Science.gov

Sample records for novo dna synthesis

  1. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  2. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  3. Inhibition of de novo NAD(+) synthesis by oncogenic URI causes liver tumorigenesis through DNA damage.

    PubMed

    Tummala, Krishna S; Gomes, Ana L; Yilmaz, Mahmut; Graña, Osvaldo; Bakiri, Latifa; Ruppen, Isabel; Ximénez-Embún, Pilar; Sheshappanavar, Vinayata; Rodriguez-Justo, Manuel; Pisano, David G; Wagner, Erwin F; Djouder, Nabil

    2014-12-01

    Molecular mechanisms responsible for hepatocellular carcinoma (HCC) remain largely unknown. Using genetically engineered mouse models, we show that hepatocyte-specific expression of unconventional prefoldin RPB5 interactor (URI) leads to a multistep process of HCC development, whereas its genetic reduction in hepatocytes protects against diethylnitrosamine (DEN)-induced HCC. URI inhibits aryl hydrocarbon (AhR)- and estrogen receptor (ER)-mediated transcription of enzymes implicated in L-tryptophan/kynurenine/nicotinamide adenine dinucleotide (NAD(+)) metabolism, thereby causing DNA damage at early stages of tumorigenesis. Restoring NAD(+) pools with nicotinamide riboside (NR) prevents DNA damage and tumor formation. Consistently, URI expression in human HCC is associated with poor survival and correlates negatively with L-tryptophan catabolism pathway. Our results suggest that boosting NAD(+) can be prophylactic or therapeutic in HCC. PMID:25453901

  4. De novo mammalian prion synthesis

    PubMed Central

    Benetti, Federico

    2009-01-01

    Prions are responsible for a heterogeneous group of fatal neurodegenerative diseases. They can be sporadic, genetic, or infectious disorders involving post-translational modifications of the cellular prion protein (PrPC). Prions (PrPSc) are characterized by their infectious property and intrinsic ability to convert the physiological PrPC into the pathological form, acting as a template. The “protein-only” hypothesis, postulated by Stanley B. Prusiner, implies the possibility to generate de novo prions in vivo and in vitro. Here we describe major milestones towards proving this hypothesis, taking into account physiological environment/s, biochemical properties and interactors of the PrPC. PMID:19887900

  5. De novo Synthesis of Monosaccharides

    NASA Astrophysics Data System (ADS)

    Vogel, Pierre; Robina, Inmaculada

    Recent approaches to asymmetric total synthesis of monosaccharides and derivatives are reviewed. They imply biochemical methods or chemical methods, or combinations of both. Aldoses, alditols, deoxysugars, aminodeoxymonosaccharides, and their analogues are considered, including aza- and thiosugars (with nitrogen and sulfur in the pyranose or furanose ring). Most common monosaccharides have three to six carbon-chains, but examples of long-chain and branched-chain carbohydrates will also be described. Organization of the review is based on the synthetic methodology rather than on the types of targeted sugar, starting with aldolase-catalyzed aldol reactions of achiral precursors, and the now popular amino-acid-catalyzed aldol and Mannich reactions. Chain elongations of small aldose derivatives with one, two, three, or four carbons remain very useful approaches as they allow one to reach a large structural and stereochemical diversity. Other methods apply Diels-Alder or hetero-Diels-Alder additions. Enantiomerically pure monosaccharides have been derived from achiral alkene, diene, and triene derivatives. Almost any targeted natural or non-natural sugar and derivative can be obtained in a few synthetic steps from inexpensive starting materials.

  6. De novo gene synthesis design using TmPrime software.

    PubMed

    Li, Mo-Huang; Bode, Marcus; Huang, Mo Chao; Cheong, Wai Chye; Lim, Li Shi

    2012-01-01

    This chapter presents TmPrime, a computer program to design oligonucleotide for both ligase chain reaction (LCR)- and polymerase chain reaction (PCR)-based de novo gene synthesis. The program divides a long input DNA sequence based on user-specified melting temperatures and assembly conditions, and dynamically optimizes the length of oligonucleotides to achieve homologous melting temperatures. The output reports the melting temperatures, oligonucleotide sequences, and potential formation of secondary structures in a PDF file, which will be sent to the user via e-mail. The program also provides functions on sequence pooling to separate long genes into smaller pieces for multipool assembly and codon optimization for expression based on the highest organism-specific codon frequency. This software has been successfully used in the design and synthesis of various genes with total length >20 kbp. This program is freely available at http://prime.ibn.a-star.edu.sg. PMID:22328437

  7. JBP2, a SWI2/SNF2-like protein, regulates de novo telomeric DNA glycosylation in bloodstream form Trypanosoma brucei.

    PubMed

    Kieft, Rudo; Brand, Verena; Ekanayake, Dilrukshi K; Sweeney, Kate; DiPaolo, Courtney; Reznikoff, William S; Sabatini, Robert

    2007-11-01

    Synthesis of the modified thymine base, beta-d-glucosyl-hydroxymethyluracil or J, within telomeric DNA of Trypanosoma brucei correlates with the bloodstream form specific epigenetic silencing of telomeric variant surface glycoprotein genes involved in antigenic variation. In order to analyze the function of base J in the regulation of antigenic variation, we are characterizing the regulatory mechanism of J biosynthesis. We have recently proposed a model in which chromatin remodeling by a SWI2/SNF2-like protein (JBP2) regulates the developmental and de novo site-specific localization of J synthesis within bloodstream form trypanosome DNA. Consistent with this model, we now show that JBP2 (-/-) bloodstream form trypanosomes contain five-fold less base J and are unable to stimulate de novo J synthesis in newly generated telomeric arrays. PMID:17706299

  8. De Novo Synthesis of Furanose Sugars: Catalytic Asymmetric Synthesis of Apiose and Apiose-Containing Oligosaccharides.

    PubMed

    Kim, Mijin; Kang, Soyeong; Rhee, Young Ho

    2016-08-01

    A de novo synthetic method towards apiose, a structurally unusual furanose, is reported. The key feature is sequential metal catalysis consisting of the palladium-catalyzed asymmetric intermolecular hydroalkoxylation of an alkoxyallene and subsequent ring-closing metathesis (RCM). This strategy enabled the efficient synthesis of various apiose-containing disaccharides and a unique convergent synthesis of trisaccharides. PMID:27381592

  9. De novo design of protein mimics of B-DNA.

    PubMed

    Yüksel, Deniz; Bianco, Piero R; Kumar, Krishna

    2016-01-01

    Structural mimicry of DNA is utilized in nature as a strategy to evade molecular defences mounted by host organisms. One such example is the protein Ocr - the first translation product to be expressed as the bacteriophage T7 infects E. coli. The structure of Ocr reveals an intricate and deliberate arrangement of negative charges that endows it with the ability to mimic ∼24 base pair stretches of B-DNA. This uncanny resemblance to DNA enables Ocr to compete in binding the type I restriction modification (R/M) system, and neutralizes the threat of hydrolytic cleavage of viral genomic material. Here, we report the de novo design and biophysical characterization of DNA mimicking peptides, and describe the inhibitory action of the designed helical bundles on a type I R/M enzyme, EcoR124I. This work validates the use of charge patterning as a design principle for creation of protein mimics of DNA, and serves as a starting point for development of therapeutic peptide inhibitors against human pathogens that employ molecular camouflage as part of their invasion stratagem. PMID:26568416

  10. Translesion DNA synthesis

    PubMed Central

    Vaisman, Alexandra; McDonald, John P.; Woodgate, Roger

    2014-01-01

    All living organisms are continually exposed to agents that damage their DNA, which threatens the integrity of their genome. As a consequence, cells are equipped with a plethora of DNA repair enzymes to remove the damaged DNA. Unfortunately, situations nevertheless arise where lesions persist, and these lesions block the progression of the cell’s replicase. Under these situations, cells are forced to choose between recombination-mediated “damage avoidance” pathways, or use a specialized DNA polymerase (pol) to traverse the blocking lesion. The latter process is referred to as Translesion DNA Synthesis (TLS). As inferred by its name, TLS not only results in bases being (mis)incorporated opposite DNA lesions, but also downstream of the replicase-blocking lesion, so as to ensure continued genome duplication and cell survival. Escherichia coli and Salmonella typhimurium possess five DNA polymerases, and while all have been shown to facilitate TLS under certain experimental conditions, it is clear that the LexA-regulated and damage-inducible pols II, IV and V perform the vast majority of TLS under physiological conditions. Pol V can traverse a wide range of DNA lesions and performs the bulk of mutagenic TLS, whereas pol II and pol IV appear to be more specialized TLS polymerases. PMID:26442823

  11. Putting Synthesis into Biology – A Viral View of Genetic Engineering Through de novo Gene and Genome synthesis

    PubMed Central

    Mueller, Steffen; Coleman, J. Robert; Wimmer, Eckard

    2009-01-01

    The rapid improvements in DNA synthesis technology hold the potential to revolutionize biosciences in the near future. Traditional genetic engineering methods are template dependent and make extensive but laborious use of site-directed mutagenesis to explore the impact of small variations on an existing sequence “theme”. De novo gene and genome synthesis frees the investigator from the restrictions of the pre-existing template and allows for the rational design of any conceivable new sequence theme. Viruses, being amongst the simplest replicating entities, have been at the forefront of the advancing biosciences since the dawn of molecular biology. Viral genomes, especially those of RNA viruses, are relatively short, often less than 10,000 bases long, making them amenable to whole genome synthesis with the currently available technology. For this reason viruses are once again poised to lead the way in the budding field of synthetic biology – for better or worse. PMID:19318214

  12. Ethanol enhances de novo synthesis of high density lipoprotein cholesterol

    SciTech Connect

    Cluette, J.E.; Mulligan, J.J.; Noring, R.; Doyle, K.; Hojnacki, J.

    1984-05-01

    Male squirrel monkeys fed ethanol at variable doses were used to assess whether alcohol enhances de novo synthesis of high density lipoprotein (HDL) cholesterol in vivo. Monkeys were divided into three groups: 1) controls fed isocaloric liquid diet; 2) low ethanol monkeys fed liquid diet with vodka substituted isocalorically for carbohydrate at 12% of calories; and 3) High Ethanol animals fed diet plus vodka at 24% of calories. High Ethanol primates had significantly higher levels of HDL nonesterified cholesterol than Control and Low Ethanol animals while serum glutamate oxaloacetate transaminase was similar for the three treatments. There were no significant differences between the groups in HDL cholesteryl ester mass or specific activity following intravenous injection of labeled mevalonolactone. By contrast, High Ethanol monkeys had significantly greater HDL nonesterified cholesterol specific activity with approximately 60% of the radioactivity distributed in the HDL/sub 3/ subfraction. This report provides the first experimental evidence that ethanol at 24% of calories induces elevations in HDL cholesterol in primates through enhanced de novo synthesis without adverse effects on liver function.

  13. Herpes simplex virus 1 induces de novo phospholipid synthesis

    SciTech Connect

    Sutter, Esther; Oliveira, Anna Paula de; Tobler, Kurt; Schraner, Elisabeth M.; Sonda, Sabrina; Kaech, Andres; Lucas, Miriam S.; Ackermann, Mathias; Wild, Peter

    2012-08-01

    Herpes simplex virus type 1 capsids bud at nuclear membranes and Golgi membranes acquiring an envelope composed of phospholipids. Hence, we measured incorporation of phospholipid precursors into these membranes, and quantified changes in size of cellular compartments by morphometric analysis. Incorporation of [{sup 3}H]-choline into both nuclear and cytoplasmic membranes was significantly enhanced upon infection. [{sup 3}H]-choline was also part of isolated virions even grown in the presence of brefeldin A. Nuclei expanded early in infection. The Golgi complex and vacuoles increased substantially whereas the endoplasmic reticulum enlarged only temporarily. The data suggest that HSV-1 stimulates phospholipid synthesis, and that de novo synthesized phospholipids are inserted into nuclear and cytoplasmic membranes to i) maintain membrane integrity in the course of nuclear and cellular expansion, ii) to supply membrane constituents for envelopment of capsids by budding at nuclear membranes and Golgi membranes, and iii) to provide membranes for formation of transport vacuoles.

  14. Activation and de novo synthesis of hydrogenase in chlamydomonas.

    PubMed

    Roessler, P G; Lien, S

    1984-12-01

    Two distinct processes are involved in the formation of active hydrogenase during anaerobic adaptation of Chlamydomonas reinhardtii cells. In the first 30 minutes of anaerobiosis, nearly all of the hydrogenase activity can be attributed to activation of a constituitive polypeptide precursor, based on the insensitivity of the process to treatment with cycloheximide (15 micrograms per milliliter). This concentration of cycloheximide inhibits protein synthesis by greater than 98%. After the initial activation period, de novo protein synthesis plays a critical role in the adaptation process since cycloheximide inhibits the expression of hydrogense in maximally adapted cells by 70%. Chloramphenicol (500 micrograms per milliliter) has a much lesser effect on the adaptation process.Incubation of cell-free extracts under anaerobic conditions in the presence of dithionite, dithiothreitol, NADH, NADP, ferredoxin, ATP, Mg(2+), Ca(2+), and iron does not lead to active hydrogenase formation. Futhermore, in vivo reactivation of oxygen-inactivated hydrogenase does not appear to take place.The adaptation process is very sensitive to the availability of iron. Iron-deficient cultures lose the ability to form active hydrogenase before growth, photosynthesis, and respiration are significantly affected. Preincubation of iron-deficient cells with iron 2 hours prior to the adaptation period fully restores the capacity of the cells to synthesize functional hydrogenase. PMID:16663954

  15. Activation and de novo synthesis of hydrogenase in Chlamydomonas

    SciTech Connect

    Roessler, P.G.; Lien, S.

    1984-12-01

    Two distinct processes are involved in the formation of active hydrogenase during anaerobic adaptation of Chlamydomonas reinhardtii cells. In the first 30 minutes of anaerobiosis, nearly all of the hydrogenase activity can be attributed to activation of constituitive polypeptide precursor, based on the insensitivity of the process to treatment with cycloheximide (15 micrograms per milliliter). This concentration of cycloheximide inhibits protein synthesis by greater than 98%. After the initial activation period, de novo protein synthesis plays a critical role in the adaptation process since cycloheximide inhibits the expression of hydrogenase in maximally adapted cells by 70%. Chloramphenicol (500 micrograms per milliliter) has a much lesser effect on the adaptation process. Incubation of cell-free extracts under anaerobic conditions in the presence of dithionite, dithiothreitol, NADH, NADP, ferredoxin, ATP, Mg/sup 2 +/, Ca/sup 2 +/, and iron does not lead to active hydrogenase formation. Furthermore, in vivo reactivation of oxygen-inactivated hydrogenase does not appear to take place. The adaptation process is very sensitive to the availability of iron. Iron-deficient cultures lose the ability to form active hydrogenase before growth, photosynthesis, and respiration are significantly affected. Preincubation of iron-deficient cells with iron 2 hours prior to the adaptation period fully restores the capacity of the cells to synthesize functional hydrogenase.

  16. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  17. De novo synthesis of phenolic dihydroxanthene near-infrared emitting fluorophores.

    PubMed

    Richard, Jean-Alexandre

    2015-08-14

    We report a flexible de novo synthesis of phenolic dihydroxanthene fluorophores. The synthesis relies on a one-pot formation of an aldehyde intermediate which can be diversified in 60-70% overall yield, providing an efficient access to this family of near-infrared emitting fluorophores. PMID:26146358

  18. Synthesis of chemically modified DNA.

    PubMed

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  19. A defect in the p53 response pathway induced by de novo purine synthesis inhibition.

    PubMed

    Bronder, Julie L; Moran, Richard G

    2003-12-01

    p53 is believed to sense cellular ribonucleotide depletion in the absence of DNA strand breaks and to respond by imposition of a p21-dependent G1 cell cycle arrest. We now report that the p53-dependent G1 checkpoint is blocked in human carcinoma cell lines after inhibition of de novo purine synthesis by folate analogs inhibitory to glycinamide ribonucleotide formyltransferase (GART). p53 accumulated in HCT116, MCF7, or A549 carcinoma cells upon GART inhibition, but, surprisingly, transcription of several p53 targets, including p21cip1/waf1, was impaired. The mechanism of this defect was examined. The p53 accumulating in these cells was nuclear but was not phosphorylated at serines 6, 15, and 20, nor was it acetylated at lysines 373 or 382. The DDATHF-stabilized p53 bound to the p21 promoter in vitro and in vivo but did not activate histone acetylation over the p53 binding sites in the p21 promoter that is an integral part of the transcriptional response mediated by the DNA damage pathway. We concluded that the robust initial response of the p53 pathway to GART inhibitors is not transcriptionally propagated to target genes due to a defect in p53 post-translational modifications and a failure to open chromatin structure despite promoter binding of this unmodified p53. PMID:14517211

  20. De Novo metabolic engineering and the promise of synthetic DNA.

    PubMed

    Klein-Marcuschamer, Daniel; Yadav, Vikramaditya G; Ghaderi, Adel; Stephanopoulos, Gregory N

    2010-01-01

    -expressing single or multiple genes using recombinant DNA, and intervention targets were predominantly selected based on knowledge of the stoichiometry, kinetics, and regulation of the pathway of interest. However, the distributive nature of metabolic control, as opposed to the existence of a single rate-limiting step, predicates the controlled expression of multiple enzymes in several coordinated pathways to achieve the desired flux, and, as such, simple strategies involving either deleting or over-expressing genes are greatly limited in this context. On the other hand, the use of synthetic or modified promoters, riboswitches, tunable intergenic regions, and translation modulators such as internal ribosome entry sequences, upstream open reading frames, optimized mRNA secondary structures, and RNA silencing have been shown to be enormously conducive to achieving the fine-tuning of gene expression. These modifications to the genetic machinery of the host organism can be best achieved via the use of synthetic DNA technology, and the constant improvement in the affordability and quality of oligonucleotide synthesis suggests that these might well become the mainstay of the metabolic engineering toolbox in the years to come. The possibilities that arise with the use of synthetic oligonucleotides will be delineated herein. PMID:20186529

  1. De novo reconstruction of plant RNA and DNA virus genomes from viral siRNAs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In antiviral defense, plants produce massive quantities of 21-24 nucleotide siRNAs. Here we demonstrate that the complete genomes of DNA and RNA viruses and viroids can be reconstructed by deep sequencing and de novo assembly of viral/viroid siRNAs from experimentally- and naturally-infected plants....

  2. De novo synthesis of milk triglycerides in humans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mammary gland (MG) de novo lipogenesis contributes significantly to milk fat in animals but little is known in humans. Objective: To test the hypothesis that the incorporation of 13C carbons from [U-13C]glucose into fatty acids (FA) and glycerol in triglycerides (TG) will be greater: 1) in milk tha...

  3. De novo synthesis and functional study of primitive polypeptides in the prebiotic protein world

    NASA Astrophysics Data System (ADS)

    Fujishima, Kosuke; Wang, Kendrick; Ferreira, Raphael; Rothschild, Lynn

    DNA, RNA and proteins within a lipid-bound membrane are the core components of life, but the order of their appearance during the origin and evolution of life is still under debate. The widely accepted “RNA World” hypothesis states that RNA likely emerged prior to proteins and DNA since RNA can serve both replicative and catalytic roles. While biochemists have reproduced the synthesis, polymerization, and replication of nucleotides/RNA under controlled prebiotic conditions, such complex organic molecules were not present in significant amounts on the prebiotic Earth. In contrast, amino acids are naturally abundant in various prebiotic contexts such as carbonaceous chondrites and Urey-Miller type experiments, and many studies have demonstrated plausible prebiotic conditions that could condense/polymerize amino acids to give rise to short peptides. These findings support the basis of a “Protein World” hypothesis for life, however little has been done to study the functions of such primitive peptides. Here, we present a novel synthetic biology-based approach to the de novo synthesis of over billions of primitive peptides/proteins derived from a limited set of naturally abundant proteinogenic amino acids. Of these peptides, ones with divalent metal-binding capability are of particular interest and will be screened and identified. Certain divalent metals are likely present in prebiotic environments and both coordinate well with amino acids and catalyze reactions, which are difficult to achieve in organic chemistry. Furthermore, since D-chiral and non-proteinogenic amino acids are also abundant in the universe and may provide insight into the pathway by which life developed, the methods to analyze primitive peptides consisting of these amino acids will be discussed. By understanding this natural pathway, we will be able to better understand how life developed here on Earth and the probability of life arising elsewhere.

  4. Glutamine supplementation, citrulline production, and de novo arginine synthesis: Is there a relation?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We would like to comment on the recent publications by Buijs et al. The authors hypothesized that a parenteral supplement of glutamine stimulates citrulline formation and enhances de novo arginine synthesis. To test this hypothesis, they conducted an experiment with stable isotopes in patients under...

  5. Photoelectrochemical synthesis of DNA microarrays

    PubMed Central

    Chow, Brian Y.; Emig, Christopher J.; Jacobson, Joseph M.

    2009-01-01

    Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis. PMID:19706433

  6. Constructing de novo biosynthetic pathways for chemical synthesis inside living cells†

    PubMed Central

    Weeks, Amy M.; Chang, Michelle C. Y.

    2011-01-01

    Living organisms have evolved a vast array of catalytic functions that make them ideally suited for the production of medicinally and industrially relevant small-molecule targets. Indeed, native metabolic pathways in microbial hosts have long been exploited and optimized for the scalable production of both fine and commodity chemicals. Our increasing capacity for DNA sequencing and synthesis has revealed the molecular basis for the biosynthesis of a variety of complex and useful metabolites and enables the de novo construction of novel metabolic pathways for the production of new and exotic molecular targets in genetically tractable microbes. However, the development of commercially viable processes for these engineered pathways is currently limited by our ability to quickly identify or engineer enzymes with the correct reaction and substrate selectivity as well as the speed by which metabolic bottlenecks can be determined and corrected. Efforts in understanding the relationship between sequence, structure, and function in the basic biochemical sciences can advance these goals for synthetic biology applications while also serving as an experimental platform to elucidate the in vivo specificity and function of enzymes and to reconstitute complex biochemical traits for study in a living model organism. Furthermore, the continuing discovery of natural mechanisms for the regulation of metabolic pathways has revealed new principles for the design of high-flux pathways with minimized metabolic burden and has inspired the development of new tools and approaches to engineer synthetic pathways in microbial hosts for chemical production. PMID:21591680

  7. Dynamic changes in histone modifications precede de novo DNA methylation in oocytes.

    PubMed

    Stewart, Kathleen R; Veselovska, Lenka; Kim, Jeesun; Huang, Jiahao; Saadeh, Heba; Tomizawa, Shin-ichi; Smallwood, Sébastien A; Chen, Taiping; Kelsey, Gavin

    2015-12-01

    Erasure and subsequent reinstatement of DNA methylation in the germline, especially at imprinted CpG islands (CGIs), is crucial to embryogenesis in mammals. The mechanisms underlying DNA methylation establishment remain poorly understood, but a number of post-translational modifications of histones are implicated in antagonizing or recruiting the de novo DNA methylation complex. In mouse oogenesis, DNA methylation establishment occurs on a largely unmethylated genome and in nondividing cells, making it a highly informative model for examining how histone modifications can shape the DNA methylome. Using a chromatin immunoprecipitation (ChIP) and genome-wide sequencing (ChIP-seq) protocol optimized for low cell numbers and novel techniques for isolating primary and growing oocytes, profiles were generated for histone modifications implicated in promoting or inhibiting DNA methylation. CGIs destined for DNA methylation show reduced protective H3K4 dimethylation (H3K4me2) and trimethylation (H3K4me3) in both primary and growing oocytes, while permissive H3K36me3 increases specifically at these CGIs in growing oocytes. Methylome profiling of oocytes deficient in H3K4 demethylase KDM1A or KDM1B indicated that removal of H3K4 methylation is necessary for proper methylation establishment at CGIs. This work represents the first systematic study performing ChIP-seq in oocytes and shows that histone remodeling in the mammalian oocyte helps direct de novo DNA methylation events. PMID:26584620

  8. Dynamic changes in histone modifications precede de novo DNA methylation in oocytes

    PubMed Central

    Stewart, Kathleen R.; Veselovska, Lenka; Kim, Jeesun; Huang, Jiahao; Saadeh, Heba; Tomizawa, Shin-ichi; Smallwood, Sébastien A.; Chen, Taiping; Kelsey, Gavin

    2015-01-01

    Erasure and subsequent reinstatement of DNA methylation in the germline, especially at imprinted CpG islands (CGIs), is crucial to embryogenesis in mammals. The mechanisms underlying DNA methylation establishment remain poorly understood, but a number of post-translational modifications of histones are implicated in antagonizing or recruiting the de novo DNA methylation complex. In mouse oogenesis, DNA methylation establishment occurs on a largely unmethylated genome and in nondividing cells, making it a highly informative model for examining how histone modifications can shape the DNA methylome. Using a chromatin immunoprecipitation (ChIP) and genome-wide sequencing (ChIP-seq) protocol optimized for low cell numbers and novel techniques for isolating primary and growing oocytes, profiles were generated for histone modifications implicated in promoting or inhibiting DNA methylation. CGIs destined for DNA methylation show reduced protective H3K4 dimethylation (H3K4me2) and trimethylation (H3K4me3) in both primary and growing oocytes, while permissive H3K36me3 increases specifically at these CGIs in growing oocytes. Methylome profiling of oocytes deficient in H3K4 demethylase KDM1A or KDM1B indicated that removal of H3K4 methylation is necessary for proper methylation establishment at CGIs. This work represents the first systematic study performing ChIP-seq in oocytes and shows that histone remodeling in the mammalian oocyte helps direct de novo DNA methylation events. PMID:26584620

  9. Selective decreased de novo synthesis of glomerular proteoglycans under the influence of reactive oxygen species.

    PubMed Central

    Kashihara, N; Watanabe, Y; Makino, H; Wallner, E I; Kanwar, Y S

    1992-01-01

    The effect of reactive oxygen species on de novo synthesis of heparan sulfate proteoglycans (HSPGs) of the renal glomerulus was investigated in an organ perfusion system. Isolated kidneys were perfused for 7 hr with a medium containing [35S]sulfate to label sulfated proteoglycans or [35S]methionine to label total glomerular glycoproteins. For the generation of reactive oxygen species, xanthine and xanthine oxidase were included in the perfusion medium, and catalase and superoxide dismutase were used as scavenging agents. Proteoglycans were characterized by Sepharose CL-6B and DEAE-Sephacel chromatographies and SDS/PAGE analysis. The labeled glycoproteins were immunoprecipitated with anti-HSPG, anti-type IV collagen, and anti-laminin, and their specific radioactivities were determined. With exposure to reactive oxygen species, a drastic dose-dependent decrease in de novo synthesis of proteoglycans was seen, and that effect was reversible by catalase treatment. No alterations in the biochemical characteristics of proteoglycans were noted. Immunoprecipitation studies revealed a 16-fold decrease in the synthesis of nascent core peptide of HSPGs, while at comparable concentrations of xanthine and xanthine oxidase, synthesis of type IV collagen and laminin slightly decreased (approximately 15%). Morphologic studies revealed a 14-fold decrease in [35S]sulfate-associated autoradiographic grains overlying the glomerular basement membrane, a critical component of the ultrafiltration apparatus. Relevance of the selective decreased de novo synthesis of HSPGs of the glomerular basement membrane is discussed in terms of increased glomerular permeability to plasma proteins. Images PMID:1631123

  10. De novo design, synthesis and spectroscopic characterization of chiral benzimidazole-derived amino acid Zn(II) complexes: Development of tryptophan-derived specific hydrolytic DNA artificial nuclease agent

    NASA Astrophysics Data System (ADS)

    Parveen, Shazia; Arjmand, Farukh

    2012-01-01

    Novel ternary dizinc(II) complexes 1- 3, derived from 1,2-bis(1H-benzimidazol-2-yl)ethane-1,2-diol and L-form of amino acids (viz., tryptophan, leucine and valine) were synthesized and characterized by spectroscopic (IR, 1H NMR, UV-vis, ESI-MS) and other analytical methods. To evaluate the biological preference of chiral drugs for inherently chiral target DNA, interaction of 1- 3 with calf thymus DNA in Tris-HCl buffer was studied by various biophysical techniques which reveal that all these complexes bind to CT DNA non-covalently via electrostatic interaction. The higher Kb value of L-tryptophan complex 1 suggested greater DNA binding propensity. Further, to evaluate the mode of action at the molecular level, interaction studies of complexes 1 and 2 with nucleotides (5'-GMP and 5'-TMP) were carried out by UV-vis titrations, 1H and 31P NMR which implicates the preferential selectivity of these complexes to N3 of thymine rather than N7 of guanine. Furthermore, complex 1 exhibits efficient DNA cleavage with supercoiled pBR322. The complex 1 cleaves DNA efficiently involving hydrolytic cleavage pathway. Such chiral synthetic hydrolytic nucleases with asymmetric centers are gaining considerable attention owing to their importance in biotechnology and drug design, in particular to cleave DNA with sequence selectivity different from that of the natural enzymes.

  11. De novo fatty acid synthesis at the mitotic exit is required to complete cellular division

    PubMed Central

    Scaglia, Natalia; Tyekucheva, Svitlana; Zadra, Giorgia; Photopoulos, Cornelia; Loda, Massimo

    2014-01-01

    Although the regulation of the cell cycle has been extensively studied, much less is known about its coordination with the cellular metabolism. Using mass spectrometry we found that lysophospholipid levels decreased drastically from G2/M to G1 phase, while de novo phosphatidylcholine synthesis, the main phospholipid in mammalian cells, increased, suggesting that enhanced membrane production was concomitant to a decrease in its turnover. In addition, fatty acid synthesis and incorporation into membranes was increased upon cell division. The rate-limiting reaction for de novo fatty acid synthesis is catalyzed by acetyl-CoA carboxylase. As expected, its inhibiting phosphorylation decreased prior to cytokinesis initiation. Importantly, the inhibition of fatty acid synthesis arrested the cells at G2/M despite the presence of abundant fatty acids in the media. Our results suggest that de novo lipogenesis is essential for cell cycle completion. This “lipogenic checkpoint” at G2/M may be therapeutically exploited for hyperproliferative diseases such as cancer. PMID:24418822

  12. De novo synthesis of a sunscreen compound in vertebrates.

    PubMed

    Osborn, Andrew R; Almabruk, Khaled H; Holzwarth, Garrett; Asamizu, Shumpei; LaDu, Jane; Kean, Kelsey M; Karplus, P Andrew; Tanguay, Robert L; Bakalinsky, Alan T; Mahmud, Taifo

    2015-01-01

    Ultraviolet-protective compounds, such as mycosporine-like amino acids (MAAs) and related gadusols produced by some bacteria, fungi, algae, and marine invertebrates, are critical for the survival of reef-building corals and other marine organisms exposed to high-solar irradiance. These compounds have also been found in marine fish, where their accumulation is thought to be of dietary or symbiont origin. In this study, we report the unexpected discovery that fish can synthesize gadusol de novo and that the analogous pathways are also present in amphibians, reptiles, and birds. Furthermore, we demonstrate that engineered yeast containing the fish genes can produce and secrete gadusol. The discovery of the gadusol pathway in vertebrates provides a platform for understanding its role in these animals, and the possibility of engineering yeast to efficiently produce a natural sunscreen and antioxidant presents an avenue for its large-scale production for possible use in pharmaceuticals and cosmetics. PMID:25965179

  13. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics

    PubMed Central

    Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-01-01

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  14. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  15. Integrative Analysis of Circadian Transcriptome and Metabolic Network Reveals the Role of De Novo Purine Synthesis in Circadian Control of Cell Cycle

    PubMed Central

    Li, Ying; Li, Guang; Görling, Benjamin; Luy, Burkhard; Du, Jiulin; Yan, Jun

    2015-01-01

    Metabolism is the major output of the circadian clock in many organisms. We developed a computational method to integrate both circadian gene expression and metabolic network. Applying this method to zebrafish circadian transcriptome, we have identified large clusters of metabolic genes containing mostly genes in purine and pyrimidine metabolism in the metabolic network showing similar circadian phases. Our metabolomics analysis found that the level of inosine 5'-monophosphate (IMP), an intermediate metabolite in de novo purine synthesis, showed significant circadian oscillation in larval zebrafish. We focused on IMP dehydrogenase (impdh), a rate-limiting enzyme in de novo purine synthesis, with three circadian oscillating gene homologs: impdh1a, impdh1b and impdh2. Functional analysis revealed that impdh2 contributes to the daily rhythm of S phase in the cell cycle while impdh1a contributes to ocular development and pigment synthesis. The three zebrafish homologs of impdh are likely regulated by different circadian transcription factors. We propose that the circadian regulation of de novo purine synthesis that supplies crucial building blocks for DNA replication is an important mechanism conferring circadian rhythmicity on the cell cycle. Our method is widely applicable to study the impact of circadian transcriptome on metabolism in complex organisms. PMID:25714999

  16. Solid-phase de novo synthesis of a (+/-)-2-deoxy-glycoside.

    PubMed

    Lucchesi, Céline; Arboré, Amélie; Pascual, Sagrario; Fontaine, Laurent; Maignan, Christian; Dujardin, Gilles

    2010-04-19

    The solid-phase synthesis of methyl 2-deoxy-3-O-benzyl-D,L-arabino-hexopyranoside was achieved in a six-step sequence via a de novo strategy based on the hetero-Diels-Alder reaction of a vinyl ether supported on an azalactone-functionalized polystyrene resin, followed by the functional modification of the heteroadduct and the final release of the methyl glycoside by acidic solvolysis. PMID:20171610

  17. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  18. Engineering Methylobacterium extorquens for de novo synthesis of the sesquiterpenoid α-humulene from methanol.

    PubMed

    Sonntag, Frank; Kroner, Cora; Lubuta, Patrice; Peyraud, Rémi; Horst, Angelika; Buchhaupt, Markus; Schrader, Jens

    2015-11-01

    Over the last 10 to 15 years, metabolic engineering of microbes has become a versatile tool for high-level de novo synthesis of terpenoids, with the sesquiterpenoids armopha-1,4-diene, farnesene and artemisinic acid as prime examples. However, almost all cell factory approaches towards terpenoids to date have been based on sugar as the raw material, which is mainly used as a food resource and subject to high price volatilities. In this study we present de novo synthesis of the sesquiterpenoid α-humulene from the abundantly available non-food carbon source methanol by metabolically engineered Methylobacterium extorquens AM1. Expression of α-humulene synthase from Zingiber zerumbet in combination with farnesyl pyrophosphate (FPP) synthase from Saccharomyces cerevisiae led to concentrations of up to 18 mg/L α-humulene. Introduction of a prokaryotic mevalonate pathway from Myxococcus xanthus in combination with ribosome binding site optimization of α-humulene and FPP synthases increased product concentration 3-fold. This value was additionally raised by 30% using a carotenoid synthesis deficient mutant strain. Final product concentrations of up to 1.65 g/L were obtained in methanol limited fed-batch cultivations, which is the highest titer of de novo synthesized α-humulene reported to date. This study demonstrates the potential of M. extorquens as a future platform strain for the production of high-value terpenoids from the alternative carbon source methanol. PMID:26369439

  19. A Real-Time de novo DNA Sequencing Assembly Platform Based on an FPGA Implementation.

    PubMed

    Hu, Yuanqi; Georgiou, Pantelis

    2016-01-01

    This paper presents an FPGA based DNA comparison platform which can be run concurrently with the sensing phase of DNA sequencing and shortens the overall time needed for de novo DNA assembly. A hybrid overlap searching algorithm is applied which is scalable and can deal with incremental detection of new bases. To handle the incomplete data set which gradually increases during sequencing time, all-against-all comparisons are broken down into successive window-against-window comparison phases and executed using a novel dynamic suffix comparison algorithm combined with a partitioned dynamic programming method. The complete system has been designed to facilitate parallel processing in hardware, which allows real-time comparison and full scalability as well as a decrease in the number of computations required. A base pair comparison rate of 51.2 G/s is achieved when implemented on an FPGA with successful DNA comparison when using data sets from real genomes. PMID:27045828

  20. De novo synthesis of a sunscreen compound in vertebrates

    PubMed Central

    Osborn, Andrew R; Almabruk, Khaled H; Holzwarth, Garrett; Asamizu, Shumpei; LaDu, Jane; Kean, Kelsey M; Karplus, P Andrew; Tanguay, Robert L; Bakalinsky, Alan T; Mahmud, Taifo

    2015-01-01

    Ultraviolet-protective compounds, such as mycosporine-like amino acids (MAAs) and related gadusols produced by some bacteria, fungi, algae, and marine invertebrates, are critical for the survival of reef-building corals and other marine organisms exposed to high-solar irradiance. These compounds have also been found in marine fish, where their accumulation is thought to be of dietary or symbiont origin. In this study, we report the unexpected discovery that fish can synthesize gadusol de novo and that the analogous pathways are also present in amphibians, reptiles, and birds. Furthermore, we demonstrate that engineered yeast containing the fish genes can produce and secrete gadusol. The discovery of the gadusol pathway in vertebrates provides a platform for understanding its role in these animals, and the possibility of engineering yeast to efficiently produce a natural sunscreen and antioxidant presents an avenue for its large-scale production for possible use in pharmaceuticals and cosmetics. DOI: http://dx.doi.org/10.7554/eLife.05919.001 PMID:25965179

  1. The Drosophila melanogaster ade5 gene encodes a bifunctional enzyme for two steps in the de novo purine synthesis pathway.

    PubMed Central

    O'Donnell, A F; Tiong, S; Nash, D; Clark, D V

    2000-01-01

    Steps 6 and 7 of de novo purine synthesis are performed by 5-aminoimidazole ribonucleotide carboxylase (AIRc) and 4-[(N-succinylamino)carbonyl]-5-aminoimidazole ribonucleotide synthetase (SAICARs), respectively. In vertebrates, a single gene encodes AIRc-SAICARs with domains homologous to Escherichia coli PurE and PurC. We have isolated an AIRc-SAICARs cDNA from Drosophila melanogaster via functional complementation with an E. coli purC purine auxotroph. This cDNA encodes AIRc yet is unable to complement an E. coli purE mutant, suggesting functional differences between Drosophila and E. coli AIRc. In vertebrates, the AIRc-SAICARs gene shares a promoter region with the gene encoding phosphoribosylamidotransferase, which performs the first step in de novo purine synthesis. In Drosophila, the AIRc-SAICARs gene maps to section 11B4-14 of the X chromosome, while the phosphoribosylamidotransferase gene (Prat) maps to chromosome 3; thus, the close linkage of these two genes is not conserved in flies. Three EMS-induced X-linked adenine auxotrophic mutations, ade4(1), ade5(1), and ade5(2), were isolated. Two gamma-radiation-induced (ade5(3) and ade5(4)) and three hybrid dysgenesis-induced (ade5(5), ade5(6), and ade5(8)) alleles were also isolated. Characterization of the auxotrophy and the finding that the hybrid dysgenesis-induced mutations all harbor P transposon sequences within the AIRc-SAICARs gene show that ade5 encodes AIRc-SAICARs. PMID:10757766

  2. De novo reconstruction of DNA origami structures through atomistic molecular dynamics simulation

    PubMed Central

    Maffeo, Christopher; Yoo, Jejoong; Aksimentiev, Aleksei

    2016-01-01

    The DNA origami method has brought nanometer-precision fabrication to molecular biology labs, offering myriads of potential applications in the fields of synthetic biology, medicine, molecular computation, etc. Advancing the method further requires controlling self-assembly down to the atomic scale. Here we demonstrate a computational method that allows the equilibrium structure of a large, complex DNA origami object to be determined to atomic resolution. Through direct comparison with the results of cryo-electron microscopy, we demonstrate de novo reconstruction of a 4.7 megadalton pointer structure by means of fully atomistic molecular dynamics simulations. Furthermore, we show that elastic network-guided simulations performed without solvent can yield similar accuracy at a fraction of the computational cost, making this method an attractive approach for prototyping and validation of self-assembled DNA nanostructures. PMID:26980283

  3. In vivo targeting of de novo DNA methylation by histone modifications in yeast and mouse.

    PubMed

    Morselli, Marco; Pastor, William A; Montanini, Barbara; Nee, Kevin; Ferrari, Roberto; Fu, Kai; Bonora, Giancarlo; Rubbi, Liudmilla; Clark, Amander T; Ottonello, Simone; Jacobsen, Steven E; Pellegrini, Matteo

    2015-01-01

    Methylation of cytosines (5(me)C) is a widespread heritable DNA modification. During mammalian development, two global demethylation events are followed by waves of de novo DNA methylation. In vivo mechanisms of DNA methylation establishment are largely uncharacterized. Here, we use Saccharomyces cerevisiae as a system lacking DNA methylation to define the chromatin features influencing the activity of the murine DNMT3B. Our data demonstrate that DNMT3B and H3K4 methylation are mutually exclusive and that DNMT3B is co-localized with H3K36 methylated regions. In support of this observation, DNA methylation analysis in yeast strains without Set1 and Set2 shows an increase of relative 5(me)C levels at the transcription start site and a decrease in the gene-body, respectively. We extend our observation to the murine male germline, where H3K4me3 is strongly anti-correlated while H3K36me3 correlates with accelerated DNA methylation. These results show the importance of H3K36 methylation for gene-body DNA methylation in vivo. PMID:25848745

  4. Regulation of ceramide generation during macrophage apoptosis by ASMase and de novo synthesis.

    PubMed

    Wang, Shih Wei; Hojabrpour, Payman; Zhang, Peng; Kolesnick, Richard N; Steinbrecher, Urs P; Gómez-Muñoz, Antonio; Duronio, Vincent

    2015-11-01

    The survival of macrophages depends on the presence of specific cytokines that activate survival signaling events, as well as suppressing formation of apoptosis-inducing pathways. We have previously shown that macrophages deprived of macrophage colony stimulating factor (M-CSF) produce ceramide that contributes to apoptosis of these cells, a pathway that is suppressed by exposure to oxidized LDL. In this study we have examined macrophages derived from mice lacking acid sphingomyelinase (ASMase) to ask whether these events are altered due to the impaired ability of these cells to break down sphingomyelin and produce ceramide. We found that these cells do survive better than cells from wild type mice, but they still undergo cell death and some ceramide is formed. We show that the ceramide is being produced by a de novo synthetic pathway. Therefore, ceramide production in M-CSF-deprived macrophages arises from a combination of ASMase activity and de novo synthesis. PMID:26253821

  5. Fractional synthesis rates of DNA and protein in rabbit skin are not correlated.

    PubMed

    Zhang, Xiao-jun; Chinkes, David L; Wu, Zhanpin; Martini, Wenjun Z; Wolfe, Robert R

    2004-09-01

    We developed a method for measurement of skin DNA synthesis, reflecting cell division, in conscious rabbits by infusing D-[U-(13)C(6)]glucose and L-[(15)N]glycine. Cutaneous protein synthesis was simultaneously measured by infusion of L-[ring-(2)H(5)]phenylalanine. Rabbits were fitted with jugular venous and carotid arterial catheters, and were studied during the infusion of an amino acid solution (10% Travasol). The fractional synthetic rate (FSR) of DNA from the de novo nucleotide synthesis pathway, a reflection of total cell division, was 3.26 +/- 0.59%/d in whole skin and 3.08 +/- 1.86%/d in dermis (P = 0.38). The de novo base synthesis pathway accounted for 76 and 60% of the total DNA FSR in whole skin and dermis, respectively; the contribution from the base salvage pathway was 24% in whole skin and 40% in dermis. The FSR of protein in whole skin was 5.35 +/- 4.42%/d, which was greater (P < 0.05) than that in dermis (2.91 +/- 2.52%/d). The FSRs of DNA and protein were not correlated (P = 0.33), indicating that cell division and protein synthesis are likely regulated by different mechanisms. This new approach enables investigations of metabolic disorders of skin diseases and regulation of skin wound healing by distinguishing the 2 principal components of skin metabolism, which are cell division and protein synthesis. PMID:15333735

  6. INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis

    SciTech Connect

    Ausin, Israel; Greenberg, Maxim V.C.; Simanshu, Dhirendra K.; Hale, Christopher J.; Vashisht, Ajay A.; Simon, Stacey A.; Lee, Tzuu-fen; Feng, Suhua; Española, Sophia D.; Meyers, Blake C.; Wohlschlegel, James A.; Patel, Dinshaw J.; Jacobsen, Steven E.

    2012-10-23

    At least three pathways control maintenance of DNA cytosine methylation in Arabidopsis thaliana. However, the RNA-directed DNA methylation (RdDM) pathway is solely responsible for establishment of this silencing mark. We previously described INVOLVED IN DE NOVO 2 (IDN2) as being an RNA-binding RdDM component that is required for DNA methylation establishment. In this study, we describe the discovery of two partially redundant proteins that are paralogous to IDN2 and that form a stable complex with IDN2 in vivo. Null mutations in both genes, termed IDN2-LIKE 1 and IDN2-LIKE 2 (IDNL1 and IDNL2), result in a phenotype that mirrors, but does not further enhance, the idn2 mutant phenotype. Genetic analysis suggests that this complex acts in a step in the downstream portion of the RdDM pathway. We also have performed structural analysis showing that the IDN2 XS domain adopts an RNA recognition motif (RRM) fold. Finally, genome-wide DNA methylation and expression analysis confirms the placement of the IDN proteins in an RdDM pathway that affects DNA methylation and transcriptional control at many sites in the genome. Results from this study identify and describe two unique components of the RdDM machinery, adding to our understanding of DNA methylation control in the Arabidopsis genome.

  7. A clinical measure of DNA methylation predicts outcome in de novo acute myeloid leukemia

    PubMed Central

    Luskin, Marlise R.; Gimotty, Phyllis A.; Smith, Catherine; Loren, Alison W.; Figueroa, Maria E.; Harrison, Jenna; Sun, Zhuoxin; Tallman, Martin S.; Paietta, Elisabeth M.; Litzow, Mark R.; Melnick, Ari M.; Levine, Ross L.; Fernandez, Hugo F.; Luger, Selina M.; Carroll, Martin

    2016-01-01

    BACKGROUND Variable response to chemotherapy in acute myeloid leukemia (AML) represents a major treatment challenge. Clinical and genetic features incompletely predict outcome. The value of clinical epigenetic assays for risk classification has not been extensively explored. We assess the prognostic implications of a clinical assay for multilocus DNA methylation on adult patients with de novo AML. METHODS We performed multilocus DNA methylation assessment using xMELP on samples and calculated a methylation statistic (M-score) for 166 patients from UPENN with de novo AML who received induction chemotherapy. The association of M-score with complete remission (CR) and overall survival (OS) was evaluated. The optimal M-score cut-point for identifying groups with differing survival was used to define a binary M-score classifier. This classifier was validated in an independent cohort of 383 patients from the Eastern Cooperative Oncology Group Trial 1900 (E1900; NCT00049517). RESULTS A higher mean M-score was associated with death and failure to achieve CR. Multivariable analysis confirmed that a higher M-score was associated with death (P = 0.011) and failure to achieve CR (P = 0.034). Median survival was 26.6 months versus 10.6 months for low and high M-score groups. The ability of the M-score to perform as a classifier was confirmed in patients ≤ 60 years with intermediate cytogenetics and patients who achieved CR, as well as in the E1900 validation cohort. CONCLUSION The M-score represents a valid binary prognostic classifier for patients with de novo AML. The xMELP assay and associated M-score can be used for prognosis and should be further investigated for clinical decision making in AML patients. PMID:27446991

  8. De novo mRNA synthesis is required for both consolidation and reconsolidation of fear memories in the amygdala

    PubMed Central

    Duvarci, Sevil; Nader, Karim; LeDoux, Joseph E.

    2008-01-01

    Memory consolidation is the process by which newly learned information is stabilized into long-term memory (LTM). Considerable evidence indicates that retrieval of a consolidated memory returns it to a labile state that requires it to be restabilized. Consolidation of new fear memories has been shown to require de novo RNA and protein synthesis in the lateral nucleus of the amygdala (LA). We have previously shown that de novo protein synthesis in the LA is required for reconsolidation of auditory fear memories. One key question is whether protein synthesis during reconsolidation depends on already existing mRNAs or on synthesis of new mRNAs in the amygdala. In the present study, we examined the effect of mRNA synthesis inhibition during consolidation and reconsolidation of auditory fear memories. We first show that intra-LA infusion of two different mRNA inhibitors dose-dependently impairs long-term memory but leaves short-term memory (STM) intact. Next, we show that intra-LA infusion of the same inhibitors dose-dependently blocks post-reactivation long-term memory (PR-LTM), whereas post-reactivation short-term memory (PR-STM) is left intact. Furthermore, the same treatment in the absence of memory reactivation has no effect. Together, these results show that both consolidation and reconsolidation of auditory fear memories require de novo mRNA synthesis and are equally sensitive to disruption of de novo mRNA synthesis in the LA. PMID:18832561

  9. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  10. De novo DNA methylation drives 5hmC accumulation in mouse zygotes

    PubMed Central

    Amouroux, Rachel; Hill, Peter WS; D’Souza, Zelpha; Nakayama, Manabu; Matsuda, Masashi; Turp, Aleksandra; Ndjetehe, Elodie; Encheva, Vesela; Kudo, Nobuaki R; Koseki, Haruhiko; Sasaki, Hiroyuki; Hajkova, Petra

    2016-01-01

    Zygotic epigenetic reprogramming entails genome-wide DNA demethylation that is accompanied by Ten-Eleven Translocation 3 (Tet3)-driven oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC)1-4. Here we demonstrate using detailed immunofluorescence analysis and ultra-sensitive LC/MS based quantitative measurements that the initial loss of paternal 5mC does not require 5hmC formation. Small molecule inhibition of Tet3 activity as well as genetic ablation impedes 5hmC accumulation in zygotes without affecting the early loss of paternal 5mC. Instead, 5hmC accumulation is dependent on the activity of zygotic Dnmt3a and Dnmt1, documenting a role for Tet3 driven hydroxylation in targeting de novo methylation activities present in the early embryo. Our data thus provide further insights into the dynamics of zygotic reprogramming revealing intricate interplay between DNA demethylation, de novo methylation and Tet3 driven hydroxylation. PMID:26751286

  11. De novo DNA methylation drives 5hmC accumulation in mouse zygotes.

    PubMed

    Amouroux, Rachel; Nashun, Buhe; Shirane, Kenjiro; Nakagawa, Shoma; Hill, Peter W S; D'Souza, Zelpha; Nakayama, Manabu; Matsuda, Masashi; Turp, Aleksandra; Ndjetehe, Elodie; Encheva, Vesela; Kudo, Nobuaki R; Koseki, Haruhiko; Sasaki, Hiroyuki; Hajkova, Petra

    2016-02-01

    Zygotic epigenetic reprogramming entails genome-wide DNA demethylation that is accompanied by Tet methylcytosine dioxygenase 3 (Tet3)-driven oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC; refs 1-4). Here we demonstrate using detailed immunofluorescence analysis and ultrasensitive LC-MS-based quantitative measurements that the initial loss of paternal 5mC does not require 5hmC formation. Small-molecule inhibition of Tet3 activity, as well as genetic ablation, impedes 5hmC accumulation in zygotes without affecting the early loss of paternal 5mC. Instead, 5hmC accumulation is dependent on the activity of zygotic Dnmt3a and Dnmt1, documenting a role for Tet3-driven hydroxylation in targeting de novo methylation activities present in the early embryo. Our data thus provide further insights into the dynamics of zygotic reprogramming, revealing an intricate interplay between DNA demethylation, de novo methylation and Tet3-driven hydroxylation. PMID:26751286

  12. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  13. Mutations in the Chinese hamster ovary cell GART gene of de novo purine synthesis

    PubMed Central

    Knox, Aaron J.; Graham, Christine; Bleskan, John; Brodsky, Gary; Patterson, David

    2009-01-01

    Mutations in several steps of de novo purine synthesis lead to human inborn errors of metabolism often characterized by mental retardation, hypotonia, sensorineural hearing loss, optic atrophy, and other features. In animals, the phosphoribosylglycinamide transformylase (GART) gene encodes a trifunctional protein carrying out 3 steps of de novo purine synthesis, phosphoribosylglycinamide synthase (GARS), phosphoribosylglycinamide transformylase (also abbreviated as GART), and phosphoribosylaminoimidazole synthetase (AIRS) and a smaller protein that contains only the GARS domain of GART as a functional protein. The GART gene is located on human chromosome 21 and is aberrantly regulated and overexpressed in individuals with Down syndrome (DS), and may be involved in the phenotype of DS. The GART activity of GART requires 10-formyltetrahydrofolate and has been a target for anti-cancer drugs. Thus, a considerable amount of information is available about GART, while less is known about the GARS and AIRS domains. Here we demonstrate that the amino acid residue glu75 is essential for the activity of the GARS enzyme and that the gly684 residue is essential for the activity of the AIRS enzyme by analysis of mutations in the Chinese hamster ovary (CHO-K1) cell that require purines for growth. We report the effects of these mutations on mRNA and protein content for GART and GARS. Further, we discuss the likely mechanisms by which mutations inactivating the GART protein might arise in CHO-K1 cells. PMID:19007868

  14. Measures of de novo synthesis of milk components from propionate in lactating goats

    SciTech Connect

    Emmanuel, B.; Kennelly, J.J.

    1985-02-01

    Possible direct contributions of propionate to de novo synthesis of milk components by the mammary gland of lactating goats fed a concentrate-roughage diet have been studied in vivo by primed constant infusion of (1-carbon-14)propionate into the right mammary artery. Specific radioactivities of milk galactose, fatty acids, and protein were higher in the infused than in the uninfused half of the mammary gland, suggesting de novo synthesis of these compounds in the udder. Specific radioactivities of milk glucose in both udder halves were identical, ruling out any possibility of mammary gland-derived glucose from propionate of blood plasma under the experimental conditions. Of milk galactose, .8% was derived from propionate of blood plasma, and of milk glucose, 98% was derived from glucose of blood plasma. After intraruminal infusion of unlabeled propionic acid at 11 g/h, concentration of propionate in blood plasma was doubled, its contribution to milk galactose was increased to 1.5%, and proportions of milk odd-numbered fatty acids were increased. Propionate was incorporated largely into milk odd-numbered fatty acids. The authors conclude that small amounts of propionate can be incorporated into principal components of milk in the mammary gland of lactating goats.

  15. Functional characterization of a rice de novo DNA methyltransferase, OsDRM2, expressed in Escherichia coli and yeast

    SciTech Connect

    Pang, Jinsong; Dong, Mingyue; Li, Ning; Zhao, Yanli; Liu, Bao

    2013-03-01

    Highlights: ► A rice de novo DNA methyltransferase OsDRM2 was cloned. ► In vitro methylation activity of OsDRM2 was characterized with Escherichia coli. ► Assays of OsDRM2 in vivo methylation were done with Saccharomyces cerevisiae. ► OsDRM2 methylation activity is not preferential to any type of cytosine context. ► The activity of OsDRM2 is independent of RdDM pathway. - Abstract: DNA methylation of cytosine nucleotides is an important epigenetic modification that occurs in most eukaryotic organisms and is established and maintained by various DNA methyltransferases together with their co-factors. There are two major categories of DNA methyltransferases: de novo and maintenance. Here, we report the isolation and functional characterization of a de novo methyltransferase, named OsDRM2, from rice (Oryza sativa L.). The full-length coding region of OsDRM2 was cloned and transformed into Escherichia coli and Saccharomyces cerevisiae. Both of these organisms expressed the OsDRM2 protein, which exhibited stochastic de novo methylation activity in vitro at CG, CHG, and CHH di- and tri-nucleotide patterns. Two lines of evidence demonstrated the de novo activity of OsDRM2: (1) a 5′-CCGG-3′ containing DNA fragment that had been pre-treated with OsDRM2 protein expressed in E. coli was protected from digestion by the CG-methylation-sensitive isoschizomer HpaII; (2) methylation-sensitive amplified polymorphism (MSAP) analysis of S. cerevisiae genomic DNA from transformants that had been introduced with OsDRM2 revealed CG and CHG methylation levels of 3.92–9.12%, and 2.88–6.93%, respectively, whereas the mock control S. cerevisiae DNA did not exhibit cytosine methylation. These results were further supported by bisulfite sequencing of the 18S rRNA and EAF5 genes of the transformed S. cerevisiae, which exhibited different DNA methylation patterns, which were observed in the genomic DNA. Our findings establish that OsDRM2 is an active de novo DNA

  16. De novo reconstruction of consensus master genomes of plant RNA and DNA viruses from siRNAs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In antiviral defense, plants produce massive quantities of 21-24 nucleotide siRNAs. Here we demonstrate that the complete genomes of DNA and RNA viruses and viroids can be reconstructed by deep sequencing and de novo assembly of viral/viroid siRNAs from experimentally- and naturally-infected plants....

  17. DNA precursor compartmentation in mammalian cells: metabolic and antimetabolic studies of nuclear and mitochondrial DNA synthesis

    SciTech Connect

    Bestwick, R.K.

    1983-01-01

    HeLa cells were used for the quantitation of cellular and mitochondrial deoxyribonucleoside triphosphate (dNTP) and ribonucleoside triphosphate (rNTP) pools and of changes in pools in response to treatment with the antimetabolites methotrexate (mtx) and 5-fluorodeoxyuridine (FUdR). Use of an enzymatic assay of dNTPs and of improved nucleotide extraction methods allowed quantitation of mitochondrial dNTP pools. All four mitochondrial dNTP pools expand following treatment with mtx or FUdR whereas cellular dTTP and dGTP pools are depleted. Mitochrondrial rNTP pools were also found to expand in response to these antimetabolites. Mouse L-cells were used to determine the relative contributions of an exogenously supplied precursor to nuclear and mitochrondrial DNA replication. Cells were labeled to near steady state specific activities with /sup 32/P-orthophosphate and subsequently labeled with (/sup 3/H)uridine, a general pyrimidine precursor, in the continuing presence of /sup 32/P. Deoxyribonucleoside monophosphates derived from these DNAs were separated by HPLC and the /sup 3/H//sup 32/P ratio in each pyrimidine determined. The dCMP residues in mitochondrial DNA (mtDNA) were found to be derived exclusively from the exogenous supplied uridine. The dTMP residues from nuclear and mtDNA and the dCMP residues from nuclear DNA were seen to be synthesized partly from exogenous sources and partly from other sources, presumably de novo pyrimidine synthesis.

  18. De Novo mRNA Synthesis Is Required for Both Consolidation and Reconsolidation of Fear Memories in the Amygdala

    ERIC Educational Resources Information Center

    Duvarci, Sevil; Nader, Karim; LeDoux, Joseph E.

    2008-01-01

    Memory consolidation is the process by which newly learned information is stabilized into long-term memory (LTM). Considerable evidence indicates that retrieval of a consolidated memory returns it to a labile state that requires it to be restabilized. Consolidation of new fear memories has been shown to require de novo RNA and protein synthesis in…

  19. Further verification of the isotope dilution approach for estimating the degree of participation of (/sup 3/H)thymidine in DNA synthesis in studies of aquatic bacterial production

    SciTech Connect

    Bell, R.T.

    1986-11-01

    The optimal concentration of (/sup 3/H)thymidine (i.e., the maximal degree of participation in DNA synthesis) as determined by adding increasing amounts of labeled thymidine at the same specific activity was similar to the concentration of thymidine inhibiting the de novo pathway as determined by isotope dilution plots. These experiments provide further verification of the isotope dilution approach for determining the degree of participation of (/sup 3/H)thymidine in DNA synthesis.

  20. Enhanced GSH synthesis by Bisphenol A exposure promoted DNA methylation process in the testes of adult rare minnow Gobiocypris rarus.

    PubMed

    Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao

    2016-09-01

    DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. PMID:27474941

  1. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.

