Science.gov

Sample records for nuclear encoded gene

  1. Evolutionary relationship of nuclear genes encoding mitochondrial proteins across grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Comparative genome studies were done across taxa to provide a basic understanding of genome evolution regarding nuclear genes encoding for mitochondrial proteins and their conservation in grass species. Two different mitochondria-related gene sets, one from rice and another from Arabidopsis, were us...

  2. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  3. (Structure and expression of nuclear genes encoding rubisco activase)

    SciTech Connect

    Zielinski, R.E.

    1990-01-01

    Our activities during the past year have centered around two basic aspects of the project: describing more thoroughly the diurnal and light irradiance effects on activase gene expression in barley; and isolating and structurally characterizing cDNA and genomic DNA sequences encoding activase from barley. Three appendices are included that summarize these activities.

  4. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  5. Regulation of nuclear genes encoding mitochondrial proteins in Saccharomyces cerevisiae.

    PubMed Central

    Brown, T A; Evangelista, C; Trumpower, B L

    1995-01-01

    Selection for mutants which release glucose repression of the CYB2 gene was used to identify genes which regulate repression of mitochondrial biogenesis. We have identified two of these as the previously described GRR1/CAT80 and ROX3 genes. Mutations in these genes not only release glucose repression of CYB2 but also generally release respiration of the mutants from glucose repression. In addition, both mutants are partially defective in CYB2 expression when grown on nonfermentable carbon sources, indicating a positive regulatory role as well. ROX3 was cloned by complementation of a glucose-inducible flocculating phenotype of an amber mutant and has been mapped as a new leftmost marker on chromosome 2. The ROX3 mutant has only a modest defect in glucose repression of GAL1 but is substantially compromised in galactose induction of GAL1 expression. This mutant also has increased SUC2 expression on nonrepressing carbon sources. We have also characterized the regulation of CYB2 in strains carrying null mutation in two other glucose repression genes, HXK2 and SSN6, and show that HXK2 is a negative regulator of CYB2, whereas SSN6 appears to be a positive effector of CYB2 expression. PMID:7592476

  6. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1990--June 30, 1992

    SciTech Connect

    Kuchka, M.R.

    1992-08-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5` UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  7. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    PubMed

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes. PMID:22733202

  8. Genetic Variants in Nuclear-Encoded Mitochondrial Genes Influence AIDS Progression

    PubMed Central

    Hendrickson, Sher L.; Lautenberger, James A.; Chinn, Leslie Wei; Malasky, Michael; Sezgin, Efe; Kingsley, Lawrence A.; Goedert, James J.; Kirk, Gregory D.; Gomperts, Edward D.; Buchbinder, Susan P.; Troyer, Jennifer L.; O'Brien, Stephen J.

    2010-01-01

    Background The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression. Methodology/Principal Findings Here we explore whether single nucleotide polymorphisms (SNPs) within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs) influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4) on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI) on chromosome 6. Conclusions Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis. PMID:20877624

  9. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    PubMed

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-01-01

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

  10. Structural organization of the human gene (LMNB1) encoding nuclear lamin B1

    SciTech Connect

    Lin, F.; Worman, H.J.

    1995-05-20

    The authors have determined the structural organization of the human gene (LMNB1) that encodes nuclear lamin B1, an intermediate filament protein of the nuclear envelope. The transcription unit spans more than 45 kb and the transcription start site is 348 nucleotides upstream from the translation initiation codon. Lamin B1 is encoded by 11 exons. Exon 1 codes for the amino-terminal head domain and the first portion of the central rod domain, exons 2 through 6 the central rod domain, and exons 7 through 11 the carboxyl-terminal tail domain of this intermediate filament protein. Intron positions are conserved in other lamin genes from frogs, mice, and humans but different in lamin genes from Drosophila melanogaster and Caenorhabditis elegans. In the region encoding the central rod domain, intron positions are also similar to those in the gene for an invertebrate nonneuronal cytoplasmic intermediate filament protein and the genes for most vertebrate cytoplasmic intermediate filament proteins except neurofilaments and nestin. 51 refs., 3 figs.

  11. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1991--May 31, 1992

    SciTech Connect

    Kuchka, M.R.

    1992-05-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  12. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity

    PubMed Central

    Zhang, Jin; Ruhlman, Tracey A.; Sabir, Jamal S. M.; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K.

    2016-01-01

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear–plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

  13. PABPN1 overexpression leads to upregulation of genes encoding nuclear proteins that are sequestered in oculopharyngeal muscular dystrophy nuclear inclusions.

    PubMed

    Corbeil-Girard, Louis-Philippe; Klein, Arnaud F; Sasseville, A Marie-Josée; Lavoie, Hugo; Dicaire, Marie-Josée; Saint-Denis, Anik; Pagé, Martin; Duranceau, André; Codère, François; Bouchard, Jean-Pierre; Karpati, George; Rouleau, Guy A; Massie, Bernard; Langelier, Yves; Brais, Bernard

    2005-04-01

    Oculopharyngeal muscular dystrophy (OPMD) is an adult-onset disease caused by expanded (GCN)12-17 stretches encoding the N-terminal polyalanine domain of the poly(A) binding protein nuclear 1 (PABPN1). OPMD is characterized by intranuclear inclusions (INIs) in skeletal muscle fibers, which contain PABPN1, molecular chaperones, ubiquitin, proteasome subunits, and poly(A)-mRNA. We describe an adenoviral model of PABPN1 expression that produces INIs in most cells. Microarray analysis revealed that PABPN1 overexpression reproducibly changed the expression of 202 genes. Sixty percent of upregulated genes encode nuclear proteins, including many RNA and DNA binding proteins. Immunofluorescence microscopy revealed that all tested nuclear proteins encoded by eight upregulated genes colocalize with PABPN1 within the INIs: CUGBP1, SFRS3, FKBP1A, HMG2, HNRPA1, PRC1, S100P, and HSP70. In addition, CUGBP1, SFRS3, and FKBP1A were also found in OPMD muscle INIs. This study demonstrates that a large number of nuclear proteins are sequestered in OPMD INIs, which may compromise cellular function. PMID:15755682

  14. Phylogenetic analysis to uncover organellar origins of nuclear-encoded genes.

    PubMed

    Foth, Bernardo J

    2007-01-01

    Most proteins that are located in mitochondria or plastids are encoded by the nuclear genome, because the organellar genomes have undergone severe reduction during evolution. In many cases, although not all, the nuclear genes encoding organelle-targeted proteins actually originated from the respective organellar genome and thus carry the phylogenetic fingerprint that still bespeaks their evolutionary origin. Phylogenetic analysis is a powerful in silico method that can yield important insights into the evolutionary history or molecular kinship of any gene or protein and that can thus also be used more specifically in the context of organellar targeting as one means to recognize protein candidates (e.g., from genome data) that may be targeted to mitochondria or plastids. This chapter provides protocols for creating multiple sequence alignments and carrying out phylogenetic analysis with the robust and comprehensive software packages Clustal and PHYLIP, which are both available free of charge for multiple computer platforms. Besides presenting step-by-step instructions on how to run these computer programs, this chapter also covers topics such as data collection and presentation of phylogenetic trees. PMID:17951706

  15. Cloning and characterization of the nucleoredoxin gene that encodes a novel nuclear protein related to thioredoxin

    SciTech Connect

    Kurooka, Hisanori; Kato, Keizo; Minoguchi, Shigeru

    1997-02-01

    In a yeast artificial chromosome contig close to the nude locus on mouse chromosome 11, we identified a novel gene, nucleoredoxin, that encodes a protein with similarity to the active site of thioredoxins. Nucleoredoxin is conserved between mammalian species, and two homologous genes were found in Caenorhabditis elegans. The nucleoredoxin transcripts are expressed in all adult tissues examined, but restricted to the nervous system and the limb buds in Day 10.5-11.5 embryos. The nucleoredoxin protein is predominantly localized in the nucleus of cells transfected with the nucleoredoxin expression construct. Since the bacterially expressed protein of nucleoredoxin showed oxidoreductase activity of the insulin disulfide bonds with kinetics similar to that of thioredoxin, it may be a redox regulator of the nuclear proteins, such as transcription factors. 40 refs., 6 figs.

  16. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-07-15

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  17. Early auxin-induced genes encode short-lived nuclear proteins.

    PubMed Central

    Abel, S; Oeller, P W; Theologis, A

    1994-01-01

    The plant growth hormone indoleacetic acid (IAA) transcriptionally activates gene expression in plants. Some of the genes whose expression is induced by IAA encode a family of proteins in pea (PS-IAA4 and PS-IAA6) and Arabidopsis (IAA1 and IAA2) that contain putative nuclear localization signals that direct a beta-glucuronidase reporter protein into the nucleus. Pulse-chase and immunoprecipitation experiments have defined the t1/2 of the PS-IAA4 and PS-IAA6 proteins to be 8 and 6 min, respectively. Their most prominent feature is the presence of a beta alpha alpha motif similar to the beta-sheet DNA-binding domain found in prokaryotic repressors of the Arc family. Based on these data, we suggest that plant tissues express short-lived nuclear proteins as a primary response to IAA. We propose that these proteins act as activators or repressors of genes responsible for mediating the various auxin responses. Images Fig. 2 Fig. 3 Fig. 4 PMID:8278386

  18. Structure and expression of a pea nuclear gene encoding a chlorophyll a/b-binding polypeptide

    SciTech Connect

    Cashmore, A.R.

    1984-05-01

    A nuclear gene AB80 has been isolated from a phage lambda Charon 4 library of pea DNA. The sequence of the gene has been determined and it has been shown to contain an interrupted reading frame of 269 amino acids, corresponding to a precursor to a constituent polypeptide of the light-harvesting chlorophyll a/b-protein complex. Primer extension and S1 nuclease studies defined a cap site for AB80. The first methionine codon 3' from this site is 69 nucleotides away and is the initiating codon of the open reading frame. A TATA sequence occurs 31 nucleotides 5' from the cap site. A second TATA sequence is found 7 nucleotides on the 5' side of the initiating methionine codon and the sequences surrounding this TATA sequence are strikingly similar to those surrounding the first TATA sequence. The mature polypeptide encoded by AB80 differs by 5 amino acids from the polypeptide corresponding to a previously characterized cDNA sequence pAB96. This result is indicative of heterogeneity within the constituent polypeptides of the light-harvesting chlorophyll a/b-protein complex. The sequence Arg-Lys-Ser-Ala-Thr-Thr-Lys-Lys occurs at, or near, the NH/sub 2/-terminus of the mature polypeptide encoded by AB80. This basic peptide is of interest because of its apparent involvement in changes in excitation-energy distribution in chloroplast membranes. Some general similarities, but no extensive sequence homology, is found on comparing the transit sequence for the precursor to the chlorophyll a/b-binding polypeptide with the transit sequences previously determined for the precursors to the small subunit of ribulose-1,5-bisphosphate carboxylase. 40 references, 3 figures.

  19. Discovery of Nuclear-Encoded Genes for the Neurotoxin Saxitoxin in Dinoflagellates

    PubMed Central

    Stüken, Anke; Orr, Russell J. S.; Kellmann, Ralf; Murray, Shauna A.; Neilan, Brett A.; Jakobsen, Kjetill S.

    2011-01-01

    Saxitoxin is a potent neurotoxin that occurs in aquatic environments worldwide. Ingestion of vector species can lead to paralytic shellfish poisoning, a severe human illness that may lead to paralysis and death. In freshwaters, the toxin is produced by prokaryotic cyanobacteria; in marine waters, it is associated with eukaryotic dinoflagellates. However, several studies suggest that saxitoxin is not produced by dinoflagellates themselves, but by co-cultured bacteria. Here, we show that genes required for saxitoxin synthesis are encoded in the nuclear genomes of dinoflagellates. We sequenced >1.2×106 mRNA transcripts from the two saxitoxin-producing dinoflagellate strains Alexandrium fundyense CCMP1719 and A. minutum CCMP113 using high-throughput sequencing technology. In addition, we used in silico transcriptome analyses, RACE, qPCR and conventional PCR coupled with Sanger sequencing. These approaches successfully identified genes required for saxitoxin-synthesis in the two transcriptomes. We focused on sxtA, the unique starting gene of saxitoxin synthesis, and show that the dinoflagellate transcripts of sxtA have the same domain structure as the cyanobacterial sxtA genes. But, in contrast to the bacterial homologs, the dinoflagellate transcripts are monocistronic, have a higher GC content, occur in multiple copies, contain typical dinoflagellate spliced-leader sequences and eukaryotic polyA-tails. Further, we investigated 28 saxitoxin-producing and non-producing dinoflagellate strains from six different genera for the presence of genomic sxtA homologs. Our results show very good agreement between the presence of sxtA and saxitoxin-synthesis, except in three strains of A. tamarense, for which we amplified sxtA, but did not detect the toxin. Our work opens for possibilities to develop molecular tools to detect saxitoxin-producing dinoflagellates in the environment. PMID:21625593

  20. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  1. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    PubMed Central

    Jandova, Jana; Janda, Jaroslav; Sligh, James E

    2012-01-01

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-κB (NF-κB) is a key transcription factor for production of MMPs. An inhibitor of NF-κB activation, Bay11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-κB in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. PMID:22705584

  2. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    SciTech Connect

    Jandova, Jana; Janda, Jaroslav; Sligh, James E

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  3. The relationship between transcript expression levels of nuclear encoded (TFAM, NRF1) and mitochondrial encoded (MT-CO1) genes in single human oocytes during oocyte maturation

    PubMed Central

    Novin, M Ghaffari; Allahveisi, A; Noruzinia, M; Farhadifar, F; Yousefian, E; Fard, A Dehghani; Salimi, M

    2015-01-01

    In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII) stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA), copied in oocytes, is essential for providing adenosine triphosphate (ATP) during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1) and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (TFAM) in various stages of human oocyte maturation. Nine consenting patients, age 21–35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI) procedures. mRNA levels of mitochondrial-related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR). There was no significant relationship between the relative expression levels in germinal vesicle (GV) stage oocytes (p = 0.62). On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI) and MII (p = 0.03 and p = 0.002). A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation. PMID:26929904

  4. Structure and expression of nuclear genes encoding rubisco activase. Final technical report

    SciTech Connect

    Zielinski, R.E.

    1994-06-01

    Rubisco activase (Rca) is a soluble chloroplast protein that catalyzes the activation of rubisco, the enzyme that initiates the photosynthetic carbon reduction cycle, to catalytic competency. Rca in barley consists of three polypeptides, one of 46- and two of 42-kDa, but the quaternary structure of the protein is not known. The authors have isolated and completely sequenced 8.8 kb of barley genomic DNA containing two, tandemly oriented activase genes (RcaA and RcaB) and three different cDNAs encoding the 42- and 46-kDa Rca polypeptide isoforms. Genomic Southern blot assays indicate that these sequences represent the entire Rca gene family in barley. Pre-mRNAs transcribed from the RcaA gene are alternatively spliced to give mRNAs encoding both 46- (RcaA1) and 42-kDa (RcaA2) Rca isoforms. The RcaB gene encodes a single polypeptide of 42 kDa. Primer extension and northern blot assays indicate that RcaB mRNA is expressed at a level that is 10- to 100-fold lower than RcaA mRNA. Analyses at the mRNA and protein level showed that Rca gene expression is coordinated by that of the rubisco subunits during barley leaf development.

  5. Identification of Nuclear Genes Encoding Chloroplast-Localized Proteins Required for Embryo Development in Arabidopsis1[W][OA

    PubMed Central

    Bryant, Nicole; Lloyd, Johnny; Sweeney, Colleen; Myouga, Fumiyoshi; Meinke, David

    2011-01-01

    We describe here the diversity of chloroplast proteins required for embryo development in Arabidopsis (Arabidopsis thaliana). Interfering with certain chloroplast functions has long been known to result in embryo lethality. What has not been reported before is a comprehensive screen for embryo-defective (emb) mutants altered in chloroplast proteins. From a collection of transposon and T-DNA insertion lines at the RIKEN chloroplast function database (http://rarge.psc.riken.jp/chloroplast/) that initially appeared to lack homozygotes and segregate for defective seeds, we identified 23 additional examples of EMB genes that likely encode chloroplast-localized proteins. Fourteen gene identities were confirmed with allelism tests involving duplicate mutant alleles. We then queried journal publications and the SeedGenes database (www.seedgenes.org) to establish a comprehensive dataset of 381 nuclear genes encoding chloroplast proteins of Arabidopsis associated with embryo-defective (119 genes), plant pigment (121 genes), gametophyte (three genes), and alternate (138 genes) phenotypes. Loci were ranked based on the level of certainty that the gene responsible for the phenotype had been identified and the protein product localized to chloroplasts. Embryo development is frequently arrested when amino acid, vitamin, or nucleotide biosynthesis is disrupted but proceeds when photosynthesis is compromised and when levels of chlorophyll, carotenoids, or terpenoids are reduced. Chloroplast translation is also required for embryo development, with genes encoding chloroplast ribosomal and pentatricopeptide repeat proteins well represented among EMB datasets. The chloroplast accD locus, which is necessary for fatty acid biosynthesis, is essential in Arabidopsis but not in Brassica napus or maize (Zea mays), where duplicated nuclear genes compensate for its absence or loss of function. PMID:21139083

  6. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    PubMed

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle. PMID:25973601

  7. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    PubMed Central

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  8. The BAT1 gene in the MHC encodes an evolutionarily conserved putative nuclear RNA helicase of the DEAD family

    SciTech Connect

    Peelman, L.J.; Van Zeveren, A.; Coppeiters, W.

    1995-03-20

    The BAT1 gene has previously been identified about 30 kb upstream from the tumor necrosis factor (TNF) locus and close to a NF{sub kb}-related gene of the nuclear factor family in the major histocompatibility complex (MHC) of human, mouse, and pig. We now show that the BAT1 translation product is the homolog of the rat p47 nuclear protein, the WM6 Drosophila gene product, and probably also Ce08102 of Caenorhabditis elegans, all members of the DEAD protein family of ATP-dependent RNA helicases. This family has more than 40 members, including the eukaryotic translation initiation factor-4A (eIF-4A), the human nuclear protein p68, and the Drosophila oocyte polar granule component vasa. BAT1 spans about 10 kb, is split into 10 exons of varying length, and encodes a protein of 428 amino acids ({approximately}48 kDa). Human and pig BAT1 cDNAs display 95.6% identity in the coding region and 80% identity in the 5{prime} and 3{prime} noncoding regions. Several repeat sequences of different types were identified in introns of the porcine BAT1 gene. Three different mRNAs, 4.1,1.7, and 0.9 kb, respectively, were detected in all tissues analyzed upon hybridization with porcine BAT1 cDNA. Transfection and expression of human BAT1 cDNA after tagging with a heterologous antibody recognition epitope revealed a nuclear localization of the hybrid protein. An MspI RFLP was detected in an SLA class I typed family, confirming the localization of the BAT1 gene in the porcine MHC. BAT1 thus encodes a putative nuclear ATP-dependent RNA helicase and is likely to have an indispensable function. 35 refs., 6 figs., 1 tab.

  9. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP) Which Is Overexpressed in Highly Proliferating Tissues

    PubMed Central

    Szafron, Lukasz Michal; Balcerak, Anna; Grzybowska, Ewa Anna; Pienkowska-Grela, Barbara; Felisiak-Golabek, Anna; Podgorska, Agnieszka; Kulesza, Magdalena; Nowak, Natalia; Pomorski, Pawel; Wysocki, Juliusz; Rubel, Tymon; Dansonka-Mieszkowska, Agnieszka; Konopka, Bozena; Lukasik, Martyna; Kupryjanczyk, Jolanta

    2015-01-01

    CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene. PMID:25978564

  10. Effects of TCDD on the Expression of Nuclear Encoded Mitochondrial Genes

    PubMed Central

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2014-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 hrs) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change|>1.5 and P-value <0.1). Of these, 8 exhibited a dose response (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 hrs. Dose responsive genes encoded proteins associated with electron transport chain (ETC) complex I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of the 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity. PMID:20399798

  11. MitoDrome: a database of Drosophila melanogaster nuclear genes encoding proteins targeted to the mitochondrion

    PubMed Central

    Sardiello, Marco; Licciulli, Flavio; Catalano, Domenico; Attimonelli, Marcella; Caggese, Corrado

    2003-01-01

    Mitochondria are organelles present in the cytoplasm of most eukaryotic cells; although they have their own DNA, the majority of the proteins necessary for a functional mitochondrion are coded by the nuclear DNA and only after transcription and translation they are imported in the mitochondrion as proteins. The primary role of the mitochondrion is electron transport and oxidative phosphorylation. Although it has been studied for a long time, the interest of researchers in mitochondria is still alive thanks to the discovery of mitochondrial role in apoptosis, aging and cancer. Aim of the MitoDrome database is to annotate the Drosophila melanogaster nuclear genes coding for mitochondrial proteins in order to contribute to the functional characterization of nuclear genes coding for mitochondrial proteins and to knowledge of gene diseases related to mitochondrial dysfunctions. Indeed D. melanogaster is one of the most studied organisms and a model for the Human genome. Data are derived from the comparison of Human mitochondrial proteins versus the Drosophila genome, ESTs and cDNA sequence data available in the FlyBase database. Links from the MitoDrome entries to the related homologous entries available in MitoNuC will be soon imple-mented. The MitoDrome database is available at http://bighost.area.ba.cnr.it/BIG/MitoDrome. Data are organised in a flat-file format and can be retrieved using the SRS system. PMID:12520013

  12. Reconstruction of Family-Level Phylogenetic Relationships within Demospongiae (Porifera) Using Nuclear Encoded Housekeeping Genes

    PubMed Central

    Hill, Malcolm S.; Hill, April L.; Lopez, Jose; Peterson, Kevin J.; Pomponi, Shirley; Diaz, Maria C.; Thacker, Robert W.; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C.; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E.; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A.; di Stefano, Michael; Tarver, James E.; Collins, Allen G.

    2013-01-01

    Background Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. Methodology/Principal Findings We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosap, Myxospongiaep, Spongillidap, Haploscleromorphap (the marine haplosclerids) and Democlaviap. We found conflicting results concerning the relationships of Keratosap and Myxospongiaep to the remaining demosponges, but our results strongly supported a clade of Haploscleromorphap+Spongillidap+Democlaviap. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillidap) are sister to Haploscleromorphap rather than part of Democlaviap. Within Keratosap, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiaep, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlaviap, Tetractinellidap, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlaviap. Within Tetractinellidap, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. Conclusions/Significance These results, using an

  13. (Structure and expression of nuclear genes encoding rubisco activase): Progress report

    SciTech Connect

    Not Available

    1989-01-01

    Our first year's activities include: (1) completing a survey of the basic characteristics of activase gene expression in barley; and (2) isolating and structurally characterizing cDNA and genomic DNA sequences encoding activase from barley. Our goal was to determine whether activase mRNA and protein accumulation are coordinated with those of the rubisco subunits. We utilized the first leaves of barley as an experimental system for these studies because they can be used in two ways to study the expression of leaf genes: by following the naturally occurring differentiation of leaf cells, which occurs acropetally along the barley leaf; and by following the photomorphogenesis of etiolated barley seedlings. In the acropetal gradient of leaf cell differentiation, activase mRNA and mRNA and polypeptide expression is tightly coordinated with rubisco subunit mRNA and polypeptide expression. Although we have not measured their precise stoichiometry at each stage of leaf differentiation, activase protein is expressed at the level of about one polypeptide per rubisco holoenzyme in mature regions of the leaf. Coordination of the expression of activase mRNAs and polypeptides indicates that in the barley leaf gradient, activase gene expression is largely controlled at the level of transcription. However, translational controls may play a role in regulating activase expression on a short term basis.

  14. Nuclear factor-κB regulates the expression of multiple genes encoding liver transport proteins.

    PubMed

    Balasubramaniyan, Natarajan; Ananthanarayanan, Meenakshisundaram; Suchy, Frederick J

    2016-04-15

    In this study we identified the mechanisms underlying the inhibitory effects of NF-κB on the expression of genes encoding multiple liver transport proteins. Well-conserved NF-κB binding sites were found in the promoters of farnesoid X receptor (FXR)-target genes. An electromobility shift assay (EMSA) demonstrated the specific interaction between the NF-κB p65 protein and a (32)P-labeled BSEP NF-κB response element (NF-κBE). Chromatin immunoprecipitation (ChIP) analysis confirmed binding of NF-κB p65 to the BSEP locus but not the FXRE in vitro. NF-κB p65 overexpression in Huh-7 cells markedly repressed FXR/RXR transactivation of the BSEP, ABCG5/G8, MRP2, and FXR promoters, which was totally reversed by expression of the IκBα super-repressor. NF-κB interacted directly with FXR on coimmunoprecipitation, suggesting another level for the inhibitory effects of NF-κB on FXR-target genes. In vivo ChIP analysis with liver nuclei obtained from mice after 3 days of common bile duct ligation (BDL) or 6 h post-lipopolysaccharide (LPS) injection showed a markedly increased recruitment of NF-κB p65 to the Bsep promoter compared with controls. There was also increased recruitment of the corepressor silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) and histone deacetylase (HDAC)3 and HDAC2 to the NF-κB sites. We also found that NF-κB p65 was recruited to NF-κB binding sites in the promoters of organic solute transporter, OSTα and OSTβ, and unexpectedly activated rather than repressed gene expression. In mouse liver after BDL NF-κB recruitment to Ostα and Ostβ promoters was associated with increased binding of the potent coactivator cAMP response element binding protein (CREB)-binding protein (CBP)/p300 to the NF-κBE and depletion of CBP/p300 at the FXR element. Overall, these studies demonstrate a novel role for NF-κB in adaptation to obstructive and LPS-induced cholestasis acting through recruitment to specific NF-κB binding sites in

  15. Organization and alternate splice products of the gene encoding nuclear inhibitor of protein phosphatase-1 (NIPP-1).

    PubMed

    Van Eynde, A; Pérez-Callejón, E; Schoenmakers, E; Jacquemin, M; Stalmans, W; Bollen, M

    1999-04-01

    Nuclear inhibitor of protein phosphatase-1 (NIPP-1) is one of two major regulatory subunits of protein phosphatase-1 in mammalian nuclei. We report here the cloning and structural characterization of the human NIPP-1 genes, designated PPP1R8P and PPP1R8 in human gene nomenclature. PPP1R8P (1.2 kb) is a processed pseudogene and was localized by in situ hybridization to chromosome 1p33-32. PPP1R8 is an authentic NIPP-1 gene and was localized to chromosome 1p35. PPP1R8 (25.2 kb) is composed of seven exons and encodes four different transcripts, as determined from cDNA library screening, reverse transcriptase-PCR (RT-PCR) and/or EST (expressed sequence tag) database search analysis. NIPP-1alpha mRNA represents the major transcript in human tissues and various cell lines, and encodes a polypeptide of 351 residues that only differs from the previously cloned calf thymus NIPP-1 by a single residue. The other transcripts, termed NIPP-1beta, gamma and delta, are generated by alternative 5'-splice site usage, by exon skipping and/or by alternative polyadenylation. The NIPP-1beta/delta and NIPP-1gamma mRNAs are expected to encode fragments of NIPP-1alpha that differ from the latter by the absence of the first 142 and 224 residues, respectively. NIPP-1gamma corresponds to 'activator of RNA decay-1' (Ard-1) which, unlike NIPP-1alpha, displays in vitro and endoribonuclease activity and lacks an RVXF consensus motif for interaction with protein phosphatase-1. While the NIPP-1alpha/beta/delta-transcripts were found to be present in various human tissues, the NIPP-1gamma transcript could only be detected in human transformed B-lymphocytes. PMID:10103062

  16. (Nuclear genes from nicotiana encoding the small subunit of ribulose-1,5-bisphosphate carboxylase). Progress report

    SciTech Connect

    Cashmore, A.R.

    1985-01-01

    Two pea nuclear genes encoding ribulose-1,5-bisphosphate carboxylase (rbcS) were isolated and completely sequenced. These sequence studies include approximately 1 kb of 5' noncoding region and several hundred nucleotides of 3' noncoding sequences. The two genes are tightly linked being separated by 10 kb of DNA and they are oriented with their 3' ends towards one another. The two genes (ss3.6 and ss8.0) correspond to two of five EcoRI fragments of pea DNA that hybridize to a rbcS hybridization probe. The two genes ss3.6 and ss8.0 are quite divergent at their 5' and their 3' ends and in the first of the two intervening sequences. In direct contrast the second of the two intervening sequences is total conserved between the two genes. This conservation of sequence identity could result directly from evolutionary forces selecting against any sequence change. Such selection would presumably reflect a very sequence-dependent function for these introns. A role in splicing is one possibility and a transcriptional regulatory element is another possibility. 9 refs.

  17. msg1, a novel melanocyte-specific gene, encodes a nuclear protein and is associated with pigmentation.

