Science.gov

Sample records for oligonucleotide phosphate acceptor

  1. Preparation of oligonucleotides corresponding to the acceptor stem of yeast tRNAPhe and their interaction with yeast ATP(CTP):tRNA nucleotidyltransferase.

    PubMed Central

    Wang, G H; McLaughlin, L W; Sternbach, H; Cramer, F

    1984-01-01

    Seven oligonucleotides corresponding to the 3' and 5' sequences of the acceptor stem of yeast tRNAPhe have been prepared by chemical synthesis, chemical-enzymatic synthesis or by isolation from tRNA hydrolysates. The oligonucleotides have been examined as substrates for phosphodiester bond synthesis in the presence of ATP as catalysed by yeast ATP (CTP): tRNA nucleotidyltransferase. Oligonucleotides which correspond to the sequence of the 3'-strand of the tRNA acceptor stem and possess no secondary structure exhibit little or no activity with the enzyme. The ability of the enzyme to catalyse the synthesis of a phosphodiester linkage using ATP and an oligonucleotide corresponding to the 3'-strand of the acceptor stem is in general dramatically increased when an oligonucleotide corresponding to the sequence of the 5'-strand of tRNA acceptor stem is present. In cases where significant activity was observed kinetic parameters have been determined. Images PMID:6384932

  2. Phosphate acceptor amino acid residues in structural proteins of rhabdoviruses.

    PubMed

    Sokol, F; Tan, K B; McFalls, M L; Madore, P

    1974-07-01

    Partial acid hydrolysates of the [(32)P]phosphate- or [(3)H]serine-labeled proteins of purified vesicular stomatitis, rabies, Lagos bat, Mokola, or spring viremia of carp virions and of purified intracellular nucleocapsids of these viruses have been analyzed by paper electrophoresis for the presence of phosphorylated amino acids. Both phosphoserine and phosphothreonine, with the former predominant, were present in virion and nucleocapsid preparations that contained phosphoproteins. An exception was the fish rhabdovirus, which contained only phosphoserine. When vesicular stomatitis or rabies virus proteins were phosphorylated in a cell-free system by the virion-associated protein kinase and analyzed for the presence of phosphorylated amino acid residues, phosphoserine was again found to be more abundant than phosphothreonine. After in vitro protein phosphorylation, another phospho-compound, possibly a third phosphoamino acid, was detected in the partial acid hydrolysates of these viruses. PMID:4365328

  3. Acceptor substrate binding revealed by crystal structure of human glucosamine-6-phosphate N-acetyltransferase 1.

    PubMed

    Wang, Juan; Liu, Xiang; Liang, Yu-He; Li, Lan-Fen; Su, Xiao-Dong

    2008-09-01

    Glucosamine-6-phosphate (GlcN6P) N-acetyltransferase 1 (GNA1) is a key enzyme in the pathway toward biosynthesis of UDP-N-acetylglucosamine, an important donor substrate for N-linked glycosylation. GNA1 catalyzes the formation of N-acetylglucosamine-6-phosphate (GlcNAc6P) from acetyl-CoA (AcCoA) and the acceptor substrate GlcN6P. Here, we report crystal structures of human GNA1, including apo GNA1, the GNA1-GlcN6P complex and an E156A mutant. Our work showed that GlcN6P binds to GNA1 without the help of AcCoA binding. Structural analyses and mutagenesis studies have shed lights on the charge distribution in the GlcN6P binding pocket, and an important role for Glu156 in the substrate binding. Hence, these findings have broadened our knowledge of structural features required for the substrate affinity of GNA1. PMID:18675810

  4. CpsE from Type 2 Streptococcus pneumoniae Catalyzes the Reversible Addition of Glucose-1-Phosphate to a Polyprenyl Phosphate Acceptor, Initiating Type 2 Capsule Repeat Unit Formation

    PubMed Central

    Cartee, Robert T.; Forsee, W. Thomas; Bender, Matthew H.; Ambrose, Karita D.; Yother, Janet

    2005-01-01

    The majority of the 90 capsule types made by the gram-positive pathogen Streptococcus pneumoniae are assembled by a block-type mechanism similar to that utilized by the Wzy-dependent O antigens and capsules of gram-negative bacteria. In this mechanism, initiation of repeat unit formation occurs by the transfer of a sugar to a lipid acceptor. In S. pneumoniae, this step is catalyzed by CpsE, a protein conserved among the majority of capsule types. Membranes from S. pneumoniae type 2 strain D39 and Escherichia coli containing recombinant Cps2E catalyzed incorporation of [14C]Glc from UDP-[14C]Glc into a lipid fraction in a Cps2E-dependent manner. The Cps2E-dependent glycolipid product from both membranes was sensitive to mild acid hydrolysis, suggesting that Cps2E was catalyzing the formation of a polyprenyl pyrophosphate Glc. Addition of exogenous polyprenyl phosphates ranging in size from 35 to 105 carbons to D39 and E. coli membranes stimulated Cps2E activity. The stimulation was due, in part, to utilization of the exogenous polyprenyl phosphates as an acceptor. The glycolipid product synthesized in the absence of exogenous polyprenyl phosphates comigrated with a 60-carbon polyprenyl pyrophosphate Glc. When 10 or 100 μM UMP was added to reaction mixtures containing D39 membranes, Cps2E activity was inhibited 40% and 80%, respectively. UMP, which acted as a competitive inhibitor of UDP-Glc, also stimulated Cps2E to catalyze the reverse reaction, with synthesis of UDP-Glc from the polyprenyl pyrophosphate Glc. These data indicated that Cps2E was catalyzing the addition of Glc-1-P to a polyprenyl phosphate acceptor, likely undecaprenyl phosphate. PMID:16237026

  5. Structure-guided redesign of D-fructose-6-phosphate aldolase from E. coli: remarkable activity and selectivity towards acceptor substrates by two-point mutation.