    2016-01-01

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  2. Inhibition of Ceramide De Novo Synthesis Ameliorates Diet Induced Skeletal Muscles Insulin Resistance

    PubMed Central

    Kurek, Krzysztof; Mikłosz, Agnieszka; Łukaszuk, Bartłomiej; Chabowski, Adrian; Górski, Jan; Żendzian-Piotrowska, Małgorzata

    2015-01-01

    Nowadays wrong nutritional habits and lack of physical activity give a rich soil for the development of insulin resistance and obesity. Many researches indicate lipids, especially the one from the sphingolipids class, as the group of molecules heavily implicated in the progress of insulin resistance in skeletal muscle. Recently, scientists have focused their scrutiny on myriocin, a potent chemical compound that inhibits ceramide (i.e., central hub of sphingolipids signaling pathway) de novo synthesis. In the present research we evaluated the effects of myriocin application on type 2 diabetes mellitus in three different types of skeletal muscles: (1) slow-oxidative (red gastrocnemius), (2) oxidative-glycolytic (soleus), and (3) glycolytic (white gastrocnemius). For these reasons the animals were randomly divided into four groups: “control” (C), “myriocin” (M), “high fat diet” (HFD), “high fat diet” (HFD), and “high fat diet + myriocin” (HFD + M). Our in vivo study demonstrated that ceramide synthesis inhibition reduces intramuscular ceramide, its precursor sphinganine, and its derivatives sphingosine and sphingosine-1-phosphate concentrations. Moreover, FFA and TG contents were also decreased after myriocin treatment. Thus, myriocin presents potential therapeutic perspectives with respect to the treatment of insulin resistance and its serious consequences in obese patients. PMID:26380311

  3. Phytochrome-induced synthesis of ribonuclease de novo in lupin hypocotyl sections.

    PubMed

    Acton, G J; Schopfer, P

    1974-09-01

    1. Density-labelling with 99 atoms% of (2)H(2)O distinguished pre-existing from newly synthesized ribonuclease molecules in sections of developing hypocotyl tissue. 2. Activity profiles of enzyme extracted from the fraction pelletable at 100000g showed heterogeneity after isopycnic centrifugation in CsCl gradients. 3. Measurement of density shifts of the entire heterogeneous band shows that ribonuclease protein is synthesized de novo in both continuous far-red light and darkness. 4. A twofold increase in enzyme activity after irradiation was accompanied by band-broadening and a significantly faster rate of labelling than in darkness. 5. The conclusion is drawn from the experimental evidence and theoretical arguments presented that phytochrome regulates the synthesis of new enzyme molecules against a background of continuous (dark-rate) synthesis and degradation. 6. Further information has been deposited as Supplementary Publication SUP 50033 (3 pages) at the British Library Lending Division (formerly the National Lending Library for Science and Technology), Boston Spa, Yorks. LS23 7BQ, U.K., from whom copies can be obtained on the terms indicated in Biochem. J. (1973), 131, 5. PMID:4464836

  4. Effects of Asterias amurensis-derived Sphingoid Bases on the de novo Ceramide Synthesis in Cultured Normal Human Epidermal Keratinocytes.

    PubMed

    Mikami, Daisuke; Sakai, Shota; Sasaki, Shigefumi; Igarashi, Yasuyuki

    2016-08-01

    Asterias amurensis starfish provide several bioactive species in addition to being fishery waste. Glucosyl ceramides (GlcCers) were extracted from the viscera of these starfish and were isolated by silica gel column chromatography. Degraded GlcCers generated A. amurensis sphingoid bases (ASBs) that mainly consisted of the triene-type bases d18:3 and 9-methyl-d18:3. The effect of these bases on ceramide synthesis and content were analyzed using normal human epidermal keratinocytes (NHEKs). The bases significantly enhanced the de novo ceramide synthesis and gene expression in NHEKs for proteins, such as serine-palmitoyltransferase and ceramide synthase. Total ceramide, GlcCer, and sphingomyelin contents increased dramatically upon ASB treatment. In particular, GlcCer bearing very-long-chain fatty acids (≥C28) exhibited a significant content increase. These ASB-induced enhancements on de novo ceramide synthesis were only observed in undifferentiated NHEKs. This stimulation of the de novo sphingolipid synthesis may improve skin barrier functions. PMID:27430385

  5. Requirement of de novo synthesis of the OdhI protein in penicillin-induced glutamate production by Corynebacterium glutamicum.

    PubMed

    Kim, Jongpill; Fukuda, Hirohisa; Hirasawa, Takashi; Nagahisa, Keisuke; Nagai, Kazuo; Wachi, Masaaki; Shimizu, Hiroshi

    2010-04-01

    We found that penicillin-induced glutamate production by Corynebacterium glutamicum is inhibited when a de novo protein synthesis inhibitor, chloramphenicol, is added simultaneously with penicillin. When chloramphenicol was added 4 h after penicillin addition, glutamate production was essentially unaffected. (3)H-Leucine incorporation experiments revealed that protein synthesis continued for 1 h after penicillin addition and then gradually decreased. These results suggest that de novo protein synthesis within 4 h of penicillin treatment is required for the induction of glutamate production. To identify the protein(s) necessary for penicillin-induced glutamate production, proteome analysis of penicillin-treated C. glutamicum cells was performed with two-dimensional gel electrophoresis. Of more than 500 proteins detected, the amount of 13 proteins, including OdhI (an inhibitory protein for 2-oxoglutarate dehydrogenase complex), significantly increased upon penicillin treatment. Artificial overexpression of the odhI gene resulted in the decreased specific activity of the 2-oxoglutarate dehydrogenase complex and increased glutamate production without any triggers. These results suggest that the de novo synthesis of OdhI is the necessary factor for penicillin-induced glutamate overproduction by C. glutamicum. Moreover, continuous glutamate production was achieved by overexpression of odhI without any triggers. Thus, the odhI-overexpressing strain of C. glutamicum can be useful for efficient glutamate production. PMID:19956942

  6. Negative regulation of DNMT3A de novo DNA methylation by frequently overexpressed UHRF family proteins as a mechanism for widespread DNA hypomethylation in cancer

    PubMed Central

    Jia, Yuanhui; Li, Pishun; Fang, Lan; Zhu, Haijun; Xu, Liangliang; Cheng, Hao; Zhang, Junying; Li, Fei; Feng, Yan; Li, Yan; Li, Jialun; Wang, Ruiping; Du, James X; Li, Jiwen; Chen, Taiping; Ji, Hongbin; Han, Jackie; Yu, Wenqiang; Wu, Qihan; Wong, Jiemin

    2016-01-01

    Global DNA hypomethylation is a most common epigenetic alteration in cancer, but the mechanism remains elusive. Previous studies demonstrate that UHRF1 but not UHRF2 is required for mediating DNA maintenance methylation by DNMT1. Here we report unexpectedly a conserved function for UHRF1 and UHRF2: inhibiting de novo DNA methylation by functioning as E3 ligases promoting DNMT3A degradation. UHRF1/2 are frequently overexpressed in cancers and we present evidence that UHRF1/2 overexpression downregulates DNMT3A proteins and consequently leads to DNA hypomethylation. Abrogating this negative regulation on DNMT3A or overexpression of DNMT3A leads to increased DNA methylation and impaired tumor growth. We propose a working model that UHRF1/2 safeguards the fidelity of DNA methylation and suggests that UHRF1/2 overexpression is likely a causal factor for widespread DNA hypomethylation in cancer via suppressing DNMT3A. PMID:27462454

  7. Olefin cross metathesis based de novo synthesis of a partially protected L-amicetose and a fully protected L-cinerulose derivative

    PubMed Central

    Hauke, Sylvia

    2014-01-01

    Summary Cross metathesis of a lactate derived allylic alcohol and acrolein is the entry point to a de novo synthesis of 4-benzoate protected L-amicetose and a cinerulose derivative protected at C5 and C1. PMID:24991253

  8. De novo synthesis and properties of analogues of the self-assembling chlorosomal bacteriochlorophylls

    SciTech Connect

    Mass, Olga; Pandithavidana, Dinesh R.; Ptaszek, Marcin; Santiago, Koraliz; Springer, Joseph W.; Jiao, Jieying; Tang, Qun; Kirmaier, Christine; Bocian, David F.; Holten, Dewey; Lindsey, Jonathan S.

    2011-01-01

    Natural photosynthetic pigments bacteriochlorophyllsc, d and e in green bacteria undergo self-assembly to create an organized antenna system known as the chlorosome, which collects photons and funnels the resulting excitation energy toward the reaction centers. Mimicry of chlorosome function is a central problem in supramolecular chemistry and artificial photosynthesis, and may have relevance for the design of photosynthesis-inspired solar cells. The main challenge in preparing artificial chlorosomes remains the synthesis of the appropriate pigment (chlorin) equipped with a set of functional groups suitable to direct the assembly and assure efficient energy transfer. Prior approaches have entailed derivatization of porphyrins or semisynthesis beginning with chlorophylls. This paper reports a third approach, the de novo synthesis of macrocycles that contain the same hydrocarbon skeleton as chlorosomal bacteriochlorophylls. The synthesis here of Zn(II) 3-(1-hydroxyethyl)-10-aryl-13¹-oxophorbines (the aryl group consists of phenyl, mesityl, or pentafluorophenyl) entails selective bromination of a 3,13-diacetyl-10-arylchlorin, palladium-catalyzed 13¹-oxophorbine formation, and selective reduction of the 3-acetyl group using BH₃·tBuNH₂. Each macrocycle contains a geminal dimethyl group in the pyrroline ring to provide stability toward adventitious dehydrogenation. A Zn(II) 7-(1-hydroxyethyl)-10-phenyl-17-oxochlorin also has been prepared. Altogether, 30 new hydroporphyrins were synthesized. The UV-Vis absorption spectra of the new chlorosomal bacteriochlorophyll mimics reveal a bathochromic shift of [similar]1800 cm-1 of the Qy band in nonpolar solvent, indicating extensive assembly in solution. The Zn(II) 3-(1-hydroxyethyl)-10-aryl-13¹-oxophorbines differ in the propensity to form assemblies based on the 10-substituent in the following order: mesityl

  9. De novo reconstruction of consensus master genomes of plant RNA and DNA viruses from siRNAs.

    PubMed

    Seguin, Jonathan; Rajeswaran, Rajendran; Malpica-López, Nachelli; Martin, Robert R; Kasschau, Kristin; Dolja, Valerian V; Otten, Patricia; Farinelli, Laurent; Pooggin, Mikhail M

    2014-01-01

    Virus-infected plants accumulate abundant, 21-24 nucleotide viral siRNAs which are generated by the evolutionary conserved RNA interference (RNAi) machinery that regulates gene expression and defends against invasive nucleic acids. Here we show that, similar to RNA viruses, the entire genome sequences of DNA viruses are densely covered with siRNAs in both sense and antisense orientations. This implies pervasive transcription of both coding and non-coding viral DNA in the nucleus, which generates double-stranded RNA precursors of viral siRNAs. Consistent with our finding and hypothesis, we demonstrate that the complete genomes of DNA viruses from Caulimoviridae and Geminiviridae families can be reconstructed by deep sequencing and de novo assembly of viral siRNAs using bioinformatics tools. Furthermore, we prove that this 'siRNA omics' approach can be used for reliable identification of the consensus master genome and its microvariants in viral quasispecies. Finally, we utilized this approach to reconstruct an emerging DNA virus and two viroids associated with economically-important red blotch disease of grapevine, and to rapidly generate a biologically-active clone representing the wild type master genome of Oilseed rape mosaic virus. Our findings show that deep siRNA sequencing allows for de novo reconstruction of any DNA or RNA virus genome and its microvariants, making it suitable for universal characterization of evolving viral quasispecies as well as for studying the mechanisms of siRNA biogenesis and RNAi-based antiviral defense. PMID:24523907

  10. De Novo Reconstruction of Consensus Master Genomes of Plant RNA and DNA Viruses from siRNAs

    PubMed Central

    Seguin, Jonathan; Rajeswaran, Rajendran; Malpica-López, Nachelli; Martin, Robert R.; Kasschau, Kristin; Dolja, Valerian V.; Otten, Patricia; Farinelli, Laurent; Pooggin, Mikhail M.

    2014-01-01

    Virus-infected plants accumulate abundant, 21–24 nucleotide viral siRNAs which are generated by the evolutionary conserved RNA interference (RNAi) machinery that regulates gene expression and defends against invasive nucleic acids. Here we show that, similar to RNA viruses, the entire genome sequences of DNA viruses are densely covered with siRNAs in both sense and antisense orientations. This implies pervasive transcription of both coding and non-coding viral DNA in the nucleus, which generates double-stranded RNA precursors of viral siRNAs. Consistent with our finding and hypothesis, we demonstrate that the complete genomes of DNA viruses from Caulimoviridae and Geminiviridae families can be reconstructed by deep sequencing and de novo assembly of viral siRNAs using bioinformatics tools. Furthermore, we prove that this ‘siRNA omics’ approach can be used for reliable identification of the consensus master genome and its microvariants in viral quasispecies. Finally, we utilized this approach to reconstruct an emerging DNA virus and two viroids associated with economically-important red blotch disease of grapevine, and to rapidly generate a biologically-active clone representing the wild type master genome of Oilseed rape mosaic virus. Our findings show that deep siRNA sequencing allows for de novo reconstruction of any DNA or RNA virus genome and its microvariants, making it suitable for universal characterization of evolving viral quasispecies as well as for studying the mechanisms of siRNA biogenesis and RNAi-based antiviral defense. PMID:24523907

  11. Matrix effects on the de novo synthesis of polychlorinated dibenzo-p-dioxins, dibenzofurans, biphenyls and benzenes.

    PubMed

    Pekárek, Vladimír; Weber, Roland; Grabic, Roman; Solcová, Olga; Fiserová, Eva; Syc, Michal; Karban, Jindrich

    2007-05-01

    The formation of polychlorinated dibenzo-p-dioxins, dibenzofurans, biphenyls and benzenes in de novo synthesis experiments have been studied on model fly ashes with a wide range of matrices. The model fly ash consisted of 18 selected matrices with the addition of CuCl(2) x 2H(2)O, activated charcoal and NaCl. The studied matrices were not restricted to the commonly investigated matrices with defined chemical composition (silica gel, alumina, florisil) and industrially produced adsorbents with silicate structures (diatomaceous earths), but also included natural occurring matrices (clays, kaolin, bentonite and feldspars). In addition fly ashes from a hazardous waste incinerator were included in the study for comparison. Differences in the isomer composition (homologue profiles and isomer patterns) of the substances formed by de novo synthesis experiments are discussed in dependence on the chemical composition of the studied matrices. The de novo synthesis experiments on matrices with silicate structures resulted in high concentration of mainly perchlorinated aromatic compounds while for other matrices in particular alkaline matrices a homologue shift to lower chlorinated homologues and lower formation rates were found. The paper discusses the resulting PCDD/PCDF pattern and compares them to the PCDD/PCDF profile found in naturally occurring kaolin and ball clay (illite). PMID:17291561

  12. Involvement of de novo ceramide synthesis in pro-inflammatory adipokine secretion and adipocyte-macrophage interaction.

    PubMed

    Hamada, Yoji; Nagasaki, Hiroshi; Fujiya, Atsushi; Seino, Yusuke; Shang, Qing-Long; Suzuki, Takeshi; Hashimoto, Hiroyuki; Oiso, Yutaka

    2014-12-01

    Interaction between adipocytes and macrophages has been suggested to play a central role in the pathogenesis of obesity. Ceramide, a sphingolipid de novo synthesized from palmitate, is known to stimulate pro-inflammatory cytokine secretion from multiple types of cells. To clarify whether de novo synthesized ceramide contributes to cytokine dysregulation in adipocytes and macrophages, we observed cytokine secretion in mature 3T3-L1 adipocytes (L1) and RAW264.7 macrophages (RAW) cultured alone or co-cultured under the suppression of de novo ceramide synthesis. Palmitate enhanced ceramide accumulation and stimulated the expression and secretion of interleukin-6 (IL-6) and monocyte chemoattractant protein-1 (MCP-1) in L1. The suppression of serine-palmitoyl transferase, a rate-limiting enzyme of de novo ceramide synthesis, by myriocin or siRNA attenuated those palmitate-induced alterations, and a ceramide synthase inhibitor fumonisin B1 showed similar results. In contrast, the inhibitor of sphingosine kinase or a membrane-permeable ceramide analogue augmented the cytokine secretion. Myriocin effects on the palmitate-induced changes were not abrogated by toll-like receptor-4 blockade. Although palmitate stimulated RAW to secrete tumor necrosis factor-α (TNF-α), it did not significantly increase ceramide content, and neither myriocin nor fumonisin B1 attenuated the TNF-α hypersecretion. The co-culture of L1 with RAW markedly augmented IL-6 and MCP-1 levels in media. Myriocin or fumonisin B1 significantly lowered these cytokine levels and suppressed the gene expression of TNF-α and MCP-1 in RAW and of IL-6 and MCP-1 in L1. In conclusion, de novo synthesized ceramide partially mediates the palmitate effects on pro-inflammatory adipokines and is possibly involved in the interaction with macrophages. PMID:25283329

  13. Continuous Histone Replacement by Hira Is Essential for Normal Transcriptional Regulation and De Novo DNA Methylation during Mouse Oogenesis

    PubMed Central

    Nashun, Buhe; Hill, Peter W.S.; Smallwood, Sebastien A.; Dharmalingam, Gopuraja; Amouroux, Rachel; Clark, Stephen J.; Sharma, Vineet; Ndjetehe, Elodie; Pelczar, Pawel; Festenstein, Richard J.; Kelsey, Gavin; Hajkova, Petra

    2015-01-01

    Summary The integrity of chromatin, which provides a dynamic template for all DNA-related processes in eukaryotes, is maintained through replication-dependent and -independent assembly pathways. To address the role of histone deposition in the absence of DNA replication, we deleted the H3.3 chaperone Hira in developing mouse oocytes. We show that chromatin of non-replicative developing oocytes is dynamic and that lack of continuous H3.3/H4 deposition alters chromatin structure, resulting in increased DNase I sensitivity, the accumulation of DNA damage, and a severe fertility phenotype. On the molecular level, abnormal chromatin structure leads to a dramatic decrease in the dynamic range of gene expression, the appearance of spurious transcripts, and inefficient de novo DNA methylation. Our study thus unequivocally shows the importance of continuous histone replacement and chromatin homeostasis for transcriptional regulation and normal developmental progression in a non-replicative system in vivo. PMID:26549683

  14. Synthesis and Characterization of Metal-Organic Frameworks (MOFs) That Are Difficult to Access De Novo

    NASA Astrophysics Data System (ADS)

    Karagiaridi, Olga

    Metal-organic frameworks (MOFs) are a class of intriguing hybrid materials, comprised of metal-based nodes joined by organic linkers into a crystalline, porous, three-dimensional lattice. Their signature properties (well-defined surfaces, tailorability and ultra-high porosity) render them promising candidates for many applications, including, but not limited to, gas storage, gas separation, catalysis and sensing. One of the greatest challenges associated with MOF synthesis lies in the fact that obtaining a desired MOF structure that is tailored to perform a specific application is often not trivial. Traditional synthetic pathways termed "de novo synthesis" (typically one-pot reactions between the MOF structural building blocks under solvothermal conditions) often give rise to side products that do not possess the desired structure. To circumvent this problem, we have studied in depth two powerful MOF synthetic techniques -- solvent-assisted linker exchange (SALE) and transmetalation. These are heterogeneous reactions of parent MOF crystals with concentrated solutions of organic linkers and inorganic metal salts, respectively, that lead to the replacement of the linkers or metal nodes within the parent MOFs by the desired components, while the overall framework topology is preserved. The projects described in this dissertation have aimed to apply these techniques to transform simple (unfunctionalized) and easy to synthesize representative materials from various MOF systems to structurally and functionally interesting daughter products. Examples include synthesis of MOFs that are energetically "unfavorable", extension of MOF cages by longer linker incorporation, functionalization of MOF pores and endowment of MOFs with permanent and persistent porosity. Through these projects, we have been able to formulate a set of rules that can be applied to predict the successful outcome of SALE. Since the allure of MOFs lies in their applications, expanding the range of

  15. De novo sequencing of sunflower genome for SNP discovery using RAD (Restriction site Associated DNA) approach

    PubMed Central

    2013-01-01

    Background Application of Single Nucleotide Polymorphism (SNP) marker technology as a tool in sunflower breeding programs offers enormous potential to improve sunflower genetics, and facilitate faster release of sunflower hybrids to the market place. Through a National Sunflower Association (NSA) funded initiative, we report on the process of SNP discovery through reductive genome sequencing and local assembly of six diverse sunflower inbred lines that represent oil as well as confection types. Results A combination of Restriction site Associated DNA Sequencing (RAD-Seq) protocols and Illumina paired-end sequencing chemistry generated high quality 89.4 M paired end reads from the six lines which represent 5.3 GB of the sequencing data. Raw reads from the sunflower line, RHA 464 were assembled de novo to serve as a framework reference genome. About 15.2 Mb of sunflower genome distributed over 42,267 contigs were obtained upon assembly of RHA 464 sequencing data, the contig lengths ranged from 200 to 950 bp with an N50 length of 393 bp. SNP calling was performed by aligning sequencing data from the six sunflower lines to the assembled reference RHA 464. On average, 1 SNP was located every 143 bp of the sunflower genome sequence. Based on several filtering criteria, a final set of 16,467 putative sequence variants with characteristics favorable for Illumina Infinium Genotyping Technology (IGT) were mined from the sequence data generated across six diverse sunflower lines. Conclusion Here we report the molecular and computational methodology involved in SNP development for a complex genome like sunflower lacking reference assembly, offering an attractive tool for molecular breeding purposes in sunflower. PMID:23947483

  16. De novo assembly of the carrot mitochondrial genome using next generation sequencing of whole genomic DNA provides first evidence of DNA transfer into an angiosperm plastid genome

    PubMed Central

    2012-01-01

    Background Sequence analysis of organelle genomes has revealed important aspects of plant cell evolution. The scope of this study was to develop an approach for de novo assembly of the carrot mitochondrial genome using next generation sequence data from total genomic DNA. Results Sequencing data from a carrot 454 whole genome library were used to develop a de novo assembly of the mitochondrial genome. Development of a new bioinformatic tool allowed visualizing contig connections and elucidation of the de novo assembly. Southern hybridization demonstrated recombination across two large repeats. Genome annotation allowed identification of 44 protein coding genes, three rRNA and 17 tRNA. Identification of the plastid genome sequence allowed organelle genome comparison. Mitochondrial intergenic sequence analysis allowed detection of a fragment of DNA specific to the carrot plastid genome. PCR amplification and sequence analysis across different Apiaceae species revealed consistent conservation of this fragment in the mitochondrial genomes and an insertion in Daucus plastid genomes, giving evidence of a mitochondrial to plastid transfer of DNA. Sequence similarity with a retrotransposon element suggests a possibility that a transposon-like event transferred this sequence into the plastid genome. Conclusions This study confirmed that whole genome sequencing is a practical approach for de novo assembly of higher plant mitochondrial genomes. In addition, a new aspect of intercompartmental genome interaction was reported providing the first evidence for DNA transfer into an angiosperm plastid genome. The approach used here could be used more broadly to sequence and assemble mitochondrial genomes of diverse species. This information will allow us to better understand intercompartmental interactions and cell evolution. PMID:22548759

  17. Initiator RNA in Discontinuous Polyoma DNA Synthesis*

    PubMed Central

    Reichard, Peter; Eliasson, Rolf; Söderman, Gunilla

    1974-01-01

    During replication of polyoma DNA in isolated nuclei, RNA was found attached to the 5′ ends of growing progeny strands. This RNA starts with either ATP or GTP and can be labeled at its 5′ end with 32P from β-labeled nucleotides. Digestion of progeny strands with pancreatic DNase released 32P-labeled RNA that, on gel electrophoresis, gave a distinct peak in the position expected for a decanucleotide. We believe that this short RNA is involved in the initiation of the discontinuous synthesis of DNA and propose the name “initiator RNA” for it. The covalent linkage of initiator RNA to 5′ ends of growing DNA chains was substantiated by the finding that 32P was transferred to ribonucleotides by alkaline hydrolysis of purified initiator RNA obtained by DNase digestion of polyoma progeny strands synthesized from [α-32P]dTTP. While initiator RNA was quite homogeneous in size, it had no unique base sequence since digestion with pancreatic RNase of initiator RNA labeled at its 5′ end with 32P released a variety of different [32P]oligonucleotides. The switch from RNA to DNA synthesis during strand elongation may thus depend on the size of initiator RNA rather than on a specific base sequence. PMID:4373733

  18. Tumor suppressor gene inactivation during cadmium-induced malignant transformation of human prostate cells correlates with overexpression of de Novo DNA methyltransferase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aberrant DNA methylation is common in carcinogenesis. The typical pattern appears to involve reduced expression of maintenance DNA methyltransferase, DNMT1, inducing genomic hypomethylation, whereas increased expression of de novo DNMT3a or 3b causes gene-specific hypermethylation. During cadmium-in...

  19. De novo synthesis of estrogen in pregnant uterus is critical for stromal decidualization and angiogenesis.

    PubMed

    Das, Amrita; Mantena, Srinivasa Raju; Kannan, Athilakshmi; Evans, Dean B; Bagchi, Milan K; Bagchi, Indrani C

    2009-07-28

    Implantation is initiated when the embryo attaches to the uterine luminal epithelium during early pregnancy. Following this event, uterine stromal cells undergo steroid hormone-dependent transformation into morphologically and functionally distinct decidual cells in a unique process known as decidualization. An angiogenic network is also formed in the uterine stromal bed, critically supporting the early development of the embryo. The steroid-induced mechanisms that promote stromal differentiation and endothelial proliferation during decidualization are not fully understood. Although the role of ovarian progesterone as a key regulator of decidualization is well established, the requirement of ovarian estrogen (E) during this process remains unresolved. Here we show that the expression of P450 aromatase, a key enzyme that converts androgens to E, is markedly induced in mouse uterine stromal cells undergoing decidualization. The aromatase then acts in conjunction with other steroid biosynthetic enzymes present in the decidual tissue to support de novo synthesis of E. This locally produced E is able to support the advancement of the stromal differentiation program even in the absence ovarian E in an ovariectomized, progesterone-supplemented pregnant mouse model. Administration of letrozole, a specific aromatase inhibitor, to these mice blocked the stromal differentiation process. Gene expression profiling further revealed that the intrauterine E induces the expression of several stromal factors that promote neovascularization in the decidual tissue. Collectively, these studies identified the decidual uterus as a novel site of E biosynthesis and uncovered E-regulated maternal signaling pathways that critically control uterine differentiation and angiogenesis during early pregnancy. PMID:19620711

  20. DNA Nanoparticles for Improved Protein Synthesis In Vitro

    PubMed Central

    Galinis, Robertas; Stonyte, Greta; Kiseliovas, Vaidotas; Zilionis, Rapolas; Studer, Sabine; Hilvert, Donald; Janulaitis, Arvydas

    2016-01-01

    Abstract The amplification and digital quantification of single DNA molecules are important in biomedicine and diagnostics. Beyond quantifying DNA molecules in a sample, the ability to express proteins from the amplified DNA would open even broader applications in synthetic biology, directed evolution, and proteomics. Herein, a microfluidic approach is reported for the production of condensed DNA nanoparticles that can serve as efficient templates for in vitro protein synthesis. Using phi29 DNA polymerase and a multiple displacement amplification reaction, single DNA molecules were converted into DNA nanoparticles containing up to about 104 clonal gene copies of the starting template. DNA nanoparticle formation was triggered by accumulation of inorganic pyrophosphate (produced during DNA synthesis) and magnesium ions from the buffer. Transcription–translation reactions performed in vitro showed that individual DNA nanoparticles can serve as efficient templates for protein synthesis in vitro. PMID:26821778

  1. Chromatin inactivation precedes de novo dna methylation during the progressive epigenetic silencing of the rassf1a promoter

    SciTech Connect

    Strunnikova Maria; Schagdarsurengin, Undraga; Kehlen, Astrid; Garbe, James C.; Stampfer, Martha R.; Dammann, Reinhard

    2005-02-23

    Epigenetic inactivation of the RASSF1A tumor suppressor by CpG island methylation was frequently detected in cancer. However, the mechanisms of this aberrant DNA methylation are unknown. In the RASSF1A promoter, we characterized four Sp1 sites, which are frequently methylated in cancer. We examined the functional relationship between DNA methylation, histone modification, Sp1 binding, and RASSF1A expression in proliferating human mammary epithelial cells. With increasing passages, the transcription of RASSF1A was dramatically silenced. This inactivation was associated with deacetylation and lysine 9 trimethylation of histone H3 and an impaired binding of Sp1 at the RASSF1A promoter. In mammary epithelial cells that had overcome a stress-associated senescence barrier, a spreading of DNA methylation in the CpG island promoter was observed. When the RASSF1A-silenced cells were treated with inhibitors of DNA methyltransferase and histone deacetylase, binding of Sp1 and expression of RASSF1 A reoccurred. In summary, we observed that histone H3 deacetylation and H3 lysine 9 trimethylation occur in the same time window as gene inactivation and precede DNA methylation. Our data suggest that in epithelial cells, histone inactivation may trigger de novo DNA methylation of the RASSF1A promoter and this system may serve as a model for CpG island inactivation of tumor suppressor genes.

  2. Low relative humidity triggers RNA-directed de novo DNA methylation and suppression of genes controlling stomatal development

    PubMed Central

    Tricker, Penny J.; Gibbings, J. George; Rodríguez López, Carlos M.; Hadley, Paul; Wilkinson, Mike J.

    2012-01-01

    Environmental cues influence the development of stomata on the leaf epidermis, and allow plants to exert plasticity in leaf stomatal abundance in response to the prevailing growing conditions. It is reported that Arabidopsis thaliana ‘Landsberg erecta’ plants grown under low relative humidity have a reduced stomatal index and that two genes in the stomatal development pathway, SPEECHLESS and FAMA, become de novo cytosine methylated and transcriptionally repressed. These environmentally-induced epigenetic responses were abolished in mutants lacking the capacity for de novo DNA methylation, for the maintenance of CG methylation, and in mutants for the production of short-interfering non-coding RNAs (siRNAs) in the RNA-directed DNA methylation pathway. Induction of methylation was quantitatively related to the induction of local siRNAs under low relative humidity. Our results indicate the involvement of both transcriptional and post-transcriptional gene suppression at these loci in response to environmental stress. Thus, in a physiologically important pathway, a targeted epigenetic response to a specific environmental stress is reported and several of its molecular, mechanistic components are described, providing a tractable platform for future epigenetics experiments. Our findings suggest epigenetic regulation of stomatal development that allows for anatomical and phenotypic plasticity, and may help to explain at least some of the plant’s resilience to fluctuating relative humidity. PMID:22442411

  3. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  4. Modulation of the equilibrative nucleoside transporter by inhibitors of DNA synthesis.

    PubMed Central

    Pressacco, J.; Wiley, J. S.; Jamieson, G. P.; Erlichman, C.; Hedley, D. W.

    1995-01-01

    Expression of the equilibrative, S-(p-nitrobenzyl)-6-thioinosine (NBMPR)-sensitive nucleoside transporter (es), a component of the nucleoside salvage pathway, was measured during unperturbed growth and following exposure to various antimetabolites at growth-inhibitory concentrations. The probe 5-(SAENTA-x8)-fluorescein is a highly modified form of adenosine incorporating a fluorescein molecule. It binds. with high affinity and specificity to the (es) nucleoside transporter at a 1:1 stoichiometry, allowing reliable estimates of es expression by flow cytometry. Using a dual labelling technique which combined the vital DNA dye Hoechst-33342 and 5-(SAENTA-x8)-fluorescein, we found that surface expression of es approximately doubled between G1 and G2 + M phases of the cell cycle. To address the question of whether es expression could be modulated in cells exposed to drugs which inhibit de novo synthesis of nucleotides, cells were exposed to antimetabolite drugs having different modes of action. Hydroxyurea and 5-fluorouracil (5-FU), which inhibit the de novo synthesis of DNA precursors, produced increases in the expression of es. In contrast, cytosine arabinoside (ara-C) and aphidicolin, which directly inhibit DNA synthesis, produced no significant increase in es expression. Thymidine (TdR), which is an allosteric inhibitor of ribonucleotide reductase that depletes dATP, dCTP and dGTP pools while repleting the dTTP pool, had no significant effect on es expression. These data suggest that surface expression of the es nucleoside transporter is regulated by a mechanism which is sensitive to the supply of deoxynucleotides. Because 5-FU (which specifically depletes dTTP pools) causes a large increase in expression whereas TdR (which depletes all precursors except dTTP) does not, this mechanism might be particularly sensitive to dTTP pools. PMID:7547244

  5. Leuconostoc citreum SK24.002 glucansucrase: Biochemical characterisation and de novo synthesis of α-glucan.

    PubMed

    Song, Liping; Miao, Ming; Jiang, Bo; Xu, Ting; Cui, Steve W; Zhang, Tao

    2016-10-01

    The cell-associated glucansucrase from Leuconostoc citreum SK24.002 was isolated, purified, characterized and used for de novo synthesis of α-glucan and acceptor-products. The final specific glucansucrase activity was 1.4U/mg protein with 13.2-fold purification. The obtained glucansucrase had a molecular weight of 186kDa,Tm of 61.7 °C and △H of 176.7kJ/mol. The enzyme showed maximum activity at pH 5.0-6.0 and 45°C. The enzyme activity was enhanced by Ca(2+), Mn(2+) or Co(2+) ions, whereas the activity decreased as the methanol, ethanol, n-butanol, DMSO or isopropanol concentration increased. The chemical inhibitors including BD, DTNB, EDC or NBS also significantly inhibited enzyme activity. Km, Vmax and kcat of glucansucrase were 10.9mM, 3.6U/mg and 306.6 1/s, respectively. For de novo synthesis from sucrose, α-glucan polymer with molecular weight of 1.5×10(7)g/mol and maltose acceptor products (trisaccharide, tetrasaccharide and pentasaccharide) were obtained by glucansucrase via glucosyltransfer reactions, respectively. PMID:27164499

  6. SNP discovery through de novo deep sequencing using the next generation of DNA sequencers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The production of high volumes of DNA sequence data using new technologies has permitted more efficient identification of single nucleotide polymorphisms in vertebrate genomes. This chapter presented practical methodology for production and analysis of DNA sequence data for SNP discovery....

  7. Synthesis of Mitochondrial DNA Precursors during Myogenesis, an Analysis in Purified C2C12 Myotubes*

    PubMed Central

    Frangini, Miriam; Franzolin, Elisa; Chemello, Francesco; Laveder, Paolo; Romualdi, Chiara; Bianchi, Vera; Rampazzo, Chiara

    2013-01-01

    During myogenesis, myoblasts fuse into multinucleated myotubes that acquire the contractile fibrils and accessory structures typical of striated skeletal muscle fibers. To support the high energy requirements of muscle contraction, myogenesis entails an increase in mitochondrial (mt) mass with stimulation of mtDNA synthesis and consumption of DNA precursors (dNTPs). Myotubes are quiescent cells and as such down-regulate dNTP production despite a high demand for dNTPs. Although myogenesis has been studied extensively, changes in dNTP metabolism have not been examined specifically. In differentiating cultures of C2C12 myoblasts and purified myotubes, we analyzed expression and activities of enzymes of dNTP biosynthesis, dNTP pools, and the expansion of mtDNA. Myotubes exibited pronounced post-mitotic modifications of dNTP synthesis with a particularly marked down-regulation of de novo thymidylate synthesis. Expression profiling revealed the same pattern of enzyme down-regulation in adult murine muscles. The mtDNA increased steadily after myoblast fusion, turning over rapidly, as revealed after treatment with ethidium bromide. We individually down-regulated p53R2 ribonucleotide reductase, thymidine kinase 2, and deoxyguanosine kinase by siRNA transfection to examine how a further reduction of these synthetic enzymes impacted myotube development. Silencing of p53R2 had little effect, but silencing of either mt kinase caused 50% mtDNA depletion and an unexpected decrease of all four dNTP pools independently of the kinase specificity. We suggest that during development of myotubes the shortage of even a single dNTP may affect all four pools through dysregulation of ribonucleotide reduction and/or dissipation of the non-limiting dNTPs during unproductive elongation of new DNA chains. PMID:23297407

  8. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    PubMed

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  9. Differential effects of pertussis toxin on insulin-stimulated phosphatidylcholine hydrolysis and glycerolipid synthesis de novo. Studies in BC3H-1 myocytes and rat adipocytes

    SciTech Connect

    Hoffman, J.M.; Standaert, M.L.; Nair, G.P.; Farese, R.V. )

    1991-04-02

    Insulin-induced increases in diacylglycerol (DAG) have been suggested to result from stimulation of de novo phosphatidic acid (PA) synthesis and phosphatidylcholine (PC) hydrolysis. Presently, the authors found that insulin decreased PC levels of BC3H-1 myocytes and rat adipocytes by approximately 10-25% within 30 s. These decreases were rapidly reversed in both cell types, apparently because of increased PC synthesis de novo. In BC3H-1 myocytes, pertussis toxin inhibited PC resynthesis and insulin effects on the pathway of de novo PA-DAG-PC synthesis, as evidenced by changes in ({sup 3}H)glycerol incorporation, but did not inhibit insulin-stimulated PC hydrolysis. Pertussis toxin also blocked the later, but not the initial, increase in DAG production in the myocytes. Phorbol esters activated PC hydrolysis in both myocytes and adipocytes, but insulin-induced stimulation of PC hydrolysis was not dependent upon activation of PKC, since this hydrolysis was not inhibited by 500 {mu}M sangivamycin, an effective PKC inhibitor. The results indicate that insulin increases DAG by pertussis toxin sensitive and insensitive (PC hydrolysis) mechanisms, which are mechanistically separate, but functionally interdependent and integrated. PC hydrolysis may contribute importantly to initial increases in DAG, but later sustained increases are apparently largely dependent on insulin-induced stimulation of the pathway of de novo phospholipid synthesis.

  10. De Novo Asymmetric Synthesis of a 6-O-Methyl-d-glycero-l-gluco-heptopyranose-Derived Thioglycoside for the Preparation of Campylobacter jejuni NCTC11168 Capsular Polysaccharide Fragments.

    PubMed

    Ashmus, Roger A; Jayasuriya, Anushka B; Lim, Ying-Jie; O'Doherty, George A; Lowary, Todd L

    2016-04-01

    An enantioselective de novo synthesis of a thioglycoside derivative of the 6-O-methyl-d-glycero-l-gluco-heptopyranose residue found in the Campylobacter jejuni NCTC11168 (HS:2) capsular polysaccharide is reported. The compound is obtained from a furfural-derived chiral diol in 11 steps. Notably, compared to the only previous synthesis of this molecule, this approach significantly reduces the number of purification steps required to obtain the target. PMID:26982173

  11. Measuring DNA synthesis rates with [1-13C]glycine.

    PubMed

    Chen, P; Abramson, F P

    1998-05-01

    We have devised and evaluated a stable-isotopic method for measuring DNA synthesis rates. The probe is [1-13C]-glycine that is incorporated into purines via de novo biosynthesis. The human hepatoma cell line HEP G2 was grown in medium containing [1-13C]glycine, the cells were harvested at various times, and the DNA was extracted. Following hydrolysis to the nucleosides, a reversed-phase HPLC separation was used to provide separate peaks for deoxythymidine (dT), deoxyadenosine (dA), and deoxyguanosine (dG). The HPLC effluent was continuously fed into a chemical reaction interface and an isotope ratio mass spectrometer (HPLC/CRI/IRMS). The isotope ratio of the CO2 produced in the CRI was used to monitor for enrichment. The cells were grown continuously for 5 days in labeled medium and also in a 1-day pulse labeling experiment where the washout of label was observed for the subsequent 9 days. As predicted from the role of glycine in de novo purine biosynthesis, the isotope ratio of the pyrimidine dT did not change. However, for the two purines, dA and dG, the characteristic log growth behavior of the cells was observed in their 13C/12C ratios and good agreement in the doubling time was obtained for each type of experiment. Parallel experiments that measured the HEP G2 doubling time in culture using tritiated thymidine incorporation and direct cell counts were carried out compare to our new method with established ones. We believe that the use of [1-13C]-glycine and the HPLC/CRI/IRMS is a highly sensitive and selective approach that forms the basis of a method that can measure DNA synthesis rates using a nonradioactive, nontoxic tracer. PMID:9599574

  12. CDP-choline:alkylacetylglycerol cholinephosphotransferase catalyzes the final step in the de novo synthesis of platelet-activating factor.

    PubMed

    Snyder, F

    1997-09-01

    Platelet-activating factor (PAF) can be synthesized de novo or by a remodeling mechanism involving the sn-2 acyl moiety of alkylacylglycerophosphocholines, a membrane-bound precursor. The final step in the de novo pathway is catalyzed by a dithiothreitol-insensitive cholinephosphotransferase that utilizes 1-alkyl-2-acetyl-sn-glycerol and CDP-choline as substrates. This article reviews various studies concerning the occurrence, assay, subcellular location, biochemical properties, substrate specificity, and regulatory controls of the PAF-related cholinephosphotransferase. Alkylacetylglycerol cholinephosphotransferase, which is located on the cytoplasmic surface of the endoplasmic reticulum, is widely distributed among mammalian tissues. Both the alkyl and acyl analogs of radylacetylglycerol are utilized at equivalent rates. Optimal enzyme activity occurs at pH 8.0 and Mg2+ is required, whereas calcium, deoxycholate, ethanol, and centrophenoxine are inhibitory. Formation of CDP-choline by cytidylyltransferase appears to play a crucial role in the regulation of PAF produced via the cholinephosphotransferase route. Significant differences exist in the behavior of the cholinephosphotransferase activities responsible for the synthesis of PAF and phosphatidylcholine. However, neither enzyme activity has been purified or cloned and, therefore, it is unknown whether a single or two separate proteins are responsible for the observed catalytic activities that form these two distinctly different classes of phospholipids. PMID:9370322

  13. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  14. The hsp70 inhibitor VER155008 induces paraptosis requiring de novo protein synthesis in anaplastic thyroid carcinoma cells.

    PubMed

    Kim, Si Hyoung; Kang, Jun Goo; Kim, Chul Sik; Ihm, Sung-Hee; Choi, Moon Gi; Yoo, Hyung Joon; Lee, Seong Jin

    2014-11-01

    In this study, we evaluated the effect of the hsp70 inhibitor VER155008 on survival of anaplastic thyroid carcinoma (ATC) cells. In ATC cells, VER155008 increased the percentages of dead cells and vacuolated cells. VER155008 did not lead to the cleavage of caspase-3 protein regardless of pretreatment with z-VAD-fmk. VER155008 increased LC3-II protein levels but the protein levels were not changed by autophagy inhibitors. VER155008 caused the dilatation of endoplasmic reticulum (ER), and the increased mRNA levels of Bip and CHOP, suggesting paraptosis. VER155008-induced paraptosis was attenuated by pretreatment with cycloheximide. In conclusion, VER155008 induces paraptosis characterized by cytoplasmic vacuolation, independence of caspase, dilatation of ER and induction of ER stress markers in ATC cells. Moreover, VER155008-induced paraptosis requires de novo protein synthesis in ATC cells. PMID:25450359

  15. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  16. Function of DNA polymerase I in RNA-primed synthesis of bacteriophage M-13 duplex DNA.

    PubMed Central

    Schneck, P K; Staudenbauer, W L; Hofschneider, P H

    1976-01-01

    Cell-free extracts from Escherichia coli contain a DNA polymerase activity resistant to SH-blocking agents, which is capable of synthesizing complementary strand DNA on a circular M-13 DNA template by extension of RNA primers. This activity is considered to be identical with DNA polymerase I (or some altered form of this enzyme) since it is missing in extracts from po1A- cells. DNA synthesis in the presence of SH-blocking agents occurs at a reduced rate as compared to untreated controls and leads to the formation of DNA chains of defined size (0.4-0.5 genome's length). It is concluded that efficient M-13 duplex DNA synthesis requires the cooperation of both DNA polymerase I and III. PMID:1272793

  17. Mutagenesis in Oocytes of DROSOPHILA MELANOGASTER. I. Scheduled Synthesis of Nuclear and Mitochondrial DNA and Unscheduled DNA Synthesis

    PubMed Central

    Kelley, Mark R.; Lee, William R.

    1983-01-01

    As a model system for studying mutagenesis, the oocyte of Drosophila melanogaster has exhibited considerable complexity. Very few experiments have been conducted on the effect of exposing oocytes to chemical mutagens, presumably due to their lower mutational response relative to sperm and spermatids. This lower response may be due either to a change in probability of mutation induction per adduct due to a change in the type of DNA repair or to a lower dose of the mutagen to the female germ line. To study molecular dosimetry and DNA repair in the oocyte, the large number of intracellular constituents (mtDNA, RNA, nucleic acid precursors and large quantities of proteins and lipids) must be separated from nuclear DNA. In this paper we present results showing reliable separation of such molecules enabling us to detect scheduled nuclear and mitochondrial DNA synthesis. We also, by understanding the precise timing of such events, can detect unscheduled DNA synthesis (UDS) as a measure of DNA repair. Furthermore, by comparing the UDS results in a repair competent (Ore-R) vs. a repair deficient (mei-9L1 ) strain, we have shown the oocyte capable of DNA repair after treatment with ethyl methanesulfonate (EMS). We conclude that the important determinant of mutation induction in oocytes after treatment with EMS is the time interval between DNA alkylation and DNA synthesis after fertilization, i.e., the interruption of continuous DNA repair. PMID:17246137

  18. Steroid-mediated inhibition of cAMP induced de novo synthesis of cytochrome P-450/sub 17 / in Leydig cell cultures

    SciTech Connect

    Hales, D.B.; Sha, L.; Payne, A.H.

    1987-05-01

    The present study was designed to investigate the mechanism by which testosterone (T), produced during cAMP induction of P-450/sub 17 /, modulates the rate of its de novo synthesis. Purified Leydig cells (LC) were maintained in culture for 7 days prior to the initiation of treatment. De novo synthesis was determined by TVS-methionine incorporation, immunoprecipitation with specific antibody, separation by SDS-gel electrophoresis and quantitation by laser densitometry. Treatment of LC with 0.05 mM 8-Br-cAMP (cA) results in a time-dependent increase in the rate of de novo synthesis of P-450/sub 17 / which is increased 2 fold when T production is inhibited by aminoglutethimide (AG). The addition of increasing concentrations of the androgen receptor antagonist, hydroxyflutamide (1-10 M), to cA treated LC enhances the rate of synthesis similar to that seen in cA-treated LC in which T production was inhibited by AG. The addition of increasing concentrations of T (0.05-5 M) or the androgen agonist, mibolerone (1-5 M), to cA + AG treated LC causes a dose-dependent reversal of the AG-enhanced increase in the rate of cA-induced de novo synthesis of P-450/sub 17 /. Addition of estradiol (1 M) or dexamethasone (1 M) was without effect. These data indicate that T produced during cA induction of P-450/sub 17 / negatively regulates the rate of synthesis of this cytochrome P-450 enzyme by an androgen receptor mediated mechanism.

  19. De novo synthesis is the main source of ornithine for citrulline production in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Citrulline is an amino acid synthesized in the gut and utilized for the synthesis of the conditionally essential amino acid arginine. Recently, the origin of the ornithine utilized for citrulline synthesis has become a matter of discussion. Multiple physiological factors may have contributed to the ...

  20. Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

    PubMed

    Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full

  1. Analyte-driven switching of DNA charge transport: de novo creation of electronic sensors for an early lung cancer biomarker.

    PubMed

    Thomas, Jason M; Chakraborty, Banani; Sen, Dipankar; Yu, Hua-Zhong

    2012-08-22

    A general approach is described for the de novo design and construction of aptamer-based electrochemical biosensors, for potentially any analyte of interest (ranging from small ligands to biological macromolecules). As a demonstration of the approach, we report the rapid development of a made-to-order electronic sensor for a newly reported early biomarker for lung cancer (CTAP III/NAP2). The steps include the in vitro selection and characterization of DNA aptamer sequences, design and biochemical testing of wholly DNA sensor constructs, and translation to a functional electrode-bound sensor format. The working principle of this distinct class of electronic biosensors is the enhancement of DNA-mediated charge transport in response to analyte binding. We first verify such analyte-responsive charge transport switching in solution, using biochemical methods; successful sensor variants were then immobilized on gold electrodes. We show that using these sensor-modified electrodes, CTAP III/NAP2 can be detected with both high specificity and sensitivity (K(d) ~1 nM) through a direct electrochemical reading. To investigate the underlying basis of analyte binding-induced conductivity switching, we carried out Förster Resonance Energy Transfer (FRET) experiments. The FRET data establish that analyte binding-induced conductivity switching in these sensors results from very subtle structural/conformational changes, rather than large scale, global folding events. The implications of this finding are discussed with respect to possible charge transport switching mechanisms in electrode-bound sensors. Overall, the approach we describe here represents a unique design principle for aptamer-based electrochemical sensors; its application should enable rapid, on-demand access to a class of portable biosensors that offer robust, inexpensive, and operationally simplified alternatives to conventional antibody-based immunoassays. PMID:22835075

  2. A Hybrid Parallel Strategy Based on String Graph Theory to Improve De Novo DNA Assembly on the TianHe-2 Supercomputer.

    PubMed

    Zhang, Feng; Liao, Xiangke; Peng, Shaoliang; Cui, Yingbo; Wang, Bingqiang; Zhu, Xiaoqian; Liu, Jie

    2016-06-01

    ' The de novo assembly of DNA sequences is increasingly important for biological researches in the genomic era. After more than one decade since the Human Genome Project, some challenges still exist and new solutions are being explored to improve de novo assembly of genomes. String graph assembler (SGA), based on the string graph theory, is a new method/tool developed to address the challenges. In this paper, based on an in-depth analysis of SGA we prove that the SGA-based sequence de novo assembly is an NP-complete problem. According to our analysis, SGA outperforms other similar methods/tools in memory consumption, but costs much more time, of which 60-70 % is spent on the index construction. Upon this analysis, we introduce a hybrid parallel optimization algorithm and implement this algorithm in the TianHe-2's parallel framework. Simulations are performed with different datasets. For data of small size the optimized solution is 3.06 times faster than before, and for data of middle size it's 1.60 times. The results demonstrate an evident performance improvement, with the linear scalability for parallel FM-index construction. This results thus contribute significantly to improving the efficiency of de novo assembly of DNA sequences. PMID:26403255

  3. Translesion DNA synthesis in the context of cancer research

    PubMed Central

    2011-01-01

    During cell division, replication of the genomic DNA is performed by high-fidelity DNA polymerases but these error-free enzymes can not synthesize across damaged DNA. Specialized DNA polymerases, so called DNA translesion synthesis polymerases (TLS polymerases), can replicate damaged DNA thereby avoiding replication fork breakdown and subsequent chromosomal instability. We focus on the involvement of mammalian TLS polymerases in DNA damage tolerance mechanisms. In detail, we review the discovery of TLS polymerases and describe the molecular features of all the mammalian TLS polymerases identified so far. We give a short overview of the mechanisms that regulate the selectivity and activity of TLS polymerases. In addition, we summarize the current knowledge how different types of DNA damage, relevant either for the induction or treatment of cancer, are bypassed by TLS polymerases. Finally, we elucidate the relevance of TLS polymerases in the context of cancer therapy. PMID:22047021

  4. De novo assembly and characterization of the carrot mitochondrial genome using next generation sequencing data from whole genomic DNA provides first evidence of DNA transfer into an angiosperm plastid genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sequence analysis of organelle genomes has revealed important aspects of plant cell evolution. The scope of this study was to develop an approach for de novo assembly of the carrot mitochondrial genome using next generation sequence data from total genomic DNA. Sequencing data from a carrot 454 whol...

  5. Restriction site-associated DNA sequencing, genotyping error estimation and de novo assembly optimization for population genetic inference.

    PubMed

    Mastretta-Yanes, A; Arrigo, N; Alvarez, N; Jorgensen, T H; Piñero, D; Emerson, B C

    2015-01-01

    Restriction site-associated DNA sequencing (RADseq) provides researchers with the ability to record genetic polymorphism across thousands of loci for nonmodel organisms, potentially revolutionizing the field of molecular ecology. However, as with other genotyping methods, RADseq is prone to a number of sources of error that may have consequential effects for population genetic inferences, and these have received only limited attention in terms of the estimation and reporting of genotyping error rates. Here we use individual sample replicates, under the expectation of identical genotypes, to quantify genotyping error in the absence of a reference genome. We then use sample replicates to (i) optimize de novo assembly parameters within the program Stacks, by minimizing error and maximizing the retrieval of informative loci; and (ii) quantify error rates for loci, alleles and single-nucleotide polymorphisms. As an empirical example, we use a double-digest RAD data set of a nonmodel plant species, Berberis alpina, collected from high-altitude mountains in Mexico. PMID:24916682

  6. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    PubMed

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases. PMID:22320201

  7. Reversing diet-induced metabolic dysregulation by diet switching leads to altered hepatic de novo lipogenesis and glycerolipid synthesis.

    PubMed

    Kowalski, Greg M; Hamley, Steven; Selathurai, Ahrathy; Kloehn, Joachim; De Souza, David P; O'Callaghan, Sean; Nijagal, Brunda; Tull, Dedreia L; McConville, Malcolm J; Bruce, Clinton R

    2016-01-01

    In humans, low-energy diets rapidly reduce hepatic fat and improve/normalise glycemic control. Due to difficulties in obtaining human liver, little is known about changes to the lipid species and pathway fluxes that occur under these conditions. Using a combination of stable isotope, and targeted metabolomic approaches we investigated the acute (7-9 days) hepatic effects of switching high-fat high-sucrose diet (HFD) fed obese mice back to a chow diet. Upon the switch, energy intake was reduced, resulting in reductions of fat mass and hepatic triacyl- and diacylglycerol. However, these parameters were still elevated compared to chow fed mice, thus representing an intermediate phenotype. Nonetheless, glucose intolerance and hyperinsulinemia were completely normalized. The diet reversal resulted in marked reductions in hepatic de novo lipogenesis when compared to the chow and HFD groups. Compared with HFD, glycerolipid synthesis was reduced in the reversal animals, however it remained elevated above that of chow controls, indicating that despite experiencing a net loss in lipid stores, the liver was still actively esterifying available fatty acids at rates higher than that in chow control mice. This effect likely promotes the re-esterification of excess free fatty acids released from the breakdown of adipose depots during the weight loss period. PMID:27273128

  8. Reversing diet-induced metabolic dysregulation by diet switching leads to altered hepatic de novo lipogenesis and glycerolipid synthesis

    PubMed Central

    Kowalski, Greg M.; Hamley, Steven; Selathurai, Ahrathy; Kloehn, Joachim; De Souza, David P.; O’Callaghan, Sean; Nijagal, Brunda; Tull, Dedreia L.; McConville, Malcolm J.; Bruce, Clinton R.

    2016-01-01

    In humans, low-energy diets rapidly reduce hepatic fat and improve/normalise glycemic control. Due to difficulties in obtaining human liver, little is known about changes to the lipid species and pathway fluxes that occur under these conditions. Using a combination of stable isotope, and targeted metabolomic approaches we investigated the acute (7–9 days) hepatic effects of switching high-fat high-sucrose diet (HFD) fed obese mice back to a chow diet. Upon the switch, energy intake was reduced, resulting in reductions of fat mass and hepatic triacyl- and diacylglycerol. However, these parameters were still elevated compared to chow fed mice, thus representing an intermediate phenotype. Nonetheless, glucose intolerance and hyperinsulinemia were completely normalized. The diet reversal resulted in marked reductions in hepatic de novo lipogenesis when compared to the chow and HFD groups. Compared with HFD, glycerolipid synthesis was reduced in the reversal animals, however it remained elevated above that of chow controls, indicating that despite experiencing a net loss in lipid stores, the liver was still actively esterifying available fatty acids at rates higher than that in chow control mice. This effect likely promotes the re-esterification of excess free fatty acids released from the breakdown of adipose depots during the weight loss period. PMID:27273128

  9. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  10. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements.

    PubMed

    Schlesinger, Felix; Smith, Andrew D; Gingeras, Thomas R; Hannon, Gregory J; Hodges, Emily

    2013-10-01

    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  11. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements

    PubMed Central

    Schlesinger, Felix; Smith, Andrew D.; Gingeras, Thomas R.; Hannon, Gregory J.; Hodges, Emily

    2013-01-01

    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  12. Biochemical characterization of GDP-L-fucose de novo synthesis pathway in fungus Mortierella alpina

    SciTech Connect

    Ren, Yan; Perepelov, Andrei V.; Wang, Haiyan; Zhang, Hao; Knirel, Yuriy A.; Wang, Lei; Chen, Wei

    2010-01-22

    Mortierella alpina is a filamentous fungus commonly found in soil, which is able to produce large amount of polyunsaturated fatty acids. L-Fucose is an important sugar found in a diverse range of organisms, playing a variety of biological roles. In this study, we characterized the de novo biosynthetic pathway of GDP-L-fucose (the nucleotide-activated form of L-fucose) in M. alpina. Genes encoding GDP-D-mannose 4,6-dehydratase (GMD) and GDP-keto-6-deoxymannose 3,5-epimerase/4-reductase (GMER) were expressed heterologously in Escherichia coli. The recombinant enzymes were produced as His-tagged fusion proteins. Conversion of GDP-mannose to GDP-4-keto-6-deoxy mannose by GMD and GDP-4-keto-6-deoxy mannose to GDP-L-fucose by GMER were analyzed by capillary electrophoresis, electro-spray ionization-mass spectrometry, and nuclear magnetic resonance spectroscopy. The k{sub m} values of GMD for GDP-mannose and GMER for GDP-4-keto-6-deoxy mannose were determined to be 0.77 mM and 1.047 mM, respectively. Both NADH and NADPH may be used by GMER as the coenzyme. The optimum temperature and pH were determined to be 37 {sup o}C and pH 9.0 (GMD) or pH 7.0 (GMER). Divalent cations are not required for GMD and GMER activity, and the activities of both enzymes may be enhanced by DTT. To our knowledge this is the first report on the characterization of GDP-L-fucose biosynthetic pathway in fungi.

  13. Decreased synthesis of DNA in regenerating rat liver after the administration of reserpine

    PubMed Central

    Ćihák, A.; Vaptzarova, K.

    1973-01-01

    1. Reserpine given to rats before the enhanced synthesis of DNA begins 14h after partial hepatectomy markedly depresses thymidine uptake into DNA at 24 hours. 2. At this time decreased activity of liver thymidine kinase but unchanged thymidine 5′-nucleotidase were observed. 3. Reserpine has no effect on DNA synthesis when administered simultaneously with the labelled thymidine 2 h before killing. 4. With depressed DNA synthesis after reserpine administration there is no significant decrease of liver RNA synthesis. PMID:4793440

  14. Polyaniline nanowire synthesis templated by DNA

    NASA Astrophysics Data System (ADS)

    Nickels, Patrick; Dittmer, Wendy U.; Beyer, Stefan; Kotthaus, Jörg P.; Simmel, Friedrich C.

    2004-11-01

    DNA-templated polyaniline nanowires and networks are synthesized using three different methods. The resulting DNA/polyaniline hybrids are fully characterized using atomic force microscopy, UV-vis spectroscopy and current-voltage measurements. Oxidative polymerization of polyaniline at moderate pH values is accomplished using ammonium persulfate as an oxidant, or alternatively in an enzymatic oxidation by hydrogen peroxide using horseradish peroxidase, or by photo-oxidation using a ruthenium complex as photo-oxidant. Atomic force microscopy shows that all three methods lead to the preferential growth of polyaniline along DNA templates. With ammonium persulfate, polyaniline can be grown on DNA templates already immobilized on a surface. Current-voltage measurements are successfully conducted on DNA/polyaniline networks synthesized by the enzymatic method and the photo-oxidation method. The conductance is found to be consistent with values measured for undoped polyaniline films.

