeutic strategies are discussed in depth. PMID:22536199

  18. Thai ethnomedicinal plants as resistant modifying agents for combating Acinetobacter baumannii infections

    PubMed Central

    2012-01-01

    Abstracts Background Acinetobacter baumannii is well-recognized as an important nosocomial pathogen, however, due to their intrinsic resistance to several antibiotics, treatment options are limited. Synergistic effects between antibiotics and medicinal plants, particularly their active components, have intensively been studied as alternative approaches. Methods Fifty-one ethanol extracts obtained from 44 different selected medicinal plant species were tested for resistance modifying agents (RMAs) of novobiocin against A. baumannii using growth inhibition assay. Results At 250 μg/ml, Holarrhena antidysenterica, Punica granatum, Quisqualis indica, Terminalia bellirica, Terminalia chebula, and Terminalia sp. that possessed low intrinsic antibacterial activity significantly enhanced the activity of novobiocin at 1 μg/ml (1/8xminimum inhibitory concentration) against this pathogen. Holarrhena antidysenterica at 7.8 μg/ml demonstrated remarkable resistant modifying ability against A. baumannii in combination with novobiocin. The phytochemical study revealed that constituents of this medicinal plant contain alkaloids, condensed tannins, and triterpenoids. Conclusion The use of Holarrhena antidysenterica in combination with novobiocin provides an effective alternative treatment for multidrug resistant A. baumannii infections. PMID:22536985

  19. Differential Role of the T6SS in Acinetobacter baumannii Virulence

    PubMed Central

    Foucault-Grunenwald, Marie-Laure; Borges, Vitor; Charpentier, Xavier; Limansky, Adriana S.; Gomes, João Paulo; Viale, Alejandro M.; Salcedo, Suzana P.

    2015-01-01

    Gram-negative bacteria, such as Acinetobacter baumannii, are an increasing burden in hospitals worldwide with an alarming spread of multi-drug resistant (MDR) strains. Herein, we compared a type strain (ATCC17978), a non-clinical isolate (DSM30011) and MDR strains of A. baumannii implicated in hospital outbreaks (Ab242, Ab244 and Ab825), revealing distinct patterns of type VI secretion system (T6SS) functionality. The T6SS genomic locus is present and was actively transcribed in all of the above strains. However, only the A. baumannii DSM30011 strain was capable of killing Escherichia coli in a T6SS-dependent manner, unlike the clinical isolates, which failed to display an active T6SS in vitro. In addition, DSM30011 was able to outcompete ATCC17978 as well as Pseudomonas aeruginosa and Klebsiella pneumoniae, bacterial pathogens relevant in mixed nosocomial infections. Finally, we found that the T6SS of DSM30011 is required for host colonization of the model organism Galleria mellonella suggesting that this system could play an important role in A. baumannii virulence in a strain-specific manner. PMID:26401654

  20. Global evolution of multidrug-resistant Acinetobacter baumannii clonal lineages.

    PubMed

    Zarrilli, Raffaele; Pournaras, Spyros; Giannouli, Maria; Tsakris, Athanassios

    2013-01-01

    The rapid expansion of Acinetobacter baumannii clinical isolates exhibiting resistance to carbapenems and most or all available antibiotics during the last decade is a worrying evolution. The apparent predominance of a few successful multidrug-resistant lineages worldwide underlines the importance of elucidating the mode of spread and the epidemiology of A. baumannii isolates in single hospitals, at a country-wide level and on a global scale. The evolutionary advantage of the dominant clonal lineages relies on the capability of the A. baumannii pangenome to incorporate resistance determinants. In particular, the simultaneous presence of divergent strains of the international clone II and their increasing prevalence in international hospitals further support the ongoing adaptation of this lineage to the hospital environment. Indeed, genomic and genetic studies have elucidated the role of mobile genetic elements in the transfer of antibiotic resistance genes and substantiate the rate of genetic alterations associated with acquisition in A. baumannii of various resistance genes, including OXA- and metallo-β-lactamase-type carbapenemase genes. The significance of single nucleotide polymorphisms and transposon mutagenesis in the evolution of A. baumannii has been also documented. Establishment of a network of reference laboratories in different countries would generate a more complete picture and a fuller understanding of the importance of high-risk A. baumannii clones in the international dissemination of antibiotic resistance. PMID:23127486

  1. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.

    PubMed

    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu

    2016-07-01

    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital. PMID:27236843

  2. Membrane proteomes of Pseudomonas aeruginosa and Acinetobacter baumannii.

    PubMed

    Dé, E; Cosette, P; Coquet, L; Siroy, A; Alexandre, S; Duncan, A; Naudin, B; Rihouey, C; Schaumann, A; Junter, G A; Jouenne, T

    2011-12-01

    Acinetobacter baumannii and Pseudomonas aeruginosa are known for their intrinsic resistance to antibiotics. Between mechanisms involved in this resistance, diminished expression of outer membrane proteins and up-regulation of efflux pumps play an important role. The characterization of membrane proteins is consequently necessary because of their importance in the antibiotic resistance but also in virulence. This review presents proteomic investigations aiming to describe the protein content of the membranes of these two bacterial species. PMID:19942379

  3. First report of OXA-72 producing Acinetobacter baumannii in Romania.

    PubMed

    Georgescu, M; Gheorghe, I; Dudu, A; Czobor, I; Costache, M; Cristea, V-C; Lazăr, V; Chifiriuc, M C

    2016-09-01

    This is the first report of an OXA-72-producing Acinetobacter baumannii strain in Romania, isolated from chronic leg ulcer samples. Identification of the strain was performed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Presence of carbapenem resistance genes was investigated by PCR and sequencing. Our data support the spread of the bla OXA-72 gene in Eastern Europe. PMID:27547405

  4. The Response of Acinetobacter baumannii to Zinc Starvation.

    PubMed

    Nairn, Brittany L; Lonergan, Zachery R; Wang, Jiefei; Braymer, Joseph J; Zhang, Yaofang; Calcutt, M Wade; Lisher, John P; Gilston, Benjamin A; Chazin, Walter J; de Crécy-Lagard, Valerie; Giedroc, David P; Skaar, Eric P

    2016-06-01

    Zinc (Zn) is an essential metal that vertebrates sequester from pathogens to protect against infection. Investigating the opportunistic pathogen Acinetobacter baumannii's response to Zn starvation, we identified a putative Zn metallochaperone, ZigA, which binds Zn and is required for bacterial growth under Zn-limiting conditions and for disseminated infection in mice. ZigA is encoded adjacent to the histidine (His) utilization (Hut) system. The His ammonia-lyase HutH binds Zn very tightly only in the presence of high His and makes Zn bioavailable through His catabolism. The released Zn enables A. baumannii to combat host-imposed Zn starvation. These results demonstrate that A. baumannii employs several mechanisms to ensure bioavailability of Zn during infection, with ZigA functioning predominately during Zn starvation, but HutH operating in both Zn-deplete and -replete conditions to mobilize a labile His-Zn pool. PMID:27281572

  5. Stress responses in the opportunistic pathogen Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E; Actis, Luis A

    2013-01-01

    Acinetobacter baumannii causes a wide range of severe infections among compromised and injured patients worldwide. The relevance of these infections are, in part, due to the ability of this pathogen to sense and react to environmental and host stress signals, allowing it to persist and disseminate in medical settings and the human host. This review summarizes current knowledge on the roles that environmental and cellular stressors play in the ability of A. baumannii to resist nutrient deprivation, oxidative and nitrosative injury, and even the presence of the commonly used antiseptic ethanol, which could serve as a nutrient- and virulence-enhancing signal rather than just being a convenient disinfectant. Emerging experimental evidence supports the role of some of these responses in the pathogenesis of the infections A. baumannii causes in humans and its capacity to resist antibiotics and host response effectors. PMID:23464372

  6. Draft genome sequence of a multidrug-resistant blaOXA-23-producing Acinetobacter baumannii ST208 isolate from China.

    PubMed

    Chen, Yan; Wu, Liyan; Chen, Yu; Xu, Zhijun; Xu, Liqun

    2016-03-01

    Acinetobacter baumannii has emerged worldwide as an important opportunistic nosocomial pathogen and has become a major public health concern. In this study, the draft genome sequence of A. baumannii TCM331 (ST208/CC92), a multidrug-resistant (MDR) isolate harbouring the blaOXA-23 gene isolated in China, was determined. The genome of TCM331 was sequenced via Illumina HiSeq™ 2000, and bioinformatics analysis was performed. Important antimicrobial resistance determinants were observed in an estimated genome size of 4,058,691bp with 3838 predicted coding regions. In conclusion, these data might facilitate further understanding of the specific genomic features of MDR A. baumannii in China. PMID:27436391

  7. Molecular Epidemiology and Mechanisms of Tigecycline Resistance in Clinical Isolates of Acinetobacter baumannii from a Chinese University Hospital

    PubMed Central

    Deng, Mei; Zhu, Man-Hua; Li, Jun-Jie; Bi, Sheng; Sheng, Zi-Ke; Hu, Fei-Shu; Zhang, Jia-Jie; Chen, Wei; Xue, Xiao-Wei; Li, Lan-Juan

    2014-01-01

    Because of its remarkable ability to acquire antibiotic resistance and to survive in nosocomial environments, Acinetobacter baumannii has become a significant nosocomial infectious agent worldwide. Tigecycline is one of the few therapeutic options for treating infections caused by A. baumannii isolates. However, tigecycline resistance has increasingly been reported. Our aim was to assess the prevalence and characteristics of efflux-based tigecycline resistance in clinical isolates of A. baumannii collected from a hospital in China. A total of 74 A. baumannii isolates, including 64 tigecycline-nonsusceptible A. baumannii (TNAB) and 10 tigecycline-susceptible A. baumannii (TSAB) isolates, were analyzed. The majority of them were determined to be positive for adeABC, adeRS, adeIJK, and abeM, while the adeE gene was found in only one TSAB isolate. Compared with the levels in TSAB isolates, the mean expression levels of adeB, adeJ, adeG, and abeM in TNAB isolates were observed to increase 29-, 3-, 0.7-, and 1-fold, respectively. The efflux pump inhibitors (EPIs) phenyl-arginine-β-naphthylamide (PAβN) and carbonyl cyanide 3-chlorophenylhydrazone (CCCP) could partially reverse the resistance pattern of tigecycline. Moreover, the tetX1 gene was detected in 12 (18.8%) TNAB isolates. To our knowledge, this is the first report of the tetX1 gene being detected in A. baumannii isolates. ST208 and ST191, which both clustered into clonal complex 92 (CC92), were the predominant sequence types (STs). This study showed that the active efflux pump AdeABC appeared to play important roles in the tigecycline resistance of A. baumannii. The dissemination of TNAB isolates in our hospital is attributable mainly to the spread of CC92. PMID:24165187

  8. Identification of an Acinetobacter baumannii Zinc Acquisition System that Facilitates Resistance to Calprotectin-mediated Zinc Sequestration

    PubMed Central

    Hood, M. Indriati; Mortensen, Brittany L.; Moore, Jessica L.; Zhang, Yaofang; Kehl-Fie, Thomas E.; Sugitani, Norie; Chazin, Walter J.; Caprioli, Richard M.; Skaar, Eric P.

    2012-01-01

    Acinetobacter baumannii is an important nosocomial pathogen that accounts for up to 20 percent of infections in intensive care units worldwide. Furthermore, A. baumannii strains have emerged that are resistant to all available antimicrobials. These facts highlight the dire need for new therapeutic strategies to combat this growing public health threat. Given the critical role for transition metals at the pathogen-host interface, interrogating the role for these metals in A. baumannii physiology and pathogenesis could elucidate novel therapeutic strategies. Toward this end, the role for calprotectin- (CP)-mediated chelation of manganese (Mn) and zinc (Zn) in defense against A. baumannii was investigated. These experiments revealed that CP inhibits A. baumannii growth in vitro through chelation of Mn and Zn. Consistent with these in vitro data, Imaging Mass Spectrometry revealed that CP accompanies neutrophil recruitment to the lung and accumulates at foci of infection in a murine model of A. baumannii pneumonia. CP contributes to host survival and control of bacterial replication in the lung and limits dissemination to secondary sites. Using CP as a probe identified an A. baumannii Zn acquisition system that contributes to Zn uptake, enabling this organism to resist CP-mediated metal chelation, which enhances pathogenesis. Moreover, evidence is provided that Zn uptake across the outer membrane is an energy-dependent process in A. baumannii. Finally, it is shown that Zn limitation reverses carbapenem resistance in multidrug resistant A. baumannii underscoring the clinical relevance of these findings. Taken together, these data establish Zn acquisition systems as viable therapeutic targets to combat multidrug resistant A. baumannii infections. PMID:23236280

  9. Synergistic effects of sulbactam in multi-drug-resistant Acinetobacter baumannii.

    PubMed

    Temocin, Fatih; Erdinc, Fatma Sebnem; Tulek, Necla; Demirelli, Meryem; Ertem, Gunay; Kinikli, Sami; Koksal, Eda

    2015-01-01

    Acinetobacter baumannii is a frequently isolated etiologic agent of nosocomial infections, especially in intensive care units. With the increase in multi-drug resistance of A. baumannii isolates, finding appropriate treatment alternatives for infections caused by these bacteria has become more difficult, and available alternate treatments include the use of older antibiotics such as colistin or a combination of antibiotics. The current study aimed to evaluate the in vitro efficacy of various antibiotic combinations against multi-drug resistant A. baumannii strains. Thirty multi-drug and carbapenem resistant A. baumannii strains isolated at the Ankara Training and Research Hospital between June 2011 and June 2012 were used in the study. Antibiotic susceptibility tests and species-level identification were performed using conventional methods and the VITEK 2 system. The effects of meropenem, ciprofloxacin, amikacin, tigecycline, and colistin alone and in combination with sulbactam against the isolates were studied using Etest (bioMérieux) in Mueller-Hinton agar medium. Fractional inhibitory concentration index (FIC) was used to determine the efficacy of the various combinations. While all combinations showed a predominant indifferent effect, a synergistic effect was also observed in 4 of the 5 combinations. Synergy was demonstrated in 43% of the isolates with the meropenem-sulbactam combination, in 27% of the isolates with tigecycline-sulbactam, and in 17% of the isolates with colistin-sulbactam and amikacin-sulbactam. No synergy was detected with the sulbactam-ciprofloxacin combination and antagonism was detected only in the sulbactam-colistin combination (6.66% of the isolates). Antibiotic combinations can be used as an alternative treatment approach in multi-drug resistant A. baumannii infections. PMID:26691470

  10. Immunization against Multidrug-Resistant Acinetobacter baumannii Effectively Protects Mice in both Pneumonia and Sepsis Models

    PubMed Central

    Huang, Weiwei; Yao, Yufeng; Long, Qiong; Yang, Xu; Sun, Wenjia; Liu, Cunbao; Jin, Xiaomei; li, Yang; Chu, Xiaojie; Chen, Bin; Ma, Yanbing

    2014-01-01

    Objective Acinetobacter baumannii is considered the prototypical example of a multi- or pan- drug-resistant bacterium. It has been increasingly implicated as a major cause of nosocomial and community-associated infections. This study proposed to evaluate the efficacy of immunological approaches to prevent and treat A. baumannii infections. Methods Mice were immunized with outer membrane vesicles (OMVs) prepared from a clinically isolated multidrug-resistant strain of A. baumannii. Pneumonia and sepsis models were used to evaluate the efficacy of active and passive immunization with OMVs. The probable effective mechanisms and the protective potential of clonally distinct clinical isolates were investigated in vitro using an opsonophagocytic assay. Results Intramuscular immunization with OMVs rapidly produced high levels of OMV-specific IgG antibodies, and subsequent intranasal challenge with A. baumannii elicited mucosal IgA and IgG responses. Both active and passive immunization protected the mice from challenges with homologue bacteria in a sepsis model. Bacterial burden in bronchoalveolar lavage fluids (BALF), lung, and spleen, inflammatory cell infiltration in BALF and lung, and inflammatory cytokine accumulation in BALF was significantly suppressed in the pneumonia model by both active and passive immunization strategies. The antisera from immunized mice presented with significant opsonophagocytic activities in a dose-dependent manner against not only homologous strains but also five of the other six clonally distinct clinical isolates. Conclusions Utilizing immunological characteristics of outer membrane proteins to elevate protective immunity and circumvent complex multidrug-resistance mechanisms might be a viable approach to effectively control A. baumannii infections. PMID:24956279

  11. Risk Factors and Clinical Outcomes for Patients With Acinetobacter baumannii Bacteremia

    PubMed Central

    Gu, Zhenyang; Han, Yuliang; Meng, Taojiang; Zhao, Shasha; Zhao, Xiaoli; Gao, Chunji; Huang, Wenrong

    2016-01-01

    Abstract Acinetobacter (A.) baumannii, an opportunistic nosocomial pathogen that can cause significant morbidity and mortality, has emerged as a worldwide problem. This study aimed to analyze the clinical features and outcomes of patients with A. baumannii bacteremia and determine the factors influencing survival by using 14-day mortality as the primary endpoint. A 6-year retrospective study of 122 cases with monomicrobial A. baumannii bacteremia was conducted in Chinese People's Liberation Army (PLA) General Hospital from January 2008 to April 2014. Predictors of 14-day mortality were identified by logistic regression analysis. The overall 14-day mortality rate was 40.2% (49 of 122 patients). Multivariable analysis revealed that independent predictors of 14-day mortality included severity of illness defined by Pitt Bacteremia Score (PBS) (odds ratio [OR], 0.46; 95% confidence interval [CI], 0.340–0.619; P < 0.001), neutropenia (OR, 18.02; 95% CI, 1.667–194.67; P = 0.017), and malignancy (OR, 4.63; 95% CI, 1.292–16.588; P = 0.019). The effect of malignancy was influenced by neutropenia (OR for interaction term, 1.60; 95% CI, 1.15–2.22; P = 0.005). A subgroup analysis revealed that 14-day mortality rate for patients with underlying hematological malignancies and solid tumors was 75% (12/16) and 40% (12/30), respectively. Survival analysis revealed that mortality in patients with hematological malignancies was higher than that in patients with solid tumors (P = 0.032). The outcomes of patients with A. baumannii bacteremia were related to PBS, neutropenia, and malignancy. Compared with solid tumors, patients with hematological malignancies had a higher mortality in the setting of A. baumannii bacteremia. PMID:26945403

  12. Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

    PubMed Central

    Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

    2015-01-01

    Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

  13. Intraspecies Transfer of the Chromosomal Acinetobacter baumannii blaNDM-1 Carbapenemase Gene.

    PubMed

    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Bontron, Séverine; Sczyrba, Alexander; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent; Schlüter, Andreas

    2016-05-01

    The species Acinetobacter baumannii is one of the most important multidrug-resistant human pathogens. To determine its virulence and antibiotic resistance determinants, the genome of the nosocomial blaNDM-1-positive A. baumannii strain R2090 originating from Egypt was completely sequenced. Genome analysis revealed that strain R2090 is highly related to the community-acquired Australian A. baumannii strain D1279779. The two strains belong to sequence type 267 (ST267). Isolate R2090 harbored the chromosomally integrated transposon Tn125 carrying the carbapenemase gene blaNDM-1 that is not present in the D1279779 genome. To test the transferability of the metallo-β-lactamase (MBL) gene region, the clinical isolate R2090 was mated with the susceptible A. baumannii recipient CIP 70.10, and the carbapenem-resistant derivative R2091 was obtained. Genome sequencing of the R2091 derivative revealed that it had received an approximately 66-kb region comprising the transposon Tn125 embedding the blaNDM-1 gene. This region had integrated into the chromosome of the recipient strain CIP 70.10. From the four known mechanisms for horizontal gene transfer (conjugation, outer membrane vesicle-mediated transfer, transformation, and transduction), conjugation could be ruled out, since strain R2090 lacks any plasmid, and a type IV secretion system is not encoded in its chromosome. However, strain R2090 possesses three putative prophages, two of which were predicted to be complete and therefore functional. Accordingly, it was supposed that the transfer of the resistance gene region from the clinical isolate R2090 to the recipient occurred by general transduction facilitated by one of the prophages present in the R2090 genome. Hence, phage-mediated transduction has to be taken into account for the dissemination of antibiotic resistance genes within the species A. baumannii. PMID:26953198

  14. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel.

    PubMed

    Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A

    2016-01-01

    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  15. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel

    PubMed Central

    Arivett, Brock A.; Ream, Dave C.; Fiester, Steven E.; Kidane, Destaalem

    2016-01-01

    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  16. Synergistic Effects and Antibiofilm Properties of Chimeric Peptides against Multidrug-Resistant Acinetobacter baumannii Strains

    PubMed Central

    Gopal, Ramamourthy; Kim, Young Gwon; Lee, Jun Ho; Lee, Seog Ki; Chae, Jeong Don; Son, Byoung Kwan; Seo, Chang Ho

    2014-01-01

    The increasing prevalence of drug-resistant pathogens highlights the need to identify novel antibiotics. Here we investigated the efficacies of four new antimicrobial peptides (AMPs) for potential drug development. The antibacterial activities, synergistic effects, and antibiofilm properties of the four chimeric AMPs were tested against Acinetobacter baumannii, an emerging Gram-negative, nosocomial, drug-resistant pathogen. Nineteen A. baumannii strains resistant to ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin were isolated at a hospital from patients with cholelithiasis. All four peptides exhibited significant antibacterial effects (MIC = 3.12 to 12.5 μM) against all 19 strains, whereas five commercial antibiotics showed little or no activity against the same pathogens. An exception was polymyxin, which was effective against all of the strains tested. Each of the peptides showed synergy against one or more strains when administered in combination with cefotaxime, ciprofloxacin, or erythromycin. The peptides also exhibited an ability to prevent biofilm formation, which was not seen with cefotaxime, ciprofloxacin, or erythromycin, though polymyxin also inhibited biofilm formation. Indeed, when administered in combination with ciprofloxacin, the AMP HPMA exerted a potent synergistic effect against A. baumannii biofilm formation. Collectively, our findings indicate that the AMPs tested have no cytotoxicity but possess potent antibacterial and antibiofilm activities and may act synergistically with commercial antibiotics. PMID:24366740

  17. Treatment of multidrug-resistant Acinetobacter baumannii meningitis with ampicillin/sulbactam.

    PubMed

    Jiménez-Mejías, M E; Pachón, J; Becerril, B; Palomino-Nicás, J; Rodríguez-Cobacho, A; Revuelta, M

    1997-05-01

    The clinical features and the outcomes of eight cases of nosocomial Acinetobacter baumannii meningitis treated with ampicillin/sulbactam are reported. All the patients had fever, neck stiffness or meningeal signs, and a low consciousness level, and in their cerebrospinal fluid (CSF), pleocytosis, a low glucose level, and an elevated protein level were noted. For all CSF isolates of A. baumannii, the MIC of ampicillin/sulbactam was < or = 8/4 microg/mL. The MICs of sulbactam by microdilution in two cases were 4 microg/mL. All isolates were resistant to cefotaxime, ceftriaxone, ceftazidime, ureidopenicillins, ciprofloxacin, and gentamicin. Seven isolates were resistant to imipenem. A. baumannii was isolated from other samples in seven episodes. All patients were treated with ampicillin/sulbactam (seven with 2 g/l g every 6 hours and one with 2 g/l g every 8 hours). Six patients were cured and two patients died of meningitis. There were no side effects with the ampicillin/sulbactam treatment. In conclusion, ampicillin/sulbactam may be effective as therapy for meningitis caused by A. baumanii resistant to imipenem and other beta-lactam drugs. PMID:9142795

  18. Molecular Epidemiology and Characterization of Genotypes of Acinetobacter baumannii Isolates from Regions of South China.

    PubMed

    Ying, Jun; Lu, Junwan; Zong, Li; Li, Ailing; Pan, Ruowang; Cheng, Cong; Li, Kunpeng; Chen, Liqiang; Ying, Jianchao; Tou, Huifen; Zhu, Chuanxin; Xu, Teng; Yi, Huiguang; Li, Jinsong; Ni, Liyan; Xu, Zuyuan; Bao, Qiyu; Li, Peizhen

    2016-05-20

    The aim of this study was to analyze the molecular epidemiologic characteristics of Acinetobacter baumannii. A total of 398 isolates were collected in 7 regions of South China from January to June of 2012. Drug sensitivity was tested toward 15 commonly used antibiotics; thus, 146 multi-drug-resistant strains (resistant to more than 7 drugs) were identified, representing 36.7% of all isolates. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for molecular subtyping. According to the PFGE results (with a cutoff of 70% similarity for the DNA electrophoretic bands), 146 strains were subdivided into 15 clusters, with cluster A being the largest (33.6%, distributed in all districts except Jiaxing). Cluster B was also widespread and included 14.4% of all strains. In addition, MLST results revealed 11 sequence types (ST), with ST208 being the most prevalent, followed by ST191 and ST729. Furthermore, 4 novel alleles and 6 novel STs were identified. Our results showed that multi-drug-resistant A. baumannii in South China shares the origin with other widespread strains in other countries. The nosocomial infections caused by A. baumannii have been severe in South China. Continuous monitoring and judicious antibiotic use are required. PMID:26166496

  19. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  20. Microbicides Alter the Expression and Function of RND-Type Efflux Pump AdeABC in Biofilm-Associated Cells of Acinetobacter baumannii Clinical Isolates.