    PubMed

    Gutierrez, Mariana; Parella, Teodor; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

    2011-05-28

    Structure-guided re-design of the acceptor binding site of D-fructose-6-phosphate aldolase from E. coli leads to the construction of FSA A129S/A165G double mutant with an activity between 5- to >900-fold higher than that of wild-type towards N-Cbz-aminoaldehyde derivatives. PMID:21499643

  6. Excitonic Heterodimer Formation in an HIV-1 Oligonucleotide Labeled with a Donor-Acceptor Pair Used for Fluorescence Resonance Energy Transfer

    PubMed Central

    Bernacchi, Serena; Piémont, Etienne; Potier, Noelle; Dorsselaer, Alain van; Mély, Yves

    2003-01-01

    In this study, we investigated the absorbance and fluorescence properties of cTAR, the complementary DNA sequence of the transactivation response element of the HIV-1 genome, doubly end-labeled by different dyes, 5(and 6)-carboxyfluorescein (Fl) and 5(and 6)-carboxytetramethylrhodamine (TMR), frequently used in fluorescence resonance energy transfer (FRET) studies. This oligonucleotide forms a stable stem-loop structure. The absorption spectrum of this species clearly differed from that of a doubly labeled cTAR derivative in which the terminal part of the stem is melted and from an equimolecular mixture of singly labeled species. Moreover, no significant TMR fluorescence change accompanies the dramatic Fl intensity increase when the doubly labeled native cTAR was melted by temperature or annealed with its complementary sequence. Both elements suggest the formation of an H-type ground-state heterodimer between Fl and TMR that may be described by the molecular exciton model. Moreover, time-resolved fluorescence further suggests that the nonfluorescent heterodimer is in equilibrium with a small population of partially melted species showing FRET. Based on the spectral shifts associated with heterodimer formation, an interchromophore distance of 7.7 Å was calculated. Both the excitonic signal and the Fl fluorescence were used as sensitive tools to monitor the temperature-mediated and HIV nucleocapsid protein-mediated annealing of cTAR with its complementary sequence. PMID:12524317

  7. Excitonic heterodimer formation in an HIV-1 oligonucleotide labeled with a donor-acceptor pair used for fluorescence resonance energy transfer.

    PubMed

    Bernacchi, Serena; Piémont, Etienne; Potier, Noelle; Dorsselaer, Alain van; Mély, Yves

    2003-01-01

    In this study, we investigated the absorbance and fluorescence properties of cTAR, the complementary DNA sequence of the transactivation response element of the HIV-1 genome, doubly end-labeled by different dyes, 5(and 6)-carboxyfluorescein (Fl) and 5(and 6)-carboxytetramethylrhodamine (TMR), frequently used in fluorescence resonance energy transfer (FRET) studies. This oligonucleotide forms a stable stem-loop structure. The absorption spectrum of this species clearly differed from that of a doubly labeled cTAR derivative in which the terminal part of the stem is melted and from an equimolecular mixture of singly labeled species. Moreover, no significant TMR fluorescence change accompanies the dramatic Fl intensity increase when the doubly labeled native cTAR was melted by temperature or annealed with its complementary sequence. Both elements suggest the formation of an H-type ground-state heterodimer between Fl and TMR that may be described by the molecular exciton model. Moreover, time-resolved fluorescence further suggests that the nonfluorescent heterodimer is in equilibrium with a small population of partially melted species showing FRET. Based on the spectral shifts associated with heterodimer formation, an interchromophore distance of 7.7 A was calculated. Both the excitonic signal and the Fl fluorescence were used as sensitive tools to monitor the temperature-mediated and HIV nucleocapsid protein-mediated annealing of cTAR with its complementary sequence. PMID:12524317

  8. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  9. Polyphosphorylation and non-enzymatic template-directed ligation of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Oligonucleotide 5'-polyphosphates are formed under potentially prebiotic conditions from oligonucleotide 5'-phosphates and sodium trimetaphosphate. Oligonucleotides activated as polyphosphates undergo template-directed ligation. We believe that these reactions could have produced longer oligonucleotide products from shorter substrates under prebiotic conditions.

  10. Cytokines and therapeutic oligonucleotides.

    PubMed

    Hartmann, G; Bidlingmaier, M; Eigler, A; Hacker, U; Endres, S

    1997-12-01

    Therapeutic oligonucleotides - short strands of synthetic nucleic acids - encompass antisense and aptamer oligonucleotides. Antisense oligonucleotides are designed to bind to target RNA by complementary base pairing and to inhibit translation of the target protein. Antisense oligonucleotides enable specific inhibition of cytokine synthesis. In contrast, aptamer oligonucleotides are able to bind directly to specific proteins. This binding depends on the sequence of the oligonucleotide. Aptamer oligonucleotides with CpG motifs can exert strong immunostimulatory effects. Both kinds of therapeutic oligonucleotides - antisense and aptamer oligonucleotides - provide promising tools to modulate immunological functions. Recently, therapeutic oligonucleotides have moved towards clinical application. An antisense oligonucleotide directed against the proinflammatory intercellular adhesion molecule 1 (ICAM-1) is currently being tested in clinical trials for therapy of inflammatory disease. Immunostimulatory aptamer oligonucleotides are in preclinical development for immunotherapy. In the present review we summarize the application of therapeutic oligonucleotides to modulate immunological functions. We include technological aspects as well as current therapeutic concepts and clinical studies. PMID:9740353

  11. Identification and characterization of a mirror-image oligonucleotide that binds and neutralizes sphingosine 1-phosphate, a central mediator of angiogenesis.