  15. Paired-End Sequencing of Long-Range DNA Fragments for De Novo Assembly of Large, Complex Mammalian Genomes by Direct Intra-Molecule Ligation

    PubMed Central

    Wu, Kui; Cai, Qingle; Wang, Yu; Lang, Yongshan; Cao, Hongzhi; Yang, Huangming; Wang, Jian; Zhang, Xiuqing

    2012-01-01

    Background The relatively short read lengths from next generation sequencing (NGS) technologies still pose a challenge for de novo assembly of complex mammal genomes. One important solution is to use paired-end (PE) sequence information experimentally obtained from long-range DNA fragments (>1 kb). Here, we characterize and extend a long-range PE library construction method based on direct intra-molecule ligation (or molecular linker-free circularization) for NGS. Results We found that the method performs stably for PE sequencing of 2- to 5- kb DNA fragments, and can be extended to 10–20 kb (and even in extremes, up to ∼35 kb). We also characterized the impact of low quality input DNA on the method, and develop a whole-genome amplification (WGA) based protocol using limited input DNA (<1 µg). Using this PE dataset, we accurately assembled the YanHuang (YH) genome, the first sequenced Asian genome, into a scaffold N50 size of >2 Mb, which is over100-times greater than the initial size produced with only small insert PE reads(17 kb). In addition, we mapped two 7- to 8- kb insertions in the YH genome using the larger insert sizes of the long-range PE data. Conclusions In conclusion, we demonstrate here the effectiveness of this long-range PE sequencing method and its use for the de novo assembly of a large, complex genome using NGS short reads. PMID:23029438

  16. Insights into eukaryotic primer synthesis from structures of the p48 subunit of human DNA primase

    PubMed Central

    Vaithiyalingam, Sivaraja; Arnett, Diana R.; Aggarwal, Amit; Eichman, Brandt F.; Fanning, Ellen; Chazin, Walter J.

    2013-01-01

    DNA replication in all organisms requires polymerases to synthesize copies of the genome. DNA polymerases are unable to function on a bare template and require a primer. Primases are crucial RNA polymerases that perform the initial de novo synthesis, generating the first 8–10 nucleotides of the primer. Although structures of archaeal and bacterial primases have provided insights into general priming mechanisms, these proteins are not well conserved with heterodimeric (p48/p58) primases in eukaryotes. Here, we present X-ray crystal structures of the catalytic engine of a eukaryotic primase, which is contained in the p48 subunit. The structures of p48 reveal eukaryotic primases maintain the conserved catalytic prim fold domain, but with a unique sub-domain not found in the archaeal and bacterial primases. Calorimetry experiments reveal Mn2+ but not Mg2+ significantly enhances the binding of nucleotide to primase, which correlates with in vitro higher catalytic efficiency. The structure of p48 with bound UTP and Mn2+ provides insights into the mechanism of nucleotide synthesis by primase. Substitution of conserved residues involved in either metal or nucleotide binding altered nucleotide binding affinities, and yeast strains containing the corresponding Pri1p substitutions were not viable. Our results revealed two residues (S160 and H166) in direct contact with the nucleotide that were previously unrecognized as critical to the human primase active site. Comparing p48 structures to those of similar polymerases in different states of action suggests changes that would be required to attain a catalytically competent conformation capable of initiating dinucleotide synthesis. PMID:24239947

  17. Magnetic isotope and magnetic field effects on the DNA synthesis

    PubMed Central

    Buchachenko, Anatoly L.; Orlov, Alexei P.; Kuznetsov, Dmitry A.; Breslavskaya, Natalia N.

    2013-01-01

    Magnetic isotope and magnetic field effects on the rate of DNA synthesis catalysed by polymerases β with isotopic ions 24Mg2+, 25Mg2+ and 26Mg2+ in the catalytic sites were detected. No difference in enzymatic activity was found between polymerases β carrying 24Mg2+ and 26Mg2+ ions with spinless, non-magnetic nuclei 24Mg and 26Mg. However, 25Mg2+ ions with magnetic nucleus 25Mg were shown to suppress enzymatic activity by two to three times with respect to the enzymatic activity of polymerases β with 24Mg2+ and 26Mg2+ ions. Such an isotopic dependence directly indicates that in the DNA synthesis magnetic mass-independent isotope effect functions. Similar effect is exhibited by polymerases β with Zn2+ ions carrying magnetic 67Zn and non-magnetic 64Zn nuclei, respectively. A new, ion–radical mechanism of the DNA synthesis is suggested to explain these effects. Magnetic field dependence of the magnesium-catalysed DNA synthesis is in a perfect agreement with the proposed ion–radical mechanism. It is pointed out that the magnetic isotope and magnetic field effects may be used for medicinal purposes (trans-cranial magnetic treatment of cognitive deceases, cell proliferation, control of the cancer cells, etc). PMID:23851636

  18. The coordinate induction of DNA synthesis after tuber wounding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses involved in processes required to heal and protect surviving plant issues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marketability o...

  19. Seasonal variations of DNA synthesis in intestinal epithelial cells of hibernating animals--I. DNA synthesis in intestinal epithelial cells of ground squirrel (Citellus undulatus) during deep hibernation.

    PubMed

    Kruman, I I; Kolaeva, S G; Iljasova, E N; Zubrikhina, G N; Khachko, V N; Petrova, A S

    1986-01-01

    The conditions for obtaining crypt cells from ground squirrel small intestine were chosen which allow flow-through cytofluorometric analysis of the DNA synthesis of this tissue. DNA synthesis was found to be greatly reduced in the intestinal crypt cells of ground squirrel during deep hibernation in torpid animals, in animals during spontaneous arousals and in animals prevented from hibernation. The conclusion is made about endogenous control of the DNA synthesis in the cells of true hibernators. PMID:3943302

  20. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    SciTech Connect

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K. )

    1990-11-15

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling.

  1. Structural basis for recognition of histone H3K36me3 nucleosome by human de novo DNA methyltransferases 3A and 3B.

    PubMed

    Rondelet, Grégoire; Dal Maso, Thomas; Willems, Luc; Wouters, Johan

    2016-06-01

    DNA methylation is an important epigenetic modification involved in chromatin organization and gene expression. The function of DNA methylation depends on cell context and is correlated with histone modification patterns. In particular, trimethylation of Lys36 on histone H3 tail (H3K36me3) is associated with DNA methylation and elongation phase of transcription. PWWP domains of the de novo DNA methyltransferases DNMT3A and DNMT3B read this epigenetic mark to guide DNA methylation. Here we report the first crystal structure of the DNMT3B PWWP domain-H3K36me3 complex. Based on this structure, we propose a model of the DNMT3A PWWP domain-H3K36me3 complex and build a model of DNMT3A (PWWP-ADD-CD) in a nucleosomal context. The trimethylated side chain of Lys36 (H3K36me3) is inserted into an aromatic cage similar to the "Royal" superfamily domains known to bind methylated histones. A key interaction between trimethylated Lys36 and a conserved water molecule stabilized by Ser270 explains the lack of affinity of mutated DNMT3B (S270P) for the H3K36me3 epigenetic mark in the ICF (Immunodeficiency, Centromeric instability and Facial abnormalities) syndrome. The model of the DNMT3A-DNMT3L heterotetramer in complex with a dinucleosome highlights the mechanism for recognition of nucleosome by DNMT3s and explains the periodicity of de novo DNA methylation. PMID:26993463

  2. The ATP binding site of the chromatin remodeling homolog Lsh is required for nucleosome density and de novo DNA methylation at repeat sequences

    PubMed Central

    Ren, Jianke; Briones, Victorino; Barbour, Samantha; Yu, Weishi; Han, Yixing; Terashima, Minoru; Muegge, Kathrin

    2015-01-01

    Lsh, a chromatin remodeling protein of the SNF2 family, is critical for normal heterochromatin structure. In particular, DNA methylation at repeat elements, a hallmark of heterochromatin, is greatly reduced in Lsh−/− (KO) cells. Here, we examined the presumed nucleosome remodeling activity of Lsh on chromatin in the context of DNA methylation. We found that dynamic CG methylation was dependent on Lsh in embryonic stem cells. Moreover, we demonstrate that ATP function is critical for de novo methylation at repeat sequences. The ATP binding site of Lsh is in part required to promote stable association of the DNA methyltransferase 3b with the repeat locus. By performing nucleosome occupancy assays, we found distinct nucleosome occupancy in KO ES cells compared to WT ES cells after differentiation. Nucleosome density was restored to wild-type level by re-expressing wild-type Lsh but not the ATP mutant in KO ES cells. Our results suggest that ATP-dependent nucleosome remodeling is the primary molecular function of Lsh, which may promote de novo methylation in differentiating ES cells. PMID:25578963

  3. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.

    PubMed

    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C

    2013-05-17

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates. PMID:23543747

  4. Identification of a de novo thymidylate biosynthesis pathway in mammalian mitochondria

    PubMed Central

    Anderson, Donald D.; Quintero, Cynthia M.; Stover, Patrick J.

    2011-01-01

    The de novo and salvage dTTP pathways are essential for maintaining cellular dTTP pools to ensure the faithful replication of both mitochondrial and nuclear DNA. Disregulation of dTTP pools results in mitochondrial dysfunction and nuclear genome instability due to an increase in uracil misincorporation. In this study, we identified a de novo dTMP synthesis pathway in mammalian mitochondria. Mitochondria purified from wild-type Chinese hamster ovary (CHO) cells and HepG2 cells converted dUMP to dTMP in the presence of NADPH and serine, through the activities of mitochondrial serine hydroxymethyltransferase (SHMT2), thymidylate synthase (TYMS), and a novel human mitochondrial dihydrofolate reductase (DHFR) previously thought to be a pseudogene known as dihydrofolate reductase-like protein 1 (DHFRL1). Human DHFRL1, SHMT2, and TYMS were localized to mitochondrial matrix and inner membrane, confirming the presence of this pathway in mitochondria. Knockdown of DHFRL1 using siRNA eliminated DHFR activity in mitochondria. DHFRL1 expression in CHO glyC, a previously uncharacterized mutant glycine auxotrophic cell line, rescued the glycine auxotrophy. De novo thymidylate synthesis activity was diminished in mitochondria isolated from glyA CHO cells that lack SHMT2 activity, as well as mitochondria isolated from wild-type CHO cells treated with methotrexate, a DHFR inhibitor. De novo thymidylate synthesis in mitochondria prevents uracil accumulation in mitochondrial DNA (mtDNA), as uracil levels in mtDNA isolated from glyA CHO cells was 40% higher than observed in mtDNA isolated from wild-type CHO cells. These data indicate that unlike other nucleotides, de novo dTMP synthesis occurs within mitochondria and is essential for mtDNA integrity. PMID:21876188

  5. Noncoordinate regulation of de novo synthesis of cytochrome P-450 cholesterol side-chain cleavage and cytochrome P-450 17 alpha-hydroxylase/C17-20 lyase in mouse Leydig cell cultures: relation to steroid production

    SciTech Connect

    Anakwe, O.O.; Payne, A.H. )

    1987-09-01

    The role of cAMP in the regulation of the amount and synthesis of cytochrome P-450 cholesterol side-chain cleavage (P-450scc) and cytochrome P-450 17 alpha-hydroxylase/C17-20 lyase P-450(17 alpha) was investigated in mouse Leydig cell cultures. In the absence of cAMP, the amount of immunoreactive P-450(17 alpha) decreased to less than 5% by day 4 and was undetectable between days 7 and 11. In contrast, the amount of immunoreactive P-450scc remained relatively constant throughout the same period. Treatment of Leydig cell cultures for 4 days with 0.05 mM 8-bromo-cAMP initiated on day 7 increased the amount of P-450(17 alpha) with relatively little effect on the amount of P-450scc. The rate of de novo synthesis of each of the P-450 enzymes was studied by determining (35S)methionine incorporation into newly synthesized protein. In the absence of cAMP, de novo synthesis of P-450(17 alpha) ceased while the rate of de novo synthesis of P-450scc increased with time in culture between days 2 and 11. Treatment with cAMP initiated on day 7 of culture caused a time-dependent increase in the rate of de novo synthesis of P-450(17 alpha) on days 9 and 11 equivalent to 40% and 60%, respectively, of that observed in freshly isolated Leydig cells. The rate of de novo synthesis of P-450scc was increased 2-fold relative to untreated cultures on days 9 and 11. De novo synthesis of P-450(17 alpha) ceased when cAMP was removed on day 11 and restored when cAMP was added again on day 13 of culture.

  6. Inhibition of Ceramide De Novo Synthesis with Myriocin Affects Lipid Metabolism in the Liver of Rats with Streptozotocin-Induced Type 1 Diabetes

    PubMed Central

    Wiesiołek-Kurek, Patrycja; Piotrowska, Dominika M.; Łukaszuk, Bartłomiej; Chabowski, Adrian; Żendzian-Piotrowska, Małgorzata

    2014-01-01

    Nowadays diabetes is one of the most common metabolic diseases. Sphingolipids, which are vitally important constituents of intracellular signal transduction pathways, may be among the most pathogenic lipid moieties intermingled in the origin and development of diabetes. It is now well established that inhibition of de novo ceramide synthesis with myriocin exerts positive effects on lipid metabolism and glucose homeostasis in type 2 diabetes mellitus animal models. However, its influence on type I diabetes still remains unknown. Therefore, the scope of this paper is to fulfill that particular gap in our knowledge. PMID:24701589

  7. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  8. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored. PMID:26403317

  9. Inaccurate DNA Synthesis in Cell Extracts of Yeast Producing Active Human DNA Polymerase Iota

    PubMed Central

    Makarova, Alena V.; Grabow, Corinn; Gening, Leonid V.; Tarantul, Vyacheslav Z.; Tahirov, Tahir H.; Bessho, Tadayoshi; Pavlov, Youri I.

    2011-01-01

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn2+ ions, can bypass some DNA lesions and misincorporates “G” opposite template “T” more frequently than incorporates the correct “A.” We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of “G” versus “A” method of Gening, abbreviated as “misGvA”). We provide unambiguous proof of the “misGvA” approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The “misGvA” activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts. PMID:21304950

  10. Pif1 helicase and Polδ promote recombination-coupled DNA synthesis via bubble migration

    PubMed Central

    Wilson, Marenda A.; Kwon, YoungHo; Xu, Yuanyuan; Chung, Woo-Hyun; Chi, Peter; Niu, Hengyao; Mayle, Ryan; Chen, Xuefeng; Malkova, Anna; Sung, Patrick; Ira, Grzegorz

    2013-01-01

    During DNA repair by homologous recombination (HR), DNA synthesis copies information from a template DNA molecule. Multiple DNA polymerases have been implicated in repair-specific DNA synthesis1–3, but it has remained unclear whether a DNA helicase is involved in this reaction. A good candidate is Pif1, an evolutionarily conserved helicase in S. cerevisiae important for break-induced replication (BIR)4 as well as HR-dependent telomere maintenance in the absence of telomerase5 found in 10–15% of all cancers6. Pif1 plays a role in DNA synthesis across hard-to-replicate sites7, 8 and in lagging strand synthesis with Polδ9–11. Here we provide evidence that Pif1 stimulates DNA synthesis during BIR and crossover recombination. The initial steps of BIR occur normally in Pif1-deficient cells, but Polδ recruitment and DNA synthesis are decreased, resulting in premature resolution of DNA intermediates into half crossovers. Purified Pif1 protein strongly stimulates Polδ-mediated DNA synthesis from a D-loop made by the Rad51 recombinase. Importantly, Pif1 liberates the newly synthesized strand to prevent the accumulation of topological constraint and to facilitate extensive DNA synthesis via the establishment of a migrating D-loop structure. Our results uncover a novel function of Pif1 and provide insights into the mechanism of HR. PMID:24025768

  11. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach. PMID:26633632

  12. Allyl isothiocyanate suppresses the proteolytic activation of sterol regulatory element-binding proteins and de novo fatty acid and cholesterol synthesis.

    PubMed

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2016-05-01

    Sterol regulatory element-binding proteins (SREBPs) are a family of transcription factors that regulate lipid homeostasis by controlling the expression of genes involved in fatty acid and cholesterol synthesis. In this study, we used a stable cell line that expresses a luciferase reporter gene driven by an SRE-containing fatty acid synthase promoter to identify allyl isothiocyanate (AITC), one of the major isothiocyanates in cruciferous vegetables, as a novel SREBP inactivator. We found that AITC downregulated the proteolytic processing of SREBPs and the expression of their target genes in human hepatoma Huh-7 cells. Furthermore, AITC reduced the de novo synthesis of both fatty acids and cholesterol. Our results indicate a novel physiological function of AITC in lipid metabolism regulation. PMID:26822063

  13. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  14. Synthesis and dissolution of hemicatenanes by type IA DNA topoisomerases

    PubMed Central

    Lee, Shun-Hsiao; Siaw, Grace Ee-Lu; Willcox, Smaranda; Griffith, Jack D.; Hsieh, Tao-Shih

    2013-01-01

    Type IA DNA topoisomerases work with a unique mechanism of strand passage through an enzyme-bridged, ssDNA gate, thus enabling them to carry out diverse reactions in processing structures important for replication, recombination, and repair. Here we report a unique reaction mediated by an archaeal type IA topoisomerase, the synthesis and dissolution of hemicatenanes. We cloned, purified, and characterized an unusual type IA enzyme from a hyperthermophilic archaeum, Nanoarchaeum equitans, which is split into two pieces. The recombinant heterodimeric enzyme has the expected activities in its preference of relaxing negatively supercoiled DNA. Its amino acid sequence and cleavage site sequence analysis suggest that it is topoisomerase III, and therefore we named it “NeqTop3.” At high enzyme concentrations, NeqTop3 can generate high-molecular-weight DNA networks. Biochemical and electron microscopic data indicate that the DNA networks are connected through hemicatenane linkages. The hemicatenane formation likely is mediated by the single-strand passage through denatured bubbles in the substrate DNA under high temperature. NeqTop3 at lower concentrations can reverse hemicatenanes. A complex of human topoisomerase 3α, Bloom helicase, and RecQ-mediated genome instability protein 1 and 2 can partially disentangle the hemicatenane network. Both the formation and dissolution of hemicatenanes by type IA topoisomerases demonstrate that these enzymes have an important role in regulating intermediates from replication, recombination, and repair. PMID:24003117

  15. [6]-Gingerol inhibits de novo fatty acid synthesis and carnitine palmitoyltransferase-1 activity which triggers apoptosis in HepG2

    PubMed Central

    Impheng, Hathaichanok; Richert, Lysiane; Pekthong, Dumrongsak; Scholfield, C Norman; Pongcharoen, Sutatip; Pungpetchara, Ittipon; Srisawang, Piyarat

    2015-01-01

    The de novo fatty acid synthesis catalyzed by key lipogenic enzymes, including fatty acid synthase (FASN) has emerged as one of the novel targets of anti-cancer approaches. The present study explored the possible inhibitory efficacy of [6]-gingerol on de novo fatty acid synthesis associated with mitochondrial-dependent apoptotic induction in HepG2 cells. We observed a dissipation of mitochondrial membrane potential accompanied by a reduction of fatty acid levels. [6]-gingerol administration manifested inhibition of FASN expression, indicating FASN is a major target of [6]-gingerol inducing apoptosis in HepG2 cells. Indeed, we found that increased ROS generation could likely be a mediator of the anti-cancer effect of [6]-gingerol. A reduction of fatty acid levels and induction of apoptosis were restored by inhibition of acetyl-CoA carboxylase (ACC) activity, suggesting an accumulation of malonyl-CoA level could be the major cause of apoptotic induction of [6]-gingerol in HepG2 cells. The present study also showed that depletion of fatty acid following [6]-gingerol treatment caused an inhibitory effect on carnitine palmitoyltransferase-1 activity (CPT-1), whereas C75 augmented CPT-1 activity, indicating that [6]-gingerol exhibits the therapeutic benefit on suppression of fatty acid β-oxidation. PMID:26101700

  16. [6]-Gingerol inhibits de novo fatty acid synthesis and carnitine palmitoyltransferase-1 activity which triggers apoptosis in HepG2.

    PubMed

    Impheng, Hathaichanok; Richert, Lysiane; Pekthong, Dumrongsak; Scholfield, C Norman; Pongcharoen, Sutatip; Pungpetchara, Ittipon; Srisawang, Piyarat

    2015-01-01

    The de novo fatty acid synthesis catalyzed by key lipogenic enzymes, including fatty acid synthase (FASN) has emerged as one of the novel targets of anti-cancer approaches. The present study explored the possible inhibitory efficacy of [6]-gingerol on de novo fatty acid synthesis associated with mitochondrial-dependent apoptotic induction in HepG2 cells. We observed a dissipation of mitochondrial membrane potential accompanied by a reduction of fatty acid levels. [6]-gingerol administration manifested inhibition of FASN expression, indicating FASN is a major target of [6]-gingerol inducing apoptosis in HepG2 cells. Indeed, we found that increased ROS generation could likely be a mediator of the anti-cancer effect of [6]-gingerol. A reduction of fatty acid levels and induction of apoptosis were restored by inhibition of acetyl-CoA carboxylase (ACC) activity, suggesting an accumulation of malonyl-CoA level could be the major cause of apoptotic induction of [6]-gingerol in HepG2 cells. The present study also showed that depletion of fatty acid following [6]-gingerol treatment caused an inhibitory effect on carnitine palmitoyltransferase-1 activity (CPT-1), whereas C75 augmented CPT-1 activity, indicating that [6]-gingerol exhibits the therapeutic benefit on suppression of fatty acid β-oxidation. PMID:26101700

  17. De novo pyrimidine nucleotide synthesis mainly occurs outside of plastids, but a previously undiscovered nucleobase importer provides substrates for the essential salvage pathway in Arabidopsis.

    PubMed

    Witz, Sandra; Jung, Benjamin; Fürst, Sarah; Möhlmann, Torsten

    2012-04-01

    Nucleotide de novo synthesis is highly conserved among organisms and represents an essential biochemical pathway. In plants, the two initial enzymatic reactions of de novo pyrimidine synthesis occur in the plastids. By use of green fluorescent protein fusions, clear support is provided for a localization of the remaining reactions in the cytosol and mitochondria. This implies that carbamoyl aspartate, an intermediate of this pathway, must be exported and precursors of pyrimidine salvage (i.e., nucleobases or nucleosides) are imported into plastids. A corresponding uracil transport activity could be measured in intact plastids isolated from cauliflower (Brassica oleracea) buds. PLUTO (for plastidic nucleobase transporter) was identified as a member of the Nucleobase:Cation-Symporter1 protein family from Arabidopsis thaliana, capable of transporting purine and pyrimidine nucleobases. A PLUTO green fluorescent protein fusion was shown to reside in the plastid envelope after expression in Arabidopsis protoplasts. Heterologous expression of PLUTO in an Escherichia coli mutant lacking the bacterial uracil permease uraA allowed a detailed biochemical characterization. PLUTO transports uracil, adenine, and guanine with apparent affinities of 16.4, 0.4, and 6.3 μM, respectively. Transport was markedly inhibited by low concentrations of a proton uncoupler, indicating that PLUTO functions as a proton-substrate symporter. Thus, a protein for the absolutely required import of pyrimidine nucleobases into plastids was identified. PMID:22474184

  18. DNA double-strand break repair in parental chromatin of mouse zygotes, the first cell cycle as an origin of de novo mutation.

    PubMed

    Derijck, Alwin; van der Heijden, Godfried; Giele, Maud; Philippens, Marielle; de Boer, Peter

    2008-07-01

    In the human, the contribution of the sexes to the genetic load is dissimilar. Especially for point mutations, expanded simple tandem repeats and structural chromosome mutations, the contribution of the male germline is dominant. Far less is known about the male germ cell stage(s) that are most vulnerable to mutation contraction. For the understanding of de novo mutation induction in the germline, mechanistic insight of DNA repair in the zygote is mandatory. At the onset of embryonic development, the parental chromatin sets occupy one pronucleus (PN) each and DNA repair can be regarded as a maternal trait, depending on proteins and mRNAs provided by the oocyte. Repair of DNA double-strand breaks (DSBs) is executed by non-homologous end joining (NHEJ) and homologous recombination (HR). Differentiated somatic cells often resolve DSBs by NHEJ, whereas embryonic stem cells preferably use HR. We show NHEJ and HR to be both functional during the zygotic cell cycle. NHEJ is already active during replacement of sperm protamines by nucleosomes. The kinetics of G1 repair is influenced by DNA-PK(cs) hypomorphic activity. Both HR and NHEJ are operative in S-phase, HR being more active in the male PN. DNA-PK(cs) deficiency upregulates the HR activity. Both after sperm remodeling and at first mitosis, spontaneous levels of gammaH2AX foci (marker for DSBs) are high. All immunoflurescent indices of DNA damage and DNA repair point at greater spontaneous damage and induced repair activity in paternal chromatin in the zygote. PMID:18353795

  19. Characterization of Quasispecies of Pandemic 2009 Influenza A Virus (A/H1N1/2009) by De Novo Sequencing Using a Next-Generation DNA Sequencer

    PubMed Central

    Kuroda, Makoto; Katano, Harutaka; Nakajima, Noriko; Tobiume, Minoru; Ainai, Akira; Sekizuka, Tsuyoshi; Hasegawa, Hideki; Tashiro, Masato; Sasaki, Yuko; Arakawa, Yoshichika; Hata, Satoru; Watanabe, Masahide; Sata, Tetsutaro

    2010-01-01

    Pandemic 2009 influenza A virus (A/H1N1/2009) has emerged globally. In this study, we performed a comprehensive detection of potential pathogens by de novo sequencing using a next-generation DNA sequencer on total RNAs extracted from an autopsy lung of a patient who died of viral pneumonia with A/H1N1/2009. Among a total of 9.4×106 40-mer short reads, more than 98% appeared to be human, while 0.85% were identified as A/H1N1/2009 (A/Nagano/RC1-L/2009(H1N1)). Suspected bacterial reads such as Streptococcus pneumoniae and other oral bacteria flora were very low at 0.005%, and a significant bacterial infection was not histologically observed. De novo assembly and read mapping analysis of A/Nagano/RC1-L/2009(H1N1) showed more than ×200 coverage on average, and revealed nucleotide heterogeneity on hemagglutinin as quasispecies, specifically at two amino acids (Gly172Glu and Gly239Asn of HA) located on the Sa and Ca2 antigenic sites, respectively. Gly239 and Asn239 on antigenic site Ca2 appeared to be minor amino acids compared with the highly distributed Asp239 in H1N1 HAs. This study demonstrated that de novo sequencing can comprehensively detect pathogens, and such in-depth investigation facilitates the identification of influenza A viral heterogeneity. To better characterize the A/H1N1/2009 virus, unbiased comprehensive techniques will be indispensable for the primary investigations of emerging infectious diseases. PMID:20428231

  20. Validity of the tritiated thymidine method for estimating bacterial growth rates: measurement of isotope dilution during DNA synthesis

    SciTech Connect

    Pollard, P.C.; Moriarty, D.J.W.

    1984-12-01

    The rate of tritiated thymidine incorporation into DNA was used to estimate bacterial growth rates in aquatic environments. To be accurate, the calculation of growth rates has to include a factor for the dilution of isotope before incorporation. The validity of an isotope dilution analysis to determine this factor was verified in experiments reported here with cultures of a marine bacterium growing in a chemostat. Growth rates calculated from data on chemostat dilution rates and cell density agreed well with rates calculated by tritiated thymidine incorporation into DNA and isotope dilution analysis. With sufficiently high concentrations of exogenous thymidine, de novo synthesis of deoxythymidine monophosphate was inhibited, thereby preventing the endogenous dilution of isoope. The thymidine technique was also shown to be useful for measuring growth rates of mixed suspensions of bacteria growing anaerobically. Thymidine was incorporated into the DNA of a range of marine pseudomonads that were investigated. Three species did not take up thymidine. The common marine cyanobacterium Synechococcus species did not incorporate thymidine into DNA.

  1. Title A de novo synthesis citrate transporter VuMATE confers aluminum resistance in rice bean (vigna umbellata)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Al-activated organic acid anion efflux from roots is an important Al resistance mechanism in plants. We have conducted the homologous cloning and isolation of VuMATE (Vigna umbellata multidrug and toxic compound extrusion), a gene encoding a de novo citrate transporter from rice bean. Al treatment u...

  2. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  3. Anatomic localization of O6-methylguanine DNA methyltransferase (MGMT) promoter methylated and unmethylated tumors: a radiographic study in 358 de novo human glioblastomas.

    PubMed

    Ellingson, Benjamin M; Cloughesy, Timothy F; Pope, Whitney B; Zaw, Taryar M; Phillips, Heidi; Lalezari, Shadi; Nghiemphu, Phioanh L; Ibrahim, Hassana; Naeini, Kourosh M; Harris, Robert J; Lai, Albert

    2012-01-16

    Promoter methylation of O6-methylguanine DNA methyltransferase (MGMT) is associated with a favorable prognosis in glioblastoma multiforme (GBM) and has been hypothesized to occur early in tumor transformation of glial cells. Thus, a possible link exists between the site of malignant transformation and MGMT promoter methylation status. Using the Analysis of Differential Involvement (ADIFFI) statistical mapping technique in a total of 358 patients with GBM, we demonstrate that human de novo GBMs occur in a high frequency contiguous with the posterior subventricular zone (SVZ); MGMT promoter methylated GBMs are lateralized to the left hemisphere, while MGMT unmethylated GBMs are lateralized to the right hemisphere; and tumors near the left temporal lobe have a significantly longer overall survival compared with tumors occurring elsewhere, independent of treatment or MGMT methylation status. PMID:22001163

  4. [The biological effect of Y-family DNA polymerases on the translesion synthesis].

    PubMed

    Gong, Yi; Yang, Jin

    2013-02-01

    A common DNA polymerase can replicate DNA which functions normally. However, if DNA suffers damage, the genome can not be replicated by a common DNA polymerase because DNA lesions will block the replication apparatus. Another kind of DNA polymerases in organism, Y-family DNA polymerases which is also called translesion synthesis (TLS) polymerases, can deal with this problem. Their main functions are bypassing the lesions in DNA, replicating the genome and saving the dying cells. This thesis presents a historical review of the literature pertinent to the structure, functions and roles of Y-family DNA polymerases. PMID:23488167

  5. DNA replication and unscheduled DNA synthesis in lungs of mice exposed to cigarette smoke

    SciTech Connect

    Rasmussen, R.E.; Boyd, C.H.; Dansie, D.R.; Kouri, R.E.; Henry, C.J.

    1981-07-01

    Mice of the hybrid strain BC3F1/Cum (C57BL/Cum X C3H/AnfCum) were chronically exposed to measured amounts of machine-generated whole Kentucky reference 2A1 cigarette smoke. DNA replication and unscheduled DNA synthesis (UDS) were measured in lung tissue in vitro using a short-term organ culture method. Within one week of beginning smoke exposure, DNA replicative activity, as indicated by incorporation of (3H)-thymidine into total lung DNA, was increased more than two-fold over sham-exposed controls and remained elevated as long as smoke exposure was continued. Treatment of lung tissues in vitro with either the lung carcinogen 4-nitroquinoline-1-oxide or methylmethane sulfonate stimulated UDS, measured as incorporation of (3H)thymidine into lung DNA in the presence of hydroxyurea, presumably as the result of DNA repair activity. Until the 10th to 12th week of smoke exposure, at which time the accumulated deposition of total particulate material in the lung was approximately 40 mg, the level of UDS stimulated by the alkylating chemicals declined to approximately 50% of that seen in lung tissue from sham-exposed control mice. If the mice were removed from smoke exposure, DNA replicative activity returned to normal levels within one week, but the UDS response to DNA damage remained depressed up to five months after ending smoke exposure. The results show that both transient and apparently permanent changes are produced in mouse lung as the result of exposure to cigarette smoke. The role of these changes in lung neoplasia is under investigation.

  6. Synthesis of type 2 Adenovirus DNA in the Presence of Cycloheximide

    PubMed Central

    Horwitz, Marshall S.; Brayton, Carol; Baum, Stephen G.

    1973-01-01

    Adenovirus type 2 DNA synthesis, either in permissive human cells or nonpermissive monkey cells, becomes independent of protein synthesis after the appearance of progeny viral DNA. In the presence of cycloheximide, semiconservative replication and initiation of progeny molecules can occur. PMID:4349494

  7. DNA (DEOXYRIBONUCLEIC ACID) SYNTHESIS FOLLOWING MICROINJECTION OF HETEROLOGOUS SPERM AND SOMATIC CELL NUCLEI INTO HAMSTER OOCYTES

    EPA Science Inventory

    The authors have investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in 3H-thymidine after being parthenogenetically activated by sha...

  8. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. PMID:27418514

  9. Inhibition of Cellular DNA Synthesis in Cells Infected with Infectious Pancreatic Necrosis Virus

    PubMed Central

    Lothrop, David; Nicholson, Bruce L.

    1974-01-01

    In asynchronous RTG-2 cell cultures infected with infectious pancreatic necrosis (IPN) virus, inhibition of cellular DNA synthesis, but not protein synthesis, was detected 5 to 6 h postinfection and was 80 to 90% complete by 7 to 8 h. Inhibition of DNA synthesis was largely abolished by UV irradiation of the virus. Sedimentation analyses of phenol-extracted DNA indicated that native cellular DNA was not degraded during infection. Sedimentation on alkaline sucrose gradients of DNA from cells pulsed with radioactive thymidine for varying periods indicated that elongation of nascent DNA chains proceeded normally in infected cells. These and previous results suggest that IPN virus infection results in a reduction of the number of chromosomal sites active in DNA synthesis but does not affect the rate of polymerization at active sites. Cells synchronized with excess thymidine and hydroxyurea and infected with virus at the time of release from the block demonstrated an inhibition of DNA synthesis 3 h postinfection. Cells infected 4 h prior to release continued to synthesize normal amounts of DNA for 1 to 2 h after release. These results indicated that DNA synthesis in early synthetic phase is relatively insensitive to inhibition by IPN virus. PMID:4852469

  10. Misincorporation during DNA synthesis, analyzed by gel electrophoresis.

    PubMed Central

    Hillebrand, G G; McCluskey, A H; Abbott, K A; Revich, G G; Beattie, K L

    1984-01-01

    A method has been developed for simultaneous comparison of the propensity of a DNA polymerase to misincorporate at different points on a natural template-primer. In this method elongation of a [5'-32P] primer, annealed to a bacteriophage template strand, is carried out in the presence of only three dNTPs (highly purified by HPLC). Under these conditions the rate of primer elongation (monitored by gel electrophoresis/autoradiography) is limited by the rate of misincorporation at template positions complementary to the missing dNTP. Variations in the rate of elongation (revealed by autoradiographic banding patterns) reflect variations in the propensity for misincorporation at different positions along the template. The effect on primer elongation produced by addition of a chemically modified dNTP to 'minus' reactions reveals the mispairing potential of the modified nucleotide during DNA synthesis. By use of this electrophoretic assay of misincorporation we have demonstrated that the fidelity of E. coli DNA polymerase I varies greatly at different positions along a natural template, and that BrdUTP and IodUTP can be incorporated in place of dCTP during chain elongation catalyzed by this enzyme. Images PMID:6326053

  11. De novo transcriptome sequence assembly from coconut leaves and seeds with a focus on factors involved in RNA-directed DNA methylation.

    PubMed

    Huang, Ya-Yi; Lee, Chueh-Pai; Fu, Jason L; Chang, Bill Chia-Han; Matzke, Antonius J M; Matzke, Marjori

    2014-11-01

    Coconut palm (Cocos nucifera) is a symbol of the tropics and a source of numerous edible and nonedible products of economic value. Despite its nutritional and industrial significance, coconut remains under-represented in public repositories for genomic and transcriptomic data. We report de novo transcript assembly from RNA-seq data and analysis of gene expression in seed tissues (embryo and endosperm) and leaves of a dwarf coconut variety. Assembly of 10 GB sequencing data for each tissue resulted in 58,211 total unigenes in embryo, 61,152 in endosperm, and 33,446 in leaf. Within each unigene pool, 24,857 could be annotated in embryo, 29,731 could be annotated in endosperm, and 26,064 could be annotated in leaf. A KEGG analysis identified 138, 138, and 139 pathways, respectively, in transcriptomes of embryo, endosperm, and leaf tissues. Given the extraordinarily large size of coconut seeds and the importance of small RNA-mediated epigenetic regulation during seed development in model plants, we used homology searches to identify putative homologs of factors required for RNA-directed DNA methylation in coconut. The findings suggest that RNA-directed DNA methylation is important during coconut seed development, particularly in maturing endosperm. This dataset will expand the genomics resources available for coconut and provide a foundation for more detailed analyses that may assist molecular breeding strategies aimed at improving this major tropical crop. PMID:25193496

  12. De Novo Transcriptome Sequence Assembly from Coconut Leaves and Seeds with a Focus on Factors Involved in RNA-Directed DNA Methylation

    PubMed Central

    Huang, Ya-Yi; Lee, Chueh-Pai; Fu, Jason L.; Chang, Bill Chia-Han; Matzke, Antonius J. M.; Matzke, Marjori

    2014-01-01

    Coconut palm (Cocos nucifera) is a symbol of the tropics and a source of numerous edible and nonedible products of economic value. Despite its nutritional and industrial significance, coconut remains under-represented in public repositories for genomic and transcriptomic data. We report de novo transcript assembly from RNA-seq data and analysis of gene expression in seed tissues (embryo and endosperm) and leaves of a dwarf coconut variety. Assembly of 10 GB sequencing data for each tissue resulted in 58,211 total unigenes in embryo, 61,152 in endosperm, and 33,446 in leaf. Within each unigene pool, 24,857 could be annotated in embryo, 29,731 could be annotated in endosperm, and 26,064 could be annotated in leaf. A KEGG analysis identified 138, 138, and 139 pathways, respectively, in transcriptomes of embryo, endosperm, and leaf tissues. Given the extraordinarily large size of coconut seeds and the importance of small RNA-mediated epigenetic regulation during seed development in model plants, we used homology searches to identify putative homologs of factors required for RNA-directed DNA methylation in coconut. The findings suggest that RNA-directed DNA methylation is important during coconut seed development, particularly in maturing endosperm. This dataset will expand the genomics resources available for coconut and provide a foundation for more detailed analyses that may assist molecular breeding strategies aimed at improving this major tropical crop. PMID:25193496

  13. In vivo measurement of unscheduled DNA synthesis and S-phase synthesis as an indicator of hepatocarcinogenesis in rodents.

    PubMed

    Mirsalis, J C

    1987-06-01

    Measurement of chemically induced DNA repair as unscheduled DNA synthesis in rodent liver following in vivo treatment is a useful screen for potential hepatocarcinogens. In addition to measurement of unscheduled DNA synthesis, examination of S-phase synthesis provides an indicator of chemically induced cell proliferation in the liver, which may be a basis for hepatic tumor promotion. Several chemicals and classes of chemicals have been examined using these end points. The pyrrolizidine alkaloid riddelline is a potent genotoxic agent in vitro, and in vivo studies confirm this response as riddelline induces significant elevations in unscheduled DNA synthesis and S-phase synthesis in rat liver. Conversely, H.C. Blue dyes #1 and #2 are both potent genotoxic agents in vitro but fail to express this genotoxicity in vivo. H.C. Blue #1 induces significant increases in S-phase synthesis in B6C3F1 mouse liver, which correlates with the observed carcinogenicity of this compound. Halogenated hydrocarbons likewise fail to induce unscheduled DNA synthesis in vivo, but many of these compounds do increase hepatic cell proliferation in mice, which may be the principal mechanism of hepatocarcinogenesis in this species. PMID:3507253

  14. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  15. Structural basis of high-fidelity DNA synthesis by yeast DNA polymerase [delta

    SciTech Connect

    Swan, Michael K.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2009-09-25

    DNA polymerase {delta} (Pol {delta}) is a high-fidelity polymerase that has a central role in replication from yeast to humans. We present the crystal structure of the catalytic subunit of yeast Pol {delta} in ternary complex with a template primer and an incoming nucleotide. The structure, determined at 2.0-{angstrom} resolution, catches the enzyme in the act of replication, revealing how the polymerase and exonuclease domains are juxtaposed relative to each other and how a correct nucleotide is selected and incorporated. The structure also reveals the 'sensing' interactions near the primer terminus, which signal a switch from the polymerizing to the editing mode. Taken together, the structure provides a chemical basis for the bulk of DNA synthesis in eukaryotic cells and a framework for understanding the effects of cancer-causing mutations in Pol {delta}.

  16. Fast turnover of genome transcription across evolutionary time exposes entire non-coding DNA to de novo gene emergence

    PubMed Central

    Neme, Rafik; Tautz, Diethard

    2016-01-01

    Deep sequencing analyses have shown that a large fraction of genomes is transcribed, but the significance of this transcription is much debated. Here, we characterize the phylogenetic turnover of poly-adenylated transcripts in a comprehensive sampling of taxa of the mouse (genus Mus), spanning a phylogenetic distance of 10 Myr. Using deep RNA sequencing we find that at a given sequencing depth transcriptome coverage becomes saturated within a taxon, but keeps extending when compared between taxa, even at this very shallow phylogenetic level. Our data show a high turnover of transcriptional states between taxa and that no major transcript-free islands exist across evolutionary time. This suggests that the entire genome can be transcribed into poly-adenylated RNA when viewed at an evolutionary time scale. We conclude that any part of the non-coding genome can potentially become subject to evolutionary functionalization via de novo gene evolution within relatively short evolutionary time spans. DOI: http://dx.doi.org/10.7554/eLife.09977.001 PMID:26836309

  17. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )

    1991-01-01

    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  18. Synthesis and self-assembly of DNA-chromophore hybrid amphiphiles.

    PubMed

    Albert, Shine K; Golla, Murali; Thelu, Hari Veera Prasad; Krishnan, Nithiyanandan; Deepak, Perapaka; Varghese, Reji

    2016-08-01

    DNA based spherical nanostructures are one of the promising nanostructures for several biomedical and biotechnological applications due to their excellent biocompatibility and DNA-directed surface addressability. Herein, we report the synthesis and amphiphilicity-driven self-assembly of two classes of DNA (hydrophilic)-chromophore (hydrophobic) hybrid amphiphiles into spherical nanostructures. A solid-phase "click" chemistry based modular approach is demonstrated for the synthesis of DNA-chromophore amphiphiles. Various spectroscopic and microscopic analyses reveal the self-assembly of the amphiphiles into vesicular and micellar assemblies with the corona made of hydrophilic DNA and the hydrophobic chromophoric unit as the core of the spherical nanostructures. PMID:27241196

  19. De Novo Synthesis of Benzenoid Compounds by the Yeast Hanseniaspora vineae Increases the Flavor Diversity of Wines.

    PubMed

    Martin, Valentina; Giorello, Facundo; Fariña, Laura; Minteguiaga, Manuel; Salzman, Valentina; Boido, Eduardo; Aguilar, Pablo S; Gaggero, Carina; Dellacassa, Eduardo; Mas, Albert; Carrau, Francisco

    2016-06-01

    Benzyl alcohol and other benzenoid-derived metabolites of particular importance in plants confer floral and fruity flavors to wines. Among the volatile aroma components in Vitis vinifera grape varieties, benzyl alcohol is present in its free and glycosylated forms. These compounds are considered to originate from grapes only and not from fermentative processes. We have found increased levels of benzyl alcohol in red Tannat wine compared to that in grape juice, suggesting de novo formation of this metabolite during vinification. In this work, we show that benzyl alcohol, benzaldehyde, p-hydroxybenzaldehyde, and p-hydroxybenzyl alcohol are synthesized de novo in the absence of grape-derived precursors by Hanseniaspora vineae. Levels of benzyl alcohol produced by 11 different H. vineae strains were 20-200 times higher than those measured in fermentations with Saccharomyces cerevisiae strains. These results show that H. vineae contributes to flavor diversity by increasing grape variety aroma concentration in a chemically defined medium. Feeding experiments with phenylalanine, tryptophan, tyrosine, p-aminobenzoic acid, and ammonium in an artificial medium were tested to evaluate the effect of these compounds either as precursors or as potential pathway regulators for the formation of benzenoid-derived aromas. Genomic analysis shows that the phenylalanine ammonia-lyase (PAL) and tyrosine ammonia lyase (TAL) pathways, used by plants to generate benzyl alcohols from aromatic amino acids, are absent in the H. vineae genome. Consequently, alternative pathways derived from chorismate with mandelate as an intermediate are discussed. PMID:27193819

  20. Integrating S-phase Checkpoint Signaling with Trans-Lesion Synthesis of Bulky DNA Adducts

    PubMed Central

    Barkley, Laura R.; Ohmori, Haruo; Vaziri, Cyrus

    2011-01-01

    Bulky adducts are DNA lesions generated in response to environmental agents including benzo[a]pyrene (a combustion product) and solar ultraviolet radiation. Error-prone replication of adducted DNA can cause mutations, which may result in cancer. To minimize the detrimental effects of bulky adducts and other DNA lesions, S-phase checkpoint mechanisms sense DNA damage and integrate DNA repair with ongoing DNA replication. The essential protein kinase Chk1 mediates the S-phase checkpoint, inhibiting initiation of new DNA synthesis and promoting stabilization and recovery of stalled replication forks. Here we review the mechanisms by which Chk1 is activated in response to bulky adducts and potential mechanisms by which Chk1 signaling inhibits the initiation stage of DNA synthesis. Additionally, we discuss mechanisms by which Chk1 signaling facilitates bypass of bulky lesions by specialized Y-family DNA polymerases, thereby attenuating checkpoint signaling and allowing resumption of normal cell cycle progression. PMID:17652783

  1. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    SciTech Connect

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-dalton DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.

  2. Unscheduled DNA Synthesis: The Clinical and Functional Assay for Global Genomic DNA Nucleotide Excision Repair

    PubMed Central

    Latimer, Jean J.; Kelly, Crystal M.

    2016-01-01

    The unscheduled DNA synthesis (UDS) assay measures the ability of a cell to perform global genomic nucleotide excision repair (NER). This chapter provides instructions for the application of this technique by creating 6-4 photoproducts and pyrimidine dimers using UV-C irradiation. This procedure is designed specifically for quantification of the 6-4 photoproducts. Repair is quantified by the amount of radioactive thymidine incorporated during repair synthesis after this insult, and radioactivity is evaluated by grain counting after autoradiography. The results are used to clinically diagnose human DNA repair deficiency disorders and provide a basis for investigation of repair deficiency in human tissues or tumors. No other functional assay is available that directly measures the capacity to perform NER on the entire genome without the use of specific antibodies. Since live cells are required for this assay, explant culture techniques must be previously established. Host cell reactivation (HCR), as discussed in Chapter 37, is not an equivalent technique, as it measures only transcription-coupled repair (TCR) at active genes, a small subset of total NER. PMID:24623250

  3. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    PubMed

    Eastman, Alexander W; Yuan, Ze-Chun

    2014-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  4. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun

    2015-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  5. H(2)O(2) increases de novo synthesis of (6R)-L-erythro-5,6,7,8-tetrahydrobiopterin via GTP cyclohydrolase I and its feedback regulatory protein in vitiligo.

    PubMed

    Chavan, B; Beazley, W; Wood, J M; Rokos, H; Ichinose, H; Schallreuter, K U

    2009-02-01

    Patients with vitiligo accumulate up to 10(-3) mol/L concentrations of H(2)O(2) in their epidermis, which in turn affects many metabolic pathways in this compartment, including the synthesis and recycling of the cofactor (6R)-L-erythro-5,6,7,8-tetrahydrobiopterin (6BH(4)). De novo synthesis of 6BH(4) is dependent on the rate-limiting enzyme GTP cyclohydrolase I (GTPCHI) together with its feedback regulatory protein (GFRP). This step is controlled by 6BH(4) and the essential amino acid L-phenylalanine. In the study presented here we wanted to investigate whether H(2)O(2) affects the GTPCHI/GFRP cascade in these patients. Our results demonstrated concentration-dependent regulation of rhGTPCHI where 100 micromol/L H(2)O(2) was the optimum concentration for the activation of the enzyme and >300 micromol/L resulted in a decrease in activity. Oxidation of GFRP and GTPCHI does not affect feedback regulation via L-phenylalanine and 6BH(4). In vitiligo a constant upregulation of 6BH(4) de novo synthesis results from epidermal build up of L-phenylalanine that is not controlled by H(2)O(2). Taking the results together, 6BH(4) de novo synthesis is controlled by H(2)O(2) in a concentration-dependent manner, but H(2)O(2)-mediated oxidation does not affect the functionality of the GTPCHI/GFRP complex. PMID:19101819

  6. Synthesis and properties of mirror-image DNA.

    PubMed Central

    Urata, H; Ogura, E; Shinohara, K; Ueda, Y; Akagi, M

    1992-01-01

    We have investigated the conformations of the hexadeoxyribonucleotide, L-d(CGCGCG) composed of L-deoxyribose, the mirror image molecule of natural D-deoxyribose. In this paper, we report the synthesis of four L-deoxynucleosides and the L-oligonucleotide-ethidium bromide interactions. The L-deoxyribose synthon 9 was synthesized from L-arabinose with an over all yield of 28.5% via the Barton-McCombie reaction. The L-deoxynucleosides were obtained by a glycosylation of appropriate nucleobase derivatives with the 1-chloro sugar 9. After derivatization to nucleoside phosphoramidites, L-deoxycytidine and L-deoxyguanosine were incorporated into a hexadeoxynucleotide, L-d(CGCGCG) by a solid-phase beta-cyanoethylphosphoramidite method. This L-hexanucleotide was resistant to digestion with nuclease P1. The conformations of L-d(CGCGCG) were an exact mirror image of that of the corresponding natural one as described previously, and the conformations of the L-d(CGCGCG)-ethidium bromide complex were also the mirror images of those of the D-d(CGCGCG)-ethidium bromide complex under both low and high salt conditions. These results suggest that ethidium bromide prefers not a right-handed helical sense, but the base-base stacking geometry of the B-form rather than that of the Z-form. Thus, L-DNA would be a useful tool for studying DNA-drug interactions. PMID:1630904

  7. Method and apparatus for synthesis of arrays of DNA probes

    DOEpatents

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  8. De novo transcriptome analysis and highly sensitive digital gene expression profiling of Calliphora vicina (Diptera: Calliphoridae) pupae using MACE (Massive Analysis of cDNA Ends).

    PubMed

    Zajac, B K; Amendt, J; Horres, R; Verhoff, M A; Zehner, R

    2015-03-01

    Determining a post-mortem interval using the weight or length of blow fly larvae to calculate the insect's age is well established. However, to date, there are only a handful studies dealing with age estimation of blow fly pupae, in which weight or length cannot be used as a relevant parameter. The analysis of genetic markers, which indicate a certain developmental stage, can extend the period for a successful post-mortem interval determination. In order to break new ground in the field of age determination of forensic relevant blow flies, we performed a de novo transcriptome analysis of Calliphora vicina pupae at 15 different developmental stages. Obtained data serve as base to establish molecular age determination techniques. We used a new, deeper, and more cost-effective digital gene expression profiling method called MACE (Massive Analysis of cDNA Ends). We generated 15 libraries out of 15 developmental stages, with 3-8 million reads per library. In total, 53,539 distinct transcripts were detected, and 7548 were annotated to known insect genes. The analysis provides high-resolution gene expression profiles of all covered transcripts, which were used to identify differentially expressed genetic markers as candidates for a molecular age estimation of C. vicina pupae. Moreover, the analysis allows insights into gene activity of pupal development and the relationship between different genes interesting for insect development in general. PMID:25468442

  9. Sequence rearrangement and duplication of double stranded fibronectin cDNA probably occurring during cDNA synthesis by AMV reverse transcriptase and Escherichia coli DNA polymerase I.

    PubMed Central

    Fagan, J B; Pastan, I; de Crombrugghe, B

    1980-01-01

    Two cloned cDNAs derived from the mRNA for cell fibronectin have been sequenced, providing evidence that transcription with AMV reverse transcriptase or Escherichia coli DNA polymerase I may not always result in double stranded cDNA that is exactly homologous with its mRNA template. Instead, the sequences of these cloned cDNAs are consistent with the duplication and rearrangement of sequences during synthesis of double stranded cDNA. PMID:6159581

  10. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    PubMed

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  11. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  12. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  13. Radiation effects on DNA synthesis in a defined chromosomal replicon

    SciTech Connect

    Larner, J.M.; Lee, H.; Hamlin, J.L. )

    1994-03-01

    It has recently been shown that the tumor suppressor p53 mediates a signal transduction pathway that responds to DNA damage by arresting cells in the late G[sub 1] period of the cell cycle. However, the operation of this pathway alone cannot explain the 50% reduction in the rate of DNA synthesis that occurs within 30 min of irradiation of an asynchronous cell population. The authors are using the amplified dihydrofolate reductase (DHFR) domain in the methotrexate-resistance CHO cell line, CHOC 400, as a model replicon in which to study this acute radiation effect. They first show that the CHOC-400 cell line retains the classical acute-phase response but does not display the late G[sub 1] arrest that characterizes the p53-mediated checkpoint. Using a two-dimensional gel replicon-mapping method, they then show that when asynchronous cultures are irradiated with 900 cGy, initiation in the DHFR locus is completely inhibited within 30 min and does not resume for 3 to 4 h. Since initiation in this locus occurs throughout the first 2 h of the S period, this result implies the existence of a p53-independent S-phase damage-sensing pathway that functions at the level of individual origins. Results obtained with the replication inhibitor mimosine define a position near the G[sub 1]/S boundary beyond which cells are unable to prevent initiation at early-firing origins in response to irradiation. This is the first direct demonstration at a defined chromosomal origin that radiation quantitatively down-regulates initiation. 42 refs., 9 figs.

  14. DNA synthesis in yeast cell-free extracts dependent on recombinant DNA plasmids purified from Escherichia coli.

    PubMed Central

    Jong, A Y; Scott, J F

    1985-01-01

    In our attempts to establish a cell-free DNA replication system for the yeast Saccharomyces cerevisiae, we have observed that recombinant DNA plasmids purified from Escherichia coli by a common procedure (lysozyme-detergent lysis and equilibrium banding in cesium chloride ethidium bromide gradients) often serve as templates for DNA synthesis by elongation enzymes. The templates could be elongated equally well by enzymes present in the yeast cell-free extracts, by the large proteolytic fragment of E. coli DNA polymerase I or by T4 DNA polymerase. The template activity of the purified plasmids was dependent on the presence of heterologous DNA segments in the bacterial vectors. The template activity could be diminished by treatment with alkali. We propose that the ability of recombinant plasmids isolated from bacterial hosts to serve as elongation templates may lead to erroneous conclusions when these plasmids are used as templates for in vitro replication or transcription reactions. Images PMID:3889851

  15. Short-step chemical synthesis of DNA by use of MMTrS group for protection of 5'-hydroxyl group.

    PubMed

    Shiraishi, Miyuki; Utagawa, Eri; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2007-01-01

    4-methoxytrithylthio (MMTrS) group was applied for the appropriately protected four canonical nucleosides. We prepared the phosphoroamidite units by use of these nucleosides and developed the synthesis of oligodeoxynucleotides without any acidic treatment. Moreover, the new DNA synthesis protocol was applied to an automated DNA synthesizer for the synthesis of longer oligodeoxynucleotides. PMID:18029620

  16. RecG Directs DNA Synthesis during Double-Strand Break Repair

    PubMed Central

    Azeroglu, Benura; Mawer, Julia S. P.; Cockram, Charlotte A.; White, Martin A.; Hasan, A. M. Mahedi; Filatenkova, Milana; Leach, David R. F.

    2016-01-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability. PMID:26872352

  17. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    SciTech Connect

    Lee, E.W.; Johnson, J.T.; Garner, C.D. )

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of ({sup 3}H)thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 {mu}M. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of ({sup 3}H)thymidine triphosphate into DNA up to 24 {mu}M but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase {alpha}, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase {alpha}, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause.

  18. Inhibition of mouse peritoneal macrophage DNA synthesis by infection with the arenavirus Pichinde.

    PubMed Central

    Friedlander, A M; Jahrling, P B; Merrill, P; Tobery, S

    1984-01-01

    Macrophage DNA synthesis and proliferation occur during the development of cell-mediated immunity and in the early nonspecific reaction to infection. Arenaviruses have a predilection for infection of cells of the reticuloendothelial system, and in this study we have examined the effect of the arenavirus Pichinde on macrophage DNA synthesis. We have found that infection of mouse peritoneal macrophages with Pichinde caused a profound dose-dependent inhibition of the DNA synthesis induced by macrophage growth factor-colony stimulating factor. At a multiplicity of inoculum of 5, there is a 75 to 95% inhibition of DNA synthesis. Viable virus is necessary for inhibition since Pichinde inactivated by heat or cobalt irradiation had no effect. Similarly, virus pretreated with an antiserum to Pichinde was without inhibitory effect. Inhibition was demonstrated by measuring DNA synthesis spectrofluorometrically as well as by [3H]thymidine incorporation. The inhibition of DNA synthesis was not associated with any cytopathology. There was no evidence that the inhibition was due to soluble factors, such as prostaglandins or interferon, released by infected cells. These studies demonstrate, for the first time in vitro, a significant alteration in macrophage function caused by infection with an arenavirus. It is possible that inhibition of macrophage proliferation represents a mechanism by which some microorganisms interfere with host resistance. PMID:6690404

  19. An inhibitor of the kinesin spindle protein activates the intrinsic apoptotic pathway independently of p53 and de novo protein synthesis.

    PubMed

    Tao, Weikang; South, Victoria J; Diehl, Ronald E; Davide, Joseph P; Sepp-Lorenzino, Laura; Fraley, Mark E; Arrington, Kenneth L; Lobell, Robert B

    2007-01-01

    The kinesin spindle protein (KSP), a microtubule motor protein, is essential for the formation of bipolar spindles during mitosis. Inhibition of KSP activates the spindle checkpoint and causes apoptosis. It was shown that prolonged inhibition of KSP activates Bax and caspase-3, which requires a competent spindle checkpoint and couples with mitotic slippage. Here we investigated how Bax is activated by KSP inhibition and the roles of Bax and p53 in KSP inhibitor-induced apoptosis. We demonstrate that small interfering RNA-mediated knockdown of Bax greatly attenuates KSP inhibitor-induced apoptosis and that Bax activation is upstream of caspase activation. This indicates that Bax mediates the lethality of KSP inhibitors and that KSP inhibition provokes apoptosis via the intrinsic apoptotic pathway where Bax activation is prior to caspase activation. Although the BH3-only protein Puma is induced after mitotic slippage, suppression of de novo protein synthesis that abrogates Puma induction does not block activation of Bax or caspase-3, indicating that Bax activation is triggered by a posttranslational event. Comparison of KSP inhibitor-induced apoptosis between matched cell lines containing either functional or deficient p53 reveals that inhibition of KSP induces apoptosis independently of p53 and that p53 is dispensable for spindle checkpoint function. Thus, KSP inhibitors should be active in p53-deficient tumors. PMID:17101792

  20. Role of Hydroxytyrosol-dependent Regulation of HO-1 Expression in Promoting Wound Healing of Vascular Endothelial Cells via Nrf2 De Novo Synthesis and Stabilization.

    PubMed

    Zrelli, Houda; Kusunoki, Miki; Miyazaki, Hitoshi

    2015-07-01

    Hydroxytyrosol (HT), an olive plant (Olea europaea L.) polyphenol, has proven atheroprotective effects. We previously demonstrated that heme oxygenase-1 (HO-1) is involved in the HT dependent prevention of dysfunction induced by oxidative stress in vascular endothelial cells (VECs). Here, we further investigated the signaling pathway of HT-dependent HO-1 expression in VECs. HT dose- and time-dependently increased HO-1 mRNA and protein levels through the PI3K/Akt and ERK1/2 pathways. Cycloheximide and actinomycin D inhibited both increases, suggesting that HT-triggered HO-1 induction is transcriptionally regulated and that de novo protein synthesis is necessary for this HT effect. HT stimulated nuclear accumulation of nuclear factor E2-related factor 2 (Nrf2). This Nrf2 accumulation was blocked by actinomycin D and cycloheximide whereas HT in combination with the 26S proteasome inhibitor MG132 enhanced the accumulation. HT also extended the half-life of Nrf2 proteins by decelerating its turnover. Moreover, HO-1 inhibitor, ZnppIX and CO scavenger, hemoglobin impaired HT-dependent wound healing while CORM-2, a CO generator, accelerated wound closure. Together, these data demonstrate that HT upregulates HO-1 expression by stimulating the nuclear accumulation and stabilization of Nrf2, leading to the wound repair of VECs crucial in the prevention of atherosclerosis. PMID:25870947

  1. de novo Design and Synthesis of Candida antarctica Lipase B Gene and α-Factor Leads to High-Level Expression in Pichia pastoris

    PubMed Central

    Yang, Jiang-Ke; Liu, Li-Ying; Dai, Jiang-Hong; Li, Qin

    2013-01-01

    Candida antarctica lipase B (CALB) is one of the most widely used and studied enzymes in the world. In order to achieve the high-level expression of CALB in Pichia, we optimized the codons of CALB gene and α-factor by using a de novo design and synthesis strategy. Through comparative analysis of a series of recombinants with different expression components, we found that the methanol-inducible expression recombinant carrying the codon-optimized α-factor and mature CALB gene (pPIC9KαM-CalBM) has the highest lipase production capacity. After fermentation parameters optimization, the lipase activity and protein content of the recombinant pPIC9KαM-CalBM reached 6,100 U/mL and 3.0 g/L, respectively, in a 5-L fermentor. We believe this strategy could be of special interest due to its capacity to improve the expression level of target gene, and the Pichia transformants carrying the codon-optimized gene had great potential for the industrial-scale production of CALB lipase. PMID:23326544

  2. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation.