    PubMed

    Krishnamoorthy, Suvarna; Shah, Bhavikkumar P; Lee, Hiu Ham; Martinez, Luis R

    2016-01-01

    Acinetobacter baumannii is a Gram-negative bacterium that causes nosocomial infections worldwide. This microbe's propensity to form biofilms allows it to persist and to survive on clinical abiotic surfaces for long periods. In fact, A. baumannii biofilm formation and its multidrug-resistant nature severely compromise our capacity to care for patients in hospital environments. In contrast, microbicides such as cetrimide (CT) and chlorhexidine (CHX) play important roles in the prevention and treatment of infections. We assessed the efficacy of CT and CHX, either alone or in combination, in eradicating A. baumannii biofilms formed by clinical isolates, by using stainless steel washers to mimic hard abiotic surfaces found in hospital settings. We demonstrated that increasing amounts of each microbicide, alone or in combination, were able to damage and to reduce the viability of A. baumannii biofilms efficaciously. Interestingly, the adeB gene of the resistance-nodulation-cell division (RND) family is predominantly associated with acquired resistance to antimicrobials in A. baumannii. We showed that CT and CHX adversely modified the expression and function of the RND-type efflux pump AdeABC in biofilm-associated A. baumannii cells. Furthermore, we established that these microbicides decreased the negative charges on A. baumannii cell membranes, causing dysregulation of the efflux pump and leading to cell death. Our findings suggest that CT and CHX, alone or in combination, can be used efficaciously for eradication of A. baumannii from hospital surfaces, in order to reduce infections caused by this nosocomial agent. PMID:26459900

  1. Early detection of metallo-β-lactamase NDM-1- and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals.

    PubMed

    Mathlouthi, Najla; El Salabi, Allaaeddin Ali; Ben Jomàa-Jemili, Mariem; Bakour, Sofiane; Al-Bayssari, Charbel; Zorgani, Abdulaziz A; Kraiema, Abdulmajeed; Elahmer, Omar; Okdah, Liliane; Rolain, Jean-Marc; Chouchani, Chedly

    2016-07-01

    Acinetobacter baumannii is an opportunistic pathogen causing various nosocomial infections. The aim of this study was to characterise the molecular support of carbapenem-resistant A. baumannii clinical isolates recovered from two Libyan hospitals. Bacterial isolates were identified by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF/MS). Antibiotic susceptibility testing was performed using disk diffusion and Etest methods, and carbapenem resistance determinants were studied by PCR amplification and sequencing. Multilocus sequence typing (MLST) was performed for typing of the isolates. All 36 imipenem-resistant isolates tested were identified as A. baumannii. The blaOXA-23 gene was detected in 29 strains (80.6%). The metallo-β-lactamase blaNDM-1 gene was detected in eight isolates (22.2%), showing dissemination of multidrug-resistant (MDR) A. baumannii in Tripoli Medical Center and Burn and Plastic Surgery Hospital in Libya, including one isolate that co-expressed the blaOXA-23 gene. MLST revealed several sequence types (STs). Imipenem-resistant A. baumannii ST2 was the predominant clone (16/36; 44.4%). This study shows that NDM-1 and OXA-23 contribute to antibiotic resistance in Libyan hospitals and represents the first incidence of the association of these two carbapenemases in an autochthonous MDR A. baumannii isolated from patients in Libya, indicating that there is a longstanding infection control problem in these hospitals. PMID:27216382

  2. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons.

    PubMed

    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia

    2010-01-01

    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection. PMID:20871867

  3. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens.

    PubMed

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa

    2015-01-01

    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  4. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens

    PubMed Central

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa

    2015-01-01

    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  5. [Antibiotic resistance of Acinetobacter baumannii strains isolated from clinical specimens in the "Marius Nasta" Pneumology Institute, Bucharest].

    PubMed

    Moisoiu, Adriana; Ionită, Monica; Sârbu, Lăcrămioara; Stoica, Corina; Grigoriu, Liliana

    2014-01-01

    Acinetobacter baumannii (A. baumannii) is one of the leading causes of morbidity and mortality in patients who are in critical condition in hospitals and especially in intensive care units (ICU). Long time considered a bacterium with low virulence, A. baumannii has more recently become a cause for major concern in clinical practice due to its high level of antimicrobial resistance. The extend of infections with Acinetobacter baumannii in ICU is caused by multiple factors, such as mechanical ventilation, invasive procedures, the use of a large number of broad spectrum antibiotics and transmission through the hands of medical staff In this study we evaluated the resistance to antibiotics of 213 non-duplicated strains of A. baumannii isolated in the bacteriology laboratory of the "Marius Nasta" lnstitute of Pneumophtisiology (IPMN) from January 2012 to December 2013. These strains originated from patients in medical wards (56), ICU (143) and surgery (14). Strains identification was performed by classical methods on multitest media and with API kits (Bio Merieux). The antibiotic sensitivity was performed on Mueller-Hinton media in accordance with CLSI2013. Analysis of the resistance to antibiotics was the following: carbenicilin (87.3%), ceftriaxone (87.3%), cefoperazone with sulbactam (84.9%), ceftazidime (79.3%), carbapenems (imipenem and/or meropenem--75.1%), fluoroquinolones (ciprofloxacin and/orlevofloxacin--73.7%), cefepime (66.6%), piperacilin with tazobactam (62.4%), amikacin (50.2%), netilmicin (45%), gentamicin (42.7%) and tobramycin (35.6%). In our study, we only found two strains of Acinetobacter baumannii with resistance to colistin and 70 (32.8%) strains sensitive only to colistin, but resistant to all other antibiotics tested. A. baumannii is a pathogen with rapid spread and extended resistance to even newer antimicrobial agents. Due to its ability to survive in the hospital environment, A. baumannii has the immense potential to cause nosocomial

  6. Host resistance to intranasal Acinetobacter baumannii reinfection in mice.

    PubMed

    Qiu, Hongyu; Li, Zack; KuoLee, Rhonda; Harris, Greg; Gao, Xiaoling; Yan, Hongbin; Xu, H Howard; Chen, Wangxue

    2016-07-01

    Acinetobacter baumannii is a major causative agent of healthcare-associated infection and develops multidrug resistance rapidly. However, little is known in the host defense mechanisms against this infection. In this study, we examined if mice recovered from a previous intranasal A. baumannii infection (recovered mice) are fully protected against a subsequent reinfection. We found that, despite the presence of specific serum IgG and mucosal IgA responses prior to the reinfection, the recovered mice were only marginally better protected against intranasal challenge with low doses of homologous or heterologous A. baumannii strains than the naïve mice. Post-challenge immune and inflammatory (cells and cytokines) responses were generally comparable between recovered and naïve mice although the recovered mice produced significantly higher amounts of IFN-γ and IL-17 and had higher percentages and numbers of resident lung CD44(hi)CD62L(-)CD4(+) and CD19(+) B lymphocytes. Taken together, our results suggest that mice recovered from a previous A. baumannii infection remain susceptible to reinfection, indicating the complexity of immune protection mechanism for this Gram-negative, multidrug-resistant emerging pathogen. PMID:27194730

  7. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside

    PubMed Central

    Lin, Ming-Feng; Lan, Chung-Yu

    2014-01-01

    Acinetobacter baumannii (A. baumannii) is undoubtedly one of the most successful pathogens in the modern healthcare system. With invasive procedures, antibiotic use and immunocompromised hosts increasing in recent years, A. baumannii has become endemic in hospitals due to its versatile genetic machinery, which allows it to quickly evolve resistance factors, and to its remarkable ability to tolerate harsh environments. Infections and outbreaks caused by multidrug-resistant A. baumannii (MDRAB) are prevalent and have been reported worldwide over the past twenty or more years. To address this problem effectively, knowledge of species identification, typing methods, clinical manifestations, risk factors, and virulence factors is essential. The global epidemiology of MDRAB is monitored by persistent surveillance programs. Because few effective antibiotics are available, clinicians often face serious challenges when treating patients with MDRAB. Therefore, a deep understanding of the resistance mechanisms used by MDRAB can shed light on two possible strategies to combat the dissemination of antimicrobial resistance: stringent infection control and antibiotic treatments, of which colistin-based combination therapy is the mainstream strategy. However, due to the current unsatisfying therapeutic outcomes, there is a great need to develop and evaluate the efficacy of new antibiotics and to understand the role of other potential alternatives, such as antimicrobial peptides, in the treatment of MDRAB infections. PMID:25516853

  8. Antimicrobial susceptibility of clinical isolates of Acinetobacter baumannii.

    PubMed

    Shi, Z Y; Liu, P Y; Lau, Y; Lin, Y; Hu, B S; Shir J-M

    1996-02-01

    The in-vitro activity of 18 antimicrobial agents alone or in combination against 248 clinical isolates of Acinetobacter baumannii from Taiwan were tested by agar dilution. The MIC90S of ampicillin, amoxicillin, piperacillin, cefuroxime, cefotaxime, ceftriaxone, gentamicin, and amikacin were at least 128 mu g/ml. Ceftazidime, cefepime, sulbactam, clavulanic acid, and tazobactam presented moderate activity with MIC90S of 32, 16, 16, 32, and 32 mu g/ml, respectively. The increased activity of ampicillin/sulbactam, amoxicillin/clavulanic acid, and piperacillin/tazobactam was due to the intrinsic effect of sulbactam, clavulanic acid, and tazobactam, respectively. Imipenem, meropenem, and ciprofloxacin were the most active antimicrobial agents with MIC90S of 1, 1, and 0.5 mu g/ml, respectively. Nineteen isolates (7.7%) were resistant to all aminoglycosides and beta-lactam antibiotics, except carbapenems and ciprofloxacin. We are concerned about the multidrug resistance of A. baumannii in this study. PMID:9147913

  9. Antimicrobial susceptibilities of clinical isolates of Acinetobacter baumannii from Singapore.

    PubMed

    Kuah, B G; Kumarasinghe, G; Doran, J; Chang, H R

    1994-10-01

    The in vitro activities of 17 antimicrobial agents alone or in combination against 70 clinical isolates of Acinetobacter baumannii from Singapore were determined by broth microdilution. The MICs of amoxicillin, ampicillin, ceftazidime, ceftriaxone, gentamicin, and piperacillin for 90% of the strains were > or = 128 micrograms/ml. Addition of sulbactam to ampicillin produced improved activity, whereas adding tazobactam to piperacillin did not. The MICs of amikacin, ciprofloxacin, and imipenem for 90% of the strains were 32, 32, and 16 micrograms/ml, respectively. PMID:7840598

  10. Comparative Genomics of Multidrug Resistance in Acinetobacter baumannii

    PubMed Central

    2006-01-01

    Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island—the largest identified to date—in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance. PMID:16415984

  11. Complete genome sequence of Acinetobacter baumannii XH386 (ST208), a multi-drug resistant bacteria isolated from pediatric hospital in China

    PubMed Central

    Fang, Youhong; Quan, Jingjing; Hua, Xiaoting; Feng, Ye; Li, Xi; Wang, Jianfeng; Ruan, Zhi; Shang, Shiqiang; Yu, Yunsong

    2015-01-01

    Acinetobacter baumannii is an important bacterium that emerged as a significant nosocomial pathogen worldwide. The rise of A. baumannii was due to its multi-drug resistance (MDR), while it was difficult to treat multi-drug resistant A. baumannii with antibiotics, especially in pediatric patients for the therapeutic options with antibiotics were quite limited in pediatric patients. A. baumannii ST208 was identified as predominant sequence type of carbapenem resistant A. baumannii in the United States and China. As we knew, there was no complete genome sequence reproted for A. baumannii ST208, although several whole genome shotgun sequences had been reported. Here, we sequenced the 4087-kilobase (kb) chromosome and 112-kb plasmid of A. baumannii XH386 (ST208), which was isolated from a pediatric hospital in China. The genome of A. baumannii XH386 contained 3968 protein-coding genes and 94 RNA-only encoding genes. Genomic analysis and Minimum inhibitory concentration assay showed that A. baumannii XH386 was multi-drug resistant strain, which showed resistance to most of antibiotics, except for tigecycline. The data may be accessed via the GenBank accession number CP010779 and CP010780. PMID:26981403

  12. Pyocyanin stimulates quorum sensing-mediated tolerance to oxidative stress and increases persister cell populations in Acinetobacter baumannii.

    PubMed

    Bhargava, Nidhi; Sharma, Prince; Capalash, Neena

    2014-08-01

    Acinetobacter baumannii and Pseudomonas aeruginosa are nosocomial pathogens with overlapping sites of infection. This work reports that the two can coexist stably in mixed-culture biofilms. In a study intended to improve our understanding of the mechanism of their coexistence, it was found that pyocyanin, produced by P. aeruginosa that generally eliminates competition from other pathogens, led to the generation of reactive oxygen species (ROS) in A. baumannii cells, which in response showed a significant (P ≤ 0.05) increase in production of enzymes, specifically, catalase and superoxide dismutase (SOD). This work shows for the first time that the expression of catalase and SOD is under the control of a quorum-sensing system in A. baumannii. In support of this observation, a quorum-sensing mutant of A. baumannii (abaI::Km) was found to be sensitive to pyocyanin compared to its wild type and showed significantly (P ≤ 0.001) lower levels of the antioxidant enzymes, which increased on addition of 5 μM N-(3-hydroxydodecanoyl)-l-homoserine lactone. Likewise, in wild-type A. baumannii, there was a significant (P < 0.01) decrease in the level of anti-oxidant enzymes in the presence of salicylic acid, a known quencher of quorum sensing. In the presence of amikacin and carbenicillin, A. baumannii formed 0.07 and 0.02% persister cells, which increased 4- and 3-fold, respectively, in the presence of pyocyanin. These findings show that pyocyanin induces a protective mechanism in A. baumannii against oxidative stress and also increases its persistence against antibiotics which could be of clinical significance in the case of coinfections with A. baumannii and P. aeruginosa. PMID:24891106

  13. Pyocyanin Stimulates Quorum Sensing-Mediated Tolerance to Oxidative Stress and Increases Persister Cell Populations in Acinetobacter baumannii

    PubMed Central

    Bhargava, Nidhi; Sharma, Prince

    2014-01-01

    Acinetobacter baumannii and Pseudomonas aeruginosa are nosocomial pathogens with overlapping sites of infection. This work reports that the two can coexist stably in mixed-culture biofilms. In a study intended to improve our understanding of the mechanism of their coexistence, it was found that pyocyanin, produced by P. aeruginosa that generally eliminates competition from other pathogens, led to the generation of reactive oxygen species (ROS) in A. baumannii cells, which in response showed a significant (P ≤ 0.05) increase in production of enzymes, specifically, catalase and superoxide dismutase (SOD). This work shows for the first time that the expression of catalase and SOD is under the control of a quorum-sensing system in A. baumannii. In support of this observation, a quorum-sensing mutant of A. baumannii (abaI::Km) was found to be sensitive to pyocyanin compared to its wild type and showed significantly (P ≤ 0.001) lower levels of the antioxidant enzymes, which increased on addition of 5 μM N-(3-hydroxydodecanoyl)-l-homoserine lactone. Likewise, in wild-type A. baumannii, there was a significant (P < 0.01) decrease in the level of anti-oxidant enzymes in the presence of salicylic acid, a known quencher of quorum sensing. In the presence of amikacin and carbenicillin, A. baumannii formed 0.07 and 0.02% persister cells, which increased 4- and 3-fold, respectively, in the presence of pyocyanin. These findings show that pyocyanin induces a protective mechanism in A. baumannii against oxidative stress and also increases its persistence against antibiotics which could be of clinical significance in the case of coinfections with A. baumannii and P. aeruginosa. PMID:24891106

  14. The first report on the outbreak of OXA-24/40-like carbapenemase-producing Acinetobacter baumannii in Turkey.

    PubMed

    Sarı, Ayşe Nur; Biçmen, Meral; Gülay, Zeynep

    2013-01-01

    Carbapenem resistance due to OXA-type carbapenemases seriously limits therapeutic options in nosocomial infections caused by Acinetobacter baumannii. Previous studies have shown the presence of OXA-51, OXA-58, and OXA-23 carbapenemases but not OXA-24/40 in A. baumannii in Turkey. In this study, we investigated carbapenem-hydrolyzing class D β-lactamases (CHDLs) in A. baumannii and the molecular epidemiology of CHDL producers at the Dokuz Eylul Hospital, Izmir Turkey, and detected blaOXA-24/40 in a clinical isolate from a patient in the medical intensive care unit (ICU). The specific enzyme type was OXA-72. Additional studies revealed 22 more isolates from 20 patients and that the OXA-72-producing strain caused an outbreak in the medical ICU from September 2012 to March 2013, which still continues. To our knowledge, this is the first report of OXA-24/40 carbapenemases in A. baumannii in Turkey. Emergency infection control should be implemented following the arrival of a new OXA at a hospital where A. baumannii is highly endemic. PMID:24047747

  15. Immunoprotective Efficacy of Acinetobacter baumannii Outer Membrane Protein, FilF, Predicted In silico as a Potential Vaccine Candidate

    PubMed Central

    Singh, Ravinder; Garg, Nisha; Shukla, Geeta; Capalash, Neena; Sharma, Prince

    2016-01-01

    Acinetobacter baumannii is emerging as a serious nosocomial pathogen with multidrug resistance that has made it difficult to cure and development of efficacious treatment against this pathogen is direly needed. This has led to investigate vaccine approach to prevent and treat A. baumannii infections. In this work, an outer membrane putative pilus assembly protein, FilF, was predicted as vaccine candidate by in silico analysis of A. baumannii proteome and was found to be conserved among the A. baumannii strains. It was cloned and expressed in E. coli BL21(DE3) and purified by Ni-NTA chromatography. Immunization with FilF generated high antibody titer (>64,000) and provided 50% protection against a standardized lethal dose (108 CFU) of A. baumannii in murine pneumonia model. FilF immunization reduced the bacterial load in lungs by 2 and 4 log cycles, 12 and 24 h post infection as compared to adjuvant control; reduced the levels of pro-inflammatory cytokines TNF-α, IL-6, IL-33, IFN-γ, and IL-1β significantly and histology of lung tissue supported the data by showing considerably reduced damage and infiltration of neutrophils in lungs. These results demonstrate the in vivo validation of immunoprotective efficacy of a protein predicted as a vaccine candidate by in silico proteomic analysis and open the possibilities for exploration of a large array of uncharacterized proteins. PMID:26904021

  16. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii

    PubMed Central

    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong

    2016-01-01

    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  17. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii.

    PubMed

    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong

    2016-01-01

    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  18. Treatment for patients with multidrug resistant Acinetobacter baumannii pulmonary infection

    PubMed Central

    PAN, TAO; LIU, XIAOYUN; XIANG, SHOUGUI; JI, WENLI

    2016-01-01

    Bacterial infections are common but have become increasingly resistant to drugs. The aim of the present study was to examine the combined treatment of traditional Chinese and Western medicine in 30 cases of pulmonary infection with multidrug resistant Acinetobacter baumannii. Patients were divided into groups A and B according to drug treatments. Cefoperazone or sulbactam and tanreqing were administered in group A, and cefoperazone or sulbactam in group B. The curative effect and prognosis of the two groups were recorded and the remaining treatments were performed routinely in the clinic. For the combined therapy group, which was administered sulperazone and tanreqing, 8 patients were recovered, 6 patients had significant effects, 3 patients exhibited some improvement and 1 patient had no response. One of the patients did not survive after 28 days. By contrast, there were 4 patients that were successfully treated, 3 patients with significant effects, 2 patients with some improvement and 2 patients had no response in the sulperazone group, and 4 patients did not survive after 28 days. In conclusion, the combined therapy of cefoperazone or sulbactam supplemented with tanreqing was identified to be more effective than cefoperazone or sulbactam as monotherapy, for treating multidrug resistant Acinetobacter baumannii. PMID:27073447

  19. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection.

    PubMed

    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C James

    2013-05-01

    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  20. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection

    PubMed Central

    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C. James

    2013-01-01

    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  1. Photodynamic therapy for Acinetobacter baumannii burn infections in mice.

    PubMed

    Dai, Tianhong; Tegos, George P; Lu, Zongshun; Huang, Liyi; Zhiyentayev, Timur; Franklin, Michael J; Baer, David G; Hamblin, Michael R

    2009-09-01

    Multidrug-resistant Acinetobacter baumannii infections represent a growing problem, especially in traumatic wounds and burns suffered by military personnel injured in Middle Eastern conflicts. Effective treatment with traditional antibiotics can be extremely difficult, and new antimicrobial approaches are being investigated. One of these alternatives to antimicrobials could be the combination of nontoxic photosensitizers (PSs) and visible light, known as photodynamic therapy (PDT). We report on the establishment of a new mouse model of full-thickness thermal burns infected with a bioluminescent derivative of a clinical Iraqi isolate of A. baumannii and its PDT treatment by topical application of a PS produced by the covalent conjugation of chlorin(e6) to polyethylenimine, followed by illumination of the burn surface with red light. Application of 10(8) A. baumannii cells to the surface of 10-s burns made on the dorsal surface of shaved female BALB/c mice led to chronic infections that lasted, on average, 22 days and that were characterized by a remarkably stable bacterial bioluminescence. PDT carried out on day 0 soon after application of the bacteria gave over 3 log units of loss of bacterial luminescence in a light exposure-dependent manner, while PDT carried out on day 1 and day 2 gave an approximately 1.7-log reduction. The application of PS dissolved in 10% or 20% dimethyl sulfoxide without light gave only a modest reduction in the bacterial luminescence from mouse burns. Some bacterial regrowth in the treated burn was observed but was generally modest. It was also found that PDT did not lead to the inhibition of wound healing. The data suggest that PDT may be an effective new treatment for multidrug-resistant localized A. baumannii infections. PMID:19564369

  2. The rise of carbapenem-resistant Acinetobacter baumannii.

    PubMed

    Evans, Benjamin A; Hamouda, Ahmed; Amyes, Sebastian G B

    2013-01-01

    Acinetobacter spp. are Gram-negative bacteria that have become one of the most difficult pathogens to treat. The species A. baumannii, largely unknown 30 years ago, has risen to prominence particularly because of its ability to cause infections in immunocompromised patients. It is now a predominant pathogen in many hospitals as it has acquired resistance genes to virtually all antibiotics capable of treating Gram-negative bacteria, including the fluoroquinolones and the cephalosporins. Some members of the species have accumulated these resistance genes in large resistance islands, located in a "hot-spot" within the bacterial chromosome. The only conventional remaining treatment options were the carbapenems. However, A. baumannii possesses an inherent class D β-lactamase gene (blaOXA-51-like) that can have the ability to confer carbapenem resistance. Additionally, mechanisms of carbapenem resistance have emerged that derive from the importation of the distantly related class D β-lactamase genes blaOXA-23 and blaOXA-58. Although not inducible, the expression of these genes is controlled by mobile promoters carried on ISAba elements. It has also been found that other resistance genes including the chromosomal class C β-lactamase genes conferring cephalosporin resistance are controlled in the same manner. Colistin is now considered to be the final drug capable of treating infections caused by carbapenem-resistant A. baumannii; however, strains are now being isolated that are resistant to this antibiotic as well. The increasing inability to treat infections caused by A. baumannii ensures that this pathogen more than ranks with MRSA or Clostridium difficile as a threat to modern medicine. PMID:22894617

  3. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System

    PubMed Central

    Ruiz, Federico M.; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio

    2015-01-01

    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen. PMID:26079269

  4. Demonstration of the interactions between aromatic compound-loaded lipid nanocapsules and Acinetobacter baumannii bacterial membrane.

    PubMed

    Montagu, A; Joly-Guillou, M-L; Guillet, C; Bejaud, J; Rossines, E; Saulnier, P

    2016-06-15

    Acinetobacter baumannii is an important nosocomial pathogen that is resistant to many commonly-used antibiotics. One strategy for treatment is the use of aromatic compounds (carvacrol, cinnamaldehyde) against A. baumannii. The aim of this study was to determine the interactions between bacteria and lipid nanocapsules (LNCs) over time based on the fluorescence of 3,3'-Dioctadecyloxacarbocyanine Perchlorate-LNCs (DiO-LNCs) and the properties of trypan blue to analyse the physicochemical mechanisms occurring at the level of the biological membrane. The results demonstrated the capacity of carvacrol-loaded LNCs to interact with and penetrate the bacterial membrane in comparison with cinnamaldehyde-loaded LNCs and unloaded LNCs. Modifications of carvacrol after substitution of hydroxyl functional groups by fatty acids demonstrated the crucial role of hydroxyl functions in antibacterial activity. Finally, after contact with the efflux pump inhibitor, carbonylcyanide-3-chlorophenyl hydrazine (CCCP), the results indicated the total synergistic antibacterial effect with Car-LNCs, showing that CCCP is associated with the action mechanism of carvacrol, especially at the level of the efflux pump mechanism. PMID:27039148

  5. Types and Prevalence of Carbapenem-Resistant Acinetobacter calcoaceticus-Acinetobacter baumannii Complex in Northern Taiwan

    PubMed Central

    Hsieh, Wen-Shyang; Wang, Nai-Yu; Feng, Jou-An; Weng, Li-Chuan

    2014-01-01

    The frequency of the carbapenem-resistant Acinetobacter calcoaceticus-Acinetobacter baumannii (CRACB) complex increases annually in our hospitals. However, the types and prevalence of carbapenemases among isolates still remain unclear. In this study, we identified and collected 672 carbapenem-resistant isolates from a medical center in Northern Taiwan between April and December of 2010. There were 577 genospecies 2 (Acinetobacter baumannii), 79 genospecies 13TU, and 16 genospecies 3 isolates. The isolates had an acquired blaOXA-24-like gene, which was confirmed by sequencing for the encoded OXA-72 carbapenemase, and were often associated with high-level carbapenem resistance. These CRACB complex isolates remained susceptible to colistin (100%). The genotyping of isolates was conducted using pulsed-field gel electrophoresis with ApaI digestion. In most clonally related groups, patients were from both branch hospitals. The results indicate that interhospital dissemination of clones occurred. This study provides updated data on the types and prevalence of the CRACB complex. In addition, it presents a warning on the emergence and spread of CRACB complex harboring blaOXA-24-like genes in northern Taiwan. PMID:24145535

  6. Controlling endemic multidrug-resistant Acinetobacter baumannii in Intensive Care Units using antimicrobial stewardship and infection control

    PubMed Central

    Cheon, Shinhye; Kim, Mi-Ja; Yun, Seon-Jin; Moon, Jae Young; Kim, Yeon-Sook

    2016-01-01

    Background/Aims: Nosocomial infections caused by multidrug-resistant (MDR) Acinetobacter baumannii have become public-health problem. However, few studies have evaluated the control of endemic MDR A. baumannii in Intensive Care Units (ICUs). Therefore, we investigated the effectiveness of antimicrobial stewardship and comprehensive intensified infection control measures for controlling endemic MDR A. baumannii in ICUs at a tertiary care center. Methods: Carbapenem use was strictly restricted through antimicrobial stewardship. Environmental cleaning and disinfection was performed at least 3 times per day in addition to basic infection control measures. Isolation using plastic curtains and contact precautions were applied to patients who were colonized or infected with MDR A. baumannii. The outcome was measured as the incidence density rate of hospital-onset MDR A. baumannii among patients in the ICUs. Results: The incidence density rate of hospital-onset MDR A. baumannii decreased from 22.82 cases per 1,000 patient-days to 2.68 cases per 1,000 patient-days after the interventions were implemented (odds ratio, 0.12; 95% confidence interval, 0.03 to 0.4; p < 0.001). The mean monthly use of carbapenems also decreased from 134.99 ± 82.26 defined daily doses per 1,000 patient-days to 94.85 ± 50.98 defined daily doses per 1,000 patient-days (p = 0.016). Conclusions: Concomitant implementation of strict antimicrobial stewardship and comprehensive infection control measures effectively controlled endemic MDR A. baumannii in our ICUs within 1 year. PMID:26874513

  7. [Distribution of blaOXA genes in Acinetobacter baumannii strains: a multicenter study].