    PubMed

    Purschke, Werner G; Hoehlig, Kai; Buchner, Klaus; Zboralski, Dirk; Schwoebel, Frank; Vater, Axel; Klussmann, Sven

    2014-08-15

    The sphingolipid S1P (sphingosine 1-phosphate) is known to be involved in a number of pathophysiological conditions such as cancer, autoimmune diseases and fibrosis. It acts extracellularly through a set of five G-protein-coupled receptors, but its intracellular actions are also well documented. Employing in vitro selection techniques, we identified an L-aptamer (Spiegelmer®) to S1P designated NOX-S93. The binding affinity of NOX-S93 to S1P had a Kd value of 4.3 nM. The Spiegelmer® shows equal binding to dihydro-S1P, but no cross-reactivity to the related lipids sphingosine, lysophosphatidic acid, ceramide, ceramide-1-phosphate or sphingosine phosphocholine. In stably transfected CHO (Chinese-hamster ovary) cell lines expressing the S1P receptors S1PR1 or S1PR3, NOX-S93 inhibits S1P-mediated β-arrestin recruitment and intracellular calcium release respectively, with IC50 values in the low nanomolar range. The pro-angiogenic activity of S1P, and of the growth factors VEGF-A (vascular endothelial growth factor-A), FGF-2 (fibroblast growth factor-2) and IGF-1 (insulin-like growth factor-1), was effectively blocked by NOX-S93 in a cellular angiogenesis assay employing primary human endothelial cells. These data provide further evidence for the relevance of extracellular S1P as a central mediator of angiogenesis, suggesting pharmacological S1P neutralization as a promising treatment alternative to current anti-angiogenesis approaches. PMID:24832383

  12. Identification and characterization of a mirror-image oligonucleotide that binds and neutralizes sphingosine 1-phosphate, a central mediator of angiogenesis

    PubMed Central

    Purschke, Werner G.; Hoehlig, Kai; Buchner, Klaus; Zboralski, Dirk; Schwoebel, Frank; Vater, Axel; Klussmann, Sven

    2014-01-01

    The sphingolipid S1P (sphingosine 1-phosphate) is known to be involved in a number of pathophysiological conditions such as cancer, autoimmune diseases and fibrosis. It acts extracellularly through a set of five G-protein-coupled receptors, but its intracellular actions are also well documented. Employing in vitro selection techniques, we identified an L-aptamer (Spiegelmer®) to S1P designated NOX-S93. The binding affinity of NOX-S93 to S1P had a Kd value of 4.3 nM. The Spiegelmer® shows equal binding to dihydro-S1P, but no cross-reactivity to the related lipids sphingosine, lysophosphatidic acid, ceramide, ceramide-1-phosphate or sphingosine phosphocholine. In stably transfected CHO (Chinese-hamster ovary) cell lines expressing the S1P receptors S1PR1 or S1PR3, NOX-S93 inhibits S1P-mediated β-arrestin recruitment and intracellular calcium release respectively, with IC50 values in the low nanomolar range. The pro-angiogenic activity of S1P, and of the growth factors VEGF-A (vascular endothelial growth factor-A), FGF-2 (fibroblast growth factor-2) and IGF-1 (insulin-like growth factor-1), was effectively blocked by NOX-S93 in a cellular angiogenesis assay employing primary human endothelial cells. These data provide further evidence for the relevance of extracellular S1P as a central mediator of angiogenesis, suggesting pharmacological S1P neutralization as a promising treatment alternative to current anti-angiogenesis approaches. PMID:24832383

  13. Associative Memory Acceptors.

    ERIC Educational Resources Information Center

    Card, Roger

    The properties of an associative memory are examined in this paper from the viewpoint of automata theory. A device called an associative memory acceptor is studied under real-time operation. The family "L" of languages accepted by real-time associative memory acceptors is shown to properly contain the family of languages accepted by one-tape,…

  14. The prebiotic synthesis of deoxythymidine oligonucleotides

    NASA Technical Reports Server (NTRS)

    Stephen-Sherwood, E.; Odom, D. G.; Oro, J.

    1974-01-01

    Deoxythymidine 5 prime-triphosphate in the presence of deoxythymidine 5 prime-phosphate, cyanamide and 4-amino-5-imidazole carboxamide polymerizes under drying conditions at moderate temperatures (60 to 90 C) to yield oligonucleotides of up to four units in length. Enzymatic analysis indicated that the majority of these oligomers contained natural 3 prime-5 prime phosphodiester bonds. This reaction offers a possible method for the formation of deoxyoligonucleotides under primitive earth conditions.

  15. DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme.

    PubMed

    Camden, Alison J; Walsh, Shannon M; Suk, Sarah H; Silverman, Scott K

    2016-05-10

    T4 polynucleotide kinase is widely used for 5'-phosphorylation of DNA and RNA oligonucleotide termini, but no natural protein enzyme is capable of 3'-phosphorylation. Here, we report the in vitro selection of deoxyribozymes (DNA enzymes) capable of DNA oligonucleotide 3'-phosphorylation, using a 5'-triphosphorylated RNA transcript (pppRNA) as the phosphoryl donor. The basis of selection was the capture, during each selection round, of the 3'-phosphorylated DNA substrate terminus by 2-methylimidazole activation of the 3'-phosphate (forming 3'-MeImp) and subsequent splint ligation with a 5'-amino DNA oligonucleotide. Competing and precedented DNA-catalyzed reactions were DNA phosphodiester hydrolysis or deglycosylation, each also leading to a 3'-phosphate but at a different nucleotide position within the DNA substrate. One oligonucleotide 3'-kinase deoxyribozyme, obtained from an N40 random pool and named 3'Kin1, can 3'-phosphorylate nearly any DNA oligonucleotide substrate for which the 3'-terminus has the sequence motif 5'-NKR-3', where N denotes any oligonucleotide sequence, K = T or G, and R = A or G. These results establish the viabilty of in vitro selection for identifying DNA enzymes that 3'-phosphorylate DNA oligonucleotides. PMID:27063020

  16. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides.

    PubMed

    Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-10-30

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca(2+) enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ~100 nm in size are found in Ca(2+)-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  17. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides

    PubMed Central

    Hori, Shin-ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-01-01

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca2+ enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ∼100 nm in size are found in Ca2+-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  18. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald

    2001-01-01

    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  19. Poly(oligonucleotide)

    PubMed Central

    2015-01-01

    Here we report the preparation of poly(oligonucleotide) brush polymers and amphiphilic brush copolymers from nucleic acid monomers via graft-through polymerization. We describe the polymerization of PNA-norbornyl monomers to yield poly-PNA (poly(peptide nucleic acid)) via ring-opening metathesis polymerization (ROMP) with the initiator, (IMesH2)(C5H5N)2(Cl)2RuCHPh.1 In addition, we present the preparation of poly-PNA nanoparticles from amphiphilic block copolymers and describe their hybridization to a complementary single-stranded DNA (ssDNA) oligonucleotide. PMID:25077676

  20. Alternansucrase acceptor products

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The regioselectivity of alternansucrase (EC 2.4.1.140) differs from dextransucrase (EC 2.4.1.5) in ways that can be useful for the synthesis of novel oligosaccharide structures. For example, it has been recently shown that the major oligosaccharides produced when maltose is the acceptor include one...