    PubMed Central

    Semenza, G L; Wang, G L

    1992-01-01

    We have identified a 50-nucleotide enhancer from the human erythropoietin gene 3'-flanking sequence which can mediate a sevenfold transcriptional induction in response to hypoxia when cloned 3' to a simian virus 40 promoter-chloramphenicol acetyltransferase reporter gene and transiently expressed in Hep3B cells. Nucleotides (nt) 1 to 33 of this sequence mediate sevenfold induction of reporter gene expression when present in two tandem copies compared with threefold induction when present in a single copy, suggesting that nt 34 to 50 bind a factor which amplifies the induction signal. DNase I footprinting demonstrated binding of a constitutive nuclear factor to nt 26 to 48. Mutagenesis studies revealed that nt 4 to 12 and 19 to 23 are essential for induction, as substitutions at either site eliminated hypoxia-induced expression. Electrophoretic mobility shift assays identified a nuclear factor which bound to a probe spanning nt 1 to 18 but not to a probe containing a mutation which eliminated enhancer function. Factor binding was induced by hypoxia, and its induction was sensitive to cycloheximide treatment. We have thus defined a functionally tripartite, 50-nt hypoxia-inducible enhancer which binds several nuclear factors, one of which is induced by hypoxia via de novo protein synthesis. Images PMID:1448077

  3. Contribution of proteolysis and de novo synthesis to alanine production in diabetic rat skeletal muscle: a 15N/1H nuclear magnetic resonance study.

    PubMed

    Meynial-Denis, D; Chavaroux, A; Foucat, L; Mignon, M; Prugnaud, J; Bayle, G; Renou, J P; Arnal, M

    1997-10-01

    To assess the role of leucine as a precursor of alanine alpha-amino nitrogen in skeletal muscle during diabetes, extensor digitorum longus muscles from control (n = 7 experiments) and streptozotocin-diabetic rats (n = 8 experiments) were isolated and superfused with [15N]leucine (3 mmol/l) in the presence of glucose (10 mmol/l) for 2 h. Muscle perchloric acid extraction was performed at the end of superfusion in order to quantify newly synthesized alanine by 15N/1H nuclear magnetic resonance. Release of [15N]alanine in the superfusion medium was also measured. The pool of newly synthesized [15N]alanine was significantly increased (approximately 40%) in extensor digitorum longus muscles from streptozotocin-diabetic rats. Whereas a significant enhancement of total alanine release from muscle was induced by diabetes (20%), only a slight increase in [15N]alanine release was detectable under our experimental conditions. Consequently, we conclude that streptozotocin-diabetes in growing rats induces in skeletal muscle: 1) an increase in nitrogen exchange between leucine and alanine leading to newly synthesized [15N]alanine; and 2) an increase of total alanine release from muscle originating from both proteolysis and de novo synthesis. PMID:9349596

  4. Adipose Weight Gain during Chronic Insulin Treatment of Mice Results from Changes in Lipid Storage without Affecting De Novo Synthesis of Palmitate

    PubMed Central

    Frikke-Schmidt, Henriette; Pedersen, Thomas Åskov; Fledelius, Christian; Olsen, Grith Skytte; Hellerstein, Marc

    2013-01-01

    Insulin treatment is associated with increased adipose mass in both humans and mice. However, the underlying dynamic basis of insulin induced lipid accumulation in adipose tissue remains elusive. To assess this, young female C57BL6/J mice were fed a low fat diet for 3 weeks, treated subsequently with 7 days of constant subcutaneous insulin infusion by osmotic minipumps and compared to mice with only buffer infused. To track changes in lipid deposition during insulin treatment, metabolic labeling was conducted with heavy water for the final 4 days. Blood glucose was significantly lowered within one hour after implantation of insulin loaded mini pumps and remained lower throughout the study. Insulin treated animals gained significantly more weight during treatment and the mean weight of the subcutaneous adipose depots was significantly higher with the highest dose of insulin. Surprisingly, de novo palmitate synthesis within the subcutaneous and the gonadal depots was not affected significantly by insulin treatment. In contrast insulin treatment caused accumulation of triglycerides in both depots due to either deposition of newly synthesised triglycerides (subcutaneous depot) or inhibition of lipolysis (gonadal depot). PMID:24069458

  5. The cobY gene of the archaeon Halobacterium sp. strain NRC-1 is required for de novo cobamide synthesis.

    PubMed

    Woodson, J D; Peck, R F; Krebs, M P; Escalante-Semerena, J C

    2003-01-01

    Genetic and nutritional analyses of mutants of the extremely halophilic archaeon Halobacterium sp. strain NRC-1 showed that open reading frame (ORF) Vng1581C encodes a protein with nucleoside triphosphate:adenosylcobinamide-phosphate nucleotidyltransferase enzyme activity. This activity was previously associated with the cobY gene of the methanogenic archaeon Methanobacterium thermoautotrophicum strain DeltaH, but no evidence was obtained to demonstrate the direct involvement of this protein in cobamide biosynthesis in archaea. Computer analysis of the Halobacterium sp. strain NRC-1 ORF Vng1581C gene and the cobY gene of M. thermoautotrophicum strain DeltaH showed the primary amino acid sequence of the proteins encoded by these two genes to be 35% identical and 48% similar. A strain of Halobacterium sp. strain NRC-1 carrying a null allele of the cobY gene was auxotrophic for cobinamide-GDP, a known intermediate of the late steps of cobamide biosynthesis. The auxotrophic requirement for cobinamide-GDP was corrected when a wild-type allele of cobY was introduced into the mutant strain, demonstrating that the lack of cobY function was solely responsible for the observed block in cobamide biosynthesis in this archaeon. The data also show that Halobacterium sp. strain NRC-1 possesses a high-affinity transport system for corrinoids and that this archaeon can synthesize cobamides de novo under aerobic growth conditions. To the best of our knowledge this is the first genetic and nutritional analysis of cobalamin biosynthetic mutants in archaea. PMID:12486068

  6. Protection of CpG islands against de novo DNA methylation during oogenesis is associated with the recognition site of E2f1 and E2f2

    PubMed Central

    2014-01-01

    Background Epigenetic reprogramming during early mammalian embryonic and germ cell development is a genome-wide process. CpG islands (CGIs), central to the regulation of mammalian gene expression, are exceptional in terms of whether, when and how they are affected by epigenetic reprogramming. Results We investigated the DNA sequences of CGIs in the context of genome-wide data on DNA methylation and transcription during oogenesis and early embryogenesis to identify signals associated with methylation establishment and protection from de novo methylation in oocytes and associated with post-fertilisation methylation maintenance. We find no evidence for a characteristic DNA sequence motif in oocyte-methylated CGIs. Neither do we find evidence for a general role of regular CpG spacing in methylation establishment at CGIs in oocytes. In contrast, the resistance of most CGIs to de novo methylation during oogenesis is associated with the motif CGCGC, the recognition site of E2f1 and E2f2, transcription factors highly expressed specifically in oocytes. This association is independent of prominent known hypomethylation-associated factors: CGI promoter activity, H3K4me3, Cfp1 binding or R-loop formation potential. Conclusions Our results support a DNA sequence-independent and transcription-driven model of de novo CGI methylation during oogenesis. In contrast, our results for CGIs that remain unmethylated are consistent with a model of protection from methylation involving sequence recognition by DNA-binding proteins, E2f1 and E2f2 being probable candidates. PMID:25478011

  7. Synthesis, integration, and restriction and modification of mycoplasma virus L2 DNA

    SciTech Connect

    Dybvig, K.

    1981-01-01

    Mycoplasma virus L2 is an enveloped, nonlytic virus containing double-stranded, superhelical DNA. The L2 virion contains about 7 to 8 major proteins identified by SDS-polyacrylamide gel electrophoresis, but the virion has no discernible capsid structure. It has been suggested that the L2 virion is a DNA-protein condensation surrounded by a lipid-protein membrane. The host for mycoplasma virus L2 is Acholeplasma laidlawii. A. laidlawii has no cell wall and contains a small genome, 1 x 10/sup 9/ daltons, which is two to three times smaller than that of most bacteria. Infection of A. laidlawii by L2 is nonlytic. The studies in this thesis show that L2 DNA synthesis begins at about 1 hour of infection and lasts throughout the infection. Viral DNA synthesis is inhibited by chloramphenicol, streptomycin, and novobiocin. Packaging of L2 DNA into progeny virus is also inhibited by chloramphenicol and novobiocin. It is concluded that protein synthesis and probably DNA gyrase activity are required for L2 DNA synthesis, and for packaging of L2 DNA into progeny virus. DNA-DNA hybridization studies demonstrate that L2 DNA integrates into the host cell during infection, and subsequent to infection the cells are mycoplasma virus L2 lysogens. The viral site of integration has been roughly mapped. L2 virus is restricted and modified by A. laidlawii strains JA1 and K2. The nature of the modification in strain K2 has been elucidated. Two L2 variants containing insertions in the viral DNA were identified in these studies. Restriction endonuclease cleavage maps of these variants have been determined. DNA from L2 and another isolate of L2, MV-Lg-L 172, are compared in these studies. 74 references, 33 figures, 6 tables. (ACR)

  8. DNA SYNTHESIS IN THE FERTILIZING HAMSTER SPERM NUCLEUS: SPERM TEMPLATE AVAILABILITY AND EGG CYTOPLASMIC CONTROL

    EPA Science Inventory

    To assess the role of sperm template availability in the regulation of DNA synthesis, the morphological status of the fertilizing hamster sperm nucleus was correlated with its ability to synthesize DNA after in vivo and in vitro fertilization. Fertilized hamster eggs were incubat...

  9. Requirement of E. coli DNA synthesis functions for the lytic replication of bacteriophage P1.

    PubMed

    Hay, N; Cohen, G

    1983-11-01

    P1 lytic growth was examined in a number of different temperature sensitive mutants of E. coli that affect chromosomal replication. Growth was analyzed by measurements of phage burst sizes and specific DNA synthesis. Efficient P1 growth required each of the bacterial elongation functions dnaE (polC), dnaZ (sub units of E. coli polymerase III holoenzyme), and dnaG (primase) but was not dependent on the elongation function dnaB (mobile promoter). Of two initiation functions tested the dnaA function was found to be dispensable for normal growth whereas the dnaC function was essential. Temperature shift experiments with different dnaC mutants showed that the initiation component of the dnaC function was needed continuously throughout at least the first half of the lytic cycle, while the dnaC elongation activity was probably required during the entire cycle for normal phage yields. In two respects the dependence of P1 lytic growth on E. coli DNA synthesis functions was significantly different from that reported for P1 plasmid replication (Scott and Vapnek, 1980). Thus, lytic replication was far more dependent on a functional polC gene product than was plasmid replication and did not require the bacterial dnaB product. PMID:6359668

  10. Novel Antibiotic-Free Plasmid Selection System Based on Complementation of Host Auxotrophy in the NAD De Novo Synthesis Pathway▿ †

    PubMed Central

    Dong, Wei-Ren; Xiang, Li-Xin; Shao, Jian-Zhong

    2010-01-01

    The use of antibiotic resistance genes in plasmids causes potential biosafety and clinical hazards, such as the possibility of horizontal spread of resistance genes or the rapid emergence of multidrug-resistant pathogens. This paper introduces a novel auxotrophy complementation system that allowed plasmids and host cells to be effectively selected and maintained without the use of antibiotics. An Escherichia coli strain carrying a defect in NAD de novo biosynthesis was constructed by knocking out the chromosomal quinolinic acid phosphoribosyltransferase (QAPRTase) gene. The resistance gene in the plasmids was replaced by the QAPRTase gene of E. coli or the mouse. As a result, only expression of the QAPRTase gene from plasmids can complement and rescue E. coli host cells in minimal medium. This is the first time that a vertebrate gene has been used to construct a nonantibiotic selection system, and it can be widely applied in DNA vaccine and gene therapy. As the QAPRTase gene is ubiquitous in species ranging from bacteria to mammals, the potential environmental biosafety problems caused by horizontal gene transfer can be eliminated. PMID:20118370

  11. Cellular integrity is required for inhibition of initiation of cellular DNA synthesis by reovirus type 3.

    PubMed Central

    Roner, M R; Cox, D C

    1985-01-01

    Synchronized HeLa cells, primed for entry into the synthesis phase by amethopterin, were prevented from initiating DNA synthesis 9 h after infection with reovirus type 3. However, nuclei isolated from synchronized cells infected with reovirus for 9 or 16 h demonstrated a restored ability to synthesize DNA. The addition of enucleated cytoplasmic extracts from infected or uninfected cells did not affect this restored capacity for synthesis. The addition of ribonucleotide triphosphates to nuclei isolated from infected cells stimulated additional DNA synthesis, suggesting that these nuclei were competent to initiate new rounds of DNA replication. Permeabilization of infected cells did not restore the ability of these cells to synthesize DNA. Nucleoids isolated from intact or permeabilized cells, infected for 9 or 16 h displayed an increased rate of sedimentation when compared with nucleoids isolated from uninfected cells. Nucleoids isolated from the nuclei of infected cells demonstrated a rate of sedimentation similar to that of nucleoids isolated from the nuclei of uninfected cells. The inhibition of initiation of cellular DNA synthesis by reovirus type 3 appears not to have been due to a permanent alteration of the replication complex, but this inhibition could be reversed by the removal of that complex from factors unique to the structural or metabolic integrity of the infected cell. Images PMID:3968718

  12. Effects of 3-aminobenzamide on DNA synthesis and cell cycle progression in Chinese hamster ovary cells

    SciTech Connect

    Schwartz, J.L.; Morgan, W.F.; Kapp, L.N.; Wolff, S.

    1983-01-01

    3-Aminobenzamide (3AB), in inhibitor of poly(ADP-ribose) polymerase, is a potent inducer of sister chromatid exchanges (SCEs). Because of the possible relation between SCEs and DNA synthesis, the effects of 3AB on DNA synthesis and cell cycle progression in Chinese hamster ovary (CHO) cells were examined. Unlike all other SCE-inducing agents whose effects on DNA synthesis have been studied, short term exposures (30-120 min) of 3AB did not inhibit the overall rate of DNA synthesis and this result was independent of the amount of bromodeoxyuridine (BrdU) in the DNA. Longer exposure times (>24 h) did result in an extended S phase, but this was not due to an effect on the rate of DNA chain elongation. 3AB also delayed the entry of cells into S phase. The overall cell cycle delay was dose dependent, approaching 9 h after a 54 h exposure to 10 mM 3AB. Earlier reports that 3AB is neither mutagenic nor cytotoxic were confirmed. Thus 3AB acts to increase SCE frequency by a mechanism distinct from that which causes cytotoxicity and mutagenicity, and does not involve any inhibition in the rate of DNA chain growth. 25 references, 3 figures, 2 tables.

  13. Acyl-chain remodeling of dioctanoyl-phosphatidylcholine in Saccharomyces cerevisiae mutant defective in de novo and salvage phosphatidylcholine synthesis

    SciTech Connect

    Kishino, Hideyuki; Eguchi, Hiroki; Takagi, Keiko; Horiuchi, Hiroyuki; Fukuda, Ryouichi; Ohta, Akinori

    2014-03-07

    Highlights: • Dioctanoyl-PC (diC8PC) supported growth of a yeast mutant defective in PC synthesis. • diC8PC was converted to PC species containing longer acyl residues in the mutant. • Both acyl residues of diC8PC were replaced by longer fatty acids in vitro. • This system will contribute to the elucidation of the acyl chain remodeling of PC. - Abstract: A yeast strain, in which endogenous phosphatidylcholine (PC) synthesis is controllable, was constructed by the replacement of the promoter of PCT1, encoding CTP:phosphocholine cytidylyltransferase, with GAL1 promoter in a double deletion mutant of PEM1 and PEM2, encoding phosphatidylethanolamine methyltransferase and phospholipid methyltransferase, respectively. This mutant did not grow in the glucose-containing medium, but the addition of dioctanoyl-phosphatidylcholine (diC8PC) supported its growth. Analyses of the metabolism of {sup 13}C-labeled diC8PC ((methyl-{sup 13}C){sub 3}-diC8PC) in this strain using electrospray ionization tandem mass spectrometry revealed that it was converted to PC species containing acyl residues of 16 or 18 carbons at both sn-1 and sn-2 positions. In addition, both acyl residues of (methyl-{sup 13}C){sub 3}-diC8PC were replaced with 16:1 acyl chains in the in vitro reaction using the yeast cell extract in the presence of palmitoleoyl-CoA. These results indicate that PC containing short acyl residues was remodeled to those with acyl chains of physiological length in yeast.

  14. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients

    PubMed Central

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-01-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. PMID:26126624

  15. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    PubMed

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. PMID:26126624

  16. Long-lived crowded-litter mice have an age-dependent increase in protein synthesis to DNA synthesis ratio and mTORC1 substrate phosphorylation

    PubMed Central

    Bruns, Danielle R.; Peelor, Frederick F.; Biela, Laurie M.; Miller, Richard A.; Hamilton, Karyn L.; Miller, Benjamin F.

    2014-01-01

    Increasing mouse litter size [crowded litter (CL)] presumably imposes a transient nutrient stress during suckling and extends lifespan through unknown mechanisms. Chronic calorically restricted and rapamycin-treated mice have decreased DNA synthesis and mTOR complex 1 (mTORC1) signaling but maintained protein synthesis, suggesting maintenance of existing cellular structures. We hypothesized that CL would exhibit similar synthetic and signaling responses to other long-lived models and, by comparing synthesis of new protein to new DNA, that insight may be gained into the potential preservation of existing cellular structures in the CL model. Protein and DNA synthesis was assessed in gastroc complex, heart, and liver of 4- and 7-mo CL mice. We also examined mTORC1 signaling in 3- and 7-mo aged animals. Compared with controls, 4-mo CL had greater DNA synthesis in gastroc complex with no differences in protein synthesis or mTORC1 substrate phosphorylation across tissues. Seven-month CL had less DNA synthesis than controls in heart and greater protein synthesis and mTORC1 substrate phosphorylation across tissues. The increased new protein-to-new DNA synthesis ratio suggests that new proteins are synthesized more so in existing cells at 7 mo, differing from 4 mo, in CL vs. controls. We propose that, in CL, protein synthesis shifts from being directed toward new cells (4 mo) to maintenance of existing cellular structures (7 mo), independently of decreased mTORC1. PMID:25205819

  17. The DNA intercalating alkaloid cryptolepine interferes with topoisomerase II and inhibits primarily DNA synthesis in B16 melanoma cells.

    PubMed

    Bonjean, K; De Pauw-Gillet, M C; Defresne, M P; Colson, P; Houssier, C; Dassonneville, L; Bailly, C; Greimers, R; Wright, C; Quetin-Leclercq, J; Tits, M; Angenot, L

    1998-04-14

    Cryptolepine hydrochloride is an indoloquinoline alkaloid isolated from the roots of Cryptolepis sanguinolenta. It is characterized by a multiplicity of host-mediated biological activities, including antibacterial, antiviral, and antimalarial properties. To date, the molecular basis for its diverse biological effects remains largely uncertain. Several lines of evidence strongly suggest that DNA might correspond to its principal cellular target. Consequently, we studied the strength and mode of binding to DNA of cryptolepine by means of absorption, fluorescence, circular, and linear dichroism, as well as by a relaxation assay using DNA topoisomerases. The results of various optical and gel electrophoresis techniques converge to reveal that the alkaloid binds tightly to DNA and behaves as a typical intercalating agent. In DNAase I footprinting experiments it was found that the drug interacts preferentially with GC-rich sequences and discriminates against homo-oligomeric runs of A and T. This study has also led to the discovery that cryptolepine is a potent topoisomerase II inhibitor and a promising antitumor agent. It stabilizes topoisomerase II-DNA covalent complexes and stimulates the cutting of DNA at a subset of preexisting topoisomerase II cleavage sites. Taking advantage of the fluorescence of the indoloquinoline chromophore, fluorescence microscopy was used to map cellular uptake of the drug. Cryptolepine easily crosses the cell membranes and accumulates selectively into the nuclei rather than in the cytoplasm of B16 melanoma cells. Quantitative analyses of DNA in cells after Feulgen reaction and image cytometry reveal that the drug blocks the cell cycle in G2/M phases. It is also shown that the alkaloid is more potent at inhibiting DNA synthesis rather than RNA and protein synthesis. Altogether, the results provide direct evidence that DNA is the primary target of cryptolepine and suggest that this alkaloid is a valid candidate for the development of tumor

  18. Effect of biodegradation and de novo matrix synthesis on the mechanical properties of valvular interstitial cell-seeded polyglycerol sebacate-polycaprolactone scaffolds.

    PubMed

    Sant, Shilpa; Iyer, Dharini; Gaharwar, Akhilesh K; Patel, Alpesh; Khademhosseini, Ali

    2013-04-01

    The development of living heart valves that grow with the patient is a promising strategy for heart valve replacements in pediatric patients. Despite active research in the field of tissue engineered heart valves there have been limited efforts to optimize the balance between biodegradation of the scaffolds and de novo extracellular matrix (ECM) synthesis by cells and study their consequences on the mechanical properties of the cell-seeded construct. This study investigates the effect of in vitro degradation and ECM secretion on the mechanical properties of hybrid polyester scaffolds. The scaffolds were synthesized from blends of fast degrading polyglycerol sebacate (PGS) and slowly degrading polycaprolactone (PCL). PGS-PCL scaffolds were electrospun using a 2:1 ratio of PGS to PCL. Accelerated hydrolytic degradation in 0.1 mM sodium hydroxide revealed 2-fold faster degradation of PGS-PCL scaffolds compared with PCL scaffolds. Thermal analysis and scanning electron microscopy demonstrated marginal change in PCL scaffold properties, while PGS-PCL scaffolds showed preferential mass loss of PGS and thinning of the individual fibers during degradation. Consequently, the mechanical properties of PGS-PCL scaffolds decreased gradually with no significant change for PCL scaffolds during accelerated degradation. Valvular interstitial cells (VICs) seeded on PGS-PCL scaffolds showed higher ECM protein secretion compared with PCL. Thus the mechanical properties of the cell-seeded PCL scaffolds did not change significantly compared with acellular scaffolds, probably due to slower degradation and ECM deposition by VICs. In contrast, the PGS-PCL scaffolds exhibited a gradual decrease in the mechanical properties of the acellular scaffolds due to degradation, which was compensated for by new matrix secreted by VICs seeded on the scaffolds. Our study demonstrated that the faster degrading PGS component of PGS-PCL accelerated the degradation rate of the scaffolds. VICs, on the other

  19. Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition

    PubMed Central

    2013-01-01

    Background In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). Results High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. Conclusions These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases. PMID:24289474

  20. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis

    PubMed Central

    Levring, Trine B.; Kongsbak, Martin; Rode, Anna K. O.; Woetmann, Anders; Ødum, Niels; Bonefeld, Charlotte Menné; Geisler, Carsten

    2015-01-01

    Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined. The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys2. Vice-versa, the GSH synthesis inhibitor L-buthionine-sulfoximine (BSO) and inhibition of Cys2 uptake with glutamate inhibited GSH and DNA synthesis in parallel. We further found that thioredoxin (Trx) can partly substitute for GSH during DNA synthesis. Finally, we show that GSH or Trx is required for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production of GSH, which in turn is required for optimal RNR-mediated deoxyribonucleotide synthesis and DNA replication. PMID:26392411

  1. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    NASA Astrophysics Data System (ADS)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  2. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  3. Further Studies on Bacteriophage T4 DNA Synthesis in Sucrose-Plasmolyzed Cells

    PubMed Central

    Stafford, Mary E.; Reddy, G. Prem Veer; Mathews, Christopher K.

    1977-01-01

    This paper describes several technical improvements in the sucrose-plasmolyzed cell system used in earlier experiments on DNA synthesis in situ with Escherichia coli infected by DNA-defective mutants of bacteriophage T4 (W. L. Collinsworth and C. K. Mathews, J. Virol. 13:908-915, 1974). Using this system, which is based primarily on that of M. G. Wovcha et al. (Proc. Natl. Acad. Sci. U.S.A. 70:2196-2200, 1973), we reinvestigated the properties of mutants bearing lesions in genes 1, 41, and 62, and we resolved some disagreements with data reported from that laboratory. We also asked whether the DNA-delay phenotype of T4 mutants is related to possible early leakage of DNA precursors from infected cells. Such cells display defective DNA synthesis in situ, even when ample DNA precursors are made available. Thus, the lesions associated with these mutations seem to manifest themselves at the level of macromolecular metabolism. Similarly, we examined an E. coli mutant defective in its ability to support T4 production, apparently because of a lesion affecting DNA synthesis (L. Simon et al., Nature [London] 252:451-455). In the plasmolyzed cell system, reduced nucleotide incorporation is seen, indicating also that the genetic defect does not involve DNA precursor synthesis. The plasmolyzed cell system incorporates deoxynucleotide 5′-monophosphates into DNA severalfold more rapidly than the corresponding 5′-triphosphates. This is consistent with the idea that DNA precursor-synthesizing enzymes are functionally organized to shuttle substrates to their sites of utilization. PMID:328926

  4. De novo design, synthesis, and pharmacology of alpha-melanocyte stimulating hormone analogues derived from somatostatin by a hybrid approach.

    PubMed

    Han, Guoxia; Haskell-Luevano, Carrie; Kendall, Laura; Bonner, Gregg; Hadley, Mac E; Cone, Roger D; Hruby, Victor J

    2004-03-11

    A number of alpha-melanotropin (alpha-MSH) analogues have been designed de novo, synthesized, and bioassayed at different melanocortin receptors from frog skin (fMC1R) and mouse/rat (mMC1R, rMC3R, mMC4R, and mMC5R). These ligands were designed from somatostatin by a hybrid approach, which utilizes a modified cyclic structure (H-d-Phe-c[Cys---Cys]-Thr-NH(2)) related to somatostatin analogues (e.g. sandostatin) acting at somatostatin receptors, CTAP which binds specifically to micro opioid receptors, and the core pharmacophore of alpha-MSH (His-Phe-Arg-Trp). Ligands designed were H-d-Phe-c[XXX-YYY-ZZZ-Arg-Trp-AAA]-Thr-NH(2) [XXX and AAA = Cys, d-Cys, Hcy, Pen, d-Pen; YYY = His, His(1'-Me), His(3'-Me); ZZZ = Phe and side chain halogen substituted Phe, d-Phe, d-Nal(1'), and d-Nal(2')]. The compounds showed a wide range of bioactivities at the frog skin MC1R; e.g. H-d-Phe-c[Hcy-His-d-Phe-Arg-Trp-Cys]-Thr-NH(2) (6, EC(50) = 0.30 nM) and H-d-Phe-c[Cys-His-d-Phe-Arg-Trp-d-Cys]-Thr-NH(2) (8, EC(50) = 0.10 nM). In addition, when a lactam bridge was used as in H-d-Phe-c[Asp-His-d-Phe-Arg-Trp-Lys]-Thr-NH(2) (7, EC(50) = 0.10 nM), the analogue obtained is as potent as alpha-MSH in the frog skin MC1R assay. Interestingly, switching the bridge of 6 to give H-d-Phe-c[Cys-His-d-Phe-Arg-Trp-Hcy]-Thr-NH(2) (5, EC(50) = 1000 nM) led to a 3000-fold decrease in agonist activity. An increase in steric size in the side chain of d-Phe(7) reduced the bioactivity significantly. For example, H-d-Phe-c[Cys-His-d-Nal(1')-Arg-Trp-d-Cys]-Thr-NH(2) (24) is 2000-fold less active than 9. On the other hand, H-d-Phe-c[Cys-His-d-Phe(p-I)-Arg-Trp-d-Cys]-Thr-NH(2) (23) lost all agonist activity and became a weak antagonist (IC(50) = 1 x 10(-5) M). Furthermore, the modified CTAP analogues with a d-Trp at position 7 all showed weak antagonist activities (EC(50) = 10(-6) to 10(-7) M). Compounds bioassayed at mouse/rat MCRs displayed intriguing results. Most of them are potent at all four receptors tested (m

  5. Genomic assay reveals tolerance of DNA damage by both translesion DNA synthesis and homology-dependent repair in mammalian cells.

    PubMed

    Izhar, Lior; Ziv, Omer; Cohen, Isadora S; Geacintov, Nicholas E; Livneh, Zvi

    2013-04-16

    DNA lesions can block replication forks and lead to the formation of single-stranded gaps. These replication complications are mitigated by DNA damage tolerance mechanisms, which prevent deleterious outcomes such as cell death, genomic instability, and carcinogenesis. The two main tolerance strategies are translesion DNA synthesis (TLS), in which low-fidelity DNA polymerases bypass the blocking lesion, and homology-dependent repair (HDR; postreplication repair), which is based on the homologous sister chromatid. Here we describe a unique high-resolution method for the simultaneous analysis of TLS and HDR across defined DNA lesions in mammalian genomes. The method is based on insertion of plasmids carrying defined site-specific DNA lesions into mammalian chromosomes, using phage integrase-mediated integration. Using this method we show that mammalian cells use HDR to tolerate DNA damage in their genome. Moreover, analysis of the tolerance of the UV light-induced 6-4 photoproduct, the tobacco smoke-induced benzo[a]pyrene-guanine adduct, and an artificial trimethylene insert shows that each of these three lesions is tolerated by both TLS and HDR. We also determined the specificity of nucleotide insertion opposite these lesions during TLS in human genomes. This unique method will be useful in elucidating the mechanism of DNA damage tolerance in mammalian chromosomes and their connection to pathological processes such as carcinogenesis. PMID:23530190

  6. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  7. The expression of N-terminal deletion DNA pilot proteins inhibits the early stages of phiX174 replication.

    PubMed

    Ruboyianes, Mark V; Chen, Min; Dubrava, Mathew S; Cherwa, James E; Fane, Bentley A

    2009-10-01

    The phiX174 DNA pilot protein H contains four predicted C-terminal coiled-coil domains. The region of the gene encoding these structures was cloned, expressed in vivo, and found to strongly inhibit wild-type replication. DNA and protein synthesis was investigated in the absence of de novo H protein synthesis and in wild-type-infected cells expressing the inhibitory proteins (DeltaH). The expression of the DeltaH proteins interfered with early stages of DNA replication, which did not require de novo H protein synthesis, suggesting that the inhibitory proteins interfere with the wild-type H protein that enters the cell with the penetrating DNA. As transcription and protein synthesis are dependent on DNA replication in positive single-stranded DNA life cycles, viral protein synthesis was also reduced. However, unlike DNA synthesis, efficient viral protein synthesis required de novo H protein synthesis, a novel function for this protein. A single amino acid change in the C terminus of protein H was both necessary and sufficient to confer resistance to the inhibitory DeltaH proteins, restoring both DNA and protein synthesis to wild-type levels. DeltaH proteins derived from the resistant mutant did not inhibit wild-type or resistant mutant replication. The inhibitory effects of the DeltaH proteins were lessened by the coexpression of the internal scaffolding protein, which may suppress H-H protein interactions. While coexpression relieved the block in DNA biosynthesis, viral protein synthesis remained suppressed. These data indicate that protein H's role in DNA replication and stimulating viral protein synthesis can be uncoupled. PMID:19640994

  8. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases.

    PubMed

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-03-15

    New types of double-headed 2'-deoxycytidine 5'-O-triphosphates (dC(XC)TPs) bearing another cytosine or 5-fluorocytosine linked through a flexible propargyl, homopropargyl or pent-1-ynyl linker to position 5 were prepared by the aqueous Sonogashira cross-coupling reactions of 5-iodo-dCTP with the corresponding (fluoro)cytosine-alkynes. The modified dC(XC)TPs were good substrates for DNA polymerases and were used for enzymatic synthesis of cytosine-functionalized DNA by primer extension or PCR. The cytosine- or fluorocytosine-linked DNA probes did not significantly inhibit DNA methyltransferases and did not cross-link to these proteins. PMID:26899597

  9. Regulation of chloroplast number and DNA synthesis in higher plants. Final report, August 1995--August 1996

    SciTech Connect

    Mullet, J.E.

    1997-06-17

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focused on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The research focused on the isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  10. DNA methylation analysis of human myoblasts during in vitro myogenic differentiation: de novo methylation of promoters of muscle-related genes and its involvement in transcriptional down-regulation

    PubMed Central

    Miyata, Kohei; Miyata, Tomoko; Nakabayashi, Kazuhiko; Okamura, Kohji; Naito, Masashi; Kawai, Tomoko; Takada, Shuji; Kato, Kiyoko; Miyamoto, Shingo; Hata, Kenichiro; Asahara, Hiroshi

    2015-01-01

    Although DNA methylation is considered to play an important role during myogenic differentiation, chronological alterations in DNA methylation and gene expression patterns in this process have been poorly understood. Using the Infinium HumanMethylation450 BeadChip array, we obtained a chronological profile of the genome-wide DNA methylation status in a human myoblast differentiation model, where myoblasts were cultured in low-serum medium to stimulate myogenic differentiation. As the differentiation of the myoblasts proceeded, their global DNA methylation level increased and their methylation patterns became more distinct from those of mesenchymal stem cells. Gene ontology analysis revealed that genes whose promoter region was hypermethylated upon myoblast differentiation were highly significantly enriched with muscle-related terms such as ‘muscle contraction’ and ‘muscle system process’. Sequence motif analysis identified 8-bp motifs somewhat similar to the binding motifs of ID4 and ZNF238 to be most significantly enriched in hypermethylated promoter regions. ID4 and ZNF238 have been shown to be critical transcriptional regulators of muscle-related genes during myogenic differentiation. An integrated analysis of DNA methylation and gene expression profiles revealed that de novo DNA methylation of non-CpG island (CGI) promoters was more often associated with transcriptional down-regulation than that of CGI promoters. These results strongly suggest the existence of an epigenetic mechanism in which DNA methylation modulates the functions of key transcriptional factors to coordinately regulate muscle-related genes during myogenic differentiation. PMID:25190712

  11. DNA synthesis in mouse brown adipose tissue is under. beta. -adrenergic control

    SciTech Connect

    Rehnmark, S.; Nedergaard, J. )

    1989-02-01

    The rate of DNA synthesis in mouse brown adipose tissue was followed with injections of ({sup 3}H)thymidine. Cold exposure led to a large increase in the rate of ({sup 3}H)thymidine incorporation, reaching a maximum after 8 days, after which the activity abruptly ceased. A series of norepinephrine injections was in itself able to increase ({sup 3}H)thymidine incorporation. When norepinephrine was injected in combination with the {alpha}-adrenergic antagonist phentolamine or with the {beta}-adrenergic antagonist propranolol, the stimulation was fully blocked by propranolol. It is suggested that stimulation of DNA synthesis in brown adipose tissue is a {beta}-adrenergically mediated process and that the tissue is an interesting model for studies of physiological control of DNA synthesis.

  12. Insulin, concanavalin A, EGF, IFG-I and vanadate activate de novo phosphatidic acid and diacylglycerol synthesis, C-kinase, and glucose transport in BC3H-1 myocytes

    SciTech Connect

    Cooper, D.R.; Hernandez, H.; Konda, T.S.; Standaert, M.S.; Pollet, R.J.; Farese, R.V.

    1987-05-01

    The authors have reported that insulin stimulates de novo synthesis of phosphatidic acid (PA) which is metabolized directly to diacylglycerol (DG) in BS3H-1 myocytes; this is accompanied by increases in C-kinase activity in membrane and cytosolic extracts. This pathway may be involved in stimulating glucose transport and other metabolic processes. In this study, the authors have compared the effects of concanavalin A, EGF, IGF-I and sodium orthovanadate to insulin on PA/DG synthesis, C-kinase activity and glucose transport. All were found to be effective in stimulating glucose transport. Additionally, all activators rapidly increased the incorporation of (/sup 3/H)glycerol into DG and total glycerolipids, although none were as effective as insulin, which increased (/sup 3/H)DG 400% in 1 minute. Increased incorporation into phospholipids and triacylglycerols and to a lesser extent monoacylglycerol was also noted. They examined effects of concanavalin A and EGF on C-kinase activity and found that both agonists, like insulin, increase C-kinase activity in cytosolic and/or membrane fractions. Their findings raise the possibility that activation of receptors having associated tyrosine kinase activity may provoke some cellular responses through de novo PA/GD synthesis and C-kinase activation.

  13. CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro.

    PubMed Central

    Usdin, K; Woodford, K J

    1995-01-01

    A large increase in the length of a CGG tandem array is associated with a number of triplet expansion diseases, including fragile X syndrome, the most common cause of heritable mental retardation in humans. Expansion results in the appearance of a fragile site on the X chromosome in the region of the CGG array. We show here that CGG repeats readily form a series of barriers to DNA synthesis in vitro. There barriers form only when the (CGG)n strand is used as the template, are K(+)-dependent, template concentration-independent, and involve hydrogen bonding between guanines. Chemical modification experiments suggest these blocks to DNA synthesis result from the formation of a series of intrastrand tetraplexes. A number of lines of evidence suggest that both triplet expansion and chromosome fragility are the result of replication defects. Our data are discussed in the light of such evidence. Images PMID:7479085

  14. Efficient Synthesis of Topologically Linked Three-Ring DNA Catenanes.

    PubMed

    Li, Qi; Wu, Guangqi; Wu, Wei; Liang, Xingguo

    2016-06-16

    Topologically controlled DNA catenanes are promising elements for the construction of molecular machines but present a significant effort in DNA nanotechnology. We report an efficient approach for preparing linear three-ring catenanes (L3C) composed of single-stranded DNA. The linking number was strictly controlled by using short complementary regions (6 nt) between each two DNA rings. High efficiency of forming three-ring catenanes (yield as high as 63 %) was obtained by using an 80 nt oligonucleotide as the scaffold to draw close the three pre-rings for hybridization between short complementary DNA. After assembly, three pre-rings were closed by DNA ligation using three 12 nt oligonucleotides as splints to form interlocked three-ring catenanes. L3C nanostructures were imaged in air by AFM: the catenane exhibited a smooth circular shape and was arranged in a line with well-defined structure, as expected. PMID:27214092

  15. Isolation of Chinese hamster ovary cells with reduced unscheduled DNA synthesis after UV irradiation

    SciTech Connect

    Stefanini, M.; Reuser, A.; Bootsma, D.

    1982-09-01

    A simple procedure has been worked out to obtain UV-sensitive mutants of Chinese hamster ovary (CHO) cells. In this procedure, conventional mutagenesis is followed by BrdU--light treatment to enrich the population for UV-sensitive cells. Colonies that are allowed to form subsequently are duplicated by replica plating and screened on the master plate for their UV sensitivity and their capacity to carry out UV-induced DNA repair synthesis. Putative mutants are isolated from the replica. With this combination of methods, we succeeded in isolating CHO mutants with an 85-95% reduced level of UV-induced DNA synthesis in combination with an increased UV sensitivity.

  16. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.

    1984-07-01

    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  17. In vivo measurement of DNA synthesis rates of colon epithelial cells in carcinogenesis

    SciTech Connect

    Kim, Sylvia Jeewon; Turner, Scott; Killion, Salena; Hellerstein, Marc K. . E-mail: march@nature.berkeley.edu

    2005-05-27

    We describe here a highly sensitive technique for measuring DNA synthesis rates of colon epithelial cells in vivo. Male SD rats were given {sup 2}H{sub 2}O (heavy water). Colon epithelial cells were isolated, DNA was extracted, hydrolyzed to deoxyribonucleosides, and the deuterium enrichment of the deoxyribose moiety was determined by gas chromatographic/mass spectrometry. Turnover time of colon crypts and the time for migration of cells from basal to top fraction of the crypts were measured. These data were consistent with cell cycle analysis and bromodeoxyuridine labeling. By giving different concentrations of a promoter, dose-dependent increases in DNA synthesis rates were detected, demonstrating the sensitivity of the method. Administration of a carcinogen increased DNA synthesis rates cell proliferation in all fractions of the crypt. In conclusion, DNA synthesis rates of colon epithelial cells can be measured directly in vivo using stable-isotope labeling. Potential applications in humans include use as a biomarker for cancer chemoprevention studies.

  18. The Transcription Factor TFII-I Promotes DNA Translesion Synthesis and Genomic Stability

    PubMed Central

    Fattah, Farjana J.; Hara, Kodai; Fattah, Kazi R.; Yang, Chenyi; Wu, Nan; Warrington, Ross; Chen, David J.; Zhou, Pengbo; Boothman, David A.; Yu, Hongtao

    2014-01-01

    Translesion synthesis (TLS) enables DNA replication through damaged bases, increases cellular DNA damage tolerance, and maintains genomic stability. The sliding clamp PCNA and the adaptor polymerase Rev1 coordinate polymerase switching during TLS. The polymerases Pol η, ι, and κ insert nucleotides opposite damaged bases. Pol ζ, consisting of the catalytic subunit Rev3 and the regulatory subunit Rev7, then extends DNA synthesis past the lesion. Here, we show that Rev7 binds to the transcription factor TFII-I in human cells. TFII-I is required for TLS and DNA damage tolerance. The TLS function of TFII-I appears to be independent of its role in transcription, but requires homodimerization and binding to PCNA. We propose that TFII-I bridges PCNA and Pol ζ to promote TLS. Our findings extend the general principle of component sharing among divergent nuclear processes and implicate TLS deficiency as a possible contributing factor in Williams-Beuren syndrome. PMID:24922507

  19. Solid-phase synthesis of DNA binding polyamides on oxime resin.

    PubMed

    Belitsky, J M; Nguyen, D H; Wurtz, N R; Dervan, Peter B

    2002-08-01

    Control of the energetics and specificity of DNA binding polyamides is necessary for inhibition of protein-DNA complex formation and gene regulation studies. Typically, solid-phase methods using Boc monomers for synthesis have depended on Boc-beta-Ala-PAM resin which affords a beta-alanine-Dp tail at the C-terminus, after cleavage with N,N-dimethylaminopropylamine (Dp). To address the energetic consequences of this tail for DNA minor groove binding, we describe an alternative solid phase method employing the Kaiser oxime resin which allows the synthesis of polyamides with incrementally shortened C-terminal tails. Polyamides without Dp and having methyl amide tails rather than beta-alanine show similar affinity relative to the standard beta-Dp tail. The truncated tail diminishes the A,T base pair energetic preference of the beta-Dp tail which will allow a greater variety of DNA sequences to be targeted by hairpin polyamides. PMID:12057666

  20. Capture of a third Mg²⁺ is essential for catalyzing DNA synthesis.

    PubMed

    Gao, Yang; Yang, Wei

    2016-06-10

    It is generally assumed that an enzyme-substrate (ES) complex contains all components necessary for catalysis and that conversion to products occurs by rearrangement of atoms, protons, and electrons. However, we find that DNA synthesis does not occur in a fully assembled DNA polymerase-DNA-deoxynucleoside triphosphate complex with two canonical metal ions bound. Using time-resolved x-ray crystallography, we show that the phosphoryltransfer reaction takes place only after the ES complex captures a third divalent cation that is not coordinated by the enzyme. Binding of the third cation is incompatible with the basal ES complex and requires thermal activation of the ES for entry. It is likely that the third cation provides the ultimate boost over the energy barrier to catalysis of DNA synthesis. PMID:27284197

  1. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  2. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    PubMed

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis. PMID:27333783

  3. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

    PubMed

    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

    2016-05-17

    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. PMID:27053724

  4. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.

    PubMed

    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J

    1995-06-01

    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  5. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras

    PubMed Central

    Roviello, G. N.; Gröschel, S.; Pedone, C.

    2009-01-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the α-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy. PMID:19629638

  6. Effects of starvation and hormones on DNA synthesis in silk gland cells of the silkworm, Bombyx mori.

    PubMed

    Li, Yao-Feng; Chen, Xiang-Yun; Zhang, Chun-Dong; Tang, Xiao-Fang; Wang, La; Liu, Tai-Hang; Pan, Min-Hui; Lu, Cheng

    2016-08-01

    Silk gland cells of silkworm larvae undergo multiple cycles of endomitosis for the synthesis of silk proteins during the spinning phase. In this paper, we analyzed the endomitotic DNA synthesis of silk gland cells during larval development, and found that it was a periodic fluctuation, increasing during the vigorous feeding phase and being gradually inhibited in the next molting phase. That means it might be activated by a self-regulating process after molting. The expression levels of cyclin E, cdt1 and pcna were consistent with these developmental changes. Moreover, we further examined whether these changes in endomitotic DNA synthesis resulted from feeding or hormonal stimulation. The results showed that DNA synthesis could be inhibited by starvation and re-activated by re-feeding, and therefore appears to be dependent on nutrition. DNA synthesis was suppressed by in vivo treatment with 20-hydroxyecdysone (20E). However, there was no effect on DNA synthesis by in vitro 20E treatment or by either in vivo or in vitro juvenile hormone treatment. The levels of Akt and 4E-BP phosphorylation in the silk glands were also reduced by starvation and in vivo treatment with 20E. These results indicate that the activation of endomitotic DNA synthesis during the intermolt stages is related to feeding and DNA synthesis is inhibited indirectly by 20E. PMID:25558018

  7. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    PubMed

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

  8. Assessment of potential damage to DNA in urine of coke oven workers: an assay of unscheduled DNA synthesis.

    PubMed Central

    Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C

    1997-01-01

    OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892

  9. Lability of DNA polymerase alpha correlated with decreased DNA synthesis and increased age in human cells

    SciTech Connect

    Busbee, D.; Sylvia, V.; Stec, J.; Cernosek, Z.; Norman, J.

    1987-12-01

    DNA excision repair and mitogen-initiated blastogenesis in human cells declined in efficiency as an apparent function of decreased DNA polymerase alpha specific activity with increased age of the cell donor. DNA polymerase alpha isolated from fetal cells contained a single, high-specific-activity enzyme form that could not be further activated and that was stable with regard to enzyme activity and affinity for DNA template-primer. DNA polymerase alpha isolated from adult-derived cells contained both low-specific-activity and high-specific-activity forms. The low-activity enzyme form, which showed low affinity of binding to DNA template-primer, was activated by treatment with phosphatidylinositol, /sup 32/P-ATP, and phosphatidylinositol kinase, resulting in a /sup 32/P-labeled enzyme that exhibited high affinity of binding to DNA template-primer. The activated enzyme was unstable, exhibiting a loss of /sup 32/P-label correlated with the loss of both specific activity and high affinity of binding to DNA template-primer. The data suggest that DNA polymerase alpha isolated from adult-derived human cells has low-activity and high-activity forms. Decreased specific activity of DNA polymerase alpha correlated with increased age of the donor appears to be a function of loss of an enzyme activator molecule resulting in diminished ability of the enzyme to bind DNA template-primer.

  10. Synthesis and characterization of DNA nano-meso-microspheres as drug delivery carriers for intratumoral chemotherapy

    NASA Astrophysics Data System (ADS)

    Enriquez Schumacher, Iris Vanessa

    Conventional cancer chemotherapy results in systemic toxicity which severely limits effectiveness and often adversely affects patient quality of life. There is a need to find new drugs and delivery methods for less toxic therapy. Previous studies concerning DNA complexing with chemotherapy drugs suggest unique opportunities for DNA as a mesosphere drug carrier. The overall objective of this research was devoted to the synthesis and evaluation of novel DNA-drug nano-mesospheres designed for localized chemotherapy via intratumoral injection. My research presents DNA nano-meso-microspheres (DNA-MS) that were prepared using a modified steric stabilization method originally developed in this lab for the preparation of albumin MS. DNA-MS were prepared with glutaraldehyde covalent crosslinking (genipin crosslinking was attempted) through the DNA base pairs. In addition, novel crosslinking of DNA-MS was demonstrated using chromium, gadolinium, or iron cations through the DNA phosphate groups. Covalent and ionic crosslinked DNA-MS syntheses yielded smooth and spherical particle morphologies with multimodal size distributions. Optimized DNA-MS syntheses produced particles with narrow and normal size distributions in the 50nm to 5mum diameter size range. In aqueous dispersions approximately 200% swelling was observed with dispersion stability for more than 48 hours. Typical process conditions included a 1550rpm initial mixing speed and particle filtration through 20mum filters to facilitate preparation. DNA-MS were in situ loaded during synthesis for the first time with mitoxantrone, 5-fluorouracil, and methotrexate. DNA-MS drug incorporation was 12%(w/w) for mitoxantrone, 9%(w/w) for methotrexate, and 5%(w/w) for 5-fluorouracil. In vitro drug release into phosphate buffered saline was observed for over 35 days by minimum sink release testing. The effect of gadolinium crosslink concentration on mitoxantrone release was evaluated at molar equivalences in the range of 20% to

  11. NOREPINEPHRINE AND EPIDERMAL GROWTH FACTOR: DYNAMICS OF THEIR INTERACTION IN THE STIMULATION OF HEPATOCYTE DNA SYNTHESIS

    EPA Science Inventory

    Primary cultures of adult rat hepatocytes are stimulated to enter DNA synthesis by norepinephrine (NE). This stimulation is maximal if the hepatocytes are incubated with NE for more than 12 hr, beginning no later than 2-4 hr after the cells are first plated. After 24 hr in cultur...

  12. EFFECT OF NONGENOTOXIC ENVIRONMENTAL CONTAMINATION ON CHOLESTEROL AND DNA SYNTHESIS IN CULTURED PRIMARY RAT HEPATOCYTES

    EPA Science Inventory

    The effect of certain reputedly non genotoxic agents on cholesterol and DNA synthesis was investigated in cultured rat primary hepatocytes and liver slices. epatocytes in culture were incubated for 48, 60, and 72 hrs with one of the following chemicals; namely, chloroform (CHCl3)...

  13. Heparin effect on DNA synthesis in a murine fibrosarcoma cell line: influence of anionic density

    SciTech Connect

    Piepkorn, M.W.; Daynes, R.A.

    1983-09-01

    The effects of heparin subfractions on DNA synthesis in a murine cutaneous fibrosarcoma cell line were examined. Porcine mucosal heparin was preparatively fractionated for anionic charge density by DEAE-Sephadex chromatography and for molecular weight by Sephadex G-100 filtration. The cell line was plated from confluent monolayer cultures and grown in medium and fetal bovine serum, with or without a heparin fraction at a final concentration of 10 micrograms/ml. At intervals thereafter, the cells were pulsed with (/sup 3/H)thymidine. A low-charge density heparin fraction stimulated (/sup 3/H)thymidine incorporation (cpm/mg protein and cpm/cell) during the first 3 days of growth compared to control values without added heparin, whereas a high-charge density heparin fraction had little of this effect (186 +/- 35% of control vs. 101 +/- 14%, respectively; P less than .05). The augmentation of DNA synthesis observed with the low-charge density fraction correlated with increased proportions of cells in S and G2 phases compared with those of the controls, as determined by flow cytofluorometry. Low- and high-molecular-weight heparin fractions did not significantly alter DNA synthesis. Heparin subfractions are thus heterogeneous with respect to their effect on cellular DNA synthesis in this tumor line.

  14. Synthesis and Properties of Novel Silver-Containing DNA Molecules.

    PubMed

    Eidelshtein, Gennady; Fardian-Melamed, Natalie; Gutkin, Vitaly; Basmanov, Dmitry; Klinov, Dmitry; Rotem, Dvir; Levi-Kalisman, Yael; Porath, Danny; Kotlyar, Alexander

    2016-06-01

    Migration of silver atoms from silver nano-particles selectively to a double-stranded poly(dG)-poly(dC) polymer leads to metallization of the DNA. As a result the DNA molecules become shorter and thicker (higher), as evident from the atomic force microscopy imaging analysis. The metalized molecules can be detected by transmission and scanning electron microscopy in contrast to the initial non-metalized ones. PMID:27116695

  15. Deoxyribonucleotide synthesis and the emergence of DNA in molecular evolution

    NASA Astrophysics Data System (ADS)

    Follmann, Hartmut

    1982-02-01

    DNA replication requires monomeric deoxyribonucleotides, which cannot be regarded as primary products of organic syntheses on a primitive earth. However, the present biosynthetic pathway — reductive elimination of the 2'-OH group from ribonucleotides, catalyzed by ribonucleotide reductases and thioredoxins — suggests an early, polyphyletic combination of protein-nucleotide interactions and metal catalysis. That key process had to precede the upcome of RNA-DNA dualism on the way from RNA-protein protocells to true organisms.

  16. Purification, characterization and biological activity of tulipin, a novel inhibitor of DNA synthesis of plant origin.

    PubMed

    Gasperi-Campani, A; Lorenzoni, E; Abbondanza, A; Perocco, P; Falasca, A I

    1987-01-01

    A DNA synthesis-inhibiting protein (for which the term tulipin is proposed) was isolated from the bulbs of Tulipa sp. The yield ranged from 3.4 to 4.1 per cent of total protein content of the crude extract. Mr, isoelectric point, neutral and amino sugar and amino acid composition were determined. Inhibition of DNA synthesis varied in intact cells according to the cellular types studied, with a minimum ID 50% (concentration giving 50% inhibition) of 400 ng/ml in neuroblastoma cells. The effect was reversible. No effect was obtained in cell-lysate. RNA and protein synthesis were unaffected. The acute toxicity, evaluated in Swiss mice, gave an LD of 6.1 mg/kg body wt. Results of electron microscopy are also given. A second protein, called tulipin 2, has been isolated and partially characterized. PMID:3592627

  17. DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present

    PubMed Central

    Chen, Cheng-Yao

    2014-01-01

    Next-generation sequencing (NGS) technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized in Sanger’s dideoxy chain-terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today’s standard capillary electrophoresis (CE) and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ϕ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ϕ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies. PMID:25009536

  18. Synthesis and evaluation of new spacers for use as dsDNA endcaps

    PubMed Central

    Ng, Pei-Sze; Laing, Brian M.; Balasundarum, Ganesan; Pingle, Maneesh; Friedman, Alan; Bergstrom, Donald E.

    2010-01-01

    A series of aliphatic and aromatic spacer molecules designed to cap the ends of DNA duplexes have been synthesized. The spacers were converted into dimethoxytrityl protected phosphoramidites as synthons for oligonucleotides synthesis. The effect of the spacers on the stability of short DNA duplexes was assessed by melting temperature studies. Endcaps containing amide groups were found to be less stabilizing than the hexaethylene glycol spacer. Endcaps containing either a terthiophene or a naphthalene tetracarboxylic acid dimide were found to be significantly more stabilizing. The former showed a preference for stacking above an A•T base pair. Spacers containing only methylene (-CH2-) and amide (-CONH-) groups interact weakly with DNA and consequently may be optimal for applications that require minimal influence on DNA structure but require a way to hold the ends of double-stranded DNA together. PMID:20715857

  19. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  20. In vivo effects of T-2 mycotoxin on synthesis of proteins and DNA in rat tissues

    SciTech Connect

    Thompson, W.L.; Wannemacher, R.W. Jr. )

    1990-09-15

    Rats were given an ip injection of T-2 mycotoxin (T-2), the T-2 metabolite, T-2 tetraol (tetraol), or cycloheximide. Serum, liver, heart, kidney, spleen, muscle, and intestine were collected at 3, 6, and 9 hr postinjection after a 2-hr pulse at each time with (14C)leucine and (3H)thymidine. Protein and DNA synthesis levels in rats were determined by dual-label counting of the acid-precipitable fraction of tissue homogenates. Rats given a lethal dose of T-2, tetraol, or cycloheximide died between 14 and 20 hr. Maximum inhibition of protein synthesis at the earliest time period was observed in additional rats given the same lethal dose of the three treatments and continued for the duration of the study (9 hr). With sublethal doses of T-2 or tetraol, the same early decrease in protein synthesis was observed but, in most of the tissues, recovery was seen with time. In the T-2-treated rats. DNA synthesis in the six tissues studied was also suppressed, although to a lesser degree. With sublethal doses, complete recovery of DNA synthesis took place in four of the six tissues by 9 hr after toxin exposure. The appearance of newly translated serum proteins did not occur in the animals treated with T-2 mycotoxin or cycloheximide, as evidenced by total and PCA-soluble serum levels of labeled leucine. An increase in tissue-pool levels of free leucine and thymidine in response to T-2 mycotoxin was also noted. T-2 mycotoxin, its metabolite, T-2 tetraol, and cycloheximide cause a rapid inhibition of protein and DNA synthesis in all tissue types studied. These results are compared with the responses seen in in vitro studies.

  1. Structural specificity of steroids in stimulating DNA synthesis and protooncogene expression in primary rat hepatocyte cultures.

    PubMed

    Lee, C H; Edwards, A M

    2002-05-01

    Among the chemical compounds of varied structure which possess liver tumour-promoting are steroids, such as estrogens, pregnenolone derivatives and anabolic steroids. Although the mechanism(s) of tumour promotion in liver by these xenobiotics is not well understood, it is clear that growth stimulation is one important element in their action. As a basis for better defining whether steroids stimulate growth by a common mechanism or fall into sub-groups with differing actions, the effects of 46 steroids on DNA synthesis and the expression of protooncogenes c-fos and c-myc were examined in primary cultures of normal rat hepatocytes. Tentative groupings of steroids have been identified based on apparent structural requirements for stimulation of DNA synthesis, and effects of auxiliary factors in modulating this growth stimulus. For a "progestin" group, insulin appeared to be permissive for stimulation of DNA synthesis, and presence of an ester or hydroxyl group at 17alpha-position in combination with a non-polar group at C(6) appeared to be required for stimulation. For the pregnenes, dexamethasone was stimulatory. Structural requirements include a non-polar substitution at 16alpha-position and presence of a 6alpha-methyl group. Androgens were weak or ineffective stimulators of DNA synthesis. Anabolic steroids were weak to strong stimulators and alteration to A ring structure in combination with non-polar substitution at 17alpha-position appeared to be required for the activity. With the exception of the anabolic steroid, dianabol, there do not appear to be strong correlation between ability to stimulate DNA synthesis and ability to induce protooncogene expression among the steroids. This study provides a starting point for future more detailed examination of growth-stimulatory mechanism(s) of action of steroids in the liver. PMID:12127039

  2. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction. PMID:26815240

  3. L-arginine improves DNA synthesis in LPS-challenged enterocytes.

    PubMed

    Tan, Bi'e; Xiao, Hao; Xiong, Xia; Wang, Jing; Li, Guangran; Yin, Yulong; Huang, Bo; Hou, Yongqing; Wu, Guoyao

    2015-01-01

    The neonatal small intestine is susceptible to damage by endotoxin, and this cytotoxicity may involve intracellular generation of reactive oxygen species (ROS), resulting in DNA damage and mitochondrial dysfunction. L-Arginine (Arg) confers a cytoprotective effect on lipopolysaccharide (LPS)-treated enterocytes through activation of the mammalian target of the rapamycin (mTOR) signaling pathway. Arg improves DNA synthesis and mitochondrial bioenergetics, which may also be responsible for beneficial effects of Arg on intestinal mucosal cells. In support of this notion, results of recent studies indicate that elevated Arg concentrations enhances DNA synthesis, cell-cycle progression, and mitochondrial bioenergetics in LPS-treated intestinal epithelial cells through mechanisms involving activation of the PI3K-Akt pathway. These findings provide a biochemical basis for dietary Arg supplementation to improve the regeneration and repair of the small-intestinal mucosa in both animals and humans. PMID:25961538

  4. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  5. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  6. Design and Synthesis of Triangulated DNA Origami Trusses.