    PubMed

    Ciftci, Ihsan Hakkı; Aşık, Gülşah; Karakeçe, Engin; Oksüz, Lütfiye; Yağcı, Server; Sesli Çetin, Emel; Ozdemir, Mehmet; Atasoy, Ali Rıza; Koçoğlu, Esra; Gül, Mustafa; Kurtoğlu, Muhammet Güzel; Köksal Çakırlar, Fatma; Seyrek, Adnan; Berktaş, Mustafa; Gültepe, Bilge; Ayyildiz, Ahmet

    2013-10-01

    Acinetobacter baumannii is the most important agent of nosocomial infections within the Acinetobacter genus. This gram-negative coccobacillus is intrinsically resistant to many antibiotics used in antimicrobial therapy, and capable of developing resistance including carbapenems. The objective of this study was to develop a multiplex real time polymerase chain reaction (qPCR) kit for OXA subgroups in A.baumannii, and to investigate the distribution of OXA subgroups in A.baumannii strains isolated from geographically different regions of Turkey. A total of 834 A.baumannii clinical isolates collected from different state and university medical centers in 13 provinces (Afyonkarahisar, Ankara, Bolu, Elazig, Erzurum, Isparta, Istanbul, Kahramanmaras, Konya, Sakarya, Van) between 2008-2011, were included in the study. The isolates were identified by conventional methods and automated systems [Vitek2 (bioMerieux, ABD) and Phoenix (BD Diagnostic, MD)]. The susceptibility profiles of the isolates were studied with automated systems and standard disc diffusion method. All samples were subjected to qPCR to detect blaOXA-51-like, blaOXA-23-like and blaOXA-58-like genes. A conventional PCR method was also used to detect blaOXA-24-like gene. The resistance rates observed during the study period were as follows: 96.8% for amoxicillin-clavulanate, 86.8% for ciprofloxacin, 74.7% for gentamicin, 71.7% for amikacin, 73.5% for cefaperozone-sulbactam, 72.1% for imipenem and 73% for meropenem. Six hundred and two (72.2 %) isolates were resistant to both imipenem and meropenem. Colistin was found to be the most effective antibiotic against A.baumannii isolates with 100% susceptibility rate. All isolates were positive for blaOXA-51-like, however blaOXA-24-like gene could not be demonstrated in any isolate. Total positivity rates of blaOXA-23-like and blaOXA-58-like genes were found as 53.7% and 12.5%, respectively, while these rates were 74.4% and 17.3% in carbapenem-resistant isolates

  8. Analysis of drug resistance in 1,861 strains of Acinetobacter baumannii

    PubMed Central

    JIN, HAO; QIU, FAN; JI, HONG JIAN; LU, QIANG

    2016-01-01

    Acinetobacter baumannii is an emerging human pathogen that causes hospital-acquired infections. The trend in increased antimicrobial resistance limits the choice of effective antimicrobial agents. The present study reports the resistance to Acinetobacter baumannii and analyzes the associations between antibiotic use and resistance rates at a general hospital between 2010 and 2014. A total of 1,861 isolates were obtained from clinical cultures, accounting for 10.33% of all detected bacteria (1,861/18,016). The strains were mainly from respiratory samples (1,628 isolates, 87.5%) and the intensive care unit (696 isolates, 37.4%). The resistance rates of Acinetobacter baumannii to the majority of antibiotics were >50%, particularly the resistance rate to cefoperazone/sulbactam increased from 47.37 in 2011 to 89.25% in 2014. However, the rates of imipenem and cilastatin sodium decreased from 81.03 to 69.44% due to the antibiotic policy. There were Pearson significant associations between the use of three antibiotics and resistance in Acinetobacter baumannii to this drug, piperacillin/tazobactam (r=0.976, P<0.01), gentamicin (r=0.870, P<0.01) and cefoxitin (r=0.741, P<0.05). Therefore, a combination of drugs should be adopted to treat Acinetobacter baumannii infections. Microbiology laboratory support and surveillance policies are essential to control the emergence of multidrug-resistance Acinetobacter baumannii. PMID:27073633

  9. Variation in the Complex Carbohydrate Biosynthesis Loci of Acinetobacter baumannii Genomes

    PubMed Central

    Kenyon, Johanna J.; Hall, Ruth M.

    2013-01-01

    Extracellular polysaccharides are major immunogenic components of the bacterial cell envelope. However, little is known about their biosynthesis in the genus Acinetobacter, which includes A. baumannii, an important nosocomial pathogen. Whether Acinetobacter sp. produce a capsule or a lipopolysaccharide carrying an O antigen or both is not resolved. To explore these issues, genes involved in the synthesis of complex polysaccharides were located in 10 complete A. baumannii genome sequences, and the function of each of their products was predicted via comparison to enzymes with a known function. The absence of a gene encoding a WaaL ligase, required to link the carbohydrate polymer to the lipid A-core oligosaccharide (lipooligosaccharide) forming lipopolysaccharide, suggests that only a capsule is produced. Nine distinct arrangements of a large capsule biosynthesis locus, designated KL1 to KL9, were found in the genomes. Three forms of a second, smaller variable locus, likely to be required for synthesis of the outer core of the lipid A-core moiety, were designated OCL1 to OCL3 and also annotated. Each K locus includes genes for capsule export as well as genes for synthesis of activated sugar precursors, and for glycosyltransfer, glycan modification and oligosaccharide repeat-unit processing. The K loci all include the export genes at one end and genes for synthesis of common sugar precursors at the other, with a highly variable region that includes the remaining genes in between. Five different capsule loci, KL2, KL6, KL7, KL8 and KL9 were detected in multiply antibiotic resistant isolates belonging to global clone 2, and two other loci, KL1 and KL4, in global clone 1. This indicates that this region is being substituted repeatedly in multiply antibiotic resistant isolates from these clones. PMID:23614028

  10. Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis.

    PubMed

    Dexter, Carina; Murray, Gerald L; Paulsen, Ian T; Peleg, Anton Y

    2015-05-01

    Community-acquired Acinetobacter baumannii (CA-Ab) is a rare but serious cause of community-acquired pneumonia in tropical regions of the world. CA-Ab infections predominantly affect individuals with risk factors, which include excess alcohol consumption, diabetes mellitus, smoking and chronic lung disease. CA-Ab pneumonia presents as a surprisingly fulminant course and is characterized by a rapid onset of fever, severe respiratory symptoms and multi-organ dysfunction, with a mortality rate reported as high as 64%. It is unclear whether the distinct clinical syndrome caused by CA-Ab is because of host predisposing factors or unique bacterial characteristics, or a combination of both. Deepening our understanding of the drivers of overwhelming CA-Ab infection will provide important insights into preventative and therapeutic strategies. PMID:25850806

  11. A glimpse into evolution and dissemination of multidrug-resistant Acinetobacter baumannii isolates in East Asia: a comparative genomics study

    PubMed Central

    Feng, Ye; Ruan, Zhi; Shu, Jianfeng; Chen, Chyi-Liang; Chiu, Cheng-Hsun

    2016-01-01

    Clonal dissemination is characteristic of the important nosocomial pathogen Acinetobacter baumannii, as revealed by previous multi-locus sequence typing (MLST) studies. However, the disseminated phyletic unit is actually MLST sequence type instead of real bacterial clone. Here we sequenced the genomes of 13 multidrug-resistant (MDR) A. baumannii strains from Taiwan, and compared them with that of A. baumannii from other East Asian countries. Core-genome phylogenetic tree divided the analyzed strains into three major clades. Among them, one ST455 clade was a hybrid between the ST208 clade and the other ST455 clade. Several strains showed nearly identical genome sequence, but their isolation sources differed by over 2,500 km and 10 years apart, suggesting a wide dissemination of the phyletic units, which were much smaller than the sequence type. Frequent structural variation was detected even between the closely related strains in antimicrobial resistance elements such as AbaRI, class I integron, indicating strong selection pressure brought by antimicrobial use. In conclusion, wide clonal dissemination and frequent genomic variation simultaneously characterize the clinical MDR A. baumannii in East Asia. PMID:27072398

  12. A glimpse into evolution and dissemination of multidrug-resistant Acinetobacter baumannii isolates in East Asia: a comparative genomics study.

    PubMed

    Feng, Ye; Ruan, Zhi; Shu, Jianfeng; Chen, Chyi-Liang; Chiu, Cheng-Hsun

    2016-01-01

    Clonal dissemination is characteristic of the important nosocomial pathogen Acinetobacter baumannii, as revealed by previous multi-locus sequence typing (MLST) studies. However, the disseminated phyletic unit is actually MLST sequence type instead of real bacterial clone. Here we sequenced the genomes of 13 multidrug-resistant (MDR) A. baumannii strains from Taiwan, and compared them with that of A. baumannii from other East Asian countries. Core-genome phylogenetic tree divided the analyzed strains into three major clades. Among them, one ST455 clade was a hybrid between the ST208 clade and the other ST455 clade. Several strains showed nearly identical genome sequence, but their isolation sources differed by over 2,500 km and 10 years apart, suggesting a wide dissemination of the phyletic units, which were much smaller than the sequence type. Frequent structural variation was detected even between the closely related strains in antimicrobial resistance elements such as AbaRI, class I integron, indicating strong selection pressure brought by antimicrobial use. In conclusion, wide clonal dissemination and frequent genomic variation simultaneously characterize the clinical MDR A. baumannii in East Asia. PMID:27072398

  13. The structure of alanine racemase from Acinetobacter baumannii

    PubMed Central

    Davis, Emily; Scaletti-Hutchinson, Emma; Opel-Reading, Helen; Nakatani, Yoshio; Krause, Kurt L.

    2014-01-01

    Acinetobacter baumannii is an opportunistic Gram-negative bacterium which is a common cause of hospital-acquired infections. Numerous antibiotic-resistant strains exist, emphasizing the need for the development of new antimicrobials. Alanine racemase (Alr) is a pyridoxal 5′-phosphate dependent enzyme that is responsible for racemization between enantiomers of alanine. As d-alanine is an essential component of the bacterial cell wall, its inhibition is lethal to prokaryotes, making it an excellent antibiotic drug target. The crystal structure of A. baumannii alanine racemase (AlrAba) from the highly antibiotic-resistant NCTC13302 strain has been solved to 1.9 Å resolution. Comparison of AlrAba with alanine racemases from closely related bacteria demonstrates a conserved overall fold. The substrate entryway and active site of the enzymes were shown to be highly conserved. The structure of AlrAba will provide the template required for future structure-based drug-design studies. PMID:25195891

  14. In vitro Comparison of Anti-Biofilm Effects against Carbapenem-Resistant Acinetobacter baumannii: Imipenem, Colistin, Tigecycline, Rifampicin and Combinations

    PubMed Central

    2015-01-01

    Background Multi-drug resistant (MDR) Acinetobacter baumannii has emerged as one of the most important nosocomial pathogens. In addition to the diverse resistance mechanisms, some A. baumannii strains are known to have biofilm-producing capacity, thereby decreasing antibiotic effectiveness. Materials and Methods This study was designed to assess biofilm-producing capacity of three different MDR A. baumannii strains with diverse resistance mechanisms (OXA-51, IMP-1 and VIM-2 type β-lactamases), and intended to compare the effect of each antibiotic regimen (rifampicin, colistin, imipenem, tigecycline, rifampicin-imipenem and rifampicin-colistin) on mature A. baumannii biofilms using in vitro polystyrene plate biofilm assay. Results Among three MDR A. baumannii strains, only VIM-2 strain produced strong biofilm compared to the controls (optical density, 8.04 ± 2.16 vs. 0.49 ± 0.26). Regarding VIM-2 strains, none of imipenem, colistin and rifampicin reduced biofilm formation alone at MIC of each antibiotic agent (inhibition of biofilm synthesis, less than 30%). In comparison, tigecyclin (0.76 ± 0.23), imipenem-rifampicin (1.07 ± 0.31) and colistin-rifampicin (1.47 ± 0.54) showed a significant inhibition of biofilm synthesis compared to the positive controls at 48 hours after incubation (P<0.01). Tigecycline inhibited biofilm formation even at the one fourth level of MIC (1.17 ± 0.21). Likewise, both imipenem and colistin were also effective even with the reduced concentrations when those were combined with rifampicin. Such biofilm-inhibiting effects with those antibiotic regimens sustained up to 96 hours after incubation. Conclusion Tigecycline, imipenem-rifampicin and colistin-rifampicin would be effective for the prevention or reduction of biofilm formation caused by A. baumannii strains. PMID:25844260

  15. Prevalence of hypermutators among clinical Acinetobacter baumannii isolates

    PubMed Central

    Komp Lindgren, Patricia; Higgins, Paul G.; Seifert, Harald; Cars, Otto

    2016-01-01

    Objectives The objectives of this study were to study the presence of mutators in a set of Acinetobacter baumannii isolates and to explore whether there is a correlation between mutation rates and antibiotic resistance. Methods The variation in mutation rate was evaluated for 237 clinical A. baumannii isolates by determining the frequency of their mutation to rifampicin resistance. For each isolate, the antibiotic resistance profile was determined by disc diffusion and/or Etest. Isolates were divided into susceptible, resistant and MDR groups according to their resistance to five groups of different antibiotics. A comparison between differences in mutation frequency (f) and strain-specific factors was performed. Results Of the 237 isolates 32%, 18% and 50% were classified as susceptible, resistant and MDR, respectively. The f of rifampicin resistance varied between 2.2 × 10−10 and 1.2 × 10−6. Of the strains under investigation, 16% had an ≥2.5- to 166-fold higher f. The presence of mutators (definition ≥2.5-fold increase in f compared with ATCC 19606) in the MDR group (22%) was significantly higher (P < 0.05) than that in the susceptible and resistant groups (11% and 7%, respectively). Furthermore, f was significantly higher in the MDR group compared with that in the susceptible and resistant groups. Conclusions The facts that 26 of 37 mutator isolates (70%) in the population were MDR and that there was a significantly higher general f in isolates exhibiting an MDR profile suggest that hypermutability can be of advantage for the organism in a selective environment with extensive exposure to antimicrobials. PMID:26660878

  16. Assessment of Minocycline and Polymyxin B Combination against Acinetobacter baumannii

    PubMed Central

    Bowers, Dana R.; Cao, Henry; Zhou, Jian; Ledesma, Kimberly R.; Sun, Dongxu; Lomovskaya, Olga

    2015-01-01

    Antimicrobial resistance among Acinetobacter baumannii is increasing worldwide, often necessitating combination therapy. The clinical utility of using minocycline with polymyxin B is not well established. In this study, we investigated the activity of minocycline and polymyxin B against 1 laboratory isolate and 3 clinical isolates of A. baumannii. Minocycline susceptibility testing was performed with and without an efflux pump inhibitor, phenylalanine-arginine β-naphthylamide (PAβN). The intracellular minocycline concentration was determined with and without polymyxin B (0.5 μg/ml). Time-kill studies were performed over 24 h using approximately 106 CFU/ml of each strain with clinically relevant minocycline concentrations (2 μg/ml and 8 μg/ml), with and without polymyxin B (0.5 μg/ml). The in vivo efficacy of the combination was assessed in a neutropenic murine pneumonia model. Infected animals were administered minocycline (50 mg/kg), polymyxin B (10 mg/kg), or both to achieve clinically equivalent exposures in humans. A reduction in the minocycline MIC (≥4×) was observed in the presence of PAβN. The intracellular concentration and in vitro bactericidal effect of minocycline were both enhanced by polymyxin B. With 2 minocycline-susceptible strains, the bacterial burden in lung tissue at 24 h was considerably reduced by the combination compared to monotherapy with minocycline or polymyxin B. In addition, the combination prolonged survival of animals infected with a minocycline-susceptible strain. Polymyxin B increased the intracellular concentration of minocycline in bacterial cells and enhanced the bactericidal activity of minocycline, presumably due to efflux pump disruption. The clinical utility of this combination should be further investigated. PMID:25712362

  17. Acinetobacter seifertii sp. nov., a member of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from human clinical specimens.

    PubMed

    Nemec, Alexandr; Krizova, Lenka; Maixnerova, Martina; Sedo, Ondrej; Brisse, Sylvain; Higgins, Paul G

    2015-03-01

    This study aimed to define the taxonomic status of a phenetically distinct group of 16 strains that corresponds to Acinetobacter genomic species 'close to 13TU', a provisional genomic species of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex recognized by Gerner-Smidt and Tjernberg in 1993. These strains have been isolated in different countries since the early 1990s and were mostly recovered from human clinical specimens. They were compared with 45 reference strains representing the known taxa of the ACB complex using taxonomic methods relevant to the genus Acinetobacter. Based on sequence analysis of the concatenated partial sequences (2976 bp) of seven housekeeping genes, the 16 strains formed a tight and well-supported cluster (intracluster sequence identity of ≥98.4 %) that was clearly separated from the other members of the ACB complex (≤94.7 %). The species status of the group was supported by average nucleotide identity values of ≤91.7 % between the whole genome sequence of representative strain NIPH 973(T) (NCBI accession no. APOO00000000) and those of the other species. In addition, whole-cell matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) MS analyses indicated the distinctness of the group at the protein level. Metabolic and physiological tests revealed several typical features of the group, although they did not allow its reliable differentiation from the other members of the ACB complex. We conclude that the 16 strains represent a distinct novel species, for which we propose the name Acinetobacter seifertii sp. nov. The type strain is NIPH 973(T) ( = CIP 110471(T) = CCUG 34785(T) = CCM 8535(T)). PMID:25563912

  18. Amide side chain amphiphilic polymers disrupt surface established bacterial bio-films and protect mice from chronic Acinetobacter baumannii infection.

    PubMed

    Uppu, Divakara S S M; Samaddar, Sandip; Ghosh, Chandradhish; Paramanandham, Krishnamoorthy; Shome, Bibek R; Haldar, Jayanta

    2016-01-01

    Bacterial biofilms represent the root-cause of chronic or persistent infections in humans. Gram-negative bacterial infections due to nosocomial and opportunistic pathogens such as Acinetobacter baumannii are more difficult to treat because of their inherent and rapidly acquiring resistance to antibiotics. Due to biofilm formation, A. baumannii has been noted for its apparent ability to survive on artificial surfaces for an extended period of time, therefore allowing it to persist in the hospital environment. Here we report, maleic anhydride based novel cationic polymers appended with amide side chains that disrupt surface established multi-drug resistant A. baumannii biofilms. More importantly, these polymers significantly (p < 0.0001) decrease the bacterial burden in mice with chronic A. baumannii burn wound infection. The polymers also show potent antibacterial efficacy against methicillin resistant Staphylococcus aureus (MRSA), vancomycin resistant Enterococci (VRE) and multi-drug resistant clinical isolates of A. baumannii with minimal toxicity to mammalian cells. We observe that optimal hydrophobicity dependent on the side chain chemical structure of these polymers dictate the selective toxicity to bacteria. Polymers interact with the bacterial cell membranes by causing membrane depolarization, permeabilization and energy depletion. Bacteria develop rapid resistance to erythromycin and colistin whereas no detectable development of resistance occurs against these polymers even after several passages. These results suggest the potential use of these polymeric biomaterials in disinfecting biomedical device surfaces after the infection has become established and also for the topical treatment of chronic bacterial infections. PMID:26454051

  19. 5-Episinuleptolide Decreases the Expression of the Extracellular Matrix in Early Biofilm Formation of Multi-Drug Resistant Acinetobacter baumannii

    PubMed Central

    Tseng, Sung-Pin; Hung, Wei-Chun; Huang, Chiung-Yao; Lin, Yin-Shiou; Chan, Min-Yu; Lu, Po-Liang; Lin, Lin; Sheu, Jyh-Horng

    2016-01-01

    Nosocomial infections and increasing multi-drug resistance caused by Acinetobacter baumannii have been recognized as emerging problems worldwide. Moreover, A. baumannii is able to colonize various abiotic materials and medical devices, making it difficult to eradicate and leading to ventilator-associated pneumonia, and bacteremia. Development of novel molecules that inhibit bacterial biofilm formation may be an alternative prophylactic option for the treatment of biofilm-associated A. baumannii infections. Marine environments, which are unlike their terrestrial counterparts, harbor an abundant biodiversity of marine organisms that produce novel bioactive natural products with pharmaceutical potential. In this study, we identified 5-episinuleptolide, which was isolated from Sinularia leptoclados, as an inhibitor of biofilm formation in ATCC 19606 and three multi-drug resistant A. baumannii strains. In addition, the anti-biofilm activities of 5-episinuleptolide were observed for Gram-negative bacteria but not for Gram-positive bacteria, indicating that the inhibition mechanism of 5-episinuleptolide is effective against only Gram-negative bacteria. The mechanism of biofilm inhibition was demonstrated to correlate to decreased gene expression from the pgaABCD locus, which encodes the extracellular polysaccharide poly-β-(1,6)-N-acetylglucosamine (PNAG). Scanning electron microscopy (SEM) indicated that extracellular matrix of the biofilm was dramatically decreased by treatment with 5-episinuleptolide. Our study showed potentially synergistic activity of combination therapy with 5-episinuleptolide and levofloxacin against biofilm formation and biofilm cells. These data indicate that inhibition of biofilm formation via 5-episinuleptolide may represent another prophylactic option for solving the persistent problem of biofilm-associated A. baumannii infections. PMID:27483290

  20. 5-Episinuleptolide Decreases the Expression of the Extracellular Matrix in Early Biofilm Formation of Multi-Drug Resistant Acinetobacter baumannii.

    PubMed

    Tseng, Sung-Pin; Hung, Wei-Chun; Huang, Chiung-Yao; Lin, Yin-Shiou; Chan, Min-Yu; Lu, Po-Liang; Lin, Lin; Sheu, Jyh-Horng

    2016-01-01

    Nosocomial infections and increasing multi-drug resistance caused by Acinetobacter baumannii have been recognized as emerging problems worldwide. Moreover, A. baumannii is able to colonize various abiotic materials and medical devices, making it difficult to eradicate and leading to ventilator-associated pneumonia, and bacteremia. Development of novel molecules that inhibit bacterial biofilm formation may be an alternative prophylactic option for the treatment of biofilm-associated A. baumannii infections. Marine environments, which are unlike their terrestrial counterparts, harbor an abundant biodiversity of marine organisms that produce novel bioactive natural products with pharmaceutical potential. In this study, we identified 5-episinuleptolide, which was isolated from Sinularia leptoclados, as an inhibitor of biofilm formation in ATCC 19606 and three multi-drug resistant A. baumannii strains. In addition, the anti-biofilm activities of 5-episinuleptolide were observed for Gram-negative bacteria but not for Gram-positive bacteria, indicating that the inhibition mechanism of 5-episinuleptolide is effective against only Gram-negative bacteria. The mechanism of biofilm inhibition was demonstrated to correlate to decreased gene expression from the pgaABCD locus, which encodes the extracellular polysaccharide poly-β-(1,6)-N-acetylglucosamine (PNAG). Scanning electron microscopy (SEM) indicated that extracellular matrix of the biofilm was dramatically decreased by treatment with 5-episinuleptolide. Our study showed potentially synergistic activity of combination therapy with 5-episinuleptolide and levofloxacin against biofilm formation and biofilm cells. These data indicate that inhibition of biofilm formation via 5-episinuleptolide may represent another prophylactic option for solving the persistent problem of biofilm-associated A. baumannii infections. PMID:27483290

  1. Use of a new mouse model of Acinetobacter baumannii pneumonia to evaluate the postantibiotic effect of imipenem.

    PubMed Central

    Joly-Guillou, M L; Wolff, M; Pocidalo, J J; Walker, F; Carbon, C

    1997-01-01

    Acinetobacter baumannii is responsible for severe nosocomial pneumonia. To evaluate new therapeutic regimens for infections due to multiresistant strains and to study the pharmacodynamic properties of various antibiotics, we developed an experimental mouse model of acute A. baumannii pneumonia. C3H/HeN mice rendered transiently neutropenic were infected intratracheally with 5 x 10(6) CFU of A. baumannii. The mean log10 CFU/g of lung homogenate (+/- the standard deviation) were 9 +/- 0.9, 9.4 +/- 0.8, 8.6 +/- 1.2, and 7.7 +/- 1.4 on days 1, 2, 3, and 4 postinoculation. The lung pathology was characterized by pneumonitis with edema and a patchy distribution of hemorrhages in the peribronchovascular spaces of both lungs. Abscesses formed on days 3 and 4. Four days after inoculation, subacute pneumonitis characterized by alveolar macrophage proliferation and areas of fibrosis was observed. The cumulative mortality on day 4 was 85%. This new model was used to study the effects of 1, 2, or 3 50-mg/kg doses of imipenem. Imipenem concentrations in lungs were above the MIC for 2 h after the last dose. The in vivo postantibiotic effect (PAE) was determined during the 9-h period following the last dose; it decreased in duration with the number of doses: 9.6, 6.4, and 4 h after 1, 2, and 3 50-mg/kg doses, respectively. In contrast, no in vitro PAE was observed. This model offers a reproducible acute course of A. baumannii pneumonia. The presence of a prolonged in vivo PAE supports the currently recommended dosing intervals of imipenem for the treatment of human infections due to A. baumannii, i.e., 15 mg/kg three times a day. PMID:9021190

  2. Identification of novel vaccine candidates against Acinetobacter baumannii using reverse vaccinology

    PubMed Central

    Chiang, Ming-Hsien; Sung, Wang-Chou; Lien, Shu-Pei; Chen, Ying-Zih; Lo, Annie Fei-yun; Huang, Jui-Hsin; Kuo, Shu-Chen; Chong, Pele

    2015-01-01

    Acinetobacter baumannii (Ab) is a global emerging bacterium causing nosocomial infections such as pneumonia, meningitis, bacteremia and soft tissue infections especially in intensive care units. Since Ab is resistant to almost all conventional antibiotics, it is now one of the 6 top-priorities of the dangerous microorganisms listed by the Infectious Disease Society of America. The development of vaccine is one of the most promising and cost-effective strategies to prevent infections. In this study, we identified potential protective vaccine candidates using reverse vaccinology. We have analyzed 14 on-line available Ab genome sequences and found 2752 homologous core genes. Using information obtained from immuno-proteomic experiments, published proteomic information and the bioinformatics PSORTb v3.0 software to predict the location of extracellular and/or outer membrane proteins, 77 genes were identified and selected for further studies. After excluding those antigens have been used as vaccine candidates reported by the in silico search-engines of PubMed and Google Scholar, 13 proteins could potentially be vaccine candidates. We have selected and cloned the genes of 3 antigens that were further expressed and purified. These antigens were found to be highly immunogenic and conferred partial protection (60%) in a pneumonia animal model. The strategy described in the present study incorporates the advantages of reverse vaccinology, bioinformatics and immuno-proteomic platform technologies and is easy to perform to identify novel immunogens for multi-component vaccines development. PMID:25751377

  3. Neutropenia exacerbates infection by Acinetobacter baumannii clinical isolates in a murine wound model

    PubMed Central

    Grguric-Smith, Laryssa M.; Lee, Hiu H.; Gandhi, Jay A.; Brennan, Melissa B.; DeLeon-Rodriguez, Carlos M.; Coelho, Carolina; Han, George; Martinez, Luis R.