  1. The delivery of therapeutic oligonucleotides.

    PubMed

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  2. Optically Triggered Immune Response through Photocaged Oligonucleotides

    PubMed Central

    Govan, Jeane M.; Young, Douglas D.; Lively, Mark O.

    2015-01-01

    Bacterial and viral CpG oligonculeotides are unmethylated cytosine-phosphate-guanosine dinucleotide sequences and trigger an innate immune response through activation of the toll-like receptor 9 (TLR9). We have developed synthetic photocaged CpGs via site-specific incorporation of nitropiperonyloxymethyl (NPOM)-caged thymidine residues. These oligonucleotides enable the optical control of TLR9 function and thereby provide light-activation of an immune response. We provide a proof-of-concept model by applying a reporter assay in live cells and by quantification of endogenous production of interleukin 6. PMID:26034339

  3. Biosynthesis of Dolichyl Phosphate

    PubMed Central

    Hopp, H. Esteban; Daleo, Gustavo R.; Romero, Pedro A.; Lezica, Rafael Pont

    1978-01-01

    This is the first report not only on the presence of polyprenyl phosphates and their site of synthesis in algae, but also on the formation of their sugar derivatives in this system. A glucose acceptor lipid was isolated from the nonphotosynthetic alga Prototheca zopfii. The lipid was acidic and resistant to mild acid and alkaline treatments. The glucosylated lipid was labile to mild acid hydrolysis and resistant to phenol treatment and catalytic hydrogenation, as dolichyl phosphate glucose is. These results are consistent with the properties of an α-saturated polyprenyl phosphate. The polyprenylic nature of the lipid was confirmed by biosynthesis from radioactive mevalonate. The [14C]lipid had the same chromatographic properties as dolichyl phosphate in DEAE-cellulose and Sephadex LH-20. Strong alkaline treatment and enzymic hydrolysis liberated free alcohols with chain lengths ranging from C90 to C105, C95 and C100 being the most abundant molecular forms. The glucose acceptor activity of the biosynthesized polyprenyl phosphate was confirmed. The ability of different subcellular fractions to synthesize dolichyl phosphate was studied. Mitochondria and the Golgi apparatus were the sites of dolichyl phosphate synthesis from mevalonate. PMID:16660269

  4. Oxygen as Acceptor.

    PubMed

    Borisov, Vitaliy B; Verkhovsky, Michael I

    2015-01-01

    Like most bacteria, Escherichia coli has a flexible and branched respiratory chain that enables the prokaryote to live under a variety of environmental conditions, from highly aerobic to completely anaerobic. In general, the bacterial respiratory chain is composed of dehydrogenases, a quinone pool, and reductases. Substrate-specific dehydrogenases transfer reducing equivalents from various donor substrates (NADH, succinate, glycerophosphate, formate, hydrogen, pyruvate, and lactate) to a quinone pool (menaquinone, ubiquinone, and dimethylmenoquinone). Then electrons from reduced quinones (quinols) are transferred by terminal reductases to different electron acceptors. Under aerobic growth conditions, the terminal electron acceptor is molecular oxygen. A transfer of electrons from quinol to O₂ is served by two major oxidoreductases (oxidases), cytochrome bo₃ encoded by cyoABCDE and cytochrome bd encoded by cydABX. Terminal oxidases of aerobic respiratory chains of bacteria, which use O₂ as the final electron acceptor, can oxidize one of two alternative electron donors, either cytochrome c or quinol. This review compares the effects of different inhibitors on the respiratory activities of cytochrome bo₃ and cytochrome bd in E. coli. It also presents a discussion on the genetics and the prosthetic groups of cytochrome bo₃ and cytochrome bd. The E. coli membrane contains three types of quinones that all have an octaprenyl side chain (C₄₀). It has been proposed that the bo₃ oxidase can have two ubiquinone-binding sites with different affinities. "WHAT'S NEW" IN THE REVISED ARTICLE: The revised article comprises additional information about subunit composition of cytochrome bd and its role in bacterial resistance to nitrosative and oxidative stresses. Also, we present the novel data on the electrogenic function of appBCX-encoded cytochrome bd-II, a second bd-type oxidase that had been thought not to contribute to generation of a proton motive force in E

  5. Fluorescent oligonucleotides can serve as suitable alternatives to radiolabeled oligonucleotides.

    PubMed

    Ballal, Rahul; Cheema, Amrita; Ahmad, Waaqar; Rosen, Eliot M; Saha, Tapas

    2009-09-01

    Prolonged exposure to radiation from radionuclei used in medical research can cause DNA damage and mutation, which lead to several diseases including cancer. Radioactivity-based experiments are expensive and associated with specialized training, dedication of instruments, approvals, and cleanup with potential hazardous waste. The objective of this study was to find an alternative to the use of radioactivity in medical research using nucleic acid chemistry. FITC-labeled oligonucleotides that contain wild-type (wt) and modified base (8-oxo-G) at the same position and their complementary unlabeled strand were synthesized. Purified DNA repair enzyme, OGG1, and nuclear lysates from MCF-7 breast cancer cells were incubated with double-stranded FITC-labeled wt and 8-oxo-G oligonucleotide to demonstrate the OGG1 incision assay. We found that FITC-coupled oligonucleotides do not impose a steric hindrance during duplex formation, and the fluorescence intensity of the oligonucleotide is comparable with the intensity of the radioactive oligonucleotide. Moreover, we have seen that the OGG1 incision assay can be performed using these fluorescence oligonucleotides, replacing conventional use of radiolabeled oligonucleotides in the assay. Although the use of fluorescent-labeled oligonucleotides was described in detail for incision assays, the technique can be applied to replace a broad range of experiments, where radioactive oligonucleotides are used, eliminating the hazardous consequences of radiation. PMID:19721820