    PubMed

    Matthies, Michael; Agarwal, Nayan P; Schmidt, Thorsten L

    2016-03-01

    DNA nanotechnology offers unique control over matter on the nanoscale. Here, we extend the DNA origami method to cover a range of wireframe truss structures composed of equilateral triangles, which use less material per volume than standard multiple-helix bundles. From a flat truss design, we folded tetrahedral, octahedral, or irregular dodecahedral trusses by exchanging few connector strands. Other than standard origami designs, the trusses can be folded in low-salt buffers that make them compatible with cell culture buffers. The structures also have defined cavities that may in the future be used to precisely position functional elements such as metallic nanoparticles or enzymes. Our graph routing program and a simple design pipeline will enable other laboratories to make use of this valuable and potent new construction principle for DNA-based nanoengineering. PMID:26883285

  7. Activation of human neutrophils by the plant lectin Viscum album agglutinin-I: modulation of de novo protein synthesis and evidence that caspases are involved in induction of apoptosis.

    PubMed

    Savoie, A; Lavastre, V; Pelletier, M; Hajto, T; Hostanska, K; Girard, D

    2000-12-01

    The plant lectin Viscum album agglutinin-I (VAA-I) was recently found to modulate protein synthesis and to induce apoptosis in various cells of immune origin. We found that VAA-I induces de novo protein synthesis of metabolically 35S-labeled human neutrophils when used at low concentrations (< 100 ng/mL) but acts as an inhibitor at higher concentrations. Using both flow cytometry (FITC-Annexin-V/PI labeling) and cytology (Diff-Quick staining) approaches, we found that VAA-I could not modulate neutrophil apoptosis at low concentrations but could induce it in >98% of cells at 500 and 1000 ng/mL. VAA-I was also found to reverse the delaying effect of GM-CSF on neutrophil apoptosis and to inhibit GM-CSF-induced de novo protein synthesis. In contrast to GM-CSF, VAA-I does not induce tyrosine phosphorylation by itself and does not alter the GM-CSF-induced response. Among the inhibitors used, genistein, pertussis toxin, staurosporine, H7, Calphostin C, manoalide, BpB, quinacrine HA-1077, and z-VAD-FMK, only the latter (inhibitor of caspases-1, -3, -4, and -7) was found to inhibit VAA-I-induced neutrophil apoptosis as the percentage of apoptotic cells decrease from 98 +/- 1.3 to 54 +/- 3.2% (n=4). Furthermore, we confirm that caspases are involved in VAA-I-induced neutrophil apoptosis as we have observed the fragmentation of the cytoskeletal gelsolin protein that is known to be caspase-3-dependent. Such degradation was reversed by the z-VAD-FMK inhibitor. We conclude that induction of neutrophil apoptosis by VAA-I is a caspase-dependent mechanism that does not involve tyrosine phosphorylation events, G-proteins, PKCs, and PLA2. In addition, we conclude that at least caspase-3 is involved. Correlation between VAA-I-induced neutrophil apoptosis and VAA-I-induced inhibition of de novo protein synthesis is discussed. PMID:11129652

  8. De novo asymmetric synthesis and biological analysis of the daumone pheromones in Caenorhabditis elegans and in the soybean cyst nematode Heterodera glycines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The de novo asymmetric total syntheses of daumone 1, daumone 2 and analogs are described. The key steps of our approach are the diastereoselective palladium catalyzed glycosylation reaction, the Noyori reduction of a acetylfuran and a propargyl ketone, which introduce the absolute stereochemistry of...

  9. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  10. Structural Basis of High-Fidelity DNA Synthesis by Yeast DNA Polymerase δ

    SciTech Connect

    Swan, M.; Johnson, R; Prakash, L; Prakash, S; Aggarwal, A

    2009-01-01

    DNA polymerase ? (Pol ?) has a crucial role in eukaryotic replication. Now the crystal structure of the yeast DNA Pol ? catalytic subunit in complex with template primer and incoming nucleotide is presented at 2.0-A resolution, providing insight into its high fidelity and a framework to understand the effects of mutations involved in tumorigenesis.

  11. Synthesis of site-specific DNA-protein conjugates and their effects on DNA replication.

    PubMed

    Yeo, Jung Eun; Wickramaratne, Susith; Khatwani, Santoshkumar; Wang, Yen-Chih; Vervacke, Jeffrey; Distefano, Mark D; Tretyakova, Natalia Y

    2014-08-15

    DNA-protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA-protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases η, κ, ν, and ι. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  12. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  13. Remote Activation of Host Cell DNA Synthesis in Uninfected Cells Signaled by Infected Cells in Advance of Virus Transmission

    PubMed Central

    Schmidt, Nora; Hennig, Thomas; Serwa, Remigiusz A.; Marchetti, Magda

    2015-01-01

    ABSTRACT Viruses modulate cellular processes and metabolism in diverse ways, but these are almost universally studied in the infected cell itself. Here, we study spatial organization of DNA synthesis during multiround transmission of herpes simplex virus (HSV) using pulse-labeling with ethynyl nucleotides and cycloaddition of azide fluorophores. We report a hitherto unknown and unexpected outcome of virus-host interaction. Consistent with the current understanding of the single-step growth cycle, HSV suppresses host DNA synthesis and promotes viral DNA synthesis in spatially segregated compartments within the cell. In striking contrast, during progressive rounds of infection initiated at a single cell, we observe that infection induces a clear and pronounced stimulation of cellular DNA replication in remote uninfected cells. This induced DNA synthesis was observed in hundreds of uninfected cells at the extended border, outside the perimeter of the progressing infection. Moreover, using pulse-chase analysis, we show that this activation is maintained, resulting in a propagating wave of host DNA synthesis continually in advance of infection. As the virus reaches and infects these activated cells, host DNA synthesis is then shut off and replaced with virus DNA synthesis. Using nonpropagating viruses or conditioned medium, we demonstrate a paracrine effector of uninfected cell DNA synthesis in remote cells continually in advance of infection. These findings have significant implications, likely with broad applicability, for our understanding of the ways in which virus infection manipulates cell processes not only in the infected cell itself but also now in remote uninfected cells, as well as of mechanisms governing host DNA synthesis. IMPORTANCE We show that during infection initiated by a single particle with progressive cell-cell virus transmission (i.e., the normal situation), HSV induces host DNA synthesis in uninfected cells, mediated by a virus-induced paracrine

  14. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  15. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  16. Antibacterial activity and inhibition of protein synthesis in Escherichia coli by antisense DNA analogs.

    PubMed

    Rahman, M A; Summerton, J; Foster, E; Cunningham, K; Stirchak, E; Weller, D; Schaup, H W

    1991-01-01

    Protein synthesis, which takes place within ribosomes, is essential for the survival of any living organism. Ribosomes are composed of both proteins and RNA. Specific interaction between the 3' end CCUCC sequence of prokaryotic 16S rRNA and a partially complementary sequence preceding the initiating codon of mRNA is believed to be a prerequisite for initiation of protein synthesis. Here we report the use of short (three to six nucleotides) synthetic DNA analogs complementary to this sequence to block protein synthesis in vitro and in vivo in Escherichia coli. In the DNA analogs the normal phosphodiester bond in the antisense DNA was replaced by methylcarbamate internucleoside linkages to enhance transport across plasma membranes. Of the analogs tested, those with the sequence AGG and GGA inhibit protein synthesis and colony formation by E. coli strains lacking an outer cell wall. Polyethylene glycol 1000 (PEG 1000) was attached to the 5' end of some of the test methylcarbamate DNAs to enhance solubility. Analogs of AGG and GGAG with PEG 1000 attached inhibited colony formation in normal E. coli. These analogs may be useful food additives to control bacterial spoilage and biomedically as antibiotics. PMID:1821653

  17. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully. PMID:17952664

  18. Up-Regulation of TREK-2 Potassium Channels in Cultured Astrocytes Requires De Novo Protein Synthesis: Relevance to Localization of TREK-2 Channels in Astrocytes after Transient Cerebral Ischemia

    PubMed Central

    Rivera-Pagán, Aixa F.; Rivera-Aponte, David E.; Melnik-Martínez, Katya V.; Zayas-Santiago, Astrid; Kucheryavykh, Lilia Y.; Martins, Antonio H.; Cubano, Luis A.; Skatchkov, Serguei N.; Eaton, Misty J.

    2015-01-01

    Excitotoxicity due to glutamate receptor over-activation is one of the key mediators of neuronal death after an ischemic insult. Therefore, a major function of astrocytes is to maintain low extracellular levels of glutamate. The ability of astrocytic glutamate transporters to regulate the extracellular glutamate concentration depends upon the hyperpolarized membrane potential of astrocytes conferred by the presence of K+ channels in their membranes. We have previously shown that TREK-2 potassium channels in cultured astrocytes are up-regulated by ischemia and may support glutamate clearance by astrocytes during ischemia. Thus, herein we determine the mechanism leading to this up-regulation and assess the localization of TREK-2 channels in astrocytes after transient middle cerebral artery occlusion. By using a cell surface biotinylation assay we confirmed that functional TREK-2 protein is up-regulated in the astrocytic membrane after ischemic conditions. Using real time RT-PCR, we determined that the levels of TREK-2 mRNA were not increased in response to ischemic conditions. By using Western blot and a variety of protein synthesis inhibitors, we demonstrated that the increase of TREK-2 protein expression requires De novo protein synthesis, while protein degradation pathways do not contribute to TREK-2 up-regulation after ischemic conditions. Immunohistochemical studies revealed TREK-2 localization in astrocytes together with increased expression of the selective glial marker, glial fibrillary acidic protein, in brain 24 hours after transient middle cerebral occlusion. Our data indicate that functional TREK-2 channels are up-regulated in the astrocytic membrane during ischemia through a mechanism requiring De novo protein synthesis. This study provides important information about the mechanisms underlying TREK-2 regulation, which has profound implications in neurological diseases such as ischemia where astrocytes play an important role. PMID:25886567

  19. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors.

    PubMed Central

    Wong, R L; Gutowski, J K; Katz, M; Goldfarb, R H; Cohen, S

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-alpha-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These findings are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor we have called ADR may be a protease itself. PMID:3540956

  20. Synthesis of Cross-Linked DNA Containing Oxidized Abasic Site Analogues

    PubMed Central

    2015-01-01

    DNA interstrand cross-links are an important family of DNA damage that block replication and transcription. Recently, it was discovered that oxidized abasic sites react with the opposing strand of DNA to produce interstrand cross-links. Some of the cross-links between 2′-deoxyadenosine and the oxidized abasic sites, 5′-(2-phosphoryl-1,4-dioxobutane) (DOB) and the C4-hydroxylated abasic site (C4-AP), are formed reversibly. Chemical instability hinders biochemical, structural, and physicochemical characterization of these cross-linked duplexes. To overcome these limitations, we developed methods for preparing stabilized analogues of DOB and C4-AP cross-links via solid-phase oligonucleotide synthesis. Oligonucleotides of any sequence are attainable by synthesizing phosphoramidites in which the hydroxyl groups of the cross-linked product were orthogonally protected using photochemically labile and hydrazine labile groups. Selective unmasking of a single hydroxyl group precedes solid-phase synthesis of one arm of the cross-linked DNA. The method is compatible with commercially available phosphoramidites and other oligonucleotide synthesis reagents. Cross-linked duplexes containing as many as 54 nt were synthesized on solid-phase supports. Subsequent enzyme ligation of one cross-link product provided a 60 bp duplex, which is suitable for nucleotide excision repair studies. PMID:24949656

  1. A new paradigm of DNA synthesis: three-metal-ion catalysis.

    PubMed

    Yang, Wei; Weng, Peter J; Gao, Yang

    2016-01-01

    Enzyme catalysis has been studied for over a century. How it actually occurs has not been visualized until recently. By combining in crystallo reaction and X-ray diffraction analysis of reaction intermediates, we have obtained unprecedented atomic details of the DNA synthesis process. Contrary to the established theory that enzyme-substrate complexes and transition states have identical atomic composition and catalysis occurs by the two-metal-ion mechanism, we have discovered that an additional divalent cation has to be captured en route to product formation. Unlike the canonical two metal ions, which are coordinated by DNA polymerases, this third metal ion is free of enzyme coordination. Its location between the α- and β-phosphates of dNTP suggests that the third metal ion may drive the phosphoryltransfer from the leaving group opposite to the 3'-OH nucleophile. Experimental data indicate that binding of the third metal ion may be the rate-limiting step in DNA synthesis and the free energy associated with the metal-ion binding can overcome the activation barrier to the DNA synthesis reaction. PMID:27602203

  2. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N.; Mariella, Jr., Raymond P.; Christian, Allen T.; Young, Jennifer A.; Clague, David S.

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  3. Mechanical loading regulates the expression of tenascin-C in the myotendinous junction and tendon but does not induce de novo synthesis in the skeletal muscle.

    PubMed

    Järvinen, Tero A H; Józsa, Lászlo; Kannus, Pekka; Järvinen, Teppo L N; Hurme, Timo; Kvist, Martti; Pelto-Huikko, Markku; Kalimo, Hannu; Järvinen, Markku

    2003-03-01

    reached the level seen in the healthy contralateral limb. Tenascin-C was abundantly expressed in myotendinous and myofascial junctions and in the Achilles tendon, but even the most strenuous mechanical loading (high-intensity treadmill running) could not induce the expression of tenascin-C in the skeletal muscle. This was in spite of the marked immobilization-induced atrophy of the previously immobilized skeletal muscle, which had been subjected to intensive stress during remobilization. mRNA in situ hybridization analysis confirmed the immunohistochemical results for the expression of tenascin-C in the study groups. In summary, this study shows that mechanical loading regulates the expression of tenascin-C in an apparently dose-dependent fashion at sites of the muscle-tendon unit normally expressing tenascin-C but can not induce de novo synthesis of tenascin-C in the skeletal muscle without accompanying injury to the tissue. Our results suggest that tenascin-C provides elasticity in mesenchymal tissues subjected to heavy tensile loading. PMID:12571283

  4. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  5. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  6. The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ.

    PubMed

    Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E; Takeda, Shunichi

    2015-02-18

    The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

  7. Synthesis, characterization and chemoprotective activity of polyoxovanadates against DNA alkylation.

    PubMed

    Nunes, Giovana G; Bonatto, Ana C; de Albuquerque, Carla G; Barison, Andersson; Ribeiro, Ronny R; Back, Davi F; Andrade, André Vitor C; de Sá, Eduardo L; Pedrosa, Fábio de O; Soares, Jaísa F; de Souza, Emanuel M

    2012-03-01

    The alkylation of pUC19 plasmid DNA has been employed as a model reaction for the first studies on chemoprotective action by a mixed-valence (+IV/+V) polyoxovanadate. A new, non-hydrothermal route for the high yield preparation of the test compound is described. The deep green, microcrystalline solid A was isolated after a three-day reaction in water at 80°C and 1 atm, while the reaction at 100°C gave green crystals of B. Both solids were structurally characterized by X-ray diffractometry and FTIR, EPR, NMR and Raman spectroscopies. Product A was identified as (NH(4))(2)V(3)O(8), while B corresponds to the spherical polyoxoanion [V(15)O(36)(Cl)](6-), isolated as the NMe(4)(+) salt. The lack of solubility of A in water and buffers prevented its use in DNA interaction studies, which were then carried out with B. Complex B was also tested for its ability to react with DNA alkylating agents by incubation with diethylsulphate (DES) and dimethylsulphate (DMS) in both the absence and presence of pUC19. For DMS, the best results were obtained with 10 mM of B (48% protection); with DES, this percentage increased to 70%. The direct reaction of B with increasing amounts of DMS in both buffered (PIPES 50 mM) and non-buffered aqueous solutions revealed the sequential formation of several vanadium(IV), vanadium(V) and mixed-valence aggregates of different nuclearities, whose relevance to the DNA-protecting activity is discussed. PMID:22265837

  8. Nuclear reorganization of mammalian DNA synthesis prior to cell cycle exit.

    PubMed

    Barbie, David A; Kudlow, Brian A; Frock, Richard; Zhao, Jiyong; Johnson, Brett R; Dyson, Nicholas; Harlow, Ed; Kennedy, Brian K

    2004-01-01

    In primary mammalian cells, DNA replication initiates in a small number of perinucleolar, lamin A/C-associated foci. During S-phase progression in proliferating cells, replication foci distribute to hundreds of sites throughout the nucleus. In contrast, we find that the limited perinucleolar replication sites persist throughout S phase as cells prepare to exit the cell cycle in response to contact inhibition, serum starvation, or replicative senescence. Proteins known to be involved in DNA synthesis, such as PCNA and DNA polymerase delta, are concentrated in perinucleolar foci throughout S phase under these conditions. Moreover, chromosomal loci are redirected toward the nucleolus and overlap with the perinucleolar replication foci in cells poised to undergo cell cycle exit. These same loci remain in the periphery of the nucleus during replication under highly proliferative conditions. These results suggest that mammalian cells undergo a large-scale reorganization of chromatin during the rounds of DNA replication that precede cell cycle exit. PMID:14701733

  9. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    PubMed

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  10. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  11. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailing description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  12. Synthesis and hybridization properties of an acyclic achiral phosphonate DNA analogue.

    PubMed

    Kehler, J; Henriksen, U; Vejbjerg, H; Dahl, O

    1998-03-01

    Protected N-(2-hydroxyethyl)-N-(nucleobase-acetyl)aminomethanephosphonic+ ++ acid (6a-d) of all four DNA nucleobases have been prepared and oligomerized by solid-phase synthesis. Four DNA decamers containing 1-10 of these 'PPNA' monomers were prepared and evaluated by Tm measurements (medium salt) for binding to their DNA and RNA complements. One central modification reduced the binding strongly (delta Tm = -10 degrees C), but contiguous PPNA monomers gave smaller effects, and the all-PPNA decamer bound to RNA with a delta Tm of -1.2 degrees C per modification. Thus PPNA oligomers are inferior DNA and RNA binders compared to the closely related and strongly binding PNA oligomers. PMID:9568285

  13. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  14. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    NASA Astrophysics Data System (ADS)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  15. Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.

    PubMed

    Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan

    2013-02-26

    Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology. PMID:23272944

  16. Translesion synthesis is the main component of SOS repair in bacteriophage lambda DNA.

    PubMed Central

    Defais, M; Lesca, C; Monsarrat, B; Hanawalt, P

    1989-01-01

    Agents that interfere with DNA replication in Escherichia coli induce physiological adaptations that increase the probability of survival after DNA damage and the frequency of mutants among the survivors (the SOS response). Such agents also increase the survival rate and mutation frequency of irradiated bacteriophage after infection of treated bacteria, a phenomenon known as Weigle reactivation. In UV-irradiated single-stranded DNA phage, Weigle reactivation is thought to occur via induced, error-prone replication through template lesions (translesion synthesis [P. Caillet-Fauquet, M: Defais, and M. Radman, J. Mol. Biol. 117:95-112, 1977]). Weigle reactivation occurs with higher efficiency in double-stranded DNA phages such as lambda, and we therefore asked if another process, recombination between partially replicated daughter molecules, plays a major role in this case. To distinguish between translesion synthesis and recombinational repair, we studied the early replication of UV-irradiated bacteriophage lambda in SOS-induced and uninduced bacteria. To avoid complications arising from excision of UV lesions, we used bacterial uvrA mutants, in which such excision does not occur. Our evidence suggests that translesion synthesis is the primary component of Weigle reactivation of lambda phage in the absence of excision repair. The greater efficiency in Weigle reactivation of double-stranded DNA phage could thus be attributed to some inducible excision repair unable to occur on single-stranded DNA. In addition, after irradiation, lambda phage replication seems to switch prematurely from the theta mode to the rolling circle mode. Images PMID:2527845

  17. Mutagenicity and pausing of HIV reverse transcriptase during HIV plus-strand DNA synthesis.

    PubMed Central

    Ji, J; Hoffmann, J S; Loeb, L

    1994-01-01

    The unusually high frequency of misincorporation by HIV-1 reverse transcriptase (HIV RT) is likely to be the major factor in the rapid accumulation of viral mutations in AIDS, especially in the env gene. To investigate the ability of HIV RT to copy the env gene, we subcloned an HIV env gene fragment into a single-stranded DNA vector and measured the progression of synthesis by HIV RT. We observed that HIV RT, but not RT from avian myeloblastosis virus, DNA polymerase-alpha or T7 DNA polymerase, pauses specifically at poly-deoxyadenosine stretches within the env gene. The frequency of bypassing the polyadenosine stretches by HIV RT is enhanced by increasing the ratio of enzyme to template. We measured the fidelity of DNA synthesis within a segment of the hypervariable region 1 of the env gene (V-1) containing a poly-deoxyadenosine sequence by repetitively copying the DNA by HIV RT, and then cloning and sequencing the copied fragments. We found that 27% of the errors identified in V-1 sequence were frameshift mutations opposite the poly-adenosine tract, a site where strong pausing was observed. Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides. Moreover, netropsin increases the frequency of frameshift mutations in experiments in which HIV RT catalyzes gap filling synthesis within the lacZ gene in double-stranded circular M13mp2 DNA. These combined results suggest that the enhanced mutation frequency may be due to increased pausing at netropsin-modified polyadenosine tracts. Therefore, netropsin and related A-T binding chemicals may selectively enhance frameshift mutagenesis induced by HIV RT and yield predominantly non-viable virus. Images PMID:7510388

  18. Genetic and metabolomic analysis of AdeD and AdeI mutants of de novo purine biosynthesis: cellular models of de novo purine biosynthesis deficiency disorders.

    PubMed

    Duval, Nathan; Luhrs, Kyleen; Wilkinson, Terry G; Baresova, Veronika; Skopova, Vaclava; Kmoch, Stanislav; Vacano, Guido N; Zikanova, Marie; Patterson, David

    2013-03-01

    Purines are molecules essential for many cell processes, including RNA and DNA synthesis, regulation of enzyme activity, protein synthesis and function, energy metabolism and transfer, essential coenzyme function, and cell signaling. Purines are produced via the de novo purine biosynthesis pathway. Mutations in purine biosynthetic genes, for example phosphoribosylaminoimidazole carboxylase/phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS, E.C. 6.3.2.6/E.C. 4.1.1.21), can lead to developmental anomalies in lower vertebrates. Alterations in PAICS expression in humans have been associated with various types of cancer. Mutations in adenylosuccinate lyase (ADSL, E.C. 4.3.2.2) or 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC, E.C. 2.1.2.3/E.C. 3.5.4.10) lead to inborn errors of metabolism with a range of clinical symptoms, including developmental delay, severe neurological symptoms, and autistic features. The pathogenetic mechanism is unknown for these conditions, and no effective treatments exist. The study of cells carrying mutations in the various de novo purine biosynthesis pathway genes provides one approach to analysis of purine disorders. Here we report the characterization of AdeD Chinese hamster ovary (CHO) cells, which carry genetic mutations encoding p.E177K and p.W363* variants of PAICS. Both mutations impact PAICS structure and completely abolish its biosynthesis. Additionally, we describe a sensitive and rapid analytical method for detection of purine de novo biosynthesis intermediates based on high performance liquid chromatography with electrochemical detection. Using this technique we detected accumulation of AIR in AdeD cells. In AdeI cells, mutant for the ADSL gene, we detected accumulation of SAICAR and SAMP and, somewhat unexpectedly, accumulation of AIR. This method has great potential for metabolite profiling of de novo purine biosynthesis pathway mutants, identification of novel genetic

  19. Synthesis of a duplex oligonucleotide containing a nitrogen mustard interstrand DNA-DNA cross-link.

    PubMed

    Ojwang, J O; Grueneberg, D A; Loechler, E L

    1989-12-01

    Many cancer chemotherapeutic agents react with DNA and give adducts that block DNA replication, which is thought to result in cytotoxicity, especially in rapidly proliferating cells such as cancer cells. One class of these agents is bifunctionally reactive (e.g., the nitrogen mustards) and forms DNA-DNA cross-links. It is unknown whether inter- or intrastrand cross-links are more effective at blocking DNA replication. To evaluate this, a DNA shuttle vector is being constructed with an interstrand cross-link at a unique site. In the first step of this project, a duplex oligonucleotide containing an interstrand cross-link is isolated by denaturing polyacrylamide gel electrophoresis from the reaction of nitrogen mustard with two partially complementary oligodeoxynucleotides. The purified oligonucleotide product is characterized and shown to be cross-linked in a 5'-GAC-3' 3'-CTG-5' sequence by a nitrogen mustard moiety that is bound at the N(7)-position of the guanines in the opposing strands; the glycosylic bonds of these guanine adducts are stabilized in their corresponding imidazole ring-opened form. Nitrogen mustard is shown to react with a variety of oligonucleotides and, based upon these results, its preferred targets for interstrand cross-linking are 5'-GXC-3' sequences, where X can be any of the four deoxyribonucleotide bases. PMID:2819709

  20. On-Flow Synthesis of Co-Polymerizable Oligo-Microspheres and Application in ssDNA Amplification

    PubMed Central

    Lee, Se Hee; Lee, Jae Ha; Lee, Ho Won; Kim, Yang-Hoon; Jeong, Ok Chan; Ahn, Ji-Young

    2016-01-01

    We fabricated droplet-based microfluidic platform for copolymerizable microspheres with acrydite modified DNA probe. The copolymerizable 3-D polyacrylamide microspheres were successfully produced from microcontinuous-flow synthesis with on-channel solidification. DNA copolymerization activity, surface presentation and thermostability were assessed by using fluorescent labeled complementary probe. The binding performance was only visible on the surface area of oligo-microspheres. We show that the resulting oligo-microspheres can be directly integrated into a streamlined microsphere-PCR protocol for amplifying ssDNA. Our microspheres could be utilized as a potential material for ssDNA analysis such as DNA microarray and automatic DNA SELEX process. PMID:27447941

  1. Design and synthesis of efficient fluorescent dyes for incorporation into DNA backbone and biomolecule detection.

    PubMed

    Wang, Wei; Li, Alexander D Q

    2007-01-01

    We report here the design and synthesis of a series of pi-conjugated fluorescent dyes with D-A-D (D, donor; A, acceptor), D-pi-D, A-pi-A, and D-pi-A for applications as the signaling motif in biological-synthetic hybrid foldamers for DNA detection. The Horner-Wadsworth-Emmons (HWE) reaction and Knoevenagel condensation were demonstrated as the optimum ways for construction of long pi-conjugated systems. Such rodlike chromophores have distinct advantages, as their fluorescence properties are not quenched by the presence of DNA. To be incorporated into the backbone of DNA, the chromophores need to be reasonably soluble in organic solvent for solid-phase synthesis, and therefore a strategy of using flexible tetraethylene glycol (TEG) linkers at either end of these rodlike dyes was developed. The presence of TEG facilitates the protection of the chain-growing hydroxyl group with DMTrCl (dimethoxytrityl chloride) as well as the activation of the coupling step with phosphoramidite chemistry on an automated DNA synthesizer. To form fluorescence resonance energy transfer (FRET) pairs, six synthetic chromophores with blue to red fluorescence have been developed, and those with orthogonal fluorescent emission were chosen for incorporation into DNA-chromophore hybrid foldamers. PMID:17508711

  2. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    PubMed

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed. PMID:27019201

  3. Synthesis, DNA-binding and biological activity of a double intercalating analog of ethidium bromide.

    PubMed Central

    Kuhlmann, K F; Charbeneau, N J; Mosher, C W

    1978-01-01

    A bis-phenanthridinium salt has been synthesized and its DNA-binding studied. Evidence provided by UV and CD spectra, by thermal denaturation profiles and by equilibrium dialysis of the drug-DNA complex lead to the conclusion that both phenanthridine moieties intercalate in the helix. The double intercalator appears to be less potent than ethidium chloride as an inhibitor of nucleic acid synthesis in cultured L1210 cells, though it is more potent than a monomeric analog. The low potency may be due to a low cell influx rate. PMID:673863

  4. Synthesis of peptide-conjugated light-driven molecular motors and evaluation of their DNA-binding properties.

    PubMed

    Nagatsugi, Fumi; Takahashi, Yusuke; Kobayashi, Maiko; Kuwahara, Shunsuke; Kusano, Shuhei; Chikuni, Tomoko; Hagihara, Shinya; Harada, Nobuyuki

    2013-05-01

    Synthetic light-driven molecular motors are molecular machines capable of rotation under photo-irradiation. In this paper, we report the synthesis of peptide-conjugated molecular motors and evaluate their DNA-binding properties. PMID:23324812

  5. STRUCTURE-ACTIVITY STUDY OF PARACETAMOL ANALOGUES: INHIBITION OF REPLICATIVE DNA SYNTHESIS IN V79 CHINESE HAMSTER CELLS

    EPA Science Inventory

    Experimental and theoretical evidence pertaining to cytotoxic and genotoxic activity of paracetamol in biological systems was used to formulate a simple mechanistic hypothesis to explain the relative inhibition of replicative DNA synthesis by a series of 19 structurally similar p...

  6. Synthesis of Programmable Reaction-Diffusion Fronts Using DNA Catalyzers

    NASA Astrophysics Data System (ADS)

    Zadorin, Anton S.; Rondelez, Yannick; Galas, Jean-Christophe; Estevez-Torres, André

    2015-02-01

    We introduce a DNA-based reaction-diffusion (RD) system in which reaction and diffusion terms can be precisely and independently controlled. The effective diffusion coefficient of an individual reaction component, as we demonstrate on a traveling wave, can be reduced up to 2.7-fold using a self-assembled hydrodynamic drag. The intrinsic programmability of this RD system allows us to engineer, for the first time, orthogonal autocatalysts that counterpropagate with minimal interaction. Our results are in excellent quantitative agreement with predictions of the Fisher-Kolmogorov-Petrovskii-Piscunov model. These advances open the way for the rational engineering of pattern formation in pure chemical RD systems.

  7. [Intensity of DNA synthesis in animal organs after a flight on the Kosmos-782 biosatellite].

    PubMed

    Guseĭnov, F T; Egorov, I A; Komolova, G S; Tigranian, R A

    1979-01-01

    With respect to H3-thymidine incorporation the rate of DNA synthesis in the liver, spleen and thymus of rats was determined in flight and synchronous rats. Six hours post-flight the rate of H3-thymidine incorporation into the liver of flight rats did not differ from the normal (vivarium controls) and was 50% higher than in the synchronous rats. In the spleen and thymus of flight animals this parameter was 60 and 33% below the norm. Similar but less pronounced changes in the spleen were found in the synchronous rats. Twenty-five days postflight the rate of DNA synthesis in lymph organs recovered completely and tended to increase, whereas in the liver it remained significantly below the norm. PMID:459398

  8. Protein synthesis directly from PCR: progress and applications of cell-free protein synthesis with linear DNA.

    PubMed

    Schinn, Song-Min; Broadbent, Andrew; Bradley, William T; Bundy, Bradley C

    2016-06-25

    A rapid, versatile method of protein expression and screening can greatly facilitate the future development of therapeutic biologics, proteomic drug targets and biocatalysts. An attractive candidate is cell-free protein synthesis (CFPS), a cell-lysate-based in vitro expression system, which can utilize linear DNA as expression templates, bypassing time-consuming cloning steps of plasmid-based methods. Traditionally, such linear DNA expression templates (LET) have been vulnerable to degradation by nucleases present in the cell lysate, leading to lower yields. This challenge has been significantly addressed in the recent past, propelling LET-based CFPS as a useful tool for studying, screening and engineering proteins in a high-throughput manner. Currently, LET-based CFPS has promise in fields such as functional proteomics, protein microarrays, and the optimization of complex biological systems. PMID:27085957

  9. Synthesis, characterization and DNA cleaving studies of new organocobaloxime derivatives.

    PubMed

    Erdem-Tuncmen, Mukadder; Karipcin, Fatma; Ozmen, Ismail

    2013-01-01

    Dioxime ligand (H2L) was synthesized by condensation reaction between 4-biphenylchloroglyoxime and 4-chloroaniline. The metal complexes of the types, [Co(HL)2(i-Pr)Py], [CoL2(i-Pr)PyB2F4] and [CoL2(i-Pr)Py(Cu(phen))2](ClO4)2 [H2L = 4-(4-chlorophenylamino)biphenylglyoxime; phen = 1,10-phenanthroline; i-Pr = isopropyl; Py = pyridine] were synthesized and characterized by elemental analysis, FT-IR, 1H NMR and magnetic susceptibility, conductivity measurements. The results of elemental analyses, IR and NMR confirmed the stoichiometry of the complexes and the formation of ligand frameworks around the metal ions. The magnetic moment measurements of the complexes indicated that the complexes are diamagnetic (low-spin d6 octahedral) except trinuclear complex. Furthermore the interaction between the dioxime ligand and its complexes with DNA has also been investigated by agarose gel electrophoresis. The trinuclear Cu2Co complex with H2O2 as a cooxidant exhibited the strongest DNA cleaving activity. PMID:23841342

  10. The Foundry: the DNA synthesis and construction Foundry at Imperial College

    PubMed Central

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-01-01

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  11. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  12. The adenovirus E1A protein overrides the requirement for cellular ras in initiating DNA synthesis.

    PubMed Central

    Stacey, D W; Dobrowolski, S F; Piotrkowski, A; Harter, M L

    1994-01-01

    The adenovirus E1A protein can induce cellular DNA synthesis in growth-arrested cells by interacting with the cellular protein p300 or pRb. In addition, serum- and growth factor-dependent cells require ras activity to initiate DNA synthesis and recently we have shown that Balb/c 3T3 cells can be blocked in either early or late G1 following microinjection of an anti-ras antibody. In this study, the E1A 243 amino acid protein is shown through microinjection not only to shorten the G0 to S phase interval but, what is more important, to override the inhibitory effects exerted by the anti-ras antibody in either early or late G1. Specifically, whether E1A is co-injected with anti-ras into quiescent cells or injected 18 h following a separate injection of anti-ras after serum stimulation, it efficiently induces cellular DNA synthesis in cells that would otherwise be blocked in G0/G1. Moreover, injection of a mutant form of E1A that can no longer associate with p300 is just as efficient as wild-type E1A in stimulating DNA synthesis in cells whose ras activity has been neutralized by anti-ras. The results presented here show that E1A is capable of overriding the requirement of cellular ras activity in promoting the entry of cells into S phase. Moreover, the results suggest the possibility that pRb and/or pRb-related proteins may function in a ras-dependent pathway that enables E1A to achieve this activity. Images PMID:7813447

  13. The Foundry: the DNA synthesis and construction Foundry at Imperial College.

    PubMed

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-06-15

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  14. Bombesin stimulation of DNA synthesis and cell division in cultures of Swiss 3T3 cells.

    PubMed Central

    Rozengurt, E; Sinnett-Smith, J

    1983-01-01

    Bombesin is shown to be a potent mitogen for Swiss 3T3 cells. At nanomolar concentrations the peptide markedly enhances the ability of fresh serum to stimulate DNA synthesis in confluent and quiescent cultures of these cells. In the presence of a low concentration (3.5%) of serum, bombesin stimulates 3T3 cell proliferation. In serum-free medium, bombesin induces DNA synthesis in the absence of any other added growth factor; half-maximal effect is obtained at 1 nM. The mitogenic effect of bombesin is dependent on dose and time, is mimicked by litorin, and is markedly potentiated by insulin, colchicine, platelet-derived growth factor, and fibroblast-derived growth factor. These mitogens increase the maximal response elicited by bombesin and decrease the bombesin concentration required to produce half-maximal effect (from 1 nM to 0.3 nM). In contrast, vasopressin, phorbol esters, or cAMP increasing agents fail to enhance the maximal level of DNA synthesis induced by bombesin. Bombesin and litorin may provide useful model peptides for studies on the mechanism(s) by which extracellular ligands control cell proliferation. PMID:6344074

  15. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis

    PubMed Central

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-01-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  16. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-03-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  17. Stimulation of DNA synthesis in human epidermis by UVB radiation and its inhibition by difluoromethylornithine

    SciTech Connect

    Eshbaugh, W.G. Jr.; Forley, B.G.; Ritter, E.F.; Serafin, D.; Klitzman, B. )

    1990-04-01

    The purpose of this study was to determine whether the rate of DNA synthesis in human skin could be increased by UVB radiation and to determine the potential for reversing the stimulatory effects of UVB radiation by alpha-difluoromethylornithine (DFMO). Split-thickness facial skin was grafted onto athymic CD-1 Nu/Nu mice on the anterolateral dorsal surface. Following graft healing for 6 weeks, grafts were treated with 0%, 2%, or 5% DFMO (a potent inhibitor of polyamine biosynthesis) and subsequently irradiated with 0.15 J/cm2 of UVB light. Two days after UVB exposure, ({sup 3}H)thymidine was injected and the grafts were dissected and counted. Ultraviolet radiation significantly increased thymidine incorporation, indicating increased DNA synthesis. The stimulatory effects of UV radiation were significantly reduced by topical application of 5% DFMO. Thus administration of DFMO most likely decreased the polyamine level and decreased the rate of DNA synthesis, which may have caused a decreased rate of epidermal proliferation. Thus the topical application of DFMO may prove beneficial for UVB exposure and other hyperproliferative states where a decrease in the rate of cell turnover might be desirable.

  18. Deoxyadenosine family: improved synthesis, DNA damage and repair, analogs as drugs.

    PubMed

    Biswas, Himadri; Kar, Indrani; Chattopadhyaya, Rajagopal

    2013-08-01

    Improved synthesis of 2'-deoxyadenosine using Escherichia coli overexpressing some enzymes and gram-scale chemical synthesis of 2'-deoxynucleoside 5'-triphosphates reported recently are described in this review. Other topics include DNA damage induced by chromium(VI), Fenton chemistry, photoinduction with lumazine, or by ultrasound in neutral solution; 8,5'-cyclo-2'-deoxyadenosine isomers as potential biomarkers; and a recapitulation of purine 5',8-cyclonucleoside studies. The mutagenicities of some products generated by oxidizing 2'-deoxyadenosine 5'-triphosphate, nucleotide pool sanitization, and translesion synthesis are also reviewed. Characterizing cross-linking between nucleosides in opposite strands of DNA and endonuclease V-mediated deoxyinosine excision repair are discussed. The use of purine nucleoside analogs in the treatment of rarer chronic lymphoid leukemias is reviewed. Some analogs at the C8 position induced delayed polymerization arrest during HIV-1 reverse transcription. The susceptibility of clinically metronidazole-resistant Trichomonas vaginalis to two analogs, toyocamycin and 2-fluoro-2'-deoxyadenosine, were tested in vitro. GS-9148, a dAMP analog, was translocated to the priming site in a complex with reverse transcriptase and double-stranded DNA to gain insight into the mechanism of reverse transcriptase inhibition. PMID:25436589

  19. Stimulation of DNA synthesis in rat and mouse liver by various tumor promoters.

    PubMed

    Büsser, M T; Lutz, W K

    1987-10-01

    In order to investigate whether the stimulation of liver DNA synthesis might be used to detect one class of hepatic tumor promoters, the incorporation of orally administered radiolabelled thymidine into liver DNA was determined in rats and mice 24 h after a single oral gavage of test compounds at various dose levels. Three DNA-binding hepatocarcinogens, aflatoxin B1, benzidine and carbon tetrachloride, did not stimulate but rather inhibited DNA synthesis (not for CCl4). Four hepatic tumor promoters, clofibrate, DDT, phenobarbital and thioacetamide, gave rise to a stimulation in a dose-dependent manner. Single oral doses between 0.02 and 0.3 mmol/kg were required to double the level of thymidine incorporation into liver DNA (= doubling dose, DD). Differences between species or sex as observed in long-term carcinogenicity studies were reflected by a different stimulation of liver DNA synthesis. In agreement with the bioassay data, aldrin was positive only in male mice (DD = 0.007 mmol/kg) but not in male rats of female mice. 2,3,7,8-TCDD was positive in male mice (DD = 10(-6) mmol/kg) and in female rats (DD = 2 X 10(-6) mmol/kg) but not in male rats. The assay was also able to distinguish between structural isomers with different carcinogenicities. [alpha]Hexachlorocyclohexane stimulated liver DNA synthesis with a doubling dose of about 0.2 mmol/kg in male rats whereas the [gamma]-isomer was ineffective even at 1 mmol/kg. So far, only one result was inconsistent with carcinogenicity bioassay data. The different carcinogenicity of di(2-ethylhexyl)adipate (negative in rats) and di(2-ethylhexyl)phthalate (positive) was not detectable. Both plasticizers were positive in this short-term system with DD's of 0.7 mmol/kg for DEHA and 0.5 mmol/kg for DEHP. The proposed assay is discussed as an attempt to devise short-term assays for carcinogens not detected by the routine genotoxicity test systems. PMID:2443263

  20. Functional interplay of DnaE polymerase, DnaG primase and DnaC helicase within a ternary complex, and primase to polymerase hand-off during lagging strand DNA replication in Bacillus subtilis

    PubMed Central

    Rannou, Olivier; Le Chatelier, Emmanuelle; Larson, Marilynn A.; Nouri, Hamid; Dalmais, Bérengère; Laughton, Charles; Jannière, Laurent; Soultanas, Panos

    2013-01-01

    Bacillus subtilis has two replicative DNA polymerases. PolC is a processive high-fidelity replicative polymerase, while the error-prone DnaEBs extends RNA primers before hand-off to PolC at the lagging strand. We show that DnaEBs interacts with the replicative helicase DnaC and primase DnaG in a ternary complex. We characterize their activities and analyse the functional significance of their interactions using primase, helicase and primer extension assays, and a ‘stripped down’ reconstituted coupled assay to investigate the coordinated displacement of the parental duplex DNA at a replication fork, synthesis of RNA primers along the lagging strand and hand-off to DnaEBs. The DnaG–DnaEBs hand-off takes place after de novo polymerization of only two ribonucleotides by DnaG, and does not require other replication proteins. Furthermore, the fidelity of DnaEBs is improved by DnaC and DnaG, likely via allosteric effects induced by direct protein–protein interactions that lower the efficiency of nucleotide mis-incorporations and/or the efficiency of extension of mis-aligned primers in the catalytic site of DnaEBs. We conclude that de novo RNA primer synthesis by DnaG and initial primer extension by DnaEBs are carried out by a lagging strand–specific subcomplex comprising DnaG, DnaEBs and DnaC, which stimulates chromosomal replication with enhanced fidelity. PMID:23563155

  1. Nuclear Enrichment of Folate Cofactors and Methylenetetrahydrofolate Dehydrogenase 1 (MTHFD1) Protect de Novo Thymidylate Biosynthesis during Folate Deficiency*

    PubMed Central

    Field, Martha S.; Kamynina, Elena; Agunloye, Olufunmilayo C.; Liebenthal, Rebecca P.; Lamarre, Simon G.; Brosnan, Margaret E.; Brosnan, John T.; Stover, Patrick J.

    2014-01-01

    Folate-mediated one-carbon metabolism is a metabolic network of interconnected pathways that is required for the de novo synthesis of three of the four DNA bases and the remethylation of homocysteine to methionine. Previous studies have indicated that the thymidylate synthesis and homocysteine remethylation pathways compete for a limiting pool of methylenetetrahydrofolate cofactors and that thymidylate biosynthesis is preserved in folate deficiency at the expense of homocysteine remethylation, but the mechanisms are unknown. Recently, it was shown that thymidylate synthesis occurs in the nucleus, whereas homocysteine remethylation occurs in the cytosol. In this study we demonstrate that methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), an enzyme that generates methylenetetrahydrofolate from formate, ATP, and NADPH, functions in the nucleus to support de novo thymidylate biosynthesis. MTHFD1 translocates to the nucleus in S-phase MCF-7 and HeLa cells. During folate deficiency mouse liver MTHFD1 levels are enriched in the nucleus >2-fold at the expense of levels in the cytosol. Furthermore, nuclear folate levels are resistant to folate depletion when total cellular folate levels are reduced by >50% in mouse liver. The enrichment of folate cofactors and MTHFD1 protein in the nucleus during folate deficiency in mouse liver and human cell lines accounts for previous metabolic studies that indicated 5,10-methylenetetrahydrofolate is preferentially directed toward de novo thymidylate biosynthesis at the expense of homocysteine remethylation during folate deficiency. PMID:25213861

  2. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed Central

    Horn, T; Chang, C A; Urdea, M S

    1997-01-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

  3. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  4. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.

    2014-01-01

    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  5. Centrosomal Localization of Cyclin E-Cdk2 is Required for Initiation of DNA Synthesis

    PubMed Central

    Ferguson, Rebecca L.; Maller, James L.

    2010-01-01

    Summary Cyclin E-Cdk2 is known to regulate both DNA replication and centrosome duplication during the G1-S transition in the cell cycle [1–4], and disruption of centrosomes results in a G1 arrest in some cell types [5–7]. Localization of cyclin E on centrosomes is mediated by a 20 amino acid domain termed the centrosomal localization sequence (CLS), and expression of the GFP-tagged CLS displaces both cyclin E and cyclin A from the centrosome [8]. In asynchronous cells CLS expression inhibits the incorporation of bromodeoxyuridine (BrdU) into DNA, an effect proposed to reflect a G1 arrest. Here we show in synchronized cells that the reduction in BrdU incorporation reflects not a G1 arrest but rather direct inhibition of the initiation of DNA replication in S phase. The loading of essential DNA replication factors such as Cdc45 and PCNA onto chromatin is blocked by CLS expression, but DNA synthesis can be rescued by retargeting active cyclin E-Cdk2 to the centrosome. These results suggest that initial steps of DNA replication require centrosomally localized Cdk activity and link the nuclear cycle with the centrosome cycle at the G1-S transition. PMID:20399658

  6. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    SciTech Connect

    Lovrinovic, Marina; Niemeyer, Christof M. . E-mail: christof.niemeyer@uni-dortmund.de

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter were ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.

  7. In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template.

    PubMed Central

    Hulen, C; Legault-Demare, J

    1975-01-01

    Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences. Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. PMID:1052527

  8. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  9. A versatile biosensing system for DNA-related enzyme activity assay via the synthesis of silver nanoclusters using enzymatically-generated DNA as template.

    PubMed

    Yuan, Yijia; Li, Wenhua; Liu, Zhuoliang; Nie, Zhou; Huang, Yan; Yao, Shouzhuo

    2014-11-15

    In the present day, oligonucleotide-encapsulated silver clusters (DNA-AgNCs) have been widely applied into bio-analysis as a signal producer. Herein, we developed a novel method to synthesize DNA-AgNCs encapsulated by long-chain cytosine (C)-rich DNA. Such DNA was polymerized in a template-free way by terminal deoxynucleotidyl transferase (TdT). We demonstrated that TdT-polymerized long chain C-rich DNA can serve as an excellent template for AgNCs synthesis. Based on this novel synthesis strategy, we developed a label-free and turn-on fluorescence assay to detect TdT activity with ultralow limit of detection (LOD) of 0.0318 U and ultrahigh signal to background (S/B) of 46.7. Furthermore, our proposed method was extended to a versatile biosensing strategy for turn-on nucleases activity assay based on the enzyme-activated TdT polymerization. Two nucleases, EcoRI and ExoIII as model of endonuclease and exonuclease, respectively, have been detected with high selectivity and competitive low LOD of 0.0629 U and 0.00867 U, respectively. Our work demonstrates the feasibility of TdT polymerization-based DNA-AgNCs synthesis strategy as a versatile and potent biosensing platform to detect the activity of DNA-related enzymes. PMID:24907540

  10. Contributions of de novo synthesis of fatty acids to total VLDL-triglyceride secretion during prolonged hyperglycemia/hyperinsulinemia in normal man.

    PubMed Central

    Aarsland, A; Chinkes, D; Wolfe, R R

    1996-01-01

    Triglycerides (TG) are synthesized in the liver principally from two sources of fatty acids (FA): FA synthesized de novo in the liver and preformed FA. We have measured the rate of secretion of de novo synthesized FA and total secretion of FA bound to VLDL-TG in healthy men (n = 5) in the basal state, and after 1 (day 1) and 4 d (day 4) of a hypercaloric carbohydrate diet (approximately 2.5 times energy expenditure) that generated a moderate endogenous hyperinsulinemia (plasma insulin approximately 60 microU/ml). Prolonged carbohydrate hyperalimentation/hyperinsulinemia increased plasma VLDL-TG approximately 10-fold in part due to a 3.4-fold increase in total VLDL-TG secretion rate (basal state = 72+/-23, day 4 = 242+/-78 micromol TG/kg/d). Although the secretion of de novo synthesized FA increased throughout the study (basal state = 1.1+/-0.4, day 1 = 15.9+/-7.9, day 4 = 50.0+/-18.8 micromol TG/ kg/d), the 2.7-fold increase in secretion rate of preformed FA (basal state = 70+/-23, day 4 = 191+/-57 micromol TG/kg/d) quantitatively contributed the most to total VLDL-TG secretion rate. Decreased catabolism of VLDL-TG also contributed to the hypertriglyceridemia as reflected by an approximately fourfold decrease in both fractional turnover rate (basal state = 9.2+/-3.8, day 1 = 2.1+/-0.2, day 4 = 2.1+/-0.3 pools/d) and rate of clearance (basal state = 0.35+/-0.08, day 1 = 0.11+/-0.01, day 4 = 0.09+/-0.01 liter/kg/d) of VLDL-TG. Thus, the primary difference between 1 and 4 d of hyperinsulinemia in conjunction with carbohydrate hyperalimentation is the increase in hepatic secretion of preformed FA into VLDL-TG. PMID:8903319

  11. Simultaneous measurement of unscheduled and replicating DNA synthesis by means of a new cell culture insert DNA retention method: rapid induction of replicating DNA synthesis in response to genotoxic carcinogens.

    PubMed

    Okumura, A; Tanaka, T; Mori, H

    1996-08-01

    In order to measure simultaneously replicating DNA synthesis (RDS) and unscheduled DNA synthesis (UDS) in rat hepatocytes responding to exposure to carcinogens, a new method, namely the "cell culture insert DNA retention (CDR)" method, was developed. All CDR procedures for cell culture, digestion of cytoplasm and retention of DNA were performed on membranes attached to cell culture containers. Four subgroups of primary cultures of hepatocytes prepared from rats were exposed to a genotoxic or non-genotoxic carcinogen with or without 10 mM hydroxyurea and incubated for 4 h with 10 microCi/ml [3H]thymidine. The membranes were then processed for both liquid scintillation and autoradiography. Among seven tested chemicals, three genotoxic agents, 3,2'-dimethyl-4-aminobiphenyl, 2-acetylaminofluorene and diethylnitrosamine, and two non-genotoxic carcinogens, nafenopin and phenobarbital, induced RDS within 4 h after the exposure, indicating that these carcinogenic agents induce cell proliferation is non-proliferating rat hepatocytes prior to the emergence of genotoxic changes. Several indices were devised to characterize the genotoxicity of the tested chemicals. The induction patterns obtained showed a wide variation in the individual characteristics of carcinogen-induced genotoxicity and mitogenicity in the early phase of initiation. This is the first report of simultaneous measurement, by using a combination of autoradiography and liquid scintillation, of UDS and RDS induced in rat hepatocytes. The described CDR approach will be useful for risk assessment and characterization of carcinogenic and tumor-promoting agents. PMID:8797886

  12. Timing of initiation of macronuclear DNA synthesis is set during the preceding cell cycle in Paramecium tetraurelia: analysis of the effects of abrupt changes in nutrient level

    SciTech Connect

    Ching, A.S.L.; Berger, J.D.

    1986-11-01

    In many eukaryotic organisms, initiation of DNA synthesis is associated with a major control point within the cell cycle and reflects the commitment of the cell to the DNA replication-division portion of the cell cycle. In paramecium, the timing of DNA synthesis initiation is established prior to fission during the preceding cell cycle. DNA synthesis normally starts at 0.25 in the cell cycle. When dividing cells are subjected to abrupt nutrient shift-up by transfer from a chemostat culture to medium with excess food, or shift-down from a well-fed culture to exhausted medium, DNA synthesis initiation in the post-shift cell cycle occurs at 0.25 of the parental cell cycle and not at either 0.25 in the post-shift cell cycle or at 0.25 in the equilibrium cell cycle produced under the post-shift conditions. The long delay prior to initiation of DNA synthesis following nutritional shift-up is not a consequence of continued slow growth because the rate of protein synthesis increases rapidly to the normal level after shift-up. Analysis of the relation between increase in cell mass and initiation of DNA synthesis following nutritional shifts indicates that increase in cell mass, per se, is neither a necessary nor a sufficient condition for initiation of DNA synthesis, in spite of the strong association between accumulation of cell mass and initiation of DNA synthesis in cells growing under steady-state conditions.

  13. DNA synthesis and tritiated thymidine incorporation by heterotrophic freshwater bacteria in continuous culture

    SciTech Connect

    Ellenbroek, F.M.; Cappenberg, T.E. )

    1991-06-01

    Continuous cultivation of heterotrophic freshwater bacteria was used to assess the relationship between DNA synthesis and tritiated thymidine incorporation. In six different continuous cultures, each inoculated with a grazer-free mixed bacterial sample from Lake Vechten (The Netherlands), tritiated thymidine incorporation into a cold trichloroacetic acid precipitate and bacterial cell production were measured simultaneously. Empirical conversion factors were determined by division of both parameters. They ranged from 0.25 {times} 10{sup 18} to 1.31 {times} 10{sup 18} cells mol of tritiated thymidine{sup {minus}1}. In addition, DNA concentrations were measured by fluorometry with Heochst 33258. The validity of this technique was confirmed. Down to a generation time of 0.67 day, bacterial DNA content showed little variation, with values of 3.8 to 4.9 fg of DNA cell{sup {minus}1}. Theoretical conversion factors, which can be derived from DNA content under several assumptions, were between 0.26 {times} 10{sup 18} and 0.34 {times} 10{sup 18} cells mol of thymidine{sup {minus}1}. Isotope dilution was considered the main factor in the observed discrepancy between the conversion factors. In all experiments, a tritiated thymidine concentration of 20 nM was used. It was concluded that the observed difference resulted from intracellular isotope dilution which cannot be detected by current techniques for isotope dilution analysis.

  14. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  15. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions.

    PubMed

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G; de Wind, Niels

    2015-04-13

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa-Atr-Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  16. Temporal and topographic changes in DNA synthesis after induced follicular atresia

    SciTech Connect

    Greenwald, G.S. )

    1989-07-01

    Hamsters were hypophysectomized on the morning of estrus (Day 1) and injected immediately with 30 IU pregnant mare's serum (PMS). This was followed on Day 4 by the injection of an antiserum to PMS (PMS-AS) that initiated follicular atresia (Time zero). From 0 to 72 h after PMS-AS, the animals were injected with (3H)thymidine and killed 4 h later. One ovary was saved for autoradiography and histology; from the other ovary, 5-10 large antral follicles were dissected and pooled, and incorporation into DNA was determined by scintillation counting. DNA synthesis dropped sharply between 12 and 18 h, coinciding with a fall in labeling index of the cumulus oophorus and thecal endothelial cells and a sharp fall in thecal vascularity. In contrast, for the mural granulosa cells bordering on the antral cavity, labeling index dropped sharply between 8 and 12 h when thecal vascularity was still high. The earliest sign of atresia was evident by 4 h in cumulus cells when, paradoxically, DNA synthesis was still high. It took 3 days for atresia of the antral follicles to progress to advanced stages, as evidenced by pseudo-pronuclei in the free floating ovum, further erosion of the mural granulosa, and minimal DNA/follicle. However, the theca still retained its histological integrity and contained no pyknotic cells. Although by 48 h the granulosal compartment was in disarray (DNA/follicle significantly different from earlier values), the egg was still viable, as judged by maximal fluorescence after the addition of fluoroscein diacetate.

  17. Inhibition by 2-deoxy-D-ribose of DNA synthesis and growth in Raji cells

    SciTech Connect

    Ulrich, F.

    1988-04-01

    When Raji cells were cultured for 3 days in serum-free medium, addition of 2-deoxy-D-ribose at the start of culture inhibited incorporation of (/sup 3/H)thymidine and cell division. At deoxyribose concentrations between 1 and 5 mM, viability was 80% or greater after 3 days of culture even though 5 mM deoxyribose inhibited thymidine incorporation 95-99%. Inhibition by deoxyribose could be completely reversed if the culture medium was replaced with fresh medium up to 8 hr after the start of culture. The inhibition was specific for deoxyribose since other monosaccharides had no effect. Inhibition of DNA synthesis did not appear to be due to depletion of essential nutrients in the medium since the percentage inhibition of thymidine incorporation by cells cultured either in suboptimal serum-free media or in media supplemented with 0.025-5% human AB serum was similar. When DNA repair synthesis was measured as hydroxyurea-resistant thymidine incorporation, addition of deoxyribose to Raji cultures caused increased thymidine incorporation. These results, together with data from others,suggest that deoxyribose damages DNA.

  18. Microinjection of fos-specific antibodies blocks DNA synthesis in fibroblast cells

    SciTech Connect

    Riabowol, K.T.; Vosatka, R.J.; Ziff, E.B.; Lamb, N.J.; Feramisco, J.R.

    1988-04-01

    Transcription of the protooncogene c-fos is increased >10-fold within minutes of treatment of fibroblasts with serum or purified growth factors. Recent experiments with mouse 3T3 cell lines containing inducible fos antisense RNA constructs have shown that induced fos antisense RNA transcripts cause either a marked inhibition of growth in continuously proliferating cells or, conversely, a minimal effect except during the transition from a quiescent (G/sub o/) state into the cell cycle. Since intracellular production of large amounts of antisense RNA does not completely block gene expression, the authors microinjected affinity-purified antibodies raised against fos to determine whether and when during the cell cycle c-fos expression was required for cell proliferation. Using this independent method, they found that microinjected fos antibodies efficiently blocked serum-stimulated DNA synthesis when injected up to 6 to 8 h after serum stimulation of quiescent REF-52 fibroblasts. Furthermore, when fos antibodies were injected into asynchronously growing cells, a consistently greater number of cells was prevented from synthesizing DNA than when cells were injected with nonspecific immunoglobulins. Thus, whereas the activity of c-fos may be necessary for transition of fibroblasts from G/sub o/ to G/sub 1/ of the cell cycle, its function is also required during the early G/sub 1/ portion of the cell cycle to allow subsequent DNA synthesis.

  19. Non-transcriptional action of oestradiol and progestin triggers DNA synthesis.

    PubMed Central

    Castoria, G; Barone, M V; Di Domenico, M; Bilancio, A; Ametrano, D; Migliaccio, A; Auricchio, F

    1999-01-01

    The recent findings that oestradiol and progestins activate the Src/Ras/Erks signalling pathway raise the question of the role of this stimulation. Microinjection experiments of human mammary cancer-derived cells (MCF-7 and T47D) with cDNA of catalytically inactive Src or anti-Ras antibody prove that Src and Ras are required for oestradiol and progestin-dependent progression of cells through the cell cycle. The antitumoral ansamycin antibiotic, geldanamycin, disrupts the steroid-induced Ras-Raf-1 association and prevents Raf-1 activation and steroid-induced DNA synthesis. Furthermore, the selective MEK 1 inhibitor, PD 98059, inhibits oestradiol and progestin stimulation of Erk-2 and the steroid-dependent S-phase entry. The MDA-MB231 cells, which do not express oestradiol receptor, fail to respond to oestradiol in terms of Erk-2 activation and S-phase entry. Fibroblasts are made equally oestradiol-responsive in terms of DNA synthesis by transient transfection with either the wild-type or the transcriptionally inactive mutant oestradiol receptor (HE241G). Co-transfection of catalytically inactive Src as well as treatment with PD98059 inhibit the oestradiol-dependent S-phase entry of fibroblasts expressing either the wild-type oestrogen receptor or its transcriptionally inactive mutant. The data presented support the view that non-transcriptional action of the two steroids plays a major role in cell cycle progression. PMID:10228164

  20. De novo synthesis of minus strand RNA by the rotavirus RNA polymerase in a cell-free system involves a novel mechanism of initiation.