    PubMed Central

    Shioda, T; Fenner, M H; Isselbacher, K J

    1996-01-01

    Messenger RNA transcripts of the highly pigmented murine melanoma B16-F1 cells were compared with those from their weakly pigmented derivative B16-F10 cells by differential display. A novel gene called msg1 (melanocyte-specific gene) was found to be expressed at high levels in B16-F1 cells but at low levels in B16-F10 cells. Expression of msg1 was undetectable in the amelanotic K1735 murine melanoma cells. The pigmented murine melanocyte cell line melan-a expressed msg1, as did pigmented primary cultures of murine and human melanocytes; however, seven amelanotic or very weakly pigmented human melanoma cell lines were negative. Transformation of murine melanocytes by transfection with v-Ha-ras or Ela was accompanied by depigmentation and led to complete loss of msg1 expression. The normal tissue distribution of msg1 mRNA transcripts in adult mice was confined to melanocytes and testis. Murine msg1 and human MSG1 genes encode a predicted protein of 27 kDa with 75% overall amino acid identity and 96% identity within the C-terminal acidic domain of 54 amino acids. This C-terminal domain was conserved with 76% amino acid identity in another protein product of a novel human gene, MRG1 (msg1-related gene), isolated from normal human melanocyte cDNA by 5'-rapid amplification of cDNA ends based on the homology to msg1. The msg1 protein was localized to the melanocyte nucleus by immunofluorescence cytochemistry. We conclude that msg1 encodes a nuclear protein, is melanocyte-specific, and appears to be lost in depigmented melanoma cells. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 Fig. 6 PMID:8901575

  18. STP1, a gene involved in pre-tRNA processing, encodes a nuclear protein containing zinc finger motifs.

    PubMed Central

    Wang, S S; Stanford, D R; Silvers, C D; Hopper, A K

    1992-01-01

    STP1 is an unessential yeast gene involved in the removal of intervening sequences from some, but not all, families of intervening sequence-containing pre-tRNAs. Previously, we proposed that STP1 might encode a product that generates pre-tRNA conformations efficiently recognized by tRNA-splicing endonuclease. To test the predictions of this model, we have undertaken a molecular analysis of the STP1 gene and its products. The STP1 locus is located on chromosome IV close to at least two other genes involved in RNA splicing: PRP3 and SPP41. The STP1 open reading frame (ORF) could encode a peptide of 64,827 Da; however, inspection of putative transcriptional and translational regulatory signals and mapping of the 5' ends of mRNA provide evidence that translation of the STP1 ORF usually initiates at a second AUG to generate a protein of 58,081 Da. The STP1 ORF contains three putative zinc fingers. The first of these closely resembles both the DNA transcription factor consensus and the Xenopus laevis p43 RNA-binding protein consensus. The third motif more closely resembles the fingers found in spliceosomal proteins. Employing antisera to the endogenous STP1 protein and to STP1-LacZ fusion proteins, we show that the STP1 protein is localized to nuclei. The presence of zinc finger motifs and the nuclear location of the STP1 protein support the model that this gene product is involved directly in pre-tRNA splicing. Images PMID:1588961

  19. An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs.

    PubMed Central

    Birnbaum, M J; Clem, R J; Miller, L K

    1994-01-01

    Two different baculovirus genes are known to be able to block apoptosis triggered upon infection of Spodoptera frugiperda cells with p35 mutants of the insect baculovirus Autographa californica nuclear polyhedrosis virus (AcMNPV):p35 (P35-encoding gene) of AcMNPV (R. J. Clem, M. Fechheimer, and L. K. Miller, Science 254:1388-1390, 1991) and iap (inhibitor of apoptosis gene) of Cydia pomonella granulosis virus (CpGV) (N. E. Crook, R. J. Clem, and L. K. Miller, J. Virol. 67:2168-2174, 1993). Using a genetic complementation assay to identify additional genes which inhibit apoptosis during infection with a p35 mutant, we have isolated a gene from Orgyia pseudotsugata NPV (OpMNPV) that was able to functionally substitute for AcMNPV p35. The nucleotide sequence of this gene, Op-iap, predicted a 30-kDa polypeptide product with approximately 58% amino acid sequence identity to the product of CpGV iap, Cp-IAP. Like Cp-IAP, the predicted product of Op-iap has a carboxy-terminal C3HC4 zinc finger-like motif. In addition, a pair of additional cysteine/histidine motifs were found in the N-terminal regions of both polypeptide sequences. Recombinant p35 mutant viruses carrying either Op-iap or Cp-iap appeared to have a normal phenotype in S. frugiperda cells. Thus, Cp-IAP and Op-IAP appear to be functionally analogous to P35 but are likely to block apoptosis by a different mechanism which may involve direct interaction with DNA. Images PMID:8139034

  20. An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs.

    PubMed

    Birnbaum, M J; Clem, R J; Miller, L K

    1994-04-01

    Two different baculovirus genes are known to be able to block apoptosis triggered upon infection of Spodoptera frugiperda cells with p35 mutants of the insect baculovirus Autographa californica nuclear polyhedrosis virus (AcMNPV):p35 (P35-encoding gene) of AcMNPV (R. J. Clem, M. Fechheimer, and L. K. Miller, Science 254:1388-1390, 1991) and iap (inhibitor of apoptosis gene) of Cydia pomonella granulosis virus (CpGV) (N. E. Crook, R. J. Clem, and L. K. Miller, J. Virol. 67:2168-2174, 1993). Using a genetic complementation assay to identify additional genes which inhibit apoptosis during infection with a p35 mutant, we have isolated a gene from Orgyia pseudotsugata NPV (OpMNPV) that was able to functionally substitute for AcMNPV p35. The nucleotide sequence of this gene, Op-iap, predicted a 30-kDa polypeptide product with approximately 58% amino acid sequence identity to the product of CpGV iap, Cp-IAP. Like Cp-IAP, the predicted product of Op-iap has a carboxy-terminal C3HC4 zinc finger-like motif. In addition, a pair of additional cysteine/histidine motifs were found in the N-terminal regions of both polypeptide sequences. Recombinant p35 mutant viruses carrying either Op-iap or Cp-iap appeared to have a normal phenotype in S. frugiperda cells. Thus, Cp-IAP and Op-IAP appear to be functionally analogous to P35 but are likely to block apoptosis by a different mechanism which may involve direct interaction with DNA. PMID:8139034

  1. The SPOROCYTELESS gene of Arabidopsis is required for initiation of sporogenesis and encodes a novel nuclear protein

    PubMed Central

    Yang, Wei-Cai; Ye, De; Xu, Jian; Sundaresan, Venkatesan

    1999-01-01

    The formation of haploid spores marks the initiation of the gametophytic phase of the life cycle of all vascular plants ranging from ferns to angiosperms. In angiosperms, this process is initiated by the differentiation of a subset of floral cells into sporocytes, which then undergo meiotic divisions to form microspores and megaspores. Currently, there is little information available regarding the genes and proteins that regulate this key step in plant reproduction. We report here the identification of a mutation, SPOROCYTELESS (SPL), which blocks sporocyte formation in Arabidopsis thaliana. Analysis of the SPL mutation suggests that development of the anther walls and the tapetum and microsporocyte formation are tightly coupled, and that nucellar development may be dependent on megasporocyte formation. Molecular cloning of the SPL gene showed that it encodes a novel nuclear protein related to MADS box transcription factors and that it is expressed during microsporogenesis and megasporogenesis. These data suggest that the SPL gene product is a transcriptional regulator of sporocyte development in Arabidopsis. PMID:10465788

  2. AtWRKY40 and AtWRKY63 Modulate the Expression of Stress-Responsive Nuclear Genes Encoding Mitochondrial and Chloroplast Proteins1[W][OA

    PubMed Central

    Van Aken, Olivier; Zhang, Botao; Law, Simon; Narsai, Reena; Whelan, James

    2013-01-01

    The expression of a variety of nuclear genes encoding mitochondrial proteins is known to adapt to changes in environmental conditions and retrograde signaling. The presence of putative WRKY transcription factor binding sites (W-boxes) in the promoters of many of these genes prompted a screen of 72 annotated WRKY factors in the Arabidopsis (Arabidopsis thaliana) genome for regulators of transcripts encoding mitochondrial proteins. A large-scale yeast one-hybrid screen was used to identify WRKY factors that bind the promoters of marker genes (Alternative oxidase1a, NADH dehydrogenaseB2, and the AAA ATPase Ubiquinol-cytochrome c reductase synthesis1), and interactions were confirmed using electromobility shift assays. Transgenic overexpression and knockout lines for 12 binding WRKY factors were generated and tested for altered expression of the marker genes during normal and stress conditions. AtWRKY40 was found to be a repressor of antimycin A-induced mitochondrial retrograde expression and high-light-induced signaling, while AtWRKY63 was identified as an activator. Genome-wide expression analysis following high-light stress in transgenic lines with perturbed AtWRKY40 and AtWRKY63 function revealed that these factors are involved in regulating stress-responsive genes encoding mitochondrial and chloroplast proteins but have little effect on more constitutively expressed genes encoding organellar proteins. Furthermore, it appears that AtWRKY40 and AtWRKY63 are particularly involved in regulating the expression of genes responding commonly to both mitochondrial and chloroplast dysfunction but not of genes responding to either mitochondrial or chloroplast perturbation. In conclusion, this study establishes the role of WRKY transcription factors in the coordination of stress-responsive genes encoding mitochondrial and chloroplast proteins. PMID:23509177

  3. The sal3(+) gene encodes an importin-beta implicated in the nuclear import of Cdc25 in Schizosaccharomyces pombe.

    PubMed Central

    Chua, Gordon; Lingner, Carol; Frazer, Corey; Young, Paul G

    2002-01-01

    In Schizosaccharomyces pombe, the nuclear accumulation of Cdc25 peaks in G2 and is necessary for the proper timing of mitotic entry. Here, we identify the sal3(+) gene product as an importin-beta homolog that participates in the nuclear import of Cdc25. Loss of sal3(+) results in a cell cycle delay, failure to undergo G1 arrest under nitrogen-starvation conditions, and mislocalization of Cdc25 to the cytosol. Fusion of an exogenous classical nuclear localization sequence (cNLS) to Cdc25 restores its nuclear accumulation in a sal3 disruptant and suppresses the sal3 mutant phenotypes. In addition, we show that enhanced nuclear localization of Cdc25 at endogenous levels of expression advances the onset of mitosis. These results demonstrate that the nuclear translocation of Cdc25 is important for the timing of mitotic entry and that Sal3 plays an important role in this process. PMID:12399381

  4. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or {gamma}-rays

    SciTech Connect

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-05-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, and cytoskeletal elements. The experiments reported herein were designed to examine the effects of either JANUS neutron or {gamma}-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or {gamma}-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and (to a lesser extent) Rb following {gamma}-ray but not following neutron exposure. Expression of p53 and c-myc genes was unaffected by radiation exposure. Radiations at different doses and dose rates were compared for each of the genes studied.

  5. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune

    PubMed Central

    Gube, Matthias; Ring, Christiane; Hanisch, Lisa; Linde, Jörg; Krause, Katrin; Kothe, Erika

    2015-01-01

    The white-rot fungus Schizophyllum commune (Agaricomycetes) was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing. PMID:26284622

  6. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    PubMed

    Brunsch, Melanie; Schubert, Daniela; Gube, Matthias; Ring, Christiane; Hanisch, Lisa; Linde, Jörg; Krause, Katrin; Kothe, Erika

    2015-01-01

    The white-rot fungus Schizophyllum commune (Agaricomycetes) was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing. PMID:26284622

  7. Infectious Laryngotracheitis Herpesvirus Expresses a Related Pair of Unique Nuclear Proteins Which Are Encoded by Split Genes Located at the Right End of the UL Genome Region

    PubMed Central

    Ziemann, Katharina; Mettenleiter, Thomas C.; Fuchs, Walter

    1998-01-01

    Avian infectious laryngotracheitis virus (ILTV) possesses an alphaherpesvirus type D DNA genome of ca. 155 kbp. Completion of our previous sequence analyses (W. Fuchs and T. C. Mettenleiter, J. Gen. Virol. 77:2221–2229, 1996) of the right end of the unique long (UL) genome region revealed the presence of two adjacent, presumably ILTV-specific genes, which were named UL0 and UL[−1] because of their location upstream of the conserved UL1 (glycoprotein L) gene. Transcriptional analyses showed that both genes are abundantly expressed during the late phase of the viral replication cycle and that both mRNAs are spliced by the removal of short introns close to their 5′ ends. Furthermore, the deduced gene products exhibit a moderate but significant homology of 28% to each other. The newly identified ILTV genes encode proteins of 63 kDa (UL0) and 73 kDa (UL[−1]), which both are predominantly localized in the nuclei of virus infected chicken cells. In summary, our results indicate that duplication of a spliced ILTV-specific gene encoding a nuclear protein has occurred during evolution of ILTV. PMID:9658136

  8. A candidate gene for developmental dyslexia encodes a nuclear tetratricopeptide repeat domain protein dynamically regulated in brain.

    PubMed

    Taipale, Mikko; Kaminen, Nina; Nopola-Hemmi, Jaana; Haltia, Tuomas; Myllyluoma, Birgitta; Lyytinen, Heikki; Muller, Kurt; Kaaranen, Minna; Lindsberg, Perttu J; Hannula-Jouppi, Katariina; Kere, Juha

    2003-09-30

    Approximately 3-10% of people have specific difficulties in reading, despite adequate intelligence, education, and social environment. We report here the characterization of a gene, DYX1C1 near the DYX1 locus in chromosome 15q21, that is disrupted by a translocation t(2;15)(q11;q21) segregating coincidentally with dyslexia. Two sequence changes in DYX1C1, one involving the translation initiation sequence and an Elk-1 transcription factor binding site (-3G --> A) and a codon (1249G --> T), introducing a premature stop codon and truncating the predicted protein by 4 aa, associate alone and in combination with dyslexia. DYX1C1 encodes a 420-aa protein with three tetratricopeptide repeat (TPR) domains, thought to be protein interaction modules, but otherwise with no homology to known proteins. The mouse Dyx1c1 protein is 78% identical to the human protein, and the nonhuman primates differ at 0.5-1.4% of residues. DYX1C1 is expressed in several tissues, including the brain, and the protein resides in the nucleus. In human brain, DYX1C1 protein localizes to a fraction of cortical neurons and white matter glial cells. We conclude that DYX1C1 should be regarded as a candidate gene for developmental dyslexia. Detailed study of its function may open a path to understanding a complex process of development and maturation of the human brain. PMID:12954984

  9. The nuclear-encoded sigma factor SIG4 directly activates transcription of chloroplast psbA and ycf17 genes in the unicellular red alga Cyanidioschyzon merolae.

    PubMed

    Fujii, Gaku; Imamura, Sousuke; Era, Atsuko; Miyagishima, Shin-ya; Hanaoka, Mitsumasa; Tanaka, Kan

    2015-05-01

    The plant organelle chloroplast originated from the endosymbiosis of a cyanobacterial-like photosynthetic bacterium, and still retains its own genome derived from this ancestor. We have been focusing on a unicellular red alga, Cyanidioschyzon merolae, as a model photosynthetic eukaryote. In this study, we analyzed the transcriptional specificity of SIG4, which is one of four nuclear-encoded chloroplast RNA polymerase sigma factors in this alga. Accumulation of the SIG4 protein was observed in response to nitrogen depletion or high light conditions. By comparing the chloroplast transcriptomes under nitrogen depletion and SIG4-overexpressing conditions, we identified several candidate genes as SIG4 targets. Together with the results of chromatin immunoprecipitation analysis, the promoters of the psbA (encoding the D1 protein of the photosystem II reaction center) and ycf17 (encoding a protein of the early light-inducible protein family) genes were shown to be direct activation targets. The phycobilisome (PBS) CpcB protein was decreased by SIG4 overexpression, which suggests the negative involvement of SIG4 in PBS accumulation. PMID:25883111

  10. The human CCGl gene, essential for progression of the G sub 1 phase, encodes a 210-kilodalton nuclear DNA-binding protein

    SciTech Connect

    Sekiguchi, Takeshi; Nohiro, Yukiko; Hisamoto, Naoki; Nishimoto, Takeharu ); Nakamura, Yasuhara )

    1991-06-01

    The human CCGl gene complements tsBN462, a temperature-sensitive G{sup 1} mutant of the BHK21 cell line. The previously cloned cDNA turned out to be a truncated form of the actual CCGl cDNA. The newly cloned CCGl cDNA was 6.0 kb and encoded a protein with a molecular mass of 210 kDa. Using an antibody to a predicted peptide from the CCGl protein, a protein with a molecular mass of over 200 kDa was identified in human, monkey, and hamster cell lines. In the newly defined C-terminal region, an acidic domain was found. It contained four consensus target sequences for casein kinase 2 and was phosphorylated by this enzyme in vitro. However, this C-terminal region was not required to complement tsBN462 mutation since the region encoding the C-terminal part was frequently missing in complemented clones derived by DNA-mediated gene transfer, CCGl contains a sequence similar to the putative DNA-binding domain of HMGl in addition to the previously detected amino acid sequences common in nuclear proteins, such as a proline cluster and a nuclear translocation signal. Consistent with these predictions, CCGl was present in nuclei, possessed DNA-binding activity, and was eluted with similar concentrations of salt, 0.3 to 0.4 M NaCl either from isolated nuclei or from a DNA-cellulose column.

  11. Mutation in TOR1AIP1 encoding LAP1B in a form of muscular dystrophy: a novel gene related to nuclear envelopathies.

    PubMed

    Kayman-Kurekci, Gulsum; Talim, Beril; Korkusuz, Petek; Sayar, Nilufer; Sarioglu, Turkan; Oncel, Ibrahim; Sharafi, Parisa; Gundesli, Hulya; Balci-Hayta, Burcu; Purali, Nuhan; Serdaroglu-Oflazer, Piraye; Topaloglu, Haluk; Dincer, Pervin

    2014-07-01

    We performed genome-wide homozygosity mapping and mapped a novel myopathic phenotype to chromosomal region 1q25 in a consanguineous family with three affected individuals manifesting proximal and distal weakness and atrophy, rigid spine and contractures of the proximal and distal interphalangeal hand joints. Additionally, cardiomyopathy and respiratory involvement were noted. DNA sequencing of torsinA-interacting protein 1 (TOR1AIP1) gene encoding lamina-associated polypeptide 1B (LAP1B), showed a homozygous c.186delG mutation that causes a frameshift resulting in a premature stop codon (p.E62fsTer25). We observed that expression of LAP1B was absent in the patient skeletal muscle fibres. Ultrastructural examination showed intact sarcomeric organization but alterations of the nuclear envelope including nuclear fragmentation, chromatin bleb formation and naked chromatin. LAP1B is a type-2 integral membrane protein localized in the inner nuclear membrane that binds to both A- and B-type lamins, and is involved in the regulation of torsinA ATPase. Interestingly, luminal domain-like LAP1 (LULL1)-an endoplasmic reticulum-localized partner of torsinA-was overexpressed in the patient's muscle in the absence of LAP1B. Therefore, the findings suggest that LAP1 and LULL1 might have a compensatory effect on each other. This study expands the spectrum of genes associated with nuclear envelopathies and highlights the critical function for LAP1B in striated muscle. PMID:24856141

  12. A nuclear gene with many introns encoding ammonium-inducible chloroplastic NADP-specific glutamate dehydrogenase(s) in Chlorella sorokiniana.

    PubMed

    Cock, J M; Kim, K D; Miller, P W; Hutson, R G; Schmidt, R R

    1991-11-01

    Chlorella sorokiniana possesses ammonium-inducible, chloroplastic, NADP-specific glutamate dehydrogenase (NADP-GDH) homo- or heterohexamers composed of alpha- and/or beta-subunits which were previously shown to derive from precursor protein(s) of identical size. From the present studies, data are consistent with these two subunits being encoded by a single nuclear gene. The NADP-GDH gene is greater than 7 kb in length due to the presence of at least 21 introns, an unusually large number for a eukaryotic microorganism. The exons, identified by comparison with sequences of NADP-GDH cDNA clones, include a region which is highly conserved among NADP-GDH genes. This region in the C. sorokiniana gene is 77% and 73% identical to the corresponding regions in the Escherichia coli and Neurospora crassa NADP-GDH genes, respectively. Seventeen independent NADP-GDH cDNA clones were analyzed by restriction mapping and partial sequencing, and no differences were detected among them. The longest cDNA was fused in frame with lacZ in a Bluescript vector and was expressed in E. coli as NADP-GDH antigen. During a 240 min induction period, under conditions in which both types of subunits were synthesized, only a single (2.2 kb) NADP-GDH mRNA band was detected on northern blots using cDNA probes from the highly conserved and 3'-untranslated regions. Collectively, these results are consistent with a single mRNA encoding a precursor-protein which is differentially processed to yield either an alpha- or beta-subunit. PMID:1718478

  13. Steep, coincident, and concordant clines in mitochondrial and nuclear-encoded genes in a hybrid zone between subspecies of Atlantic killifish, Fundulus heteroclitus.

    PubMed

    McKenzie, Jessica L; Dhillon, Rashpal S; Schulte, Patricia M

    2016-08-01

    Steep genetic clines resulting from recent secondary contact between previously isolated taxa can either gradually erode over time or be stabilized by factors such as ecological selection or selection against hybrids. We used patterns of variation in 30 nuclear and two mitochondrial SNPs to examine the factors that could be involved in stabilizing clines across a hybrid zone between two subspecies of the Atlantic killifish, Fundulus heteroclitus. Increased heterozygote deficit and cytonuclear disequilibrium in populations near the center of the mtDNA cline suggest that some form of reproductive isolation such as assortative mating or selection against hybrids may be acting in this hybrid zone. However, only a small number of loci exhibited these signatures, suggesting locus-specific, rather than genomewide, factors. Fourteen of the 32 loci surveyed had cline widths inconsistent with neutral expectations, with two SNPs in the mitochondrial genome exhibiting the steepest clines. Seven of the 12 putatively non-neutral nuclear clines were for SNPs in genes related to oxidative metabolism. Among these putatively non-neutral nuclear clines, SNPs in two nuclear-encoded mitochondrial genes (SLC25A3 and HDDC2), as well as SNPs in the myoglobin, 40S ribosomal protein S17, and actin-binding LIM protein genes, had clines that were coincident and concordant with the mitochondrial clines. When hybrid index was calculated using this subset of loci, the frequency distribution of hybrid indices for a population located at the mtDNA cline center was non-unimodal, suggesting selection against advanced-generation hybrids, possibly due to effects on processes involved in oxidative metabolism. PMID:27547353

  14. One nuclear gene controls the removal of transient pre-sequences from two yeast proteins: one encoded by the nuclear the other by the mitochondrial genome.

    PubMed Central

    Pratje, E; Guiard, B

    1986-01-01

    The proteolytic processing of the mitochondrially encoded subunit II of cytochrome oxidase is prevented by the yeast mutation ts2858. We report that the mutant is, in addition, temperature sensitive for the processing of cytochrome b2, a protein encoded by nuclear DNA. Thus the same mutation affects the removal of pre-sequences from a mitochondrially encoded inner membrane protein and from an imported soluble protein located in the intermembrane space. The mutation blocks the second processing step of cytochrome b2. The cytochrome b2 intermediate accumulates in the mutant at 36 degrees C and assumes its enzyme activity. At 23 degrees C the conversion to the mature protein is considerably slower than in wild-type cells. The similarity of the cleavage sites Asn-Asp and Asn-Glu of the precursors for cytochrome oxidase subunit II and cytochrome b2, respectively, suggests a sequence-specific recognition by one protease or a factor activating a protease. On the other hand maturation of cytochrome c peroxidase, another enzyme of the intermembrane space, is not affected by the pet ts2858 mutation. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3015596

  15. The mutated human gene encoding hepatocyte nuclear factor 1β inhibits kidney formation in developing Xenopus embryos

    PubMed Central

    Wild, Wiltrud; Pogge von Strandmann, Elke; Nastos, Aristotelis; Senkel, Sabine; Lingott-Frieg, Anja; Bulman, Michael; Bingham, Coralie; Ellard, Sian; Hattersley, Andrew T.; Ryffel, Gerhart U.

    2000-01-01

    The transcription factor hepatocyte nuclear factor 1β (HNF1β) is a tissue-specific regulator that also plays an essential role in early development of vertebrates. In humans, four heterozygous mutations in the HNF1β gene have been identified that lead to early onset of diabetes and severe primary renal defects. The degree and type of renal defects seem to depend on the specific mutation. We show that the frameshift mutant P328L329fsdelCCTCT associated with nephron agenesis retains its DNA-binding properties and acts as a gain-of-function mutation with increased transactivation potential in transfection experiments. Expression of this mutated factor in the Xenopus embryo leads to defective development and agenesis of the pronephros, the first kidney form of amphibians. Very similar defects are generated by overexpressing in Xenopus the wild-type HNF1β, which is consistent with the gain-of-function property of the mutant. In contrast, introduction of the human HNF1β mutant R137-K161del, which is associated with a reduced number of nephrons with hypertrophy of the remaining ones and which has an impaired DNA binding, shows only a minor effect on pronephros development in Xenopus. Thus, the overexpression of both human mutants has a different effect on renal development in Xenopus, reflecting the variation in renal phenotype seen with these mutations. We conclude that mutations in human HNF1β can be functionally characterized in Xenopus. Our findings imply that HNF1β not only is an early marker of kidney development but also is functionally involved in morphogenetic events, and these processes can be investigated in lower vertebrates. PMID:10758154

  16. The ORF012 Gene of Marek's Disease Virus Type 1 Produces a Spliced Transcript and Encodes a Novel Nuclear Phosphoprotein Essential for Virus Growth

    PubMed Central

    Schippers, Timo; Jarosinski, Keith

    2014-01-01

    interfere with MDV and herpesviral pathogenesis. We have identified a previously unidentified phosphoprotein encoded by MDV ORF012. We were able to show experimentally that predicted splicing of the gene based on bioinformatics data does indeed occur during replication. The newly identified p012 is essential for MDV replication and localizes to the nucleus due to the presence of a transferable nuclear localization signal at its C terminus. Our results also imply that p012 could constitute a nucleocytoplasmic shuttle protein, a feature that could prove interesting and important. PMID:25392220

  17. [Development genes encoding transcription factors and dysmorphology].

    PubMed

    Lacombe, Didier

    2009-04-01

    Studies of children with developmental abnormalities of genetic origin are necessary for accurate diagnosis, prognostication, patient management, and genetic counseling. Such studies can also help to identify genes involved in normal and abnormal morphogenesis, which often act as patterning genes and are also potential oncogenes. Many encode transcription factors that regulate other genes during embryonic development. PMID:20120282

  18. A Deoxynivalenol-Activated Methionyl-tRNA Synthetase Gene from Wheat Encodes a Nuclear Localized Protein and Protects Plants Against Fusarium Pathogens and Mycotoxins.

    PubMed

    Zuo, Dong-Yun; Yi, Shu-Yuan; Liu, Rong-Jing; Qu, Bo; Huang, Tao; He, Wei-Jie; Li, Cheng; Li, He-Ping; Liao, Yu-Cai

    2016-06-01

    Fusarium graminearum is the fungal pathogen that causes globally important diseases of cereals and produces mycotoxins such as deoxynivalenol (DON). Owing to the dearth of available sources of resistance to Fusarium pathogens, characterization of novel genes that confer resistance to mycotoxins and mycotoxin-producing fungi is vitally important for breeding resistant crop varieties. In this study, a wheat methionyl-tRNA synthetase (TaMetRS) gene was identified from suspension cell cultures treated with DON. It shares conserved aminoacylation catalytic and tRNA anticodon binding domains with human MetRS and with the only previously characterized plant MetRS, suggesting that it functions in aminoacylation in the cytoplasm. However, the TaMetRS comprises a typical nuclear localization signal and cellular localization studies with a TaMetRS::GFP fusion protein showed that TaMetRS is localized in the nucleus. Expression of TaMetRS was activated by DON treatment and by infection with a DON-producing F. graminearum strain in wheat spikes. No such activation was observed following infection with a non-DON-producing F. graminearum strain. Expression of TaMetRS in Arabidopsis plants conferred significant resistance to DON and F. graminearum. These results indicated that this DON-activated TaMetRS gene may encode a novel type of MetRS in plants that has a role in defense and detoxification. PMID:26882849

  19. Kaposi's sarcoma-associated herpesvirus noncoding polyadenylated nuclear RNA interacts with virus- and host cell-encoded proteins and suppresses expression of genes involved in immune modulation.

    PubMed

    Rossetto, Cyprian C; Pari, Gregory S

    2011-12-01

    During lytic infection, Kaposi's sarcoma-associated herpesvirus (KSHV) expresses a polyadenylated nuclear RNA (PAN RNA). This noncoding RNA (ncRNA) is localized to the nucleus and is the most abundant viral RNA during lytic infection; however, to date, the role of PAN RNA in the virus life cycle is unknown. Many examples exist where ncRNAs have a defined key regulatory function controlling gene expression by various mechanisms. Our goal for this study was to identify putative binding partners for PAN RNA in an effort to elucidate a possible function for the transcript in KSHV infection. We employed an in vitro affinity protocol where PAN RNA was used as bait for factors present in BCBL-1 cell nuclear extract to show that PAN RNA interacts with several virus- and host cell-encoded factors, including histones H1 and H2A, mitochondrial and cellular single-stranded binding proteins (SSBPs), and interferon regulatory factor 4 (IRF4). RNA chromatin immunoprecipitation (ChIP) assays confirmed that PAN RNA interacted with these factors in the infected cell environment. A luciferase reporter assay showed that PAN RNA expression interfered with the ability of IRF4/PU.1 to activate the interleukin-4 (IL-4) promoter, strongly suggesting a role for PAN RNA in immune modulation. Since the proteomic screen and functional data suggested a role in immune responses, we investigated if constitutive PAN RNA expression could affect other genes involved in immune responses. PAN RNA expression decreased expression of gamma interferon, interleukin-18, alpha interferon 16, and RNase L. These data strongly suggest that PAN RNA interacts with viral and cellular proteins and can function as an immune modulator. PMID:21957289

  20. Gene encoding plant asparagine synthetase

    DOEpatents

    Coruzzi, Gloria M.; Tsai, Fong-Ying

    1993-10-26

    The identification and cloning of the gene(s) for plant asparagine synthetase (AS), an important enzyme involved in the formation of asparagine, a major nitrogen transport compound of higher plants is described. Expression vectors constructed with the AS coding sequence may be utilized to produce plant AS; to engineer herbicide resistant plants, salt/drought tolerant plants or pathogen resistant plants; as a dominant selectable marker; or to select for novel herbicides or compounds useful as agents that synchronize plant cells in culture. The promoter for plant AS, which directs high levels of gene expression and is induced in an organ specific manner and by darkness, is also described. The AS promoter may be used to direct the expression of heterologous coding sequences in appropriate hosts.