  6. Synthesis of chimeric oligonucleotides containing phosphodiester, phosphorothioate, and phosphoramidate linkages.

    PubMed

    Maier, M A; Guzaev, A P; Manoharan, M

    2000-06-29

    [reaction: see text] H-Phosphonate monomers of 2'-O-(2-methoxyethyl) ribonucleosides have been synthesized. Oxidation of oligonucleotide H-phosphonates has been optimized to allow the synthesis of oligonucleotides containing either 2'-deoxy or 2'-O-(2-methoxyethyl) ribonucleoside residues combined with three different phosphate modifications in the backbone, i.e., phosphodiester (PO), phosphorothioate (PS), and phosphoramidate (PN). Phosphodiester linkages were introduced by oxidation with a cocktail of 0.1 M Et(3)N in CCl(4)/Pyr/H(2)O (5:9:1) without affecting phosphorothioate or phosphoramidate linkages. For the synthesis of phosphoramidate-modified oligonucleotides, N(4)-acetyl deoxycytidine-3'-H-phosphonate monomers were used to avoid transamination during the oxidation step. PMID:10891166

  7. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Zieboll, Gerhard; Orgel, Leslie E.

    1994-01-01

    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  8. Working with Oligonucleotide Arrays.

    PubMed

    Carvalho, Benilton S

    2016-01-01

    Preprocessing microarray data consists of a number of statistical procedures that convert the observed intensities into quantities that represent biological events of interest, like gene expression and allele-specific abundances. Here, we present a summary of the theory behind microarray data preprocessing for expression, whole transcriptome and SNP designs and focus on the computational protocol used to obtain processed data that will be used on downstream analyses. We describe the main features of the oligo Bioconductor package, an application designed to support oligonucleotide microarrays using the R statistical environment and the infrastructure provided by Bioconductor, allowing the researcher to handle probe-level data and interface with advanced statistical tools under a simplified framework. We demonstrate the use of the package by preprocessing data originated from three different designs. PMID:27008013

  9. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  10. Construction and Evaluation of Desulfovibrio vulgaris Whole-Genome Oligonucleotide Microarrays

    SciTech Connect

    Z. He; Q. He; L. Wu; M.E. Clark; J.D. Wall; Jizhong Zhou; Matthew W. Fields

    2004-03-17

    Desulfovibrio vulgaris Hildenborough has been the focus of biochemical and physiological studies in the laboratory, and the metabolic versatility of this organism has been largely recognized, particularly the reduction of sulfate, fumarate, iron, uranium and chromium. In addition, a Desulfovibrio sp. has been shown to utilize uranium as the sole electron acceptor. D. vulgaris is a d-Proteobacterium with a genome size of 3.6 Mb and 3584 ORFs. The whole-genome microarrays of D. vulgaris have been constructed using 70mer oligonucleotides. All ORFs in the genome were represented with 3471 (97.1%) unique probes and 103 (2.9%) non-specific probes that may have cross-hybridization with other ORFs. In preparation for use of the experimental microarrays, artificial probes and targets were designed to assess specificity and sensitivity and identify optimal hybridization conditions for oligonucleotide microarrays. The results indicated that for 50mer and 70mer oligonucleotide arrays, hybridization at 45 C to 50 C, washing at 37 C and a wash time of 2.5 to 5 minutes obtained specific and strong hybridization signals. In order to evaluate the performance of the experimental microarrays, growth conditions were selected that were expected to give significant hybridization differences for different sets of genes. The initial evaluations were performed using D. vulgaris cells grown at logarithmic and stationary phases. Transcriptional analysis of D. vulgaris cells sampled during logarithmic phase growth indicated that 25% of annotated ORFs were up-regulated and 3% of annotated ORFs were downregulated compared to stationary phase cells. The up-regulated genes included ORFs predicted to be involved with acyl chain biosynthesis, amino acid ABC transporter, translational initiation factors, and ribosomal proteins. In the stationary phase growth cells, the two most up-regulated ORFs (70-fold) were annotated as a carboxynorspermidine decarboxylase and a 2C-methyl-D-erythritol-2

  11. Electrochemical uranyl cation biosensor with DNA oligonucleotides as receptor layer.

    PubMed

    Jarczewska, Marta; Ziółkowski, Robert; Górski, Łukasz; Malinowska, Elżbieta

    2014-04-01

    The present study aims at the further development of the uranyl oligonucleotide-based voltammetric biosensor, which takes advantage of strong interaction between UO2(2+) and phosphate DNA backbone. Herein we report the optimization of working parameters of previously elaborated electrochemical DNA biosensor. It is shown that the sensor sensitivity is highly dependent on the oligonucleotide probe length and the incubation time of sensor in a sample solution. Consequently, the highest sensitivity was obtained for 10-nucleotide sequence and 60 min incubation time. The lower detection limit towards uranyl cation for developed biosensor was 30 nM. The influence of mixed monolayers and the possibility of developing a non-calibration device were also investigated. The selectivity of the proposed biosensor was significantly improved via elimination of adenine nucleobases from the DNA probe. Moreover, the regeneration procedure was elaborated and tested to prolong the use of the same biosensor for 4 subsequent determinations of UO2(2+). PMID:24334186

  12. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes

    2013-01-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  13. Acceptors in ZnO

    SciTech Connect

    McCluskey, Matthew D. Corolewski, Caleb D.; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T.; Walter, Eric D.; Norton, M. Grant; Harrison, Kale W.; Ha, Su

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence indicates these point defects have acceptor levels 3.2, 1.4, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO{sub 2} contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals is attributed to an acceptor, which may involve a Zn vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g{sub ⊥} = 2.0015 and g{sub //} = 2.0056, along with an isotropic center at g = 2.0035.

  14. Acceptors in ZnO

    SciTech Connect

    Mccluskey, Matthew D.; Corolewski, Caleb; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T.; Walter, Eric D.; Norton, M. G.; Harrison, Kale W.; Ha, Su Y.

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence shows that these point defects have acceptor levels 3.2, 1.5, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO2 contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals has been attributed to an acceptor, which may involve a zinc vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g = 2.0033 and g = 2.0075, along with an isotropic center at g = 2.0053.

  15. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  16. [Study toward practical use of oligonucleotide therapeutics].