    PubMed Central

    Chen, D; Patton, J T

    2000-01-01

    The replicase activity of rotavirus open cores has been used to study the synthesis of (-) strand RNA from viral (+) strand RNA in a cell-free replication system. The last 7 nt of the (+) strand RNA, 5'-UGUGACC-3', are highly conserved and are necessary for efficient (-) strand synthesis in vitro. Characterization of the cell-free replication system revealed that the addition of NaCl inhibited (-) strand synthesis. By preincubating open cores with (+) strand RNA and ATP, CTP, and GTP prior to the addition of NaCl and UTP, the salt-sensitive step was overcome. Thus, (-) strand initiation, but not elongation, was a salt-sensitive process in the cell-free system. Further analysis of the requirements for initiation showed that preincubating open cores and the (+) strand RNA with GTP or UTP, but not with ATP or CTP, allowed (-) strand synthesis to occur in the presence of NaCl. Mutagenesis suggested that in the presence of GTP, (-) strand synthesis initiated at the 3'-terminal C residue of the (+) strand template, whereas in the absence of GTP, an aberrant initiation event occurred at the third residue upstream from the 3' end of the (+) strand RNA. During preincubation with GTP, formation of the dinucleotides pGpG and ppGpG was detected; however, no such products were made during preincubation with ATP, CTP, or UTP. Replication assays showed that pGpG, but not GpG, pApG, or ApG, served as a specific primer for (-) strand synthesis and that the synthesis of pGpG may occur by a template-independent process. From these data, we conclude that initiation of rotavirus (-) strand synthesis involves the formation of a ternary complex consisting of the viral RNA-dependent RNA polymerase, viral (+) strand RNA, and possibly a 5'-phosphorylated dinucleotide, that is, pGpG or ppGpG. PMID:11073221

  1. Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

    SciTech Connect

    Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A. )

    1991-07-01

    Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population.

  2. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. PMID:24571086

  3. Assessment of DNA synthesis in Islet-1{sup +} cells in the adult murine heart

    SciTech Connect

    Weinberger, Florian Mehrkens, Dennis Starbatty, Jutta Nicol, Philipp Eschenhagen, Thomas

    2015-01-02

    Highlights: • Islet-1 was expressed in the adult heart. • Islet-1-positive cells did not proliferate in the adult heart. • Sinoatrial node cells did not proliferate in the adult heart. - Abstract: Rationale: Islet-1 positive (Islet-1{sup +}) cardiac progenitor cells give rise to the right ventricle, atria and outflow tract during murine cardiac development. In the adult heart Islet-1 expression is limited to parasympathetic neurons, few cardiomyocytes, smooth muscle cells, within the proximal aorta and pulmonary artery and sinoatrial node cells. Its role in these cells is unknown. Here we tested the hypothesis that Islet-1{sup +} cells retain proliferative activity and may therefore play a role in regenerating specialized regions in the heart. Methods and results: DNA synthesis was analyzed by the incorporation of tritiated thymidine ({sup 3}H-thymidine) in Isl-1-nLacZ mice, a transgenic model with an insertion of a nuclear beta-galactosidase in the Islet-1 locus. Mice received daily injections of {sup 3}H-thymidine for 5 days. DNA synthesis was visualized throughout the heart by dipping autoradiography of cryosections. Colocalization of an nLacZ-signal and silver grains would indicate DNA synthesis in Islet-1{sup +} cells. Whereas Islet{sup −} non-myocyte nuclei were regularly marked by accumulation of silver grains, colocalization with nLacZ-signals was not detected in >25,000 cells analyzed. Conclusions: Islet-1{sup +} cells are quiescent in the adult heart, suggesting that, under normal conditions, even pacemaking cells do not proliferate at higher rates than normal cardiac myocytes.

  4. Nicotine inhibits collagen synthesis and alkaline phosphatase activity, but stimulates DNA synthesis in osteoblast-like cells

    SciTech Connect

    Ramp, W.K.; Lenz, L.G.; Galvin, R.J. )

    1991-05-01

    Use of smokeless tobacco is associated with various oral lesions including periodontal damage and alveolar bone loss. This study was performed to test the effects of nicotine on bone-forming cells at concentrations that occur in the saliva of smokeless tobacco users. Confluent cultures of osteoblast-like cells isolated from chick embryo calvariae were incubated for 2 days with nicotine added to the culture medium (25-600 micrograms/ml). Nicotine inhibited alkaline phosphatase in the cell layer and released to the medium, whereas glycolysis (as indexed by lactate production) was unaffected or slightly elevated. The effects on medium and cell layer alkaline phosphatase were concentration dependent with maximal inhibition occurring at 600 micrograms nicotine/ml. Nicotine essentially did not affect the noncollagenous protein content of the cell layer, but did inhibit collagen synthesis (hydroxylation of ({sup 3}H)proline and collagenase-digestible protein) at 100, 300, and 600 micrograms/ml. Release of ({sup 3}H)hydroxyproline to the medium was also decreased in a dose-dependent manner, as was the collagenase-digestible protein for both the medium and cell layer. In contrast, DNA synthesis (incorporation of ({sup 3}H)thymidine) was more than doubled by the alkaloid, whereas total DNA content was slightly inhibited at 600 micrograms/ml, suggesting stimulated cell turnover. Morphologic changes occurred in nicotine-treated cells including rounding up, detachment, and the occurrence of numerous large vacuoles. These results suggest that steps to reduce the salivary concentration of nicotine in smokeless tobacco users might diminish damaging effects of this product on alveolar bone.

  5. Fabrication of polyurethane molecular stamps for the synthesis of DNA microarray

    NASA Astrophysics Data System (ADS)

    Liu, Zhengchun; He, Quanguo; Xiao, Pengfeng; He, Nongyao; Lu, Zuhong; Bo, Liang

    2001-10-01

    Polyurethane based on polypropylene glycol (PPG) and Toluene diisocyanate (TDI) using 3,3'-dichloride-4,4'- methylenedianiline (MOCA) as the crosslinker is presented for the first time to fabricate molecular stamps (PU stamps) for the synthesis of DNA microarray with contact procedure. The predictability of the process is achieved by utilizing commercially available starting materials. SEM analysis of the morphology of PU stamps and master showed that PU elastometer could replicate subtly the motherboard's patterns with high fidelity. It was proved from the contact angle measurement that PU stamps surface has good affinity with acetonitrile, which guarantee the well-distribution of DNA monomers on patterned stamps. Laser confocal fluorescence microscopy images of oligonucleotide arrays confirmed polyurethane is an excellent material for molecular stamps.

  6. Inositol stimulates DNA and protein synthesis, and expansion by rabbit blastocysts in vitro.

    PubMed

    Fahy, M M; Kane, M T

    1992-04-01

    The effect of different concentrations (0, 0.6, 3, 15, 75 and 375 microM) of myo-inositol on the development of rabbit morulae to expanded blastocysts was investigated in terms of blastocyst expansion and synthesis of DNA and protein, as measured by incorporation of [3H]thymidine and [14C]amino acids into acid-precipitable material. A concentration of 15 microM inositol caused a 2.8-fold increase in blastocyst expansion (P less than 0.01), a 9.9-fold increase in thymidine incorporation into DNA (P less than 0.01) and a 3.6-fold increase in amino acid incorporation into protein (P less than 0.01). There were no significant differences in the range from 15 to 375 microM inositol. PMID:1522201

  7. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  8. Radiofrequency (microwave) radiation exposure of mammalian cells during UV-induced DNA repair synthesis

    SciTech Connect

    Meltz, M.L.; Walker, K.A.; Erwin, D.N.

    1987-05-01

    The effect of continuous-wave (CW) and pulsed-wave (PW) radiofrequency radiation (RFR) in the microwave range on UV-induced DNA repair has been investigated in MRC-5 normal human diploid fibroblasts. RFR exposure at power densities of 1 (or 5) and 10 mW/cm2 gave a maximum specific absorption rate (SAR) (at 10 mW/cm2) of 0.39 +/- 0.15 W/kg for 350 MHz RFR, 4.5 +/- 3.0 W/kg for 850 MHz RFR, and 2.7 +/- 1.6 W/kg for 1.2 GHz RFR. RFR exposures for 1 to 3 h at 37 degrees C, in either continuous-wave or pulsed-wave modes, had no effect on the rate of repair replication label incorporated into preexisting UV-damaged DNA. RFR exposures (PW), with a constant medium temperature of 39 degrees C at 350 and 850 MHz during the repair period after UV damage, also had no effect. Assay for induction of repair synthesis by RFR exposure alone in non-UV irradiated cells was negative for the 350-, 850-, and 1200-MHz CW and PW RFR at 37 degrees C and the 350- and 850-MHz PW RFR at 39 degrees C. RFR does not induce DNA repair under these exposure conditions. In preliminary experiments--with the tissue culture medium maintained at 39 degrees C and RFR exposures (PW) at the frequencies of 350, 850, and 1200 MHz--no effect on incorporation of (/sup 3/H)thymidine into DNA undergoing semiconservative synthesis was observed.

  9. Convergent DNA synthesis: a non-enzymatic dimerization approach to circular oligodeoxynucleotides.

    PubMed Central

    Rubin, E; Rumney, S; Wang, S; Kool, E T

    1995-01-01

    We report a novel convergent approach to the construction of circular DNA oligonucleotides from two smaller linear precursors. Circular DNAs 34-74 nucleotides (nt) in size are constructed non-enzymatically in a single step from two half-length oligomers. A DNA template is used to assemble the constituent parts into a triple helical complex which brings the four reactive ends together for chemical ligation with BrCN/imidazole/Ni2+. A homodimerization reaction strategy is successfully used on a small scale to construct circles 42, 58 and 74 nt in size. In addition, a heterodimerization strategy is successfully used in two cases to construct circular 34mers from different 16mer and 18mer precursors. Measurement of preparative yields for one biologically active 34mer circle shows that the dimerization strategy gives a yield higher than that from conventional cyclization and nearly as high as that for a normally synthesized linear DNA, establishing that there is not necessarily a yield penalty for circle construction. Six additional preparative circle constructions, giving conversions of approximately 33-85% from precursors to circular product, are also described. Convergent strategies allow the construction of medium and large size DNA molecules in higher yields than can be achieved by standard linear synthesis alone. Images PMID:7567468

  10. De Novo Lipogenesis and Cholesterol Synthesis in Humans with Long-Standing Type 1 Diabetes Are Comparable to Non-Diabetic Individuals

    PubMed Central

    Lambert, Jennifer E.; Ryan, Edmond A.; Thomson, Alan B. R.; Clandinin, Michael T.

    2013-01-01

    Background Synthesis of lipid species, including fatty acids (FA) and cholesterol, can contribute to pathological disease. The purpose of this study was to investigate FA and cholesterol synthesis in individuals with type 1 diabetes, a group at elevated risk for vascular disease, using stable isotope analysis. Methods Individuals with type 1 diabetes (n = 9) and age-, sex-, and BMI-matched non-diabetic subjects (n = 9) were recruited. On testing day, meals were provided to standardize food intake and elicit typical feeding responses. Blood samples were analyzed at fasting (0 and 24 h) and postprandial (2, 4, 6, and 8 hours after breakfast) time points. FA was isolated from VLDL to estimate hepatic FA synthesis, whereas free cholesterol (FC) and cholesteryl ester (CE) was isolated from plasma and VLDL to estimate whole-body and hepatic cholesterol synthesis, respectively. Lipid synthesis was measured using deuterium incorporation and isotope ratio mass spectrometry. Results Fasting total hepatic lipogenesis (3.91±0.90% vs. 5.30±1.22%; P = 0.41) was not significantly different between diabetic and control groups, respectively, nor was synthesis of myristic (28.60±4.90% vs. 26.66±4.57%; P = 0.76), palmitic (12.52±2.75% vs. 13.71±2.64%; P = 0.65), palmitoleic (3.86±0.91% vs. 4.80±1.22%; P = 0.65), stearic (5.55±1.04% vs. 6.96±0.97%; P = 0.29), and oleic acid (1.45±0.28% vs. 2.10±0.51%; P = 0.21). Postprandial lipogenesis was also not different between groups (P = 0.38). Similarly, fasting synthesis of whole-body FC (8.2±1.3% vs. 7.3±0.8%/day; P = 0.88) and CE (1.9±0.4% vs. 2.0±0.3%/day; P = 0.96) and hepatic FC (8.2±2.0% vs. 8.1±0.8%/day; P = 0.72) was not significantly different between diabetic and control subjects. Conclusions Despite long-standing disease, lipogenesis and cholesterol synthesis was not different in individuals with type 1 diabetes compared to healthy non-diabetic humans. PMID:24376543

  11. Replication Protein A: Single-stranded DNA's first responder : Dynamic DNA-interactions allow Replication Protein A to direct single-strand DNA intermediates into different pathways for synthesis or repair

    PubMed Central

    Chen, Ran; Wold, Marc S.

    2015-01-01

    Summary Replication Protein A (RPA), the major single-stranded DNA-binding protein in eukaryotic cells, is required for processing of single-stranded DNA (ssDNA) intermediates found in replication, repair and recombination. Recent studies have shown that RPA binding to ssDNA is highly dynamic and that more than high-affinity binding is needed for function. Analysis of DNA binding mutants identified forms of RPA with reduced affinity for ssDNA that are fully active, and other mutants with higher affinity that are inactive. Single molecule studies showed that while RPA binds ssDNA with high affinity, the RPA complex can rapidly diffuse along ssDNA and be displaced by other proteins that act on ssDNA. Finally, dynamic DNA binding allows RPA to prevent error-prone repair of double-stranded breaks and promote error-free repair. Together, these findings suggest a new paradigm where RPA acts as a first responder at sites with ssDNA, thereby actively coordinating DNA repair and DNA synthesis. PMID:25171654

  12. Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

    PubMed

    Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

    2012-10-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. PMID:22766489

  13. De novo truncating variants in the AHDC1 gene encoding the AT-hook DNA-binding motif-containing protein 1 are associated with intellectual disability and developmental delay

    PubMed Central

    Yang, Hui; Douglas, Ganka; Monaghan, Kristin G.; Retterer, Kyle; Cho, Megan T.; Escobar, Luis F.; Tucker, Megan E.; Stoler, Joan; Rodan, Lance H.; Stein, Diane; Marks, Warren; Enns, Gregory M.; Platt, Julia; Cox, Rachel; Wheeler, Patricia G.; Crain, Carrie; Calhoun, Amy; Tryon, Rebecca; Richard, Gabriele; Vitazka, Patrik; Chung, Wendy K.

    2015-01-01

    Whole-exome sequencing (WES) represents a significant breakthrough in clinical genetics, and identifies a genetic etiology in up to 30% of cases of intellectual disability (ID). Using WES, we identified seven unrelated patients with a similar clinical phenotype of severe intellectual disability or neurodevelopmental delay who were all heterozygous for de novo truncating variants in the AT-hook DNA-binding motif–containing protein 1 (AHDC1). The patients were all minimally verbal or nonverbal and had variable neurological problems including spastic quadriplegia, ataxia, nystagmus, seizures, autism, and self-injurious behaviors. Additional common clinical features include dysmorphic facial features and feeding difficulties associated with failure to thrive and short stature. The AHDC1 gene has only one coding exon, and the protein contains conserved regions including AT-hook motifs and a PDZ binding domain. We postulate that all seven variants detected in these patients result in a truncated protein missing critical functional domains, disrupting interactions with other proteins important for brain development. Our study demonstrates that truncating variants in AHDC1 are associated with ID and are primarily associated with a neurodevelopmental phenotype. PMID:27148574

  14. In planta Identification of Putative Pathogenicity Factors from the Chickpea Pathogen Ascochyta rabiei by De novo Transcriptome Sequencing Using RNA-Seq and Massive Analysis of cDNA Ends

    PubMed Central

    Fondevilla, Sara; Krezdorn, Nicolas; Rotter, Björn; Kahl, Guenter; Winter, Peter

    2015-01-01

    The most important foliar diseases in legumes worldwide are ascochyta blights. Up to now, in the Ascochyta-legume pathosystem most studies focused on the identification of resistance genes in the host, while very little is known about the pathogenicity factors of the fungal pathogen. Moreover, available data were often obtained from fungi growing under artificial conditions. Therefore, in this study we aimed at the identification of the pathogenicity factors of Ascochyta rabiei, causing ascochyta blight in chickpea. To identify potential fungal pathogenicity factors, we employed RNA-seq and Massive Analysis of cDNA Ends (MACE) to produce comprehensive expression profiles of A. rabiei genes isolated either from the fungus growing in absence of its host or from fungi infecting chickpea leaves. We further provide a comprehensive de novo assembly of the A. rabiei transcriptome comprising 22,725 contigs with an average length of 1178 bp. Since pathogenicity factors are usually secreted, we predicted the A. rabiei secretome, yielding 550 putatively secreted proteins. MACE identified 596 transcripts that were up-regulated during infection. An analysis of these genes identified a collection of candidate pathogenicity factors and unraveled the pathogen's strategy for infecting its host. PMID:26648917

  15. De novo truncating variants in the AHDC1 gene encoding the AT-hook DNA-binding motif-containing protein 1 are associated with intellectual disability and developmental delay.

    PubMed

    Yang, Hui; Douglas, Ganka; Monaghan, Kristin G; Retterer, Kyle; Cho, Megan T; Escobar, Luis F; Tucker, Megan E; Stoler, Joan; Rodan, Lance H; Stein, Diane; Marks, Warren; Enns, Gregory M; Platt, Julia; Cox, Rachel; Wheeler, Patricia G; Crain, Carrie; Calhoun, Amy; Tryon, Rebecca; Richard, Gabriele; Vitazka, Patrik; Chung, Wendy K

    2015-10-01

    Whole-exome sequencing (WES) represents a significant breakthrough in clinical genetics, and identifies a genetic etiology in up to 30% of cases of intellectual disability (ID). Using WES, we identified seven unrelated patients with a similar clinical phenotype of severe intellectual disability or neurodevelopmental delay who were all heterozygous for de novo truncating variants in the AT-hook DNA-binding motif-containing protein 1 (AHDC1). The patients were all minimally verbal or nonverbal and had variable neurological problems including spastic quadriplegia, ataxia, nystagmus, seizures, autism, and self-injurious behaviors. Additional common clinical features include dysmorphic facial features and feeding difficulties associated with failure to thrive and short stature. The AHDC1 gene has only one coding exon, and the protein contains conserved regions including AT-hook motifs and a PDZ binding domain. We postulate that all seven variants detected in these patients result in a truncated protein missing critical functional domains, disrupting interactions with other proteins important for brain development. Our study demonstrates that truncating variants in AHDC1 are associated with ID and are primarily associated with a neurodevelopmental phenotype. PMID:27148574

  16. In vivo evidence for translesion synthesis by the replicative DNA polymerase δ

    PubMed Central

    Hirota, Kouji; Tsuda, Masataka; Mohiuddin; Tsurimoto, Toshiki; Cohen, Isadora S.; Livneh, Zvi; Kobayashi, Kaori; Narita, Takeo; Nishihara, Kana; Murai, Junko; Iwai, Shigenori; Guilbaud, Guillaume; Sale, Julian E.; Takeda, Shunichi

    2016-01-01

    The intolerance of DNA polymerase δ (Polδ) to incorrect base pairing contributes to its extremely high accuracy during replication, but is believed to inhibit translesion synthesis (TLS). However, chicken DT40 cells lacking the POLD3 subunit of Polδ are deficient in TLS. Previous genetic and biochemical analysis showed that POLD3 may promote lesion bypass by Polδ itself independently of the translesion polymerase Polζ of which POLD3 is also a subunit. To test this hypothesis, we have inactivated Polδ proofreading in pold3 cells. This significantly restored TLS in pold3 mutants, enhancing dA incorporation opposite abasic sites. Purified proofreading-deficient human Polδ holoenzyme performs TLS of abasic sites in vitro much more efficiently than the wild type enzyme, with over 90% of TLS events resulting in dA incorporation. Furthermore, proofreading deficiency enhances the capability of Polδ to continue DNA synthesis over UV lesions both in vivo and in vitro. These data support Polδ contributing to TLS in vivo and suggest that the mutagenesis resulting from loss of Polδ proofreading activity may in part be explained by enhanced lesion bypass. PMID:27185888

  17. Dnmt3b, de novo DNA methyltransferase, interacts with SUMO-1 and Ubc9 through its N-terminal region and is subject to modification by SUMO-1.

    PubMed

    Kang, E S; Park, C W; Chung, J H

    2001-12-14

    Dnmt3b, a DNA methyltransferase, is essential for mammalian development potentially through its transcription repression activity. To comprehend the underlying regulatory mechanism of Dnmt3b, we isolated small ubiquitin-like modifier 1 (SUMO-1) and Ubc9 as Dnmt3b-interacting proteins using yeast two-hybrid screens. Deletion analysis and colocalization experiment demonstrated that Dnmt3b interacts with SUMO-1 and Ubc9 at its N-terminal region. We also confirmed the modification of Dnmt3b by SUMO-1 in vivo. These results suggest that sumoylation may constitute a regulation mechanism of Dnmt3b in vivo. PMID:11735126

  18. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    SciTech Connect

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-07-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were /sup 14/C-protein hydrolysate, (/sup 14/C)uridine, and (/sup 14/C) thymidine. Stimulation was determined by measuring incorporation of (/sup 14/C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules.

  19. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis. PMID:25420601

  20. Induction of unscheduled DNA synthesis in suspensions of rat hepatocytes by an environmental toxicant, 3,3'4,4'-tetrachloroazobenzene.

    PubMed

    Hsia, M T; Kreamer, B L

    1979-04-01

    Unscheduled DNA synthesis was induced by 3,3'4,4'-tetrachloroazobenzene (TCAB)) in freshly isolated suspensions of rat hepatocytes. A dose-dependent response was demonstrated. Hepatocellular DNA was obtained after the chloroform-isoamyl alchohol-phenol extraction of the isolated nuclei. The induction of unscheduled DNA synthesis was measured by the incorporation of [3H]-thymidine in the presence of hydroxyurea as determined by the scintillation counting assay. DNA repair data obtained in this study on benzo[a]pyrene and methyl methanesulfonate are comparable to a previous report using primary cultures of hepatocytes and cesium chloride gradients. Hence, the present method offers promise as a rapid and sensitive screen for chemical carcinogens. PMID:436117

  1. Estrogen-induced DNA synthesis in vascular endothelial cells is mediated by ROS signaling

    PubMed Central

    Felty, Quentin

    2006-01-01

    Background Since estrogen is known to increase vascular endothelial cell growth, elevated estrogen exposure from hormone replacement therapy or oral contraceptives has the potential to contribute in the development of abnormal proliferative vascular lesions and subsequent thickening of the vasculature. How estrogen may support or promote vascular lesions is not clear. We have examined in this study whether estrogen exposure to vascular endothelial cells increase the formation of reactive oxygen species (ROS), and estrogen-induced ROS is involved in the growth of endothelial cells. Methods The effect of estrogen on the production of intracellular oxidants and the role of estrogen-induced ROS on cell growth was studied in human umbilical vein endothelial cells. ROS were measured by monitoring the oxidation of 2'7'-dichlorofluorescin by spectrofluorometry. Endothelial cell growth was measured by a colorimetric immunoassay based on BrdU incorporation into DNA. Results Physiological concentrations of estrogen (367 fmol and 3.67 pmol) triggered a rapid 2-fold increase in intracellular oxidants in endothelial cells. E2-induced ROS formation was inhibited to basal levels by cotreatment with the mitochondrial inhibitor rotenone (2 μM) and xanthine oxidase inhibitor allopurinol (50 μM). Inhibitors of NAD(P)H oxidase, apocynin and DPI, did not block E2-induced ROS formation. Furthermore, the NOS inhibitor, L-NAME, did not prevent the increase in E2-induced ROS. These findings indicate both mitochondria and xanthine oxidase are the source of ROS in estrogen treated vascular endothelial cells. E2 treated cells showed a 2-fold induction of BrdU incorporation at 18 h which was not observed in cells exposed to vehicle alone. Cotreatment with ebselen (20 μM) and NAC (1 mM) inhibited E2-induced BrdU incorporation without affecting the basal levels of DNA synthesis. The observed inhibitory effect of NAC and ebselen on E2-induced DNA synthesis was also shown to be dose dependent

  2. NN-414. Novo Nordisk.

    PubMed

    Choi, Joong-Kwon

    2003-04-01

    Novo Nordisk is developing NN-414, an orally active beta-cell-selective regulator of insulin release, for the potential treatment of type 1 and type 2 diabetes. Phase 1 efficacy trials were underway by November 2000; these trials were ongoing in February 2002 and had been concluded by February 2003. PMID:12808887

  3. Total Synthesis of the Antitumor Antibiotic (±)-Streptonigrin: First- and Second-Generation Routes for de Novo Pyridine Formation Using Ring-Closing Metathesis

    PubMed Central

    2013-01-01

    The total synthesis of (±)-streptonigrin, a potent tetracyclic aminoquinoline-5,8-dione antitumor antibiotic that reached phase II clinical trials in the 1970s, is described. Two routes to construct a key pentasubstituted pyridine fragment are depicted, both relying on ring-closing metathesis but differing in the substitution and complexity of the precursor to cyclization. Both routes are short and high yielding, with the second-generation approach ultimately furnishing (±)-streptonigrin in 14 linear steps and 11% overall yield from inexpensive ethyl glyoxalate. This synthesis will allow for the design and creation of druglike late-stage natural product analogues to address pharmacological limitations. Furthermore, assessment of a number of chiral ligands in a challenging asymmetric Suzuki–Miyaura cross-coupling reaction has enabled enantioenriched (up to 42% ee) synthetic streptonigrin intermediates to be prepared for the first time. PMID:24328139

  4. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1

    PubMed Central

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R.; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D.; Chen, Zhucheng; Xiao, Wei

    2016-01-01

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5–Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  5. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    PubMed

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  6. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1.

    PubMed

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D; Chen, Zhucheng; Xiao, Wei

    2016-06-20

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5-Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  7. Antiproliferative activity of bicyclic benzimidazole nucleosides: synthesis, DNA-binding and cell cycle analysis.

    PubMed

    Sontakke, Vyankat A; Lawande, Pravin P; Kate, Anup N; Khan, Ayesha; Joshi, Rakesh; Kumbhar, Anupa A; Shinde, Vaishali S

    2016-04-26

    An efficient route was developed for synthesis of bicyclic benzimidazole nucleosides from readily available d-glucose. The key reactions were Vörbruggen glycosylation and ring closing metathesis (RCM). Primarily, to understand the mode of DNA binding, we performed a molecular docking study and the binding was found to be in the minor groove region. Based on the proposed binding model, UV-visible and fluorescence spectroscopic techniques using calf thymus DNA (CT-DNA) demonstrated a non-intercalative mode of binding. Antiproliferative activity of nucleosides was tested against MCF-7 and MDA-MB-231 breast cancer cell lines and found to be active at low micromolar concentrations. Compounds and displayed significant antiproliferative activity as compared to and with the reference anticancer drug, doxorubicin. Cell cycle analysis showed that nucleoside induced cell cycle arrest at the S-phase. Confocal microscopy has been performed to validate the induction of cellular apoptosis. Based on these findings, such modified bicyclic benzimidazole nucleosides will make a significant contribution to the development of anticancer drugs. PMID:27074628

  8. Biallelic mutations in CAD, impair de novo pyrimidine biosynthesis and decrease glycosylation precursors

    PubMed Central

    Ng, Bobby G.; Wolfe, Lynne A.; Ichikawa, Mie; Markello, Thomas; He, Miao; Tifft, Cynthia J.; Gahl, William A.; Freeze, Hudson H.

    2015-01-01

    In mitochondria, carbamoyl-phosphate synthetase 1 activity produces carbamoyl phosphate for urea synthesis, and deficiency results in hyperammonemia. Cytoplasmic carbamoyl-phosphate synthetase 2, however, is part of a tri-functional enzyme encoded by CAD; no human disease has been attributed to this gene. The tri-functional enzyme contains carbamoyl-phosphate synthetase 2 (CPS2), aspartate transcarbamylase (ATCase) and dihydroorotase (DHOase) activities, which comprise the first three of six reactions required for de novo pyrimidine biosynthesis. Here we characterize an individual who is compound heterozygous for mutations in different domains of CAD. One mutation, c.1843-1G>A, results in an in-frame deletion of exon 13. The other, c.6071G>A, causes a missense mutation (p.Arg2024Gln) in a highly conserved residue that is essential for carbamoyl-phosphate binding. Metabolic flux studies showed impaired aspartate incorporation into RNA and DNA through the de novo synthesis pathway. In addition, CTP, UTP and nearly all UDP-activated sugars that serve as donors for glycosylation were decreased. Uridine supplementation rescued these abnormalities, suggesting a potential therapy for this new glycosylation disorder. PMID:25678555

  9. Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction.

    PubMed

    Zhang, Yinbo; Baranovskiy, Andrey G; Tahirov, Emin T; Tahirov, Tahir H; Pavlov, Youri I

    2016-07-01

    DNA polymerases (pols) are sophisticated protein machines operating in the replication, repair and recombination of genetic material in the complex environment of the cell. DNA pol reactions require at least two divalent metal ions for the phosphodiester bond formation. We explore two understudied roles of metals in pol transactions with emphasis on polα, a crucial enzyme in the initiation of DNA synthesis. We present evidence that the combination of many factors, including the structure of the template/primer, the identity of the metal, the metal turnover in the pol active site, and the influence of the concentration of nucleoside triphosphates, affect DNA pol synthesis. On the poly-dT70 template, the increase of Mg(2+) concentration within the range typically used for pol reactions led to the severe loss of the ability of pol to extend DNA primers and led to a decline in DNA product sizes when extending RNA primers, simulating the effect of "counting" of the number of nucleotides in nascent primers by polα. We suggest that a high Mg(2+) concentration promotes the dynamic formation of unconventional DNA structure(s), thus limiting the apparent processivity of the enzyme. Next, we found that Zn(2+) supported robust polα reactions when the concentration of nucleotides was above the concentration of ions; however, there was only one nucleotide incorporation by the Klenow fragment of DNA pol I. Zn(2+) drastically inhibited polα, but had no effect on Klenow, when Mg(2+) was also present. It is possible that Zn(2+) perturbs metal-mediated transactions in pol active site, for example affecting the step of pyrophosphate removal at the end of each pol cycle necessary for continuation of polymerization. PMID:27235627

  10. Unscheduled deoxyribonucleic acid (DNA) synthesis assays for toxicological studies. May 1977-March 1990 (A Bibliography from the NTIS data base). Report for May 1977-March 1990

    SciTech Connect

    Not Available

    1990-04-01

    This bibliography contains citations concerning the unscheduled DNA synthesis (UDS) assay for toxicological studies. UDS assays provide very sensitive measures of damage to DNA by detecting induction of DNA synthesis in non-S-phase cells. UDS toxicological studies analyzing gamma radiation, drugs, pesticides, nerve gas, jet engine fuels, ultraviolet light, chlorated organic compounds, and aromatic compounds are discussed. UDS studies using both human and animal tissue cultures are described. (Contains 57 citations fully indexed and including a title list.)

  11. Repair synthesis by human cell extracts in cisplatin-damaged DNA is preferentially determined by minor adducts.

    PubMed Central

    Calsou, P; Frit, P; Salles, B

    1992-01-01

    During reaction of cis-diamminedichloroplatinum(II) (cis-DDP) with DNA, a number of adducts are formed which may be discriminated by the excision-repair system. An in vitro excision-repair assay with human cell-free extracts has been used to assess the relative repair extent of monofunctional adducts, intrastrand and interstrand cross-links of cis-DDP on plasmid DNA. Preferential removal of cis-DDP 1,2-intrastrand diadducts occurred in the presence of cyanide ions. In conditions where cyanide treatment removed 85% of total platinum adducts while approximately 70% of interstrand cross-links remained in plasmid DNA, no significant variation in repair synthesis by human cell extracts was observed. Then, we constructed three types of plasmid DNA substrates containing mainly either monoadducts, 1,2-intrastrand cross-links or interstrand cross-links lesions. The three plasmid species were modified in order to obtain the same extent of total platinum DNA adducts per plasmid. No DNA repair synthesis was detected with monofunctional adducts during incubation with human whole cell extracts. However, a two-fold increase in repair synthesis was found when the proportion of interstrand cross-links in plasmid DNA was increased by 2-3 fold. These findings suggest that (i) cis-DDP 1,2-intrastrand diadducts are poorly repaired by human cell extracts in vitro, (ii) among other minor lesions potentially cyanide-resistant, cis-DDP interstrand cross-links represent a major lesion contributing to the repair synthesis signal in the in vitro assay. These results could account for the drug efficiency in vivo. Images PMID:1475197

  12. A de novo frameshift mutation in chromodomain helicase DNA-binding domain 8 (CHD8): A case report and literature review.

    PubMed

    Merner, Nancy; Forgeot d'Arc, Baudouin; Bell, Scott C; Maussion, Gilles; Peng, Huashan; Gauthier, Julie; Crapper, Liam; Hamdan, Fadi F; Michaud, Jacques L; Mottron, Laurent; Rouleau, Guy A; Ernst, Carl

    2016-05-01

    Mutations in chromodomain helicase DNA-binding domain 8 (CHD8) have been identified in independent genotyping studies of autism spectrum disorder. To better understand the phenotype associated with CHD8 mutations, we genotyped all CHD8 exons in carefully assessed cohorts of autism (n = 142), schizophrenia (SCZ; n = 143), and intellectual disability (ID; n = 94). We identified one frameshift mutation, seven non-synonymous variants, and six synonymous variants. The frameshift mutation, p.Asn2092Lysfs*2, which creates a premature stop codon leading to the loss of 212 amino acids of the protein, was from an autism case on whom we present multiple clinical assessments and pharmacological treatments spanning more than 10 years. RNA and protein analysis support a model where the transcript generated from the mutant allele results in haploinsufficiency of CHD8. This case report supports the association of CHD8 mutations with classical autism, macrocephaly, infantile hypotonia, speech delay, lack of major ID, and psychopathology in late adolescence caused by insufficient dosage of CHD8. Review of 16 other CHD8 mutation cases suggests that clinical features and their severity vary considerably across individuals; however, these data support a CHD8 mutation syndrome, further highlighting the importance of genomic medicine to guide clinical assessment and treatment. PMID:26789910

  13. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  14. Synthesis of herpes simplex virus, vaccinia virus, and adenovirus DNA in isolated HeLa cell nuclei. I. Effect of viral-specific antisera and phosphonoacetic acid.

    PubMed Central

    Bolden, A; Aucker, J; Weissbach, A

    1975-01-01

    Purified nuclei, isolated from appropriately infected HeLa cells, are shown to synthesize large amounts of either herpes simplex virus (HSV) or vaccinia virus DNA in vitro. The rate of synthesis of DNA by nuclei from infected cells is up to 30 times higher than the synthesis of host DNA in vitro by nuclei isolated from uninfected HeLa cells. Thus HSV nuclei obtained from HSV-infected cells make DNA in vitro at a rate comparable to that seen in the intact, infected cell. Molecular hybridization studies showed that 80% of the DNA sequences synthesized in vitro by nuclei from herpesvirus-infected cells are herpesvirus specific. Vaccinia virus nuclei from vaccinia virus-infected cells, also produce comparable percentages of vaccinia virus-specific DNA sequences. Adenovirus nuclei from adenovirus 2-infected HeLa cells, which also synthesize viral DNA in vitro, have been included in this study. Synthesis of DNA by HSV or vaccinia virus nuclei is markedly inhibited by the corresponding viral-specific antisera. These antisera inhibit in a similar fashion the purified herpesvirus-induced or vaccinia virus-induced DNA polymerase isolated from infected cells. Phosphonoacetic acid, reported to be a specific inhibitor of herpesvirus formation and the herpesvirus-induced DNA polymerase, is equally effective as an inhibitor of HSV DNA synthesis in isolated nuclei in vitro. However, we also find phosphonoacetic acid to be an effective inhibitor of vaccinia virus nuclear DNA synthesis and the purified vaccinia virus-induced DNA polymerase. In addition, this compound shows significant inhibition of DNA synthesis in isolated nuclei obtained from adenovirus-infected or uninfected cells and is a potent inhibitor of HeLa cell DNA polymerase alpha. PMID:172658

  15. The structure-based design, synthesis and biological evaluation of DNA-binding bisintercalating bisanthrapyrazole anticancer compounds

    PubMed Central

    Hasinoff, Brian B.; Liang, Hong; Wu, Xing; Guziec, Lynn J.; Guziec, Frank S.; Marshall, Kyle; Yalowich, Jack C.

    2008-01-01

    Anticancer drugs that bind to DNA and inhibit DNA-processing enzymes represent an important class of anticancer drugs. In order to find stronger DNA binding and more potent cytotoxic compounds, a series of ester-coupled bisanthrapyrazole derivatives of 7-chloro-2-[2-[(2-hydroxyethyl)methylamino]ethyl]anthra[1,9-cd]pyrazol-6(2H)-one (AP9) were designed and evaluated by molecular docking techniques. Because the anthrapyrazoles are unable to be reductively activated like doxorubicin and other anthracyclines, they should not be cardiotoxic like the anthracyclines. Based on the docking scores of a series of bisanthrapyrazoles with different numbers of methylene linkers (n) that were docked into an X-ray structure of double-stranded DNA, five bisanthrapyrazoles (n = 1 to 5) were selected for synthesis and physical and biological evaluation. The synthesized compounds were evaluated for DNA binding and bisintercalation by measuring the DNA melting temperature increase, for growth inhibitory effects on the human erythroleukemic K562 cell line, and for DNA topoisomerase IIα-mediated cleavage of DNA and inhibition of DNA topoisomerase IIα decatenation activities. The results suggest that the bisanthrapyrazoles with n = 2 to 5 formed bisintercalation complexes with DNA. In conclusion, a novel group of bisintercalating anthrapyrazole compounds have been designed, synthesized and biologically evaluated as possible anticancer agents. PMID:18258442

  16. SYNTHESIS, IN VITRO METABOLISM, MUTAGENICITY, AND DNA-ADDUCTION OF NAPHTHO[1,2-E]PYRENE

    EPA Science Inventory

    SYNTHESIS, IN V1TRO METABOLISM, MUTAGENICITY , AND DNA-ADDUCnON OF NAPHTHO[l ,2-e ]PYRENE

    Literature data, although limited, underscore the contribution of C24HI4 polycyclic aromatic hydrocarbons to the biological activity of the extracts of complex environmental samples....

  17. Synthesis of DNA templated trifunctional electrically conducting, optical, and magnetic nanochain of Nicore-Aushell for biodevice

    NASA Astrophysics Data System (ADS)

    Mandal, Madhuri; Mandal, Kalyan

    2009-07-01

    Synthesis of trifunctional, e.g., electrically conducting, optical, and magnetic nanochains of Nicore-Aushell, has been discussed here. Properties of the materials were investigated from the view of its application in bionanodevice. Our investigation indicates that such material attached to biomolecule "DNA chain" and having three main properties in one material will have great potentiality in medical instrumentation and biocomputer device.

  18. UAP56 is a novel interacting partner of Bcr in regulating vascular smooth muscle cell DNA synthesis

    SciTech Connect

    Sahni, Abha; Wang, Nadan; Alexis, Jeffrey D.

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer UAP56 is an important regulator of DNA synthesis in vascular smooth muscle cells. Black-Right-Pointing-Pointer UAP56 binds to Bcr. Black-Right-Pointing-Pointer Interaction between Bcr and UAP56 is critical for Bcr induced DNA synthesis. -- Abstract: Bcr is a serine/threonine kinase that is a critical regulator of vascular smooth muscle cell inflammation and proliferation. We have previously demonstrated that Bcr acts in part via phosphorylation and inhibition of PPAR{gamma}. We have identified the RNA helicase UAP56 as another substrate of Bcr. In this report we demonstrate that knockdown of UAP56 blocks Bcr induced DNA synthesis in vascular smooth muscle cells (VSMC). We also found that over expression of Bcr increased the expression of cyclin E and decreased the expression of p27. Knockdown of UAP56 reversed the effect of Bcr on cyclin E and p27 expression. Furthermore, we found that Bcr binds to UAP56 and demonstrate that binding of UAP56 to Bcr is critical for Bcr induced DNA synthesis in VSMC. Our data identify UAP56 as an important binding partner of Bcr and a novel target for inhibiting vascular smooth muscle cell proliferation.

  19. PROLINE IS REQUIRED FOR THE STIMULATION OF DNA SYNTHESIS IN HEPATOCYTE CULTURES BY EGF (EPIDERMAL GROWTH FACTOR)

    EPA Science Inventory

    Epidermal growth factor (EGF) has been shown to stimulate DNA synthesis in rat parenchymal hepatocytes both in vivo and in vitro (4,9). The authors report here that this response in vitro is dependent on the amino acids present in the media. Of all the amino acids, proline has th...

  20. Knockdown of prolactin receptors in a pancreatic beta cell line: effects on DNA synthesis, apoptosis, and gene expression.

    PubMed

    Arumugam, Ramamani; Fleenor, Don; Freemark, Michael

    2014-08-01

    Prolactin (PRL) and placental lactogen stimulate beta cell replication and insulin production in vitro and in vivo. The molecular mechanisms by which lactogens promote beta cell expansion are unclear. We treated rat insulinoma cells with a PRL receptor (PRLR) siRNA to determine if PRLR signaling is required for beta cell DNA synthesis and cell survival and to identify beta cell cycle genes whose expression depends upon lactogen action. Effects of PRLR knockdown were compared with those of PRL treatment. PRLR knockdown (-80 %) reduced DNA synthesis, increased apoptosis, and inhibited expression of cyclins D2 and B2, IRS-2, Tph1, and the anti-apoptotic protein PTTG1; p21 and BCL6 mRNAs increased. Conversely, PRL treatment increased DNA synthesis, reduced apoptosis, and enhanced expression of A, B and D2 cyclins, CDK1, IRS-2, FoxM1, BCLxL, and PTTG1; BCL6 declined. PRLR signaling is required for DNA synthesis and survival of rat insulinoma cells. The effects of lactogens are mediated by down-regulation of cell cycle inhibitors (BCL6, p21) and induction of A, B, and D2 cyclins, IRS-2, Tph1, FoxM1, and the anti-apoptotic proteins BCLxL and PTTG1. PMID:24114406

  1. Rational design, synthesis, and DNA binding properties of novel sequence-selective peptidyl congeners of ametantrone.

    PubMed

    Gianoncelli, Alessandra; Basili, Serena; Scalabrin, Matteo; Sosic, Alice; Moro, Stefano; Zagotto, Giuseppe; Palumbo, Manlio; Gresh, Nohad; Gatto, Barbara

    2010-07-01

    Natural and synthetic compounds characterized by an anthraquinone nucleus represent an important class of anti-neoplastic agents, the mechanism of action of which is related to intercalation into DNA. Ametantrone (AM) is a synthetic 9,10-anthracenedione bearing two (hydroxyethylamino)ethylamino residues at positions 1 and 4; along with other anthraquinones and anthracyclines, it shares a polycyclic intercalating moiety and charged side chains that stabilize DNA binding. All these drugs elicit adverse side effects, which represent a challenge for antitumor chemotherapy. In the present work the structure of AM was augmented with appropriate groups that target well-defined base pairs in the major groove. These should endow AM with DNA sequence selectivity. We describe the rationale for the synthesis and the evaluation of activity of a new series of compounds in which the planar anthraquinone is conjugated at positions 1 and 4 through the side chains of AM or other bioisosteric linkers to appropriate dipeptides. The designed novel AM derivatives were shown to selectively stabilize two oligonucleotide duplexes that both have a palindromic GC-rich hexanucleotide core, but their stabilizing effects on a random DNA sequence was negligible. In the case of the most effective compound, the 1,4-bis-[Gly-(L-Lys)] derivative of AM, the experimental results confirm the predictions of earlier theoretical computations. In contrast, AM had equal stabilizing effects on all three sequences and showed no preferential binding. This novel peptide derivative can be classified as a strong binder regarding the sequences that it selectively targets, possibly opening the exploitation of less cytotoxic conjugates of AM to the targeted treatment of oncological and viral diseases. PMID:20458714

  2. Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

    PubMed

    Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

    2014-08-01

    In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. PMID:24965874

  3. The Role of De Novo Catecholamine Synthesis in Mediating Methylmercury-Induced Vesicular Dopamine Release From Rat Pheochromocytoma (PC12) Cells

    PubMed Central

    Atchison, William D.

    2013-01-01

    The purpose of this study was to characterize methylmercury (MeHg)–induced dopamine (DA) release from undifferentiated pheochromocytoma (PC12) cells and to examine the potential role for DA synthesis in this process. MeHg caused a significant increase in DA release that was both concentration- and time-dependent. DA release was significantly increased by 2µM MeHg at 60min and by 5µM MeHg at 30min; 1µM MeHg was without effect. Because DA release induced by 5µM MeHg was associated with a significant percentage of cell death at 60 and 120min, 2µM MeHg was chosen for further characterization of release mechanisms. MeHg-induced DA release was attenuated but not abolished in the absence of extracellular calcium, whereas the vesicular content depleting drug reserpine (50nM) abolished release. Thus, MeHg-induced DA release requires vesicular exocytosis but not extracellular calcium. MeHg also increased intracellular DA and the rate of DA storage utilization, suggesting a role for DA synthesis in MeHg-induced DA release. The tyrosine hydroxylase inhibitor α-methyltyrosine (300µM, 24h) completely abolished MeHg-induced DA release. MeHg significantly increased DA precursor accumulation in cells treated with 3-hydroxybenzylhydrazine (10µM), revealing that MeHg increases tyrosine hydroxylase activity. Overall, these data demonstrate that MeHg facilitates DA synthesis, increases intracellular DA, and augments vesicular exocytosis. PMID:23425605

  4. Simple, efficient protocol for enzymatic synthesis of uniformly 13C, 15N-labeled DNA for heteronuclear NMR studies.

    PubMed Central

    Masse, J E; Bortmann, P; Dieckmann, T; Feigon, J

    1998-01-01

    The use of uniformly 13C,15N-labeled RNA has greatly facilitated structural studies of RNA oligonucleotides by NMR. Application of similar methodologies for the study of DNA has been limited, primarily due to the lack of adequate methods for sample preparation. Methods for both chemical and enzymatic synthesis of DNA oligonucleotides uniformly labeled with 13C and/or 15N have been published, but have not yet been widely used. We have developed a modified procedure for preparing uniformly 13C,15N-labeled DNA based on enzymatic synthesis using Taq DNA polymerase. The highly efficient protocol results in quantitative polymerization of the template and approximately 80% incorporation of the labeled dNTPs. Procedures for avoiding non-templated addition of nucleotides or for their removal are given. The method has been used to synthesize several DNA oligonucleotides, including two complementary 15 base strands, a 32 base DNA oligonucleotide that folds to form an intramolecular triplex and a 12 base oligonucleotide that dimerizes and folds to form a quadruplex. Heteronuclear NMR spectra of the samples illustrate the quality of the labeled DNA obtained by these procedures. PMID:9592146

  5. Peptide Nucleic Acid with a Lysine Side Chain at the β-Position: Synthesis and Application for DNA Cleavage.

    PubMed

    Sugiyama, Toru; Kuwata, Keiko; Imamura, Yasutada; Demizu, Yosuke; Kurihara, Masaaki; Takano, Masashi; Kittaka, Atsushi

    2016-01-01

    This paper reports the synthesis of new β-Lys peptide nucleic acid (PNA) monomers and their incorporation into a 10-residue PNA sequence. PNA containing β-Lys PNA units formed a stable hybrid duplex with DNA. However, incorporation of β-Lys PNA units caused destabilization of PNA-DNA duplexes to some extent. Electrostatic attractions between β-PNA and DNA could reduce this destabilization effect. Subsequently, bipyridine-conjugated β-Lys PNA was prepared and exhibited sequence selective cleavage of DNA. Based on the structures of the cleavage products and molecular modeling, we reasoned that bipyridine moiety locates within the minor groove of the PNA-DNA duplexes. The lysine side chain of β-PNA is a versatile handle for attaching various functional molecules. PMID:27373637

  6. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    SciTech Connect

    Kim, Sunyoung; Baltimore, D. Massachusetts Institute of Technology, Cambridge ); Byrn, R.; Groopman, J. )

    1989-09-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4{sup +} lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes.

  7. An Integrated System for DNA Sequencing by Synthesis Using Novel Nucleotide Analogues

    PubMed Central

    Guo, Jia; Yu, Lin; Turro, Nicholas J.; Ju, Jingyue

    2010-01-01

    Conspectus The Human Genome Project has concluded, but its successful completion has increased, rather than decreased, the need for high-throughput DNA sequencing technologies. The possibility of clinically screening a full genome for an individual's mutations offers tremendous benefits, both for pursuing personalized medicine as well as uncovering the genomic contributions to diseases. The Sanger sequencing method—although enormously productive for more than 30 years—requires an electrophoretic separation step that, unfortunately, remains a key technical obstacle for achieving economically acceptable full-genome results. Alternative sequencing approaches thus focus on innovations that can reduce costs. The DNA sequencing by synthesis (SBS) approach has shown great promise as a new sequencing platform, with particular progress reported recently. The general fluorescent SBS approach involves (i) incorporation of nucleotide analogs bearing fluorescent reporters, (ii) identification of the incorporated nucleotide by its fluorescent emissions, and (iii) cleavage of the fluorophore, along with the reinitiation of the polymerase reaction for continuing sequence determination. In this Account, we review the construction of a DNA-immobilized chip and the development of novel nucleotide reporters for the SBS sequencing platform. Click chemistry, with its high selectivity and coupling efficiency, was explored for surface immobilization of DNA. The first generation (G-1) modified nucleotides for SBS feature a small chemical moiety capping the 3′-OH and a fluorophore tethered to the base through a chemically cleavable linker; the design ensures that the nucleotide reporters are good substrates for the polymerase. The 3′-capping moiety and the fluorophore on the DNA extension products, generated by the incorporation of the G-1 modified nucleotides, are cleaved simultaneously to reinitiate the polymerase reaction. The sequence of a DNA template immobilized on a surface

  8. Different activities of unscheduled DNA synthesis in human melanoma and bone marrow cells

    SciTech Connect

    Lewensohn, R.; Ringborg, U.; Hansson, J.

    1982-01-01

    Unscheduled DNA synthesis (UDS) indicated by melphalan was studied in freshly collected tumor cells from human melanoma metastases. Comparative studies were done on human bone marrow blast cells. Significant levels of UDS comparable with those in myeloblasts were found in only two of eight melanoma cell populations. This difference between melanoma and blast cells was not related to different cellular uptake of melphalan. When UDS was induced by ultraviolet irradiation, significant levels of UDS were found in all melanoma and blast cell populations studied. Also, in a human melanoma cell line, high levels of UDS were found after exposure to ultraviolet irradiation, while treatment with melphalan did not result in detectable levels of UDS. Possible explanations for the divergent results of UDS in melphalan-exposed melanoma cells are discussed.

  9. The trypanocidal activity of the alkaloid oliverine involves inhibition of DNA synthesis.

    PubMed

    Garro, H A; Juri Ayub, M; Nieto, M; Lucero Estrada, C; Pungitore, C R; Tonn, C E

    2010-01-01

    The Trypanosoma cruzi parasite is an etiologic agent of the American trypanosomiasis called Chagas disease. This pathology affects more than 24 million persons and represents one of the most important public health problems in Latin America. Taking into account this, it is necessary the search of new antitrypanosomal agents that show a major level of efficacy and minor indexes of toxicity in affected patients. Vast source of them are the natural products from plants with enormous structural diversity. A particular type of these compounds is represented by aporphinoid alkaloids. In our experiments, anonaine (2), oliverine (3) and guatterine (5) displayed antitrypanosomal activity. The compound 3 showed the most important activity with an IC50 = 12.00 ± 0.36 μM. Its mechanism of action may include inhibition of DNA synthesis. PMID:20937218

  10. Uncoupling of mitochondrial oxidative phosphorylation by DNA gyrase inhibitors

    SciTech Connect

    Gallagher, M.; Weinberg, R.; Simpson, M.V.

    1986-05-01

    Supercoiled mtDNA and the swivel requirement for its replication suggest the existence of a mtDNA gyrase. The authors published studies on isolated mitochondria showing that novobiocin, coumermycin, nalidixic acid, and oxolinic acid promote relaxed DNA formation at the expense of supercoiled DNA are in accord with this view. However, their inability to directly detect the enzyme led them to ask whether these drugs act elsewhere. Their results with isolated rat liver mitochondria show that novo, nal, but not oxo, stimulate O/sub 2/ uptake as much as does 2.4-dinitrophenol (DNP). This possible uncoupling effect was confirmed by a standard (/sup 32/P) assay showing the following inhibitions of ATP synthesis: 0.2 mM novo, 95% (0.4 mM, 100%) 0.4 mM nal, 37%; oxo to at least 1.9 mM, 0%; (0.5 mM 2,4-DNP, 100%). Thus, oxo remains a useful tool for intact mitochondrial studies. Because these three drugs, especially novo, are being used to study the role of DNA superhelicity on pro- and eucaryotic (and mitochondrial) gene expression, the authors studied their effect on oxidative phosphorylation in such cells. In these cases the drugs did not affect DNP-sensitive (/sup 14/C)glutamine transport into E. coli cells (an established measure of ATP level), nor, in an S. cerevisiae mutant permeable to novo, did novo affect the steady state ATP level. Studies on cultured mammalian cells are in progress.

  11. Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

    PubMed Central

    Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

    2014-01-01

    The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

  12. Synthesis and characterization of monomolecular DNA G-quadruplexes formed by tetra-end-linked oligonucleotides.

    PubMed

    Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Galeone, Aldo; Petraccone, Luigi; Varra, Michela; Piccialli, Gennaro; Mayol, Luciano

    2006-01-01

    Guanine-rich DNA sequences are widely dispersed in the eukaryotic genome and are abundant in regions with relevant biological significance. They can form quadruplex structures stabilized by guanine quartets. These structures differ for number and strand polarity, loop composition, and conformation. We report here the syntheses and the structural studies of a set of interconnected d(TG(4)T) fragments which are tethered, with different orientations, to a tetra-end-linker in an attempt to force the formation of specific four-stranded DNA quadruplex structures. Two synthetic strategies have been used to obtain oligodeoxyribonucleotide (ODN) strands linked with their 3'- or 5'-ends to each of the four arms of the linker. The first approach allowed the synthesis of tetra-end-linked ODN (TEL-ODN) containing the four ODN strands with a parallel orientation, while the latter synthetic pathway led to the synthesis of TEL-ODNs each containing antiparallel ODN pairs. The influence of the linker at 3'- or 5'-ODN, on the quadruplex typology and stability, in the presence of sodium or potassium ions, has been investigated by circular dichroism (CD), CD thermal denaturation, (1)H NMR experiments at variable temperature, and molecular modeling. All synthesized TEL-ODNs formed parallel G-quadruplex structures. Particularly, the TEL-ODN containing all parallel ODN tracts formed very stable parallel G-quadruplex complexes, whereas the TEL-ODNs containing antiparallel ODN pairs led to relatively less stable parallel G-quadruplexes. The molecular modeling data suggested that the above antiparallel TEL-ODNs can adopt parallel G-quadruplex structures thanks to a considerable folding of the tetra-end-linker around the whole quadruplex scaffold. PMID:16848394

  13. Long conducting polymer nanonecklaces with a `beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties

    NASA Astrophysics Data System (ADS)

    Chen, Guofang; Mao, Chengde

    2016-05-01

    Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k

  14. Induction of unscheduled DNA synthesis in HeLa cells by allylic compounds.

    PubMed

    Schiffmann, D; Eder, E; Neudecker, T; Henschler, D

    1983-10-01

    Thirteen allylic compounds, mostly with close structural relationship, were tested for their ability to induce unscheduled DNA synthesis (UDS) in HeLa cells and mutations in the Ames test; 11 induced UDS in dose dependence. Allyl isothiocyanate was negative in UDS (borderline in the Ames test) and acrolein (positive in the Ames test) proved toxic to HeLa cells, therefore UDS measurement was excluded. In general, positive qualitative and quantitative correlation between UDS, Ames test and alkylating properties (as measured in the 4-nitrobenzyl-pyridine test, NBP) were found. Among structural analogs and typical allylic compounds with various leaving groups, the amount of induced DNA repair at equimolar concentrations decreased in the same order as the mutagenic and alkylating activities in the other 2 test systems: 1,3-dichloropropene (cis) greater than 1,3-dichloropropene (trans) greater than 2,3-dichloro-1-propene; 1-chloro-2-butene greater than 3-chloro-1-butene greater than 3-chloro-2-methyl-1-propene greater than allyl chloride; allyl-methane-sulfonate greater than -iodide greater than -bromide greater than -chloride. PMID:6627227

  15. Genetic and metabolomic analysis of AdeD and AdeI mutants of de novo purine biosynthesis: cellular models of de novo purine biosynthesis deficiency disorders

    PubMed Central

    Wilkinson, Terry G.; Baresova, Veronika; Skopova, Vaclava; Kmoch, Stanislav; Vacano, Guido N.; Zikanova, Marie; Patterson, David

    2014-01-01

    Purines are molecules essential for many cell processes, including RNA and DNA synthesis, regulation of enzyme activity, protein synthesis and function, energy metabolism and transfer, essential coenzyme function, and cell signaling. Purines are produced via the de novo purine biosynthesis pathway. Mutations in purine biosynthetic genes, for example phosphoribosylaminoimidazole carboxylase/phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS, E.C. 6.3.2.6/E.C. 4.1.1.21), can lead to developmental anomalies in lower vertebrates. Alterations in PAICS expression in humans have been associated with various types of cancer. Mutations in adenylosuccinate lyase (ADSL, E.C. 4.3.2.2) or 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC, E.C. 2.1.2.3/E.C. 3.5.4.10) lead to inborn errors of metabolism with a range of clinical symptoms, including developmental delay, severe neurological symptoms, renal stones, combined immunodeficiency, and autistic features. The pathogenetic mechanism is unknown for any of these conditions, and no effective treatments exist. The study of cells carrying mutations in the various de novo purine biosynthesis pathway genes provides one approach to analysis of purine disorders. Here we report the characterization of AdeD Chinese hamster ovary (CHO) cells, which carry genetic mutations encoding p.E177K and p.W363* variants of PAICS. Both mutations impact PAICS structure and completely abolish its biosynthesis. Additionally, we describe a sensitive and rapid analytical method for detection of purine de novo biosynthesis intermediates based on high performance liquid chromatography with electrochemical detection. Using this technique we detected accumulation of AIR in AdeD cells. In AdeI cells, mutant for the ADSL gene, we detected accumulation of SAICAR and SAMP and, somewhat unexpectedly, accumulation of AIR. This method has great potential for metabolite profiling of de novo purine biosynthesis

  16. Synthesis, crystal structures, DNA binding and photoluminescence properties of [Cu(pzta)2Cl]Cl⋅H2O for DNA detection.

    PubMed

    Duan, Ran-ran; Wang, Lu; Huo, Wei-qiang; Chen, Shi; Zhou, Xiao-hua

    2014-07-15

    We report here the synthesis of a new copper(II) complex of 2,4-diamino-6-(2'-pyrazin)-1,3,5-triazine [Cu(pzta)2Cl]Cl·H2O and its characterization using UV and IR spectroscopy, elemental analysis, and X-ray diffraction. Fluorescence spectroscopy revealed that the complex was sensitive to oxygen and to the polarity of nonaqueous solvents. Binding of the complex to DNA was investigated using UV spectroscopy, ethidium bromide displacement from DNA, cyclic voltammetry, and viscometry. The results revealed the DNA binding mode was intercalation together with external static-electricity. However, the complex can be also used to DNA detection as DNA fluorescence probe with a LOD of 4.21 ng mL(-1) for the relative wide linear range between 0.2 and 17 μg mL(-1). In conclusion, that synthetic method of the complex was easy with low expense and was relatively rapid and sensitive compared to most toxic fluorescence dyes. This finding would indicate the complex may be a potential DNA-targeted probes and optical probes for oxygen-free environments in nonaqueous form. PMID:24691376

  17. Agrobacterium rhizogenes pRi8196 T-DNA: mapping and DNA sequence of functions involved in mannopine synthesis and hairy root differentiation.