  1. The nuclear protein encoded by the Drosophila neurogenic gene mastermind is widely expressed and associates with specific chromosomal regions

    SciTech Connect

    Bettler, D.; Pearson, S.; Yedvobnick, B.

    1996-06-01

    The Drosophila neurogenic loci encode a diverse group of proteins that comprise an inhibitory signal transduction pathway. The pathway is used throughout development in numerous contexts. We have examined the distribution of the neurogenic locus mastermind protein (Mam). Mam is expressed through all germlayers during early embryogenesis, including ectodermal precursors to both neuroblasts and epidermoblasts. Mam is subsequently down-regulated within the nervous system and then reexpressed. It persists in the nervous system through late embryogenesis and postembryonically. Mam is ubiquitously expressed in wing and leg imaginal discs and is not down-regulated in sensory organ precursor cells of the wing margin or notum. In the eye disc, Mam shows most prominent expression posterior to the morphogenetic furrow. Expression of the protein during oogenesis appears limited to follicle cells. Immunohistochemical detection of Mam on polytene chromosomes revealed binding at >100 sites. Chromosome colocalization studies with RNA polymerase and the groucho corepressor protein implicate Mam in transcriptional regulation. 94 refs., 8 figs., 1 tab.

  2. Molecular phylogeny of brachiopods and phoronids based on nuclear-encoded small subunit ribosomal RNA gene sequences

    PubMed Central

    L.Cohen, B.

    1998-01-01

    Brachiopod and phoronid phylogeny is inferred from SSU rDNA sequences of 28 articulate and nine inarticulate brachiopods, three phoronids, two ectoprocts and various outgroups, using gene trees reconstructed by weighted parsimony, distance and maximum likelihood methods. Of these sequences, 33 from brachiopods, two from phoronids and one each from an ectoproct and a priapulan are newly determined. The brachiopod sequences belong to 31 different genera and thus survey about 10% of extant genus-level diversity. Sequences determined in different laboratories and those from closely related taxa agree well, but evidence is presented suggesting that one published phoronid sequence (GenBank accession UO12648) is a brachiopod-phoronid chimaera, and this sequence is excluded from the analyses. The chiton, Acanthopleura, is identified as the phenetically proximal outgroup; other selected outgroups were chosen to allow comparison with recent, non-molecular analyses of brachiopod phylogeny. The different outgroups and methods of phylogenetic reconstruction lead to similar results, with differences mainly in the resolution of weakly supported ancient and recent nodes, including the divergence of inarticulate brachiopod sub-phyla, the position of the rhynchonellids in relation to long- and short-looped articulate brachiopod clades and the relationships of some articulate brachiopod genera and species. Attention is drawn to the problem presented by nodes that are strongly supported by non-molecular evidence but receive only low bootstrap resampling support. Overall, the gene trees agree with morphology-based brachiopod taxonomy, but novel relationships are tentatively suggested for thecideidine and megathyrid brachiopods. Articulate brachiopods are found to be monophyletic in all reconstructions, but monophyly of inarticulate brachiopods and the possible inclusion of phoronids in the inarticulate brachiopod clade are less strongly established. Phoronids are clearly excluded from

  3. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, P.G.; Ohlrogge, J.B.

    1996-09-24

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  4. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, Paul G.; Ohlrogge, John B.

    1996-01-01

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  5. Expression of a nuclear-encoded psbH gene complements the plastidic RNA processing defect in the PSII mutant hcf107 in Arabidopsis thaliana.

    PubMed

    Levey, Tatjana; Westhoff, Peter; Meierhoff, Karin

    2014-10-01

    The helical-repeat RNA-binding protein HCF107 is required for processing, stabilization and translation of plastid-encoded psbH mRNA. The psbH gene encodes a small, hydrophilic subunit of the PSII complex and is part of the plastidic psbB-psbT-psbH-petB-petD transcription unit. In Arabidopsis hcf107 mutants, only trace amounts of PSII proteins can be detected. Beside drastically reduced synthesis of PsbH, the synthesis of CP47 was also reduced in these mutants, although the corresponding psbB transcripts accumulate to wild type levels. This situation raises the question, whether the reduction of CP47 is a direct consequence of the mutation, based on targeting of HCF107 to the psbB mRNA, or a secondary affect due to the absent PsbH. To clarify this issue we introduced a chimeric psbH construct comprising a sequence encoding a chloroplast transit peptide into the hcf107-2 background. We found that the nucleus-localized psbH was able to complement the mutant defect resulting in photoautotrophic plants. The PSII proteins CP47 and D1 accumulated to barely half of the wild type level. Further experiments showed that cytosolically synthesized PsbH was imported into chloroplasts and assembled into PSII complexes. Using this approach, we showed that the tetratricopeptide repeat protein HCF107 of Arabidopsis is only responsible for expression of PsbH and not for synthesis of CP47. In addition the data suggest the necessity of the small, one-helix membrane spanning protein PsbH for the accumulation of CP47 in higher plants. PMID:25081859

  6. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    SciTech Connect

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin . E-mail: min-xin.guan@chmcc.org

    2006-04-21

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations.

  7. The Yeast Hrs1 Gene Encodes a Polyglutamine-Rich Nuclear Protein Required for Spontaneous and Hpr1-Induced Deletions between Direct Repeats

    PubMed Central

    Santos-Rosa, H.; Clever, B.; Heyer, W. D.; Aguilera, A.

    1996-01-01

    The hrs1-1 mutation was isolated as an extragenic suppressor of the hyperrecombination phenotype of hpr1Δ cells. We have cloned, sequenced and deleted from the genome the HRS1 gene. The DNA sequence of the HRS1 gene reveals that it is identical to PGD1, a gene with no reported function, and that the Hrs1p protein contains polyglutamine stretches typically found in transcription factors. We have purified a His(6) tagged version of Hrs1p protein from E. coli and have obtained specific anti-Hrs1p polyclonal antibodies. We show that Hrs1p is a 49-kD nuclear protein, as determined by indirect immunofluorescence microscopy and Western blot analysis. The hrs1Δ null mutation reduces the frequency of deletions in wild-type and hpr1Δ backgrounds sevenfold below wild-type and rad52 levels. Furthermore, hrs1Δ cells show reduced induction of the GAL1,10 promoter relative to wild-type cells. Our results suggest that Hrs1p is required for the formation of deletions between direct repeats and that it may function in gene expression. This suggests a connection between gene expression and direct repeat recombination. In this context, we discuss the possible roles of Hrs1p and Hpr1p in initiation of direct-repeat recombination. PMID:8849881

  8. A Novel Gene SbSI-2 Encoding Nuclear Protein from a Halophyte Confers Abiotic Stress Tolerance in E. coli and Tobacco

    PubMed Central

    Yadav, Narendra Singh; Singh, Vijay Kumar; Singh, Dinkar; Jha, Bhavanath

    2014-01-01

    Salicornia brachiata is an extreme halophyte that grows luxuriantly in coastal marshes. Previously, we have reported isolation and characterization of ESTs from Salicornia with large number of novel/unknown salt-responsive gene sequences. In this study, we have selected a novel salt-inducible gene SbSI-2 (Salicornia brachiata salt-inducible-2) for functional characterization. Bioinformatics analysis revealed that SbSI-2 protein has predicted nuclear localization signals and a strong protein-protein interaction domain. Transient expression of the RFP:SbSI2 fusion protein confirmed that SbSI-2 is a nuclear-localized protein. Genomic organization study showed that SbSI-2 is intronless and has a single copy in Salicornia genome. Quantitative RT-PCR analysis revealed higher SbSI-2 expression under salt stress and desiccation conditions. The SbSI-2 gene was transformed in E. coli and tobacco for functional characterization. pET28a-SbSI-2 recombinant E. coli cells showed higher tolerance to desiccation and salinity compared to vector alone. Transgenic tobacco plants overexpressing SbSI-2 have improved salt- and osmotic tolerance, accompanied by better growth parameters, higher relative water content, elevated accumulation of compatible osmolytes, lower Na+ and ROS accumulation and lesser electrolyte leakage than the wild-type. Overexpression of the SbSI-2 also enhanced transcript levels of ROS-scavenging genes and some stress-related transcription factors under salt and osmotic stresses. Taken together, these results demonstrate that SbSI-2 might play an important positive modulation role in abiotic stress tolerance. This identifies SbSI-2 as a novel determinant of salt/osmotic tolerance and suggests that it could be a potential bioresource for engineering abiotic stress tolerance in crop plants. PMID:24999628

  9. A novel gene SbSI-2 encoding nuclear protein from a halophyte confers abiotic stress tolerance in E. coli and tobacco.

    PubMed

    Yadav, Narendra Singh; Singh, Vijay Kumar; Singh, Dinkar; Jha, Bhavanath

    2014-01-01

    Salicornia brachiata is an extreme halophyte that grows luxuriantly in coastal marshes. Previously, we have reported isolation and characterization of ESTs from Salicornia with large number of novel/unknown salt-responsive gene sequences. In this study, we have selected a novel salt-inducible gene SbSI-2 (Salicornia brachiata salt-inducible-2) for functional characterization. Bioinformatics analysis revealed that SbSI-2 protein has predicted nuclear localization signals and a strong protein-protein interaction domain. Transient expression of the RFP:SbSI2 fusion protein confirmed that SbSI-2 is a nuclear-localized protein. Genomic organization study showed that SbSI-2 is intronless and has a single copy in Salicornia genome. Quantitative RT-PCR analysis revealed higher SbSI-2 expression under salt stress and desiccation conditions. The SbSI-2 gene was transformed in E. coli and tobacco for functional characterization. pET28a-SbSI-2 recombinant E. coli cells showed higher tolerance to desiccation and salinity compared to vector alone. Transgenic tobacco plants overexpressing SbSI-2 have improved salt- and osmotic tolerance, accompanied by better growth parameters, higher relative water content, elevated accumulation of compatible osmolytes, lower Na+ and ROS accumulation and lesser electrolyte leakage than the wild-type. Overexpression of the SbSI-2 also enhanced transcript levels of ROS-scavenging genes and some stress-related transcription factors under salt and osmotic stresses. Taken together, these results demonstrate that SbSI-2 might play an important positive modulation role in abiotic stress tolerance. This identifies SbSI-2 as a novel determinant of salt/osmotic tolerance and suggests that it could be a potential bioresource for engineering abiotic stress tolerance in crop plants. PMID:24999628

  10. Phylogeny and evolutionary history of Leymus (Triticeae; Poaceae) based on a single-copy nuclear gene encoding plastid acetyl-CoA carboxylase

    PubMed Central

    Fan, Xing; Sha, Li-Na; Yang, Rui-Wu; Zhang, Hai-Qin; Kang, Hou-Yang; Ding, Cun-Bang; Zhang, Li; Zheng, You-Liang; Zhou, Yong-Hong

    2009-01-01

    Background Single- and low- copy genes are less likely subject to concerted evolution, thus making themselves ideal tools for studying the origin and evolution of polyploid taxa. Leymus is a polyploid genus with a diverse array of morphology, ecology and distribution in Triticeae. The genomic constitution of Leymus was assigned as NsXm, where Ns was presumed to be originated from Psathyrostachys, while Xm represented a genome of unknown origin. In addition, little is known about the evolutionary history of Leymus. Here, we investigate the phylogenetic relationship, genome donor, and evolutionary history of Leymus based on a single-copy nuclear Acc1 gene. Results Two homoeologues of the Acc1 gene were isolated from nearly all the sampled Leymus species using allele-specific primer and were analyzed with those from 35 diploid taxa representing 18 basic genomes in Triticeae. Sequence diversity patterns and genealogical analysis suggested that (1) Leymus is closely related to Psathyrostachys, Agropyron, and Eremopyrum; (2) Psathyrostachys juncea is an ancestral Ns-genome donor of Leymus species; (3) the Xm genome in Leymus may be originated from an ancestral lineage of Agropyron and Eremopyrum triticeum; (4) the Acc1 sequences of Leymus species from the Qinghai-Tibetan plateau are evolutionarily distinct; (5) North America Leymus species might originate from colonization via the Bering land bridge; (6) Leymus originated about 11-12MYA in Eurasia, and adaptive radiation might have occurred in Leymus during the period of 3.7-4.3 MYA and 1.7-2.1 MYA. Conclusion Leymus species have allopolyploid origin. It is hypothesized that the adaptive radiation of Leymus species might have been triggered by the recent upliftings of the Qinghai-Tibetan plateau and subsequent climatic oscillations. Adaptive radiation may have promoted the rapid speciation, as well as the fixation of unique morphological characters in Leymus. Our results shed new light on our understanding of the origin

  11. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.

    1999-10-26

    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  12. Population-level expression variability of mitochondrial DNA-encoded genes in humans

    PubMed Central

    Wang, Gang; Yang, Ence; Mandhan, Ishita; Brinkmeyer-Langford, Candice L; Cai, James J

    2014-01-01

    Human mitochondria contain multiple copies of a circular genome made up of double-stranded DNA (mtDNA) that encodes proteins involved in cellular respiration. Transcript abundance of mtDNA-encoded genes varies between human individuals, yet the level of variation in the general population has not been systematically assessed. In the present study, we revisited large-scale RNA sequencing data generated from lymphoblastoid cell lines of HapMap samples of European and African ancestry to estimate transcript abundance and quantify expression variation for mtDNA-encoded genes. In both populations, we detected up to over 100-fold difference in mtDNA gene expression between individuals. The marked variation was not due to differences in mtDNA copy number between individuals, but was shaped by the transcription of hundreds of nuclear genes. Many of these nuclear genes were co-expressed with one another, resulting in a module-enriched co-expression network. Significant correlations in expression between genes of the mtDNA and nuclear genomes were used to identify factors involved with the regulation of mitochondrial functions. In conclusion, we determined the baseline amount of variability in mtDNA gene expression in general human populations and cataloged a complete set of nuclear genes whose expression levels are correlated with those of mtDNA-encoded genes. Our findings will enable the integration of information from both mtDNA and nuclear genetic systems, and facilitate the discovery of novel regulatory pathways involving mitochondrial functions. PMID:24398800

  13. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, Jonathan D.; Scott-Craig, John S.

    1999-01-01

    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

  14. Reduction of a 4q35-encoded nuclear envelope protein in muscle differentiation

    SciTech Connect

    Ostlund, Cecilia; Guan, Tinglu; Figlewicz, Denise A.; Hays, Arthur P.; Worman, Howard J.; Gerace, Larry; Schirmer, Eric C.

    2009-11-13

    Muscular dystrophy and peripheral neuropathy have been linked to mutations in genes encoding nuclear envelope proteins; however, the molecular mechanisms underlying these disorders remain unresolved. Nuclear envelope protein p19A is a protein of unknown function encoded by a gene at chromosome 4q35. p19A levels are significantly reduced in human muscle as cells differentiate from myoblasts to myotubes; however, its levels are not similarly reduced in all differentiation systems tested. Because 4q35 has been linked to facioscapulohumeral muscular dystrophy (FSHD) and some adjacent genes are reportedly misregulated in the disorder, levels of p19A were analyzed in muscle samples from patients with FSHD. Although p19A was increased in most cases, an absolute correlation was not observed. Nonetheless, p19A downregulation in normal muscle differentiation suggests that in the cases where its gene is inappropriately re-activated it could affect muscle differentiation and contribute to disease pathology.

  15. A continental-wide perspective: the genepool of nuclear encoded ribosomal DNA and single-copy gene sequences in North American Boechera (Brassicaceae).

    PubMed

    Kiefer, Christiane; Koch, Marcus A

    2012-01-01

    74 of the currently accepted 111 taxa of the North American genus Boechera (Brassicaceae) were subject to pyhlogenetic reconstruction and network analysis. The dataset comprised 911 accessions for which ITS sequences were analyzed. Phylogenetic analyses yielded largely unresolved trees. Together with the network analysis confirming this result this can be interpreted as an indication for multiple, independent, and rapid diversification events. Network analyses were superimposed with datasets describing i) geographical distribution, ii) taxonomy, iii) reproductive mode, and iv) distribution history based on phylogeographic evidence. Our results provide first direct evidence for enormous reticulate evolution in the entire genus and give further insights into the evolutionary history of this complex genus on a continental scale. In addition two novel single-copy gene markers, orthologues of the Arabidopsis thaliana genes At2g25920 and At3g18900, were analyzed for subsets of taxa and confirmed the findings obtained through the ITS data. PMID:22606266

  16. A novel nuclear-encoded mitochondrial poly(A) polymerase PAPD1 is a potential candidate gene for the extreme obesity related phenotypes in mammals.

    PubMed

    Xiao, Qianjun; Wu, Xiao-Lin; Michal, Jennifer J; Reeves, Jerry J; Busboom, Jan R; Thorgaard, Gary H; Jiang, Zhihua

    2006-01-01

    People with obesity, especially extreme obesity, are at risk for many health problems. However, the responsible genes remain unknown in >95% of severe obesity cases. Our previous genome-wide scan of Wagyu x Limousin F2 cattle crosses with extreme phenotypes revealed a molecular marker significantly associated with intramuscular fat deposition. Characterization of this marker showed that it is orthologous to the human gene KIAA1462 located on HSA10p11.23, where a major quantitative trait locus for morbid obesity has been reported. The newly identified mitochondrial poly(A) polymerase associated domain containing 1 (PAPD1) gene, which is located near this marker, is particularly interesting because the polymerase is required for the polyadenylation and stabilization of mammalian mitochondrial mRNAs. In the present study, both cDNA and genomic DNA sequences were annotated for the bovine PAPD1 gene and ten genetic markers were detected in the promoter and exon 1 region. Among seven markers assayed on approximately 250 Wagyu x Limousin F2 animals, two single nucleotide polymorphisms (SNPs) in the promoter region were significantly associated with intramuscular fat (P<0.05). However, there was a significant interaction (P<0.05) between a third SNP, which causes an amino acid change in coding exon 1, and each of these two promoter SNPs on intramuscular fat deposition. In particular, the differences between double heterozygous animals at two polymorphic sites and the slim genotype animals exceeded 2.3 standard deviations for the trait in both cases. Our study provides evidence for a new mechanism--the involvement of compound heterosis in extreme obesity, which warrants further examination. PMID:16810331

  17. Trichoderma asperellum Chi42 Genes Encode Chitinase

    PubMed Central

    Quang, Hoang Tan; Hung, Nguyen Bao; Huy, Nguyen Duc; Phuong, Truong Thi Bich; Ha, Tran Thi Thu

    2011-01-01

    Four Trichoderma strains (CH2, SH16, PQ34, and TN42) were isolated from soil samples collected from Quang Tri and Thua Thien Hue provinces in Vietnam. The strains exhibited high chitinolytic secretion. Strain PQ34 formed the largest zone of chitinase-mediated clearance (> 4 cm in diameter) in agar containing 1% (w/v) colloidal chitin. Analysis of the internal transcribed spacer regions of these strains indicated that they were Trichoderma asperellum. The molecular weights of the chitinases were approximately 42 kDa. Chitinase genes (chi42) of T. asperellum strains TN42, CH2, SH16, and PQ34 were 98~99% homologous to the ech42 gene of T. harzianum CB-Pin-01 (accession No. DQ166036). The deduced amino acid sequences of both T. asperellum strains SH16 and TN42 shared 100% similarity. PMID:22783101

  18. Mutations in nuclear genes alter post-transcriptional regulation of mitochondrial genes.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nuclear gene products are required for the expression of mitochondrial genes and elaboration of functional mitochondrial protein complexes. To better understand the roles of these nuclear genes, we exploited the mitochondrial encoded S-type of cytoplasmic male sterility (CMS-S) and developed a nove...

  19. Coordination of plastid and nuclear gene expression.

    PubMed Central

    Gray, John C; Sullivan, James A; Wang, Jun-Hui; Jerome, Cheryl A; MacLean, Daniel

    2003-01-01

    The coordinated expression of genes distributed between the nuclear and plastid genomes is essential for the assembly of functional chloroplasts. Although the nucleus has a pre-eminent role in controlling chloroplast biogenesis, there is considerable evidence that the expression of nuclear genes encoding photosynthesis-related proteins is regulated by signals from plastids. Perturbation of several plastid-located processes, by inhibitors or in mutants, leads to decreased transcription of a set of nuclear photosynthesis-related genes. Characterization of arabidopsis gun (genomes uncoupled) mutants, which express nuclear genes in the presence of norflurazon or lincomycin, has provided evidence for two separate signalling pathways, one involving tetrapyrrole biosynthesis intermediates and the other requiring plastid protein synthesis. In addition, perturbation of photosynthetic electron transfer produces at least two different redox signals, as part of the acclimation to altered light conditions. The recognition of multiple plastid signals requires a reconsideration of the mechanisms of regulation of transcription of nuclear genes encoding photosynthesis-related proteins. PMID:12594922

  20. A reanalysis of mouse ENCODE comparative gene expression data

    PubMed Central

    Gilad, Yoav; Mizrahi-Man, Orna

    2015-01-01

    Recently, the Mouse ENCODE Consortium reported that comparative gene expression data from human and mouse tend to cluster more by species rather than by tissue. This observation was surprising, as it contradicted much of the comparative gene regulatory data collected previously, as well as the common notion that major developmental pathways are highly conserved across a wide range of species, in particular across mammals. Here we show that the Mouse ENCODE gene expression data were collected using a flawed study design, which confounded sequencing batch (namely, the assignment of samples to sequencing flowcells and lanes) with species. When we account for the batch effect, the corrected comparative gene expression data from human and mouse tend to cluster by tissue, not by species. PMID:26236466

  1. Selection for genes encoding secreted proteins and receptors.

    PubMed Central

    Klein, R D; Gu, Q; Goddard, A; Rosenthal, A

    1996-01-01

    Extracellular proteins play an essential role in the formation, differentiation, and maintenance of multicellular organisms. Despite that, the systematic identification of genes encoding these proteins has not been possible. We describe here a highly efficient method to isolate genes encoding secreted and membrane-bound proteins by using a single-step selection in yeast. Application of this method, termed signal peptide selection, to various tissues yielded 559 clones that appear to encode known or novel extracellular proteins. These include members of the transforming growth factor and epidermal growth factor protein families, endocrine hormones, tyrosine kinase receptors, serine/threonine kinase receptors, seven transmembrane receptors, cell adhesion molecules, extracellular matrix proteins, plasma proteins, and ion channels. The eventual identification of most, or all, extracellular signaling molecules will advance our understanding of fundamental biological processes and our ability to intervene in disease states. Images Fig. 1 PMID:8692953

  2. Functions Encoded by Pyrrolnitrin Biosynthetic Genes from Pseudomonas fluorescens

    PubMed Central

    Kirner, Sabine; Hammer, Philip E.; Hill, D. Steven; Altmann, Annett; Fischer, Ilona; Weislo, Laura J.; Lanahan, Mike; van Pée, Karl-Heinz; Ligon, James M.

    1998-01-01

    Pyrrolnitrin is a secondary metabolite derived from tryptophan and has strong antifungal activity. Recently we described four genes, prnABCD, from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin. In the work presented here, we describe the function of each prn gene product. The four genes encode proteins identical in size and serology to proteins present in wild-type Pseudomonas fluorescens, but absent from a mutant from which the entire prn gene region had been deleted. The prnA gene product catalyzes the chlorination of l-tryptophan to form 7-chloro-l-tryptophan. The prnB gene product catalyzes a ring rearrangement and decarboxylation to convert 7-chloro-l-tryptophan to monodechloroaminopyrrolnitrin. The prnC gene product chlorinates monodechloroaminopyrrolnitrin at the 3 position to form aminopyrrolnitrin. The prnD gene product catalyzes the oxidation of the amino group of aminopyrrolnitrin to a nitro group to form pyrrolnitrin. The organization of the prn genes in the operon is identical to the order of the reactions in the biosynthetic pathway. PMID:9537395

  3. (Genetic engineering with a gene encoding a soybean storage protein)

    SciTech Connect

    Beachy, R.N.

    1985-12-18

    We have isolated and characterized a gene which encodes the alpha prime subunit of beta conglycinin. This gene was fully sequenced by DNA sequence analysis and a report of that work was prepared and submitted for publication in early November 1985. This represented the culmination of several years of research effort by several scientists. A preprint of that work is attached to this report and has been offered by Dr. J.J. Doyle, Dr. Mary A. Schuler and Dr. Jerry Slighton, as well as myself. This paper is a comparison of the alpha prime subunit gene with a similar gene from phaseolus vulgaris, the common garden bean. In this paper we compare the sequences that are 5' of the gene, and which would represent the transcriptional promoter, as well as the sequences within the structural region of the gene. The sequence paper also compares the amino acid sequence of these two genes with that of other genes from Phaseolus, peas and from soybeans. On the basis of this comparison, we predict evolutionary trends within the multigene families which encode these proteins in the various plants, as well as to look at the protein itself to try to predict regions of the protein that might have functional significance. All of this work was done on a prior DOE-BER grant and has simply been reported here for the first time.

  4. A complex gene superfamily encodes actin in petunia.

    PubMed Central

    Baird, W V; Meagher, R B

    1987-01-01

    We have shown by several independent criteria that actin is encoded by a very large and complex superfamily of genes in Petunia. Several cDNA and genomic probes encoding actins from diverse organisms (Dictyostelium, Drosophila, chicken and soybean) hybridize to hundreds of restriction fragments in the petunia genome. Actin-hybridizing sequences were isolated from a petunia genomic library at a rate of at least 200 per genome equivalent. Twenty randomly selected actin-hybridizing clones were characterized in more detail. DNA sequence data from four representative and highly divergent clones, PAc2, PAc3, PAc4 and PAc7, demonstrate that these actin-like sequences are related to functional actin genes. Intron positions typical of other known plant actin genes are conserved in these clones. Four of six clones analyzed (PAc1, PAc2, PAc3, PAc4) hybridize to leaf mRNA of the same size (1.7 kb) as that reported for other plant actin mRNAs and to a slightly smaller mRNA species (1.5 kb). Five distinct subfamilies of actin-related genes were characterized which varied in size from a few members to several dozen members. It is clear from our data that other actin gene subfamilies must also exist within the genome. Possible mechanisms of actin gene amplification and genome turnover are discussed. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3428258

  5. Expression of genes encoding extracellular matrix proteins: A macroarray study

    PubMed Central

    FUTYMA, KONRAD; MIOTŁA, PAWEŁ; RÓŻYŃSKA, KRYSTYNA; ZDUNEK, MAŁGORZATA; SEMCZUK, ANDRZEJ; RECHBERGER, TOMASZ; WOJCIEROWSKI, JACEK

    2014-01-01

    Endometrial cancer (EC) is one of the most common gynecological malignancies in Poland, with well-established risk factors. Genetic instability and molecular alterations responsible for endometrial carcinogenesis have been systematically investigated. The aim of the present study was to investigate, by means of cDNA macroarrays, the expression profiles of genes encoding extracellular matrix (ECM) proteins in ECs. Tissue specimens were collected during surgical procedures from 40 patients with EC, and control tissue was collected from 9 patients with uterine leiomyomas. RNA was isolated and RT-PCR with radioisotope-labeled cDNA was performed. The levels of ECM protein gene expression in normal endometrial tissues were compared to the expression of these genes in EC specimens. Statistically significant differences in gene expression, stratified by clinical stage of the ECs, were detected for aggrecan, vitronectin, tenascin R, nidogen and two collagen proteins: type VIII chain α1 and type XI chain α2. All of these proteins were overexpressed in stage III endometrial carcinomas compared to levels in stage I and II uterine neoplasms. In conclusion, increased expression of genes encoding ECM proteins may play an important role in facilitating accelerated disease progression of human ECs. PMID:25231141

  6. Nuclear Neighborhoods and Gene Expression

    PubMed Central

    Zhao, Rui; Bodnar, Megan S.; Spector, David L.

    2009-01-01

    Summary The eukaryotic nucleus is a highly compartmentalized and dynamic environment. Chromosome territories are arranged non-randomly within the nucleus and numerous studies have indicated that a gene’s position in the nucleus can impact its transcriptional activity. Here, we focus on recent advances in our understanding of the influence of specific nuclear neighborhoods on gene expression or repression. Nuclear neighborhoods associated with transcriptional repression include the inner nuclear membrane/nuclear lamina and peri-nucleolar chromatin, whereas neighborhoods surrounding the nuclear pore complex, PML nuclear bodies, and nuclear speckles seem to be transcriptionally permissive. While nuclear position appears to play an important role in gene expression, it is likely to be only one piece of a flexible puzzle that incorporates numerous parameters. We are still at a very early, yet exciting stage in our journey toward deciphering the mechanism(s) that govern the permissiveness of gene expression/repression within different nuclear neighborhoods. PMID:19339170

  7. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  8. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  9. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  10. Kluyveromyces lactis genome harbours a functional linker histone encoding gene.

    PubMed

    Staneva, Dessislava; Georgieva, Milena; Miloshev, George

    2016-06-01

    Linker histones are essential components of chromatin in eukaryotes. Through interactions with linker DNA and nucleosomes they facilitate folding and maintenance of higher-order chromatin structures and thus delicately modulate gene activity. The necessity of linker histones in lower eukaryotes appears controversial and dubious. Genomic data have shown that Schizosaccharomyces pombe does not possess genes encoding linker histones while Kluyveromyces lactis has been reported to have a pseudogene. Regarding this controversy, we have provided the first direct experimental evidence for the existence of a functional linker histone gene, KlLH1, in K. lactis genome. Sequencing of KlLH1 from both genomic DNA and copy DNA confirmed the presence of an intact open reading frame. Transcription and splicing of the KlLH1 sequence as well as translation of its mRNA have been studied. In silico analysis revealed homology of KlLH1p to the histone H1/H5 protein family with predicted three domain structure characteristic for the linker histones of higher eukaryotes. This strongly proves that the yeast K. lactis does indeed possess a functional linker histone gene thus entailing the evolutionary preservation and significance of linker histones. The nucleotide sequences of KlLH1 are deposited in the GenBank under accession numbers KT826576, KT826577 and KT826578. PMID:27189369

  11. The proliferation potential protein-related (P2P-R) gene with domains encoding heterogeneous nuclear ribonucleoprotein association and Rb1 binding shows repressed expression during terminal differentiation.