    2015-01-01

    The Gram negative coccobacillus Acinetobacter baumannii has become an increasingly prevalent cause of hospital-acquired infections in recent years. The majority of clinical A. baumannii isolates display high-level resistance to antimicrobials, which severely compromises our capacity to care for patients with A. baumannii disease. Neutrophils are of major importance in the host defense against microbial infections. However, the contribution of these cells of innate immunity in host resistance to cutaneous A. baumannii infection has not been directly investigated. Hence, we hypothesized that depletion of neutrophils increases severity of bacterial disease in an experimental A. baumannii murine wound model. In this study, the Ly-6G-specific monoclonal antibody (mAb), 1A8, was used to generate neutropenic mice and the pathogenesis of several A. baumannii clinical isolates on wounded cutaneous tissue was investigated. We demonstrated that neutrophil depletion enhances bacterial burden using colony forming unit determinations. Also, mAb 1A8 reduces global measurements of wound healing in A. baumannii-infected animals. Interestingly, histological analysis of cutaneous tissue excised from A. baumannii-infected animals treated with mAb 1A8 displays enhanced collagen deposition. Furthermore, neutropenia and A. baumannii infection alter pro-inflammatory cytokine release leading to severe microbial disease. Our findings provide a better understanding of the impact of these innate immune cells in controlling A. baumannii skin infections. PMID:26528277

  4. Epidemiology and resistance features of Acinetobacter baumannii isolates from the ward environment and patients in the burn ICU of a Chinese hospital.

    PubMed

    Gong, Yali; Shen, Xiaodong; Huang, Guangtao; Zhang, Cheng; Luo, Xiaoqiang; Yin, Supeng; Wang, Jing; Hu, Fuquan; Peng, Yizhi; Li, Ming

    2016-08-01

    Acinetobacter baumannii is an important opportunistic pathogen that causes severe nosocomial infections, especially in intensive care units (ICUs). Over the past decades, an everincreasing number of hospital outbreaks caused by A. baumannii have been reported worldwide. However, little attention has been directed toward the relationship between A. baumannii isolates from the ward environment and patients in the burn ICU. In this study, 88 A. baumannii isolates (26 from the ward environment and 62 from patients) were collected from the burn ICU of the Southwest Hospital in Chongqing, China, from July through December 2013. Antimicrobial susceptibility testing results showed that drug resistance was more severe in isolates from patients than from the ward environment, with all of the patient isolates being fully resistant to 10 out of 19 antimicrobials tested. Isolations from both the ward environment and patients possessed the β-lactamase genes bla OXA-51, bla OXA-23, bla AmpC, bla VIM, and bla PER. Using pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST), these isolates could be clustered into 4 major PFGE types and 4 main sequence types (ST368, ST369, ST195, and ST191) among which, ST368 was the dominant genotype. Epidemiologic and molecular typing data also revealed that a small-scale outbreak of A. baumannii infection was underway in the burn ICU of our hospital during the sampling period. These results suggest that dissemination of β-lactamase genes in the burn ICU might be closely associated with the high-level resistance of A. baumannii, and the ICU environment places these patients at a high risk for nosocomial infection. Cross-contamination should be an important concern in clinical activities to reduce hospitalacquired infections caused by A. baumannii. PMID:27480635

  5. First report of NDM-1-producing Acinetobacter baumannii sequence type 25 in Brazil.

    PubMed

    Pillonetto, Marcelo; Arend, Lavinia; Vespero, Eliana Carolina; Pelisson, Marsileni; Chagas, Thiago Pavoni Gomes; Carvalho-Assef, Ana Paula D'Alincourt; Asensi, Marise Dutra

    2014-12-01

    New Delhi metallo-β-lactamase 1 (NDM-1) was first identified in Brazil in Enterobacter hormaechei and Providencia rettgeri in 2013. Here, we describe the first case of NDM-1-producing Acinetobacter baumannii sequence type 25 isolated from the urinary tract of a 71-year-old man who died of multiple complications, including A. baumannii infection. The NDM-1 gene was detected by quantitative PCR, and its sequence confirmed its presence in an ∼ 100-kb plasmid. PMID:25288087

  6. Candida albicans Airway Colonization Facilitates Subsequent Acinetobacter baumannii Pneumonia in a Rat Model.

    PubMed

    Tan, Xiaojiang; Chen, Ruilan; Zhu, Song; Wang, Huijun; Yan, Dongxing; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios

    2016-06-01

    The objective of the study was to determine the effects of Candida albicans respiratory tract colonization on Acinetobacter baumannii pneumonia in a rat model. Rats were colonized with C. albicans by instillation of 3 × 10(6) CFU into their airways, while sterile saline was instilled in the control group. The colonized rats were further divided into two groups: treated with amphotericin B or not. The rats were subsequently infected with A. baumannii (10(8) CFU by tracheobronchial instillation). A. baumannii lung CFU counts, cytokine lung levels, and rates of A. baumannii pneumonia were compared between groups. In vitro expression of A. baumannii virulence genes was measured by reverse transcription (RT)-PCR after 24-hour incubation with C. albicans or with Mueller-Hinton (MH) broth alone. Rats with Candida colonization developed A. baumannii pneumonia more frequently and had higher A. baumannii CFU burdens and heavier lungs than controls. After A. baumannii infection, lung interleukin 17 (IL-17) concentrations were lower and gamma interferon (IFN-γ) concentrations were higher in Candida-colonized rats than in controls. Candida-colonized rats treated with amphotericin B had a decreased rate of A. baumannii pneumonia and lower IFN-γ levels but higher IL-17 levels than untreated rats. Expression of basC, barB, bauA, ptk, plc2, and pld2 was induced while expression of ompA and abaI was suppressed in A. baumannii cultured in the presence of C. albicans C. albicans colonization facilitated the development of A. baumannii pneumonia in a rat model. Among Candida-colonized rats, antifungal treatment lowered the incidence of A. baumannii pneumonia. These findings could be due to modification of the host immune response and/or expression of A. baumannii virulence genes by Candida spp. PMID:27001817

  7. Draft genome sequence of Acinetobacter baumannii strain NCTC 13423, a multidrug-resistant clinical isolate.

    PubMed

    Michiels, Joran E; Van den Bergh, Bram; Fauvart, Maarten; Michiels, Jan

    2016-01-01

    Acinetobacter baumannii is a pathogen that is becoming increasingly important and causes serious hospital-acquired infections. We sequenced the genome of A. baumannii NCTC 13423, a multidrug-resistant strain belonging to the international clone II group, isolated from a human infection in the United Kingdom in 2003. The 3,937,944 bp draft genome has a GC-content of 39.0 % and a total of 3672 predicted protein-coding sequences. The availability of genome sequences of multidrug-resistant A. baumannii isolates will fuel comparative genomic studies to help understand the worrying spread of multidrug resistance in this pathogen. PMID:27594976

  8. Characterization and identification of newly isolated Acinetobacter baumannii strain serdang 1 for phenol removal

    NASA Astrophysics Data System (ADS)

    Yadzir, Z. H. M.; Shukor, M. Y.; Nazir, M. S.; Abdullah, M. A.

    2012-09-01

    A new indigenous bacterial strain from Malaysian soil contaminated with petroleum waste had been successfully isolated, characterized and identified for phenol removal. The gram negative bacteria showed 98% identity with Acinetobacter baumannii based on Biolog{trade mark, serif} Identification System and the determination of a partial 16S ribosomal RNA (rRNA) sequence. The isolate clustered with species belonging to Acinetobacter clade in a 16S rDNA-based neighbour-joining phylogenetic tree.

  9. Pyogenic Liver Abscess Caused by Acinetobacter lwoffii: A Case Report.

    PubMed

    Singh, N Pal; Sagar, Tanu; Nirmal, Kirti; Kaur, I Rajender

    2016-06-01

    Acinetobacter lwoffii is a gram negative aerobic non-fermenter bacilli. It is considered as an important emerging pathogen after Acinetobacter baumannii in patients with impaired immune system and in nosocomial infections. Here, we present a case of community acquired pyogenic liver Abscess caused by Acinetobacter lwoffii in a diabetic patient. PMID:27504286

  10. Pyogenic Liver Abscess Caused by Acinetobacter lwoffii: A Case Report

    PubMed Central

    Singh, N. Pal; Nirmal, Kirti; Kaur, I. Rajender

    2016-01-01

    Acinetobacter lwoffii is a gram negative aerobic non-fermenter bacilli. It is considered as an important emerging pathogen after Acinetobacter baumannii in patients with impaired immune system and in nosocomial infections. Here, we present a case of community acquired pyogenic liver Abscess caused by Acinetobacter lwoffii in a diabetic patient. PMID:27504286

  11. Distribution and resistance of pathogens in liver transplant recipients with Acinetobacter baumannii infection

    PubMed Central

    Gao, Fei; Ye, Qifa; Wan, Qiquan; Liu, Shan; Zhou, Jiandang

    2015-01-01

    Background Drug-resistant Acinetobacter baumannii has become a major problem in liver transplant recipients. The aim of this study was to investigate the clinical presentation, distribution, and drug susceptibility characteristics in liver recipients with A. baumannii infection. Methods We retrospectively investigated 17 liver recipients who developed A. baumannii infection between January 1, 2007 and December 31, 2014. The distribution of A. baumannii and drug susceptibility characteristics were reviewed. Results Infectious complications due to A. baumannii appeared in 17 liver recipients, with a total of 24 episodes. Approximately 63% (15/24) of A. baumannii infections occurred within 2 weeks after transplantation. The most common source of infection was multiple culture-positive sites (35.3%, n=6), followed by the intra-abdominal/biliary tract (23.5%, n=4) and lung (23.5%, n=4). Eight patients (47.1%) had a body temperature of 38°C or higher at the onset of A. baumannii infection. Nine, seven, and 12 recipients had a serum creatinine level of >1.5 mg/dL, a white blood cell count of >15,000/mm3, and a platelet count of <50,000/mm3, respectively. There were five (29.4%) cases of septic shock and eight (47.1%) deaths. The rate of antibiotic resistance of A. baumannii to ten of 12 antibiotics investigated was more than 60%. Among the 24 infections caused by A. baumannii, 75% were carbapenem-resistant. The rods were relatively sensitive to tigecycline and cefoperazone-sulbactam. Conclusion The clinical manifestations of A. baumannii infection included a high body temperature, a decreased platelet count, an elevated white blood cell count, and onset in the early period after transplantation as well as high mortality. The antibiotic resistance rate of A. baumannii was extremely high. Prevention measures and combination antibiotic therapy are needed to improve the outcomes of liver recipients with A. baumannii infections. PMID:25848296

  12. Effect of Ethanol on Differential Protein Production and Expression of Potential Virulence Functions in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Nwugo, Chika C.; Arivett, Brock A.; Zimbler, Daniel L.; Gaddy, Jennifer A.; Richards, Ashley M.; Actis, Luis A.

    2012-01-01

    Acinetobacter baumannii persists in the medical environment and causes severe human nosocomial infections. Previous studies showed that low-level ethanol exposure increases the virulence of A. baumannii ATCC 17978. To better understand the mechanisms involved in this response, 2-D gel electrophoresis combined with mass spectrometry was used to investigate differential protein production in bacteria cultured in the presence or absence of ethanol. This approach showed that the presence of ethanol significantly induces and represses the production of 22 and 12 proteins, respectively. Although over 25% of the ethanol-induced proteins were stress-response related, the overall bacterial viability was uncompromised when cultured under these conditions. Production of proteins involved in lipid and carbohydrate anabolism was increased in the presence of ethanol, a response that correlates with increased carbohydrate biofilm content, enhanced biofilm formation on abiotic surfaces and decrease bacterial motility on semi-solid surfaces. The presence of ethanol also induced the acidification of bacterial cultures and the production of indole-3-acetic acid (IAA), a ubiquitous plant hormone that signals bacterial stress-tolerance and promotes plant-bacteria interactions. These responses could be responsible for the significantly enhanced virulence of A. baumannii ATCC 17978 cells cultured in the presence of ethanol when tested with the Galleria mellonella experimental infection model. Taken together, these observations provide new insights into the effect of ethanol in bacterial virulence. This alcohol predisposes the human host to infections by A. baumannii and could favor the survival and adaptation of this pathogen to medical settings and adverse host environments. PMID:23284824

  13. Association of blaOXA-23 and bap with the persistence of Acinetobacter baumannii within a major healthcare system

    PubMed Central

    Luo, Ting L.; Rickard, Alexander H.; Srinivasan, Usha; Kaye, Keith S.; Foxman, Betsy

    2015-01-01

    Objectives: Acinetobacter baumannii is an emerging opportunistic nosocomial pathogen. Two factors that may enhance persistence in healthcare settings are antimicrobial resistance and biofilm-forming ability. The aim of this work was to determine whether A. baumannii isolates that persist in healthcare settings (endemic), can be differentiated from sporadic isolates based upon their ability to resist antibiotics and their biofilm-forming capability. Methods: Two hundred and ninety A. baumannii isolates were isolated over 17 months in the Detroit Medical Center (DMC). The isolates were genotyped using repetitive extragenic palindromic-PCR (REP-PCR). REP-types appearing greater than 10 times during active surveillance were considered endemic. The in vitro biofilm-forming ability and antibiotic resistance profile of each isolate were evaluated. Isolates were tested for the presence of two genetic markers—one implicated in biofilm formation (bap) and the other in antibiotic resistance (blaOXA-23). Results: Of the 290 isolates evaluated, 84% carried bap and 36% carried blaOXA-23. Five unique REP-PCR banding-types were detected >10 times (endemic) and constituted 58% of the 290 isolates. These five endemic REP-PCR types were 5.1 times more likely than sporadic isolates to carry both bap and blaOXA-23. Furthermore, endemic isolates were resistant to 3 more antibiotic classes, on average, than sporadic isolates and four of the five endemic REP-PCR types formed denser biofilms in vitro than sporadic isolates. Conclusions: Endemic A. baumannii isolates are more likely than sporadic isolates to possess factors that increase virulence and enhance survival within a large healthcare system. PMID:25814985

  14. [Identification and determination of sensitivity to antibiotics of 31 clinical strains of Acinetobacter other than A. baumannii].

    PubMed

    Freney, J; Bouvet, P J; Tixier, C

    1989-01-01

    Precise identification and determination of MICs of clinical isolates of Acinetobacter identified to other species than the hospital species A. baumannii were carried out. On 260 Acinetobacter strains isolated in an hospital over a 6 months period, 31 strains (12 p. cent) were identified to species other than A. baumannii. Among these 31 strains, A. Iwoffii sensu stricto (16 strains) and A. haemolyticus (6 strains) were mostly recovered. Eight glucose oxidizing strains were identified to A. haemolyticus (6 strains), Acinetobacter genospecies 3 (2 strains), and A. Iwoffii sensu stricto (1 strain). Antibiotic susceptibilities of these strains were greater than those commonly observed with A. baumannii strains. PMID:2930020

  15. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?

    PubMed Central

    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J.; Singh, Nalini

    2016-01-01

    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  16. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?

    PubMed

    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J; Singh, Nalini

    2016-09-01

    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  17. Role of Fibronectin in the Adhesion of Acinetobacter baumannii to Host Cells

    PubMed Central

    Smani, Younes; McConnell, Michael J.; Pachón, Jerónimo

    2012-01-01

    Adhesion to host cells is an initial and important step in Acinetobacter baumannii pathogenesis. However, there is relatively little information on the mechanisms by which A. baumannii binds to and interacts with host cells. Adherence to extracellular matrix proteins, such as fibronectin, affords pathogens with a mechanism to invade epithelial cells. Here, we found that A. baumannii adheres more avidly to immobilized fibronectin than to control protein. Free fibronectin used as a competitor resulted in dose-dependent decreased binding of A. baumannii to fibronectin. Three outer membrane preparations (OMPs) were identified as fibronectin binding proteins (FBPs): OMPA, TonB-dependent copper receptor, and 34 kDa OMP. Moreover, we demonstrated that fibronectin inhibition and neutralization by specific antibody prevented significantly the adhesion of A. baumannii to human lung epithelial cells (A549 cells). Similarly, A. baumannii OMPA neutralization by specific antibody decreased significantly the adhesion of A. baumannii to A549 cells. These data indicate that FBPs are key adhesins that mediate binding of A. baumannii to human lung epithelial cells through interaction with fibronectin on the surface of these host cells. PMID:22514602

  18. [Evaluation of the efficacy of colistin/sulbactam combination on carbapenem-resistant Acinetobacter baumannii strains].

    PubMed

    Çetinkol, Yeliz; Telli, Murat; Altunçekiç Yıldırım, Arzu; Çalgın, Mustafa Kerem

    2016-07-01

    Acinetobacter baumannii strains, are opportunistic pathogens that cause severe nosocomial infections that are difficult to treat due to development of resistance to multiple antibiotics. As the antibiotic choices to be used in treatment are limited, combinations of a variety of antibiotics are used. The aims of this study were to identify the minimal inhibitory concentration (MIC) values of colistin and sulbactam against A.baumannii isolates and to determine the in vitro activity of colistin-sulbactam combination. A total of 50 A.baumannii strains isolated from different clinical specimens (32 tracheal aspirates, 10 blood, 6 urine and 2 wound samples) were included in the study. The identification of bacteria was performed by traditional methods and Vitek-2 (BioMerieux, France) automated system. Antibiotic susceptibilities were detected by Mueller-Hinton agar disk diffusion method and Vitek-2 automated system and the results were interpreted according to the CLSI standards. MIC values of colistin and sulbactam against A.baumannii strains and in vitro interactions of colistin-sulbactam combinations were determined with the E-test (BioMerieux, France). Fractional inhibitory concentration (FIC) index was used for the detection of efficacy of drug combinations. The presence of oxacillinase and metallo-beta-lactamase (MBL) genes that lead carbapenem resistance was investigated by polymerase chain reaction (PCR), and pulsed-field gel electrophoresis (PFGE) was performed for the determination of clonal relationship. In our study, all strains (100%) were detected as susceptible to colistin, 48 (96%) to trimethoprim/sulphamethoxazole and 18 to (36%) tigecyclin; however all of them were resistant to the other studied antibiotics, including sulbactam and carbapenem. When the colistin-sulbactam combination was assessed according to FIC index, all strains were found to have antagonistic effect. All of the carbapenem-resistant strains were positive for OXA-51 and OXA-23, and 3

  19. Fatal skin and soft tissue infection of multidrug resistant Acinetobacter baumannii: A case report

    PubMed Central

    Ali, Aqsa; Botha, John; Tiruvoipati, Ravindranath

    2014-01-01

    INTRODUCTION Acinetobacter baumannii is usually associated with respiratory tract, urinary tract and bloodstream infections. Recent reports suggest that it is increasingly causing skin and soft tissue infections. It is also evolving as a multidrug resistant organism that can be difficult to treat. We present a fatal case of multidrug resistant A. baumannii soft tissue infection and review of relevant literature. PRESENTATION OF CASE A 41 year old morbidly obese man, with history of alcoholic liver disease presented with left superficial pre-tibial abrasions and cellulitis caused by multidrug resistant (MDR) A. baumannii. In spite of early antibiotic administration he developed extensive myositis and fat necrosis requiring extensive and multiple surgical debridements. He deteriorated despite appropriate antibiotic therapy and multiple surgical interventions with development of multi-organ failure and died. DISCUSSION Managing Acinetobacter infections remains difficult due to the array of resistance and the pathogens ability to develop new and ongoing resistance. The early diagnosis of necrotizing soft tissue infection may be challenging, but the key to successful management of patients with necrotizing soft tissue infection are early recognition and complete surgical debridement. CONCLUSION A. baumannii is emerging as an important cause of severe, life-threatening soft tissue infections. Multidrug resistant A. baumannii soft tissue infections may carry a high mortality in spite of early and aggressive treatment. Clinicians need to consider appropriate early empirical antibiotic coverage or the use of combination therapy to include MDR A. baumannii as a cause of skin and soft tissue infections. PMID:25016080

  20. Candida spp. airway colonization: A potential risk factor for Acinetobacter baumannii ventilator-associated pneumonia.

    PubMed

    Tan, Xiaojiang; Zhu, Song; Yan, Dongxing; Chen, Weiping; Chen, Ruilan; Zou, Jian; Yan, Jingdong; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios

    2016-08-01

    This retrospective study was conducted to identify potential risk factors for Acinetobacter baumannii (A. baumannii) ventilator-associated pneumonia (VAP) and evaluate the association between Candida spp. airway colonization and A. baumannii VAP. Intensive care unit (ICU) patients who were on mechanical ventilation (MV) for ≥48 hours were divided into the following groups: patients with and without Candida spp. airway colonization; colonized patients receiving antifungal treatment or not; patients with A. baumannii VAP and those without VAP. Logistic regression analysis and propensity score matching were used to identify factors independently associated with A. baumannii VAP. Among 618 eligible patients, 264 (43%) had Candida spp. airway colonization and 114 (18%) developed A. baumannii VAP. Along with MV for ≥7 days (adjusted odds ratio [aOR] 8.9, 95% confidence intervals [95% CI] 4.9-15.8) and presence of a central venous catheter (aOR 3.2, 95% CI 1.1-9), Candida spp. airway colonization (aOR 2.6, 95% CI 1.6-4.3) was identified as an independent risk factor for A. baumannii VAP. Patients with Candida spp. airway colonization were more likely to develop A. baumannii VAP than non-colonized patients (23% vs 15%, P=.01 and 34% vs. 15%, P<.001 in propensity score-matched subgroups). Administration of antifungal agents was not associated with A. baumannii VAP (29% vs. 21%, P=.153) but with higher in-hospital mortality (53% vs. 39%, P=.037). Candida spp. airway colonization (43%) and A. baumannii VAP (18%) were common in ICU patients who were on mechanical ventilation for at least 48 hours. Candida spp. airway colonization was an independent risk factor for subsequent A. baumannii VAP. PMID:27001670

  1. Real-Time Fluorescence Loop Mediated Isothermal Amplification for the Detection of Acinetobacter baumannii

    PubMed Central

    Wang, Qinqin; Zhou, Yanbin; Li, Shaoli; Zhuo, Chao; Xu, Siqi; Huang, Lixia; Yang, Ling; Liao, Kang

    2013-01-01

    Background Detection of Acinetobacter baumannii has been relying primarily on bacterial culture that often fails to return useful results in time. Although DNA-based assays are more sensitive than bacterial culture in detecting the pathogen, the molecular results are often inconsistent and challenged by doubts on false positives, such as those due to system- and environment-derived contaminations. In addition, these molecular tools require expensive laboratory instruments. Therefore, establishing molecular tools for field use require simpler molecular platforms. The loop-mediated isothermal amplification method is relatively simple and can be improved for better use in a routine clinical bacteriology laboratory. A simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in the same platform has been developed in recent years. This method is referred to as real-time loop-mediated isothermal amplification. In this study, we attempted to utilize this method for rapid detection of A. baumannii. Methodology and Significant Findings Species-specific primers were designed to test the utility of this method. Clinical samples of A. baumannii were used to determine the sensitivity and specificity of this system compared to bacterial culture and a polymerase chain reaction method. All positive samples isolated from sputum were confirmed to be the species of Acinetobacter by 16S rRNA gene sequencing. The RealAmp method was found to be simpler and allowed real-time detection of DNA amplification, and could distinguish A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3. DNA was extracted by simple boiling method. Compared to bacterial culture, the sensitivity and specificity of RealAmp in detecting A. baumannii was 98.9% and 75.0%, respectively. Conclusion The RealAmp assay only requires a single unit, and the assay positivity can be verified by visual inspection. Therefore, this assay has

  2. [Characterization and determination of antibiotic resistance profiles of a single clone Acinetobacter baumannii strains isolated from blood cultures].