    PubMed

    Inoue, Takao; Yoshida, Tokuyuki

    2014-01-01

    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics. PMID:25707197

  17. Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.

    PubMed

    Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E

    2005-02-01

    Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. PMID:15614814

  18. Phosphate salts

    MedlinePlus

    ... taken by mouth or used as enemas. Indigestion. Aluminum phosphate and calcium phosphate are FDA-permitted ingredients ... Phosphate salts containing sodium, potassium, aluminum, or calcium are LIKELY SAFE for most people when taken by mouth short-term, when sodium phosphate is inserted into the ...

  19. The synthesis of oligonucleotides containing a primary amino group at the 5'-terminus.

    PubMed Central

    Connolly, B A

    1987-01-01

    Oligonucleotides containing a primary amino group at their 5'-termini have been prepared and further derivatised with amino specific probes. The sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed with N-monomethoxytrityl-0-methoxydiisopropylaminophosphinyl 3-aminopropan(1)ol. After cleavage from the resin, removal of the phosphate and base protecting groups and purification gives a monomethoxytrityl-NH(CH2)3PO4-oligomer. The monomethoxytrityl group can be removed with acetic acid to give the desired amino containing oligomer. The amino group can be further derivatised with amino specific probes yielding fluorescent or biotinylated oligonucleotide products. PMID:3562247

  20. Electron acceptor dependence of electron shuttle secretion and extracellular electron transfer by Shewanella oneidensis MR-1.

    PubMed

    Wu, Chao; Cheng, Yuan-Yuan; Li, Bing-Bing; Li, Wen-Wei; Li, Dao-Bo; Yu, Han-Qing

    2013-05-01

    Shewanella oneidensis MR-1 is an extensively studied dissimilatory metal-reducing bacterium with a great potential for bioremediation and electricity generation. It secretes flavins as electron shuttles which play an important role in extracellular electron transfer. However, the influence of various environmental factors on the secretion of flavins is largely unknown. Here, the effects of electron acceptors, including fumarate, ferrihydrite, Fe(III)-nitrilotriacetic acid (NTA), nitrate and trimethylamine oxide (TMAO), on the secretion of flavins were investigated. The level of riboflavin and riboflavin-5'-phosphate (FMN) secreted by S. oneidensis MR-1 varied considerably with different electron acceptors. While nitrate and ferrihydrite suppressed the secretion of flavins in relative to fumarate, Fe(III)-NTA and TMAO promoted such a secretion and greatly enhanced ferrihydrite reduction and electricity generation. This work clearly demonstrates that electron acceptors could considerably affect the secretion of flavins and consequent microbial EET. Such impacts of electron acceptors in the environment deserve more attention. PMID:23558182

  1. Biopolymer synthesis on polypropylene supports. I. Oligonucleotides.

    PubMed

    Matson, R S; Rampal, J B; Coassin, P J

    1994-03-01

    We have modified polypropylene to serve as a new solid-phase support for oligonucleotide synthesis. The plastic is first surface aminated by exposure to an ammonia plasma generated by radiofrequency plasma discharge. The aminated polypropylene has been found to be useful as a support for the in situ synthesis of oligonucleotides from monomers. Furthermore, oligonucleotides synthesized on the surface of the plastic remain attached following deprotection and can be used directly for hybridization. PMID:8203760

  2. Disulfide-tethered solid supports for synthesis of photoluminescent oligonucleotide conjugates: hydrolytic stability and labeling on the support.

    PubMed

    Salo, H; Guzaev, A; Lönnberg, H

    1998-01-01

    Several new disulfide-tethered solid supports (S1-S5) were synthesized, and their resistance against ammonolysis was tested. Among these supports, only the one bearing an N-[15-[(4, 4'-dimethoxytrityl)oxy]-12,13-dithiapentadecanoyl] linker (S4b) tolerated ammonolysis and exhibited properties compatible with the oligonucleotide synthesis by phosphoramidite strategy. The applicability of this disulfide linker structure in postsynthetic oligonucleotide labeling on the support was demonstrated by introduction of two photoluminescent lanthanide chelates or two dansyl groups to the N4-(6-aminohexyl) amino-modified cytosine residues at the 5' end of the oligonucleotide sequence. Subsequent release of the resulting conjugates as their 3'-phosphates was achieved by reductive cleavage of the disulfide bond and precipitation of the conjugate from the solution with ethanol. The fluorescently tagged oligomer obtained showed hybridization properties similar to those of oligonucleotides labeled in solution. PMID:9576811

  3. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.

    1974-01-01

    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  4. Phosphate salts

    MedlinePlus

    ... as a laxative to clean the bowels before surgery or intestinal tests. Healthcare providers sometimes give potassium phosphate intravenously (by IV) for treating low phosphate and high calcium levels in the blood, and for preventing low phosphate in patients who are being tube-fed.

  5. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian

    2014-01-01

    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  6. Relationship between Nitrite Reduction and Active Phosphate Uptake in the Phosphate-Accumulating Denitrifier Pseudomonas sp. Strain JR 12

    PubMed Central

    Barak, Yoram; van Rijn, Jaap

    2000-01-01

    Phosphate uptake by the phosphate-accumulating denitrifier Pseudomonas sp. JR12 was examined with different combinations of electron and carbon donors and electron acceptors. Phosphate uptake in acetate-supplemented cells took place with either oxygen or nitrate but did not take place when nitrite served as the final electron acceptor. Furthermore, nitrite reduction rates by this denitrifier were shown to be significantly reduced in the presence of phosphate. Phosphate uptake assays in the presence of the H+-ATPase inhibitor N,N′-dicyclohexylcarbodiimide (DCCD), in the presence of the uncoupler carbonyl cyanide 3-chlorophenylhydrazone (CCCP), or with osmotic shock-treated cells indicated that phosphate transport over the cytoplasmic membrane of this bacterium was mediated by primary and secondary transport systems. By examining the redox transitions of whole cells at 553 nm we found that phosphate addition caused a significant oxidation of a c-type cytochrome. Based on these findings, we propose that this c-type cytochrome serves as an intermediate in the electron transfer to both nitrite reductase and the site responsible for active phosphate transport. In previous studies with this bacterium we found that the oxidation state of this c-type cytochrome was significantly higher in acetate-supplemented, nitrite-respiring cells (incapable of phosphate uptake) than in phosphate-accumulating cells incubated with different combinations of electron donors and acceptors. Based on the latter finding and results obtained in the present study it is suggested that phosphate uptake in this bacterium is subjected to a redox control of the active phosphate transport site. By means of this mechanism an explanation is provided for the observed absence of phosphate uptake in the presence of nitrite and inhibition of nitrite reduction by phosphate in this organism. The implications of these findings regarding denitrifying, phosphate removal wastewater plants is discussed. PMID