    PubMed

    Witte, M M; Scott, R E

    1997-02-18

    Terminal differentiation is associated with repression in the expression of the proliferation potential proteins (P2P) subset of heterogeneous nuclear ribonucleoprotein (hnRNP) proteins. We report here the cloning and characterization of a 5173-bp P2P-related (P2P-R) cDNA that contains a 4214-bp open reading frame. Probes to this cDNA detect a single 8-kb mRNA in multiple murine tissues and in proliferating 3T3T cells, but not in terminally differentiated 3T3T adipocytes. Evidence that this cDNA can encode peptides with domains for hnRNP association was established by showing that such peptides are recognized by two monoclonal antibodies known to detect core hnRNP proteins, and by showing that the C130 monoclonal antibody, produced against a cDNA-derived fusion protein, also selectively detects native P2P hnRNP proteins. In addition, P2P-R cDNA-derived fusion proteins bind single-stranded nucleic acids, and a P2P-R cDNA-derived antisense oligonucleotide selectively represses P2P expression. Because terminal differentiation is associated with modulation in Rb1 function, we assayed if products of this cDNA might interact with Rb1. Evidence that the P2P-R cDNA encodes a protein domain that binds Rb1 was established using a glutathione S-transferase fusion protein to selectively precipitate Rb1 from cellular extracts. Data also show that this binding is reduced by competition with the adenovirus E1a protein, indicating that binding occurs through the "pocket" domain of Rb1. These results establish that the P2P-R cDNA encodes protein domains involved in both hnRNP association and Rb1 binding and complement recent reports that localize Rb1 to sites of RNA processing in the nucleus. PMID:9037032

  12. Phylogenetic position of Cryothecomonas inferred from nuclear-encoded small subunit ribosomal RNA.

    PubMed

    Kühn, S; Lange, M; Medlin, L K

    2000-12-01

    The systematic position of the genus Cryothecomonas has been determined from an analysis of the nuclear-encoded small subunit ribosomal RNA gene of Cryothecomonas longipes and two strains of Cryothecomonas aestivalis. Our phylogenetic trees inferred from maximum likelihood, distance and maximum parsimony methods robustly show that the genus Cryothecomonas clusters within the phylum Cercozoa, and is related to the sarcomonad flagellate Heteromita globosa. Morphological data supporting the taxonomic placement of Cryothecomonas near the sarcomonad flagellates has been compiled from the literature. The high number of nucleotide substitutions found between two morphologically indistinguishable strains of Cryothecomonas aestivalis suggests the possibility of cryptic species within Cryothecomonas aestivalis. PMID:11212894

  13. Genome-wide analysis of NBS-encoding disease resistance genes in Cucumis sativus and phylogenetic study of NBS-encoding genes in Cucurbitaceae crops

    PubMed Central

    2013-01-01

    Background Plant nucleotide-binding site (NBS)-leucine-rich repeat (LRR) proteins encoded by resistance genes play an important role in the responses of plants to various pathogens, including viruses, bacteria, fungi, and nematodes. In this study, a comprehensive analysis of NBS-encoding genes within the whole cucumber genome was performed, and the phylogenetic relationships of NBS-encoding resistance gene homologues (RGHs) belonging to six species in five genera of Cucurbitaceae crops were compared. Results Cucumber has relatively few NBS-encoding genes. Nevertheless, cucumber maintains genes belonging to both Toll/interleukine-1 receptor (TIR) and CC (coiled-coil) families. Eight commonly conserved motifs have been established in these two families which support the grouping into TIR and CC families. Moreover, three additional conserved motifs, namely, CNBS-1, CNBS-2 and TNBS-1, have been identified in sequences from CC and TIR families. Analyses of exon/intron configurations revealed that some intron loss or gain events occurred during the structural evolution between the two families. Phylogenetic analyses revealed that gene duplication, sequence divergence, and gene loss were proposed as the major modes of evolution of NBS-encoding genes in Cucurbitaceae species. Compared with NBS-encoding sequences from the Arabidopsis thaliana genome, the remaining seven TIR familes of NBS proteins and RGHs from Cucurbitaceae species have been shown to be phylogenetically distinct from the TIR family of NBS-encoding genes in Arabidopsis, except for two subfamilies (TIR4 and TIR9). On the other hand, in the CC-NBS family, they grouped closely with the CC family of NBS-encoding genes in Arabidopsis. Thus, the NBS-encoding genes in Cucurbitaceae crops are shown to be ancient, and NBS-encoding gene expansions (especially the TIR family) may have occurred before the divergence of Cucurbitaceae and Arabidopsis. Conclusion The results of this paper will provide a genomic framework

  14. Human xeroderma pigmentosum group G gene encodes a DNA endonuclease.

    PubMed Central

    Habraken, Y; Sung, P; Prakash, L; Prakash, S

    1994-01-01

    Because of defective nucleotide excision repair of ultraviolet damaged DNA, xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers. Cell fusion studies have identified seven XP complementation groups, A to G. Previous studies have implicated the products of these seven XP genes in the recognition of ultraviolet-induced DNA damage and in incision of the damage-containing DNA strand. Here, we express the XPG-encoded protein in Sf9 insect cells and purify it to homogeneity. We demonstrate that XPG is a single-strand specific DNA endonuclease, thus identifying the catalytic role of the protein in nucleotide excision repair. We suggest that XPG nuclease acts on the single-stranded region created as a result of the combined action of the XPB helicase and XPD helicase at the DNA damage site. Images PMID:8078765

  15. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    DOEpatents

    Jarvis, Eric E.; Roessler, Paul G.

    1999-01-01

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  16. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    DOEpatents

    Jarvis, E.E.; Roessler, P.G.

    1999-07-27

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.

  17. Characterization of a plasmid-encoded urease gene cluster found in members of the family Enterobacteriaceae.

    PubMed

    D'Orazio, S E; Collins, C M

    1993-03-01

    Plasmid-encoded urease gene clusters found in uropathogenic isolates of Escherichia coli, Providencia stuartii, and Salmonella cubana demonstrated DNA homology, similar positions of restriction endonuclease cleavage sites, and manners of urease expression and therefore represent the same locus. DNA sequence analysis indicated that the plasmid-encoded urease genes are closely related to the Proteus mirabilis urease genes. PMID:8449894

  18. Zebrafish tyrosine hydroxylase 2 gene encodes tryptophan hydroxylase.

    PubMed

    Ren, Guiqi; Li, Song; Zhong, Hanbing; Lin, Shuo

    2013-08-01

    The primary pathological hallmark of Parkinson disease (PD) is the profound loss of dopaminergic neurons in the substantia nigra pars compacta. To facilitate the understanding of the underling mechanism of PD, several zebrafish PD models have been generated to recapitulate the characteristics of dopaminergic (DA) neuron loss. In zebrafish studies, tyrosine hydroxylase 1 (th1) has been frequently used as a molecular marker of DA neurons. However, th1 also labels norepinephrine and epinephrine neurons. Recently, a homologue of th1, named tyrosine hydroxylase 2 (th2), was identified based on the sequence homology and subsequently used as a novel marker of DA neurons. In this study, we present evidence that th2 co-localizes with serotonin in the ventral diencephalon and caudal hypothalamus in zebrafish embryos. In addition, knockdown of th2 reduces the level of serotonin in the corresponding th2-positive neurons. This phenotype can be rescued by both zebrafish th2 and mouse tryptophan hydroxylase 1 (Tph1) mRNA as well as by 5-hydroxytryptophan, the product of tryptophan hydroxylase. Moreover, the purified Th2 protein has tryptophan hydroxylase activity comparable with that of the mouse TPH1 protein in vitro. Based on these in vivo and in vitro results, we conclude that th2 is a gene encoding for tryptophan hydroxylase and should be used as a marker gene of serotonergic neurons. PMID:23754283

  19. Phylogenetic analysis of the genus Plasmodium based on the gene encoding adenylosuccinate lyase.

    PubMed

    Kedzierski, Lukasz; Escalante, Ananias A; Isea, Raul; Black, Casilda G; Barnwell, John W; Coppel, Ross L

    2002-07-01

    Phylogenetic studies of the genus Plasmodium have been performed using sequences of the nuclear, mitochondrial and plastid genes. Here we have analyzed the adenylosuccinate lyase (ASL) gene, which encodes an enzyme involved in the salvage of host purines needed by malaria parasites for DNA synthesis. The ASL gene is present in several eukaryotic as well as prokaryotic organisms and does not have repeat regions, which facilitates the accuracy of the alignment. Furthermore, it has been shown that ASL is not subject to positive natural selection. We have sequenced the ASL gene of several different Plasmodium species infecting humans, rodents, monkeys and birds and used the obtained sequences along with the previously known P. falciparum ASL sequence, for structural and phylogenetic analysis of the genus Plasmodium. The genetic divergence of ASL is comparable with that observed in other nuclear genes such as cysteine proteinase, although ASL cannot be considered conserved when compared to aldolase or superoxide dismutase, which exhibit a slower rate of evolution. Nevertheless, a protein like ASL has a rate of evolution that provides enough information for elucidating evolutionary relationships. We modeled 3D structures of the ASL protein based on sequences used in the phylogenetic analysis and obtained a consistent structure for four different species despite the divergence observed. Such models would facilitate alignment in further studies with a greater number of plasmodial species or other Apicomplexa. PMID:12798008

  20. Assembly of NADH: ubiquinone reductase (complex I) in Neurospora mitochondria. Independent pathways of nuclear-encoded and mitochondrially encoded subunits.

    PubMed

    Tuschen, G; Sackmann, U; Nehls, U; Haiker, H; Buse, G; Weiss, H

    1990-06-20

    NADH:ubiquinone reductase, the respiratory chain complex I of mitochondria, consists of some 25 nuclear-encoded and seven mitochondrially encoded subunits, and contains as redox groups one FMN, probably one internal ubiquinone and at least four iron-sulphur clusters. We are studying the assembly of the enzyme in Neurospora crassa. The flux of radioactivity in cells that were pulse-labelled with [35S]methionine was followed through immunoprecipitable assembly intermediates into the holoenzyme. Labelled polypeptides were observed to accumulate transiently in a Mr 350,000 intermediate complex. This complex contains all mitochondrially encoded subunits of the enzyme as well as subunits encoded in the nucleus that have no homologous counterparts in a small, merely nuclear-encoded form of the NADH:ubiquinone reductase made by Neurospora crassa cells poisoned with chloramphenicol. With regard to their subunit compositions, the assembly intermediate and small NADH:ubiquinone reductase complement each other almost perfectly to give the subunit composition of the large complex I. These results suggest that two pathways exist in the assembly of complex I that independently lead to the preassembly of two major parts, which subsequently join to form the complex. One preassembled part is related to the small form of NADH:ubiquinone reductase and contributes most of the nuclear-encoded subunits, FMN, three iron-sulphur clusters and the site for the internal ubiquinone. The other part is the assembly intermediate and contributes all mitochondrially encoded subunits, one iron-sulphur cluster and the catalytic site for the substrate ubiquinone. We discuss the results with regard to the evolution of the electron pathway through complex I. PMID:2141652

  1. Genomic organization of the human NSP gene, prototype of a novel gene family encoding reticulons

    SciTech Connect

    Roebroek, A.J.M.; Ayoubi, T.A.Y.; Velde, H.J.K. van de; Schoenmakers, E.F.P.M.; Pauli, I.G.L.; Van De Ven, W.J.M.

    1996-03-01

    Recently, cDNA cloning and expression of three mRNA variants of the human NSP gene were described. This neuroendocrine-specific gene encodes three NSP protein isoforms with unique amino-terminal parts, but common carboxy-terminal parts. The proteins, with yet unknown function, are associated with the endoplasmic reticulum and therefore are named NSP reticulons. Potentially, these proteins are neuroendocrine markers of a novel category in human lung cancer diagnosis. Here, the genomic organization of this gene was studied by analysis of genomic clones isolated from lambda phage and YAC libraries. The NSP exons were found to be dispersed over a genomic region of about 275 kb. The present elucidation of the genomic organization of the NSP gene explains the generation of NSP mRNA variants encoding NSP protein isoforms. Multiple promoters rather than alternative splicing of internal exons seem to be involved in this diversity. Furthermore, comparison of NSP genomic and cDNA sequences with databank nucleotide sequences resulted in the discovery of other human members of this novel family of reticulons encoding genes. 25 refs., 4 figs.

  2. Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Pseudomonas putida.

    PubMed Central

    Allison, S L; Phillips, A T

    1990-01-01

    The hutC gene of Pseudomonas putida encodes a repressor which, in combination with the inducer urocanate, regulates expression of the five structural genes necessary for conversion of histidine to glutamate, ammonia, and formate. The nucleotide sequence of the hutC region was determined and found to contain two open reading frames which overlapped by one nucleotide. The first open reading frame (ORF1) appeared to encode a 27,648-dalton protein of 248 amino acids whose sequence strongly resembled that of the hut repressor of Klebsiella aerogenes (A. Schwacha and R. A. Bender, J. Bacteriol. 172:5477-5481, 1990) and contained a helix-turn-helix motif that could be involved in operator binding. The gene was preceded by a sequence which was nearly identical to that of the operator site located upstream of hutU which controls transcription of the hutUHIG genes. The operator near hutC would presumably allow the hut repressor to regulate its own synthesis as well as the expression of the divergent hutF gene. A second open reading frame (ORF2) would encode a 21,155-dalton protein, but because this region could be deleted with only a slight effect on repressor activity, it is not likely to be involved in repressor function or structure. PMID:2203753

  3. A putative novel nuclear-encoded subunit of the cytochrome c oxidase complex in trypanosomatids.

    PubMed

    Maslov, Dmitri A; Zíková, Alena; Kyselová, Iveta; Lukes, Julius

    2002-01-01

    A relatively large nuclear-encoded polypeptide, designated trCOIV, is found in the cytochrome c oxidase (CO) complex of trypanosomatids. In order to determine if this polypeptide represents a bona fide subunit of the complex, we have characterized the cDNA and the gene for this polypeptide in Leishmania tarentolae. Its nuclear gene has no sequence similarity to mammalian COIV. The trCOIV preprotein has a long mitochondrial targeting sequence of 31 residues. The mature polypeptide cofractionates with kinetoplast-mitochondria and its preferential mitochondrial localization was confirmed by immunofluorescence and immunoelectron microscopy. Based on the hydropathy plot analysis, the protein lacks pronounced transmembrane domains and likely occupies a peripheral position within the CO complex. The corresponding genes are also present in the sequenced portions of the Trypanosoma cruzi, Trypanosoma brucei and Leishmania major genomes, and the same polypeptide is found in cytochrome oxidase isolated from procyclic T. brucei and promastigote Leishmania mexicana amazonensis. However, the trCOIV gene, the mRNA and the polypeptide could not be detected in a respiration-deficient trypanosomatid Phytomonas serpens. PMID:12467979

  4. (Genetic engineering with a gene encoding a soybean storage protein). Progress report

    SciTech Connect

    Beachy, R.N.

    1985-01-01

    Progress is reported on research directed toward introducing a gene (Gmg 17.1) encoding the ..cap alpha..'-subunit of ..beta..-conglycinin, a soybean seed protein, into petunia plants using gene transfer mechanisms. (ACR)

  5. The maize brittle 1 gene encodes amyloplast membrane polypeptides.

    PubMed

    Sullivan, T D; Kaneko, Y

    1995-01-01

    A chimeric protein, formed of 56 amino acids from the carboxy terminus of the maize (Zea mays L.) wild-type Brittle1 (Bt1) protein fused to the glutathione-S-transferase gene, was synthesized in Escherichia coli, and used to raise antibodies. Following affinity purification, the antibodies recognized a set of 38- to 42-kDa proteins in endosperm from wild-type Bt1 plants, as well as from brittle2, shrunken2 and sugary1 plants, but not in mutant bt1 endosperm. Bt1 proteins were not detected with the preimmune antibodies. A low level of Bt1-specific proteins was detected at 10 d after pollination (DAP) and increased to a plateau at 16 DAP. At the same time, the ratio of slow- to fast-migrating forms of the protein decreased. During endosperm fractionation by differential centrifugation and membrane sedimentation in sucrose gradients, the Bt1 proteins co-purified with the carotenoid-containing plastid membranes. They were localized to amyloplasts by electron-microscopic immunocytochemistry; most of the signal was detected at the plastid periphery. These results are consistent with predictions made from the deduced amino-acid sequence and previous in-vitro experiments that the bt1 locus encodes amyloplast membrane proteins. PMID:7647682

  6. Expression cloning of genes encoding human peroxisomal proteins

    SciTech Connect

    Spathaky, J.M.; Tate, A.W.; Cox, T.M.

    1994-09-01

    Numerous metabolic disorders associated with diverse peroxisomal defects have been identified but their molecular characterization has been hampered by difficulties associated with the purification of proteins from this fragile organelle. We have utilized antibodies directed against the C-terminal tripeptide peroxisomal targeting signal to detect hitherto unknown peroxisomal proteins in tissue fractions and to isolate genes encoding peroxisonal proteins from human expression libraries. We immunized rabbits with a peptide conjugate encompassing the C-terminal nine amino acids of rat peroxisomal acyl CoA oxidase. Immunoprecipitation assays using radio-labelled peptide showed that the antibody specifically recognizes the terminal SKL motif as well as C-terminal SHL and SRL but not SHL at an internal position. Affinity-purified antibody was used to probe Western blots of crude and peroxisome-enriched monkey liver preparations and detected 8-10 proteins specifically in the peroxisome fractions. 100 positive clones were identified on screening a human liver cDNA expression library in {lambda}-gt11. Sequence analysis has confirmed the identity of cDNA clones for human acyl CoA oxidase and epoxide hydrolase. Four clones show no sequence identity and their putative role in the human peroxisome is being explored.

  7. Flower-enhanced expression of a nuclear-encoded mitochondrial respiratory protein is associated with changes in mitochondrion number.

    PubMed Central

    Huang, J; Struck, F; Matzinger, D F; Levings, C S

    1994-01-01

    The mitochondrial Rieske iron-sulfur protein is an obligatory component of the respiratory electron transport chain that is encoded by a single-copy gene in mammals and fungi. In contrast, this protein is encoded by a small gene family in dicotyledonous tobacco and monocotyledonous maize. We cloned four cDNAs from tobacco that encode the mitochondrial Rieske iron-sulfur protein. These clones, along with a previously isolated cDNA, represent five independent members of the gene family that can be divided into three subfamilies. All of these genes were derived from the two progenitor species and were expressed in amphidiploid tobacco. The proteins encoded by these five genes are probably functional because they all contain the universally conserved hexyl peptides necessary for the 2Fe-2S cluster formation. The expression of the Rieske protein gene family is differentially regulated; a 6- to 11-fold higher level of steady state transcripts was found in flowers than in leaves, stems, and roots. Members of at least two subfamilies were preferentially expressed in flowers, indicating that they share a common cis-regulatory element(s), which can respond to a flower-specific signal(s). Although approximately 10 times more transcripts occurred in flowers than in leaves, flower and leaf mitochondria contained a similar amount of the Rieske protein. Flowers, however, contained seven times more Rieske proteins than leaves. These results indicated an increase in mitochondrion number in flowers. High-energy demands during anther development might bring about an increase in mitochondrion numbers in flowers and the flower-enhanced expression of the Rieske protein gene family. Our results suggested that nuclear genes encoding mitochondrial respiratory proteins could sense and respond to changes in energy metabolism and/or changes in mitochondrion numbers. PMID:8180500

  8. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    PubMed Central

    Kim, Seongman; Ahn, Byung Chul; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication. PMID:22721961

  9. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    SciTech Connect

    Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.; Kim, Seong Kee

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  10. Inactivation of the Neurospora Crassa Gene Encoding the Mitochondrial Protein Import Receptor Mom19 by the Technique of ``sheltered Rip''

    PubMed Central

    Harkness, TAA.; Metzenberg, R. L.; Schneider, H.; Lill, R.; Neupert, W.; Nargang, F. E.

    1994-01-01

    We have used a technique referred to as ``sheltered RIP'' (repeat induced point mutation) to create mutants of the mom-19 gene of Neurospora crassa, which encodes an import receptor for nuclear encoded mitochondrial precursor proteins. Sheltered RIP permits the isolation of a mutant gene in one nucleus, even if that gene is essential for the survival of the organism, by sheltering the nucleus carrying the mutant gene in a heterokaryon with an unaffected nucleus. Furthermore, the nucleus harboring the RIPed gene contains a selectable marker so that it is possible to shift nuclear ratios in the heterokaryons to a state in which the nucleus containing the RIPed gene predominates in cultures grown under selective conditions. This results in a condition where the target gene product should be present at very suboptimal levels and allows the study of the mutant phenotype. One allele of mom-19 generated by this method contains 44 transitions resulting in 18 amino acid substitutions. When the heterokaryon containing this allele was grown under conditions favoring the RIPed nucleus, no MOM19 protein was detectable in the mitochondria of the strain. Homokaryotic strains containing the RIPed allele exhibit a complex and extremely slow growth phenotype suggesting that the product of the mom-19 gene is important in N. crassa. PMID:8138148

  11. A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription.

    PubMed Central

    Grépin, C; Dagnino, L; Robitaille, L; Haberstroh, L; Antakly, T; Nemer, M

    1994-01-01

    In contrast to skeletal muscle, the mechanisms responsible for activation and maintenance of tissue-specific transcription in cardiac muscle remain poorly understood. A family of hormone-encoding genes is expressed in a highly specific manner in cardiac but not skeletal myocytes. This includes the A- and B-type natriuretic peptide (ANP and BNP) genes, which encode peptide hormones with crucial roles in the regulation of blood volume and pressure. Since these genes are markers of cardiac cells, we have used them to probe the mechanisms for cardiac muscle-specific transcription. Cloning and functional analysis of the rat BNP upstream sequences revealed unexpected structural resemblance to erythroid but not to muscle-specific promoters and enhancers, including a requirement for regulatory elements containing GATA motifs. A cDNA clone corresponding to a member of the GATA family of transcription factors was isolated from a cardiomyocyte cDNA library. Transcription of this GATA gene is restricted mostly to the heart and is undetectable in skeletal muscle. Within the heart, GATA transcripts are localized in ANP- and BNP-expressing myocytes, and forced expression of the GATA protein in heterologous cells markedly activates transcription from the natural cardiac muscle-specific ANP and BNP promoters. This GATA-dependent pathway defines the first mechanism for cardiac muscle-specific transcription. Moreover, the present findings reveal striking similarities between the mechanisms controlling gene expression in hematopoietic and cardiac cells and may have important implications for studies of cardiogenesis. Images PMID:8164667

  12. Molecular cloning and characterization of a Bombyx mori gene encoding the transcription factor Atonal.

    PubMed

    Hu, Ping; Feng, Fan; Xia, Hengchuan; Chen, Liang; Yao, Qin; Chen, Keping

    2014-01-01

    The atonal genes are an evolutionarily conserved group of genes encoding regulatory basic helix-loop-helix (bHLH) transcription factors. These transcription factors have a critical antioncogenic function in the retina, and are necessary for cell fate determination through the regulation of the cell signal pathway. In this study, the atonal gene was cloned from Bombyx mori, and the transcription factor was named BmAtonal. Sequence analysis showed that the BmAtonal protein shares extensive homology with other invertebrate Atonal proteins with the bHLH motif. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analyses revealed that BmAtonal was expressed in all developmental stages of B. mori and various larval tissues. The BmAtonal protein was expressed in Escherichia coli, and polyclonal antibodies were raised against the purified protein. By immunofluorescence, the BmAtonal protein was localized to both the nucleus and cytoplasm of BmN cells. After knocking out nuclear localization signals (NLS), the BmAtonal protein was only detected in the cytoplasm. In addition, using the B. mori nuclear polyhedrosis virus (BmNPV) baculovirus expression system, the recombinant BmAtonal protein was successfully expressed in the B. mori cell line BmN. This work lays the foundation for exploring the biological functions of the BmAtonal protein, such as identifying its potential binding partners and understanding the molecular control of the formation of sensory organs. PMID:24873037

  13. The rolB gene activates the expression of genes encoding microRNA processing machinery.

    PubMed

    Bulgakov, Victor P; Veremeichik, Galina N; Shkryl, Yuri N

    2015-04-01

    The rolB gene of Agrobacterium rhizogenes renders cells more tolerant of environmental stresses and increases their defense potential. However, these effects, coupled with the developmental abnormalities caused by rolB, have not yet been explained. In rolB-transformed Arabidopsis thaliana cells, we detected a 2.2 to 7-fold increase in the expression of genes encoding core and accessory proteins (DCL1, SE, HYL1, AGO1, TGH, DDL, HEN1, AGO4 and RDR2) of the microRNA processing machinery. However, the rolB gene did not affect the expression of DCL2, DCL3 and HST. The diverse and complex effects of rolB on transformed plant cells may be attributable to changes caused by this gene in particular RNA silencing pathways. PMID:25491479

  14. Species-specific duplications of NBS-encoding genes in Chinese chestnut (Castanea mollissima)

    PubMed Central

    Zhong, Yan; Li, Yingjun; Huang, Kaihui; Cheng, Zong-Ming

    2015-01-01

    The disease resistance (R) genes play an important role in protecting plants from infection by diverse pathogens in the environment. The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) class of genes is one of the largest R gene families. Chinese chestnut (Castanea mollissima) is resistant to Chestnut Blight Disease, but relatively little is known about the resistance mechanism. We identified 519 NBS-encoding genes, including 374 NBS-LRR genes and 145 NBS-only genes. The majority of Ka/Ks were less than 1, suggesting the purifying selection operated during the evolutionary history of NBS-encoding genes. A minority (4/34) of Ka/Ks in non-TIR gene families were greater than 1, showing that some genes were under positive selection pressure. Furthermore, Ks peaked at a range of 0.4 to 0.5, indicating that ancient duplications arose during the evolution. The relationship between Ka/Ks and Ks indicated greater selective pressure on the newer and older genes with the critical value of Ks = 0.4–0.5. Notably, species-specific duplications were detected in NBS-encoding genes. In addition, the group of RPW8-NBS-encoding genes clustered together as an independent clade located at a relatively basal position in the phylogenetic tree. Many cis-acting elements related to plant defense responses were detected in promoters of NBS-encoding genes. PMID:26559332

  15. Species-specific duplications of NBS-encoding genes in Chinese chestnut (Castanea mollissima).

    PubMed

    Zhong, Yan; Li, Yingjun; Huang, Kaihui; Cheng, Zong-Ming

    2015-01-01

    The disease resistance (R) genes play an important role in protecting plants from infection by diverse pathogens in the environment. The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) class of genes is one of the largest R gene families. Chinese chestnut (Castanea mollissima) is resistant to Chestnut Blight Disease, but relatively little is known about the resistance mechanism. We identified 519 NBS-encoding genes, including 374 NBS-LRR genes and 145 NBS-only genes. The majority of Ka/Ks were less than 1, suggesting the purifying selection operated during the evolutionary history of NBS-encoding genes. A minority (4/34) of Ka/Ks in non-TIR gene families were greater than 1, showing that some genes were under positive selection pressure. Furthermore, Ks peaked at a range of 0.4 to 0.5, indicating that ancient duplications arose during the evolution. The relationship between Ka/Ks and Ks indicated greater selective pressure on the newer and older genes with the critical value of Ks = 0.4-0.5. Notably, species-specific duplications were detected in NBS-encoding genes. In addition, the group of RPW8-NBS-encoding genes clustered together as an independent clade located at a relatively basal position in the phylogenetic tree. Many cis-acting elements related to plant defense responses were detected in promoters of NBS-encoding genes. PMID:26559332

  16. RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

    SciTech Connect

    Sheren, Jamie E.; Kassenbrock, C. Kenneth

    2013-11-01

    Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequence (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.

  17. Cell type-specific transcriptional regulation of the gene encoding importin-{alpha}1

    SciTech Connect

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro; Department of Biochemistry, Graduate School of Medicine, Osaka University; JST, CREST, Graduate School of Frontier Biosciences, Osaka University, Yamada-oka, Suita, Osaka 565-0871

    2011-08-15

    Importin-{alpha}1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: {yields} We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. {yields} NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. {yields} Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  18. DNA sequence of a gene encoding a BALB/c mouse Ld transplantation antigen.

    PubMed

    Moore, K W; Sher, B T; Sun, Y H; Eakle, K A; Hood, L

    1982-02-01

    The sequence of a gene, denoted 27.5, encoding a transplantation antigen for the BALB/c mouse has been determined. Gene transfer studies and comparison of the translated sequence with the partial amino acid sequence of the Ld transplantation antigen establish that gene 27.5 encodes an Ld polypeptide. A comparison of the gene 27.5 sequence with several complementary DNA sequences suggests that the BALB/c mouse may contain a number of closely related L-like genes. Gene 27.5 has eight exons that correlate with the structural domains of the transplantation antigen. PMID:7058332

  19. A 47-kDa human nuclear protein recognized by antikinetochore autoimmune sera is homologous with the protein encoded by RCC1, a gene implicated in onset of chromosome condensation.