    PubMed

    Karagöz, Alper; Baran, Irmak; Aksu, Neriman; Acar, Sümeyra; Durmaz, Rıza

    2014-10-01

    Acinetobacter baumannii which is a significant cause of nosocomial infections, increases the rate of morbidity and mortality in health care settings especially in intensive care units (ICUs). The aim of this study was to determine the antibiotic resistance profiles of A.baumannii strains isolated from blood cultures of inpatients from different ICUs, wards and hospital environment and evaluate their clonal relationships and epidemiologic features. A total of 54 A.baumannii strains (47 from the blood cultures and 7 from the hospital environment), identified between 01 January 2012-28 December 2012 at the Clinical Microbiology Laboratory of Ankara Numune Training and Research Hospital, Turkey, were included in the study. Identification of A.baumannii isolates and their antimicrobial [sulbactam-ampicillin (SAM), piperacillin (PIP), piperacillin-tazobactam (TZP), ceftazidime (CFZ), cefoperazone-sulbactam (SCF), cefepime (CEF), imipenem (IMP), meropenem (MER), amikacin (AMK), gentamicin (GEN), netilmicin (NT), ciprofloxacin (CIP), levofloxacin (LVF), tetracycline (TET), tigecycline (TG), colistin (COL), trimethoprim-sulfamethoxazole (SXT)] susceptibility testing were performed by Vitek 2 (bioMérieux, France) system. The clonal relationship between the A.baumannii isolates was analysed by pulsed-field gel electrophoresis (PFGE). In our study colistin, tigecycline and netilmicin were found to be the most effective agents against A.baumannii isolates. All of the clinical isolates (n= 47) were found susceptible to COL, however all were resistant to SAM, PIP, TZP, CEF, IPM, CFZ, MER and CIP. While 1.85%, 14.8%, 14.8%, 16.6%, 59.2% and 22.2% of the isolates were susceptible to SCF, AMK, NT, GEN, TG and SXT, respectively; 1.85%, 1.85%, 9.2%, 16.6%, 38.8% and 27.7% of the isolates were intermediate to SCF, TET, AMK, NT, LVF and TG, respectively. Similarly, all of the environmental A.baumannii isolates (n= 7) were resistant to SAM, PIP, TZP, CFZ, CEF, IPM, MER and CIP, and all

  3. Analysis of tigecycline resistance development in clinical Acinetobacter baumannii isolates through a combined genomic and transcriptomic approach.

    PubMed

    Liu, Lin; Cui, Yujun; Zheng, Beiwen; Jiang, Saiping; Yu, Wei; Shen, Ping; Ji, Jinru; Li, Lanjuan; Qin, Nan; Xiao, Yonghong

    2016-01-01

    Tigecycline (Tgc) is considered a last-resort antibiotic for the treatment of multi-drug resistant bacteria. To study Tgc resistance development in the important nosocomial pathogen Acinetobacter baumannii, we adopted six clinical isolates from three patients undergoing antibiotic treatment, and bacterial genomic sequences and seven strand-specific transcriptomes were studied. Interestingly, the Tgc-intermediate 2015ZJAB1 only differed from Tgc-resistant 2015ZJAB2 in an SNP-clustered region including OprD, a sugar-type MFS permease, and a LuxR-type transcriptional regulator. Surprisingly, an almost identical region was found in 2015ZJAB3, which supports the possibility of a homologous recombination event that increased Tgc resistance. Furthermore, comparative transcriptomic analysis identified significantly regulated genes associated with Tgc resistance, which was verified using qRT-PCR. Three enriched COG categories included amino acid transport and metabolism, transcription, and inorganic ion transport and metabolism. KEGG analysis revealed common features under Tgc conditions, including up regulated benzoate degradation and a less active TCA cycle. This may be related to selective antimicrobial pressure in the environment and adaptation by lowering metabolism. This study provides the first report of an in vivo evolutionary process that included a putative homologous recombination event conferring Tgc resistance in clinical A. baumannii isolates in which transcriptome analysis revealed resistance-conferring genes and related metabolism characteristics. PMID:27240484

  4. Prevalence and Genetic Characterization of Carbapenem- and Polymyxin-Resistant Acinetobacter baumannii Isolated from a Tertiary Hospital in Terengganu, Malaysia

    PubMed Central

    Lean, Soo-Sum; Suhaili, Zarizal; Ismail, Salwani; Rahman, Nor Iza A.; Othman, Norlela; Abdullah, Fatimah Haslina; Thong, Kwai-Lin

    2014-01-01

    Nosocomial infection caused by Acinetobacter baumannii is of great concern due to its increasing resistance to most antimicrobials. In this study, 54 nonrepeat isolates of A. baumannii from the main tertiary hospital in Terengganu, Malaysia, were analyzed for their antibiograms and genotypes. Out of the 54 isolates, 39 (72.2%) were multidrug resistant (MDR) and resistant to carbapenems whereas 14 (25.9%) were categorized as extensive drug resistant (XDR) with additional resistance to polymyxin B, the drug of “last resort.” Pulsed-field gel electrophoresis analyses showed that the polymyxin-resistant isolates were genetically diverse while the carbapenem-resistant isolates were clonally related. The 14 XDR isolates were further investigated for mutations in genes known to mediate polymyxin resistance, namely, pmrCAB, and the lipopolysaccharide biosynthesis genes, lpxA, lpxC, lpxD, and lpsB. All 14 isolates had a P102H mutation in pmrA with no mutation detected in pmrC and pmrB. No mutation was detected in lpxA but each polymyxin-resistant isolate had 2–4 amino acid substitutions in lpxD and 1-2 substitutions in lpxC. Eight resistant isolates also displayed a unique H181Y mutation in lpsB. The extent of polymyxin resistance is of concern and the novel mutations discovered here warrant further investigations. PMID:25006521

  5. Analysis of tigecycline resistance development in clinical Acinetobacter baumannii isolates through a combined genomic and transcriptomic approach

    PubMed Central

    Liu, Lin; Cui, Yujun; Zheng, Beiwen; Jiang, Saiping; Yu, Wei; Shen, Ping; Ji, Jinru; Li, Lanjuan; Qin, Nan; Xiao, Yonghong

    2016-01-01

    Tigecycline (Tgc) is considered a last-resort antibiotic for the treatment of multi-drug resistant bacteria. To study Tgc resistance development in the important nosocomial pathogen Acinetobacter baumannii, we adopted six clinical isolates from three patients undergoing antibiotic treatment, and bacterial genomic sequences and seven strand-specific transcriptomes were studied. Interestingly, the Tgc-intermediate 2015ZJAB1 only differed from Tgc-resistant 2015ZJAB2 in an SNP-clustered region including OprD, a sugar-type MFS permease, and a LuxR-type transcriptional regulator. Surprisingly, an almost identical region was found in 2015ZJAB3, which supports the possibility of a homologous recombination event that increased Tgc resistance. Furthermore, comparative transcriptomic analysis identified significantly regulated genes associated with Tgc resistance, which was verified using qRT-PCR. Three enriched COG categories included amino acid transport and metabolism, transcription, and inorganic ion transport and metabolism. KEGG analysis revealed common features under Tgc conditions, including up regulated benzoate degradation and a less active TCA cycle. This may be related to selective antimicrobial pressure in the environment and adaptation by lowering metabolism. This study provides the first report of an in vivo evolutionary process that included a putative homologous recombination event conferring Tgc resistance in clinical A. baumannii isolates in which transcriptome analysis revealed resistance-conferring genes and related metabolism characteristics. PMID:27240484

  6. Distribution of AdeABC efflux system genes in genotypically diverse strains of clinical Acinetobacter baumannii.

    PubMed

    Wieczorek, Piotr; Sacha, Paweł; Czaban, Sławomir; Hauschild, Tomasz; Ojdana, Dominika; Kowalczuk, Oksana; Milewski, Robert; Poniatowski, Bogusław; Nikliński, Jacek; Tryniszewska, Elżbieta

    2013-10-01

    Acinetobacter baumannii has emerged as a highly problematic hospital-associated pathogen. Different mechanisms contribute to the formation of multidrug resistance in A. baumannii, including the AdeABC efflux system. Distribution of the structural and regulatory genes encoding the AdeABC efflux system among genetically diverse clinical A. baumannii strains was achieved by using PCR and pulsed-field gel electrophoresis techniques. The distribution of adeABRS genes is extremely high among our A. baumannii strains, except the adeC gene. We have observed a large proportion of strains presenting multidrug-resistance phenotype for several years. The efflux pump could be an important mechanism in these strains in resistance to antibiotics. PMID:23886790

  7. Evaluation of CHROMagar Acinetobacter for Detection of Enteric Carriage of Multidrug-Resistant Acinetobacter baumannii in Samples from Critically Ill Patients▿

    PubMed Central

    Gordon, N. C.; Wareham, D. W.

    2009-01-01

    CHROMagar Acinetobacter was used to screen stool and perineal swabs for enteric carriage of multidrug-resistant Acinetobacter baumannii in samples from critically ill patients. Results were compared with a molecular assay resulting in sensitivity and specificity of culture compared to PCR of 91.7% and 89.6%, respectively. PMID:19439546

  8. Identifying more epidemic clones during a hospital outbreak of multidrug-resistant Acinetobacter baumannii.

    PubMed

    Domenech de Cellès, Matthieu; Salomon, Jérôme; Marinier, Anne; Lawrence, Christine; Gaillard, Jean-Louis; Herrmann, Jean-Louis; Guillemot, Didier

    2012-01-01

    Infections caused by multidrug-resistant bacteria are a major concern in hospitals. Current infection-control practices legitimately focus on hygiene and appropriate use of antibiotics. However, little is known about the intrinsic abilities of some bacterial strains to cause outbreaks. They can be measured at a population level by the pathogen's transmission rate, i.e. the rate at which the pathogen is transmitted from colonized hosts to susceptible hosts, or its reproduction number, counting the number of secondary cases per infected/colonized host. We collected data covering a 20-month surveillance period for carriage of multidrug-resistant Acinetobacter baumannii (MDRAB) in a surgery ward. All isolates were subjected to molecular fingerprinting, and a cluster analysis of profiles was performed to identify clonal groups. We then applied stochastic transmission models to infer transmission rates of MDRAB and each MDRAB clone. Molecular fingerprinting indicated that 3 clonal complexes spread in the ward. A first model, not accounting for different clones, quantified the level of in-ward cross-transmission, with an estimated transmission rate of 0.03/day (95% credible interval [0.012-0.049]) and a single-admission reproduction number of 0.61 [0.30-1.02]. The second model, accounting for different clones, suggested an enhanced transmissibility of clone 3 (transmission rate 0.047/day [0.018-0.091], with a single-admission reproduction number of 0.81 [0.30-1.56]). Clones 1 and 2 had comparable transmission rates (respectively, 0.016 [0.001-0.045], 0.014 [0.001-0.045]). The method used is broadly applicable to other nosocomial pathogens, as long as surveillance data and genotyping information are available. Building on these results, more epidemic clones could be identified, and could lead to follow-up studies dissecting the functional basis for variation in transmissibility of MDRAB lineages. PMID:23029226

  9. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.

    2014-01-01

    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  10. Joint Transcriptional Control of Virulence and Resistance to Antibiotic and Environmental Stress in Acinetobacter baumannii

    PubMed Central

    Gallagher, Larry A.; Jacobson, Rachael K.; Usacheva, Elena A.; Peterson, Lance R.; Zurawski, Daniel V.; Shuman, Howard A.

    2015-01-01

    ABSTRACT The increasing emergence of antibiotic-resistant bacterial pathogens represents a serious risk to human health and the entire health care system. Many currently circulating strains of Acinetobacter baumannii exhibit resistance to multiple antibiotics. A key limitation in combating A. baumannii is that our understanding of the molecular mechanisms underlying the pathogenesis of A. baumannii is lacking. To identify potential virulence determinants of a contemporary multidrug-resistant isolate of A. baumannii, we used transposon insertion sequencing (TnSeq) of strain AB5075. A collection of 250,000 A. baumannii transposon mutants was analyzed for growth within Galleria mellonella larvae, an insect-based infection model. The screen identified 300 genes that were specifically required for survival and/or growth of A. baumannii inside G. mellonella larvae. These genes encompass both known, established virulence factors and several novel genes. Among these were more than 30 transcription factors required for growth in G. mellonella. A subset of the transcription factors was also found to be required for resistance to antibiotics and environmental stress. This work thus establishes a novel connection between virulence and resistance to both antibiotics and environmental stress in A. baumannii. PMID:26556274

  11. Carbapenem-resistant isolates of Acinetobacter baumannii in a municipal wastewater treatment plant, Croatia, 2014.

    PubMed

    Hrenovic, Jasna; Goic-Barisic, Ivana; Kazazic, Snjezana; Kovacic, Ana; Ganjto, Marin; Tonkic, Marija

    2016-04-14

    Acinetobacter baumannii is an emerging hospital pathogen. Whereas A. baumannii isolated from patients or hospitals has been reported, there are few data regarding propagation of viable A. baumannii in the natural environment. This study investigates the occurrence and antimicrobial susceptibility of viable A. baumannii in municipal wastewater and its persistence through the wastewater treatment process. A total of 21 A. baumannii isolates were recovered at a secondary type of municipal wastewater treatment plant in Zagreb, Croatia: 15 from raw influent wastewater and six from final effluent. All isolates were carbapenem- and multidrug-resistant. Among 14 isolates tested for blaOXA genes, all harboured the constitutive blaOXA-51-like gene, while the acquired blaOXA-23-like and blaOXA-40-like genes were found in 10 and three isolates respectively. Six A. baumannii isolates recovered from effluent wastewater multiplied and survived in sterilised effluent wastewater up to 50 days. These findings support the idea that multidrug-resistant A. baumannii can occur and have the ability to survive in the environment. PMID:27105318

  12. Evaluation of Vitek2 and BD Phoenix in antimicrobial susceptibility testing of Acinetobacter baumannii and Pseudomonas aeruginosa.

    PubMed

    Jekarl, Dong Wook; Han, Sang Bong; Kim, Yoon Joo; Shin, Sang Hyun; Park, Kang Gyun; Park, Jung Jun; Han, Kyungja; Park, Yeon-Joon

    2010-08-01

    The accuracy of antimicrobial susceptibility testing of Vitek2 and BD Phoenix against Acinetobacter baumannii and Pseudomonas aeruginosa was evaluated. Both systems showed overall categoric agreement of < or =90% for cefepime and ceftazidime against A. baumannii and imipenem and cefepime (and ceftazidime with Vitek2) against P. aeruginosa because of high minor error rates. PMID:20638609

  13. Clonal diversity of Acinetobacter baumannii clinical isolates revealed by a snapshot study

    PubMed Central

    2013-01-01

    Background Acinetobacter baumannii is a notorious opportunistic pathogen mainly associated with hospital-acquired infections. Studies on the clonal relatedness of isolates could lay the foundation for effective infection control. A snapshot study was performed to investigate the clonal relatedness of A. baumannii clinical isolates in our local settings. Results Among 82 non-repetitive Acinetobacter spp. clinical isolates that were recovered during a period of four days in 13 hospitals in Sichuan, Southwest China, 67 isolates were identified as A. baumannii. Half of the 67 A. baumannii isolates were non-susceptible to carbapenems. blaOXA-23 was the only acquired carbapenemase gene detected, present in 40 isolates including five carbapenem-susceptible ones. The isolates belonged to 62 pulsotypes determined by PFGE and 31 sequence types (ST) by multi-locus sequence typing. Forty-three isolates belonged to the globally-disseminated clonal complex 92, among which ST75, ST92 and ST208 were the most common sequence types. Conclusions Clinical isolates of A. baumannii were diverse in clonality in this snapshot study. However, most of the isolates belonged to the globally-distributed clonal complex CC92. ST75, ST92 and ST208 were the most common types in our region. In particular, ST208 might be an emerging lineage carrying blaOXA-23. PMID:24144168

  14. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

    PubMed Central

    Durn, Goran; Goic-Barisic, Ivana; Kovacic, Ana

    2014-01-01

    Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol. PMID:24584245

  15. Evaluation of five susceptibility test methods for detection of tobramycin resistance in a cluster of epidemiologically related Acinetobacter baumannii isolates.

    PubMed

    Moodley, V Mischka; Oliver, Stephen P; Shankland, Iva; Elisha, B Gay

    2013-08-01

    Acinetobacter baumannii is a major nosocomial pathogen causing infections in critically ill patients. This organism has acquired the propensity to rapidly develop resistance to most antibiotics. At several hospitals within Cape Town, South Africa, tobramycin and colistin are frequently the only therapeutic options. Vitek2 automated susceptibility testing (AST) is used in the clinical laboratory to determine selected susceptibility profiles. The suspicion of a possible AST-related technical error when testing for susceptibility to tobramycin in A. baumannii precipitated this study. Thirty-nine A. baumannii strains isolated from clinical specimens (June to December 2006) were included in this prospective study. Tobramycin susceptibility testing results obtained by AST, disc diffusion, the epsilometer test (Etest), and agar dilution were compared to those for broth microdilution (BMD), the reference method. The tobramycin susceptibility results revealed errors in 25/39 (64%) isolates (10 very major and 15 minor errors) when AST was compared to BMD, 12/39 (31%) (2 very major and 10 minor errors) when Etest was compared to BMD, 16/39 (41%) (3 very major and 13 minor errors) when disc diffusion was compared to BMD, and 21/39 (54%) (10 very major and 11 minor errors) when agar dilution was compared to BMD. Using PCR, we detected aac(3)-IIa, which is associated with tobramycin resistance, in 21/25 of the discrepant isolates. Molecular typing (using pulsed-field gel electrophoresis and repetitive sequence-based PCR [rep-PCR]) showed that these isolates were genetically related. Clinical laboratories that routinely use the Vitek2 system should consider an alternative testing method for determining susceptibility to tobramycin. PMID:23698528

  16. Tn125-Related Acquisition of blaNDM-Like Genes in Acinetobacter baumannii

    PubMed Central

    Poirel, Laurent; Bonnin, Rémy A.; Boulanger, Anne; Schrenzel, Jacques; Kaase, Martin

    2012-01-01

    A multidrug-resistant Acinetobacter baumannii isolate recovered from a patient hospitalized in Switzerland after a transfer from Serbia produced the NDM-1 carbapenemase. The blaNDM-1 gene was part of a chromosomally located Tn125 composite transposon bracketed by two copies of the same insertion sequence, ISAba125. This transposon was also associated with the acquisition and expression of the blaNDM-2 gene in an A. baumannii isolate in Germany. Tn125 appears to be the main vehicle for dissemination of blaNDM genes in that species. PMID:22143526

  17. Inhibition of LpxC Increases Antibiotic Susceptibility in Acinetobacter baumannii.

    PubMed

    García-Quintanilla, Meritxell; Caro-Vega, José M; Pulido, Marina R; Moreno-Martínez, Patricia; Pachón, Jerónimo; McConnell, Michael J

    2016-08-01

    LpxC inhibitors have generally shown poor in vitro activity against Acinetobacter baumannii We show that the LpxC inhibitor PF-5081090 inhibits lipid A biosynthesis, as determined by silver staining and measurements of endotoxin levels, and significantly increases cell permeability. The presence of PF-5081090 at 32 mg/liter increased susceptibility to rifampin, vancomycin, azithromycin, imipenem, and amikacin but had no effect on susceptibility to ciprofloxacin and tigecycline. Potentiating existing antibiotics with LpxC inhibitors may represent an alternative treatment strategy for multidrug-resistant A. baumannii. PMID:27270288

  18. The contribution of nutrient metal acquisition and metabolism to Acinetobacter baumannii survival within the host

    PubMed Central

    Mortensen, Brittany L.; Skaar, Eric P.

    2013-01-01

    Acinetobacter baumannii is a significant contributor to intensive care unit (ICU) mortality causing numerous types of infection in this susceptible ICU population, most notably ventilator-associated pneumonia. The substantial disease burden attributed to A. baumannii and the rapid acquisition of antibiotic resistance make this bacterium a serious health care threat. A. baumannii is equipped to tolerate the hostile host environment through modification of its metabolism and nutritional needs. Among these adaptations is the evolution of mechanisms to acquire nutrient metals that are sequestered by the host as a defense against infection. Although all bacteria require nutrient metals, there is diversity in the particular metal needs among species and within varying tissue types and bacterial lifecycles. A. baumannii is well-equipped with the metal homeostatic systems required for the colonization of a diverse array of tissues. Specifically, iron and zinc homeostasis is important for A. baumannii interactions with biotic surfaces and for growth within vertebrates. This review discusses what is currently known regarding the interaction of A. baumannii with vertebrate cells with a particular emphasis on the contributions of metal homeostasis systems. Overall, published research supports the utility of exploiting these systems as targets for the development of much-needed antimicrobials against this emerging infectious threat. PMID:24377089

  19. Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

    PubMed Central

    Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried

    2014-01-01

    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii. PMID:25000585

  20. Identification of Variable-Number Tandem-Repeat (VNTR) Sequences in Acinetobacter baumannii and Interlaboratory Validation of an Optimized Multiple-Locus VNTR Analysis Typing Scheme▿†

    PubMed Central

    Pourcel, Christine; Minandri, Fabrizia; Hauck, Yolande; D'Arezzo, Silvia; Imperi, Francesco; Vergnaud, Gilles; Visca, Paolo

    2011-01-01

    Acinetobacter baumannii is an important opportunistic pathogen responsible for nosocomial outbreaks, mostly occurring in intensive care units. Due to the multiplicity of infection sources, reliable molecular fingerprinting techniques are needed to establish epidemiological correlations among A. baumannii isolates. Multiple-locus variable-number tandem-repeat analysis (MLVA) has proven to be a fast, reliable, and cost-effective typing method for several bacterial species. In this study, an MLVA assay compatible with simple PCR- and agarose gel-based electrophoresis steps as well as with high-throughput automated methods was developed for A. baumannii typing. Preliminarily, 10 potential polymorphic variable-number tandem repeats (VNTRs) were identified upon bioinformatic screening of six annotated genome sequences of A. baumannii. A collection of 7 reference strains plus 18 well-characterized isolates, including unique types and representatives of the three international A. baumannii lineages, was then evaluated in a two-center study aimed at validating the MLVA assay and comparing it with other genotyping assays, namely, macrorestriction analysis with pulsed-field gel electrophoresis (PFGE) and PCR-based sequence group (SG) profiling. The results showed that MLVA can discriminate between isolates with identical PFGE types and SG profiles. A panel of eight VNTR markers was selected, all showing the ability to be amplified and good amounts of polymorphism in the majority of strains. Independently generated MLVA profiles, composed of an ordered string of allele numbers corresponding to the number of repeats at each VNTR locus, were concordant between centers. Typeability, reproducibility, stability, discriminatory power, and epidemiological concordance were excellent. A database containing information and MLVA profiles for several A. baumannii strains is available from http://mlva.u-psud.fr/. PMID:21147956

  1. Lytic Myophage Abp53 Encodes Several Proteins Similar to Those Encoded by Host Acinetobacter baumannii and Phage phiKO2 ▿ †

    PubMed Central

    Lee, Chia-Ni; Tseng, Tsai-Tien; Lin, Juey-Wen; Fu, Yung-Chieh; Weng, Shu-Fen; Tseng, Yi-Hsiung

    2011-01-01

    Acinetobacter baumannii is an important Gram-negative opportunistic pathogen causing nosocomial infections. The emergence of multiple-drug-resistant A. baumannii isolates has increased in recent years. Directed toward phage therapy, a lytic phage of A. baumannii, designated Abp53, was isolated from a sputum sample in this study. Abp53 has an isometric head and a contractile tail with tail fibers (belonging to Myoviridae), a latent period of about 10 min, and a burst size of approximately 150 PFU per infected cell. Abp53 could completely lyse 27% of the A. baumannii isolates tested, which were all multiple drug resistant, but not other bacteria. Mg2+ enhanced the adsorption and productivity of, and host lysis by, Abp53. Twenty Abp53 virion proteins were visualized in SDS-polyacrylamide gel electrophoresis, with a 47-kDa protein being the predicted major capsid protein. Abp53 has a double-stranded DNA genome of 95 kb. Sequence analyses of a 10-kb region revealed 8 open reading frames. Five of the encoded proteins, including 3 tail components and 2 hypothetical proteins, were similar to proteins encoded by A. baumannii strain ACICU. ORF1176 (one of the tail components, 1,176 amino acids [aa]), which is also similar to tail protein gp21 of Klebsiella phage phiKO2, contained repeated domains similar to those within the ACICU_02717 protein of A. baumannii ACICU and gp21. These findings suggest a common ancestry and horizontal gene transfer during evolution. As phages can expand the host range by domain duplication in tail fiber proteins, repeated domains in ORF1176 might have a similar significance in Abp53. PMID:21821767

  2. Draft Genome Sequences of Two Extensively Drug-Resistant Acinetobacter baumannii Strains Isolated from Pus Samples

    PubMed Central

    Mahalingam, Niranjana; Manivannan, Bhavani; Jadhao, Sudhir; Mishra, Gayathri; Nilawe, Pravin

    2016-01-01

    We report the draft genomes of two extensively drug-resistant (XDR) Acinetobacter baumannii strains isolated from pus samples of two patients with surgical site infections at Sri Sathya Sai Institute of Higher Medical Sciences, Prasanthigram, India. The average genomic size and G+C content are 4 Mbp and 38.96% (AB28) and 4 Mbp and 38.94% (AB30), respectively. PMID:27013044

  3. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii

    PubMed Central

    Hasan, Tarik; Choi, Chul Hee

    2015-01-01

    Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA), L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport. PMID:25873846

  4. Outbreak of extensively drug-resistant Acinetobacter baumannii indigo-pigmented strains.

    PubMed

    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Rodriguez, Rocio; Pallone, Elida; Bakai, Romina; Centrón, Daniela; Ramírez, María Soledad

    2013-11-01

    Acinetobacter baumannii pigmented strains are not common in clinical settings. Here, we report an outbreak caused by indigo-pigmented A. baumannii strains isolated in an acute care hospital in Argentina from March to September 2012. Pan-PCR assays exposed a unique pattern belonging to the recently described regional CC113(B)/CC79(P) clonal complex that confirms the relevant relationships among the indigo-pigmented A. baumannii strains. All of them were extensively drug resistant and harbored different genetic elements associated with horizontal genetic transfer, such as the transposon Tn2006, class 2 integrons, AbaR-type islands, IS125, IS26, strA, strB, florR, and the small recombinase ISCR2 associated with the sul2 gene preceded by ISAba1. PMID:23985923

  5. VEB-1 Extended-Spectrum β-lactamase–producing Acinetobacter baumannii, France1

    PubMed Central

    Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice

    2006-01-01

    VEB-1 extended-spectrum β-lactamase–producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were blaVEB-1-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resistance. PMID:16965700

  6. Acinetobactin Isomerization Enables Adaptive Iron Acquisition in Acinetobacter baumannii through pH-Triggered Siderophore Swapping.