    PubMed Central

    Hansen, G; Larribe, M; Vaubert, D; Tempé, J; Biermann, B J; Montoya, A L; Chilton, M D; Brevet, J

    1991-01-01

    This paper presents the map and DNA sequence analysis of pRi8196 transferred DNA (T-DNA) genes encoding root-inducing and mannopine synthesis functions. A canonical 24-base-pair border repeat as well as two "pseudoborders" are present at the functional right T-DNA border. To the left of this border are homologs of the mas1' and mas2' genes of TR pRiA4. Next to these are five open reading frames (ORFs) homologous to ORFs 10-14 of TL of pRiA4. ORFs 10-12 (rolA, rolB, and rolC) are less related to their pRiA4 homologs than are the other large ORFs analyzed here. In contrast to T-DNA genes of pRiA4, pRi8196 T-DNA ORFs 11 and 12 (rolB and rolC) are sufficient to induce hairy roots on carrot disks. Images PMID:1909028

  18. Effects of DNA synthesis inhibitors on post-traumatic glial cell proliferation

    SciTech Connect

    Billingsley, M.L.; Mandel, H.G.

    1982-09-01

    This study attempts to inhibit post-traumatic glial cell scarring in rats lesioned in the frontal cortex, by treatment with several antiproliferative drugs. (/sup 3/H)Thymidine ((/sup 3/H)TdR) incorporation into DNA served as the biochemical index of glial cell proliferation and histological observations confirmed the biochemical effects. Cytosine arabinoside (ara-C), given i.p. at a total daily dosage of 15 to 100 mg/kg, was found to inhibit the incorporation of (/sup 3/H)TdR into cortical DNA and also inhibited the proliferation of glial cells after cortical trauma. Treatment using ara-C induced marked histological changes in glial cells near the lesion, indicating that the inhibition by the drug of DNA synthesis correlated with cytotoxicity to proliferating glial cells. Experiments using (/sup 3/H)ara-C confirmed that this drug entered lesioned brain tissue, although at levels considerably lower than those found in the periphery. Cyclophosphamide also reduced (/sup 3/H)TdR incorporation into both lesioned and control cortices; however, this effect, unlike that of ara-C, was not proportionately greater in the lesioned cortex. Vincristine, but not vinblastine, also inhibited (/sup 3/H)TdR incorporation into the lesioned cortex, possibly reflecting differences in the neuronal uptake of the vinca alkaloids. We propose that ara-C can inhibit the proliferation of glial cells after neural trauma and that judicious use of this agent may lessen scarring in the injured central nervous system, possibly enhancing the regenerative capacity of the brain.

  19. Rabies RNA synthesis, detected with cDNA probes, as a marker for virus transport in the rat nervous system.

    PubMed

    Ermine, A; Ceccaldi, P E; Masson, G; Tsiang, H

    1993-02-01

    The kinetics of viral RNA synthesis in different parts of the rat brain, infected with fixed or street rabies virus strains, is correlated with their anatomical neuronal connections with the masseter muscles, using hybridization with rabies cDNA probes. Viral RNA synthesis is first detected in the brain-stem and in the pons where the direct anatomical projection of the masseter muscle nervous arborization into the sensory and motor nuclei is located, through the trigeminus nerve. Rabies RNA detection is delayed in the other regions of the rat brain depending on the time course of virus transport from the trigeminal nuclei through multiple nervous connections. PMID:7681151

  20. Synthesis, interaction with DNA, cytotoxicity, cell cycle arrest and apoptotic inducing properties of ruthenium(II) molecular "light switch" complexes.

    PubMed

    Shobha Devi, C; Anil Kumar, D; Singh, Surya S; Gabra, Nazar; Deepika, N; Kumar, Y Praveen; Satyanarayana, S

    2013-06-01

    In an endeavor toward the development of metal-based anticancer drugs, we present here the design, synthesis and characterization of three ruthenium(II) functionalized phenanthroline complexes with extended π-conjugation. These complexes have been shown to act as promising CT-DNA intercalators as evidenced by UV-visible, luminescence, emission quenching by [Fe(CN)6](4-), DNA competitive binding with ethidium bromide and salt dependent studies. All three complexes [Ru(Hdpa)2PPIP](2+) (1), [Ru(Hdpa)2PIP](2+) (2), [Ru(Hdpa)24HEPIP](2+) (3) clearly demonstrated that they can bind to DNA through the intercalation mode. Cell viability experiments indicated that all complexes showed significant dose dependent cytotoxicity in selected cell lines. The apoptosis and cell cycle arrest were also investigated. The complexes were docked into DNA-base-pairs using the 'GOLD' (Genetic Optimization for Ligand Docking), docking program. PMID:23665797

  1. Sensitivity to Flg22 Is Modulated by Ligand-Induced Degradation and de Novo Synthesis of the Endogenous Flagellin-Receptor FLAGELLIN-SENSING2[W][OPEN

    PubMed Central

    Smith, John M.; Salamango, Daniel J.; Leslie, Michelle E.; Collins, Carina A.; Heese, Antje

    2014-01-01

    FLAGELLIN-SENSING2 (FLS2) is the plant cell surface receptor that perceives bacterial flagellin or flg22 peptide, initiates flg22-signaling responses, and contributes to bacterial growth restriction. Flg22 elicitation also leads to ligand-induced endocytosis and degradation of FLS2 within 1 h. Why plant cells remove this receptor precisely at the time during which its function is required remains mainly unknown. Here, we assessed in planta flg22-signaling competency in the context of ligand-induced degradation of endogenous FLS2 and chemical interference known to impede flg22-dependent internalization of FLS2 into endocytic vesicles. Within 1 h after an initial flg22 treatment, Arabidopsis (Arabidopsis thaliana) leaf tissue was unable to reelicit flg22 signaling in a ligand-, time-, and dose-dependent manner. These results indicate that flg22-induced degradation of endogenous FLS2 may serve to desensitize cells to the same stimulus (homologous desensitization), likely to prevent continuous signal output upon repetitive flg22 stimulation. In addition to impeding ligand-induced FLS2 degradation, pretreatment with the vesicular trafficking inhibitors Wortmannin or Tyrphostin A23 impaired flg22-elicited reactive oxygen species production that was partially independent of BRASSINOSTEROID INSENSITIVE1-ASSOCIATED KINASE1. Interestingly, these inhibitors did not affect flg22-induced mitogen-activated protein kinase phosphorylation, indicating the ability to utilize vesicular trafficking inhibitors to target different flg22-signaling responses. For Tyrphostin A23, reduced flg22-induced reactive oxygen species could be separated from the defect in FLS2 degradation. At later times (>2 h) after the initial flg22 elicitation, recovery of FLS2 protein levels positively correlated with resensitization to flg22, indicating that flg22-induced new synthesis of FLS2 may prepare cells for a new round of monitoring the environment for flg22. PMID:24220680

  2. UV-assisted photocatalytic synthesis of highly dispersed Ag nanoparticles supported on DNA decorated graphene for quantitative iodide analysis.

    PubMed

    Kong, Fen-Ying; Li, Wei-Wei; Wang, Jing-Yi; Wang, Wei

    2015-07-15

    Herein, we report, for the first time, the synthesis of reduced graphene oxide-DNA-Ag (RGO-DNA-Ag) nanohybrids by ultraviolet (UV) irradiation of aqueous solutions of GO and Ag ions in the presence of DNA. The morphology and microstructure characterizations of the resultant nanohybrids reveal that the proposed method leads to the simultaneous reduction of GO and Ag ions together with efficient dispersion of Ag nanoparticles on the surface of RGO sheets. This simple and fast synthesis route is carried out at ambient conditions without using any additional chemical reducing agents, which has the potential to provide new avenues for the green fabrication of various RGO-based nanomaterials. Additionally, the RGO-DNA-Ag nanohybrids can be utilized as a novel sensing interfacial for direct determination of iodide by simple differential pulse voltammetry (DPV), without requiring any preceding preconcentration of the analyte. Based on the RGO-DNA-Ag nanohybrids modified electrode, a wide linear range of 1μM-1mM and a low detection limit of 0.2μM were obtained. This sensitive and direct method of analysis can be applied successfully to the determination of iodide in real samples. PMID:25747505

  3. DNA polymerase beta-catalyzed-PCNA independent long patch base excision repair synthesis: a mechanism for repair of oxidatively damaged DNA ends in post-mitotic brain.

    PubMed

    Wei, Wei; Englander, Ella W

    2008-11-01

    Oxidative DNA damage incidental to normal respiratory metabolism poses a particular threat to genomes of highly metabolic-long lived cells. We show that post-mitotic brain has capacity to repair oxidatively damaged DNA ends, which are targets of the long patch (LP) base excision repair (BER) subpathway. LP-BER relies, in part, on proteins associated with DNA replication, including proliferating cell nuclear antigen and is inherent to proliferating cells. Nonetheless, repair products are generated with brain extracts, albeit at slow rates, in the case of 5'-DNA ends modeled with tetrahydrofuran (THF). THF at this position is refractory to DNA polymerase beta 5'-deoxyribose 5-phosphate lyase activity and drives repair into the LP-BER subpathway. Comparison of repair of 5'-THF-blocked termini in the post-mitotic rat brain and proliferative intestinal mucosa, revealed that in mucosa, resolution of damaged 5'-termini is accompanied by formation of larger repair products. In contrast, adducts targeted by the single nucleotide BER are proficiently repaired with both extracts. Our findings reveal mechanistic differences in BER processes selective for the brain versus proliferative tissues. The differences highlight the physiological relevance of the recently proposed 'Hit and Run' mechanism of alternating cleavage/synthesis steps, in the proliferating cell nuclear antigen-independent LP-BER process. PMID:18752643

  4. DNA-Metalization: Synthesis and Properties of Novel Silver-Containing DNA Molecules (Adv. Mater. 24/2016).

    PubMed

    Eidelshtein, Gennady; Fardian-Melamed, Natalie; Gutkin, Vitaly; Basmanov, Dmitry; Klinov, Dmitry; Rotem, Dvir; Levi-Kalisman, Yael; Porath, Danny; Kotlyar, Alexander

    2016-06-01

    D. Porath, A. Kotlyar, and co-workers transform DNA to a conducting material by metalization through coating or chemical modifications, as described on page 4839. Specific and reversible metalization of poly(dG)-poly(dC) DNA by migration of atoms from silver nanoparticles to the DNA is demonstrated. As the transformation occurs gradually, novel, truly hybrid molecular structures are obtained, paving the way to their usage as nanowires in programmable molecular electronic devices and circuits. PMID:27311096

  5. Pyridine and p-Nitrophenyl Oxime Esters with Possible Photochemotherapeutic Activity: Synthesis, DNA Photocleavage and DNA Binding Studies.

    PubMed

    Pasolli, Milena; Dafnopoulos, Konstantinos; Andreou, Nicolaos-Panagiotis; Gritzapis, Panagiotis S; Koffa, Maria; Koumbis, Alexandros E; Psomas, George; Fylaktakidou, Konstantina C

    2016-01-01

    Compared to standard treatments for various diseases, photochemotherapy and photo-dynamic therapy are less invasive approaches, in which DNA photocleavers represent promising tools for novel "on demand" chemotherapeutics. A series of p-nitrobenzoyl and p-pyridoyl ester conjugated aldoximes, amidoximes and ethanone oximes were subjected to UV irradiation at 312 nm with supercoiled circular plasmid DNA. The compounds which possessed appropriate properties were additionally subjected to UVA irradiation at 365 nm. The ability of most of the compounds to photocleave DNA was high at 312 nm, whereas higher concentrations were required at 365 nm as a result of their lower UV absorption. The affinity of selected compounds to calf-thymus (CT) DNA was studied by UV spectroscopy, viscosity experiments and competitive studies with ethidium bromide (EB) revealing that all compounds interacted with CT DNA. The fluorescence emission spectra of the pre-treated EB-DNA exhibited a moderate to significant quenching in the presence of the compounds indicating the binding of the compounds to CT DNA via intercalation as concluded also by DNA-viscosity experiments. For the oxime esters the DNA photocleavage and affinity studies aimed to clarify the role of the oxime nature (aldoxime, ketoxime, amidoxime) and the role of the pyridine and p-nitrophenyl moieties both as oxime substituents and ester conjugates. PMID:27376258

  6. Direct Visualization of De novo Lipogenesis in Single Living Cells

    NASA Astrophysics Data System (ADS)

    Li, Junjie; Cheng, Ji-Xin

    2014-10-01

    Increased de novo lipogenesis is being increasingly recognized as a hallmark of cancer. Despite recent advances in fluorescence microscopy, autoradiography and mass spectrometry, direct observation of de novo lipogenesis in living systems remains to be challenging. Here, by coupling stimulated Raman scattering (SRS) microscopy with isotope labeled glucose, we were able to trace the dynamic metabolism of glucose in single living cells with high spatial-temporal resolution. As the first direct visualization, we observed that glucose was largely utilized for lipid synthesis in pancreatic cancer cells, which occurs at a much lower rate in immortalized normal pancreatic epithelial cells. By inhibition of glycolysis and fatty acid synthase (FAS), the key enzyme for fatty acid synthesis, we confirmed the deuterium labeled lipids in cancer cells were from de novo lipid synthesis. Interestingly, we also found that prostate cancer cells exhibit relatively lower level of de novo lipogenesis, but higher fatty acid uptake compared to pancreatic cancer cells. Together, our results demonstrate a valuable tool to study dynamic lipid metabolism in cancer and other disorders.

  7. DNA polymerase kappa microsatellite synthesis: two distinct mechanisms of slippage-mediated errors.

    PubMed

    Baptiste, Beverly A; Eckert, Kristin A

    2012-12-01

    Microsatellite tandem repeats are frequent sites of strand slippage mutagenesis in the human genome. Microsatellite mutations often occur as insertion/deletion of a repeat motif (unit-based indels), and increase in frequency with increasing repeat length after a threshold is reached. We recently demonstrated that DNA polymerase κ (Pol κ) produces fewer unit-based indel errors within dinucleotide microsatellites than does polymerase δ. Here, we examined human Pol κ's error profile within microsatellite alleles of varying sequence composition and length, using an in vitro HSV-tk gap-filling assay. We observed that Pol κ displays relatively accurate synthesis for unit-based indels, using di- and tetranucleotide repeat templates longer than the threshold length. We observed an abrupt increase in the unit-based indel frequency when the total microsatellite length exceeds 28 nucleotides, suggesting that extended Pol κ protein-DNA interactions enhance fidelity of the enzyme when synthesizing these microsatellite alleles. In contrast, Pol κ is error-prone within the HSV-tk coding sequence, producing frequent single-base errors in a manner that is highly biased with regard to sequence context. Single-nucleotide errors are also created by Pol κ within di- and tetranucleotide repeats, independently of the microsatellite allele length and at a frequency per nucleotide similar to the frequency of single base errors within the coding sequence. These single-base errors represent the mutational signature of Pol κ, and we propose them a mechanism independent of homology-stabilized slippage. Pol κ's dual fidelity nature provides a unique research tool to explore the distinct mechanisms of slippage-mediated mutagenesis. PMID:22965905

  8. Scorpion (Odontobuthus doriae) venom induces apoptosis and inhibits DNA synthesis in human neuroblastoma cells.

    PubMed

    Zargan, Jamil; Sajad, Mir; Umar, Sadiq; Naime, M; Ali, Shakir; Khan, Haider A

    2011-02-01

    Scorpion and its organs have been used to cure epilepsy, rheumatism, and male impotency since medieval times. Scorpion venom which contains different compounds like enzyme and non-enzyme proteins, ions, free amino acids, and other organic inorganic substances have been reported to posses antiproliferative, cytotoxic, apoptogenic, and immunosuppressive properties. We for the first time report the apoptotic and antiproliferative effects of scorpion venom (Odontobuthus doriae) in human neuroblastoma cells. After exposure of cells to medium containing varying concentrations of venom (10, 25, 50, 100, and 200 μg/ml), cell viability decreased to 90.75, 75.53, 55.52, 37.85, and 14.30%, respectively, after 24 h. Cells expressed morphological changes like swelling, inhibition of neurite outgrowth, irregular shape, aggregation, rupture of membrane, and release of cytosolic contents after treatment with venom. Lactate dehydrogenase (LDH) level increased in 50 and 100 μg/ml as compared to control, but there was no significant increase in LDH level at a dose of 10 and 20 μg/ml. Two concentrations viz. 50 and 100 μ/ml were selected because of the profound effect of these concentrations on the cellular health and population. Treatment with these two concentrations induced reactive nitrogen intermediates and depolarization in mitochondria. While caspase-3 activity increased in a concentration-dependent manner, only 50 μg/ml was able to fragment DNA. It was interesting to note that at higher dose, i.e., 100 μg/ml, the cells were killed, supposedly by acute necrosis. DNA synthesis evidenced by bromodeoxyuridine (BrdU) incorporation was inhibited in a concentration-dependent manner. The cells without treatment incorporated BrdU with high affinity confirming their cancerous nature whereas very less incorporation was noticed in treated cells. Our results show apoptotic and antiproliferative potential of scorpion venom (O. doriae) in human neuroblastoma cells. These properties

  9. Psoralen covalently linked to oligodeoxyribonucleotides: synthesis, sequence specific recognition of DNA and photo-cross-linking to pyrimidine residues of DNA.

    PubMed Central

    Pieles, U; Englisch, U

    1989-01-01

    The psoralen derivative 4,5',8-trimethylpsoralen was covalently linked to the 5'-terminus of an 18mer oligodeoxyribonucleotide in the course of solid phase synthesis using phosphoroamidite chemistry. The derivative was introduced as a phosphitylation compound in the last cycle of the oligomer synthesis. The reagent was prepared by 4'-chloromethylation of 4,5',8-trimethylpsoralen, introduction of a linker by ethanediol and phosphitylation with chloro-[(beta-cyanoethoxy)-N,N-diisopropylamino]-phosphine. After oxydation and deprotection the 5'-psoralen modified oligodeoxyribonucleotide was characterised by HPLC. Hybridisation of the psoralen-modified oligomer to a complementary single stranded 21mer followed by irradiation at 350 nm revealed a photo-cross-linked double-stranded DNA fragment analysed on denaturing polyacrylamide gels. The cross-link could be reversed upon irradiation at 254nm. Images PMID:2911468

  10. Psoralen covalently linked to oligodeoxyribonucleotides: synthesis, sequence specific recognition of DNA and photo-cross-linking to pyrimidine residues of DNA.

    PubMed

    Pieles, U; Englisch, U

    1989-01-11

    The psoralen derivative 4,5',8-trimethylpsoralen was covalently linked to the 5'-terminus of an 18mer oligodeoxyribonucleotide in the course of solid phase synthesis using phosphoroamidite chemistry. The derivative was introduced as a phosphitylation compound in the last cycle of the oligomer synthesis. The reagent was prepared by 4'-chloromethylation of 4,5',8-trimethylpsoralen, introduction of a linker by ethanediol and phosphitylation with chloro-[(beta-cyanoethoxy)-N,N-diisopropylamino]-phosphine. After oxydation and deprotection the 5'-psoralen modified oligodeoxyribonucleotide was characterised by HPLC. Hybridisation of the psoralen-modified oligomer to a complementary single stranded 21mer followed by irradiation at 350 nm revealed a photo-cross-linked double-stranded DNA fragment analysed on denaturing polyacrylamide gels. The cross-link could be reversed upon irradiation at 254nm. PMID:2911468

  11. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  12. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

    PubMed

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

    2015-01-01

    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  13. Interacting RNA polymerase motors on a DNA track: effects of traffic congestion and intrinsic noise on RNA synthesis.

    PubMed

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions. PMID:18351890

  14. Chemical synthesis of human papillomavirus type 16 E7 oncoprotein: autonomous protein domains for induction of cellular DNA synthesis and for trans activation.

    PubMed

    Rawls, J A; Pusztai, R; Green, M

    1990-12-01

    The human papillomavirus type 16 E7 protein belongs to a family of nuclear oncoproteins that share amino acid sequences and functional homology. To localize biochemical activities associated with E7, we chemically synthesized the full-length 98-amino-acid polypeptide and several deletion mutant peptides. We show that the E7 polypeptide is biologically active and possesses at least two functional domains; the first induces cellular DNA synthesis in quiescent rodent cells, and the second trans activates the adenovirus E1A-inducible early E2 promoter and binds zinc. Further, each domain is autonomous and can function on separate peptides. DNA synthesis induction activity maps within the N-terminal portion of the molecule, which contains sequences related to adenovirus E1A conserved domains 1 and 2 required for cell transformation and binding of the retinoblastoma gene product. trans-Activation and Zn-binding activities map within the C-terminal portion of the molecule, a region which contains Cys-X-X-Cys motifs. trans Activation does not require protein synthesis, implying a mechanism that involves interaction with a preexisting cellular factor(s). E7 trans activates the adenovirus E2 promoter but not other E1A-inducible viral promoters, suggesting the possibility that E7 trans activation involves interaction, directly or indirectly, with cellular transcription factor E2F. PMID:2173783

  15. Stimulators and inhibitors of lymphocyte DNA synthesis in supernatants from human lymphoid cell lines.

    PubMed

    Vesole, D H; Goust, J M; Fett, J W; Fudenberg, H H

    1979-09-01

    Some T and B lymphoid cell lines (LCL) were found to secrete into their supernatants a substance able to stimulate lymphocyte proliferation. This substance produced an increase in [3H]thymidine uptake by mononuclear cells when added to unstimulated cultures (mitogenic effect) or when added to cultures stimulated with phytohemagglutinin (PHA) or pokeweed mitogen (PWM) (potentiating effect). When complete supernatants were used, the potentiating effect was sometimes masked by an inhibitor of DNA synthesis. Fractionation on Sephadex G-100 separated these two activities. The stimulatory substance eluted at a m.w. range of 15,000 to 30,000, and the inhibitor eluted with the albumin peak. B cells with or without monocytes were the most sensitive to the mitogenic effect, whereas T cells were unaffected. Responses to PHA and PWM were potentiated when T cells were present, but the maximum effect was observed when the proportion of T cells was less than 50%. The stimulatory material may be similar to lymphocyte mitogenic factor and may function as a T cell-replacing factor in B cell stimulation. PMID:313950

  16. The mechanism of inhibition of endothelin-1-induced stimulation of DNA synthesis in rat articular chondrocytes.

    PubMed

    Khatib, A M; Ribault, D; Quintero, M; Barbara, A; Fiet, J; Mitrovic, D R

    1997-09-19

    Endothelin-1 (ET-1) is a potent mitogen for rat articular chondrocytes (AC) in short term culture (24 h). Prolonged incubation (72 h) of AC with ET-1 resulted in inhibition of [3H]thymidine incorporation. This inhibition seemed to be mediated by prostaglandins (PGs) released in response to ET-1, since indomethacin (INDO) enhanced ET-1-induced [3H]thymidine incorporation. In agreement with this hypothesis, exogenous prostaglandins (PGE2, PGF2alpha and TxB2) blocked all basal, ET-1-induced and ET-1 induced-INDO-enhanced [3H]thymidine incorporation and ET-1 stimulated PGE2 release in a time and concentration-dependent manner. INDO also blocked cGMP production and 6-anilino-5,8-quinolinedione, a relatively specific inhibitor of cGMP formation, enhanced the stimulation and suppressed the inhibition of ET-1-induced DNA synthesis. In addition, 8-bromo-cGMP, an analogue of cGMP, blocked at all time periods studied, both basal and ET-1-induced incorporations of [3H]thymidine. Thus, PGs produced in response to ET-1 counteract the ET-1-induced stimulation of [3H]thymidine incorporation into rat AC by increasing cGMP production. PMID:9324043

  17. The DNA methylation inhibitor 5-azacytidine decreases melanin synthesis by inhibiting CREB phosphorylation.

    PubMed

    Shin, Jun Seob; Jeong, Hyo-Soon; Kim, Myo-Kyoung; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Kim, Dong-Seok

    2015-10-01

    Here we examined the effects of a DNA methylation inhibitor, 5-azacytidine, on melanogenesis in Mel-Ab cells. We found that 5-azacytidine decreased the melanin content and tyrosinase activity in these cells in a dose-dependent manner; importantly, 5-azacytidine was not cytotoxic at the concentrations used in these experiments. On the other hand, 5-azacytidine did not affect tyrosinase activity in a cell-free system, indicating that 5-azacytidine is not a direct tyrosinase inhibitor. Instead, 5-azacytidine decreased the protein levels of microphthalmia-associated transcription factor (MITF) and tyrosinase. Thus, we investigated the effects of 5-azacytidine on signal transduction pathways related to melanogenesis. However, 5-azacytidine did not have any effect on either Akt or glycogen synthase kinase 3β (GSK3β) phosphorylation. The phosphorylation of cAMP response element-binding protein (CREB) is well known to regulate MITF expression, thereby also regulating tyrosinase expression. We found that 5-azacytidine decreased the phosphorylation of CREB. Therefore, we propose that 5-azacytidine may decrease melanin synthesis by downregulating MITF and tyrosinase via CREB inactivation. PMID:26601420

  18. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  19. Regulation of translesion DNA synthesis: posttranslational modification of lysine residues in key proteins

    PubMed Central

    McIntyre, Justyna; Woodgate, Roger

    2015-01-01

    Posttranslational modification of proteins often controls various aspects of their cellular function. Indeed, over the past decade or so, it has been discovered that posttranslational modification of lysine residues plays a major role in regulating translesion DNA synthesis (TLS) and perhaps the most appreciated lysine modification is that of ubiquitination. Much of the recent interest in ubiquitination stems from the fact that proliferating cell nuclear antigen (PCNA) was previously shown to be specifically ubiquitinated at K164 and that such ubiquitination plays a key role in regulating TLS. In addition, TLS polymerases themselves are now known to be ubiquitinated. In the case of human polymerase η, ubiquitination at four lysine residues in its C-terminus appears to regulate its ability to interact with PCNA and modulate TLS. Within the past few years, advances in global proteomic research has revealed that many proteins involved in TLS are, in fact, subject to a previously underappreciated number of lysine modifications. In this review, we will summarize the known lysine modifications of several key proteins involved in TLS; PCNA and Y-family polymerases η, ι, κ and Rev1 and we will discuss the potential regulatory effects of such modification in controlling TLS in vivo. PMID:25743599

  20. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates

    NASA Astrophysics Data System (ADS)

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  1. Dihydrochelerythrine and its derivatives: Synthesis and their application as potential G-quadruplex DNA stabilizing agents.

    PubMed

    Malhotra, Rajesh; Rarhi, Chhanda; Diveshkumar, K V; Barik, Rajib; D'cunha, Ruhee; Dhar, Pranab; Kundu, Mrinalkanti; Chattopadhyay, Subrata; Roy, Subho; Basu, Sourav; Pradeepkumar, P I; Hajra, Saumen

    2016-07-01

    A convenient route was envisaged toward the synthesis of dihydrochelerythrine (DHCHL), 4 by intramolecular Suzuki coupling of 2-bromo-N-(2-bromobenzyl)-naphthalen-1-amine derivative 5 via in situ generated arylborane. This compound was converted to (±)-6-acetonyldihydrochelerythrine (ADC), 3 which was then resolved by chiral prep-HPLC. Efficiency of DHCHL for the stabilization of promoter quadruplex DNA structures and a comparison study with the parent natural alkaloid chelerythrine (CHL), 1 was performed. A thorough investigation was carried out to assess the quadruplex binding affinity by using various biophysical and biochemical studies and the binding mode was explained by using molecular modeling and dynamics studies. Results clearly indicate that DHCHL is a strong G-quadruplex stabilizer with affinity similar to that of the parent alkaloid CHL. Compounds ADC and DHCHL were also screened against different human cancer cell lines. Among the cancer cells, (±)-ADC and its enantiomers showed varied (15-48%) inhibition against human colorectal cell line HCT116 and breast cancer cell line MDA-MB-231 albeit low enantio-specificity in the inhibitory effect; whereas DHCHL showed 30% inhibition against A431 cell line only, suggesting the compounds are indeed cancer tissue specific. PMID:27234888

  2. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates.

    PubMed

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out. PMID:25646895

  3. DNA interstrand crosslinking agents: synthesis, DNA interactions, and cytotoxicity of dimeric achiral seco-amino-CBI and conjugates of achiral seco-amino-CBI with pyrrolobenzodiazepine (PBD).

    PubMed

    Purnell, Bethany; Sato, Atsushi; O'kelley, Amanda; Price, Carly; Summerville, Kaitlin; Hudson, Stephen; O'hare, Caroline; Kiakos, Konstantinos; Asao, Tetsuji; Lee, Moses; Hartley, John A

    2006-11-01

    The design and synthesis of three novel bisalkylating agents derived from the achiral seco-duocarmycin or CC-1065 analogs and pyrrolobenzodiazepines (PBDs) are described: achiral seco-CBI (cyclopropanebenz[e]indoline)-PBD 11, achiral seco-CI-PBD 12, and achiral seco-CBI dimer 13. Compounds 11 and 12 demonstrated enhanced cytotoxicity over the monomer counterparts against the growth of P815 murine mastocytoma cells in culture. Conjugate 11 was found to covalently react with adenine-N3 positions within the minor groove at AT-rich sequences and to produce DNA interstrand crosslinks. Both compounds were found to induce apoptosis in P815 cells. Due to its poor water solubility, dimer 13 did not give any appreciable DNA binding or cytotoxicity. PMID:16919946

  4. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia; Altmannova, Veronika; Sebesta, Marek; Pacesa, Martin; Fugger, Kasper; Sorensen, Claus Storgaard; Lee, Marietta Y W T; Haracska, Lajos; Krejci, Lumir

    2016-04-20

    Successful and accurate completion of the replication of damage-containing DNA requires mainly recombination and RAD18-dependent DNA damage tolerance pathways. RAD18 governs at least two distinct mechanisms: translesion synthesis (TLS) and template switching (TS)-dependent pathways. Whereas TS is mainly error-free, TLS can work in an error-prone manner and, as such, the regulation of these pathways requires tight control to prevent DNA errors and potentially oncogenic transformation and tumorigenesis. In humans, the PCNA-associated recombination inhibitor (PARI) protein has recently been shown to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HRin vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits the extent of HR and represents a new potential target for anticancer therapy. PMID:26792895

  5. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis

    PubMed Central

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia; Altmannova, Veronika; Sebesta, Marek; Pacesa, Martin; Fugger, Kasper; Sorensen, Claus Storgaard; Lee, Marietta Y.W.T.; Haracska, Lajos; Krejci, Lumir

    2016-01-01

    Successful and accurate completion of the replication of damage-containing DNA requires mainly recombination and RAD18-dependent DNA damage tolerance pathways. RAD18 governs at least two distinct mechanisms: translesion synthesis (TLS) and template switching (TS)-dependent pathways. Whereas TS is mainly error-free, TLS can work in an error-prone manner and, as such, the regulation of these pathways requires tight control to prevent DNA errors and potentially oncogenic transformation and tumorigenesis. In humans, the PCNA-associated recombination inhibitor (PARI) protein has recently been shown to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HR in vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits the extent of HR and represents a new potential target for anticancer therapy. PMID:26792895

  6. Installing hydrolytic activity into a completely de novo protein framework.

    PubMed

    Burton, Antony J; Thomson, Andrew R; Dawson, William M; Brady, R Leo; Woolfson, Derek N

    2016-09-01

    The design of enzyme-like catalysts tests our understanding of sequence-to-structure/function relationships in proteins. Here we install hydrolytic activity predictably into a completely de novo and thermostable α-helical barrel, which comprises seven helices arranged around an accessible channel. We show that the lumen of the barrel accepts 21 mutations to functional polar residues. The resulting variant, which has cysteine-histidine-glutamic acid triads on each helix, hydrolyses p-nitrophenyl acetate with catalytic efficiencies that match the most-efficient redesigned hydrolases based on natural protein scaffolds. This is the first report of a functional catalytic triad engineered into a de novo protein framework. The flexibility of our system also allows the facile incorporation of unnatural side chains to improve activity and probe the catalytic mechanism. Such a predictable and robust construction of truly de novo biocatalysts holds promise for applications in chemical and biochemical synthesis. PMID:27554410

  7. Exploration of cellular DNA lesion, DNA-binding and biocidal ordeal of novel curcumin based Knoevenagel Schiff base complexes incorporating tryptophan: Synthesis and structural validation

    NASA Astrophysics Data System (ADS)

    Chandrasekar, Thiravidamani; Raman, Natarajan

    2016-07-01

    A few novel Schiff base transition metal complexes of general formula [MLCl] (where, L = Schiff base, obtained by the condensation reaction of Knoevenagel condensate of curcumin, L-tryptophan and M = Cu(II), Ni(II), Co(II), and Zn(II)), were prepared by stencil synthesis. They were typified using UV-vis, IR, EPR spectral techniques, micro analytical techniques, magnetic susceptibility and molar conductivity. Geometry of the metal complexes was examined and recognized as square planar. DNA binding and viscosity studies revealed that the metal(II) complexes powerfully bound via an intercalation mechanism with the calf thymus DNA. Gel-electrophoresis technique was used to investigate the DNA cleavage competence of the complexes and they establish to approve the cleavage of pBR322 DNA in presence of oxidant H2O2. This outcome inferred that the synthesized complexes showed better nuclease activity. Moreover, the complexes were monitored for antimicrobial activities. The results exposed that the synthesized compounds were forceful against all the microbes under exploration.

  8. Exploration of cellular DNA lesion, DNA-binding and biocidal ordeal of novel curcumin based Knoevenagel Schiff base complexes incorporating tryptophan: Synthesis and structural validation

    NASA Astrophysics Data System (ADS)

    Chandrasekar, Thiravidamani; Raman, Natarajan

    2016-07-01

    A few novel Schiff base transition metal complexes of general formula [MLCl] (where, L = Schiff base, obtained by the condensation reaction of Knoevenagel condensate of curcumin, L-tryptophan and M = Cu(II), Ni(II), Co(II), and Zn(II)), were prepared by stencil synthesis. They were typified using UV-vis, IR, EPR spectral techniques, micro analytical techniques, magnetic susceptibility and molar conductivity. Geometry of the metal complexes was examined and recognized as square planar. DNA binding and viscosity studies revealed that the metal(II) complexes powerfully bound via an intercalation mechanism with the calf thymus DNA. Gel-electrophoresis technique was used to investigate the DNA cleavage competence of the complexes and they establish to approve the cleavage of pBR322 DNA in presence of oxidant H2O2. This outcome inferred that the synthesized complexes showed better nuclease activity. Moreover, the complexes were monitored for antimicrobial activities. The results exposed that the synthesized compounds were forceful against all the microbes under exploration.

  9. Mutations for Worse or Better: Low-Fidelity DNA Synthesis by SOS DNA Polymerase V Is a Tightly Regulated Double-Edged Sword.

    PubMed

    Jaszczur, Malgorzata; Bertram, Jeffrey G; Robinson, Andrew; van Oijen, Antoine M; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

    2016-04-26

    1953, the year of Watson and Crick, bore witness to a less acclaimed yet highly influential discovery. Jean Weigle demonstrated that upon infection of Escherichia coli, λ phage deactivated by UV radiation, and thus unable to form progeny, could be reactivated by irradiation of the bacterial host. Evelyn Witkin and Miroslav Radman later revealed the presence of the SOS regulon. The more than 40 regulon genes are repressed by LexA protein and induced by the coproteolytic cleavage of LexA, catalyzed by RecA protein bound to single-stranded DNA, the RecA* nucleoprotein filament. Several SOS-induced proteins are engaged in repairing both cellular and extracellular damaged DNA. There's no "free lunch", however, because error-free repair is accompanied by error-prone translesion DNA synthesis (TLS), involving E. coli DNA polymerase V (UmuD'2C) and RecA*. This review describes the biochemical mechanisms of pol V-mediated TLS. pol V is active only as a mutasomal complex, pol V Mut = UmuD'2C-RecA-ATP. RecA* donates a single RecA subunit to pol V. We highlight three recent insights. (1) pol V Mut has an intrinsic DNA-dependent ATPase activity that governs polymerase binding and dissociation from DNA. (2) Active and inactive states of pol V Mut are determined at least in part by the distinct interactions between RecA and UmuC. (3) pol V is activated by RecA*, not at a blocked replisome, but at the inner cell membrane. PMID:27043933

  10. Synthesis of eight-arm, branched oligonucleotide hybrids and studies on the limits of DNA-driven assembly.

    PubMed

    Schwenger, Alexander; Gerlach, Claudia; Griesser, Helmut; Richert, Clemens

    2014-12-01

    Oligonucleotide hybrids with organic cores as rigid branching elements and four or six CG dimer strands have been shown to form porous materials from dilute aqueous solution. In order to explore the limits of this form of DNA-driven assembly, we prepared hybrids with three or eight DNA arms via solution-phase syntheses, using H-phosphonates of protected dinucleoside phosphates. This included the synthesis of (CG)8TREA, where TREA stands for the tetrakis[4-(resorcin-5-ylethynyl)phenyl]adamantane core. The ability of the new compounds to assemble in a DNA-driven fashion was studied by UV-melting analysis and NMR, using hybrids with self-complementary CG zipper arms or non-self-complementary TC dimer arms. The three-arm hybrid failed to form a material under conditions where four-arm hybrids did so. Further, the assembly of TREA hybrids appears to be dominated by hydrophobic interactions, not base pairing of the DNA arms. These results help in the design of materials forming by multivalent DNA-DNA interactions. PMID:25407332

  11. Baculovirus DNA Replication-Specific Expression Factors Trigger Apoptosis and Shutoff of Host Protein Synthesis during Infection▿

    PubMed Central

    Schultz, Kimberly L. W.; Friesen, Paul D.

    2009-01-01

    Apoptosis is an important antivirus defense. To define the poorly understood pathways by which invertebrates respond to viruses by inducing apoptosis, we have identified replication events that trigger apoptosis in baculovirus-infected cells. We used RNA silencing to ablate factors required for multiplication of Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV). Transfection with double-stranded RNA (dsRNA) complementary to the AcMNPV late expression factors (lefs) that are designated as replicative lefs (lef-1, lef-2, lef-3, lef-11, p143, dnapol, and ie-1/ie-0) blocked virus DNA synthesis and late gene expression in permissive Spodoptera frugiperda cells. dsRNAs specific to designated nonreplicative lefs (lef-8, lef-9, p47, and pp31) blocked late gene expression without affecting virus DNA replication. Thus, both classes of lefs functioned during infection as defined. Silencing the replicative lefs prevented AcMNPV-induced apoptosis of Spodoptera cells, whereas silencing the nonreplicative lefs did not. Thus, the activity of replicative lefs or virus DNA replication is sufficient to trigger apoptosis. Confirming this conclusion, AcMNPV-induced apoptosis was suppressed by silencing the replicative lefs in cells from a divergent species, Drosophila melanogaster. Silencing replicative but not nonreplicative lefs also abrogated AcMNPV-induced shutdown of host protein synthesis, suggesting that virus DNA replication triggers inhibition of host biosynthetic processes and that apoptosis and translational arrest are linked. Our findings suggest that baculovirus DNA replication triggers a host cell response similar to the DNA damage response in vertebrates, which causes translational arrest and apoptosis. Pathways for detecting virus invasion and triggering apoptosis may therefore be conserved between insects and mammals. PMID:19706708

  12. Effects of 8-halo-7-deaza-2'-deoxyguanosine triphosphate on DNA synthesis by DNA polymerases and cell proliferation.

    PubMed

    Yin, Yizhen; Sasaki, Shigeki; Taniguchi, Yosuke

    2016-08-15

    8-OxodG (8-oxo-2'-deoxyguanosine) is representative of nucleoside damage and shows a genotoxicity. To significantly reveal the contributions of 7-NH and C8-oxygen to the mutagenic effect of 8-oxodG by DNA polymerases, we evaluated the effects of the 8-halo-7-deaza-dG (8-halogenated 7-deaza-2'-deoxyguanosine) derivatives by DNA polymerases. 8-Halo-7-deaza-dGTPs were poorly incorporated by both KF(exo(-)) and human DNA polymerase β opposite dC or dA into the template DNA. Furthermore, it was found that KF(exo(-)) was very sensitive to the introduction of the C8-halogen, while polymerase β can accommodate the C8-halogen resulting in an efficient dCTP insertion opposite the 8-halo-7-deaza-dG in the template DNA. These results indicate that strong hydrogen bonding between 7-NH in the 8-oxo-G nucleobase and 1-N in the adenine at the active site of the DNA polymerase is required for the mutagenic effects. Whereas, I-deaza-dGTP shows an antiproliferative effect for the HeLa cells, suggesting that it could become a candidate as a new antitumor agent. PMID:27372838

  13. The Affinity of EBNA1 for Its Origin of DNA Synthesis Is a Determinant of the Origin's Replicative Efficiency▿ †

    PubMed Central

    Lindner, Scott E.; Zeller, Krisztina; Schepers, Aloys; Sugden, Bill

    2008-01-01

    Epstein-Barr virus (EBV) replicates its genome as a licensed plasmid in latently infected cells. Although replication of this plasmid is essential for EBV latent infection, its synthesis still fails for 16% of the templates in S phase. In order to understand these failures, we sought to determine whether the affinity of the initiator protein (EBNA1) for its binding sites in the origin affects the efficiency of plasmid replication. We have answered this question by using several engineered origins modeled upon the arrangement of EBNA1-binding sites found in DS, the major plasmid origin of EBV. The human TRF2 protein also binds to half-sites in DS and increases EBNA1's affinity for its own sites; we therefore also tested origin efficiency in the presence or absence of these sites. We have found that if TRF2-half-binding sites are present, the efficiency of supporting the initiation of DNA synthesis and of establishing a plasmid bearing that origin directly correlates with the affinity of EBNA1 for that origin. Moreover, the presence of TRF2-half-binding sites also increases the average level of EBNA1 and ORC2 bound to those origins in vivo, as measured by chromatin immunoprecipitation. Lastly, we have created an origin of DNA synthesis from high-affinity EBNA1-binding sites and TRF2-half-binding sites that functions severalfold more efficiently than does DS. This finding indicates that EBV has selected a submaximally efficient origin of DNA synthesis for the latent phase of its life cycle. This enhanced origin could be used practically in human gene vectors to improve their efficiency in therapy and basic research. PMID:18385243

  14. Effects of cryopreservation on sperm viability, synthesis of reactive oxygen species, and DNA damage of bovine sperm.

    PubMed

    Gürler, H; Malama, E; Heppelmann, M; Calisici, O; Leiding, C; Kastelic, J P; Bollwein, H

    2016-07-15

    The objective was to examine if there are relationships between alterations in sperm viability, reactive oxygen species (ROS) synthesis, and DNA integrity induced by cryopreservation of bovine sperm. Four ejaculates were collected from each of six bulls. Each ejaculate was diluted and divided into two aliquots; one was incubated for 24 hours at 37 °C, and the other frozen, thawed, and incubated for 24 hours at 37 °C. Analyses of quality of sperm were performed after 0, 3, 6, 12, and 24 hours of incubation. Progressive motile sperm was determined with computer assisted sperm analysis. Percentages of plasma membrane- and acrosome-intact sperm, sperm with a high mitochondrial membrane potential, sperm showing a high degree of DNA fragmentation (%DFI), and their reactive oxygen species content were assessed with dichlorofluorescein-diacetate, dihydrorhodamine, diaminofluorescein diacetate, and mitochondrial superoxide indicator using flow cytometry. Although all other sperm parameters showed alterations (P < 0.05) during the 24-hour incubation time, %DFI stayed constant (P > 0.05, 0.91 ± 0.23) in nonfrozen sperm. Cryopreservation induced changes of all sperm parameters (P < 0.05). In contrast to all other sperm parameters, dichlorofluorescein-diacetate-fluoroescence indicating the synthesis of H2O2 showed a similar exponential rise (P < 0.05) like the %DFI values in frozen sperm. In conclusion, changes of DNA integrity in frozen sperm seem to be related to synthesis of H2O2 but not to sperm viability and synthesis of other reactive oxygen species. PMID:27039074

  15. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  16. Nerve growth factor inhibits the synthesis of a single-stranded DNA binding protein in pheochromocytoma cells (clone PC12).

    PubMed Central

    Biocca, S; Cattaneo, A; Calissano, P

    1984-01-01

    Arrest of mitosis and neurite outgrowth induced by nerve growth factor (NGF) in rat pheochromocytoma cells (clone PC12) is accompanied by a progressive inhibition of the synthesis of a protein that binds to single-stranded but not to double-stranded DNA. Time course experiments show that this inhibition is already apparent after a 2-day incubation with NGF and is maximum (85-95%) upon achievement of complete PC12 cell differentiation. Inhibition of the synthesis of this single-stranded DNA binding protein after 48 hr of incubation with NGF is potentiated by concomitant treatment of PC12 cells with antimitotic drugs acting at different levels of DNA replication. Purification on a preparative scale of this protein and analysis of its major physicochemical properties show that: (i) it constitutes 0.5% of total soluble proteins of naive PC12 cells; (ii) its molecular weight measured by NaDodSO4/PAGE is Mr 34,000 (sucrose gradient centrifugation under nondenaturing conditions yields a sedimentation coefficient s20,w of 8.1 S, indicating that the native protein is an oligomer); (iii) amino acid analysis demonstrates a preponderance of acidic over basic residues, while electrofocusing experiments show that it has an isoelectric point around 8.0; (iv) approximately 15% of the protein is phosphorylated in vivo. It is postulated that control of the synthesis of this protein is connected with activation of a differentiative program triggered by NGF in the PC12 neoplastic cell line at some step(s) of DNA activity. Images PMID:6585787

  17. Synthesis of bisphosphonate derivatives of ATP by T4 DNA ligase, ubiquitin activating enzyme (E1) and other ligases.

    PubMed

    Günther Sillero, María A; de Diego, Anabel; Pérez-Zúñiga, Francisco J; Sillero, Antonio

    2008-05-15

    T4 DNA ligase and the ubiquitin activating enzyme (E1), catalyze the synthesis of ATP beta,gamma-bisphosphonate derivatives. Concerning T4 DNA ligase: (i) etidronate (pC(OH)(CH(3))p) displaced the AMP moiety of the complex E-AMP in a concentration dependent manner; (ii) the K(m) values and the rate of synthesis k(cat) (s(-1)), determined for the following compounds were, respectively: etidronate, 0.73+/-0.09 mM and (70+/-10)x10(-3) s(-1); clodronate (pCCl(2)p), 0.08+/-0.01 mM and (4.1+/-0.3)x10(-3) s(-1); methylenebisphosphonate (pCH(2)p), 0.024+/-0.001 mM and (0.6+/-0.1)x10(-3) s(-1); tripolyphosphate (P(3)) (in the synthesis of adenosine 5'-tetraphosphate, p(4)A), 1.30+/-0.30 mM and (6.2+/-1.1)x10(-3) s(-1); (iii) in the presence of GTP and ATP, inhibition of the synthesis of Ap(4)G was observed with clodronate but not with pamidronate (pC(OH)(CH(2)-CH(2)-NH(3))p). Concerning the ubiquitin activating enzyme (E1): methylenebisphosphonate was the only bisphosphonate, out of the ones tested, that served as substrate for the synthesis of an ATP derivative (K(m)=0.36+/-0.09 mM and k(cat)=0.15+/-0.02 s(-1)). None of the above bisphosphonates were substrates of the reaction catalyzed by luciferase or by acyl-CoA synthetase. The ability of acetyl-CoA synthetase to use methylenebisphosphonate as substrate depended on the commercial source of the enzyme. In our view this report widens our knowledge of the enzymes able to metabolize bisphosphonates, a therapeutic tool widely used in the treatment of osteoporosis. PMID:18378215

  18. Ultrastructural Studies of H-1 Parvovirus Replication VI. Simultaneous Autoradiographic and Immunochemical Intranuclear Localization of Viral DNA Synthesis and Protein Accumulation

    PubMed Central

    Singer, Irwin I.; Rhode, Solon L.

    1978-01-01

    The localization of H-1 viral replicative-form double-stranded DNA and progeny single-stranded DNA replication in parasynchronously infected, simian virus 40-transformed newborn human kidney cells was studied with high-resolution electron microscope autoradiography (80-nm silver grains). We analyzed wild-type H-1 and ts1 H-1 (a conditional mutant defective in progeny single-stranded DNA synthesis). The proportion of the total DNA synthesis that was viral was estimated to be >90% by comparing the amount of [3H]thymidine uptake in cultures infected with wild-type H-1 versus ts14 (an H-1 mutant defective in DNA replication). Simultaneous staining with cytochrome c-conjugated anti-H-1 immunoglobulin G was performed to ensure that cells incorporating [3H]thymidine (2- to 60-min pulses) were H-1 infected. The sites of H-1 replicative-form (in ts1-infected cells) and progeny (in wild-type-infected cells) DNA synthesis were identical. Immunospecifically labeled nuclei at the earliest stages of infection exhibited dense clusters of silver grains over material extruded from nucleolar fibrillar centers. These foci became larger with increasing cellular damage, forming a limited number of H-1 DNA synthetic centers in the euchromatin. Each island-like focus was surrounded by tufts of heterochromatin containing high concentrations of unassembled H-1 capsid proteins. In late phases of infection, the heterochromatin became completely marginated, and the nucleoplasm contained only euchromatin that exhibited randomly distributed sites of H-1 DNA replication. This indicates that H-1 DNA synthesis begins at localized euchromatic or nucleolar sites and then spreads outward. Immunostained heterochromatin and nucleolar chromatin never incorporated [3H]thymidine. Our results suggest that H-1 proteins and cellular cofactors associated with the fibrillar component of the nucleolus and the euchromatin may play a role in the regulation of H-1 DNA synthesis. Images PMID:340710

  19. RNA-template dependent de novo telomere addition.

    PubMed

    Fuhrmann, Gloria; Jönsson, Franziska; Weil, Patrick Philipp; Postberg, Jan; Lipps, Hans J

    2016-08-01

    De novo addition of telomeric sequences can occur at broken chromosomes and must be well controlled, which is essential during programmed DNA reorganization processes. In ciliated protozoa an extreme form of DNA-reorganization is observed during macronuclear differentiation after sexual reproduction leading to the elimination of specific parts of the germline genome. Regulating these processes involves small noncoding RNAs, but in addition DNA-reordering, excision and amplification require RNA templates deriving from the parental macronucleus. We show that these putative RNA templates can carry telomeric repeats. Microinjection of RNA templates carrying modified telomeres into the developing macronucleus leads to modified telomeres in vegetative cells, providing strong evidence, that de novo addition of telomeres depends on a telomere-containing transcript from the parental macronucleus. PMID:26786510

  20. Optimizing stem-loop qPCR assays through multiplexed cDNA synthesis of U6 and miRNAs

    PubMed Central

    Turner, Marie; Adhikari, Sajag; Subramanian, Senthil

    2013-01-01

    We recently reported that hairpin (or stem-loop) priming is better-suited than polyA tailing to generate cDNA for plant microRNA qPCR. One major limitation of this method is the need to perform individual cDNA synthesis reactions for the reference gene and test miRNAs. Here, we report a novel fusion primer that allows multiplexed hairpin cDNA synthesis of the most-commonly used reference gene, nucleolar small RNA U6, together with test miRNAs. We also propose the use of miR1515 as a house keeping control for tropical legumes. We show that multiplexed cDNA synthesis does not result in loss of sensitivity and reduces the amount of RNA required for miRNA gene expression assays. PMID:23673353

  1. Dithiocarbamate/piperazine bridged pyrrolobenzodiazepines as DNA-minor groove binders: synthesis, DNA-binding affinity and cytotoxic activity.

    PubMed

    Kamal, Ahmed; Sreekanth, Kokkonda; Shankaraiah, Nagula; Sathish, Manda; Nekkanti, Shalini; Srinivasulu, Vunnam

    2015-04-01

    A new series of C8-linked dithiocarbamate/piperazine bridged pyrrolo[2,1-c][1,4]benzodiazepine conjugates (5a-c, 6a,b) have been synthesized and evaluated for their cytotoxic potential and DNA-binding ability. The representative conjugates 5a and 5b have been screened for their cytotoxicity against a panel of 60 human cancer cell lines. Compound 5a has shown promising cytotoxic activity on selected cancer cell lines that display melanoma, leukemia, CNS, ovarian, breast and renal cancer phenotypes. The consequence of further replacement of the 3-cyano-3,3-diphenylpropyl 1-piperazinecarbodithioate in 5b and 5c with 4-methylpiperazine-1-carbodithioate yielded new conjugates 6a and 6b respectively. In addition, the compounds 5c and 6a,b have been evaluated for their in vitro cytotoxicity on some of the selected human cancer cell lines and these conjugates have exhibited significant cytotoxic activity. Further, the DNA-binding ability of these new conjugates has been evaluated by using thermal denaturation (ΔTm) studies. The correlation between structure and DNA-binding ability has been investigated by molecular modeling studies which predicted that 6b exhibits superior DNA-binding ability and these are in agreement with the experimental DNA-binding studies. PMID:25665519

  2. Genetic variation and the de novo assembly of human genomes

    PubMed Central

    Chaisson, Mark J. P.; Wilson, Richard K.; Eichler, Evan E.

    2016-01-01

    The discovery of genetic variation and the assembly of genome sequences are both inextricably linked to advances in DNA-sequencing technology. Short-read massively parallel sequencing has revolutionized our ability to discover genetic variation but is insufficient to generate high-quality genome assemblies or resolve most structural variation. Full resolution of variation is only guaranteed by complete de novo assembly of a genome. Here, we review approaches to genome assembly, the nature of gaps or missing sequences, and biases in the assembly process. We describe the challenges of generating a complete de novo genome assembly using current technologies and the impact that being able to perfectly sequence the genome would have on understanding human disease and evolution. Finally, we summarize recent technological advances that improve both contiguity and accuracy and emphasize the importance of complete de novo assembly as opposed to read mapping as the primary means to understanding the full range of human genetic variation. PMID:26442640

  3. Hydrogenase synthesis in Bradyrhizobium japonicum Hupc mutants is altered in sensitivity to DNA gyrase inhibitors.

    PubMed Central

    Novak, P D; Maier, R J

    1989-01-01

    In the Hupc mutants of Bradyrhizobium japonicum SR, regulation of expression of hydrogenase is altered; the mutants synthesize hydrogenase constitutively in the presence of atmospheric levels of oxygen. The DNA gyrase inhibitors nalidixic acid, novobiocin, and coumermycin were used to inhibit growth of wild-type and mutant cells. For each inhibitor tested, growth of mutant and wild-type strains was equally sensitive. However, in contrast to the wild type, the Hupc mutants synthesized hydrogenase in the presence of high levels of any inhibitor. Cells were incubated with the drugs and simultaneously labeled with 14C-labeled amino acids, and hydrogenase was immunoprecipitated with antibody to the large subunit of the enzyme. Fluorograms of antibody blots then were scanned to determine the relative amount of hydrogenase (large subunit) synthesized in the presence or absence of the gyrase inhibitors. The amount of hydrogenase synthesized by the Hupc mutants in the presence of 300 micrograms of nalidixic acid per ml was near the level of enzyme synthesized in the absence of the inhibitor. No hydrogenase was detected in antibody blots of wild-type cultures which were derepressed for hydrogenase in the presence of 100 micrograms of coumermycin or novobiocin per ml. In contrast, hydrogenase was synthesized by the Hupc mutants in the presence of 100 micrograms of either drug per ml. The amount synthesized ranged from 5 to 32% and 20 to 49%, respectively, of that in the absence of those inhibitors, but nevertheless, hydrogenase synthesis was detected in all of the mutants examined.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2547335

  4. In vivo effects of endotoxin on DNA synthesis in rat nasal epithelium

    SciTech Connect

    Harkema, J.R.; Hotchkiss, J.A. )

    1993-12-01

    Airway inflammation in bacterial infections is characterized by the presence of neutrophils and often epithelial injury and repair. Release of endotoxin from bacteria may contribute to these processes. The purpose of this study was to determine the in vivo effects of repeated endotoxin exposure on DNA synthesis in rat nasal epithelium in the presence and absence of neutrophilic influx. Rats were intranasally instilled, once a day for 3 days, with endotoxin or saline (controls). Before the first and third instillations, half of the saline and endotoxin-instilled animals were depleted of circulating blood neutrophils by administering a rabbit anti-rat neutrophil antiserum. Rats were sacrificed 6 or 24 h after the last instillation. Two hours prior to sacrifice, rats were intraperitoneally injected with bromodeoxyuridine (BrdU), an analog of thymidine that is incorporated in the nucleus of cells in the S-phase of the cell cycle. Nasal tissues were processed for light microscopy and immunohistochemical detection of BrdU in nasal epithelial cells. The numbers of nasal epithelial cells, BrdU-labeled epithelial nuclei, and neutrophils per millimeter of basal lamina in the epithelium lining the nasal turbinates in the proximal nasal passages were determined by morphometric analysis. The authors did not observe a neutrophilic influx in the nasal tissues of neutrophil-depleted rats at 6 or 24 h after the last endotoxin instillation; however, the numbers of nasal epithelial cells and the BrdU-labeling index were significantly increased compared to saline-instilled controls. In contrast, non-neutrophil-depleted rats instilled with endotoxin had a marked neutrophilic influx, but no significant differences in the number of nasal epithelial cells at 6 or 24 h, compared to controls. In addition, the BrdU-labeling index in neutrophil-sufficient rats was increased only 6 h after the last instillation, compared to controls.

  5. De novo sequencing of unique sequence tags for discovery of post-translational modifications of proteins

    SciTech Connect

    Shen, Yufeng; Tolic, Nikola; Hixson, Kim K.; Purvine, Samuel O.; Anderson, Gordon A.; Smith, Richard D.

    2008-10-15

    De novo sequencing has a promise to discover the protein post-translation modifications; however, such approach is still in their infancy and not widely applied for proteomics practices due to its limited reliability. In this work, we describe a de novo sequencing approach for discovery of protein modifications through identification of the UStags (Anal. Chem. 2008, 80, 1871-1882). The de novo information was obtained from Fourier-transform tandem mass spectrometry for peptides and polypeptides in a yeast lysate, and the de novo sequences obtained were filtered to define a more limited set of UStags. The DNA-predicted database protein sequences were then compared to the UStags, and the differences observed across or in the UStags (i.e., the UStags’ prefix and suffix sequences and the UStags themselves) were used to infer the possible sequence modifications. With this de novo-UStag approach, we uncovered some unexpected variances of yeast protein sequences due to amino acid mutations and/or multiple modifications to the predicted protein sequences. Random matching of the de novo sequences to the predicted sequences were examined with use of two random (false) databases, and ~3% false discovery rates were estimated for the de novo-UStag approach. The factors affecting the reliability (e.g., existence of de novo sequencing noise residues and redundant sequences) and the sensitivity are described. The de novo-UStag complements the UStag method previously reported by enabling discovery of new protein modifications.

  6. DNA sequencing by synthesis using 3′-O-azidomethyl nucleotide reversible terminators and surface-enhanced Raman spectroscopic detection

    PubMed Central

    Palla, Mirkó; Guo, Wenjing; Shi, Shundi; Li, Zengmin; Wu, Jian; Jockusch, Steffen; Guo, Cheng; Russo, James J.; Turro, Nicholas J.; Ju, Jingyue

    2014-01-01

    As an alternative to fluorescence-based DNA sequencing by synthesis (SBS), we report here an approach using an azido moiety (N3) that has an intense, narrow and unique Raman shift at 2125 cm−1, where virtually all biological molecules are transparent, as a label for SBS. We first demonstrated that the four 3′-O-azidomethyl nucleotide reversible terminators (3′-O-azidomethyl-dNTPs) displayed surface enhanced Raman scattering (SERS) at 2125 cm−1. Using these 4 nucleotide analogues as substrates, we then performed a complete 4-step SBS reaction. We used SERS to monitor the appearance of the azide-specific Raman peak at 2125 cm−1 as a result of polymerase extension by a single 3′-O-azidomethyl-dNTP into the growing DNA strand and disappearance of this Raman peak with cleavage of the azido label to permit the next nucleotide incorporation, thereby continuously determining the DNA sequence. Due to the small size of the azido label, the 3′-O-azidomethyl-dNTPs are efficient substrates for the DNA polymerase. In the SBS cycles, the natural nucleotides are restored after each incorporation and cleavage, producing a growing DNA strand that bears no modifications and will not impede further polymerase reactions. Thus, with further improvements in SERS for the azido moiety, this approach has the potential to provide an attractive alternative to fluorescence-based SBS. PMID:25396047

  7. Excision of ultraviolet damage and the effect of irradiation on DNA synthesis in a strain of Bloom's syndrome fibroblasts

    SciTech Connect

    Henson, P.; Selsky, C.A.; Little, J.B.