    PubMed Central

    Bischoff, F R; Maier, G; Tilz, G; Ponstingl, H

    1990-01-01

    Several autoimmune sera from patients with Raynaud phenomenon decorated mammalian kinetochores and bound to a 47-kDa protein on immunoblots of nuclear lysates. Antibody affinity-purified from immunoblots of the 47-kDa band recognized kinetochores, but due to crossreaction with an 18-kDa protein, localization remains elusive. We used one of these sera to purify the antigen from HeLa cells synchronized in mitosis as a noncovalent complex with a 25-kDa protein. The antigen was released from DNA by intercalation with 25 mM chloroquine. Ion-exchange chromatography yielded the pure complex with an apparent molecular size of 68 kDa, which was separated into its components by gel filtration in 6 M guanidinium chloride. Upon two-dimensional gel electrophoresis the 47-kDa protein gave two main spots of pI 6.6 and 6.7, respectively. Posttranslational modification is indicated by additional antigenic spots, by lack of a free alpha-amino group, and by chromatographic behavior of peptides on reversed-phase chromatography. The amino acid sequence for 205 residues of the 47-kDa protein has been established. This sequence is highly homologous with the translated reading frame of RCC1, a gene reportedly involved in regulating onset of mammalian chromosome condensation. Images PMID:2236072

  20. Phylogeny and molecular dating of the cerato-platanin-encoding genes

    PubMed Central

    Yu, Hanying; Li, Lin

    2014-01-01

    The cerato-platanin family consists of proteins that can induce immune responses, cause necrosis, change chemotaxis and locomotion and may be related to the growth and development of various fungi. In this work, we analyzed the phylogenetic relationships among genes encoding members of the cerato-platanin family and computed the divergence times of the genes and corresponding fungi. The results showed that cerato-platanin-encoding genes could be classified into 10 groups but did not cluster according to fungal classes or their functions. The genes transferred horizontally and showed duplication. Molecular dating and adaptive evolution analyses indicated that the cerato-platanin gene originated with the appearance of saprophytes and that the gene was under positive selection. This finding suggests that cerato-platanin-encoding genes evolved with the development of fungal parasitic characteristics. PMID:25071408

  1. SurfaceomeDB: a cancer-orientated database for genes encoding cell surface proteins.

    PubMed

    de Souza, Jorge Estefano Santana; Galante, Pedro Alexandre Favoretto; de Almeida, Renan Valieris Bueno; da Cunha, Julia Pinheiro Chagas; Ohara, Daniel Takatori; Ohno-Machado, Lucila; Old, Lloyd J; de Souza, Sandro José

    2012-01-01

    Cell surface proteins (CSPs) are excellent targets for the development of diagnostic and therapeutic reagents, and it is estimated that 10-20% of all genes in the human genome encode CSPs. In an effort to integrate all data publicly available for genes encoding cell surface proteins, a database (SurfaceomeDB) was developed. SurfaceomeDB is a gene-centered portal containing different types of information, including annotation for gene expression, protein domains, somatic mutations in cancer, and protein-protein interactions for all human genes encoding CSPs. SurfaceomeDB was implemented as an integrative and relational database in a user-friendly web interface, where users can search for gene name, gene annotation, or keywords. There is also a streamlined graphical representation of all data provided and links to the most important data repositories and databases, such as NCBI, UCSC Genome Browser, and EBI. PMID:23390370

  2. The Drosophila gene escargot encodes a zinc finger motif found in snail-related genes.

    PubMed

    Whiteley, M; Noguchi, P D; Sensabaugh, S M; Odenwald, W F; Kassis, J A

    1992-02-01

    Two independent P-element enhancer detection lines were obtained that express lacZ in a pattern of longitudinal stripes early in germband elongation. In this paper, molecular and genetic characterization of a gene located near these transposons is presented. Sequence analysis of a cDNA clone from the region reveals that this gene has a high degree of similarity with the Drosophila snail gene (Boulay et al., 1987). The sequence similarity extends over 400 nucleotides, and includes a region encoding five tandem zinc finger motifs (72% nucleotide identity; 76% amino acid identity). This region is also conserved in the snail homologue from Xenopus laevis (76% nucleotide identity; 83% amino acid identity) (Sargent and Bennett, 1990). We have named the Drosophila snail-related gene escargot (esg), and the region of sequence conservation common to all three genes the 'snailbox'. A number of Drosophila genomic DNA fragments cross-hybridize to a probe from the snailbox region suggesting that snail and escargot are members of a multigene family. The expression pattern of escargot is dynamic and complex. Early in germband elongation, escargot RNA is expressed in a pattern of longitudinal stripes identical to the one observed in the two enhancer detection lines. Later in development, escargot is expressed in cells that will form the larval imaginal tissues, escargot is allelic with l(2)35Ce, an essential gene located near snail in the genome. PMID:1571289

  3. A cysteine protease encoded by the baculovirus Bombyx mori nuclear polyhedrosis virus.

    PubMed Central

    Ohkawa, T; Majima, K; Maeda, S

    1994-01-01

    Sequence analysis of the BamHI F fragment of the genome of Bombyx mori nuclear polyhedrosis virus (BmNPV) revealed an open reading frame whose deduced amino acid sequence had homology to those of cysteine proteases of the papain superfamily. The putative cysteine protease sequence (BmNPV-CP) was 323 amino acids long and showed 35% identity to a cysteine proteinase precursor from Trypanosoma brucei. Of 36 residues conserved among cathepsins B, H, L, and S and papain, 31 were identical in BmNPV-CP. In order to determine the activity and function of the putative cysteine protease, a BmNPV mutant (BmCysPD) was constructed by homologous recombination of the protease gene with a beta-galactosidase gene cassette. BmCysPD-infected BmN cell extracts were significantly reduced in acid protease activity compared with wild-type virus-infected cell extracts. The cysteine protease inhibitor E-64 [trans-epoxysuccinylleucylamido-(4-guanidino)butane] inhibited wild-type virus-expressed protease activity. Deletion of the cysteine protease gene had no significant effect on viral growth or polyhedron production in BmN cells, indicating that the cysteine protease was not essential for viral replication in vitro. However, B. mori larvae infected with BmCysPD showed symptoms different from those of wild-type BmNPV-infected larvae, e.g., less degradation of the body, including fat body cells, white body surface color due presumably to undegraded epidermal cells, and an increase in the number of polyhedra released into the hemolymph. This is the first report of (i) a virus-encoded protease with activity on general substrates and (ii) evidence that a virus-encoded protease may play a role in degradation of infected larvae to facilitate horizontal transmission of the virus. Images PMID:8083997

  4. Evolution of the nuclear-encoded cytochrome oxidase subunits in vertebrates.

    PubMed

    Little, A G; Kocha, K M; Lougheed, S C; Moyes, C D

    2010-06-01

    Vertebrate mitochondrial cytochrome c oxidase (COX) possesses 10 nuclear-encoded subunits. Six subunits have paralogs in mammals, but the origins and distribution of isoforms among vertebrates have not been analyzed. We used Bayesian phylogenetic analysis to interpret the origins of each subunit, inferring the roles of gene and genome duplications. The paralogous ancestries of five genes were identical throughout the major vertebrate taxa: no paralogs of COX6c and COX7c, two paralogs of COX4 and COX6a, and three paralogs of COX7a. Two genes had an extra copy in teleosts (COX5a, COX5b), and three genes had additional copies in mammals (COX6b, COX7b, COX8). Focusing on early vertebrates, we examined structural divergence and explored transcriptional profiles across zebrafish tissues. Quantitative transcript profiles revealed dramatic differences in transcript abundance for different subunits. COX7b and COX4 transcripts were typically present at very low levels, whereas COX5a and COX8 were in vast excess in all tissues. For genes with paralogs, two general patterns emerged. For COX5a and COX8, there was ubiquitous expression of one paralog, with the other paralog in lower abundance in all tissues. COX4 and COX6a shared a distinct expression pattern, with one paralog dominant in brain and gills and the other in muscles. The isoform profiles in combination with phylogenetic analyses show that vertebrate COX isoform patterns are consistent with the hypothesis that early whole genome duplications in basal vertebrates governed the isoform repertoire in modern fish and tetrapods, though more recent lineage-specific gene/genome duplications also play a role in select subunits. PMID:20233836

  5. Molecular cloning and transcriptional analysis of the Aspergillus terreus gla1 gene encoding a glucoamylase.

    PubMed Central

    Ventura, L; González-Candelas, L; Pérez-González, J A; Ramón, D

    1995-01-01

    The Aspergillus terreus gla1 gene, coding for a glucoamylase, has been cloned by heterologous hybridization. The gene is interrupted by four introns and encodes a protein with an N-terminal catalytic domain and a C-terminal starch-binding domain. The expression of the gene is induced by starch and maltose and repressed by glucose. PMID:7534054

  6. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.

    PubMed

    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël

    2002-03-19

    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  7. Reduction of nuclear encoded enzymes of mitochondrial energy metabolism in cells devoid of mitochondrial DNA.

    PubMed

    Mueller, Edith E; Mayr, Johannes A; Zimmermann, Franz A; Feichtinger, René G; Stanger, Olaf; Sperl, Wolfgang; Kofler, Barbara

    2012-01-20

    Mitochondrial DNA (mtDNA) depletion syndromes are generally associated with reduced activities of oxidative phosphorylation (OXPHOS) enzymes that contain subunits encoded by mtDNA. Conversely, entirely nuclear encoded mitochondrial enzymes in these syndromes, such as the tricarboxylic acid cycle enzyme citrate synthase (CS) and OXPHOS complex II, usually exhibit normal or compensatory enhanced activities. Here we report that a human cell line devoid of mtDNA (HEK293 ρ(0) cells) has diminished activities of both complex II and CS. This finding indicates the existence of a feedback mechanism in ρ(0) cells that downregulates the expression of entirely nuclear encoded components of mitochondrial energy metabolism. PMID:22222373

  8. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    PubMed

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates. PMID:23441914

  9. Cloning, sequencing, and expression of bacteriophage BF23 late genes 24 and 25 encoding tail proteins.

    PubMed Central

    Nakayama, S; Kaneko, T; Ishimaru, H; Moriwaki, H; Mizobuchi, K

    1994-01-01

    Two bacteriophage BF23 late genes, genes 24 and 25, were isolated on a 7.4-kb PstI fragment from the phage DNA, and their nucleotide sequences were determined. Gene 24 encodes a minor tail protein with the expected M(r) of 34,309, and gene 25 located 4 bp upstream of gene 24 encodes a major tail protein with the expected M(r) of 50,329. When total cellular RNA isolated from either phage-infected cells or cells bearing the cloned genes was analyzed by the primer extension method using the primers specific to either gene 25 or gene 24, we identified a possible late gene promoter, designated P25, in the 5'-flanking region of gene 25. This promoter was similar in structure to Escherichia coli promoters for sigma 70. Studies of the translational gene 25- and gene 24-lacZ fusions in the cloned gene system revealed that the promoter P25 was responsible for the expression of both genes 25 and 24 even in the absence of the regulatory genes which were absolutely required for late gene expression in the normal phage-infected cells. These results indicate that the two genes constitute an operon under the control of P25 and that the regulatory gene products of BF23 do not participate directly in specifying the late gene promoter. Images PMID:7961500

  10. A single gene encodes a selective toxin causal to the development of tan spot of wheat.

    PubMed Central

    Ciuffetti, L M; Tuori, R P; Gaventa, J M

    1997-01-01

    The identification and characterization of pathogenicity factors are essential to an understanding of the molecular events that regulate the interaction of plant-pathogenic microbes with their hosts. We have isolated the gene that encodes a host-selective toxic protein produced by the fungus Pyrenophora tritici-repentis and confirmed that this gene functions in the plant as the primary determinant of pathogenicity in the Pyrenophora-wheat interaction. These results demonstrate that a single gene encodes the production of a host-selective toxin and that transformation of this gene into a non-toxin-producing isolate of P. tritici-repentis leads to both toxin production and pathogenicity. PMID:9061946

  11. RAmy2A; a novel alpha-amylase-encoding gene in rice.

    PubMed

    Huang, N; Reinl, S J; Rodriguez, R L

    1992-02-15

    The structure and expression of the alpha-amylase-encoding gene, RAmy2A, are described. This only representative of the Amy2 subfamily in rice differs from other cereal alpha-amylase-encoding genes in several respects. It contains the largest introns of all the cereal alpha-amylase-encoding genes examined to date. Moreover, the second of three introns in this gene contains a long inverted repeat sequence that can potentially form a large and stable stem-loop structure in the unspliced RNA transcript. Finally, RAmy2A is constitutively expressed at very low levels in germinated seeds, root, etiolated leaves, immature seeds and callus. This is in marked contrast to the Amy2 genes of wheat and barley which are highly expressed in the aleurone layer of the germinated seeds. PMID:1541400

  12. Transport of nuclear-encoded proteins into secondarily evolved plastids.

    PubMed

    Hempel, Franziska; Bozarth, Andrew; Sommer, Maik S; Zauner, Stefan; Przyborski, Jude M; Maier, Uwe-G

    2007-09-01

    Many algal groups evolved by engulfment and intracellular reduction of a eukaryotic phototroph within a heterotrophic cell. Via this process, so-called secondary plastids evolved, surrounded by three or four membranes. In these organisms most of the genetic material encoding plastid functions is localized in the cell nucleus, with the result that many proteins have to pass three, four, or even five membranes to reach their final destination within the plastid. In this article, we review recent models and findings that help to explain important cellular mechanisms involved in the complex process of protein transport into secondary plastids. PMID:17696773

  13. BamHI E region of the Epstein-Barr virus genome encodes three transformation-associated nuclear proteins.

    PubMed Central

    Ricksten, A; Kallin, B; Alexander, H; Dillner, J; Fåhraeus, R; Klein, G; Lerner, R; Rymo, L

    1988-01-01

    Recombinant vectors carrying DNA fragments from the BamHI E region of the B95-8 Epstein-Barr virus (EBV) genome were transfected into COS-1 cells, and the transient expression of EBV-encoded nuclear antigens (EBNAs) was analyzed by using polyvalent human antisera and rabbit antibodies to synthetic peptides. Vector DNA containing two rightward open reading frames in the BamHI E fragment, BERF2a and BERF2b, induced the expression of a nuclear antigen identical serologically and with respect to size to the larger of the two polypeptides previously designated as EBNA4 in B95-8 cells. An antigen corresponding to the smaller polypeptide was induced in cells transfected with constructs that contained two neighboring reading frames, BERF3 and BERF4. This antigen also reacted with a rabbit antiserum to the synthetic peptide 203, deduced from BERF4. Thus, the findings show that the two components of the EBNA4 doublet in B95-8 cells are encoded by separate genes. The antigen encoded by BERF2a and/or BERF2b has been designated as EBNA4 and the antigen encoded by BERF3 and/or BERF4 has been designated as EBNA6. Polyvalent human antisera detected EBNA4 and EBNA6 in 9 of 11 lymphoid cell lines carrying independent EBV isolates. In the remaining two lines, either EBNA4 or EBNA6 was not detectable. Images PMID:2829223

  14. A highly divergent gene cluster in honey bees encodes a novel silk family

    PubMed Central

    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

    2006-01-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins. PMID:17065612

  15. Divergence of genes encoding non-specific lipid transfer proteins in the poaceae family.

    PubMed

    Jang, Cheol Seong; Jung, Jae Hyeong; Yim, Won Cheol; Lee, Byung-Moo; Seo, Yong Weon; Kim, Wook

    2007-10-31

    The genes encoding non-specific lipid transfer proteins (nsLTPs), members of a small multigene family, show a complex pattern of expressional regulation, suggesting that some diversification may have resulted from changes in their expression after duplication. In this study, the evolution of nsLTP genes within the Poaceae family was characterized via a survey of the pseudogenes and unigenes encoding the nsLTP in rice pseudomolecules and the NCBI unigene database. nsLTP-rich regions were detected in the distal portions of rice chromosomes 11 and 12; these may have resulted from the most recent large segmental duplication in the rice genome. Two independent tandem duplications were shown to occur within the nsLTP-rich regions of rice. The genomic distribution of the nsLTP genes in the rice genome differs from that in wheat. This may be attributed to gene migration, chromosomal rearrangement, and/or differential gene loss. The genomic distribution pattern of nsLTP genes in the Poaceae family points to the existence of some differences among cereal nsLTP genes, all of which diverged from an ancient gene. The unigenes encoding nsLTPs in each cereal species are clustered into five groups. The somewhat different distribution of nsLTP-encoding EST clones between the groups across cereal species imply that independent duplication(s) followed by subfunctionalization (and/or neofunctionalization) of the nsLTP gene family in each species occurred during speciation. PMID:17978574

  16. A group III twintron encoding a maturase-like gene excises through lariat intermediates.

    PubMed Central

    Copertino, D W; Hall, E T; Van Hook, F W; Jenkins, K P; Hallick, R B

    1994-01-01

    The 1605 bp intron 4 of the Euglena gracilis chloroplast psbC gene was characterized as a group III twintron composed of an internal 1503 nt group III intron with an open reading frame of 1374 nt (ycf13, 458 amino acids), and an external group III intron of 102 nt. Twintron excision proceeds by a sequential splicing pathway. The splicing of the internal and external group III introns occurs via lariat intermediates. Branch sites were mapped by primer extension RNA sequencing. The unpaired adenosines in domains VI of the internal and external introns are covalently linked to the 5' nucleotide of the intron via 2'-5' phosphodiester bonds. This bond is susceptible to hydrolysis by the debranching activity of the HeLa nuclear S100 fraction. The internal intron and presumptive ycf13 mRNA accumulates primarily as a linear RNA, although a lariat precursor can also be detected. The ycf13 gene encodes a maturase-like protein that may be involved in group III intron metabolism. Images PMID:7512259

  17. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    SciTech Connect

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  18. The Agrobacterium rhizogenes GALLS Gene Encodes Two Secreted Proteins Required for Genetic Transformation of Plants▿

    PubMed Central

    Hodges, Larry D.; Lee, Lan-Ying; McNett, Henry; Gelvin, Stanton B.; Ream, Walt

    2009-01-01

    Agrobacterium tumefaciens and Agrobacterium rhizogenes are related pathogens that cause crown gall and hairy root diseases, which result from integration and expression of bacterial genes in the plant genome. Single-stranded DNA (T strands) and virulence proteins are translocated into plant cells by a type IV secretion system. VirD2 nicks a specific DNA sequence, attaches to the 5′ end, and pilots the DNA into plant cells. A. tumefaciens translocates single-stranded DNA-binding protein VirE2 into plant cells where it likely binds T strands and may aid in targeting them into the nucleus. Although some A. rhizogenes strains lack VirE2, they transfer T strands efficiently due to the GALLS gene, which complements an A. tumefaciens virE2 mutant for tumor formation. Unlike VirE2, full-length GALLS (GALLS-FL) contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. GALLS-FL and VirE2 contain nuclear localization signals (NLS) and secretion signals. Mutations in any of these domains abolish the ability of the GALLS gene to substitute for virE2. Here, we show that the GALLS gene encodes two proteins from one open reading frame: GALLS-FL and a protein comprised of the C-terminal domain, which initiates at an internal in-frame start codon. On some hosts, both GALLS proteins were required to substitute for VirE2. GALLS-FL tagged with yellow fluorescent protein localized to the nucleus of tobacco cells in an NLS-dependent manner. In plant cells, the GALLS proteins interacted with themselves, VirD2, and each other. VirD2 interacted with GALLS-FL and localized inside the nucleus, where its predicted helicase activity may pull T strands into the nucleus. PMID:18952790

  19. The naked endosperm Genes Encode Duplicate INDETERMINATE Domain Transcription Factors Required for Maize Endosperm Cell Patterning and Differentiation1[OPEN

    PubMed Central

    Yi, Gibum; Neelakandan, Anjanasree K.; Gontarek, Bryan C.; Vollbrecht, Erik; Becraft, Philip W.

    2015-01-01

    The aleurone is the outermost layer of cereal endosperm and functions to digest storage products accumulated in starchy endosperm cells as well as to confer important dietary health benefits. Whereas normal maize (Zea mays [Zm]) has a single aleurone layer, naked endosperm (nkd) mutants produce multiple outer cell layers of partially differentiated cells that show sporadic expression of aleurone identity markers such as a viviparous1 promoter-β-glucuronidase transgene. The 15:1 F2 segregation ratio suggested that two recessive genes were involved, and map-based cloning identified two homologous genes in duplicated regions of the genome. The nkd1 and nkd2 genes encode the INDETERMINATE1 domain (IDD) containing transcription factors ZmIDDveg9 and ZmIDD9 on chromosomes 2 and 10, respectively. Independent mutant alleles of nkd1 and nkd2, as well as nkd2-RNA interference lines in which both nkd genes were knocked down, also showed the nkd mutant phenotype, confirming the gene identities. In wild-type kernels, the nkd transcripts were most abundant around 11 to 16 d after pollination. The NKD proteins have putative nuclear localization signals, and green fluorescent protein fusion proteins showed nuclear localization. The mutant phenotype and gene identities suggest that NKD controls a gene regulatory network involved in aleurone cell fate specification and cell differentiation. PMID:25552497

  20. The naked endosperm genes encode duplicate INDETERMINATE domain transcription factors required for maize endosperm cell patterning and differentiation.

    PubMed

    Yi, Gibum; Neelakandan, Anjanasree K; Gontarek, Bryan C; Vollbrecht, Erik; Becraft, Philip W

    2015-02-01

    The aleurone is the outermost layer of cereal endosperm and functions to digest storage products accumulated in starchy endosperm cells as well as to confer important dietary health benefits. Whereas normal maize (Zea mays [Zm]) has a single aleurone layer, naked endosperm (nkd) mutants produce multiple outer cell layers of partially differentiated cells that show sporadic expression of aleurone identity markers such as a viviparous1 promoter-β-glucuronidase transgene. The 15:1 F2 segregation ratio suggested that two recessive genes were involved, and map-based cloning identified two homologous genes in duplicated regions of the genome. The nkd1 and nkd2 genes encode the INDETERMINATE1 domain (IDD) containing transcription factors ZmIDDveg9 and ZmIDD9 on chromosomes 2 and 10, respectively. Independent mutant alleles of nkd1 and nkd2, as well as nkd2-RNA interference lines in which both nkd genes were knocked down, also showed the nkd mutant phenotype, confirming the gene identities. In wild-type kernels, the nkd transcripts were most abundant around 11 to 16 d after pollination. The NKD proteins have putative nuclear localization signals, and green fluorescent protein fusion proteins showed nuclear localization. The mutant phenotype and gene identities suggest that NKD controls a gene regulatory network involved in aleurone cell fate specification and cell differentiation. PMID:25552497

  1. NBS-LRR-Encoding genes in sorghum and their role in plant defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nucleotide-binding site leucine-rich repeats (NBS-LRR) proteins are encoded by a large class of plant genes and many of them play an important role in plant defense against pest attack. Identification and characterization of the whole set of NBS-LRR genes in a plant genome will provide insights int...

  2. Characterization of GM-CSF-inhibitory factor and Uracil DNA glycosylase encoding genes from camel pseudocowpoxvirus.

    PubMed

    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Narnaware, S D; Mehta, S C; Singh, P K; Singh, Raghvendar; Tuteja, F C; Patil, N V

    2015-06-01

    The present study describes the PCR amplification of GM-CSF-inhibitory factor (GIF) and Uracil DNA glycosylase (UDG) encoding genes of pseudocowpoxvirus (PCPV) from the Indian Dromedaries (Camelus dromedarius) infected with contagious ecthyma using the primers based on the corresponding gene sequences of human PCPV and reindeer PCPV, respectively. The length of GIF gene of PCPV obtained from camel is 795 bp and due to the addition of one cytosine residue at position 374 and one adenine residue at position 516, the open reading frame (ORF) got altered, resulting in the production of truncated polypeptide. The ORF of UDG encoding gene of camel PCPV is 696 bp encoding a polypeptide of 26.0 kDa. Comparison of amino acid sequence homologies of GIF and UDG of camel PCPV revealed that the camel PCPV is closer to ORFV and PCPV (reference stains of both human and reindeer), respectively. PMID:25816930

  3. An essential yeast gene with homology to the exonuclease-encoding XRN1/KEM1 gene also encodes a protein with exoribonuclease activity

    SciTech Connect

    Kenna, M.; Douglas, M.G. ); Stevens, A. ); McCammon, M. )

    1993-01-01

    This is a study of a temperature-sensitive (ts) mutant from Saccharomyces cerevisiae which was obtained in a screen for mutants reduced in the synthesis of binding of a hybrid protein which competes for the transport of protein precursors into mitochondria. Examination of this mutant lead to the characterization of a gene with significant primary sequence homology to a previously identified gene, XRN1 or KEM1. Often called XRN1/KEM1, it encodes a protein of 175kDa which appears to have a multitude of properties, including involvement in recombination, RNA processing and turnover, involvement in recombination, RNA processing and turnover, microtubule function, karyogamy and DNA replication. The related gene describes further characterization of the HKE1/RAT1 gene and an hkal mutant and shows that p116 is a protein having 5[prime]-->3[prime] exoribonuclease activity, a major activity of the product of the related XRN1/KEM1 gene.

  4. THE BRASSICA RAPA ELONGATED INTERNODE (EIN) GENE ENCODES PHYTOCHROME B

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The elongated internode (ein) mutation of Brassica rapa leads to a deficiency in immunochemically detectable phytochrome B. Molecular analysis of the PHYB gene from ein indicates a deletion in the flanking DNA 5' of the ATG start codon, which could interfere either with PHYB transcription or process...

  5. The Novelty of Human Cancer/Testis Antigen Encoding Genes in Evolution

    PubMed Central

    Dobrynin, Pavel; Matyunina, Ekaterina; Malov, S. V.; Kozlov, A. P.

    2013-01-01

    In order to be inherited in progeny generations, novel genes should originate in germ cells. Here, we suggest that the testes may play a special “catalyst” role in the birth and evolution of new genes. Cancer/testis antigen encoding genes (CT genes) are predominantly expressed both in testes and in a variety of tumors. By the criteria of evolutionary novelty, the CT genes are, indeed, novel genes. We performed homology searches for sequences similar to human CT in various animals and established that most of the CT genes are either found in humans only or are relatively recent in their origin. A majority of all human CT genes originated during or after the origin of Eutheria. These results suggest relatively recent origin of human CT genes and align with the hypothesis of the special role of the testes in the evolution of the gene families. PMID:23691492

  6. Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

    2008-02-01

    The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

  7. The bat gene of Halobacterium halobium encodes a trans-acting oxygen inducibility factor.

    PubMed Central

    Gropp, F; Betlach, M C

    1994-01-01

    Oxygen and light affect the expression of the bacterioopsin gene (bop), which encodes a light-driven proton pump in the purple membrane of Halobacterium halobium. This response is thought to be mediated by a set of genes located adjacent to the bop gene. DNA fragments containing either the bop gene or the entire bop gene cluster reversed the phenotype of purple membrane-deficient strains with mutations in the bop gene. Purple membrane synthesis was constitutive in one of these strains transformed with the bop gene alone. The same strain transformed with the bop gene cluster was inducible by low oxygen tension. Moreover, another strain that constitutively expresses purple membrane remained constitutive when transformed with the bop gene alone but the phenotype of the strain changed to inducible when transformed with the bop gene cluster. Additional experiments have confirmed that one of the genes of the bop gene cluster, the bat gene, encodes a trans-acting factor that is necessary and sufficient to confer inducibility of purple membrane synthesis by low oxygen tension. Images PMID:8202511

  8. A rhomboid gene controls speciation through regulation of nuclear-mitochondrial compatibility in Triticum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The nuclear encoded species cytoplasm specific (scs) genes control nuclear-cytoplasmic compatibility in Triticum. Alloplasmic cells, which have nucleus and cytoplasm derived from different species, produce vigorous and vital organisms only when the correct version of scs is present in their nucleus....

  9. The herpes simplex virus 1 protein kinase encoded by the US3 gene mediates posttranslational modification of the phosphoprotein encoded by the UL34 gene.

    PubMed Central

    Purves, F C; Spector, D; Roizman, B

    1991-01-01

    Earlier studies have shown that a herpes simplex virus 1 (HSV-1) open reading frame, US3, encodes a novel protein kinase and have characterized the cognate amino acid sequence which is phosphorylated by this enzyme. This report identifies an apparently essential viral phosphoprotein whose posttranslational processing involves the viral protein kinase. Analyses of viral proteins phosphorylated in the course of productive infection revealed a phosphoprotein whose mobility was viral protein kinase and serotype dependent. Thus, the corresponding HSV-1 and HSV-2 phosphoproteins differ in their electrophoretic mobilities, and the phosphoprotein specified by the HSV-1 mutant deleted in US3 (R7041) differs from that of the corresponding HSV-1 and HSV-2 proteins. Analyses of HSV-1 x HSV-2 recombinants mapped the phosphoprotein between 0.42 and 0.47 map units on the prototype HSV-1 DNA map. Within this region, the UL34 open reading frame was predicted to encode a protein of appropriate molecular weight which would also contain the consensus target site for phosphorylation by the viral protein kinase as previously defined with synthetic peptides. Replacement of the native UL34 gene with a UL34 gene tagged with a 17-amino-acid epitope from the alpha 4 protein identified this gene as encoding the phosphoprotein. Finally, mutagenesis of the predicted phosphorylation site on UL34 in the viral genome, and specifically the substitution of threonine or serine with alanine in the product of the UL34 gene, yielded phosphoproteins whose electrophoretic mobilities could not be differentiated from that of the US3- mutant. We conclude that the posttranslational processing of the UL34 gene product to its wild-type phenotype requires the participation of the viral protein kinase. While the viral protein kinase is not essential for viral replication in cells in culture, the UL34 gene product itself may not be dispensable. Images PMID:1656069

  10. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  11. The gene encoding topoisomerase II from Plasmodium falciparum.