  7. Electron Transfer Dissociation of Oligonucleotide Cations.

    PubMed

    Smith, Suncerae I; Brodbelt, Jennifer S

    2009-06-01

    Electron transfer dissociation (ETD) of multi-protonated 6 - 20-mer oligonucleotides and 12- and 14-mer duplexes is compared to collision activated dissociation (CAD). ETD causes efficient charge reduction of the multi-protonated oligonucleotides in addition to limited backbone cleavages to yield sequence ions of low abundance. Subsequent CAD of the charge-reduced oligonucleotides formed upon electron transfer, in a net process termed electron transfer collision activated dissociation (ETcaD), results in rich fragmentation in terms of w, a, z, and d products, with a marked decrease in the abundance of base loss ions and internal fragments. Complete sequencing was possible for nearly all oligonucleotides studied. ETcaD of an oligonucleotide duplex resulted in specific backbone cleavages, with conservation of weaker non-covalent bonds. PMID:20161288

  8. Structural basis for phosphatidylinositol-phosphate biosynthesis

    PubMed Central

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-01-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis. PMID:26510127

  9. Structural basis for phosphatidylinositol-phosphate biosynthesis.

    PubMed

    Clarke, Oliver B; Tomasek, David; Jorge, Carla D; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R; Shapiro, Lawrence; Hendrickson, Wayne A; Santos, Helena; Mancia, Filippo

    2015-01-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis. PMID:26510127

  10. Structural basis for phosphatidylinositol-phosphate biosynthesis

    NASA Astrophysics Data System (ADS)

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-10-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.

  11. DONOR-ACCEPTOR INTERACTIONS OF NITROGEN*

    PubMed Central

    Kimura, J. E.; Szent-Györgyi, A.

    1969-01-01

    The nitrogen atoms of organic molecules readily enter into donor-acceptor interactions, giving off an electron from their lone pair. Under favorable conditions the acceptor can form free radicals. S and O atoms behave likewise but less intensely. PMID:4306047

  12. Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens

    NASA Technical Reports Server (NTRS)

    Nealson, K. H.; Moser, D. P.; Saffarini, D. A.

    1995-01-01

    Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

  13. Glucansucrase acceptor reactions with D-mannose

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The main acceptor product of glucansucrases with D-mannose has not previously been identified. We used glucansucrases that form water-insoluble a-D-glucans to produce increased yields of acceptor products from D-mannose, and identified the major product as 6-O-a-D-glucopyranosyl-D-mannose. Glucansuc...

  14. Synthesis of 5'-Aldehyde Oligonucleotide.

    PubMed

    Lartia, Rémy

    2016-01-01

    Synthesis of oligonucleotide ending with an aldehyde functional group at their 5'-end (5'-AON) is possible for both DNA (5'-AODN) and RNA (5'-AORN) series irrespectively of the nature of the last nucleobase. The 5'-alcohol of on-support ODN is mildly oxidized under Moffat conditions. Transient protection of the resulting aldehyde by N,N'-diphenylethylenediamine derivatives allows cleavage, deprotection, and RP-HPLC purification of the protected 5'-AON. Finally, 5'-AON is deprotected by usual acetic acid treatment. In the aggregates, 5'-AON can be now synthesized and purified as routinely as non-modified ODNs, following procedures similar to the well-known "DMT-On" strategy. PMID:26967469

  15. Tandem oligonucleotide synthesis using linker phosphoramidites

    PubMed Central

    Pon, Richard T.; Yu, Shuyuan

    2005-01-01

    Multiple oligonucleotides of the same or different sequence, linked end-to-end in tandem can be synthesized in a single automated synthesis. A linker phosphoramidite [R. T. Pon and S. Yu (2004) Nucleic Acids Res., 32, 623–631] is added to the 5′-terminal OH end of a support-bound oligonucleotide to introduce a cleavable linkage (succinic acid plus sulfonyldiethanol) and the 3′-terminal base of the new sequence. Conventional phosphoramidites are then used for the rest of the sequence. After synthesis, treatment with ammonium hydroxide releases the oligonucleotides from the support and cleaves the linkages between each sequence. Mixtures of one oligonucleotide with both 5′- and 3′-terminal OH ends and other oligonucleotides with 5′-phosphorylated and 3′-OH ends are produced, which are deprotected and worked up as a single product. Tandem synthesis can be used to make pairs of PCR primers, sets of cooperative oligonucleotides or multiple copies of the same sequence. When tandem synthesis is used to make two self-complementary sequences, double-stranded structures spontaneously form after deprotection. Tandem synthesis of oligonucleotide chains containing up to six consecutive 20mer (120 bases total), various trinucleotide codons and primer pairs for PCR, or self-complementary strands for in situ formation of double-stranded DNA fragments has been demonstrated. PMID:15814811

  16. Bright Solid-State Emission of Disilane-Bridged Donor-Acceptor-Donor and Acceptor-Donor-Acceptor Chromophores.

    PubMed

    Shimada, Masaki; Tsuchiya, Mizuho; Sakamoto, Ryota; Yamanoi, Yoshinori; Nishibori, Eiji; Sugimoto, Kunihisa; Nishihara, Hiroshi

    2016-02-01

    The development of disilane-bridged donor-acceptor-donor (D-Si-Si-A-Si-Si-D) and acceptor-donor-acceptor (A-Si-Si-D-Si-Si-A) compounds is described. Both types of compound showed strong emission (λem =ca. 500 and ca. 400 nm, respectively) in the solid state with high quantum yields (Φ: up to 0.85). Compound 4 exhibited aggregation-induced emission enhancement in solution. X-ray diffraction revealed that the crystal structures of 2, 4, and 12 had no intermolecular π-π interactions to suppress the nonradiative transition in the solid state. PMID:26822564