    PubMed

    Shapiro, Justin A; Wencewicz, Timothy A

    2016-02-12

    Pathogenic strains of Acinetobacter baumannii excrete multiple siderophores that enhance iron scavenging from host sources. The oxazoline siderophore pre-acinetobactin undergoes an unusual non-enzymatic isomerization, producing the isoxazolidinone acinetobactin. In this study, we explored the kinetics, mechanism, and biological consequence of this siderophore swapping. Pre-acinetobactin is excreted to the extracellular space where the isomerization to acinetobactin occurs with a pH-rate profile consistent with 5-exo-tet cyclization at C5' with clean stereochemical inversion. Pre-acinetobactin persists at pH <6, and acinetobactin is rapidly formed at pH >7, matching each siderophore's pH preference for iron(III) chelation and A. baumannii growth promotion. Acinetobactin isomerization provides two siderophores for the price of one, enabling A. baumannii to sequester iron over a broad pH range likely to be encountered during the course of an infection. PMID:27624967

  7. In vitro and in vivo antimicrobial activities of gallium nitrate against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Antunes, Luísa C S; Imperi, Francesco; Minandri, Fabrizia; Visca, Paolo

    2012-11-01

    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO(3))(3), the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO(3))(3) delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO(3))(3) activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO(3))(3) also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO(3))(3) inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO(3))(3) also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii. PMID:22964249

  8. Screening of Herbal-Based Bioactive Extract Against Carbapenem-Resistant Strain of Acinetobacter baumannii.

    PubMed

    Tiwari, Monalisa; Roy, Ranita; Tiwari, Vishvanath

    2016-07-01

    Acinetobacter baumannii is grouped in the ESKAPE pathogens by Infectious Disease Society of America, which is linked to high degree of morbidity, mortality, and increased costs. The high level of acquired and intrinsic resistance mechanisms of these bacteria makes it an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In this study, methanolic extracts of six medicinal plants were subjected to phytochemical screening and their antimicrobial activity was tested against two strains of A. baumannii (ATCC 19606, carbapenem-sensitive strain, and RS 307, carbapenem-resistant strain). Synergistic effect of the plant extracts and antibiotics was also tested. Bael or Aegle marmelos contains tannin, phenol, terpenoids, glycoside, alkaloids, coumarine, steroid, and quinones. Flowers of madar or Calotropis procera possess tannin, phenol, terpenoids, glycoside, quinone, anthraquinone, anthocyanin, coumarin, and steroid. An inhibitory growth curve was seen for both the bacterial strains when treated with A. marmelos, Curcuma longa, and leaves and flowers of C. procera. Antibiotics alone showed a small zone of inhibition, but when used with herbal extracts they exhibited larger zone of inhibition. Synergistic effect of A. marmelos and imipenem was the best against both the strains of A. baumannii. From this study, it can be concluded that extracts from A. marmelos and leaves and flowers of C. procera exhibited the most effective antibacterial activity. These herbal extracts may be used to screen the bioactive compound against the carbapenem-resistant strain of A. baumannii. PMID:26910023

  9. Structural and bioinformatic characterization of an Acinetobacter baumannii type II carrier protein

    SciTech Connect

    Allen, C. Leigh; Gulick, Andrew M.

    2014-06-01

    The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented. Microorganisms produce a variety of natural products via secondary metabolic biosynthetic pathways. Two of these types of synthetic systems, the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), use large modular enzymes containing multiple catalytic domains in a single protein. These multidomain enzymes use an integrated carrier protein domain to transport the growing, covalently bound natural product to the neighboring catalytic domains for each step in the synthesis. Interestingly, some PKS and NRPS clusters contain free-standing domains that interact intermolecularly with other proteins. Being expressed outside the architecture of a multi-domain protein, these so-called type II proteins present challenges to understand the precise role they play. Additional structures of individual and multi-domain components of the NRPS enzymes will therefore provide a better understanding of the features that govern the domain interactions in these interesting enzyme systems. The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented here. Comparison with the closest structural homologs of other carrier proteins identifies the requirements for a conserved glycine residue and additional important sequence and structural requirements within the regions that interact with partner proteins.

  10. A fatal case of multidrug resistant acinetobacter necrotizing fasciitis: the changing scary face of nosocomial infection.

    PubMed

    Sinha, Nupur; Niazi, Masooma; Lvovsky, Dmitry

    2014-01-01

    Necrotizing fasciitis is an uncommon soft-tissue infection, associated with high morbidity and mortality. Early recognition and treatment are crucial for survival. Acinetobacter baumannii is rarely associated with necrotizing fasciitis. Wound infections due to A. baumannii have been described in association with severe trauma in soldiers. There are only sporadic reports of monomicrobial A. baumannii necrotizing fasciitis. We report a unique case of monomicrobial necrotizing fasciitis caused by multidrug resistant (MDR) A. baumannii, in absence of any preceding trauma, surgery, or any obvious breech in the continuity of skin or mucosa. A 48-year-old woman with history of HIV, asthma, hypertension, and tobacco and excocaine use presented with acute respiratory failure requiring mechanical ventilation. She was treated for pneumonia for 7 days and was successfully extubated. All septic work-up was negative. Two days later, she developed rapidly spreading nonblanching edema with bleb formation at the lateral aspect of right thigh. Emergent extensive debridement and fasciotomy were performed. Operative findings and histopathology were consistent with necrotizing fasciitis. Despite extensive debridement, she succumbed to septic shock in the next few hours. Blood, wound, and tissue cultures grew A. baumannii, sensitive only to amikacin and polymyxin. Histopathology was consistent with necrotizing fasciitis. PMID:25349748

  11. Detection of AdeABC efflux pump genes in tetracycline-resistant Acinetobacter baumannii isolates from burn and ventilator-associated pneumonia patients

    PubMed Central

    Beheshti, Maryam; Talebi, Malihe; Ardebili, Abdollah; Bahador, Abbas; Lari, Abdolaziz Rastegar

    2014-01-01

    Purpose: Acinetobacter baumannii is the most prevalent nosocomial pathogen which have been emerged in the past three decades worldwide. The aim of this study was to assess the distribution of the AdeABC efflux pump genes, associated with tetracycline resistance in Acinetobacter baumannii isolates collected from burn infection and Ventilator Associated Pneumonia (VAP). Materials and Methods: Ninety-eight A. baumannii isolates were collected from two different hospitals in Tehran, Iran. Tetracycline susceptibility testing was performed by disk diffusion and agar dilution methods according to the CLSI guidelines. The presence of adeSR, adeB, drug efflux system genes in resistant isolates was assessed by polymerase chain reaction (PCR). Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as a chemical inhibitor agent to assess the contribution of AdeABC efflux pump in tetracycline resistance isolates. Results: Approximately 48% (47 out of 98) of isolates showed resistance to tetracycline which 14 (14.2%) isolates were corresponded to burn infection and the remaining 33 (33.8%) strains were isolated from VAP. All tetracycline resistant isolates have AdeABC in PCR assay. The reduction of tetracycline MICs by using 50 μg/ml CCCP were as follows: in 18 isolates 2-4 fold reduction in MICs, 26 isolates showed 8 fold reduction,1 isolate showed 16 fold, 1 isolate showed 32 fold and the remaining 1 isolate showed 128 fold reduction in MICs. Conclusion: The results showed significant correlation between tetracycline resistance and AdeABC efflux pump genes in resistant A. baumannii isolates. PMID:25400404

  12. Acinetobacter baumannii Is Dependent on the Type II Secretion System and Its Substrate LipA for Lipid Utilization and In Vivo Fitness

    PubMed Central

    Johnson, Tanya L.; Waack, Ursula; Smith, Sara; Mobley, Harry

    2015-01-01

    ABSTRACT Gram-negative bacteria express a number of sophisticated secretion systems to transport virulence factors across the cell envelope, including the type II secretion (T2S) system. Genes for the T2S components GspC through GspN and PilD are conserved among isolates of Acinetobacter baumannii, an increasingly common nosocomial pathogen that is developing multidrug resistance at an alarming rate. In contrast to most species, however, the T2S genes are dispersed throughout the genome rather than linked into one or two operons. Despite this unique genetic organization, we show here that the A. baumannii T2S system is functional. Deletion of gspD or gspE in A. baumannii ATCC 17978 results in loss of secretion of LipA, a lipase that breaks down long-chain fatty acids. Due to a lack of extracellular lipase, the gspD mutant, the gspE mutant, and a lipA deletion strain are incapable of growth on long-chain fatty acids as a sole source of carbon, while their growth characteristics are indistinguishable from those of the wild-type strain in nutrient-rich broth. Genetic inactivation of the T2S system and its substrate, LipA, also has a negative impact on in vivo fitness in a neutropenic murine model for bacteremia. Both the gspD and lipA mutants are outcompeted by the wild-type strain as judged by their reduced numbers in spleen and liver following intravenous coinoculation. Collectively, our findings suggest that the T2S system plays a hitherto-unrecognized role in in vivo survival of A. baumannii by transporting a lipase that may contribute to fatty acid metabolism. IMPORTANCE Infections by multidrug-resistant Acinetobacter baumannii are a growing health concern worldwide, underscoring the need for a better understanding of the molecular mechanisms by which this pathogen causes disease. In this study, we demonstrated that A. baumannii expresses a functional type II secretion (T2S) system that is responsible for secretion of LipA, an extracellular lipase required for

  13. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar.

    PubMed

    Rolain, J-M; Loucif, L; Al-Maslamani, M; Elmagboul, E; Al-Ansari, N; Taj-Aldeen, S; Shaukat, A; Ahmedullah, H; Hamed, M

    2016-05-01

    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (bla OXA-23, bla OXA-24, bla OXA-58, bla NDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and bla OXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for bla OXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar. PMID:27054039

  14. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications

    PubMed Central

    Thi Khanh Nhu, Nguyen; Riordan, David W.; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W.; Baker, Stephen; Stabler, Richard A

    2016-01-01

    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  15. Effect of carbonyl cyanide 3-chlorophenylhydrazone (CCCP) on killing Acinetobacter baumannii by colistin.

    PubMed

    Park, Young Kyoung; Ko, Kwan Soo

    2015-01-01

    We investigated the effect of cyanide 3-chlorophenylhydrazone (CCCP) and other efflux pump inhibitors (EPIs) on the colistin susceptibility in Acinetobacter baumannii. While minimum inhibitory concentrations (MICs) of colistin in all colistin-resistant strains decreased significantly with 25 μM of CCCP and 2,4-dinitrophenol (DNP), phenyl-arginine-β-naphthylamide (PAβN), and reserpine did not decrease the colistin MICs. However, CCCP and DNP as well as PAβN and reserpine did not have a significant effect on the MICs of the other agents. Efflux pump gene expressions in colistin-resistant strains were not increased compared with those in colistin-susceptible strains. When only 5X MIC of colistin (5 mg/L) was provided to a colistin-susceptible A. baumannii strain, the bacterial cell number was reduced by 9 h after exposure to colistin, but regrowth was observed. When CCCP was added to colistin, bacterial cells were completely killed after 24 to 48 h of incubation, which was not due to the toxicity of CCCP itself. Colistin resistance in A. baumannii may not be due to efflux pumps. Our present study suggests that bacterial cells with reduced metabolic activity by CCCP are more susceptible to colistin in A. baumannii. It may show the possibility that combined therapy with colistin and other antimicrobial agents could effective against A. baumannii infections. PMID:25557480

  16. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii

    PubMed Central

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong

    2016-01-01

    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs–antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  17. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications.

    PubMed

    Thi Khanh Nhu, Nguyen; Riordan, David W; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W; Baker, Stephen; Stabler, Richard A

    2016-01-01

    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  18. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii.

    PubMed

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong

    2016-01-01

    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs-antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  19. Carbapenem-Resistant Acinetobacter baumannii: Concomitant Contamination of Air and Environmental Surfaces.

    PubMed

    Shimose, Luis A; Masuda, Eriko; Sfeir, Maroun; Berbel Caban, Ana; Bueno, Maria X; dePascale, Dennise; Spychala, Caressa N; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Doi, Yohei; Munoz-Price, L Silvia

    2016-07-01

    OBJECTIVE To concomitantly determine the differential degrees of air and environmental contamination by Acinetobacter baumannii based on anatomic source of colonization and type of ICU layout (single-occupancy vs open layout). DESIGN Longitudinal prospective surveillance study of air and environmental surfaces in patient rooms. SETTING A 1,500-bed public teaching hospital in Miami, Florida. PATIENTS Consecutive A. baumannii-colonized patients admitted to our ICUs between October 2013 and February 2014. METHODS Air and environmental surfaces of the rooms of A. baumannii-colonized patients were sampled daily for up to 10 days. Pulsed-field gel electrophoresis (PFGE) was used to type and match the matching air, environmental, and clinical A. baumannii isolates. RESULTS A total of 25 A. baumannii-colonized patients were identified during the study period; 17 were colonized in the respiratory tract and 8 were colonized in the rectum. In rooms with rectally colonized patients, 38.3% of air samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 13.1% of air samples were positive (P=.0001). In rooms with rectally colonized patients, 15.5% of environmental samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 9.5% of environmental samples were positive (P=.02). The rates of air contamination in the open-layout and single-occupancy ICUs were 17.9% and 21.8%, respectively (P=.5). Environmental surfaces were positive in 9.5% of instances in open-layout ICUs versus 13.4% in single-occupancy ICUs (P=.09). CONCLUSIONS Air and environmental surface contaminations were significantly greater among rectally colonized patients; however, ICU layout did not influence the rate of contamination. Infect Control Hosp Epidemiol 2016;37:777-781. PMID:27045768

  20. Clinical predictors of Pseudomonas aeruginosa or Acinetobacter baumannii bacteremia in patients admitted to the ED.

    PubMed

    Kang, Cheol-In; Chung, Doo Ryeon; Peck, Kyong Ran; Song, Jae-Hoon

    2012-09-01

    The identification of clinical characteristics that could identify patients at high risk for Pseudomonas aeruginosa or Acinetobacter baumannii bacteremia would aid clinicians in the appropriate management of these life-threatening conditions, especially in patients admitted to the emergency department (ED) with community-onset infections. To determine clinical risk factors for P. aeruginosa or A. baumannii bacteremia in patients with community-onset gram-negative bacteremia (GNB), a post hoc analysis of a nationwide bacteremia surveillance database including patients with microbiologically documented GNB was performed. Ninety-six patients with P. aeruginosa or A. baumannii bacteremia were compared with 1230 patients with Escherichia coli or Klebsiella pneumoniae bacteremia. A solid tumor or hematologic malignancy was more likely to be associated with P. aeruginosa or A. baumannii bacteremia, whereas concurrent neurologic disease was less frequently seen. In regards to the site of infection, pneumonia was more common in P. aeruginosa or A. baumannii bacteremia, whereas a urinary tract infection was less frequently seen. Factors associated with P. aeruginosa or A. baumannii bacteremia in multivariate analysis included pneumonia (odds ratio [OR], 3.60; 95% confidence interval [CI], 1.86-6.99), hematologic malignancy (OR, 2.71; 95% CI, 1.26-5.84), male sex (OR, 2.17; 95% CI, 1.31-3.58), solid tumor (OR, 1.89; 95% CI, 1.15-3.12), and health-care-associated infection (OR, 1.88; 95% CI, 1.48-2.41). Our data suggest that an initial empirical antimicrobial coverage of P. aeruginosa or A. baumannii bacteremia should be seriously considered in patients with pneumonia, a hematologic malignancy, solid tumor, or health-care-associated infection, when GNB is suspected, even in community-onset infections. PMID:22030178

  1. Impact of a Cross-Kingdom Signaling Molecule of Candida albicans on Acinetobacter baumannii Physiology

    PubMed Central

    Kostoulias, Xenia; Murray, Gerald L.; Cerqueira, Gustavo M.; Kong, Jason B.; Bantun, Farkad; Mylonakis, Eleftherios; Khoo, Chen Ai

    2015-01-01

    Multidrug-resistant (MDR) Acinetobacter baumannii is an opportunistic human pathogen that has become highly problematic in the clinical environment. Novel therapies are desperately required. To assist in identifying new therapeutic targets, the antagonistic interactions between A. baumannii and the most common human fungal pathogen, Candida albicans, were studied. We have observed that the C. albicans quorum-sensing molecule, farnesol, has cross-kingdom interactions, affecting the viability of A. baumannii. To gain an understanding of its mechanism, the transcriptional profile of A. baumannii exposed to farnesol was examined. Farnesol caused dysregulation of a large number of genes involved in cell membrane biogenesis, multidrug efflux pumps (AcrAB-like and AdeIJK-like), and A. baumannii virulence traits such as biofilm formation (csuA, csuB, and ompA) and motility (pilZ and pilH). We also observed a strong induction in genes involved in cell division (minD, minE, ftsK, ftsB, and ftsL). These transcriptional data were supported by functional assays showing that farnesol disrupts A. baumannii cell membrane integrity, alters cell morphology, and impairs virulence characteristics such as biofilm formation and twitching motility. Moreover, we showed that A. baumannii uses efflux pumps as a defense mechanism against this eukaryotic signaling molecule. Owing to its effects on membrane integrity, farnesol was tested to see if it potentiated the activity of the membrane-acting polymyxin antibiotic colistin. When coadministered, farnesol increased sensitivity to colistin for otherwise resistant strains. These data provide mechanistic understanding of the antagonistic interactions between diverse pathogens and may provide important insights into novel therapeutic strategies. PMID:26482299

  2. In Vivo Selection of Pan-Drug Resistant Acinetobacter baumannii during Antibiotic Treatment

    PubMed Central

    Kim, Yoonjung; Bae, Il Kwon; Yong, Dongeun; Lee, Kyungwon

    2015-01-01

    Purpose Colistin resistance in Acinetobacter baumannii (A. baumannii) is mediated by a complete loss of lipopolysaccharide production via mutations in lpxA, lpxC, and lpxD gene or lipid A modifications via mutations in the pmrA and pmrB genes. However, the exact mechanism of therapy-induced colistin resistance in A. baumannii is not well understood. Materials and Methods We investigated the genotypic and phenotypic changes that underlie pan-drug resistance mechanisms by determining differences between the alterations in extensively drug-resistant (XDR) A. baumannii (AB001 and AB002) isolates and a pan-drug resistant (PDR) counterpart (AB003) recovered from one patient before and after antibiotic treatment, respectively. Results All three clinical isolates shared an identical sequence type (ST138), belonging to the global epidemic clone, clonal complex 92, and all produced OXA-23 carbapenemase. The PDR AB003 showed two genetic differences, acquisition of armA gene and an amino acid substitution (Glu229Asp) in pmrB gene, relative to XDR isolates. No mutations were detected in the pmrA, pmrC, lpxA, lpxC, or lpxD genes in all three isolates. In matrix-assisted laser desorption ionization-time of flight analysis, the three isolates commonly showed two major peaks at 1728 m/z and 1912 m/z, but peaks at 2034 m/z, 2157 m/z, 2261 m/z, and 2384 m/z were detected only in the PDR A. baumannii AB003 isolate. Conclusion Our results show that changes in lipid A structure via a mutation in the pmrB gene and acquisition of armA gene might confer resistance to colistin and aminoglycosides to XDR A. baumannii strains, resulting in appearance of a PDR A. baumannii strain of ST138. PMID:26069113

  3. RT-PCR and statistical analyses of adeABC expression in clinical isolates of Acinetobacter calcoaceticus-Acinetobacter baumannii complex.

    PubMed

    Ruzin, Alexey; Immermann, Frederick W; Bradford, Patricia A

    2010-06-01

    The relationship between expression of adeABC and minimal inhibitory concentration (MIC) of tigecycline was investigated by RT-PCR and statistical analyses in a population of 106 clinical isolates (MIC range, 0.0313-16 microg/ml) of Acinetobacter calcoaceticus-Acinetobacter baumannii complex. There was a statistically significant linear relationship (p < 0.0001) between log-transformed expression values and log-transformed MIC values, indicating that overexpression of AdeABC efflux pump is a prevalent mechanism for decreased susceptibility to tigecycline in A. calcoaceticus-A. baumannii complex. PMID:20438348

  4. Multidrug-Resistant Acinetobacter baumannii in Veterinary Clinics, Germany

    PubMed Central

    Prenger-Berninghoff, Ellen; Weiss, Reinhard; van der Reijden, Tanny; van den Broek, Peterhans; Baljer, Georg; Dijkshoorn, Lenie

    2011-01-01

    An increase in prevalence of multidrug-resistant Acinetobacter spp. in hospitalized animals was observed at the Justus-Liebig-University (Germany). Genotypic analysis of 56 isolates during 2000–2008 showed 3 clusters that corresponded to European clones I–III. Results indicate spread of genotypically related strains within and among veterinary clinics in Germany. PMID:21888812

  5. Identification of Acinetobacter baumannii Serum-Associated Antibiotic Efflux Pump Inhibitors

    PubMed Central

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn

    2014-01-01

    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca2+ channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. PMID:25114126

  6. Contribution of Resistance-Nodulation-Cell Division Efflux Systems to Antibiotic Resistance and Biofilm Formation in Acinetobacter baumannii

    PubMed Central

    Yoon, Eun-Jeong; Nait Chabane, Yassine; Goussard, Sylvie; Snesrud, Erik; Courvalin, Patrice; Dé, Emmanuelle

    2015-01-01

    ABSTRACT Acinetobacter baumannii is a nosocomial pathogen of increasing importance due to its multiple resistance to antibiotics and ability to survive in the hospital environment linked to its capacity to form biofilms. To fully characterize the contribution of AdeABC, AdeFGH, and AdeIJK resistance-nodulation-cell division (RND)-type efflux systems to acquired and intrinsic resistance, we constructed, from an entirely sequenced susceptible A. baumannii strain, a set of isogenic mutants overexpressing each system following introduction of a point mutation in their cognate regulator or a deletion for the pump by allelic replacement. Pairwise comparison of every derivative with the parental strain indicated that AdeABC and AdeFGH are tightly regulated and contribute to acquisition of antibiotic resistance when overproduced. AdeABC had a broad substrate range, including β-lactams, fluoroquinolones, tetracyclines-tigecycline, macrolides-lincosamides, and chloramphenicol, and conferred clinical resistance to aminoglycosides. Importantly, when combined with enzymatic resistance to carbapenems and aminoglycosides, this pump contributed in a synergistic fashion to the level of resistance of the host. In contrast, AdeIJK was expressed constitutively and was responsible for intrinsic resistance to the same major drug classes as AdeABC as well as antifolates and fusidic acid. Surprisingly, overproduction of AdeABC and AdeIJK altered bacterial membrane composition, resulting in decreased biofilm formation but not motility. Natural transformation and plasmid transfer were diminished in recipients overproducing AdeABC. It thus appears that alteration in the expression of efflux systems leads to multiple changes in the relationship between the host and its environment, in addition to antibiotic resistance. PMID:25805730

  7. Susceptibility Pattern and Distribution of Oxacillinases and blaPER-1 Genes among Multidrug Resistant Acinetobacter baumannii in a Teaching Hospital in Iran

    PubMed Central

    Bagheri Josheghani, Sareh; Moniri, Rezvan; Firoozeh, Farzaneh; Sehat, Mojtaba; Dasteh Goli, Yasaman

    2015-01-01

    Acinetobacter baumannii (A. baumannii) is an important nosocomial pathogen in healthcare institutions. β-Lactamase-mediated resistance is the most common mechanism for carbapenem resistance in A. baumannii. The aim of this study was to determine the antibiotic resistance pattern, to detect OXA encoding genes, class A, blaPER-1, and to detect the presence of ISAba1. A total of 124 A. baumannii isolates were collected from hospitalized patients in a teaching hospital in Kashan, Iran. The susceptibility of isolates to different antibiotics was determined by disk-diffusion method. PCR was used to detect blaPER-1, blaOXA-23, blaOXA-24, blaOXA-51, blaOXA-58, and ISAba1 genes. All isolates were resistant to ceftazidime, ceftriaxone, and cefotaxime. All of the isolates revealed susceptibility to polymyxin B and colistin. Ninety-six percent of the isolates were extensive drug resistance (XDR), 5.6% extended spectrum beta-lactamase (ESBL), and 54.8% metallo-beta-lactamase (MBL). All isolates were positive for blaOXA-51 and ISAba1. blaOXA-23,  blaOXA-24, and blaOXA-58 were found in 79.8%, 25%, and 3.2%, respectively. The frequency rate of blaPER-1 gene was 52.4%. Multidrug resistant A. baumannii isolates are increasing in our setting and extensively limit therapeutic options. The high rate presence of class D carbapenemase-encoding genes, mainly blaOXA-23 carbapenemases, is worrying and alarming as an emerging threat in our hospital. PMID:26881082

  8. Analyzing pmrA and pmrB genes in Acinetobacter baumannii resistant to colistin in Shahid Rajai Shiraz, Iran Hospital by PCR: First report in Iran.