    PubMed Central

    Cheesman, S; McAleese, S; Goman, M; Johnson, D; Horrocks, P; Ridley, R G; Kilbey, B J

    1994-01-01

    The gene for topoisomerase II has been isolated from genomic libraries of strain K1 of the human malarial parasite, Plasmodium falciparum. The sequence reveals an open reading frame of 4194 nucleotides which predicts a polypeptide of 1398 amino acids. There are apparently no introns. The sequence is present as a single copy which has an identity of 47.4% and a similarity of 65.4% with its human homologue. Sequences conserved in topoisomerase II from other species are present in Pftopoisomerase II but in addition it has two adjacent asparagine-rich insertions which are unique to it. We have also detected asparagine-rich regions in the gene for PfDNA polymerase alpha. The gene for Pftopoisomerase II has been localised to chromosome 14 and northern analysis reveals a transcript of 5.8 kb. Two independent antisera raised in mice against glutathione-S-transferase fusion proteins containing the amino terminal portion of the malarial protein detect a weak band on western blots at about 160kDa, the expected size of the protein. Use of the same antisera for immunofluorescence analysis suggests that the protein is present at all stages of intraerythrocytic growth of the parasite. Images PMID:8041616

  12. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    SciTech Connect

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-06-05

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with I{kappa}B-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy.

  13. A sex recognition glycoprotein is encoded by the plus mating-type gene fus1 of Chlamydomonas reinhardtii.

    PubMed Central

    Ferris, P J; Woessner, J P; Goodenough, U W

    1996-01-01

    Sexual fusion between plus and minus gametes of the unicellular green alga Chlamydomonas reinhardtii entails adhesion between plus-specific and minus-specific "fringe" proteins displayed on the plasma membrane of gametic mating structures. We report the identification of the gene (fus1) encoding the plus fringe glycoprotein, which resides in a unique domain of the mating-type plus (mt+) locus, and which was identified by transposon insertions in three fusion-defective mutant strains. Transformation with fus1+ restores fringe and fusion competence to these mutants and to the pseudo-plus mutant imp11 mt-, defective in minus differentiation. The fus1 gene is remarkable in lacking the codon bias found in all other nuclear genes of C. reinhardtii. Images PMID:8856667

  14. Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

    PubMed Central

    Fisher, Susan H.; Wray, Lewis V.

    2002-01-01

    Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

  15. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    NASA Astrophysics Data System (ADS)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  16. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus).

    PubMed

    Yue, Jia-Xing; Holland, Nicholas D; Holland, Linda Z; Deheyn, Dimitri D

    2016-01-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians. PMID:27311567

  17. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    PubMed Central

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-01-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians. PMID:27311567

  18. Isolation and Functional Characterization of a Novel Gene Encoding a Dehydration Responsive Element Binding Transcription Factor from Populus euphratica.

    PubMed

    Wei, Li; Ma, Jiangtao; Wang, Suomin; Wu, Yanmin

    2016-01-01

    Dehydration responsive element binding (DREB) transcription factors (TFs) play a key role in regulating abiotic stress related genes. A new gene (PeDREB2b) encoding an unidentified DRE-binding protein was isolated from 20% PEG6000 treated Populus euphratica Oliv. seedlings by RT-PCR and RACE. Full length of PeDREB2b cDNA was 1110 bp, and an ORF of 870 bp, which encoded 289-amino-acids polypeptide, were included. The deduced amino acid sequence analysis revealed that this protein was a putative AP2/EREBP transcription factor with a conserved AP2/EREBP domain of 64 amino acids and a potential nuclear localization signal (NLS). Based on phylogenetic characterization, PeDREB2b was classified as a member of A-5 group belonged to the DREB family. The PeDREB2b gene is induced by salinization, low temperature, drought and phytohormones GA3, NAA and 6BA, but not by ABA treatment. The fact that the product of PeDREB2b as a DREB transcription factor was verified in our further experiment: the nuclear localization of the gene when it was expressed transiently as a GFP fusion in onion epidermal cells. In addition, PeDREB2b was capable of activating reporter gene expression. To study the salt and drought stress responses for PeDREB2b transgenic Arabidopsis thaliana in detail, integrated physiological, biochemical and genetic approach methods were used. Results indicated that the PeDREB2b gene was over-expressed under stress-inducible rd29A promotor in transgenic plants alleviates the adverse effects of environmental stresses. PMID:27001404

  19. Reduction of nuclear encoded enzymes of mitochondrial energy metabolism in cells devoid of mitochondrial DNA

    SciTech Connect

    Mueller, Edith E.; Mayr, Johannes A.; Zimmermann, Franz A.; Feichtinger, Rene G.; Stanger, Olaf; Sperl, Wolfgang; Kofler, Barbara

    2012-01-20

    Highlights: Black-Right-Pointing-Pointer We examined OXPHOS and citrate synthase enzyme activities in HEK293 cells devoid of mtDNA. Black-Right-Pointing-Pointer Enzymes partially encoded by mtDNA show reduced activities. Black-Right-Pointing-Pointer Also the entirely nuclear encoded complex II and citrate synthase exhibit reduced activities. Black-Right-Pointing-Pointer Loss of mtDNA induces a feedback mechanism that downregulates complex II and citrate synthase. -- Abstract: Mitochondrial DNA (mtDNA) depletion syndromes are generally associated with reduced activities of oxidative phosphorylation (OXPHOS) enzymes that contain subunits encoded by mtDNA. Conversely, entirely nuclear encoded mitochondrial enzymes in these syndromes, such as the tricarboxylic acid cycle enzyme citrate synthase (CS) and OXPHOS complex II, usually exhibit normal or compensatory enhanced activities. Here we report that a human cell line devoid of mtDNA (HEK293 {rho}{sup 0} cells) has diminished activities of both complex II and CS. This finding indicates the existence of a feedback mechanism in {rho}{sup 0} cells that downregulates the expression of entirely nuclear encoded components of mitochondrial energy metabolism.

  20. Analysis of genes encoding an alternative nitrogenase in the archaeon Methanosarcina barkeri 227.

    PubMed

    Chien, Y T; Auerbuch, V; Brabban, A D; Zinder, S H

    2000-06-01

    Methanosarcina barkeri 227 possesses two clusters of genes potentially encoding nitrogenases. We have previously demonstrated that one cluster, called nif2, is expressed under molybdenum (Mo)-sufficient conditions, and the deduced amino acid sequences for nitrogenase structural genes in that cluster most closely resemble those for the Mo nitrogenase of the gram-positive eubacterium Clostridium pasteurianum. The previously cloned nifH1 from M. barkeri shows phylogenetic relationships with genes encoding components of eubacterial Mo-independent eubacterial alternative nitrogenases and other methanogen nitrogenases. In this study, we cloned and sequenced nifD1 and part of nifK1 from M. barkeri 227. The deduced amino acid sequence encoded by nifD1 from M. barkeri showed great similarity with vnfD gene products from vanadium (V) nitrogenases, with an 80% identity at the amino acid level with the vnfD gene product from Anabaena variabilis. Moreover, there was a small open reading frame located between nifD1 and nifK1 with clear homology to vnfG, a hallmark of eubacterial alternative nitrogenases. Stimulation of diazotrophic growth of M. barkeri 227 by V in the absence of Mo was demonstrated. The unusual complement of nif genes in M. barkeri 227, with one cluster resembling that from a gram-positive eubacterium and the other resembling a eubacterial V nitrogenase gene cluster, suggests horizontal genetic transfer of those genes. PMID:10809706

  1. An Apicoplast Localized Ubiquitylation System Is Required for the Import of Nuclear-encoded Plastid Proteins

    PubMed Central

    Ponts, Nadia; van Dooren, Giel G.; Prudhomme, Jacques; Brooks, Carrie F.; Rodrigues, Elisadra M.; Tan, John C.; Ferdig, Michael T.; Striepen, Boris; Le Roch, Karine G.

    2013-01-01

    Apicomplexan parasites are responsible for numerous important human diseases including toxoplasmosis, cryptosporidiosis, and most importantly malaria. There is a constant need for new antimalarials, and one of most keenly pursued drug targets is an ancient algal endosymbiont, the apicoplast. The apicoplast is essential for parasite survival, and several aspects of its metabolism and maintenance have been validated as targets of anti-parasitic drug treatment. Most apicoplast proteins are nuclear encoded and have to be imported into the organelle. Recently, a protein translocon typically required for endoplasmic reticulum associated protein degradation (ERAD) has been proposed to act in apicoplast protein import. Here, we show ubiquitylation to be a conserved and essential component of this process. We identify apicoplast localized ubiquitin activating, conjugating and ligating enzymes in Toxoplasma gondii and Plasmodium falciparum and observe biochemical activity by in vitro reconstitution. Using conditional gene ablation and complementation analysis we link this activity to apicoplast protein import and parasite survival. Our studies suggest ubiquitylation to be a mechanistic requirement of apicoplast protein import independent to the proteasomal degradation pathway. PMID:23785288

  2. Experimental strategies for cloning or identifying genes encoding DNA-binding proteins.

    PubMed

    Carey, Michael F; Peterson, Craig L; Smale, Stephen T

    2012-02-01

    This article describes experimental strategies for cloning or identifying genes encoding DNA-binding proteins. DNA-binding proteins are most commonly identified by electrophoretic mobility-shift assay (EMSA) or DNase I footprinting. To identify the gene encoding a protein detected by EMSA or DNase footprinting, the protein often needs to be purified and its sequence analyzed, as described here. Other methods are also available which do not resort to protein purification, including the one-hybrid screen, in vitro expression library screen, and mammalian expression cloning. These methods are outlined, and their advantages and disadvantages are discussed. PMID:22301659

  3. Human Genetic Disorders Caused by Mutations in Genes Encoding Biosynthetic Enzymes for Sulfated Glycosaminoglycans*

    PubMed Central

    Mizumoto, Shuji; Ikegawa, Shiro; Sugahara, Kazuyuki

    2013-01-01

    A number of genetic disorders are caused by mutations in the genes encoding glycosyltransferases and sulfotransferases, enzymes responsible for the synthesis of sulfated glycosaminoglycan (GAG) side chains of proteoglycans, including chondroitin sulfate, dermatan sulfate, and heparan sulfate. The phenotypes of these genetic disorders reflect disturbances in crucial biological functions of GAGs in human. Recent studies have revealed that mutations in genes encoding chondroitin sulfate and dermatan sulfate biosynthetic enzymes cause various disorders of connective tissues. This minireview focuses on growing glycobiological studies of recently described genetic diseases caused by disturbances in biosynthetic enzymes for sulfated GAGs. PMID:23457301

  4. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    NASA Technical Reports Server (NTRS)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  5. Nuclear-encoded factors involved in post-transcriptional processing and modification of mitochondrial tRNAs in human disease

    PubMed Central

    Powell, Christopher A.; Nicholls, Thomas J.; Minczuk, Michal

    2015-01-01

    The human mitochondrial genome (mtDNA) encodes 22 tRNAs (mt-tRNAs) that are necessary for the intraorganellar translation of the 13 mtDNA-encoded subunits of the mitochondrial respiratory chain complexes. Maturation of mt-tRNAs involves 5′ and 3′ nucleolytic excision from precursor RNAs, as well as extensive post-transcriptional modifications. Recent data suggest that over 7% of all mt-tRNA residues in mammals undergo post-transcriptional modification, with over 30 different modified mt-tRNA positions so far described. These processing and modification steps are necessary for proper mt-tRNA function, and are performed by dedicated, nuclear-encoded enzymes. Recent growing evidence suggests that mutations in these nuclear genes (nDNA), leading to incorrect maturation of mt-tRNAs, are a cause of human mitochondrial disease. Furthermore, mtDNA mutations in mt-tRNA genes, which may also affect mt-tRNA function, processing, and modification, are also frequently associated with human disease. In theory, all pathogenic mt-tRNA variants should be expected to affect only a single process, which is mitochondrial translation, albeit to various extents. However, the clinical manifestations of mitochondrial disorders linked to mutations in mt-tRNAs are extremely heterogeneous, ranging from defects of a single tissue to complex multisystem disorders. This review focuses on the current knowledge of nDNA coding for proteins involved in mt-tRNA maturation that have been linked to human mitochondrial pathologies. We further discuss the possibility that tissue specific regulation of mt-tRNA modifying enzymes could play an important role in the clinical heterogeneity observed for mitochondrial diseases caused by mutations in mt-tRNA genes. PMID:25806043

  6. Cloning, nucleotide sequence, and expression of the Escherichia coli gene encoding carnitine dehydratase.

    PubMed Central

    Eichler, K; Schunck, W H; Kleber, H P; Mandrand-Berthelot, M A

    1994-01-01

    Carnitine dehydratase from Escherichia coli O44 K74 is an inducible enzyme detectable in cells grown anaerobically in the presence of L-(-)-carnitine or crotonobetaine. The purified enzyme catalyzes the dehydration of L-(-)-carnitine to crotonobetaine (H. Jung, K. Jung, and H.-P. Kleber, Biochim. Biophys. Acta 1003:270-276, 1989). The caiB gene, encoding carnitine dehydratase, was isolated by oligonucleotide screening from a genomic library of E. coli O44 K74. The caiB gene is 1,215 bp long, and it encodes a protein of 405 amino acids with a predicted M(r) of 45,074. The identity of the gene product was first assessed by its comigration in sodium dodecyl sulfate-polyacrylamide gels with the purified enzyme after overexpression in the pT7 system and by its enzymatic activity. Moreover, the N-terminal amino acid sequence of the purified protein was found to be identical to that predicted from the gene sequence. Northern (RNA) analysis showed that caiB is likely to be cotranscribed with at least one other gene. This other gene could be the gene encoding a 47-kDa protein, which was overexpressed upstream of caiB. Images PMID:8188598

  7. Genetic location of genes encoding enterobacterial common antigen.

    PubMed Central

    Meier, U; Mayer, H

    1985-01-01

    A new rff mutation (rff-726) of Escherichia coli is described which affects the biosynthesis of the enterobacterial common antigen. This mutation was detected in an rfe-defective strain. A Tn10 insertion near the rfe locus was isolated to facilitate further mapping. Both mutations rfe and rff were mapped by transduction with bacteriophage P1, giving the gene order ilv rfe rff uvrD metE. The F' factor F14 was able to complement both mutations rfe and rff, whereas the F' factor F16 could complement the rfe but not the rff mutation. The rff mutation did not affect the biosynthesis of N-acetyl-D-mannosaminuronic acid, as the previously described rff mutations in Salmonella typhimurium do (H. C. Lew, H. Nikaido, and P. H. Mäkelä, J. Bacteriol. 136:227-233, 1978), and also did not affect the biosynthesis of other enterobacterial common antigen components; however, the biosynthesis of the complete enterobacterial common antigen molecule was blocked. PMID:3894334

  8. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    PubMed Central

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran

    2011-01-01

    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  9. Concerted evolution of the tandemly repeated genes encoding primate U2 small nuclear RNA (the RNU2 locus) does not prevent rapid diversification of the (CT){sub n} {center_dot} (GA){sub n} microsatellite embedded within the U2 repeat unit

    SciTech Connect

    Liao, D.; Weiner, A.M.

    1995-12-10

    The RNU2 locus encoding human U2 small nuclear RNA (snRNA) is organized as a nearly perfect tandem array containing 5 to 22 copies of a 5.8-kb repeat unit. Just downstream of the U2 snRNA gene in each 5.8-kb repeat unit lies a large (CT){sub n}{center_dot}(GA){sub n} dinucleotide repeat (n {approx} 70). This form of genomic organization, in which one repeat is embedded within another, provides an unusual opportunity to study the balance of forces maintaining the homogeneity of both kinds of repeats. Using a combination of field inversion gel electrophoresis and polymerase chain reaction, we have been able to study the CT microsatellites within individual U2 tandem arrays. We find that the CT microsatellites within an RNU2 allele exhibit significant length polymorphism, despite the remarkable homogeneity of the surrounding U2 repeat units. Length polymorphism is due primarily to loss or gain of CT dinucleotide repeats, but other types of deletions, insertions, and substitutions are also frequent. Polymorphism is greatly reduced in regions where pure (CT){sub n} tracts are interrupted by occasional G residues, suggesting that irregularities stabilize both the length and the sequence of the dinucleotide repeat. We further show that the RNU2 loci of other catarrhine primates (gorilla, chimpanzee, ogangutan, and baboon) contain orthologous CT microsatellites; these also exhibit length polymorphism, but are highly divergent from each other. Thus, although the CT microsatellite is evolving far more rapidly than the rest of the U2 repeat unit, it has persisted through multiple speciation events spanning >35 Myr. The persistence of the CT microsatellite, despite polymorphism and rapid evolution, suggests that it might play a functional role in concerted evolution of the RNU2 loci, perhaps as an initiation site for recombination and/or gene conversion. 70 refs., 5 figs.

  10. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    PubMed

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum. PMID:9310943

  11. Arabidopsis thaliana contains a single gene encoding squalene synthase.

    PubMed

    Busquets, Antoni; Keim, Verónica; Closa, Marta; del Arco, Ana; Boronat, Albert; Arró, Montserrat; Ferrer, Albert

    2008-05-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate (FPP) to produce squalene (SQ), the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. Arabidopsis thaliana contains two SQS-annotated genomic sequences, At4g34640 (SQS1) and At4g34650 (SQS2), organized in a tandem array. Here we report that the SQS1 gene is widely expressed in all tissues throughout plant development, whereas SQS2 is primarily expressed in the vascular tissue of leaf and cotyledon petioles, and the hypocotyl of seedlings. Neither the complete A. thaliana SQS2 protein nor the chimeric SQS resulting from the replacement of the 69 C-terminal residues of SQS2 by the 111 C-terminal residues of the Schizosaccharomyces pombe SQS were able to confer ergosterol prototrophy to a Saccharomyces cerevisiae erg9 mutant strain lacking SQS activity. A soluble form of SQS2 expressed in Escherichia coli and purified was unable to synthesize SQ from FPP in the presence of NADPH and either Mg2+ or Mn2+. These results demonstrated that SQS2 has no SQS activity, so that SQS1 is the only functional SQS in A. thaliana. Mutational studies revealed that the lack of SQS activity of SQS2 cannot be exclusively attributed to the presence of an unusual Ser replacing the highly conserved Phe at position 287. Expression of green fluorescent protein (GFP)-tagged versions of SQS1 in onion epidermal cells demonstrated that SQS1 is targeted to the endoplasmic reticulum (ER) membrane and that this location is exclusively dependent on the presence of the SQS1 C-terminal hydrophobic trans-membrane domain. PMID:18236008

  12. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    PubMed Central

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-01-01

    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  13. Characterization of the BMR1 gene encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae.

    PubMed

    Kihara, Junichi; Moriwaki, Akihiro; Tanaka, Nozomi; Tanaka, Chihiro; Ueno, Makoto; Arase, Sakae

    2008-04-01

    We isolated and characterized Bipolaris melanin regulation 1 gene (BMR1) encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae. Sequence analysis showed that the BMR1 gene encodes a putative protein of 1012 amino acids that has 99% sequence similarity to transcription factor Cmr1 of Cochliobolus heterostrophus. The predicted B. oryzae Bmr1 protein has two DNA-binding motifs, two Cys2His2 zinc finger domains, and a Zn(II)2Cys6 binuclear cluster domain at the N-terminal region of Bmr1. Targeted disruption of the BMR1 gene showed that BMR1 is essential for melanin biosynthesis in B. oryzae. The overexpression of the BMR1 gene led to more dark colonies than in the wild-type strain under dark conditions. Real-time PCR analysis showed that the BMR1 expression of the overexpression transformant was about 10-fold that of the wild type under dark conditions and of the expression of three melanin biosynthesis genes. These results indicated that BMR1 encodes the transcription factor of melanin biosynthesis genes in B. oryzae. PMID:18312572

  14. Borrelia burgdorferi supercoiled plasmids encode multicopy tandem open reading frames and a lipoprotein gene family.

    PubMed Central

    Porcella, S F; Popova, T G; Akins, D R; Li, M; Radolf, J D; Norgard, M V

    1996-01-01

    DNA sequencing and Southern blot analyses of a Borrelia burgdorferi DNA fragment encoding a signal sequence led to the discovery of a genetic locus, designated 2.9, which appears to be present in at least seven copies in virulent B. burgdorferi 297. DNA sequence analysis of these regions revealed that each 2.9 locus contained an operon of four genes (ABCD) and open reading frames designated rep+ (positive strand) and rep- (negative strand) which encoded multiple repeat motifs. Downstream of the rep+ gene(s) in six of the completely cloned and sequenced 2.9 loci also were lipoprotein (LP) genes possessing highly similar signal sequences but encoding variable mature polypeptides. The lipoproteins could he separated into two classes on the basis of hydrophilicity profiles, sequence similarities, and reactivity with specific antibodies. The 2.9 loci were localized to two (20- and 30-kb) supercoiled plasmids in B. burgdorferi 297. Northern (RNA) blot analysis established that the 2.9 ABCD operon was only minimally expressed, whereas the rep- gene(s) and at least three of the seven LP genes were expressed by B. burgdorferi in vitro. A single putative promoter element was identified by RNA primer extension analysis upstream of the ABCD operon, whereas a number of potential promoter regions existed upstream of the LP genes. The combined data indicate that the ABCD operon, rep+ and rep- genes, and LP genes are separately transcribed during in vitro growth. The 2.9 loci possess a repetitiveness, diversity, and complexity not previously described for B. burgdorferi; differential expression of these genes may facilitate the spirochete's ability to survive in diverse host environments. PMID:8655511

  15. Molecular cloning and characterization of the pgm gene encoding phosphoglucomutase of Escherichia coli.

    PubMed Central

    Lu, M; Kleckner, N

    1994-01-01

    We report here the identification and characterization of pgm, a gene in Escherichia coli that encodes the enzyme phosphoglucomutase, specifically required for the catalysis of the interconversion of glucose 1-phosphate and glucose 6-phosphate. The predicted amino acid sequence of the pgm gene is highly conserved in E. coli, Acetobacter xylinum, Saccharomyces cerevisiae, rabbits, and humans. pgm deletion mutant strains are deficient in phosphoglucomutase activity. Images PMID:8083177

  16. Genes Encoding Phospholipases A2 Mediate Insect Nodulation Reactions to Bacterial Challenge

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We propose that expression of four genes encoding secretory phospholipases A2 (sPLA2) mediates insect nodulation responses to bacterial infection. Nodulation is the quantitatively predominant cellular defense reaction to bacterial infection. This reaction is mediated by eicosanoids, the biosynthesis...

  17. Haplotypes of the steroid 21-hydroxylase gene region encoding mild steroid 21-hydroxylase deficiency.

    PubMed Central

    Haglund-Stengler, B; Martin Ritzén, E; Gustafsson, J; Luthman, H

    1991-01-01

    Haplotypes of the complement 4 (C4) and steroid 21-hydroxylase [21-OHase; steroid hydrogen-donor: oxygen oxidoreductase (21-hydroxylating), EC 1.14.99.10] repeated gene complex were studied in nine families with at least one member affected with a mild form of 21-OHase deficiency. DNA probes from different parts of the repeated C4/21-OHase unit were used to follow the segregation of hybridization patterns in the families. Ten structurally distinct haplotypes of the C4/21-OHase gene region were identified, and the encoded phenotype was assigned to 34 of the 36 C4/21-OHase haplotypes. Four structurally different haplotypes with three C4/21-OHase repeat units were found. Eight of the nine haplotypes found with triplications of the C4/21-OHase repeat unit encoded the mild form of 21-OHase deficiency, whereas one particular triplicated haplotype encoded a severe form of the disease. In one case the mild form of 21-OHase deficiency was encoded by a haplotype with a single C4/21-OHase repeat unit. Mild 21-OHase deficiency was predicted in a patient by the presence of a triplicated haplotype. The finding of deranged 21-OHase genes on all triplicated C4/21-OHase haplotypes indicate that most of these common haplotypes carry mutated 21-OHase genes, and thus may cause functional polymorphism of general importance in the population. PMID:1924294

  18. Multiple proteins encoded within the urease gene complex of Proteus mirabilis.

    PubMed

    Walz, S E; Wray, S K; Hull, S I; Hull, R A

    1988-03-01

    Chromosomal DNA fragments from a uropathogenic isolate of Proteus mirabilis were inserted into the cosmid vector pHC79 to construct a genomic library in Escherichia coli HB101. A urease-positive recombinant cosmid, designated pSKW1, was recovered. Sequential recombinant manipulation of pSKW1 yielded a 10.2-kilobase plasmid, designated pSKW4, which encoded three urease isozymes with electrophoretic mobilities identical to those of the donor P. mirabilis strain. Plasmid pSKW4 gene sequences encode seven proteins designated 68K (apparent molecular weight, of 68,000), 28K, 25K, 22.5K, 18.5K, 7.5K, and 5.2K within the limits of the urease gene complex. Insertion mutations in genes encoding the 68K, 28K, 25K, 22.5K, 7.5K, and 5.2K proteins resulted in complete or partial (22.5K) loss of urease activity. There was no reduction in urease activity when the gene encoding the 18.5K protein was inactivated. PMID:2830226

  19. The cloning and expression of a gene encoding haemolytic activity from the fish pathogen Renibacterium salmoninarum.

    PubMed

    Evenden, A J; Gilpin, M L; Munn, C B

    1990-09-01

    A gene encoding haemolytic activity from Renibacterium salmoninarum (strain PPD) was cloned into Escherichia coli using the cosmid vector pHC79, and subsequently subcloned on a 1.6 kbp SAlI fragment into pBR328. Southern blot hybridisation revealed that a homologous sequence is found in other strains of R. salmoninarum. PMID:2276613

  20. Cloning of human genes encoding novel G protein-coupled receptors

    SciTech Connect

    Marchese, A.; Docherty, J.M.; Heiber, M.

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  1. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.

    PubMed

    Conner, T W; Thompson, M D; Silflow, C D

    1989-12-14

    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  2. Nucleotide sequence and expression of alpha-glucosidase-encoding gene (agdA) from Aspergillus oryzae.

    PubMed

    Minetoki, T; Gomi, K; Kitamoto, K; Kumagai, C; Tamura, G

    1995-08-01

    We have isolated an alpha-glucosidase(AGL)-encoding gene (agdA) from Aspergillus oryzae by heterologous hybridization using the corresponding Aspergillus niger gene as a probe. Southern hybridization analysis showed that the agdA gene is on a 5.0-kb ScaI fragment and there is a single copy in the A. oryzae chromosome. Comparison with the A. niger agdA gene indicated that the agdA gene contains three putative introns from 52 to 59 nucleotides long, and that it encodes 985 amino acid residues. The deduced amino acid sequence of A. oryzae AGL is 78% homologous with the A. niger AGL. The high degree of homology with the amino acid sequence bordering the putative catalytic residue of a number of AGL enzymes, and this enzyme suggests that Asp492 is a catalytic residue of A. oryzae AGL. The cloned gene was functional. Transformants of A. oryzae containing multiple copies of the cloned agdA gene showed a 6-16 fold increase in AGL activity. Like the Taka-amylase A and glucoamylase genes of A. oryzae, expression of the agdA gene was induced when maltose was provided as a carbon source, but expression was not induced by glucose. This result suggested that cis-element(s) involved in maltose induction may be also present in the agdA promoter region. PMID:7549103

  3. Genes Encoding Cher-TPR Fusion Proteins Are Predominantly Found in Gene Clusters Encoding Chemosensory Pathways with Alternative Cellular Functions

    PubMed Central

    Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino

    2012-01-01

    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  4. Multiple conversion between the genes encoding bacterial class-I release factors

    PubMed Central

    Ishikawa, Sohta A.; Kamikawa, Ryoma; Inagaki, Yuji

    2015-01-01

    Bacteria require two class-I release factors, RF1 and RF2, that recognize stop codons and promote peptide release from the ribosome. RF1 and RF2 were most likely established through gene duplication followed by altering their stop codon specificities in the common ancestor of extant bacteria. This scenario expects that the two RF gene families have taken independent evolutionary trajectories after the ancestral gene duplication event. However, we here report two independent cases of conversion between RF1 and RF2 genes (RF1-RF2 gene conversion), which were severely examined by procedures incorporating the maximum-likelihood phylogenetic method. In both cases, RF1-RF2 gene conversion was predicted to occur in the region encoding nearly entire domain 3, of which functions are common between RF paralogues. Nevertheless, the ‘direction’ of gene conversion appeared to be opposite from one another—from RF2 gene to RF1 gene in one case, while from RF1 gene to RF2 gene in the other. The two cases of RF1-RF2 gene conversion prompt us to propose two novel aspects in the evolution of bacterial class-I release factors: (i) domain 3 is interchangeable between RF paralogues, and (ii) RF1-RF2 gene conversion have occurred frequently in bacterial genome evolution. PMID:26257102

  5. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    PubMed Central

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged H4 variant (hH4v) not described in other species. The hH4-1 and hH4-2 genes, which are 96% identical in their coding regions and encode identical proteins, were inactivated independently. Strains with inactivating mutations in either gene were phenotypically wild type, in terms of growth rates and fertility, but the double mutants were inviable. As expected, we were unable to isolate null alleles of hH2A, hH2B, or hH3. The genomic arrangement of the histone and histone variant genes was determined. hH2Az and the hH3-hH4-1 gene pair are on LG IIR, with hH2Az centromere-proximal to hH3-hH4-1 and hH3 centromere-proximal to hH4-1. hH3v and hH4-2 are on LG IIIR with hH3v centromere-proximal to hH4-2. hH4v is on LG IVR and the hH2A-hH2B pair is located immediately right of the LG VII centromere, with hH2A centromere-proximal to hH2B. Except for the centromere-distal gene in the pairs, all of the histone genes are transcribed toward the centromere. Phylogenetic analysis of the N. crassa histone genes places them in the Euascomycota lineage. In contrast to the general case in eukaryotes, histone genes in euascomycetes are few in number and contain introns. This may be a reflection of the evolution of the RIP (repeat-induced point mutation) and MIP (methylation induced premeiotically) processes that detect sizable duplications and silence associated genes. PMID:11901114

  6. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  7. The human NFKB3 gene encoding the p65 subunit of transcription factor NF-[sub K]B is located on chromosome 11q12

    SciTech Connect

    Deloukas, P.; Loon, A.P.G.M. van ); Dauwerse, J.G.; Ommen, G.J.B. van )

    1994-02-01

    A YAC clone that contains the human gene NFKB3, encoding the p65 subunit of transcription factor nuclear factor [sub K]B (NF-[sub K]B), was isolated. The YAC contains the entire NFKB3 gene, which is smaller than 15 kb and present in a single copy in the genome. Fluorescence in situ hybridization with metaphase chromosomes showed two different chromosomal locations (11q12 and Xp11.4) for sequences present in the YAC. The NFKB3 gene was assigned to chromosome 11q12 by PCR analysis of a panel of relevant hybrid cell lines. Thus, no linkage exists between NFKB3 and genes encoding other known members of the NF-[sub K]B family. 20 refs., 2 figs.