    1981-03-01

    Researchers have studied repair of ultraviolet light-induced damage in a strain of Bloom's syndrome cells which we have shown to be defective in host cell reactivation of uv-irradiated herpes simplex virus. Excision repair was monitored by following loss of sensitivity of DNA in permeabilized cells to digestion by the Micrococcus luteus uv endonuclease preparation. The Bloom's syndrome fibroblasts apparently removed endonuclease-sensitive sites from the DNA slightly less efficiently than did normal strains. After 24 h, 38% of the sites remained in the Bloom's syndrome cells in comparison with 16% in normal fibroblasts. DNA newly synthesized in uv-irradiated Bloom's syndrome cells sedimented less far into alkaline sucrose gradients than did DNA from similarly treated normal cells. In other respects, including the effect of caffeine exposure, DNA synthesis in Bloom's syndrome cells was indistinguishable from that in normal cells. We were therefore able to detect only minor defects in the repair of uv-induced damage in Bloom's syndrome fibroblasts. This is consistent with the normal survival exhibited by these cells. The defect in excision repair may, however, be sufficient to allow the cellular repair capacity to become saturated at high infecting multiplicities of uv-irradiated herpes simplex virus.

  8. Macrophages do not inhibit the participation of the nuclei of nonmalignant proliferating cells in DNA synthesis in heterokaryons

    SciTech Connect

    Egorov, E.E.; Prudovskii, I.A.; Zelenin, A.V.

    1985-07-01

    The authors continue their investigations into types of heterokaryons in an effort to detect an inhibition of nondividing macrophages (differentiated cells) on the entry of the nuclei of proliferating cells into replication. For the experiments described in this paper, the authors used asynchronous cultures of mouse diploid fibroblasts (MDF), 3T3 mouse cells from continuous culture, and malignant SV3T3 cells (3T3 cells transformed by SV40). Fusion of the cells of the cultures with macrophages was performed using PEG at various periods after deposition (2, 8, 12, and 20 h). The authors used double isotope marking to identify DNA synthesis in the heterokaryons. For this purpose, the nuclei of the culture cells were labeled with (/sup 3/H)thymidine before fusion with macrophages. All the nuclei of the culture cells intensively incorporated the label. After fusion, (/sup 14/C)thymidine was introduced into the incubation medium. If the cell nucleus began to synthesize DNA, it incorporated (/sup 14/C)thymidine, and a supplementary relatively weak label appeared on the auto-radiographic preparations, both above the nuclei themselves and next to them. The nuclei of macrophages in which DNA synthesis was reactivated contained only the (/sup 14/C)label. Fixation was performed 26 h after stimulation (in the case of 3T3) or 35 h after stimulation (for MDF). The percentages of nuclei of culture cells labeled with (/sup 14/C)thymidine were determined in the heterokaryons and free-lying cells.

  9. On the Origin of De Novo Genes in Arabidopsis thaliana Populations.

    PubMed

    Li, Zi-Wen; Chen, Xi; Wu, Qiong; Hagmann, Jörg; Han, Ting-Shen; Zou, Yu-Pan; Ge, Song; Guo, Ya-Long

    2016-01-01

    De novo genes, which originate from ancestral nongenic sequences, are one of the most important sources of protein-coding genes. This origination process is crucial for the adaptation of organisms. However, how de novo genes arise and become fixed in a population or species remains largely unknown. Here, we identified 782 de novo genes from the model plant Arabidopsis thaliana and divided them into three types based on the availability of translational evidence, transcriptional evidence, and neither transcriptional nor translational evidence for their origin. Importantly, by integrating multiple types of omics data, including data from genomes, epigenomes, transcriptomes, and translatomes, we found that epigenetic modifications (DNA methylation and histone modification) play an important role in the origination process of de novo genes. Intriguingly, using the transcriptomes and methylomes from the same population of 84 accessions, we found that de novo genes that are transcribed in approximately half of the total accessions within the population are highly methylated, with lower levels of transcription than those transcribed at other frequencies within the population. We hypothesized that, during the origin of de novo gene alleles, those neutralized to low expression states via DNA methylation have relatively high probabilities of spreading and becoming fixed in a population. Our results highlight the process underlying the origin of de novo genes at the population level, as well as the importance of DNA methylation in this process. PMID:27401176

  10. On the Origin of De Novo Genes in Arabidopsis thaliana Populations

    PubMed Central

    Li, Zi-Wen; Chen, Xi; Wu, Qiong; Hagmann, Jörg; Han, Ting-Shen; Zou, Yu-Pan; Ge, Song; Guo, Ya-Long

    2016-01-01

    De novo genes, which originate from ancestral nongenic sequences, are one of the most important sources of protein-coding genes. This origination process is crucial for the adaptation of organisms. However, how de novo genes arise and become fixed in a population or species remains largely unknown. Here, we identified 782 de novo genes from the model plant Arabidopsis thaliana and divided them into three types based on the availability of translational evidence, transcriptional evidence, and neither transcriptional nor translational evidence for their origin. Importantly, by integrating multiple types of omics data, including data from genomes, epigenomes, transcriptomes, and translatomes, we found that epigenetic modifications (DNA methylation and histone modification) play an important role in the origination process of de novo genes. Intriguingly, using the transcriptomes and methylomes from the same population of 84 accessions, we found that de novo genes that are transcribed in approximately half of the total accessions within the population are highly methylated, with lower levels of transcription than those transcribed at other frequencies within the population. We hypothesized that, during the origin of de novo gene alleles, those neutralized to low expression states via DNA methylation have relatively high probabilities of spreading and becoming fixed in a population. Our results highlight the process underlying the origin of de novo genes at the population level, as well as the importance of DNA methylation in this process. PMID:27401176

  11. A model of binding on DNA microarrays: understanding the combined effect of probe synthesis failure, cross-hybridization, DNA fragmentation and other experimental details of affymetrix arrays

    PubMed Central

    2012-01-01

    Background DNA microarrays are used both for research and for diagnostics. In research, Affymetrix arrays are commonly used for genome wide association studies, resequencing, and for gene expression analysis. These arrays provide large amounts of data. This data is analyzed using statistical methods that quite often discard a large portion of the information. Most of the information that is lost comes from probes that systematically fail across chips and from batch effects. The aim of this study was to develop a comprehensive model for hybridization that predicts probe intensities for Affymetrix arrays and that could provide a basis for improved microarray analysis and probe development. The first part of the model calculates probe binding affinities to all the possible targets in the hybridization solution using the Langmuir isotherm. In the second part of the model we integrate details that are specific to each experiment and contribute to the differences between hybridization in solution and on the microarray. These details include fragmentation, wash stringency, temperature, salt concentration, and scanner settings. Furthermore, the model fits probe synthesis efficiency and target concentration parameters directly to the data. All the parameters used in the model have a well-established physical origin. Results For the 302 chips that were analyzed the mean correlation between expected and observed probe intensities was 0.701 with a range of 0.88 to 0.55. All available chips were included in the analysis regardless of the data quality. Our results show that batch effects arise from differences in probe synthesis, scanner settings, wash strength, and target fragmentation. We also show that probe synthesis efficiencies for different nucleotides are not uniform. Conclusions To date this is the most complete model for binding on microarrays. This is the first model that includes both probe synthesis efficiency and hybridization kinetics/cross-hybridization. These

  12. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  13. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  14. TWINKLE is an essential mitochondrial helicase required for synthesis of nascent D-loop strands and complete mtDNA replication

    PubMed Central

    Milenkovic, Dusanka; Matic, Stanka; Kühl, Inge; Ruzzenente, Benedetta; Freyer, Christoph; Jemt, Elisabeth; Park, Chan Bae; Falkenberg, Maria; Larsson, Nils-Göran

    2013-01-01

    Replication of the mammalian mitochondrial DNA (mtDNA) is dependent on the minimal replisome, consisting of the heterotrimeric mtDNA polymerase (POLG), the hexameric DNA helicase TWINKLE and the tetrameric single-stranded DNA-binding protein (mtSSB). TWINKLE has been shown to unwind DNA during the replication process and many disease-causing mutations have been mapped to its gene. Patients carrying Twinkle mutations develop multiple deletions of mtDNA, deficient respiratory chain function and neuromuscular symptoms. Despite its importance in human disease, it has been unclear whether TWINKLE is the only replicative DNA helicase in mammalian mitochondria. Furthermore, a substantial portion of mtDNA replication events is prematurely terminated at the end of mitochondrial control region (D-loop) and it is unknown whether TWINKLE also has a role in this abortive replication. Here, we present a conditional mouse knockout for Twinkle and demonstrate that TWINKLE is essential for mouse embryonic development and thus is the only replicative DNA helicase in mammalian mitochondria. Conditional knockout of Twinkle results in severe and rapid mtDNA depletion in heart and skeletal muscle. No replication intermediates or deleted mtDNA molecules are observed after Twinkle knockout, suggesting that TWINKLE once loaded is very processive. We also demonstrate that TWINKLE is essential for nascent H-strand synthesis in the D-loop, thus showing that there is no separate DNA helicase responsible for replication of this region. Our data thus suggest that the relative levels of abortive D-loop synthesis versus complete mtDNA replication are regulated and may provide a mechanism to control progression to complete mtDNA replication. PMID:23393161

  15. Complementation of defective translesion synthesis and UV light sensitivity in xeroderma pigmentosum variant cells by human and mouse DNA polymerase eta.

    PubMed

    Yamada, A; Masutani, C; Iwai, S; Hanaoka, F

    2000-07-01

    Defects in the human gene XPV result in the variant form of the genetic disease xeroderma pigmentosum (XP-V). XPV encodes DNA polymerase eta, a novel DNA polymerase that belongs to the UmuC/DinB/Rad30 superfamily. This polymerase catalyzes the efficient and accurate translesion synthesis of DNA past cis-syn cyclobutane di-thymine lesions. In this report we present the cDNA sequence and expression profiles of the mouse XPV gene and demonstrate its ability to complement defective DNA synthesis in XP-V cells. The mouse XPV protein shares 80.3% amino acid identity and 86.9% similarity with the human XPV protein. The recombinant mouse XPV protein corrected the inability of XP-V cell extracts to carry out DNA replication, by bypassing thymine dimers on template DNA. Transfection of the mouse or human XPV cDNA into human XP-V cells corrected UV sensitivity. Northern blot analysis revealed that the mouse XPV gene is expressed ubiquitously, but at a higher level in testis, liver, skin and thymus compared to other tissues. Although the mouse XPV gene was not induced by UV irradiation, its expression was elevated approximately 4-fold during cell proliferation. These results suggest that DNA polymerase eta plays a role in DNA replication, though the enzyme is not essential for viability. PMID:10871396

  16. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  17. Cucurbitacin I blocks cerebrospinal fluid and platelet derived growth factor-BB stimulation of leptomeningeal and meningioma DNA synthesis

    PubMed Central

    2013-01-01

    Background Currently, there are no consistently effective chemotherapies for recurrent and inoperable meningiomas. Recently, cucurbitacin I (JSI-124), a naturally occurring tetracyclic triterpenoid compound used as folk medicines has been found to have cytoxic and anti-proliferative properties in several malignancies thru inhibition of activator of transcription (STAT3) activation. Previously, we have found STAT3 to be activated in meningiomas, particularly higher grade tumors. Methods Primary leptomeningeal cultures were established from 17, 20 and 22 week human fetuses and meningioma cell cultures were established from 6 World Health Organization (WHO) grade I or II meningiomas. Cells were treated with cerebrospinal fluid from patients without neurologic disease. The effects of cucurbitacin I on cerebrospinal fluid stimulation of meningioma cell DNA synthesis phosphorylation/activation of JAK1, STAT3, pMEK1/2, p44/42MAPK, Akt, mTOR, Rb and caspase 3 activation were analyzed in human leptomeningeal and meningioma cells. Results Cerebrospinal fluid significantly stimulated DNA synthesis in leptomeningeal cells. Co-administration of cucurbitacin I (250 nM) produces a significant blockade of this effect. Cucurbitacin I alone also produced a significant reduction in basal DNA synthesis. In grade I and II meningiomas, cerebrospinal fluid also significantly stimulated DNA synthesis. Co-administration of cucurbitacin I (250 nM) blocked this effect. In the leptomeningeal cultures, cerebrospinal fluid stimulated STAT3 phosphorylation but not p44/42MAPK, Akt or mTOR. Cucurbitacin I had no effect on basal STAT3 phosphorylation but co-administration with cerebrospinal fluid blocked cerebrospinal fluid stimulation of STAT3 phosphorylation in each. In the grade I meningiomas, cerebrospinal fluid stimulated phosphorylation of STAT3 and decreased MEK1/2 and cucurbitacin I had no effect on basal STAT3, p44/42MAPK, Akt, JAK1, mTOR, or Rb phosphorylation. In the grade II

  18. Induction of maturation of human B-cell lymphomas in vitro. Morphologic changes in relation to immunoglobulin and DNA synthesis.

    PubMed Central

    Beiske, K.; Ruud, E.; Drack, A.; Marton, P. F.; Godal, T.

    1984-01-01

    In vitro stimulation of cells from 8 non-Hodgkin's lymphomas comprising several histologic types with a tumor promotor (TPA) and with or without anti-immunoglobulins directed against the surface immunoglobulin of the tumor cells is reported. Morphologic transformation to immunoblastic and plasmablastic cells, but not to plasma cells, and induction of Ig and DNA synthesis were observed. A comparative analysis, including flow cytofluorometry, light microscopy combined with immunocytochemistry, and electron microscopy, suggests that the three events may not always be associated phenomena at the single-cell level even in monoclonal cell populations. Images Figure 1 Figure 3 Figure 4 Figure 5 Figure 6 PMID:6375389

  19. Sequence identity of the terminal redundancies on the minus-strand DNA template is necessary but not sufficient for the template switch during hepadnavirus plus-strand DNA synthesis.

    PubMed Central

    Loeb, D D; Gulya, K J; Tian, R

    1997-01-01

    The template for hepadnavirus plus-strand DNA synthesis is a terminally redundant minus-strand DNA. An intramolecular template switch during plus-strand DNA synthesis, which permits plus-strand DNA elongation, has been proposed to be facilitated by this terminal redundancy, which is 7 to 9 nucleotides long. The aim of this study was to determine whether the presence of identical copies of the redundancy on the minus-strand DNA template was necessary and/or sufficient for the template switch and at what position(s) within the redundancy the switch occurs for duck hepatitis B virus. When dinucleotide insertions were placed within the copy of the redundancy at the 3' end of the minus-strand DNA template, novel sequences were copied into plus-strand DNA. The generation of these novel sequences could be explained by complete copying of the redundancy at the 5' end of the minus-strand DNA template followed by a template switch and then extension from a mismatched 3' terminus. In a second set of experiments, it was found that when one copy of the redundancy had either three or five nucleotides replaced the template switch was inhibited. When the identical, albeit mutant, sequences were restored in both copies of the redundancy, template switching was not necessarily restored. Our results indicate that the terminal redundancy on the minus-strand DNA template is necessary but not sufficient for template switching. PMID:8985334

  20. Photoinduced interactions of supramolecular ruthenium(II) complexes with plasmid DNA: synthesis and spectroscopic, electrochemical, and DNA photocleavage studies.

    PubMed

    Swavey, Shawn; DeBeer, Madeleine; Li, Kaiyu

    2015-04-01

    Two new bridging ligands have been synthesized by combining substituted benzaldehydes with phenanthrolinopyrrole (php), resulting in new polyazine bridging ligands. The ligands have been characterized by (1)H NMR, mass spectroscopy, and elemental analysis. These new ligands display π-π* transitions above 500 nm with modest molar absorptivities. Upon excitation at the ligand-centered charge-transfer transition, weak emission with a maximum wavelength of 612 nm is observed. When coordinated to two ruthenium(II) bis(bipyridyl) groups, the new bimetallic complexes generated give an overall 4+ charge. The electronic transitions of the bimetallic ruthenium(II) complexes display traditional π-π* transitions at 287 nm and metal-to-ligand charge-transfer transitions at 452 nm with molar absorptivities greater than 30000 M(-1) cm(-1). Oxidation of the ruthenium(II) metal centers to ruthenium(III) occurs at potentials above 1.4 V versus the Ag/AgCl reference electrode. Spectroscopic and electrochemical measurements indicate that the ruthenium(II) moieties behave independently. Both complexes are water-soluble and show the ability to photonick plasmid DNA when irradiated with low-energy light above 550 nm. In addition, one of the complexes, [Ru(bpy)2php]2Van(4+), shows the ability to linearize plasmid DNA and gives evidence, by gel electrophoresis, of photoinduced binding to plasmid DNA. PMID:25798576

  1. A new synthesis in epigenetics: towards a unified function of DNA methylation from invertebrates to vertebrates.

    PubMed

    Mandrioli, M

    2007-10-01

    DNA methylation is generally limited to CpG doublets located at the gene promoter with an involvement in gene silencing. Surprisingly, two recent papers showed an extensive methylation affecting coding portions of transcriptionally active genes in human and plants prompting a rethink of DNA methylation in eukaryotes. Actually, gene body methylation is not surprising since it has been repeatedly reported in invertebrates, where it interferes with transcriptional elongation preventing aberrant transcription initiations. As a whole, the published data suggest that the most ancestral function of DNA methylation is the control of genes that are susceptible to transcriptional interference and not to gene silencing. The recruitment of DNA methylation for silencing represents a successive tinkered use. In view of this additional function, the invertebrate-vertebrate transition has been accompanied by new constraints on DNA methylation that resulted in the strong conservation of the DNA methylation machinery in vertebrates and in the non-viability of mutants lacking DNA methylation. PMID:17712527

  2. Synthesis of linear and cyclic peptide-PEG-lipids for stabilization and targeting of cationic liposome-DNA complexes.

    PubMed

    Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R

    2016-03-15

    Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles. PMID:26874401

  3. DNA-templated microwave-hydrothermal synthesis of nanostructured hydroxyapatite for storing and sustained release of an antibacterial protein.

    PubMed

    Chen, Xi; Yang, Bin; Qi, Chao; Sun, Tuan-Wei; Chen, Feng; Wu, Jin; Feng, Xi-Ping; Zhu, Ying-Jie

    2016-01-28

    Hydroxyapatite (HA) is promising in various biomedical applications owing to its similar chemical composition, structure and properties to the inorganic component in natural hard tissues. Herein, we report a DNA-templated microwave-assisted hydrothermal strategy for the preparation of HA nanostructured materials. As a kind of natural biomacromolecule, DNA molecules open up a new way to the synthesis of HA nanostructured materials with well-defined structures and morphologies. The HA nanostructured materials with a nanosheet-assembled hierarchical structure and a HA nanorod ordered structure are successfully prepared. The important roles of DNA molecules and pH values in the formation of HA nanostructured materials are investigated, and a possible formation mechanism is proposed. The as-prepared HA nanostructured materials exhibit a relatively high adsorption ability for chicken immunoglobulin Y (IgY) protein and a sustained protein release behavior. The as-prepared HA nanostructured materials after loading the IgY protein show a high antimicrobial activity. Thus, the HA nanostructured materials prepared by the DNA-templated microwave hydrothermal method are promising for the applications in various areas such as the prevention and treatment of dental caries. PMID:26696032

  4. Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

    2016-09-01

    Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. PMID:27187190

  5. Synthesis, antiproliferative activity and DNA binding properties of novel 5-aminobenzimidazo[1,2-a]quinoline-6-carbonitriles.

    PubMed

    Perin, Nataša; Nhili, Raja; Ester, Katja; Laine, William; Karminski-Zamola, Grace; Kralj, Marijeta; David-Cordonnier, Marie-Hélène; Hranjec, Marijana

    2014-06-10

    The synthesis of 5-amino substituted benzimidazo[1,2-a]quinolines prepared by microwave assisted amination from halogeno substituted precursor was described. The majority of compounds were active at micromolar concentrations against colon, lung and breast carcinoma cell lines in vitro. The N,N-dimethylaminopropyl 9 and piperazinyl substituted derivative 19 showed the most pronounced activity towards all of the three tested tumor cell lines, which could be correlated to the presence of another N heteroatom and its potential interactions with biological targets. The DNA binding studies, consisting of UV/Visible absorbency, melting temperature studies, and fluorescence and circular dichroism titrations, revealed that compounds 9, 19 and 20 bind to DNA as strong intercalators. The cellular distribution analysis, based on compounds' intrinsic fluorescence, showed that compound 20 does not enter the cell, while compounds 9 and 19 do, which is in agreement with their cytotoxic effects. Compound 9 efficiently targets the nucleus whereas 19, which also showed DNA intercalating properties in vitro, was mostly localised in the cytoplasm suggesting that the antitumor mechanism of action is DNA-independent. PMID:24780599

  6. SYNTHESIS OF THE FULLY PROTECTED PHOSPHORAMIDITE OF THE BENZENE-DNA ADDUCT, N2- (4-HYDROXYPHENYL)-2'-DEOXYGUANOSINE AND INCORPORATION OF THE LATER INTO DNA OLIGOMERS

    SciTech Connect

    Chenna, Ahmed; Gupta, Ramesh C.; Bonala, Radha R.; Johnson, Francis; Huang, Bo

    2008-06-09

    N2-(4-Hydroxyphenyl)-2'-deoxyguanosine-5'-O-DMT-3'-phosphoramidite has been synthesized and used to incorporate the N2-(4-hydroxyphenyl)-2'-dG (N2-4-HOPh-dG) into DNA, using solid-state synthesis technology. The key step to obtaining the xenonucleoside is a palladium (Xantphos-chelated) catalyzed N2-arylation (Buchwald-Hartwig reaction) of a fully protected 2'-deoxyguanosine derivative by 4-isobutyryloxybromobenzene. The reaction proceeded in good yield and the adduct was converted to the required 5'-O-DMT-3'-O-phosphoramidite by standard methods. The latter was used to synthesize oligodeoxynucleotides in which the N2-4-HOPh-dG adduct was incorporated site-specifically. The oligomers were purified by reverse-phase HPLC. Enzymatic hydrolysis and HPLC analysis confirmed the presence of this adduct in the oligomers.

  7. Synthesis and in vitro characterization of antigen-conjugated polysaccharide as a CpG DNA carrier.

    PubMed

    Shimada, Naohiko; Ishii, Ken J; Takeda, Yoichi; Coban, Cevayir; Torii, Yuichi; Shinkai, Seiji; Akira, Shizuo; Sakurai, Kazuo

    2006-01-01

    Oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNAs) are known as an immune adjuvant. CpG DNAs coupled with a particular antigen enabling both CpG DNA and antigen delivery to the same antigen-presenting cell have been shown to be more effective. Based on our previous finding that beta-(1-->3)-D-glucan schizophyllan (SPG) can be used as a CpG DNA carrier, here we present the synthesis of an antigen-conjugated SPG and the characterization of the conjugate. Ovalbumin (OVA, 43 kDa) was used as a model antigen, and two OVA were conjugated to one SPG molecule (M(w) = 150,000), denoted by OVA-SPG. Circular dichroism and gel electrophoresis showed that OVA-SPG could form a complex with a (dA)(40)-tailed CpG DNA at the 3' end (1,668-(dA)(40)). When OVA-SPG was added to macrophages (J774.A1), the amount of the ingested OVA-SPG was increased compared with that of OVA itself, suggesting that Dectin-1 (proinflammatory nonopsonic receptor for beta-glucans) is involved to ingest OVA-SPG. Furthermore, the complex of the conjugate and DNA was co-localized in the same vesicles, implying that OVA (antigen) and CpG DNA (adjuvant) were ingested into the cell at the same time. This paper shows that OVA-SPG can be used as a CpG DNA carrier to induce antigen-specific immune responses. PMID:16984120

  8. Amplified and multiplexed detection of DNA using the dendritic rolling circle amplified synthesis of DNAzyme reporter units.

    PubMed

    Wang, Fuan; Lu, Chun-Hua; Liu, Xiaoqing; Freage, Lina; Willner, Itamar

    2014-02-01

    The amplified, highly sensitive detection of DNA using the dendritic rolling circle amplification (RCA) is introduced. The analytical platform includes a circular DNA and a structurally tailored hairpin structure. The circular nucleic acid template includes a recognition sequence for the analyte DNA (the Tay-Sachs mutant gene), a complementary sequence to the Mg(2+)-dependent DNAzyme, and a sequence identical to the loop region of the coadded hairpin structure. The functional hairpin in the system consists of the analyte-sequence that is caged in the stem region and a single-stranded loop domain that communicates with the RCA product. The analyte activates the RCA process, leading to DNA chains consisting of the Mg(2+)-dependent DNAzyme and sequences that are complementary to the loop of the functional hairpin structure. Opening of the coadded hairpin releases the caged analyte sequence, resulting in the dendritic RCA-induced synthesis of the Mg(2+)-dependent DNAzyme units. The DNAzyme-catalyzed cleavage of a fluorophore/quencher-modified substrate leads to a fluorescence readout signal. The method enabled the analysis of the target DNA with a detection limit corresponding to 1 aM. By the design of two different circular DNAs that include recognition sites for two different target genes, complementary sequences for two different Mg(2+)-dependent DNAzyme sequences and two different functional hairpin structures, the dendritic RCA-stimulated multiplexed analysis of two different genes is demonstrated. The amplified dendritic RCA detection of DNA is further implemented to yield the hemin/G-quadruplex horseradish peroxidase (HRP)-mimicking DNAzyme as catalytic labels that provide colorimetric or chemiluminescent readout signals. PMID:24377284

  9. Comparative analysis of de novo transcriptome assembly.

    PubMed

    Clarke, Kaitlin; Yang, Yi; Marsh, Ronald; Xie, Linglin; Zhang, Ke K

    2013-02-01

    The fast development of next-generation sequencing technology presents a major computational challenge for data processing and analysis. A fast algorithm, de Bruijn graph has been successfully used for genome DNA de novo assembly; nevertheless, its performance for transcriptome assembly is unclear. In this study, we used both simulated and real RNA-Seq data, from either artificial RNA templates or human transcripts, to evaluate five de novo assemblers, ABySS, Mira, Trinity, Velvet and Oases. Of these assemblers, ABySS, Trinity, Velvet and Oases are all based on de Bruijn graph, and Mira uses an overlap graph algorithm. Various numbers of RNA short reads were selected from the External RNA Control Consortium (ERCC) data and human chromosome 22. A number of statistics were then calculated for the resulting contigs from each assembler. Each experiment was repeated multiple times to obtain the mean statistics and standard error estimate. Trinity had relative good performance for both ERCC and human data, but it may not consistently generate full length transcripts. ABySS was the fastest method but its assembly quality was low. Mira gave a good rate for mapping its contigs onto human chromosome 22, but its computational speed is not satisfactory. Our results suggest that transcript assembly remains a challenge problem for bioinformatics society. Therefore, a novel assembler is in need for assembling transcriptome data generated by next generation sequencing technique. PMID:23393031

  10. PATTERNS OF RNA SYNTHESIS IN T5-INFECTED CELLS I. AS STUDIED BY THE TECHNIQUE OF DNA-RNA HYBRIDIZATION-COMPETITION*

    PubMed Central

    Moyer, Richard W.; Buchanan, John M.

    1969-01-01

    The RNA-labeling patterns obtained after T5 infection of Escherichia coli F agree with the patterns of protein labeling published by McCorquodale and Buchanan.1 Three distinct classes of RNA formed sequentially during the period of viral development can be recognized by the DNA-RNA hybridization-competition technique. Class I RNA is formed within 5 minutes after the beginning of viral metabolism and corresponds to the RNA synthesized in response to infection with the 8 per cent segment of T5 DNA. Protein synthesis directed by this 8 per cent segment is required in some capacity for the cessation of class I synthesis and the beginning of the synthesis of class II at 4 to 5 min after infection. Class III RNA synthesis begins between 9 and 12 minutes. Its appearance is prevented when chloramphenicol is added immediately after complete expression of class I functions. PMID:4916923

  11. Induction of human beta-interferon synthesis with poly(rI . rC) in mouse cells transfected with cloned cDNA plasmids.

    PubMed Central

    Pitha, P M; Ciufo, D M; Kellum, M; Raj, N B; Reyes, G R; Hayward, G S

    1982-01-01

    Human genomic DNA and plasmids carrying portions of the cDNA gene for human beta-interferon have been introduced into mouse Ltk- cells by cotransfection with a herpes simplex virus thymidine kinase (TK) gene. One plasmid contains 840 base pairs of human DNA complementary to pre-beta-interferon mRNA inserted into pBR322, whereas the other plasmids have hybrid genes containing only the 560-base pair coding region inserted under the transcriptional control of the TK promoter. Constitutive interferon production could not be detected in any of the mouse TK+ cell lines tested. Nevertheless, synthesis of interferon could be induced by poly(rI . rC) treatment in at least 16 of these cell lines, including clones transfected with genomic DNA, the beta-interferon cDNA, and the TK-beta-interferon cDNA hybrid gene. The interferon produced was specific for human cells and could be neutralized by antiserum against human beta-interferon. In contrast to human fibroblast cells, in which the synthesis of induced beta-interferon is transient, the poly(rI . rC)-induced TK+ lines continued to produce beta-interferon for prolonged periods of time and did not respond to superinduction conditions. Therefore, in transfected mouse cells, the coding DNA sequence from the human beta-interferon gene, without any of the adjacent 3' or 5' flanking human DNA sequences, was sufficient both to direct synthesis of biologically active product and to respond to the specific induction system that operates in human cells. However, the mechanism that switches off the synthesis of induced interferon in human cells appears not to operate in mouse cells transfected with beta-interferon cDNA. PMID:6956863

  12. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  13. Mitochondrial transcription terminator family members mTTF and mTerf5 have opposing roles in coordination of mtDNA synthesis.

    PubMed

    Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T

    2013-01-01

    All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965

  14. DNA synthesis and microtubule assembly-related events in fertilized Paracentrotus lividus eggs: reversible inhibition by 10 mM procaine.

    PubMed

    Raymond, M N; Foucault, G; Coffe, G; Pudles, J

    1986-04-01

    This report describes the effects of 10 mM procaine on microtubule assembly and on DNA synthesis, as followed by [3H]colchicine binding assays and [3H]thymidine incorporation respectively, in fertilized Paracentrotus lividus eggs. In the absence of microtubule assembly inhibitors, about 25% of the total egg tubulin is submitted to two cycles of polymerization prior to the first cell division, this polymerization process precedes DNA synthesis. If the zygotes are treated with 10 mM procaine in the course of the cell cycle, tubulin polymerization is inhibited or microtubules are disassembled. DNA synthesis is inhibited when procaine treatment is performed 10 min, before the initiation of the S-period. However, when the drug is applied in the course of this synthetic period, the process is normally accomplished, but the next S-period becomes inhibited. Moreover, procaine treatment increases the cytoplasmic pH of the fertilized eggs by about 0.6 to 0.8 pH units. This pH increase precedes microtubule disassembly and inhibition of DNA synthesis. Washing out the drug induces a decrease of the intracellular pH which returns to about the same value as that of the fertilized egg controls. This pH change is then followed by the reinitiation of microtubule assembly, DNA synthesis and cell division. Our results show that the inhibition of both tubulin polymerization and DNA synthesis in fertilized eggs treated with 10 mM procaine, appears to be related to the drug-induced increase in cytoplasmic pH. PMID:3709552

  15. Characterization of DNA Primase Complex Isolated from the Archaeon, Thermococcus kodakaraensis*

    PubMed Central

    Chemnitz Galal, Wiebke; Pan, Miao; Kelman, Zvi; Hurwitz, Jerard

    2012-01-01

    In most organisms, DNA replication is initiated by DNA primases, which synthesize primers that are elongated by DNA polymerases. In this study, we describe the isolation and biochemical characterization of the DNA primase complex and its subunits from the archaeon Thermococcus kodakaraensis. The T. kodakaraensis DNA primase complex is a heterodimer containing stoichiometric levels of the p41 and p46 subunits. The catalytic activity of the complex resides within the p41 subunit. We show that the complex supports both DNA and RNA synthesis, whereas the p41 subunit alone marginally produces RNA and synthesizes DNA chains that are longer than those formed by the complex. We report that the T. kodakaraensis primase complex preferentially interacts with dNTP rather than ribonucleoside triphosphates and initiates RNA as well as DNA chains de novo. The latter findings indicate that the archaeal primase complex, in contrast to the eukaryote homolog, can initiate DNA chain synthesis in the absence of ribonucleoside triphosphates. DNA primers formed by the archaeal complex can be elongated extensively by the T. kodakaraensis DNA polymerase (Pol) B, whereas DNA primers formed by the p41 catalytic subunit alone were not. Supplementation of reactions containing the p41 subunit with the p46 subunit leads to PolB-catalyzed DNA synthesis. We also established a rolling circle reaction using a primed 200-nucleotide circle as the substrate. In the presence of the T. kodakaraensis minichromosome maintenance (MCM) 3′ → 5′ DNA helicase, PolB, replication factor C, and proliferating cell nuclear antigen, long leading strands (>10 kb) are produced. Supplementation of such reactions with the DNA primase complex supported lagging strand formation as well. PMID:22351771

  16. Novel Organotin(IV)-Schiff Base Complexes: Synthesis, Characterization, Antimicrobial Activity, and DNA Interaction Studies

    PubMed Central

    Prasad, K. Shiva; Kumar, L. Shiva; Prasad, Melvin; Revanasiddappa, Hosakere D.

    2010-01-01

    Four organotin(IV) complexes with 2-(2-hydroxybenzylideneamino)isoindoline-1,3-dione (L1), and 4-(4-hydroxy-3-methoxybenzylideneamino-N-(pyrimidin-2-yl)benzenesulfonamide (L2) were synthesized and well characterized by analytical and spectral studies. The synthesized compounds were tested for antimicrobial activity by disc diffusion method. The DNA binding of the complexes 1 and 3 with CT-DNA has been performed with absorption spectroscopy, which showed that both the complexes are avid binders of CT-DNA. Also the nuclease activity of complexes 1 and 3 with plasmid DNA (pUC19) was studied using agarose gel electrophoresis. The complex 1 can act as effective DNA cleaving agent when compared to complex 3 resulting in the nicked form of DNA under physiological conditions. The gel was run both in the absence and presence of the oxidizing agent. PMID:21253533

  17. A Novel Styryldehydropyridocolinium Homodimer: Synthesis and Fluorescence Properties Upon Interaction with DNA.

    PubMed

    Yao, Huirong; Chang, Lifang; Liu, Chang; Jiao, Xiaojie; He, Song; Liu, Haijun; Zeng, Xianshun

    2015-11-01

    A novel homodimer of the styryldehydropyridocolinium dye (TPTP) has been synthesized and characterized. Free TPTP exhibited low fluorescence quantum yield and large Stokes shift (over 160 nm) in water. However, it showed a significant fluorescence turn-on effect upon intercalation into DNA base pairs. Meanwhile, the fluorescence intensity of the intercalated structures formed by TPTP and DNA decreased quickly upon addition of deoxyribonuclease I, indicating that the dye can be used to monitor deoxyribonuclease I activity and DNA hydrolysis. Electrophoresis analysis revealed that the dye had intercalative binding to DNA and can potentially be used for DNA staining in electrophoresis. Thus, the innate nature of large Stokes shift and excellent fluorescence turn on effect upon interaction with DNA endue the dye with a wide range of applications. PMID:26384336

  18. Inhibition of human carcinoma cell growth and DNA synthesis by silibinin, an active constituent of milk thistle: comparison with silymarin.

    PubMed

    Bhatia, N; Zhao, J; Wolf, D M; Agarwal, R

    1999-12-01

    Several studies from our laboratory have shown the cancer chemopreventive and anti-carcinogenic effects of silymarin, a flavonoid antioxidant isolated from milk thistle, in long-term tumorigenesis models and in human prostate, breast and cervical carcinoma cells. Since silymarin is composed mainly of silibinin with small amounts of other stereoisomers of silibinin, in the present communication, studies were performed to assess whether the cancer preventive and anti-carcinogenic effects of silymarin are due to its major component silibinin. Treatment of different prostate, breast, and cervical human carcinoma cells with silibinin resulted in a highly significant inhibition of both cell growth and DNA synthesis in a time-dependent manner with large loss of cell viability only in case of cervical carcinoma cells. When compared with silymarin, these effects of silibinin were consistent and comparable in terms of cell growth and DNA synthesis inhibition, and loss of cell viability. Based on the comparable results of silibinin and silymarin, we suggest that the cancer chemopreventive and anti-carcinogenic effects of silymarin reported earlier are due to the main constituent silibinin. PMID:10660092

  19. Mitochondrial DNA, RNA and protein synthesis in normal, hypothyroid and mildly hyperthyroid rat liver during cold exposure.

    PubMed

    Goglia, F; Liverini, G; Lanni, A; Barletta, A

    1988-02-01

    We have examined in isolated liver mitochondria the effect of cold exposure on DNA, RNA and protein synthesis in normal, hypothyroid and mildly hyperthyroid rats. In normal rats DNA polymerase activity increased from the first day of cold exposure remaining high up to the fifteenth day. RNA polymerase and protein synthesis were stimulated from the fifth day of cold exposure, maintaining a high level up to the fifteenth day. These activities were related to serum triiodothyronine (T3) levels. Indeed propylthiouracil (PTU) administration to cold-exposed rats drastically depressed the above activities, whereas T3 administration to PTU-treated cold-exposed rats restored them to about the values prevalent in normal cold-exposed rats. The translation products analyzed by gel electrophoresis showed that different effects may be exerted by T3 depending on whether its circulating levels are physiologically or pharmacologically modified. These findings suggest that T3 may be involved in the regulation of the acclimation process by acting, presumably with a permissive role, on those activities which determine a modification of the mitochondrial morphometric features and an increase in mitochondria number and turnover. PMID:2451625

  20. ES936 stimulates DNA synthesis in HeLa cells independently on NAD(P)H:quinone oxidoreductase 1 inhibition, through a mechanism involving p38 MAPK.

    PubMed

    González-Aragón, David; Alcaín, Francisco J; Ariza, Julia; Jódar, Laura; Barbarroja, Nuria; López-Pedrera, Chary; Villalba, José M

    2010-07-30

    The indolequinone ES936 (5-methoxy-1,2-dimethyl-3-[(4-nitrophenol)methyl]-indole-4,7-dione) is a potent mechanism-based inhibitor of NAD(P)H:quinone oxidoreductase 1 (NQO1). Here, we report that ES936 significantly stimulated thymidine incorporation in sparse cultures of human adenocarcinoma HeLa cells, but was without effect in dense cultures. Stimulation of DNA synthesis was not related with a DNA repair response because an increase in thymidine incorporation was not observed in cells treated with 2,5 bis-[1-aziridyl]-1,4 benzoquinone, a well-established antitumor quinone that causes DNA damage. Conversely, it was related with an increase of cell growth. NQO1 inhibition was not involved in ES936 stimulation of DNA synthesis, because the same response was observed in cells where NQO1 expression had been knocked down by small interfering RNA. Stimulation of DNA synthesis was reverted by treatment with ambroxol, a SOD mimetic, and by pyruvate, an efficient peroxide scavenger, supporting the involvement of alterations in cellular redox state. Pharmacological inhibition of p38 with either SB203580 or PD169316 completely abolished ES936-stimulated DNA synthesis, indicating the requirement of p38 activity. This is the first report that demonstrates the existence of an ES936-sensitive system which is separate from NQO1, modulating the redox state and cell growth in HeLa cells through a p38-dependent mechanism. Our results show that the effect ES936 exerts on DNA synthesis may be either positive or negative depending on the cellular context and growth conditions. PMID:20433816

  1. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives.

    PubMed

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; da Silva, Lúcia Patrícia Bezerra Gomes; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Ruiz, Ana Lucia Tasca Gois; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a-h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 10(4) to 1.0 × 10(6) M(-1) and quenching constants from -0.2 × 10(4) to 2.18 × 10(4) M(-1) indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N- (4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  2. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  3. Synthesis of a novel water-soluble zinc phthalocyanine and its CT DNA-damaging studies

    NASA Astrophysics Data System (ADS)

    Wang, Tianhui; Wang, Ao; Zhou, Lin; Lu, Shan; Jiang, Weiwei; Lin, Yun; Zhou, Jiahong; Wei, Shaohua

    2013-11-01

    A novel 3-(4-methoxybenzylamino) propanoic acid substituted water-soluble zinc phthalocyanine (CNPcZn) was synthesized. The interaction between CNPcZn with calf thymus DNA (CT DNA) was studied using spectroscopic methods. The studies indicated that CNPcZn has strong affinity to CT DNA, and furthermore, CNZnPc showed excellent photodamaging activity to CT DNA. Above results indicated that such CNPcZn has great potential to be used as an effective photosensitizer in the field of photodynamic therapy.

  4. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools. PMID:26494264

  5. Beet curly top virus symptom amelioration in Nicotiana benthamiana transformed with a naturally occurring viral subgenomic DNA.

    PubMed

    Frischmuth, T; Stanley, J

    1994-05-01

    Beet curly top virus (BCTV) infection is associated with the de novo synthesis of a heterogeneous population of subgenomic viral DNAs. Nicotiana benthamiana plants transformed with a partial repeat of one such subgenomic DNA remain susceptible to infection but produce ameliorated symptoms when agroinoculated with BCTV. Transgenic plants contained from 10 to 30% of the amount of viral DNA detected in nontransformed control plants showing severe symptoms. Symptom amelioration is associated with the mobilization of subgenomic DNA from the integrated template and its amplification to approximately one third of the total amount of viral DNA. The amplification in transgenic plants of a specific subgenomic DNA rather than a heterogeneous population implies that mobilization from the integrated template frequently occurs during systemic infection, precluding the accumulation of other subgenomic DNA forms. PMID:8178467

  6. Complex Multiple-Nucleotide Substitution Mutations Causing Human Inherited Disease Reveal Novel Insights into the Action of Translesion Synthesis DNA Polymerases.

    PubMed

    Chen, Jian-Min; Férec, Claude; Cooper, David N

    2015-11-01

    Translesion synthesis (TLS) DNA polymerases allow the bypass of unrepaired lesions during DNA replication. Based upon mutational signatures of a subtype of multiple-nucleotide substitution (MNS) mutations causing human inherited disease, we have recently postulated two properties of TLS DNA polymerases in DNA repair, namely, the generation of neo-microhomologies potentiating strand-misalignment, and additional microlesions within the templated inserts when recruited to stalled replication forks. To provide further support for this postulate, we analyzed the mutational signatures of a new and complex subtype of pathogenic MNS mutation. Several mutations containing long templated inserts (8-19 bp) that are highly informative with regard to their underlying mutational mechanisms, harbor imprints of TLS DNA polymerase action. Dissecting the mechanism underlying the generation of the 19-bp insert implicated repeated participation of TLS DNA polymerases in the conversion of a damaged base into a complex MNS lesion through a process of successive template switching and bypass repair. PMID:26172832

  7. The Effects of Magnesium Ions on the Enzymatic Synthesis of Ligand-Bearing Artificial DNA by Template-Independent Polymerase

    PubMed Central

    Takezawa, Yusuke; Kobayashi, Teruki; Shionoya, Mitsuhiko

    2016-01-01

    A metal-mediated base pair, composed of two ligand-bearing nucleotides and a bridging metal ion, is one of the most promising components for developing DNA-based functional molecules. We have recently reported an enzymatic method to synthesize hydroxypyridone (H)-type ligand-bearing artificial DNA strands. Terminal deoxynucleotidyl transferase (TdT), a template-independent DNA polymerase, was found to oligomerize H nucleotides to afford ligand-bearing DNAs, which were subsequently hybridized through copper-mediated base pairing (H–CuII–H). In this study, we investigated the effects of a metal cofactor, MgII ion, on the TdT-catalyzed polymerization of H nucleotides. At a high MgII concentration (10 mM), the reaction was halted after several H nucleotides were appended. In contrast, at lower MgII concentrations, H nucleotides were further appended to the H-tailed product to afford longer ligand-bearing DNA strands. An electrophoresis mobility shift assay revealed that the binding affinity of TdT to the H-tailed DNAs depends on the MgII concentration. In the presence of excess MgII ions, TdT did not bind to the H-tailed strands; thus, further elongation was impeded. This is possibly because the interaction with MgII ions caused folding of the H-tailed strands into unfavorable secondary structures. This finding provides an insight into the enzymatic synthesis of longer ligand-bearing DNA strands. PMID:27338351

  8. Boron Clusters as a Platform for New Materials: Synthesis of Functionalized o-Carborane (C2 B10 H12 ) Derivatives Incorporating DNA Fragments.

    PubMed

    Janczak, Slawomir; Olejniczak, Agnieszka; Balabańska, Sandra; Chmielewski, Marcin K; Lupu, Marius; Viñas, Clara; Lesnikowski, Zbigniew J

    2015-10-19

    A synthetic strategy for functionalization of the three vertices of o-carborane and the attachment of the obtained triped to the solid support was developed. Further functionalization of the triped with short DNA sequences by automated DNA synthesis was achieved. The proposed methodology is a first example of boron cluster chemistry on a solid support opening new perspectives in boron cluster functionalization. PMID:26346614

  9. Microtubule configurations and nuclear DNA synthesis during initiation of suspensor-bearing embryos from Brassica napus cv. Topas microspores.

    PubMed

    Dubas, Ewa; Custers, Jan; Kieft, Henk; Wędzony, Maria; van Lammeren, André A M

    2011-11-01

    In the new Brassica napus microspore culture system, wherein embryos with suspensors are formed, ab initio mimics zygotic embryogenesis. The system provides a powerful in vitro tool for studying the diverse developmental processes that take place during early stages of plant embryogenesis. Here, we studied in this new culture system both the temporal and spatial distribution of nuclear DNA synthesis places and the organization of the microtubular (MT) cytoskeleton, which were visualized with a refined whole mount immunolocalization technology and 3D confocal laser scanning microscopy. A 'mild' heat stress induced microspores to elongate, to rearrange their MT cytoskeleton and to re-enter the cell cycle and perform a predictable sequence of divisions. These events led to the formation of a filamentous suspensor-like structure, of which the distal tip cell gave rise to the embryo proper. Cells of the developing pro-embryo characterized endoplasmic (EMTs) and cortical microtubules (CMTs) in various configurations in the successive stages of the cell cycle. However, the most prominent changes in MT configurations and nuclear DNA replication concerned the first sporophytic division occurring within microspores and the apical cell of the pro-embryo. Microspore embryogenesis was preceded by pre-prophase band formation and DNA synthesis. The apical cell of the pro-embryo exhibited a random organization of CMTs and, in relation to this, isotropic expansion occurred, mimicking the development of the apical cell of the zygotic situation. Moreover, the apical cell entered the S phase shortly before it divided transversally at the stage that the suspensor was 3-8 celled. PMID:21779827

  10. Synthesis of Sequence-Specific DNA-Protein Conjugates via a Reductive Amination Strategy

    PubMed Central

    Wickramaratne, Susith; Mukherjee, Shivam; Villalta, Peter W.; Schärer, Orlando D.; Tretyakova, Natalia

    2013-01-01

    DNA-protein cross-links (DPCs) are ubiquitous, structurally diverse DNA lesions formed upon exposure to bis-electrophiles, transition metals, UV light, and reactive oxygen species. Because of their super-bulky, helix distorting nature, DPCs interfere with DNA replication, transcription, and repair, potentially contributing to mutagenesis and carcinogenesis. However, the biological implications of DPC lesions have not been fully elucidated due to the difficulty of generating site-specific DNA substrates representative of DPC lesions formed in vivo. In the present study, a novel approach involving post-synthetic reductive amination has been developed to prepare a range of hydrolytically stable lesions structurally mimicking the DPCs produced between the N7 position of guanine in DNA and basic lysine or arginine side chains of proteins and peptides. PMID:23885807

  11. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    PubMed

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone. PMID:27139727

  12. Alteration of mitochondrial DNA and RNA level in human fibroblasts with impaired vitamin B12 coenzyme synthesis.

    PubMed

    Cantatore, P; Petruzzella, V; Nicoletti, C; Papadia, F; Fracasso, F; Rustin, P; Gadaleta, M N

    1998-08-01

    Alterations of mitochondrial (mt) nucleic acid metabolism in methylmalonic aciduria (MMA) were studied in two cell lines from skin fibroblasts of patients with mitochondrial (GM00595) or cytosolic (GM10011) defects in the biosynthesis pathways of cobalamin coenzymes. The mtDNA level increased two-fold in GM00595 cells, which carry a mt defect in the adenosylcobalamin synthesis, whereas no appreciable change was found in GM10011 cells. The content of the two rRNAs 16S and 12S mtRNAs, normalized for the mtDNA copy number, decreased by 70% and 50% in GM00595 and GM10011, respectively. The normalized content of ND1, ND2 and CO I mRNAs decreased in GM00595, but was unchanged in GM10011. Respiratory chain complex activities measured in these two cell lines were not different from control activities. These data suggest that the maintenance of the mt function is due to doubling of mtDNA and that this compensatory response takes place only in those cells in which the greater reduction of the level of rRNA might have brought the content of these transcripts below the threshold value for optimal expression of the mt genome. PMID:9720919

  13. Gas-phase synthesis of solid state DNA nanoparticles stabilized by l-leucine.

    PubMed

    Raula, Janne; Hanzlíková, Martina; Rahikkala, Antti; Hautala, Juho; Kauppinen, Esko I; Urtti, Arto; Yliperttula, Marjo

    2013-02-28

    Aerosol flow reactor is used to generate solid-state nanoparticles in a one-step process that is based on drying of aerosol droplets in continuous flow. We investigated the applicability of aerosol flow reactor method to prepare solid state DNA nanoparticles. Precursor solutions of plasmid DNA with or without complexing agent (polyethylenimine), coating material (l-leucine) and mannitol (bulking material) were dispersed to nanosized droplets and instantly dried in laminar heat flow. Particle morphology, integrity and stability were studied by scanning electron microscopy. The stability of DNA was studied by gel electrophoresis. Plasmid DNA as such degraded in the aerosol flow process. Complexing agent protected DNA from degradation and coating material enabled production of dispersed, non-aggregated, nanoparticles. The resulting nanoparticles were spherical and their mean diameter ranged from 65 to 125nm. The nanoparticles were structurally stable at room temperature and their DNA content was about 10%. We present herein the proof of principle for the production of dispersed solid state nanoparticles with relevant size and intact plasmid DNA. PMID:23352859

  14. The carbocyclic analog of 2'-deoxyguanosine induces a prolonged inhibition of duck hepatitis B virus DNA synthesis in primary hepatocyte cultures and in the liver.

    PubMed Central

    Fourel, I; Saputelli, J; Schaffer, P; Mason, W S

    1994-01-01

    The carbocyclic analog of 2'-deoxyguanosine (2'-CDG) is a strong inhibitor of hepatitis B virus (HBV) DNA synthesis in HepG2 cells (P.M. Price, R. Banerjee, and G. Acs, Proc. Natl. Acad. USA 86:8543-8544, 1989). We now report that 2'-CDG inhibited duck hepatitis B virus (DHBV) DNA synthesis in primary cultures of duck hepatocytes and in experimentally infected ducks. Like foscarnet (phosphonoformic acid [PFA]) and 2'-,3'-dideoxycytidine (ddC), 2'-CDG blocked viral DNA replication in primary hepatocyte cultures when present during an infection but failed to inhibit the DNA repair reaction that occurs during the initiation of infection to convert virion relaxed circular DNA to covalently closed circular DNA, the template for viral mRNA transcription. Moreover, as for PFA and ddC, viral RNA synthesis was detected when infection was initiated in the presence 2'-CDG. In another respect, however, 2'-CDG exhibited antiviral activity unlike that of ddC or PFA: a single 1-day treatment of hepatocytes with 2'-CDG blocked initiation of viral DNA synthesis for at least 8 days, irrespective of whether DHBV infection was carried out at the time of drug treatment or several days later. Furthermore, orally administered 2'-CDG was long-acting against DHBV in experimentally infected ducklings. Virus replication was delayed by up to 4 days in ducklings infected after administration of 2'-CDG. These observations of long-lasting efficacy in vitro and in vivo even after oral administration suggest that this inhibitor or a nucleoside with similar pharmacological properties may be ideal for reducing virus replication in patients with chronic HBV infection. Images PMID:8289335

  15. Fluorescent DNA Nanotags Featuring Covalently Attached Intercalating Dyes: Synthesis, Antibody Conjugation and Intracellular Imaging

    PubMed Central

    Stadler, Andrea L.; Santos, Junriz Delos; Stensrud, Elizabeth S.; Dembska, Anna; Silva, Gloria L.; Liu, Shengpeng; Shank, Nathaniel I.; Kunttas-Tatli, Ezgi; Sobers, Courtney J.; Gramlich, Philipp M. E.; Carell, Thomas; Peteanu, Linda A.; McCartney, Brooke M.; Armitage, Bruce A.

    2011-01-01

    We have synthesized fluorescent DNA duplexes featuring multiple thiazole orange (TO) intercalating dyes covalently attached to the DNA via a triazole linkage. The intercalating dyes stabilize the duplex against thermal denaturation and show bright fluorescence in the green. The emission color can be changed to orange or red by addition of energy-accepting Cy3 or Cy5 dyes attached covalently to the DNA duplex. The dye-modified DNA duplexes were then attached to a secondary antibody for intracellular fluorescence imaging of centrosomes in Drosophila embryos. Bright fluorescent foci were observed at the centrosomes in both the donor (TO) and acceptor (Cy5) channels, due to the fact that the energy transfer efficiency is moderate. Monitoring the Cy5 emission channel significantly minimized the background signal due to the large shift in emission wavelength allowed by energy transfer. PMID:21755981

  16. Cell division and subsequent radicle protrusion in tomato seeds are inhibited by osmotic stress but DNA synthesis and formation of microtubular cytoskeleton are not.

    PubMed

    de Castro, R D; van Lammeren, A A; Groot, S P; Bino, R J; Hilhorst, H W

    2000-02-01

    We studied cell cycle events in embryos of tomato (Lycopersicon esculentum Mill. cv Moneymaker) seeds during imbibition in water and during osmoconditioning ("priming") using both quantitative and cytological analysis of DNA synthesis and beta-tubulin accumulation. Most embryonic nuclei of dry, untreated control seeds were arrested in the G(1) phase of the cell cycle. This indicated the absence of DNA synthesis (the S-phase), as confirmed by the absence of bromodeoxyuridine incorporation. In addition, beta-tubulin was not detected on western blots and microtubules were not present. During imbibition in water, DNA synthesis was activated in the radicle tip and then spread toward the cotyledons, resulting in an increase in the number of nuclei in G(2). Concomitantly, beta-tubulin accumulated and was assembled into microtubular cytoskeleton networks. Both of these cell cycle events preceded cell expansion and division and subsequent growth of the radicle through the seed coat. The activation of DNA synthesis and the formation of microtubular cytoskeleton networks were also observed throughout the embryo when seeds were osmoconditioned. However, this pre-activation of the cell cycle appeared to become arrested in the G(2) phase since no mitosis was observed. The pre-activation of cell cycle events in osmoconditioned seeds appeared to be correlated with enhanced germination performance during re-imbibition in water. PMID:10677426

  17. DNA Synthesis during Endomitosis Is Stimulated by Insulin via the PI3K/Akt and TOR Signaling Pathways in the Silk Gland Cells of Bombyx mori

    PubMed Central

    Li, Yaofeng; Chen, Xiangyun; Tang, Xiaofang; Zhang, Chundong; Wang, La; Chen, Peng; Pan, Minhui; Lu, Cheng

    2015-01-01

    Silk gland cells undergo multiple endomitotic cell cycles during silkworm larval ontogeny. Our previous study demonstrated that feeding is required for continued endomitosis in the silk gland cells of silkworm larvae. Furthermore, the insulin signaling pathway is closely related to nutritional signals. To investigate whether the insulin signaling pathway is involved in endomitosis in silk gland cells, in this study, we initially analyzed the effects of bovine insulin on DNA synthesis in endomitotic silk gland cells using 5-bromo-2'-deoxyuridine (BrdU) labeling technology, and found that bovine insulin can stimulate DNA synthesis. Insulin signal transduction is mainly mediated via phosphoinositide 3-kinase (PI3K)/Akt, the target of rapamycin (TOR) and the extracellular signal-regulated kinase (ERK) pathways in vertebrates. We ascertained that these three pathways are involved in DNA synthesis in endomitotic silk gland cells using specific inhibitors against each pathway. Moreover, we investigated whether these three pathways are involved in insulin-stimulated DNA synthesis in endomitotic silk gland cells, and found that the PI3K/Akt and TOR pathways, but not the ERK pathway, are involved in this process. These results provide an important theoretical foundation for the further investigations of the mechanism underlying efficient endomitosis in silk gland cells. PMID:25794286

  18. DNA synthesis during endomitosis is stimulated by insulin via the PI3K/Akt and TOR signaling pathways in the silk gland cells of Bombyx mori.

    PubMed

    Li, Yaofeng; Chen, Xiangyun; Tang, Xiaofang; Zhang, Chundong; Wang, La; Chen, Peng; Pan, Minhui; Lu, Cheng

    2015-01-01

    Silk gland cells undergo multiple endomitotic cell cycles during silkworm larval ontogeny. Our previous study demonstrated that feeding is required for continued endomitosis in the silk gland cells of silkworm larvae. Furthermore, the insulin signaling pathway is closely related to nutritional signals. To investigate whether the insulin signaling pathway is involved in endomitosis in silk gland cells, in this study, we initially analyzed the effects of bovine insulin on DNA synthesis in endomitotic silk gland cells using 5-bromo-2'-deoxyuridine (BrdU) labeling technology, and found that bovine insulin can stimulate DNA synthesis. Insulin signal transduction is mainly mediated via phosphoinositide 3-kinase (PI3K)/Akt, the target of rapamycin (TOR) and the extracellular signal-regulated kinase (ERK) pathways in vertebrates. We ascertained that these three pathways are involved in DNA synthesis in endomitotic silk gland cells using specific inhibitors against each pathway. Moreover, we investigated whether these three pathways are involved in insulin-stimulated DNA synthesis in endomitotic silk gland cells, and found that the PI3K/Akt and TOR pathways, but not the ERK pathway, are involved in this process. These results provide an important theoretical foundation for the further investigations of the mechanism underlying efficient endomitosis in silk gland cells. PMID:25794286

  19. Effects of platelet-derived growth factor and other polypeptide mitogens on DNA synthesis and growth of cultured rat liver fat-storing cells.

    PubMed Central

    Pinzani, M; Gesualdo, L; Sabbah, G M; Abboud, H E

    1989-01-01

    In vitro and in vivo studies suggest that liver fat-storing cells (FSC) may play an important role in the development of liver fibrosis. We explored the effects of platelet-derived growth factor (PDGF), epidermal growth factor (EGF), transforming growth factor (TGF)-alpha and TGF-beta, and basic fibroblast growth factor (bFGF) on DNA synthesis and growth of rat liver FSC. PDGF, EGF, TGF-alpha, and bFGF induced a dose-dependent increase in DNA synthesis with a peak effect at 24 h. PDGF produced the most striking effect with a maximum 18-fold increase over control. EGF, TGF-alpha, and bFGF elicited a maximum three- to fourfold increase in DNA synthesis. Analysis of growth curves revealed a similar pattern of potency of the growth factors. TGF-beta did not affect DNA synthesis of FSC; however, TGF-beta markedly potentiated the stimulatory effects of both EGF and PDGF. FSC showed high specific binding of 125I-PDGF and Scatchard analysis revealed high affinity receptors with an apparent Kd of 2.3 x 10(-10) M. Our data suggest that PDGF is a key mitogen for FSC and that the coordinate release of other growth factors together with PDGF by inflammatory cells represents a potent potential stimulus for FSC proliferation in conditions of chronic self-perpetuating liver inflammation. Images PMID:2592560

  20. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.