    PubMed

    Sepahvand, Shahriar; Doudi, Monir; Davarpanah, Mohammad Ali; Bahador, Abbas; Ahmadi, Mehranoosh

    2016-07-01

    Acinetobacter baumanni is known as a worldwide emerging nosocomial infections and it is classified as one of the six dangerous microorganisms by Diseases Society of America. Multi drug-resistant strains of A. baumannii have been reported in recent decades, which may be a result of the high use of antimicrobial agents. Colistin is the last form of treatment against this organism. The presence of pmrA and pmrB genes in A. baumannii causes the resistance of this organism against Colistin. This cross-sectional study was performed on 100 samples of A. baumannii isolated from ulcer, urinary, respiratory, blood of patients admitted to the intensive care unit of Shahid Rajai Shiraz hospital within a 12-month period. The diagnosis was performed by microscopic and biochemical testing using microgen kits. Determining Colistin resistance was carried out by Diffusion Disc, Colistin antibiotic disc of MAST- England and E-test. The analysis of genes pmrA and pmrB genes was done by PCR. 100 A. baumannii samples were diagnosed out of which using diffusion disk 94 cases were sensitive to Colistin and 6 cases were resistant to it. The E-test results in resistant samples presented an MIC equal to 64 micrograms per milliliter. The PCR results in sensitive and resistant to Colistin samples presented the existence of pmrA and pmrB genes. The results indicated the presence of pmrA and pmrB genes that are the main reason of A. baumannii resistance against the last line of treatment of this organism to Colistin. PMID:27592491

  9. Zingiber officinale (ginger) compounds have tetracycline-resistance modifying effects against clinical extensively drug-resistant Acinetobacter baumannii.

    PubMed

    Wang, Hui-Min; Chen, Chung-Yi; Chen, Hsi-An; Huang, Wan-Chun; Lin, Wei-Ru; Chen, Tun-Chieh; Lin, Chun-Yu; Chien, Hsin-Ju; Lu, Po-Liang; Lin, Chiu-Mei; Chen, Yen-Hsu

    2010-12-01

    Extensively drug-resistant Acinetobacter baumannii (XDRAB) is a growing and serious nosocomial infection worldwide, such that developing new agents against it is critical. The antimicrobial activities of the rhizomes from Zingiber officinale, known as ginger, have not been proven in clinical bacterial isolates with extensive drug-resistance. This study aimed to investigate the effects of four known components of ginger, [6]-dehydrogingerdione, [10]-gingerol, [6]-shogaol and [6]-gingerol, against clinical XDRAB. All these compounds showed antibacterial effects against XDRAB. Combined with tetracycline, they showed good resistance modifying effects to modulate tetracycline resistance. Using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method, these four ginger compounds demonstrated antioxidant properties, which were inhibited by MnO₂, an oxidant without antibacterial effects. After the antioxidant property was blocked, their antimicrobial effects were abolished significantly. These results indicate that ginger compounds have antioxidant effects that partially contribute to their antimicrobial activity and are candidates for use in the treatment of infections with XDRAB. PMID:20564496

  10. Characterisation of Pellicles Formed by Acinetobacter baumannii at the Air-Liquid Interface

    PubMed Central

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B.; Jouenne, Thierry; Dé, Emmanuelle

    2014-01-01

    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster’s Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  11. Characterisation of pellicles formed by Acinetobacter baumannii at the air-liquid interface.

    PubMed

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B; Jouenne, Thierry; Dé, Emmanuelle

    2014-01-01

    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster's Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  12. Tigecycline Efflux as a Mechanism for Nonsusceptibility in Acinetobacter baumannii.

    PubMed

    Peleg, Anton Y; Adams, Jennifer; Paterson, David L

    2007-06-01

    Tigecycline has an extended spectrum of in vitro antimicrobial activities, including that against multidrug-resistant Acinetobacter. After identifying bloodstream isolates of Acinetobacter with reduced susceptibilities to tigecycline, we performed a study to assess tigecycline efflux mediated by the resistance-nodulation-division-type transporter AdeABC. After exposure of two tigecycline-nonsusceptible isolates to the efflux pump inhibitor phenyl-arginine-beta-naphthylamide (PABN), a fourfold reduction in the tigecycline MIC was observed. Both tigecycline-susceptible and -nonsusceptible isolates were found to carry the gene coding for the transmembrane component of the AdeABC pump, adeB, and the two-component regulatory system comprising adeS and adeR. Previously unreported point mutations were identified in the regulatory system in tigecycline-nonsusceptible isolates. Real-time PCR identified 40-fold and 54-fold increases in adeB expression in the two tigecycline-nonsusceptible isolates compared to that in a tigecycline-susceptible isolate. In vitro exposure of a tigecycline-susceptible clinical strain to tigecycline caused a rapid rise in the MIC of tigecycline from 2 microg/ml to 24 microg/ml, which was reversible with PABN. A 25-fold increase in adeB expression was observed in a comparison between this tigecycline-susceptible isolate and its isogenic tigecycline-nonsusceptible mutant. These results indicate that an efflux-based mechanism plays a role in reduced tigecycline susceptibility in Acinetobacter. PMID:17420217

  13. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii.

    PubMed

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin; Choi, Chul Hee; Han, Kyudong

    2015-05-15

    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  14. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

    2015-01-01

    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  15. Novel Approach To Optimize Synergistic Carbapenem-Aminoglycoside Combinations against Carbapenem-Resistant Acinetobacter baumannii

    PubMed Central

    Yadav, Rajbharan; Landersdorfer, Cornelia B.; Nation, Roger L.; Boyce, John D.

    2015-01-01

    Acinetobacter baumannii is among the most dangerous pathogens and emergence of resistance is highly problematic. Our objective was to identify and rationally optimize β-lactam-plus-aminoglycoside combinations via novel mechanism-based modeling that synergistically kill and prevent resistance of carbapenem-resistant A. baumannii. We studied combinations of 10 β-lactams and three aminoglycosides against four A. baumannii strains, including two imipenem-intermediate (MIC, 4 mg/liter) and one imipenem-resistant (MIC, 32 mg/liter) clinical isolate, using high-inoculum static-concentration time-kill studies. We present the first application of mechanism-based modeling for killing and resistance of A. baumannii using Monte Carlo simulations of human pharmacokinetics to rationally optimize combination dosage regimens for immunocompromised, critically ill patients. All monotherapies achieved limited killing (≤2.3 log10) of A. baumannii ATCC 19606 followed by extensive regrowth for aminoglycosides. Against this strain, imipenem-plus-aminoglycoside combinations yielded more rapid and extensive killing than other β-lactam-plus-aminoglycoside combinations. Imipenem at 8 mg/liter combined with an aminoglycoside yielded synergistic killing (>5 log10) and prevented regrowth of all four strains. Modeling demonstrated that imipenem likely killed the aminoglycoside-resistant population and vice versa and that aminoglycosides enhanced the target site penetration of imipenem. Against carbapenem-resistant A. baumannii (MIC, 32 mg/liter), optimized combination regimens (imipenem at 4 g/day as a continuous infusion plus tobramycin at 7 mg/kg of body weight every 24 h) were predicted to achieve >5 log10 killing without regrowth in 98.2% of patients. Bacterial killing and suppression of regrowth were best achieved for combination regimens with unbound imipenem steady-state concentrations of at least 8 mg/liter. Imipenem-plus-aminoglycoside combination regimens are highly promising and

  16. Predictors of mortality in patients with extensively drug-resistant Acinetobacter baumannii pneumonia receiving colistin therapy.

    PubMed

    Choi, Ik Sung; Lee, Yu Ji; Wi, Yu Mi; Kwan, Byung Soo; Jung, Kae Hwa; Hong, Woong Pyo; Kim, June Myong

    2016-08-01

    The ratio of the area under the free (unbound) concentration-time curve to minimum inhibitory concentration (fAUC/MIC) was proposed to be the pharmacokinetic/pharmacodynamic index most strongly linked to the antibacterial effect of colistin against Acinetobacter baumannii. A retrospective study of patients who received colistin to treat pneumonia caused by extensively drug-resistant (XDR) A. baumannii over a 4-year period was performed to assess the impact of the colistin MIC on mortality. A total of 227 patients were included in the analysis. The 7-day and 14-day mortality rates of patients with XDR A. baumannii pneumonia receiving colistin therapy were 15.0% and 23.8%, respectively. In the multivariate analysis, Acute Physiology and Chronic Health Evaluation (APACHE) II score, days from index culture to first dose of colistin, underlying tumour and septic shock at presentation were independent predictors of mortality in patients with XDR A. baumannii pneumonia receiving colistin therapy. In the univariate analysis, the colistin dose based on ideal body weight (IBW) correlated with patient outcome. Therefore, the use of IBW appeared to be more appropriate to calculate the colistin dosage. In addition, these results highlight the clinical significance of colistin MIC in patients with XDR A. baumannii pneumonia receiving colistin therapy. Although MICs were in the 'susceptible' range, patients infected with isolates with high colistin MICs showed a poorer clinical response rate than patients infected with isolates with low colistin MICs. Further clinical studies are needed to evaluate the roles of colistin MIC for predicting mortality in XDR A. baumannii pneumonia with a high colistin MIC. PMID:27423416

  17. Diversity of multi-drug resistant Acinetobacter baumannii population in a major hospital in Kuwait

    PubMed Central

    Vali, Leila; Dashti, Khadija; Opazo-Capurro, Andrés F.; Dashti, Ali A.; Al Obaid, Khaled; Evans, Benjamin A.

    2015-01-01

    Acinetobacter baumannii is one of the most important opportunistic pathogens that causes serious health care associated complications in critically ill patients. In the current study we report on the diversity of the clinical multi-drug resistant (MDR) A. baumannii in Kuwait by molecular characterization. One hundred A. baumannii were isolated from one of the largest governmental hospitals in Kuwait. Following the identification of the isolates by molecular methods, the amplified blaOXA-51-like gene product of one isolate (KO-12) recovered from blood showed the insertion of the ISAba19 at position 379 in blaOXA-78. Of the 33 MDR isolates, 28 (85%) contained blaOXA-23, 2 (6%) blaOXA-24 and 6 (18%) blaPER-1 gene. We did not detect blaOXA-58, blaVIM, blaIMP, blaGES, blaVEB, and blaNDM genes in any of the tested isolates. In three blaPER-1 positive isolates the genetic environment of blaPER-1 consisted of two copies of ISPa12 (tnpiA1) surrounding the blaPER-1 gene on a highly stable plasmid of ca. 140-kb. Multilocus-sequence typing (MLST) analysis of the 33 A. baumannii isolates identified 20 different STs, of which six (ST-607, ST-608, ST-609, ST-610, ST-611, and ST-612) were novel. Emerging STs such as ST15 (identified for the first time in the Middle East), ST78 and ST25 were also detected. The predominant clonal complex was CC2. Pulsed-field gel electrophoresis and MLST defined the MDR isolates as multi-clonal with diverse lineages. Our results lead us to believe that A. baumannii is diverse in clonal origins and/or is undergoing clonal expansion continuously while multiple lineages of MDR A. baumannii circulate in hospital ward simultaneously. PMID:26257720

  18. Ultraviolet C light for Acinetobacter baumannii wound infections in mice: Potential use for battlefield wound decontamination?

    PubMed Central

    Dai, Tianhong; Murray, Clinton K.; Vrahas, Mark S.; Baer, David G.; Tegos, George P.; Hamblin, Michael R.

    2012-01-01

    BACKGROUND Since the beginning of the conflicts in the Middle East, US Army physicians have noted a high rate of multidrug-resistant Acinetobacter baumannii infections among US soldiers wounded and initially treated in Iraq. In this study, we investigated the use of ultraviolet C (UVC) light for prevention of multidrug-resistant A. baumannii wound infections using mouse models. METHODS Partial-thickness skin abrasions and full-thickness burns in mice were infected with a multidrug-resistant A. baumannii isolate recovered from a wounded US soldier deployed to Iraq. The luxCDABE operon, which was contained in plasmid pMF 385, was cloned into the A. baumannii strain. This allowed real-time monitoring of the extent of infection in mice using bioluminescence imaging. UVC light was delivered to the mouse wounds at 30 minutes after the inoculation of A. baumannii. Groups of infected mouse wounds without being exposed to UVC served as the controls. RESULTS In vitro studies demonstrated that A. baumannii cells were inactivated at UVC exposures much lower than those needed for a similar effect on mammalian cells. It was observed in animal studies that UVC (3.24 J/cm2 for abrasions and 2.59 J/cm2 for burns) significantly reduced the bacterial burdens in UVC-treated wounds by approximately 10-fold compared with nontreated controls (p = 0.004 for abrasions, p = 0.019 for burns). DNA lesions were observed by immunofluorescence in mouse skin abrasions immediately after a UVC exposure of 3.24 J/cm2; however, the lesions were extensively repaired within 72 hours. CONCLUSION These results suggested that UVC may be useful in preventing combat-related wound infections. PMID:22929495

  19. First report of an OXA-23 carbapenemase-producing Acinetobacter baumannii clinical isolate related to Tn2006 in Spain.

    PubMed

    Espinal, P; Macià, M D; Roca, I; Gato, E; Ruíz, E; Fernández-Cuenca, F; Oliver, A; Rodríguez-Baño, J; Bou, G; Tomás, M; Vila, J

    2013-01-01

    A carbapenem-resistant Acinetobacter baumannii clinical isolate belonging to European clone II and sequence type 2 was recovered from a patient in the Son Espases hospital in Mallorca, Spain. Genetic analysis showed the presence of the bla(OXA-23) gene in association with the widely disseminated transposon Tn2006. This is the first reported identification of A. baumannii carrying bla(OXA-23) in Spain. PMID:23070166

  20. Recipient-born bloodstream infection due to extensively drug-resistant Acinetobacter baumannii after emergency heart transplant: report of a case and review of the literature.

    PubMed

    Andini, Roberto; Agrusta, Federica; Mattucci, Irene; Malgeri, Umberto; Cavezza, Giusi; Utili, Riccardo; Durante-Mangoni, Emanuele

    2015-10-01

    Infections due to drug-resistant Gram-negative rods are an emerging risk factor for increased mortality after solid organ transplant. Extensively drug-resistant (XDR) Acinetobacter baumannii (Acb) is a major threat in several critical care settings. The limited available data on the outcome of XDR Acb infections in organ transplant recipients mostly comes from cases of donor-derived infections. However, recipients of life-saving organs are often critically ill patients, staying long term in intensive care units, and therefore at high risk for nosocomial infections. In this report, we describe our experience with the exceedingly complex management of a recipient-born XDR Acb bloodstream infection clinically ensued shortly after heart transplant. We also review the current literature on this mounting issue relevant for intensive care, transplant medicine and infectious diseases. PMID:25828937

  1. Enhanced Efficacy of Combinations of Pexiganan with Colistin Versus Acinetobacter Baumannii in Experimental Sepsis.

    PubMed

    Cirioni, Oscar; Simonetti, Oriana; Pierpaoli, Elisa; Barucca, Alessandra; Ghiselli, Roberto; Orlando, Fiorenza; Pelloni, Maria; Minardi, Daniele; Trombettoni, Maria Michela Cappelletti; Guerrieri, Mario; Offidani, Annamaria; Giacometti, Andrea; Provinciali, Mauro

    2016-08-01

    We investigated the efficacy of colistin combined with pexiganan in experimental mouse models of Acinetobacter baumannii infection.Adult male BALB/c mice received intraperitoneally 1 mL saline containing 2 × 10 CFU of susceptible and multiresistant A. baumannii. Two hours after bacterial challenge, animals received 1 mg/kg of colistin, 1 mg/kg of pexiganan, or 1 mg/kg of colistin plus 1 mg/kg of pexiganan.Blood culture positivity, the quantities of bacteria in the intra-abdominal fluid, the rate of lethality and immunological studies, such as immunophenotyping and NK cytotoxicity, were evaluated.In the in vitro study, A. baumannii showed susceptibility to colistin and pexiganan and a strong synergy was observed by testing colistin combined with pexiganan with fractionary inhibitory concentration index of 0.312 for both strains.In the in vivo study colistin or pexiganan alone showed a good antimicrobial efficacy. When colistin was combined with pexiganan, the positive interaction produced low bacterial counts that were statistically significant versus singly treated groups. For both strains the highest rate of survival was observed in combined-treated groups (90%).Pexiganan increased NK cytotoxic activity over the levels of infected and colistin-treated animals.In conclusion, pexiganan combined with colistin was found to be efficacious against A. baumannii infection. PMID:26849630

  2. The First Outbreak Caused by Acinetobacter baumannii ST208 and ST195 in China

    PubMed Central

    Qu, Junyan; Du, Yu

    2016-01-01

    This study aimed to analyze the clinical characteristics of patients and molecular mechanisms of the first outbreak mainly caused by sequence types (STs) 208 multidrug resistant (MDR) Acinetobacter baumannii in China. A total of 10 clinical samples were collected from 5 patients who were involved in the outbreak. Bacterial identification and antibiotic sensitivity tests were performed by the VITEK-2 COMPACT automated system. MICs of tigecycline for clinical isolates were determined using broth microdilution. The clonal relatedness of A. baumannii clinical isolates in our local settings was determinated by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). A total of 7 A. baumannii strains were isolated and all were MDR strains; two of them were carbapenem-nonsusceptible strains. blaOXA-23 was the only acquired carbapenemase gene in the isolates. The isolates belonged to a single clonal pulsotype determined by PFGE and two sequences types (STs) determined by MLST. The isolates belonged to the globally disseminated clonal complex 92, among which ST195 and ST208 were the most common sequence types (71.43% and 28.57%). The outbreak was successfully controlled by stringent infection control measures, especially improving the hand hygiene compliance and enhancing antimicrobial stewardship. In conclusion, this is the first description of an outbreak caused mainly by A. baumannii of ST208 in China. Infection control measures should be strengthened when infection outbreaks in hospital. PMID:27144176

  3. Colistin Resistance in Acinetobacter baumannii Is Mediated by Complete Loss of Lipopolysaccharide Production ▿

    PubMed Central

    Moffatt, Jennifer H.; Harper, Marina; Harrison, Paul; Hale, John D. F.; Vinogradov, Evgeny; Seemann, Torsten; Henry, Rebekah; Crane, Bethany; St. Michael, Frank; Cox, Andrew D.; Adler, Ben; Nation, Roger L.; Li, Jian; Boyce, John D.

    2010-01-01

    Infections caused by multidrug-resistant (MDR) Gram-negative bacteria represent a major global health problem. Polymyxin antibiotics such as colistin have resurfaced as effective last-resort antimicrobials for use against MDR Gram-negative pathogens, including Acinetobacter baumannii. Here we show that A. baumannii can rapidly develop resistance to polymyxin antibiotics by complete loss of the initial binding target, the lipid A component of lipopolysaccharide (LPS), which has long been considered to be essential for the viability of Gram-negative bacteria. We characterized 13 independent colistin-resistant derivatives of A. baumannii type strain ATCC 19606 and showed that all contained mutations within one of the first three genes of the lipid A biosynthesis pathway: lpxA, lpxC, and lpxD. All of these mutations resulted in the complete loss of LPS production. Furthermore, we showed that loss of LPS occurs in a colistin-resistant clinical isolate of A. baumannii. This is the first report of a spontaneously occurring, lipopolysaccharide-deficient, Gram-negative bacterium. PMID:20855724

  4. DNA microarray for genotyping antibiotic resistance determinants in Acinetobacter baumannii clinical isolates.

    PubMed

    Dally, Simon; Lemuth, Karin; Kaase, Martin; Rupp, Steffen; Knabbe, Cornelius; Weile, Jan

    2013-10-01

    In recent decades, Acinetobacter baumannii has emerged as an organism of great concern due to its ability to accumulate antibiotic resistance. In order to improve the diagnosis of resistance determinants in A. baumannii in terms of lead time and accuracy, we developed a microarray that can be used to detect 91 target sequences associated with antibiotic resistance within 4 h from bacterial culture to result. The array was validated with 60 multidrug-resistant strains of A. baumannii in a blinded, prospective study. The results were compared to phenotype results determined by the automated susceptibility testing system VITEK2. Antibiotics considered were piperacillin-tazobactam, ceftazidime, imipenem, meropenem, trimethoprim-sulfamethoxazole, amikacin, gentamicin, tobramycin, ciprofloxacin, and tigecycline. The average positive predictive value, negative predictive value, sensitivity, and specificity were 98, 98, 99, and 94%, respectively. For carbapenemase genes, the array results were compared to singleplex PCR results provided by the German National Reference Center for Gram-Negative Pathogens, and results were in complete concordance. The presented array is able to detect all relevant resistance determinants of A. baumannii in parallel. The short handling time of 4 h from culture to result helps to provide fast results in order to initiate adequate anti-infective therapy for critically ill patients. Another application would be data acquisition for epidemiologic surveillance. PMID:23856783

  5. Treatment Options for Carbapenem-Resistant and Extensively Drug-Resistant Acinetobacter baumannii Infections

    PubMed Central

    Viehman, J. Alexander; Nguyen, Minh-Hong; Doi, Yohei

    2014-01-01

    Acinetobacter baumannii is a leading cause of healthcare-associated infections worldwide. Due to various intrinsic and acquired mechanisms of resistance, most β-lactam agents are not effective against many strains, and carbapenems have played an important role in therapy. Recent trends show many infections are caused by carbapenem-resistant, or even extensively drug-resistant (XDR) strains, for which effective therapy is not well established. Evidence to date suggests that colistin constitutes the backbone of therapy, but the unique pharmacokinetic properties of colistin have led many to suggest the use of combination antimicrobial therapy. However, the combination of agents and dosing regimens that delivers the best clinical efficacy while minimizing toxicity is yet to be defined. Carbapenems, sulbactam, rifampin and tigecycline have been the most studied in the context of combination therapy. Most data regarding therapy for invasive, resistant A. baumannii infections come from uncontrolled case series and retrospective analyses, though some clinical trials have been completed and others are underway. Early institution of appropriate antimicrobial therapy is shown to consistently improve survival of patients with carbapenem-resistant and XDR A. baumannii infection, but the choice of empiric therapy in these infections remains an open question. This review summarizes the most current knowledge regarding the epidemiology, mechanisms of resistance, and treatment considerations of carbapenem-resistant and XDR A. baumannii. PMID:25091170

  6. Anthelmintic closantel enhances bacterial killing of polymyxin B against multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Tran, Thien B.; Cheah, Soon-Ee; Yu, Heidi H.; Bergen, Phillip J.; Nation, Roger L.; Creek, Darren J.; Purcell, Anthony; Forrest, Alan; Doi, Yohei; Song, Jiangning; Velkov, Tony; Li, Jian

    2015-01-01

    Polymyxins, an old class of antibiotics, are currently used as the last resort for the treatment of multidrug-resistant (MDR) Acinetobacter baumannii. However, recent pharmacokinetic and pharmacodynamic data indicate that monotherapy can lead to the development of resistance. Novel approaches are urgently needed to preserve and improve the efficacy of this last-line class of antibiotics. This study examined the antimicrobial activity of novel combination of polymyxin B with anthelmintic closantel against A. baumannii. Closantel monotherapy (16 mg/L) was ineffective against most tested A. baumannii isolates. However, closantel at 4–16 mg/L with a clinically achievable concentration of polymyxin B (2 mg/L) successfully inhibited the development of polymyxin resistance in polymyxin-susceptible isolates, and provided synergistic killing against polymyxin-resistant isolates (MIC ≥4 mg/L). Our findings suggest that the combination of polymyxin B with closantel could be potentially useful for the treatment of MDR, including polymyxin-resistant, A. baumannii infections. The re-positioning of non-antibiotic drugs to treat bacterial infections may significantly expedite discovery of new treatment options for bacterial ‘superbugs’. PMID:26669752

  7. Differential protection from tobramycin by extracellular polymeric substances from Acinetobacter baumannii and Staphylococcus aureus biofilms.

    PubMed

    Davenport, Emily K; Call, Douglas R; Beyenal, Haluk

    2014-08-01

    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a "universal protector" by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg(2+) or Ca(2+) reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  8. Differential Protection from Tobramycin by Extracellular Polymeric Substances from Acinetobacter baumannii and Staphylococcus aureus Biofilms

    PubMed Central

    Davenport, Emily K.; Call, Douglas R.

    2014-01-01

    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a “universal protector” by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg2+ or Ca2+ reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  9. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii.

    PubMed

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu

    2015-01-01

    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  10. Acinetobacter baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis.

    PubMed

    Bhuiyan, Md Saruar; Ellett, Felix; Murray, Gerald L; Kostoulias, Xenia; Cerqueira, Gustavo M; Schulze, Keith E; Mahamad Maifiah, Mohd Hafidz; Li, Jian; Creek, Darren J; Lieschke, Graham J; Peleg, Anton Y

    2016-08-23

    Innate cellular immune responses are a critical first-line defense against invading bacterial pathogens. Leukocyte migration from the bloodstream to a site of infection is mediated by chemotactic factors that are often host-derived. More recently, there has been a greater appreciation of the importance of bacterial factors driving neutrophil movement during infection. Here, we describe the development of a zebrafish infection model to study Acinetobacter baumannii pathogenesis. By using isogenic A. baumannii mutants lacking expression of virulence effector proteins, we demonstrated that bacterial drivers of disease severity are conserved between zebrafish and mammals. By using transgenic zebrafish with fluorescent phagocytes, we showed that a mutation of an established A. baumannii global virulence regulator led to marked changes in neutrophil behavior involving rapid neutrophil influx to a localized site of infection, followed by prolonged neutrophil dwelling. This neutrophilic response augmented bacterial clearance and was secondary to an impaired A. baumannii phenylacetic acid catabolism pathway, which led to accumulation of phenylacetate. Purified phenylacetate was confirmed to be a neutrophil chemoattractant. These data identify a previously unknown mechanism of bacterial-guided neutrophil chemotaxis in vivo, providing insight into the role of bacterial metabolism in host innate immune evasion. Furthermore, the work provides a potentially new therapeutic paradigm of targeting a bacterial metabolic pathway to augment host innate immune responses and attenuate disease. PMID:27506797

  11. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii

    PubMed Central

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu

    2015-01-01

    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  12. Functional Exposed Amino Acids of BauA as Potential Immunogen Against Acinetobacter baumannii.