  8. Systematic Identification and Characterization of Novel Human Skin-Associated Genes Encoding Membrane and Secreted Proteins

    PubMed Central

    Buhren, Bettina Alexandra; Martinez, Cynthia; Schrumpf, Holger; Gasis, Marcia; Grether-Beck, Susanne; Krutmann, Jean

    2013-01-01

    Through bioinformatics analyses of a human gene expression database representing 105 different tissues and cell types, we identified 687 skin-associated genes that are selectively and highly expressed in human skin. Over 50 of these represent uncharacterized genes not previously associated with skin and include a subset that encode novel secreted and plasma membrane proteins. The high levels of skin-associated expression for eight of these novel therapeutic target genes were confirmed by semi-quantitative real time PCR, western blot and immunohistochemical analyses of normal skin and skin-derived cell lines. Four of these are expressed specifically by epidermal keratinocytes; two that encode G-protein-coupled receptors (GPR87 and GPR115), and two that encode secreted proteins (WFDC5 and SERPINB7). Further analyses using cytokine-activated and terminally differentiated human primary keratinocytes or a panel of common inflammatory, autoimmune or malignant skin diseases revealed distinct patterns of regulation as well as disease associations that point to important roles in cutaneous homeostasis and disease. Some of these novel uncharacterized skin genes may represent potential biomarkers or drug targets for the development of future diagnostics or therapeutics. PMID:23840300

  9. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.

    PubMed

    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G

    1992-08-01

    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  10. Identification of the Gene Encoding the Enzyme Deficient in Mucopolysaccharidosis IIIC (Sanfilippo Disease Type C)

    PubMed Central

    Fan, Xiaolian; Zhang, Huiwen; Zhang, Sunqu; Bagshaw, Richard D.; Tropak, Michael B.; Callahan, John W.; Mahuran, Don J.

    2006-01-01

    Mucopolysaccharidosis IIIC (MPS IIIC), or Sanfilippo C, represents the only MPS disorder in which the responsible gene has not been identified; however, the gene has been localized to the pericentromeric region of chromosome 8. In an ongoing proteomics study of mouse lysosomal membrane proteins, we identified an unknown protein whose human homolog, TMEM76, was encoded by a gene that maps to 8p11.1. A full-length mouse expressed sequence tag was expressed in human MPS IIIC fibroblasts, and its protein product localized to the lysosome and corrected the enzymatic defect. The mouse sequence was used to identify the full-length human homolog (HGSNAT), which encodes a protein with no homology to other proteins of known function but is highly conserved among plants and bacteria. Mutational analyses of two MPS IIIC cell lines identified a splice-junction mutation that accounted for three mutant alleles, and a single base-pair insertion accounted for the fourth. PMID:16960811

  11. Cloning and expression analysis of a prion protein encoding gene in guppy ( Poecilia reticulata)

    NASA Astrophysics Data System (ADS)

    Wu, Suihan; Wei, Qiwei; Yang, Guanpin; Wang, Dengqiang; Zou, Guiwei; Chen, Daqing

    2008-11-01

    The full length cDNA of a prion protein (PrP) encoding gene of guppy ( Poecilia reticulata) and the corresponding genomic DNA were cloned. The cDNA was 2245 bp in length and contained an open reading frame (ORF) of 1545 bp encoding a protein of 515 amino acids, which held all typical structural characteristics of the functional PrP. The cloned genomic DNA fragment corresponding to the cDNA was 3720 bp in length, consisting of 2 introns and 2 exons. The 5' untranslated region of cDNA originated from the 2 exons, while the ORF originated from the second exon. Although the gene was transcribed in diverse tissues including brain, eye, liver, intestine, muscle and tail, its transcript was most abundant in the brain. In addition, the transcription of the gene was enhanced by 5 salinity, implying that it was associated with the response of guppy to saline stress.

  12. A novel gene encoding amidinotransferase in the cylindrospermopsin producing cyanobacterium Aphanizomenon ovalisporum.

    PubMed

    Shalev-Alon, Gali; Sukenik, Assaf; Livnah, Oded; Schwarz, Rakefet; Kaplan, Aaron

    2002-03-19

    The hepatotoxin cylindrospermopsin is produced by several cyanobacteria species, which may flourish in tropical and sub-tropical lakes. Biosynthesis of cylindrospermopsin is poorly understood but its chemical nature, and feeding experiments with stable isotopes, suggested that guanidinoacetic acid is the starter unit and indicated involvement of a polyketide synthase. We have identified a gene encoding an amidinotransferase from the cylindrospermopsin producing cyanobacterium Aphanizomenon ovalisporum. This is the first report on an amidinotransferase gene in cyanobacteria. It is likely to be involved in the formation of guanidinoacetic acid. The aoaA is located in a genomic region bearing genes encoding a polyketide synthase and a peptide synthetase, further supporting its putative role in cylindrospermopsin biosynthesis. PMID:12007659

  13. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase

    PubMed Central

    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E.; Segerson, Nicholas A.; Kannan, Latha

    2013-01-01

    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  14. Characterization of the gene encoding a fibrinogen-related protein expressed in Crassostrea gigas hemocytes.

    PubMed

    Skazina, M A; Gorbushin, A M

    2016-07-01

    Four exons of the CgFrep1 gene (3333 bp long) encode a putative fibrinogen-related protein (324 aa) bearing a single C-terminal FBG domain. Transcripts of the gene obtained from hemocytes of different Pacific oysters show prominent individual variation based on SNP and indels of tandem repeats resulted in polymorphism of N-terminus of the putative CgFrep1 polypeptide. The polypeptide chain bears N-terminal coiled-coil region potentially acting as inter-subunit interface in the protein oligomerization. It is suggested that CgFrep1 gene encodes the oligomeric lectin composed of at least two subunits. PMID:27189918

  15. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase.

    PubMed

    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E; Segerson, Nicholas A; Kannan, Latha; Mor, Tsafrir S

    2013-04-01

    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  16. Expression patterns of genes encoding plasma membrane aquaporins during fruit development in cucumber (Cucumis sativus L.).

    PubMed

    Shi, Jin; Wang, Jinfang; Li, Ren; Li, Dianbo; Xu, Fengfeng; Sun, Qianqian; Zhao, Bin; Mao, Ai-Jun; Guo, Yang-Dong

    2015-11-01

    Aquaporins are membrane channels precisely regulating water movement through cell membranes in most living organisms. Despite the advances in the physiology of fruit development, their participation during fruit development in cucumber still barely understood. In this paper, the expressions of 12 genes encoding plasma membrane intrinsic proteins (PIPs) were analyzed during cucumber fruit development in our work. Based on the homology search with known PIPs from rice, Arabidopsis and strawberry, 12 cucumber PIP genes subfamily members were identified. Cellular localization assays indicated that CsPIPs were localized in the plasma membrane. The qRT-PCR analysis of CsPIPs showed that 12 CsPIPs were differentially expressed during fruit development. These results suggest that 12 genes encoding plasma membrane intrinsic proteins (CsPIPs) play very important roles in cucumber life cycle and the data generated will be helpful in understanding their precise roles during fruit development in cucumber. PMID:26351149

  17. Cloning and expression of a gene segment encoding the enzymatic moiety of Pseudomonas aeruginosa exotoxin A.

    PubMed Central

    Mozola, M A; Wilson, R B; Jordan, E M; Draper, R K; Clowes, R C

    1984-01-01

    Using the broad-host-range plasmid vector pRO1614, we cloned a segment of the gene from Pseudomonas aeruginosa PA103 encoding the enzymatically active part of the exotoxin A protein. Expression of the cloned gene segment has been achieved both in Escherichia coli and in a nontoxigenic P. aeruginosa host, as assayed by the production of exotoxin A-related antigen and by the ability of the gene product to ADP-ribosylate elongation factor 2. Western blot hybridization analysis revealed a series of polypeptides antigenically related to exotoxin A, the largest of which had a molecular weight of ca. 50,000. Images PMID:6086583

  18. Horse cDNA clones encoding two MHC class I genes

    SciTech Connect

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  19. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    PubMed Central

    Karlyshev, A.V.; Thacker, G.; Jones, M.A.; Clements, M.O.; Wren, B.W.

    2014-01-01

    According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection. PMID:24918062

  20. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  1. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    PubMed

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  2. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    PubMed Central

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  3. Structure of an invertebrate gene encoding cytoplasmic intermediate filament (IF) proteins: implications for the origin and the diversification of IF proteins.

    PubMed Central

    Dodemont, H; Riemer, D; Weber, K

    1990-01-01

    The structure of the single gene encoding the cytoplasmic intermediate filament (IF) proteins in non-neuronal cells of the gastropod Helix aspersa is described. Genomic and cDNA sequences show that the gene is composed of 10 introns and 11 exons, spanning greater than 60 kb of DNA. Alternative RNA processing accounts for two mRNA families which encode two IF proteins differing only in their C-terminal sequence. The intron/exon organization of the Helix rod domain is identical to that of the vertebrate type III IF genes in spite of low overall protein sequence homology and the presence of an additional 42 residues in coil 1b of the invertebrate sequence. Intron position homology extends to the entire coding sequence comprising both the rod and tail domains when the invertebrate IF gene is compared with the nuclear lamin LIII gene of Xenopus laevis presented in the accompanying report of Döring and Stick. In contrast the intron patterns of the tail domains of the invertebrate IF and the lamin genes differ from those of the vertebrate type III genes. The combined data are in line with an evolutionary descent of cytoplasmic IF proteins from a nuclear lamin-like progenitor and suggest a mechanism for this derivation. The unique position of intron 7 in the Helix IF gene indicates that the archetype IF gene arose by the elimination of the nuclear localization sequence due to the recruitment of a novel splice site. The presumptive structural organization of the archetype IF gene allows predictions with respect to the later diversification of metazoan IF genes. Whereas models proposing a direct derivation of neurofilament genes seem unlikely, the earlier speculation of an mRNA transposition mechanism is compatible with current results. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 6. PMID:2249666

  4. A gene encoding a new cold-active lipase from an Antarctic isolate of Penicillium expansum.

    PubMed

    Mohammed, Suja; Te'o, Junior; Nevalainen, Helena

    2013-08-01

    Cold-active lipases are of significant interest as biocatalysts in industrial processes. We have identified a lipase that displayed activity towards long carbon-chain-p-nitrophenyl substrates (C12-C18) at 25 °C from the culture supernatant of an Antarctic Penicillium expansum strain assigned P. expansum SM3. Zymography revealed a protein band of around 30 kDa with activity towards olive oil. DNA fragments of a lipase gene designated as lipPE were isolated from the genomic DNA of P. expansum SM3 by genomic walking PCR. Subsequently, the complete genomic lipPE gene was amplified using gene-specific primers designed from the 5'- and 3'-regions. Reverse transcription PCR was used to amplify the lipPE cDNA. The deduced amino acid sequence consisted of 285 residues that included a predicted signal peptide. Three peptides identified by LC/MS/MS analysis of the proteins in the culture supernatant of P. expansum were also present in the deduced amino acid sequence of the lipPE gene suggesting that this gene encoded the lipase identified by initial zymogram activity analysis. Full analysis of the nucleotide and the deduced amino acid sequences indicated that the lipPE gene encodes a novel P. expansum lipase. The lipPE gene was expressed in E. coli for further characterization of the enzyme with a view of assessing its suitability for industrial applications. PMID:23779196

  5. Nuclear structure, gene expression and development.

    PubMed

    Brown, K

    1999-01-01

    This article considers the extent to which features of nuclear structure are involved in the regulation of genome function. The recent renaissance in imaging technology has inspired a new determination to assign specific functions to nuclear domains or structures, many of which have been described as "factories" to express the idea that they coordinate nuclear processes in an efficient way. Visual data have been combined with genetic and biochemical information to support the idea that nuclear organization has functional significance. Particular DNA sequences or chromatin structures may nucleate domains that are permissive or restrictive of transcription, to which active or inactive loci could be recruited. Associations within the nucleus, as well as many nuclear structures, are transient and change dynamically during cell cycle progression and development. Despite this complexity, elucidation of the possible structural basis of epigenetic phenomena, such as the inheritance of a "cellular memory" of gene expression status, is an important goal for cell biology. Topics for discussion include the regulatory effect of chromatin structure on gene expression, putative "nuclear addresses" for genes and proteins, the functional significance of nuclear bodies, and the role of the nuclear matrix in nuclear compartmentalization. PMID:10651237

  6. The Drosophila gene taranis encodes a novel trithorax group member potentially linked to the cell cycle regulatory apparatus.

    PubMed Central

    Calgaro, Stéphane; Boube, Muriel; Cribbs, David L; Bourbon, Henri-Marc

    2002-01-01

    Genes of the Drosophila Polycomb and trithorax groups (PcG and trxG, respectively) influence gene expression by modulating chromatin structure. Segmental expression of homeotic loci (HOM) initiated in early embryogenesis is maintained by a balance of antagonistic PcG (repressor) and trxG (activator) activities. Here we identify a novel trxG family member, taranis (tara), on the basis of the following criteria: (i) tara loss-of-function mutations act as genetic antagonists of the PcG genes Polycomb and polyhomeotic and (ii) they enhance the phenotypic effects of mutations in the trxG genes trithorax (trx), brahma (brm), and osa. In addition, reduced tara activity can mimic homeotic loss-of-function phenotypes, as is often the case for trxG genes. tara encodes two closely related 96-kD protein isoforms (TARA-alpha/-beta) derived from broadly expressed alternative promoters. Genetic and phenotypic rescue experiments indicate that the TARA-alpha/-beta proteins are functionally redundant. The TARA proteins share evolutionarily conserved motifs with several recently characterized mammalian nuclear proteins, including the cyclin-dependent kinase regulator TRIP-Br1/p34(SEI-1), the related protein TRIP-Br2/Y127, and RBT1, a partner of replication protein A. These data raise the possibility that TARA-alpha/-beta play a role in integrating chromatin structure with cell cycle regulation. PMID:11861561

  7. Complex Formation among Murine Cytomegalovirus US22 Proteins Encoded by Genes M139, M140, and M141

    PubMed Central

    Karabekian, Zaruhi; Hanson, Laura K.; Slater, Jacquelyn S.; Krishna, Neel K.; Bolin, Lisa L.; Kerry, Julie A.; Campbell, Ann E.

    2005-01-01

    The murine cytomegalovirus (MCMV) proteins encoded by US22 genes M139, M140, and M141 function, at least in part, to regulate replication of this virus in macrophages. Mutant MCMV having one or more of these genes deleted replicates poorly in macrophages in culture and in the macrophage-dense environment of the spleen. In this report, we demonstrate the existence of stable complexes formed by the products of all three of these US22 genes, as well as a complex composed of the products of M140 and M141. These complexes form in the absence of other viral proteins; however, the pM140/pM141 complex serves as a requisite binding partner for the M139 gene products. Products from all three genes colocalize to a perinuclear region of the cell juxtaposed to or within the cis-Golgi region but excluded from the trans-Golgi region. Interestingly, expression of pM141 redirects pM140 from its predominantly nuclear residence to the perinuclear, cytoplasmic locale where these US22 proteins apparently exist in complex. Thus, complexing of these nonessential, early MCMV proteins likely confers a function(s) independent of each individual protein and important for optimal replication of MCMV in its natural host. PMID:15731247

  8. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  9. Isolation and expression of two aquaporin-encoding genes from the marine phanerogam Posidonia oceanica.

    PubMed

    Maestrini, Pierluigi; Giordani, Tommaso; Lunardi, Andrea; Cavallini, Andrea; Natali, Lucia

    2004-12-01

    Seagrasses such as Posidonia oceanica (L.) Delile are marine phanerogams, widespread in various seas, where they form large prairies representing dynamic substrates exceeding the area of the sediment surface several times over and allowing settlement of epiphyte organisms. Studying mechanisms involved in water transport in marine plants, we isolated two aquaporin-encoding genes, PoPIP1;1 and PoTIP1;1, showing high similarity to plasma membrane- and tonoplast-intrinsic protein-encoding genes, respectively. PoPIP1;1 is unique in the genome of P. oceanica, while PoTIP1;1 belongs to an aquaporin subfamily of at least four members. PoPIP1;1 and PoTIP1;1 encode functional proteins, as indicated by expression experiments in Xenopus oocytes. Both genes are constitutively expressed in the leaves, with higher levels of transcripts in young than in differentiated leaf tissues. Variations of salt concentration in aquarium determined different PoPIP1;1 and PoTIP1;1 transcript accumulation, indicating the existence of adaptation mechanisms related to gene expression also in marine plants, i.e. adapted to very high salt concentrations. Hyposalinity induced lower levels of PIP1 transcripts, while hypersalinity determined more PIP1 transcripts than normal salinity. TIP1 transcripts increased in response to both hypo- and hypersalinity after 2 days of treatment and went back to control levels after 5 d. PMID:15653802

  10. The PANE1 gene encodes a novel human minor histocompatibility antigen that is selectively expressed in B-lymphoid cells and B-CLL

    PubMed Central

    Brickner, Anthony G.; Evans, Anne M.; Mito, Jeffrey K.; Xuereb, Suzanne M.; Feng, Xin; Nishida, Tetsuya; Fairfull, Liane; Ferrell, Robert E.; Foon, Kenneth A.; Hunt, Donald F.; Shabanowitz, Jeffrey; Engelhard, Victor H.; Riddell, Stanley R.; Warren, Edus H.

    2006-01-01

    Minor histocompatibility antigens (mHAg's) are peptides encoded by polymorphic genes that are presented by major histocompatibility complex (MHC) molecules and recognized by T cells in recipients of allogeneic hematopoietic cell transplants. Here we report that an alternative transcript of the proliferation-associated nuclear element 1 (PANE1) gene encodes a novel human leukocyte antigen (HLA)-A*0301-restricted mHAg that is selectively expressed in B-lymphoid cells. The antigenic peptide is entirely encoded within a unique exon not present in other PANE1 transcripts. Sequencing of PANE1 alleles in mHAg-positive and mHAg-negative cells demonstrates that differential T-cell recognition is due to a single nucleotide polymorphism within the variant exon that replaces an arginine codon with a translation termination codon. The PANE1 transcript that encodes the mHAg is expressed at high levels in resting CD19+ B cells and B-lineage chronic lymphocytic leukemia (B-CLL) cells, and at significantly lower levels in activated B cells. Activation of B-CLL cells through CD40 ligand (CD40L) stimulation decreases expression of the mHAg-encoding PANE1 transcript and reciprocally increases expression of PANE1 transcripts lacking the mHAg-encoding exon. These studies suggest distinct roles for different PANE1 isoforms in resting compared with activated CD19+ cells, and identify PANE1 as a potential therapeutic target in B-CLL. PMID:16391015

  11. Diversity of plasmids encoding histidine decarboxylase gene in Tetragenococcus spp. isolated from Japanese fish sauce.

    PubMed

    Satomi, Masataka; Furushita, Manabu; Oikawa, Hiroshi; Yano, Yutaka

    2011-07-15

    Nineteen isolates of histamine producing halophilic bacteria were isolated from four fish sauce mashes, each mash accumulating over 1000 ppm of histamine. The complete sequences of the plasmids encoding the pyruvoyl dependent histidine decarboxylase gene (hdcA), which is harbored in histamine producing bacteria, were determined. In conjunction, the sequence regions adjacent to hdcA were analyzed to provide information regarding its genetic origin. As reference strains, Tetragenococcus halophilus H and T. muriaticus JCM10006(T) were also studied. Phenotypic and 16S rRNA gene sequence analyses identified all isolates as T. halophilus, a predominant histamine producing bacteria present during fish sauce fermentation. Genetic analyses (PCR, Southern blot, and complete plasmid sequencing) of the histamine producing isolates confirmed that all the isolates harbored approximately 21-37 kbp plasmids encoding a single copy of the hdc cluster consisting of four genes related to histamine production. Analysis of hdc clusters, including spacer regions, indicated >99% sequence similarity among the isolates. All of the plasmids sequenced encoded traA, however genes related to plasmid conjugation, namely mob genes and oriT, were not identified. Two putative mobile genetic elements, ISLP1-like and IS200-like, respectively, were identified in the up- and downstream region of the hdc cluster of all plasmids. Most of the sequences, except hdc cluster and two adjacent IS elements, were diverse among plasmids, suggesting that each histamine producers harbored a different histamine-related plasmid. These results suggested that the hdc cluster was not spread by clonal dissemination depending on the specific plasmid and that the hdc cluster in tetragenococcal plasmid was likely encoded on transformable elements. PMID:21616548

  12. Cloning of a complementary DNA encoding an 80 kilodalton nuclear cap binding protein.

    PubMed Central

    Kataoka, N; Ohno, M; Kangawa, K; Tokoro, Y; Shimura, Y

    1994-01-01

    It has been shown that the monomethylated cap structure plays important roles in nuclear events. The cap structure has been implicated in the enhancement of pre-mRNA splicing. More recently, this structure has also been suggested to facilitate RNA transport from the nucleus to the cytoplasm. We have previously identified and purified an 80kD Nuclear Cap Binding Protein (NCBP) from a HeLa cell nuclear extract, which could possibly mediate these nuclear activities. In this report, we describe cloning of complementary DNA (cDNA) encoding NCBP. The partial protein sequences of NCBP were determined, and the full-length cDNA of NCBP was isolated from HeLa cDNA libraries. This cDNA encoded an open reading frame of 790 amino acids with a calculated molecular mass of 91,734 daltons, which contained most of the determined protein sequences. However, the protein sequence had no significant homology to any known proteins. Transfection experiments demonstrated that the epitope-tagged NCBP, transiently expressed in HeLa cells, was localized exclusively in the nucleoplasm. Similar experiments using a truncated NCBP cDNA indicated that this nuclear localization activity is conferred by the N-terminal 70 amino-acid region. Images PMID:7937105

  13. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.

    PubMed

    Perumal, N; Murugesan, S; Krishnan, P

    2016-01-01

    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates. PMID:27514959

  14. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    SciTech Connect

    Chen, Lei

    2009-01-01

    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  15. Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein

    SciTech Connect

    Hickey, E.; Brandon, S.E.; Weber, L.A.; Lloyd, D.

    1989-06-01

    Vertebrate cells synthesize two forms of the 82- to 90-kilodalton heat shock protein that are encoded by distinct gene families. In HeLa cells, both proteins (hsp89/alpha/ and hspio/beta/) are abundant under normal growth conditions and are synthesized at increased rates in response to heat stress. Only the larger form, hsp89/alpha/, is induced by the adenovirus E1A gene product. The authors have isolated a human hsp89/alpha/ gene that shows complete sequence identity with heat- and E1A-inducible cDNA used as a hybridization probe. The 5'-flanking region contained overlapping and inverted consensus heat shock control elements that can confer heat-inducible expression n a /beta/-globin reporter gene. The gene contained 10 intervening sequences. The first intron was located adjacent to the translation start codon, an arrangement also found in the Drosophila hsp82 gene. The spliced mRNA sequence contained a single open reading frame encoding an 84,564-dalton polypeptide showing high homology with the hsp82 to hsp90 proteins of other organisms. The deduced hsp89/alpha/ protein sequence differed from the human hsp89/beta/ sequence reported elsewhere in at least 99 out of the 732 amino acids. Transcription of the hsp89/alpha/ gene was induced by serum during normal cell growth, but expression did not appear to be restricted to a particular stage of the cell cycles. hsp89/alpha/ mRNA was considerably more stable than the mRNA encoding hsp70, which can account for the higher constitutive rate of hsp89 synthesis in unstressed cells.

  16. The Coxiella burnetii Cryptic Plasmid Is Enriched in Genes Encoding Type IV Secretion System Substrates▿ †

    PubMed Central

    Voth, Daniel E.; Beare, Paul A.; Howe, Dale; Sharma, Uma M.; Samoilis, Georgios; Cockrell, Diane C.; Omsland, Anders; Heinzen, Robert A.

    2011-01-01

    The intracellular bacterial pathogen Coxiella burnetii directs biogenesis of a phagolysosome-like parasitophorous vacuole (PV), in which it replicates. The organism encodes a Dot/Icm type IV secretion system (T4SS) predicted to deliver to the host cytosol effector proteins that mediate PV formation and other cellular events. All C. burnetii isolates carry a large, autonomously replicating plasmid or have chromosomally integrated plasmid-like sequences (IPS), suggesting that plasmid and IPS genes are critical for infection. Bioinformatic analyses revealed two candidate Dot/Icm substrates with eukaryotic-like motifs uniquely encoded by the QpH1 plasmid from the Nine Mile reference isolate. CpeC, containing an F-box domain, and CpeD, possessing kinesin-related and coiled-coil regions, were secreted by the closely related Legionella pneumophila Dot/Icm T4SS. An additional QpH1-specific gene, cpeE, situated in a predicted operon with cpeD, also encoded a secreted effector. Further screening revealed that three hypothetical proteins (CpeA, CpeB, and CpeF) encoded by all C. burnetii plasmids and IPS are Dot/Icm substrates. By use of new genetic tools, secretion of plasmid effectors by C. burnetii during host cell infection was confirmed using β-lactamase and adenylate cyclase translocation assays, and a C-terminal secretion signal was identified. When ectopically expressed in HeLa cells, plasmid effectors trafficked to different subcellular sites, including autophagosomes (CpeB), ubiquitin-rich compartments (CpeC), and the endoplasmic reticulum (CpeD). Collectively, these results suggest that C. burnetii plasmid-encoded T4SS substrates play important roles in subversion of host cell functions, providing a plausible explanation for the absolute maintenance of plasmid genes by this pathogen. PMID:21216993

  17. Mammalian ets-1 and ets-2 genes encode highly conserved proteins

    SciTech Connect

    Watson, D.K.; McWilliams, M.J.; Lapis, P.; Lautenberger, J.A.; Schweinfest, C.W.; Papas, T.S. )

    1988-11-01

    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, the authors have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is >95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published finding indicates that ets is a family of genes whose members share distinct domains.

  18. Mammalian ets-1 and ets-2 genes encode highly conserved proteins.

    PubMed Central

    Watson, D K; McWilliams, M J; Lapis, P; Lautenberger, J A; Schweinfest, C W; Papas, T S

    1988-01-01

    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, we have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is greater than 95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published findings indicates that ets is a family of genes whose members share distinct domains. PMID:2847145

  19. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.

    PubMed

    de Boer, A P; van der Oost, J; Reijnders, W N; Westerhoff, H V; Stouthamer, A H; van Spanning, R J

    1996-12-15

    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994) Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans, Antonie Leeu wenhoek 66, 111-127]. norC and norB encode the cytochrome-c-containing subunit II and cytochrome b-containing subunit I of nitric-oxide reductase (NO reductase), respectively. norQ encodes a protein with an ATP-binding motif and has high similarity to NirQ from Pseudomonas stutzeri and Pseudomonas aeruginosa and CbbQ from Pseudomonas hydrogenothermophila. norE encodes a protein with five putative transmembrane alpha-helices and has similarity to CoxIII, the third subunit of the aa3-type cytochrome-c oxidases. norF encodes a small protein with two putative transmembrane alpha-helices. Mutagenesis of norC, norB, norQ and norD resulted in cells unable to grow anaerobically. Nitrite reductase and NO reductase (with succinate or ascorbate as substrates) and nitrous oxide reductase (with succinate as substrate) activities were not detected in these mutant strains. Nitrite extrusion was detected in the medium, indicating that nitrate reductase was active. The norQ and norD mutant strains retained about 16% and 23% of the wild-type level of NorC, respectively. The norE and norF mutant strains had specific growth rates and NorC contents similar to those of the wild-type strain, but had reduced NOR and NIR activities, indicating that their gene products are involved in regulation of enzyme activity. Mutant strains containing the norCBQDEF region on the broad-host-range vector pEG400 were able to grow anaerobically, although at a lower specific growth rate and with lower

  20. Cloning and characterization of two Lactobacillus casei genes encoding a cystathionine lyase.

    PubMed

    Irmler, Stefan; Raboud, Sylvie; Beisert, Beata; Rauhut, Doris; Berthoud, Hélène

    2008-01-01

    Volatile sulfur compounds are key flavor compounds in several cheese types. To better understand the metabolism of sulfur-containing amino acids, which certainly plays a key role in the release of volatile sulfur compounds, we searched the genome database of Lactobacillus casei ATCC 334 for genes encoding putative homologs of enzymes known to degrade cysteine, cystathionine, and methionine. The search revealed that L. casei possesses two genes that putatively encode a cystathionine beta-lyase (CBL; EC 4.4.1.8). The enzyme has been implicated in the degradation of not only cystathionine but also cysteine and methionine. Recombinant CBL proteins catalyzed the degradation of L-cystathionine, O-succinyl-L-homoserine, L-cysteine, L-serine, and L-methionine to form alpha-keto acid, hydrogen sulfide, or methanethiol. The two enzymes showed notable differences in substrate specificity and pH optimum. PMID:17993563

  1. Human TOP3: a single-copy gene encoding DNA topoisomerase III.

    PubMed Central

    Hanai, R; Caron, P R; Wang, J C

    1996-01-01

    A human cDNA encoding a protein homologous to the Escherichia coli DNA topoisomerase I subfamily of enzymes has been identified through cloning and sequencing. Expressing the cloned human cDNA in yeast (delta)top1 cells lacking endogenous DNA topoisomerase I yielded an activity in cell extracts that specifically reduces the number of supercoils in a highly negatively supercoiled DNA. On the basis of these results, the human gene containing the cDNA sequence has been denoted TOP3, and the protein it encodes has been denoted DNA topoisomerase III. Screening of a panel of human-rodent somatic hybrids and fluorescence in situ hybridization of cloned TOP3 genomic DNA to metaphase chromosomes indicate that human TOP3 is a single-copy gene located at chromosome 17p11.2-12. Images Fig. 2 PMID:8622991

  2. Immunoglobulin kappa light chain variable region gene complex organization and immunoglobulin genes encoding anti-DNA autoantibodies in lupus mice.

    PubMed Central

    Kofler, R; Strohal, R; Balderas, R S; Johnson, M E; Noonan, D J; Duchosal, M A; Dixon, F J; Theofilopoulos, A N

    1988-01-01

    We have investigated the genetic origin of autoantibody production in several strains of mice that spontaneously develop a systemic lupus erythematosus-like disease. Restriction fragment length polymorphism analyses of gene loci encoding kappa light chain variable regions (Igk-V) demonstrated, as shown previously for the Ig heavy chain locus, that autoantibody production and disease occur in different Igk-V haplotypes. Moreover, autoimmune mice with known genetic derivation inherited their Igk-V loci essentially unaltered from their nonautoimmune ancestors. New Zealand black lupus mice, with unknown genetic derivation, had a possibly recombinant Igk-V haplotype, composed of V kappa loci that were primarily indistinguishable from those of nonautoimmune strains from either of the two potential donor haplotypes. The heavy and light chain gene segments (variable, diversity, joining) encoding anti-DNA antibodies were diverse and often closely related, or even identical, to those found in antibodies to foreign antigens in normal mice. Only 1 of 11 sequenced variable region genes could not be assigned to existing variable region gene families; however, corresponding germline genes were present in the genome of normal mice as well. These data argue against abnormalities in the genes and mechanisms generating antibody diversity in lupus mice and suggest a remarkable genetic and structural diversity in the generation of anti-DNA binding sites. Images PMID:3138286

  3. Identification of the Repressor-Encoding Gene of the Lactobacillus Bacteriophage A2

    PubMed Central

    Ladero, Victor; García, Pilar; Bascarán, Victoria; Herrero, Mónica; Alvarez, Miguel A.; Suárez, Juan E.

    1998-01-01

    The repressor gene of the Lactobacillus phage A2 has the following properties: it (i) encodes a 224-residue polypeptide with DNA binding and RecA cleavage motifs, (ii) is expressed in lysogenic cultures, and (iii) confers superinfection immunity on the host. Adjacent, but divergently transcribed, lies another open reading frame whose product resembles the λ Cro protein. In the 161-bp intergenic segment, putative promoters and operators have been detected. PMID:9642205

  4. Nucleotide sequence, transcription and phylogeny of the gene encoding the superoxide dismutase of Sulfolobus acidocaldarius.

    PubMed

    Klenk, H P; Schleper, C; Schwass, V; Brudler, R

    1993-07-18

    The gene encoding the superoxide dismutase (SOD) of the thermophilic archaeon Sulfolobus acidocaldarius has been isolated and sequenced. Both the start site and the termination sites of the corresponding transcript were mapped. The deduced amino acid sequence of the protein is very similar to the sequence of manganese- or iron-containing SODs. Phylogenetic sequence analysis corroborated the monophyletic nature of the archaeal domain. PMID:8334170

  5. Cloning and Expression of clt Genes Encoding Milk-Clotting Proteases from Myxococcus xanthus 422

    PubMed Central

    Poza, M.; Prieto-Alcedo, M.; Sieiro, C.; Villa, T. G.

    2004-01-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems. PMID:15466588

  6. The mammalian homologue of yeast Afg1 ATPase (lactation elevated 1) mediates degradation of nuclear-encoded complex IV subunits.

    PubMed

    Cesnekova, Jana; Rodinova, Marie; Hansikova, Hana; Houstek, Josef; Zeman, Jiri; Stiburek, Lukas

    2016-03-15

    Mitochondrial protein homeostasis is crucial for cellular function and integrity and is therefore maintained by several classes of proteins possessing chaperone and/or proteolytic activities. In the present study, we focused on characterization of LACE1 (lactation elevated 1) function in mitochondrial protein homeostasis. LACE1 is the human homologue of yeast mitochondrial Afg1 (ATPase family gene 1) ATPase, a member of the SEC18-NSF, PAS1, CDC48-VCP, TBP family. Yeast Afg1 was shown to mediate degradation of mitochondrially encoded complex IV subunits, and, on the basis of its similarity to CDC48 (p97/VCP), it was suggested to facilitate extraction of polytopic membrane proteins. We show that LACE1, which is a mitochondrial integral membrane protein, exists as part of three complexes of approximately 140, 400 and 500 kDa and is essential for maintenance of fused mitochondrial reticulum and lamellar cristae morphology. We demonstrate that LACE1 mediates degradation of nuclear-encoded complex IV subunits COX4 (cytochrome c oxidase 4), COX5A and COX6A, and is required for normal activity of complexes III and IV of the respiratory chain. Using affinity purification of LACE1-FLAG expressed in a LACE1-knockdown background, we show that the protein interacts physically with COX4 and COX5A subunits of complex IV and with mitochondrial inner-membrane protease YME1L. Finally, we demonstrate by ectopic expression of both K142A Walker A and E214Q Walker B mutants, that an intact ATPase domain is essential for LACE1-mediated degradation of nuclear-encoded complex IV subunits. Thus the present study establishes LACE1 as a novel factor with a crucial role in mitochondrial protein homeostasis. PMID:26759378

  7. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  8. Genes encoding farnesyl cysteine carboxyl methyltransferase in Schizosaccharomyces pombe and Xenopus laevis.

    PubMed Central

    Imai, Y; Davey, J; Kawagishi-Kobayashi, M; Yamamoto, M

    1997-01-01

    The mam4 mutation of Schizosaccharomyces pombe causes mating deficiency in h- cells but not in h+ cells. h- cells defective in mam4 do not secrete active mating pheromone M-factor. We cloned mam4 by complementation. The mam4 gene encodes a protein of 236 amino acids, with several potential membrane-spanning domains, which is 44% identical with farnesyl cysteine carboxyl methyltransferase encoded by STE14 and required for the modification of a-factor in Saccharomyces cerevisiae. Analysis of membrane fractions revealed that mam4 is responsible for the methyltransferase activity in S. pombe. Cells defective in mam4 produced farnesylated but unmethylated cysteine and small peptides but no intact M-factor. These observations strongly suggest that the mam4 gene product is farnesyl cysteine carboxyl methyltransferase that modifies M-factor. Furthermore, transcomplementation of S. pombe mam4 allowed us to isolate an apparent homolog of mam4 from Xenopus laevis (Xmam4). In addition to its sequence similarity to S. pombe mam4, the product of Xmam4 was shown to have a farnesyl cysteine carboxyl methyltransferase activity in S. pombe cells. The isolation of a vertebrate gene encoding farnesyl cysteine carboxyl methyltransferase opens the way to in-depth studies of the role of methylation in a large body of proteins, including Ras superfamily proteins. PMID:9032282

  9. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    PubMed Central

    Liao, Liao; Vimolmangkang, Sornkanok; Wei, Guochao; Zhou, Hui; Korban, Schuyler S.; Han, Yuepeng

    2015-01-01

    Proanthocyanidins (PAs) are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR) and anthocyanidin reductase (ANR) was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis. PMID:25914714

  10. Four genes from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin.

    PubMed Central

    Hammer, P E; Hill, D S; Lam, S T; Van Pée, K H; Ligon, J M

    1997-01-01

    Pyrrolnitrin is a secondary metabolite of Pseudomonas and Burkholderia sp. strains with strong antifungal activity. Production of pyrrolnitrin has been correlated with the ability of some bacteria to control plant diseases caused by fungal pathogens, including the damping-off pathogen Rhizoctonia solani. Pseudomonas fluorescens BL915 has been reported to produce pyrrolnitrin and to be an effective biocontrol agent for this pathogen. We have isolated a 32-kb genomic DNA fragment from this strain that contains genes involved in the biosynthesis of pyrrolnitrin. Marker-exchange mutagenesis of this DNA with Tn5 revealed the presence of a 6.2-kb region that contains genes required for the synthesis of pyrrolnitrin. The nucleotide sequence of the 6.2-kb region was determined and found to contain a cluster of four genes that are required for the production of pyrrolnitrin. Deletion mutations in any of the four genes resulted in a pyrrolnitrin-nonproducing phenotype. The putative coding sequences of the four individual genes were cloned by PCR and fused to the tac promoter from Escherichia coli. In each case, the appropriate tac promoter-pyrrolnitrin gene fusion was shown to complement the pyrrolnitrin-negative phenotype of the corresponding deletion mutant. Transfer of the four gene cluster to E. coli resulted in the production of pyrrolnitrin by this organism, thereby demonstrating that the four genes are sufficient for the production of this metabolite and represent all of the genes required to encode the pathway for pyrrolnitrin biosynthesis. PMID:9172332

  11. Brassica rapa Has Three Genes That Encode Proteins Associated with Different Neutral Lipids in Plastids of Specific Tissues1

    PubMed Central

    Kim, Hyun Uk; Wu, Sherry S.H.; Ratnayake, Chandra; Huang, Anthony H.C.

    2001-01-01

    Plastid lipid-associated protein (PAP), a predominant structural protein associated with carotenoids and other non-green neutral lipids in plastids, was shown to be encoded by a single nuclear gene in several species. Here we report three PAP genes in the diploid Brassica rapa; the three PAPs are associated with different lipids in specific tissues. Pap1 and Pap2 are more similar to each other (84% amino acid sequence identity) than to Pap3 (46% and 44%, respectively) in the encoded mature proteins. Pap1 transcript was most abundant in the maturing anthers (tapetum) and in lesser amounts in leaves, fruit coats, seeds, and sepals; Pap2 transcript was abundant only in the petals; and Pap3 transcript had a wide distribution, but at minimal levels in numerous organs. Immunoblotting after sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that most organs had several nanograms of PAP1 or PAP2 per milligram of total protein, the highest amounts being in the anthers (10.9 μg mg−1 PAP1) and petals (6.6 μg mg−1 PAP2), and that they had much less PAP3 (<0.02 μg mg−1). In these organs PAP was localized in isolated plastid fractions. Plants were subjected to abiotic stresses; drought and ozone reduced the levels of the three Pap transcripts, whereas mechanical wounding and altering the light intensity enhanced their levels. We conclude that the PAP gene family consists of several members whose proteins are associated with different lipids and whose expressions are controlled by distinct mechanisms. Earlier reports of the expression of one Pap gene in various organs in a species need to be re-examined. PMID:11351096

  12. COMPLEMENTATION OF THE NUCLEAR ANTISENSE RBCS GENE INTO THE TOBACCO PLASTID GENOME

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The small subunit (rbcS) of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is a nuclear gene-encoded protein that is imported into chloroplasts where it assembles with the large subunit (rbcL) after removal of the transit peptide to form Rubisco. We have explored the possibility that the ...

  13. daf-12 encodes a nuclear receptor that regulates the dauer diapause and developmental age in C. elegans.

    PubMed

    Antebi, A; Yeh, W H; Tait, D; Hedgecock, E M; Riddle, D L

    2000-06-15

    The daf-12 gene acts at the convergence of pathways regulating larval diapause, developmental age, and adult longevity in Caenorhabditis elegans. It encodes a nuclear receptor most closely related to two C. elegans receptors, NHR-8 and NHR-48, Drosophila DHR96, and vertebrate vitamin D and pregnane-X receptors. daf-12 has three predicted protein isoforms, two of which contain DNA- and ligand-binding domains, and one of which contains the ligand-binding domain only. Mutations cluster in DNA- and ligand-binding domains, but correspond to distinct phenotypic classes. DAF-12 is expressed widely in target tissues from embryo to adult, but is upregulated during midlarval stages. In the adult, expression persists in nervous system and somatic gonad, two tissues that regulate adult longevity. We propose that DAF-12 integrates hormonal signals in cellular targets to coordinate major life history traits. PMID:10859169

  14. The yeast SNF3 gene encodes a glucose transporter homologous to the mammalian protein.

    PubMed Central

    Celenza, J L; Marshall-Carlson, L; Carlson, M

    1988-01-01

    The SNF3 gene is required for high-affinity glucose transport in the yeast Saccharomyces cerevisiae and has also been implicated in control of gene expression by glucose repression. We report here the nucleotide sequence of the cloned SNF3 gene. The predicted amino acid sequence shows that SNF3 encodes a 97-kilodalton protein that is homologous to mammalian glucose transporters and has 12 putative membrane-spanning regions. We also show that a functional SNF3-lacZ gene-fusion product cofractionates with membrane proteins and is localized to the cell surface, as judged by indirect immunofluorescence microscopy. Expression of the fusion protein is regulated by glucose repression. Images PMID:3281163

  15. A Putative Gene Cluster from a Lyngbya wollei Bloom that Encodes Paralytic Shellfish Toxin Biosynthesis

    PubMed Central

    Mihali, Troco K.; Carmichael, Wayne W.; Neilan, Brett A.

    2011-01-01

    Saxitoxin and its analogs cause the paralytic shellfish-poisoning syndrome, adversely affecting human health and coastal shellfish industries worldwide. Here we report the isolation, sequencing, annotation, and predicted pathway of the saxitoxin biosynthetic gene cluster in the cyanobacterium Lyngbya wollei. The gene cluster spans 36 kb and encodes enzymes for the biosynthesis and export of the toxins. The Lyngbya wollei saxitoxin gene cluster differs from previously identified saxitoxin clusters as it contains genes that are unique to this cluster, whereby the carbamoyltransferase is truncated and replaced by an acyltransferase, explaining the unique toxin profile presented by Lyngbya wollei. These findings will enable the creation of toxin probes, for water monitoring purposes, as well as proof-of-concept for the combinatorial biosynthesis of these natural occurring alkaloids for the production of novel, biologically active compounds. PMID:21347365

  16. Neurally expressed Drosophila genes encoding homologs of the NSF and SNAP secretory proteins.

    PubMed Central

    Ordway, R W; Pallanck, L; Ganetzky, B

    1994-01-01

    Several lines of investigation have now converged to indicate that the neurotransmitter release apparatus is formed by assembly of cytosolic proteins with proteins of the synaptic vesicle and presynaptic terminal membranes. We are undertaking a genetic approach in Drosophila melanogaster to investigate the functions of two types of cytosolic proteins thought to function in this complex: N-ethylmaleimide-sensitive fusion protein (NSF) and the soluble NSF attachment proteins (SNAPs). We have identified Drosophila homologs of the vertebrate and yeast NSF and SNAP genes. Both Drosophila genes encode polypeptides that closely resemble their vertebrate counterparts and are expressed in the nervous system; neither appears to be in a family of closely related Drosophila genes. These results indicate that the Drosophila NSF and SNAP genes are excellent candidates for mutational analysis of neurotransmitter release. Images PMID:8202553

  17. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    PubMed Central

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica

    2009-01-01

    Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of

  18. Conservation of structure in the human gene encoding argininosuccinate synthetase and the argG genes of the archaebacteria Methanosarcina barkeri MS and Methanococcus vannielii

    SciTech Connect

    Morris, C.J.; Reeve, J.N.

    1988-07-01

    The DNA sequences of the argG genes of Methanosarcina barkeri MS and Methanococcus vannielii were determined. The polypeptide products of these methanogen genes have amino acid sequences which are 50% identical to each other and 38% identical to the amino acid sequence encoded by the exons of the human argininosuccinate synthetase gene. Introns in the human chromosomal gene separate regions which encode amino acids conserved in both the archaebacterial and human gene products. An open reading frame immediately upstream of argG in Methanosarcina barkeri MS codes for an amino acid sequence which is 45 and 31% identical to the sequences of the large subunits of carbamyl phosphate synthetase in Escherichia coli and Saccharomyces cerevisiae, respectively. If this gene encodes carbamyl phosphate synthetase in Methanosarcina barkeri, this is the first example, in an archaebacterium, of physical linkage of genes that encode enzymes which catalyze reactions in the same amino acid biosynthetic pathway.

  19. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    NASA Astrophysics Data System (ADS)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

    2013-03-01

    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  20. Dissection of the erythroid-specific transcriptional promoter used by the gene encoding aminolevulinic acid dehydratase (ALAD)

    SciTech Connect

    Bishop, T.R.; Schaffer, T.; Pien, B.

    1994-09-01

    The gene encoding delta-aminolevulinate dehydratase (ALAD), the second enzyme of the heme biosynthetic pathway, exists as a single gene in most mammalian genomes and we have sequenced over 12 kb from overlapping lambda clones containing the murine ALAD gene. The gene has a dual promoter driving expression of two different first exons; exon1A is expressed in all tissues and exon1B only in erythroid cells, where heme production is induced to exceptionally high levels for hemoglobin synthesis. Erythroid-specific expression of the ALAD gene is presumably accomplished by using the exon1B promoter which we hypothesize is responsive to erythroid-specific transcriptional activators. In order to test this, we have used gel mobility shift assays and DNase footprint analyses to dissect and identify the critical upstream regulatory elements. Nuclear extracts, prepared from murine erythroleukemia cells (MELC), human chronic myelogenous leukemia cell line (K562) and human fibroblast cell line (HeLa), were used as sources of proteins to analyze DNA binding sites in the ALAD erythroid-specific promoter from -307 to +1. In this region, there are three potential GATA1 sites, two CACCC boxes, a CCAAT box and a GGTGG box. NF-E2 sites were explored by using in vitro translation products of cloned p18 and p45, the two heterologous components of NF-E2, and successfully gel-shifted a 29 bp double-stranded oligo found at 2.6 kb in front of the ALAD gene. Thus, the ALAD gene utilizes both a housekeeping and a tissue-specific promoter.

  1. funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi

    PubMed Central

    2014-01-01

    Background RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA http://funrna.riceblast.snu.ac.kr/, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. Description To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. Conclusions funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi. PMID:25522231

  2. Somatic diversity in CDR3 loops allows single V-genes to encode innate immunological memories for multiple pathogens.

    PubMed

    Thomson, Christy A; Little, Ken Q; Reason, Donald C; Schrader, John W

    2011-02-15

    The human Ab response to many common pathogens is oligoclonal, with restricted usage of Ig V-genes. Intriguingly, the IGVK3-11 and IGVH3-30 V-genes are repeatedly paired in protective Abs against the 23F polysaccharide of Streptococcus pneumoniae, as well as against the gB envelope protein of human CMV, where germline-encoded amino acids make key contacts with the gB protein. We constructed IgGs encoded by the germline IGVK3-11 and IGVH3-30 V-genes together with DNA encoding the respective CDR3 regions of the L chain and H chain found in a hypermutated anti-23F Ab. These IgGs encoded by germline V-genes bound specifically to 23F pneumococcal capsular polysaccharides with no reactivity to other serotypes of pneumococcal capsular polysaccharides or arrayed glycans and recognized L-rhamnose, a component of the 23F repeating subunit. IgGs encoded by this pair of germline V-genes mediated complement-dependent phagocytosis of encapsulated 23F S. pneumoniae by human neutrophils. Mutations in CDRL3 and CDRH3 had significant effects on binding. Thus, IGKV3-11 and IGHV3-30, depending on with which distinct DNA sequences encoding CDR3 they are recombined, can encode binding sites for protective Abs against chemically distinct Ags and thus, may encode innate immunological memory against human CMV and S. pneumoniae. PMID:21228346

  3. Identification of candidate genes encoding an LDL-C QTL in baboons[S

    PubMed Central

    Karere, Genesio M.; Glenn, Jeremy P.; Birnbaum, Shifra; Hafizi, Sussan; Rainwater, David L.; Mahaney, Michael C.; VandeBerg, John L.; Cox, Laura A.

    2013-01-01

    Cardiovascular disease (CVD) is the leading cause of death in developed countries, and dyslipidemia is a major risk factor for CVD. We previously identified a cluster of quantitative trait loci (QTL) on baboon chromosome 11 for multiple, related quantitative traits for serum LDL-cholesterol (LDL-C). Here we report differentially regulated hepatic genes encoding an LDL-C QTL that influences LDL-C levels in baboons. We performed hepatic whole-genome expression profiling for LDL-C-discordant baboons fed a high-cholesterol, high-fat (HCHF) diet for seven weeks. We detected expression of 117 genes within the QTL 2-LOD support interval. Three genes were differentially expressed in low LDL-C responders and 8 in high LDL-C responders in response to a HCHF diet. Seven genes (ACVR1B, CALCOCO1, DGKA, ERBB3, KRT73, MYL6B, TENC1) showed discordant expression between low and high LDL-C responders. To prioritize candidate genes, we integrated miRNA and mRNA expression profiles using network tools and found that four candidates (ACVR1B, DGKA, ERBB3, TENC1) were miRNA targets and that the miRNAs were inversely expressed to the target genes. Candidate gene expression was validated using QRT-PCR and Western blotting. This study reveals candidate genes that influence variation in LDL-C in baboons and potential genetic mechanisms for further investigation. PMID:23596326

  4. Clusters of genes encoding fructan biosynthesizing enzymes in wheat and barley.

    PubMed

    Huynh, Bao-Lam; Mather, Diane E; Schreiber, Andreas W; Toubia, John; Baumann, Ute; Shoaei, Zahra; Stein, Nils; Ariyadasa, Ruvini; Stangoulis, James C R; Edwards, James; Shirley, Neil; Langridge, Peter; Fleury, Delphine

    2012-10-01

    Fructans are soluble carbohydrates with health benefits and possible roles in plant adaptation. Fructan biosynthetic genes were isolated using comparative genomics and physical mapping followed by BAC sequencing in barley. Genes encoding sucrose:sucrose 1-fructosyltransferase (1-SST), fructan:fructan 1-fructosyltransferase (1-FFT) and sucrose:fructan 6-fructosyltransferase (6-SFT) were clustered together with multiple copies of vacuolar invertase genes and a transposable element on two barley BAC. Intron-exon structures of the genes were similar. Phylogenetic analysis of the fructosyltransferases and invertases in the Poaceae showed that the fructan biosynthetic genes may have evolved from vacuolar invertases. Quantitative real-time PCR was performed using leaf RNA extracted from three wheat cultivars grown under different conditions. The 1-SST, 1-FFT and 6-SFT genes had correlated expression patterns in our wheat experiment and in existing barley transcriptome database. Single nucleotide polymorphism (SNP) markers were developed and successfully mapped to a major QTL region affecting wheat grain fructan accumulation in two independent wheat populations. The alleles controlling high- and low- fructan in parental lines were also found to be associated in fructan production in a diverse set of 128 wheat lines. To the authors' knowledge, this is the first report on the mapping and sequencing of a fructan biosynthetic gene cluster and in particular, the isolation of a novel 1-FFT gene from barley. PMID:22864927

  5. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    PubMed

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. PMID:20722697

  6. Entamoeba histolytica: a unicellular organism containing two active genes encoding for members of the TBP family.

    PubMed

    Castañon-Sanchez, Carlos Alberto; Luna-Arias, Juan Pedro; de Dios-Bravo, Ma Guadalupe; Herrera-Aguirre, Maria Esther; Olivares-Trejo, Jose J; Orozco, Esther; Hernandez, Jose Manuel

    2010-03-01

    Entamoeba histolytica is the protozoan parasite which causes human amoebiasis. In this parasite, few encoding genes for transcription factors have been cloned and characterized. The E. histolytica TATA-box binding protein (EhTBP) is the first basal transcription factor that has been studied. To continue with the identification of other members of the basal transcription machinery, we performed an in silico analysis of the E. histolytica genome and found three loci encoding for polypeptides with similarity to EhTBP. One locus has a 100% identity to the previously Ehtbp gene reported by our group. The second locus encodes for a 212 aa polypeptide that is 100% identical to residues 23-234 from EhTBP. The third one encodes for a 216 aa polypeptide of 24kDa that showed 42.6% identity and 73.7% similarity to EhTBP. This protein was named E. histolytica TBP-related factor 1 (EhTRF1). Ehtrf1 gene was expressed in bacteria and the purified 28kDa recombinant polypeptide showed the capacity to bind to TATTTAAA-box by electrophoretic mobility shift assays. K(D) values for rEhTBP and rEhTRF1 were (1.71+/-2.90)x10(-12)M and (1.12+/-0.160)x10(-11)M, respectively. Homology modeling of EhTRF1 and EhTBP revealed that, although they were very similar, they showed some differences on their surfaces. Thus, E. histolytica is a unicellular organism having two members of the TBP family. PMID:20026212

  7. Cloning and characterization of a Pseudomonas mendocina KR1 gene cluster encoding toluene-4-monooxygenase

    SciTech Connect

    Kwangmu Yen; Karl, M.R.; Blatt, L.M.; Simon, M.J.; Winter, R.B.; Fausset, P.R.; Lu, H.S.; Harcourt, A.A.; Chen, K.K. )

    1991-09-01

    Pseudomonas mendocina KR1 metabolizes toluene as a carbon source by a previously unknown pathway. The initial step of the pathway is hydroxylation of toluene to form p-cresol by a multicomponent toluene-4-monooxygenase (T4MO) system. The authors have cloned and characterized a gene cluster from KR 1 that determines the T4MO activity. To clone the T4MO genes, KR1 DNA libraries were constructed in Escherichia coli HB 101 by using a broad-host-range vector and transferred to a KR1 mutant able to grow on p-cresol but no on toluene. An insert consisting of two SacI fragments of identical size was shown to complement the mutant for growth on toluene. One of the SacI fragments, when cloned into the E. coli vector pUC19, was found to direct the synthesis of indigo dye. The indigo-forming property was correlated with the presence of T4MO activity. The T4MO genes were mapped to a 3.6-kb region, and the direction of transcription was determined. DNA sequencing and N-terminal amino acid determination identified a five-gene cluster, tmoABCDE, within this region. Expression of this cluster carrying a single mutation in each gene demonstrated that each of the five genes is essential for T4MO activity. Other evidence presented indicated that none of the tmo genes was involved in the regulation of the tmo gene cluster, in the control of substrate transport of the T4MO system, or in major processing of the products of the tmo genes. It was tentatively concluded that the tmoABCDE genes encode structural polypeptides of the T4MO enzyme system. One of the tmo genes was tentatively identified as a ferredoxin gene.

  8. TCA1, a single nuclear-encoded translational activator specific for petA mRNA in Chlamydomonas reinhardtii chloroplast.

    PubMed Central

    Wostrikoff, K; Choquet, Y; Wollman, F A; Girard-Bascou, J

    2001-01-01

    We isolated seven allelic nuclear mutants of Chlamydomonas reinhardtii specifically blocked in the translation of cytochrome f, a major chloroplast-encoded subunit of the photosynthetic electron transport chain encoded by the petA gene. We recovered one chloroplast suppressor in which the coding region of petA was now expressed under the control of a duplicated 5' untranslated region from another open reading frame of presently unknown function. Since we also recovered 14 nuclear intragenic suppressors, we ended up with 21 alleles of a single nuclear gene we called TCA1 for translation of cytochrome b(6)f complex petA mRNA. The high number of TCA1 alleles, together with the absence of genetic evidence for other nuclear loci controlling translation of the chloroplast petA gene, strongly suggests that TCA1 is the only trans-acting factor. We studied the assembly-dependent regulation of cytochrome f translation--known as the CES process--in TCA1-mutated contexts. In the presence of a leaky tca1 allele, we observed that the regulation of cytochrome f translation was now exerted within the limits of the restricted translational activation conferred by the altered version of TCA1 as predicted if TCA1 was the ternary effector involved in the CES process. PMID:11560891

  9. Response of NBS encoding resistance genes linked to both heat and fungal stress in Brassica oleracea.

    PubMed

    Kim, Young-Wook; Jung, Hee-Jeong; Park, Jong-In; Hur, Yoonkang; Nou, Ill-Sup

    2015-01-01

    Environmental stresses, including both abiotic and biotic stresses, cause considerable yield loss in crops and can significantly affect their development. Under field conditions, crops are exposed to a variety of concurrent stresses. Among abiotic and biotic stresses, heat and Fusarium oxysporum, are the most important factors affecting development and yield productivity of Brassica oleracea. Genes encoding the nucleotide-binding site (NBS) motif are known to be related to responses to abiotic and biotic stresses in many plants. Hence, this study was conducted to characterize the NBS encoding genes obtained from transcriptome profiles of two cabbage genotypes with contrasting responses to heat stress, and to test expression levels of selected NBS- leucine reich repeat (LRR) genes in F. oxysporum infected plants. We selected 80 up-regulated genes from a total of 264 loci, among which 17 were confirmed to be complete and incomplete members of the TIR-NBS-LRR (TNL) class families, and another identified as an NFYA-HAP2 family member. Expression analysis using qRT-PCR revealed that eight genes showed significant responses to heat shock treatment and F. oxysporum infection. Additionally, in the commercial B. oleracea cultivars with resistance to F. oxysporum, the Bol007132, Bol016084, and Bol030522 genes showed dramatically higher expression in the F. oxysporum resistant line than in the intermediate and susceptible lines. The results of this study will facilitate the identification and the development of molecular markers based on multiple stress resistance genes related to heat and fungal stress under field conditions in B. oleracea. PMID:25461701

  10. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae.

    PubMed

    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem

    2014-09-01

    Proteins containing nucleotide binding sites (NBS) encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL)-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution. PMID:25249784