    PubMed

    Sefid, Fatemeh; Rasooli, Iraj; Jahangiri, Abolfazl; Bazmara, Hadise

    2015-06-01

    Multidrug-resistant Acinetobacter baumannii is recognized to be among the most difficult antimicrobial-resistant gram negative bacilli to control and treat. One of the major challenges that the pathogenic bacteria face in their host is the scarcity of freely available iron. To survive under such conditions, bacteria express new proteins on their outer membrane and also secrete iron chelators called siderophores. Antibodies directed against these proteins associated with iron uptake exert a bacteriostatic or bactericidal effect against A. baumanii in vitro, by blocking siderophore mediated iron uptake pathways. Attempts should be made to discover peptides that could mimic protein epitopes and possess the same immunogenicity as the whole protein. Subsequently, theoretical methods for epitope prediction have been developed leading to synthesis of such peptides that are important for development of immunodiagnostic tests and vaccines. The present study was designed to in silico resolving the major obstacles in the control or in prevention of the diseases caused by A. baumannii. We exploited bioinformatic tools to better understand and characterize the Baumannii acinetobactin utilization structure of A. baumannii and select appropriate regions as effective B cell epitopes. In conclusion, amino acids 26-191 of cork domain and 321-635 of part of the barrel domain including L4-L9, were selected as vaccine candidates. These two regions contain functional exposed amino acids with higher score of B cell epitopes properties. Majority of amino acids are hydrophilic, flexible, accessible, and favorable for B cells from secondary structure point of view. PMID:25840681

  13. Characterizing In Vivo Pharmacodynamics of Carbapenems against Acinetobacter baumannii in a Murine Thigh Infection Model To Support Breakpoint Determinations

    PubMed Central

    MacVane, Shawn H.; Crandon, Jared L.

    2014-01-01

    Pharmacodynamic profiling data of carbapenems for Acinetobacter spp. are sparse. This study aimed to determine the pharmacodynamic targets of carbapenems for Acinetobacter baumannii based on a range of percentages of the dosing interval in which free drug concentrations remained above the MIC (fT>MIC) in the neutropenic murine thigh infection model. fT>MIC values of 23.7%, 32.8%, and 47.5% resulted in stasis, 1-log reductions, and 2-log reductions in bacterial density after 24 h, respectively. The pharmacodynamic targets of carbapenems for A. baumannii demonstrated in vivo are similar to those of other Gram-negative bacteria. PMID:24165174

  14. Donor platelet plasma components inactivate sensitive and multidrug resistant Acinetobacter baumannii isolates.

    PubMed

    Edelblute, Chelsea M; Pakhomova, Olga N; Li, Fanying; Hargrave, Barbara Y; Heller, Loree C

    2015-12-01

    Acinetobacter baumannii is an environmentally resilient healthcare-associated opportunistic pathogen responsible for infections at many body sites. In the last 10 years, clinical strains resistant to many or all commonly used antibiotics have emerged globally. With few antimicrobial agents in the pharmaceutical pipeline, new and alternative agents are essential. Platelets secrete a large number of proteins, including proteins with antimicrobial activity. In a previous study, we demonstrated that donor platelet supernatants and plasma significantly inhibited the growth of a reference strain of A. baumannii in broth and on skin. This inhibition appeared to be unrelated to the platelet activation state. In this study, we demonstrate that this growth inhibition extends to clinical multidrug resistant isolates. We also demonstrate that there is no relationship between this activity and selected platelet-derived antimicrobial proteins. Instead, the donor plasma components complement and alpha-2 macroglobulin are implicated. PMID:26500225

  15. Brain abscess caused by multidrug-resistant Acinetobacter baumannii. Case report.

    PubMed

    Guinand Vives, Carlos H; Monsalve Duarte, Guillermo A; Beltrán, Sandra Valderrama; Pinzón, Johanna Osorio

    2009-08-01

    This 24-year-old soldier had a history of polytrauma caused by firearm missiles of a fragmentation weapon. He was referred to the Hospital Militar Central, where multiple shrapnel wounds in the head, face, thorax, and extremities were found. A brain abscess was documented and drained, and a culture grew a multidrug-resistant Acinetobacter baumannii. An appropriate antibiotic treatment was started but did not lead to a good response, and the patient died. The clinical course of the illness is presented, as is its treatment and the role of A baumannii as an etiological agent of a brain abscess. To the authors' knowledge, there have been no reported cases in the worldwide literature of brain abscess by this infectious agent. PMID:19061347

  16. Preferential carriage of class 2 integrons in Acinetobacter baumannii CC113 and novel singletons.

    PubMed

    Ramírez, M S; Montaña, S; Cassini, M; Centrón, D

    2015-10-01

    Our understanding of the distribution of integrons associated with multidrug resistance in Acinetobacter baumannii isolates around the world remains incomplete. The association between the class 1 and 2 integron A. baumannii-positive isolates (n = 60), recovered since 1982 from 11 Argentinean hospitals, and the circulating lineages, was investigated. While class 2 integrons were highly significantly associated with clonal lineage CC113B/CC79P (P = 0·009) and novel singletons (P = 0·001), class 1 integrons were found not to be associated with CC109B/CC1P or other lineages. The study reveals a differential distribution of class 2 integrons in lineages, and suggests that the prevalence of intI2 in Argentina is related to the emergence of novel singletons in recent years and to the abundance of CC113B/CC79P, which has been the local dominant lineage for several decades. PMID:25697643

  17. Correlation of Ciprofloxacin Resistance with the AdeABC Efflux System in Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Ardebili, Abdollah; Talebi, Malihe

    2014-01-01

    Background Acinetobacter baumannii is one of the most important pathogens capable of colonization in burn patients, leading to drug-resistant wound infections. This study evaluated the distribution of the AdeABC efflux system genes and their relationship to ciprofloxacin resistance in A. baumannii isolates collected from burn patients. Methods A total of 68 A. baumannii clinical strains were isolated from patients hospitalized in Motahari Burns Center in Tehran, Iran. Ciprofloxacin susceptibility was tested by the disk diffusion and agar dilution methods. PCR amplification of the adeRS-adeB drug efflux genes was performed for all resistant and susceptible isolates. To assess the role of the drug efflux pump in ciprofloxacin susceptibility, carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as an efflux pump inhibitor (EPI). Results Approximately 95.6% of the Acinetobacter isolates were resistant to ciprofloxacin, with minimum inhibitory concentration (MIC) values ranging from 4 to ≥128 µg/mL. The susceptibility of 86.1% of the resistant isolates increased by factors of 2 to 64 in the presence of CCCP. All resistant isolates were positive for the adeRS-adeB genes, and 73.2% of them had mutations in the AdeRS regulatory system. Conclusions The results showed that AdeABC genes are common in A. baumannii, which might be associated with ciprofloxacin non-susceptibility, as indicated by the observed linkage to the presence of the genes essential for the activity of the AdeABC, several single mutations occurring in the adeRS regulatory system, and an increase of ciprofloxacin susceptibility in the presence of a CCCP EPI. PMID:25368818

  18. Clonal spread of blaOXA-72-carrying Acinetobacter baumannii sequence type 512 in Taiwan.

    PubMed

    Kuo, Han-Yueh; Hsu, Po-Jui; Chen, Jiann-Yuan; Liao, Po-Cheng; Lu, Chia-Wei; Chen, Chang-Hua; Liou, Ming-Li

    2016-07-01

    This is the first report to show an insidious outbreak of armA- and blaOXA-72-carrying Acinetobacter baumannii sequence type 512 (ST512) at a study hospital in northern Taiwan. Multilocus sequence typing revealed that this was a ST512 clone. All of the isolates with ST512 carried a novel 12,056-bp repGR2 in combination with a repGR12-type plasmid. This plasmid, designated pAB-ML, had one copy of the blaOXA-72 gene that was flanked by XerC/XerD-like sites and conferred resistance to carbapenems. PMID:27242318

  19. Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation

    PubMed Central

    Dafopoulou, Konstantina; Xavier, Basil Britto; Hotterbeekx, An; Janssens, Lore; Lammens, Christine; Dé, Emmanuelle; Goossens, Herman; Tsakris, Athanasios; Malhotra-Kumar, Surbhi

    2015-01-01

    In two pairs of clinical colistin-susceptible/colistin-resistant (Csts/Cstr) Acinetobacter baumannii strains, the Cstr strains showed significantly decreased biofilm formation in static and dynamic assays (P < 0.001) and lower relative fitness (P < 0.05) compared with those of the Csts counterparts. The whole-genome sequencing comparison of strain pairs identified a mutation converting a stop codon to lysine (*241K) in LpsB (involved in lipopolysaccharide [LPS] synthesis) in one Cstr strain and a frameshift mutation in CarO and the loss of a 47,969-bp element containing multiple genes associated with biofilm production in the other. PMID:26666921

  20. Emergence of Acinetobacter baumannii international clone II in Brazil: reflection of a global expansion

    PubMed Central

    Martins, Natacha; Dalla-Costa, Libera; Uehara, Aline Almeida; Riley, Lee Woodland; Moreira, Beatriz Meurer

    2013-01-01

    The aim of this study was to investigate the occurrence of carbapenem-resistant Acinetobacter baumannii international clones (IC) in Curitiba, Brazil, using multilocus sequence typing and trilocus PCR-based typing schemes. IC2 was the first emerging clone. This IC was detected in an isolate from 2003 of a PFGE type spread in at least two hospitals since 1999. Subsequently, IC2 waned while IC1 and clonal complex 15/104 prevailed. This is the first description of IC2 in Brazil and Latin America. PMID:24121023

  1. Validation of use of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak.

    PubMed Central

    Snelling, A M; Gerner-Smidt, P; Hawkey, P M; Heritage, J; Parnell, P; Porter, C; Bodenham, A R; Inglis, T

    1996-01-01

    Acinetobacter spp. are being reported with increasing frequency as causes of nosocomial infection. In order to identify reservoirs of infection as quickly as possible, a rapid typing method that can differentiate epidemic strains from environmental and nonepidemic strains is needed. In 1993, a cluster of Acinetobacter baumannii isolates from five patients in the adult intensive therapy unit of our tertiary-care teaching hospital led us to develop and optimize a rapid repetitive extragenic palindromic sequence-based PCR (REP-PCR) typing protocol for members of the Acinetobacter calcoaceticus-A. baumannii complex that uses boiled colonies and consensus primers aimed at repetitive extragenic palindromic sequences. Four of the five patient isolates gave the same REP-PCR typing pattern as isolates of A. baumannii obtained from the temperature probe of a Bennett humidifier; the fifth isolate had a unique profile. Disinfection of the probe with 70% ethanol, as recommended by the manufacturer, proved ineffective, as A. baumannii with the same REP-PCR pattern was isolated from it 10 days after cleaning, necessitating a change in our decontamination procedure. Results obtained with REP-PCR were subsequently confirmed by ribotyping. To evaluate the discriminatory power (D) of REP-PCR for typing members of the A. calcoaceticus-A. baumannii complex, compared with that of ribotyping, we have applied both methods to a collection of 85 strains that included representatives of six DNA groups within the complex. Ribotyping using EcoRI digests yielded 53 patterns (D = 0.98), whereas 68 different REP-PCR patterns were observed (D = 0.99). By computer-assisted analysis of gel images, 74 patterns were observed with REP-PCR (D = 1.0). Overall, REP-PCR typing proved to be slightly more discriminatory than ribotyping. Our results indicate that REP-PCR typing used boiled colonies is a simple, rapid, and effective means of typing members of the A. calcoaceticus-A. baumannii complex. PMID

  2. Comparative Genomics of Two ST 195 Carbapenem-Resistant Acinetobacter baumannii with Different Susceptibility to Polymyxin Revealed Underlying Resistance Mechanism

    PubMed Central

    Lean, Soo-Sum; Yeo, Chew Chieng; Suhaili, Zarizal; Thong, Kwai-Lin

    2016-01-01

    Acinetobacter baumannii is a Gram-negative nosocomial pathogen of importance due to its uncanny ability to acquire resistance to most antimicrobials. These include carbapenems, which are the drugs of choice for treating A. baumannii infections, and polymyxins, the drugs of last resort. Whole genome sequencing was performed on two clinical carbapenem-resistant A. baumannii AC29 and AC30 strains which had an indistinguishable ApaI pulsotype but different susceptibilities to polymyxin. Both genomes consisted of an approximately 3.8 Mbp circular chromosome each and several plasmids. AC29 (susceptible to polymyxin) and AC30 (resistant to polymyxin) belonged to the ST195 lineage and are phylogenetically clustered under the International Clone II (IC-II) group. An AbaR4-type resistance island (RI) interrupted the comM gene in the chromosomes of both strains and contained the blaOXA−23 carbapenemase gene and determinants for tetracycline and streptomycin resistance. AC29 harbored another copy of blaOXA−23 in a large (~74 kb) conjugative plasmid, pAC29b, but this gene was absent in a similar plasmid (pAC30c) found in AC30. A 7 kb Tn1548::armA RI which encodes determinants for aminoglycoside and macrolide resistance, is chromosomally-located in AC29 but found in a 16 kb plasmid in AC30, pAC30b. Analysis of known determinants for polymyxin resistance in AC30 showed mutations in the pmrA gene encoding the response regulator of the two-component pmrAB signal transduction system as well as in the lpxD, lpxC, and lpsB genes that encode enzymes involved in the biosynthesis of lipopolysaccharide (LPS). Experimental evidence indicated that impairment of LPS along with overexpression of pmrAB may have contributed to the development of polymyxin resistance in AC30. Cloning of a novel variant of the blaAmpC gene from AC29 and AC30, and its subsequent expression in E. coli also indicated its likely function as an extended-spectrum cephalosporinase. PMID:26779129

  3. In Vitro activities of combinations of rifampin with other antimicrobials against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Bai, Yan; Liu, Bin; Wang, Tianlin; Cai, Yun; Liang, Beibei; Wang, Rui; Liu, Youning; Wang, Jin

    2015-03-01

    The antimicrobial treatment of multidrug-resistant (MDR) Acinetobacter baumannii infections has become a great challenge for medical staff all over the world. Increasing numbers of MDR A. baumannii infections have been identified and reported, but effective clinical treatments for them are decreasing. The objective of this study was to investigate the in vitro activities of combinations of rifampin (an established antimicrobial) and other antimicrobials, including biapenem, colistin, and tigecycline, against 73 clinical isolates of MDR A. baumannii. In total, 73 clinical isolates of MDR A. baumannii were collected from two A-level general hospitals in Beijing, and the MICs of rifampin, biapenem, colistin, and tigecycline were determined. The checkerboard method was used to determine the fractional inhibitory concentration indices (FICIs), that is, whether the combinations acted synergistically against these isolates. The MIC50, MIC90, and MICrange of rifampin combined with biapenem, colistin, and tigecycline against the isolates were clearly lower than those for four antimicrobials (rifampin, biapenem, colistin, and tigecycline) that were used alone. Combinations of rifampin with biapenem, colistin, and tigecycline individually demonstrated the following interactions: synergistic interactions (FICI ≤ 0.5) for 31.51%, 34.25%, and 31.51% of the isolates, partially synergistic interactions (0.5 < FICI < 1) for 49.31%, 43.83%, and 47.94% of the isolates, and additive interactions (FICI = 1) for 19.18%, 21.92%, and 20.55% of the isolates, respectively. There were no indifferent (1 < FICI < 4) or antagonistic (FICI ≥ 4) interactions. Therefore, combinations of rifampin with biapenem, colistin, or tigecycline may be future therapeutic alternatives for the treatment of MDR A. baumannii infections. PMID:25534730

  4. In Vitro Activities of Combinations of Rifampin with Other Antimicrobials against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Bai, Yan; Liu, Bin; Wang, Tianlin; Cai, Yun; Liang, Beibei; Liu, Youning; Wang, Jin

    2014-01-01

    The antimicrobial treatment of multidrug-resistant (MDR) Acinetobacter baumannii infections has become a great challenge for medical staff all over the world. Increasing numbers of MDR A. baumannii infections have been identified and reported, but effective clinical treatments for them are decreasing. The objective of this study was to investigate the in vitro activities of combinations of rifampin (an established antimicrobial) and other antimicrobials, including biapenem, colistin, and tigecycline, against 73 clinical isolates of MDR A. baumannii. In total, 73 clinical isolates of MDR A. baumannii were collected from two A-level general hospitals in Beijing, and the MICs of rifampin, biapenem, colistin, and tigecycline were determined. The checkerboard method was used to determine the fractional inhibitory concentration indices (FICIs), that is, whether the combinations acted synergistically against these isolates. The MIC50, MIC90, and MICrange of rifampin combined with biapenem, colistin, and tigecycline against the isolates were clearly lower than those for four antimicrobials (rifampin, biapenem, colistin, and tigecycline) that were used alone. Combinations of rifampin with biapenem, colistin, and tigecycline individually demonstrated the following interactions: synergistic interactions (FICI ≤ 0.5) for 31.51%, 34.25%, and 31.51% of the isolates, partially synergistic interactions (0.5 < FICI < 1) for 49.31%, 43.83%, and 47.94% of the isolates, and additive interactions (FICI = 1) for 19.18%, 21.92%, and 20.55% of the isolates, respectively. There were no indifferent (1 < FICI < 4) or antagonistic (FICI ≥ 4) interactions. Therefore, combinations of rifampin with biapenem, colistin, or tigecycline may be future therapeutic alternatives for the treatment of MDR A. baumannii infections. PMID:25534730

  5. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar

    PubMed Central

    Rolain, J.-M.; Loucif, L.; Al-Maslamani, M.; Elmagboul, E.; Al-Ansari, N.; Taj-Aldeen, S.; Shaukat, A.; Ahmedullah, H.; Hamed, M.

    2016-01-01

    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (blaOXA-23, blaOXA-24, blaOXA-58, blaNDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and blaOXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for blaOXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar. PMID:27054039

  6. Antibiotic Resistance of Acinetobacter baumannii in Iran: A Systemic Review of the Published Literature

    PubMed Central

    Moradi, Jale; Hashemi, Farhad B.; Bahador, Abbas

    2015-01-01

    Objectives Acinetobacter baumannii is a bacterium responsible for health care-associated infections, and it frequently develops multiple drug resistance (MDR). The prevalence of antibiotic-resistant A. baumannii in Iran has increased, and this may cause significant clinical problems. Therefore, in order to elucidate the development of antibiotic resistance, we performed a systematic review of the literature published on antibiotic-resistant A. baumannii reported in Iran. Methods Thirty-six publications that met the criteria for inclusion were reviewed from an initial 87 papers. Selected papers published between 2008 and September 2014, were categorized on the basis of the sample collecting year been between 2001 and 2013. Results Analysis of data revealed that, in general, there was an increase in antimicrobial resistance. During the initial time point of these studies (2001–2007) there was a high rate of resistance to all antibiotics, with the exception of carbapenems, lipopeptides, and aminoglycosides that had a low resistance rate in comparison with the others. Also, the resistance rate was increased in one group of these three antimicrobial groups from 2010 to 2013. In particular, there was an increase in resistance to carbapenems (imipenem and meropenem) from 2010–2011 and 2012–2013, whereas no significant change in the resistance rate of the other two antimicrobial groups (lipopeptides and aminoglycosides) during the study time was observed, although we did observe certain trends in amikacin (aminoglycoside group antibiotic) between 2011–2012 and 2012–2013. Conclusion These findings indicate that antimicrobial resistance of A. baumannii in Iran has increased, which may very well affect the antimicrobial resistance of this organism worldwide. Based on these results, novel prevention and treatment strategies against A. baumannii infections are warranted. Furthermore, these data may assist in revising treatment guidelines and regional policies in care

  7. Photodynamic Inactivation of Acinetobacter baumannii Using Phenothiazinium Dyes: In Vitro and In Vivo Studies

    PubMed Central

    Ragàs, Xavier; Dai, Tianhong; Tegos, George P.; Agut, Montserrat; Nonell, Santi; Hamblin, Michael R.

    2010-01-01

    Background and Objective Phenothiazinium dyes have been reported to be effective photosensitizers inactivating a wide range of microorganisms in vitro after illumination with red light. However, their application in vivo has not extensively been explored. This study evaluates the bactericidal activity of phenothiazinium dyes against multidrug-resistant Acinetobacter baumannii both in vitro and in vivo. Study Design/Materials and Methods We report the investigation of toluidine blue O, methylene blue, 1,9-dimethylmethylene blue, and new methylene blue for photodynamic inactivation of multidrug-resistant A. baumannii in vitro. The most effective dye was selected to carry out in vivo studies using third-degree mouse burns infected with a bioluminescent A. baumannii strain, upon irradiation with a 652 nm noncoherent light source. The mice were imaged daily for 2 weeks to observe differences in the bioluminescence–time curve between the photodynamic therapy (PDT)-treated mice in comparison with untreated burns. Results All the dyes were effective in vitro against A. baumannii after 30 J/cm2 irradiation of 635 or 652 nm red light had been delivered, with more effective killing when the dye remained in solution. New methylene blue was the most effective of the four dyes, achieving a 3.2-log reduction of the bacterial luminescence during PDT in vivo after 360 J/cm2 and an 800 μM dye dose. Moreover, a statistically significant reduction of the area under the bioluminescence–time curve of PDT-treated mice was observed showing that the infection did not recur after PDT. Conclusions Phenothiazinium dyes, and especially new methylene blue, are potential photosensitizers for PDT to treat burns infected with multidrug-resistant A. baumannii in vivo. PMID:20583252

  8. Distribution and expression of the Ade multidrug efflux systems in Acinetobacter baumannii clinical isolates.

    PubMed

    Pagdepanichkit, Sirawit; Tribuddharat, Chanwit; Chuanchuen, Rungtip

    2016-09-01

    One hundred Acinetobacter baumannii clinical isolates were examined for inhibitory effect of reserpine and carbonyl cyanide m-chlorophenylhydrazone (CCCP) on the antimicrobial susceptibility and expression of 4 resistant-nodulation-cell division (RND)-type multidrug efflux systems, including AdeABC, AdeDE, AdeIJK, and AdeFGH, using RT-PCR. Ten A. baumannii isolates expressing AdeABC, AdeIJK, or AdeFGH were randomly selected for determination of transcription level and regulatory mutations. While all the isolates were resistant to multiple drugs, the reserpine and CCCP experiment showed that the multidrug resistance phenotype in most A. baumannii isolates was associated with efflux pumps. Most isolates expressed at least one of the RND-type efflux pumps tested (97%). AdeIJK expression was most common (97%), but none of the isolates produced AdeDE. Fifty-two percent of the A. baumannii isolates simultaneously produced up to 3 RND-type efflux systems (i.e., AdeABC, AdeFGH, and AdeIJK). No good correlation between the expression of RND-type efflux pumps and the type of antimicrobial resistance was observed. Overexpression of AdeABC, AdeIJK, and AdeFGH was not always related to the presence of mutations in their corresponding regulatory genes. This study highlights (i) the universal presence of the RND-type efflux pumps with variable levels of expression level among the A. baumannii in this collection and (ii) the complexity of their regulation of expression. PMID:27332787

  9. Modeling the impact of interventions against Acinetobacter baumannii transmission in intensive care units

    PubMed Central

    Doan, Tan N; Kong, David CM; Marshall, Caroline; Kirkpatrick, Carl MJ; McBryde, Emma S

    2016-01-01

    The efficacy of infection control interventions against Acinetobacter baumannii remains unclear, despite such information being critical for effective prevention of the transmission of this pathogen. Mathematical modeling offers an alternative to clinical trials, which may be prohibitively expensive, unfeasible or unethical, in predicting the impact of interventions. Furthermore, it allows the ability to ask key “what if” questions to evaluate which interventions have the most impact. We constructed a transmission dynamic model to quantify the effects of interventions on reducing A. baumannii prevalence and the basic reproduction ratio (R0) in intensive care units (ICUs). We distinguished between colonization and infection, and incorporated antibiotic exposure and transmission from free-living bacteria in the environment. Under the assumptions and parameterization in our model, 25% and 18% of patients are colonized and infected with A. baumannii, respectively; and R0 is 1.4. Improved compliance with hand hygiene (≥87%), enhanced environmental cleaning, reduced length of ICU stay of colonized patients (≤ 10 days), shorter durations of antibiotic treatment of A. baumannii (≤6 days), and isolation of infected patients combined with cleaning of isolation rooms are effective, reducing R0 to below unity. In contrast, expediting the recovery of the intestinal microbiota (e.g. use of probiotics) is not effective. This study represents a biologically realistic model of the transmission dynamics of A. baumannii, and the most comprehensive analysis of the effectiveness of interventions against this pathogen. Our study provides important data for designing effective infection control interventions. PMID:26252184

  10. The Prevalence of ISAba1 and ISAba4 in Acinetobacter baumannii Species of Different International Clone Lineages Among Patients With Burning in Tehran, Iran

    PubMed Central

    Bahador, Abbas; Raoofian, Reza; Farshadzadeh, Zahra; Beitollahi, Leyli; Khaledi, Azad; Rahimi, Sara; Mokhtaran, Masoumeh; Mehrabi Tavana, Ali; Esmaeili, Davood

    2015-01-01

    Background: Multidrug resistant strains of Acinetobacter baumannii (MDR-AB) have emerged as alarming nosocomial pathogens among patients with burning. Objectives: The current study aimed to determine the susceptibility of A. baumannii species, carbapenems resistance patterns, and their association with ISAba1 and ISAba4 elements upstream of the blaOXA-like genes, and the distribution of international clone (IC) of A. baumannii isolates among patients with burning in Tehran, Iran. Materials and Methods: In the current study, 62 A. baumannii species isolates from patients with burning in Tehran, Iran, in 2012 were evaluated for the antimicrobial susceptibility, genetic relationships, ICs, carbapenemase encoding genes, and insertion elements ISAba upstream of blaOXA-like genes. Results: The highest rates of susceptibility were observed with colistin (88.7%) and tigecycline (82.2%). The extensively drug-resistance and pan drug-resistance were observed in 37.1% and 8.1% of the isolates, respectively. About 98.3% of 17 genotypes categorized into three distinct clusters. Thirty-six of the 62 isolates (58%) belonged to the IC II lineage. The most prevalent acquired OXA-type carbapenemase was blaOXA-23-like (62.9%). ISAba1 and ISAba4 were detected upstream of blaOXA-23-like genes in 45.1% and 12.9% of isolates, respectively. In 32.2% of all isolates, ISAba1 laid upstream of blaOXA-51-like genes. The PCR results were negative for carbapenemase genes of Ambler class A and B, except blaVIM-2. (1.6%). Conclusions: It was the first study that attempted to detect the insertion elements ISAba and IC lineages in MDR-AB species isolated from patients with burning in Iran. PMID:26396712