  17. Pyridine as proton acceptor in the concerted proton electron transfer oxidation of phenol.

    PubMed

    Bonin, Julien; Costentin, Cyrille; Robert, Marc; Savéant, Jean-Michel

    2011-06-01

    Taking pyridine as a prototypal example of biologically important nitrogen bases involved in proton-coupled electron transfers, it is shown with the example of the photochemically triggered oxidation of phenol by Ru(III)(bpy)(3) that this proton acceptor partakes in a concerted pathway whose kinetic characteristics can be extracted from the overall kinetic response. The treatment of these data, implemented by the results of a parallel study carried out in heavy water, allowed the determination of the intrinsic kinetic characteristics of this proton acceptor. Comparison of the reorganization energies and of the pre-exponential factors previously derived for hydrogen phosphate and water (in water) as proton acceptors suggests that, in the case of pyridine, the proton charge is delocalized over a primary shell of water molecules firmly bound to the pyridinium cation. PMID:21499600

  18. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  19. Quantitation of phosphorothioate oligonucleotides in human plasma.

    PubMed

    Leeds, J M; Graham, M J; Truong, L; Cummins, L L

    1996-03-01

    Methods are presented for the extraction of phosphorothioate oligonucleotides from human plasma to permit quantitation by capillary gel electrophoresis. Extraction of the phosphorothioate oligonucleotides from plasma was accomplished using two solid-phase extraction columns, a strong anion-exchange column to remove plasma proteins and lipids, followed by a reverse-phase column to remove salts. A second desalting step, achieved by dialysis utilizing a membrane with a molecular weight cutoff of 2500 Da floating on distilled water, was required to remove residual ionic material from the extracted sample. This method should be generally applicable to the analysis and quantitation of phosphorothioate oligonucleotides. PMID:8850544

  20. Gene Assembly from Chip-Synthesized Oligonucleotides

    PubMed Central

    Eroshenko, Nikolai; Kosuri, Sriram; Marblestone, Adam H; Conway, Nicholas; Church, George M.

    2012-01-01

    De novo synthesis of long double-stranded DNA constructs has a myriad of applications in biology and biological engineering. However, its widespread adoption has been hindered by high costs. Cost can be significantly reduced by using oligonucleotides synthesized on high-density DNA chips. However, most methods for using off-chip DNA for gene synthesis have failed to scale due to the high error rates, low yields, and high chemical complexity of the chip-synthesized oligonucleotides. We have recently demonstrated that some commercial DNA chip manufacturers have improved error rates, and that the issues of chemical complexity and low yields can be solved by using barcoded primers to accurately and efficiently amplify subpools of oligonucleotides. This article includes protocols for computationally designing the DNA chip, amplifying the oligonucleotide subpools, and assembling 500-800 basepair (bp) constructs. PMID:25077042

  1. Transformation of yeast with synthetic oligonucleotides.

    PubMed Central

    Moerschell, R P; Tsunasawa, S; Sherman, F

    1988-01-01

    Genomic DNA of the yeast, Saccharomyces cerevisiae, can be conveniently and specifically altered by transforming spheroplasts or lithium acetate-treated cells directly with synthetic oligonucleotides. Altered forms of iso-1-cytochrome c were generated by transforming a cyc1 mutant with oligonucleotides and selecting for at least partially functional revertants; the oligonucleotides contained a sequence that corrected the cyc1 mutation and produced additional alterations at nearby sites. Transformation has been accomplished with oligonucleotides as short as 20 nucleotides and with amounts as low as 100 micrograms. This method of site-directed mutagenesis in vivo has been used to produce alterations in the NH2-terminal region of iso-1-cytochrome c in which the NH2-terminal methionine is excised and the penultimate residue is acetylated. PMID:2829192

  2. Antisense oligonucleotides as therapeutics for malignant diseases.

    PubMed

    Ho, P T; Parkinson, D R

    1997-04-01

    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  3. Acceptor Products of Alternansucrase with Gentiobiose

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the presence of suitable acceptor molecules, dextransucrase makes a homologous series of oligosaccharides in which the isomers differ by a single glucosyl unit, whereas alternansucrase synthesizes one trisaccharide, two tetrasaccharides, etc. Previously, we showed that alternansucrase only forms...

  4. Synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S.; Curran, George P.

    1981-08-18

    A synthetic CO.sub.2 acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca.sub.5 (SiO.sub.4).sub.2 CO.sub.3. A method for producing the synthetic CO.sub.2 acceptor is also disclosed.

  5. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    PubMed

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  6. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field

    PubMed Central

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds’ vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  7. Caged oligonucleotides for studying biological systems

    PubMed Central

    Ruble, Brittani K.; Yeldell, Sean B.; Dmochowski, Ivan J.

    2015-01-01

    Light-activated (“caged”) compounds have been widely employed for studying biological processes with high spatial and temporal control. In the past decade, several new approaches for caging the structure and function of DNA and RNA oligonucleotides have been developed. This review focuses on caged oligonucleotides that incorporate site-specifically one or two photocleavable linkers, whose photolysis yields oligonucleotides with dramatic structural and functional changes. This technique has been employed by our laboratory and others to photoregulate gene expression in cells and living organisms, typically using near UV-activated organic chromophores. To improve capabilities for in vivo studies, we harnessed the rich inorganic photochemistry of ruthenium bipyridyl complexes to synthesize Ru-caged morpholino antisense oligonucleotides that remain inactive in zebrafish embryos until uncaged with visible light. Expanding into new caged oligonucleotide applications, our lab has developed Transcriptome In Vivo Analysis (TIVA) technology, which provides the first noninvasive, unbiased method for isolating mRNA from single neurons in brain tissues. TIVA-isolated mRNA can be amplified and then analyzed using next-generation sequencing (RNA-seq). PMID:25865001

  8. In silico screening based on predictive algorithms as a design tool for exon skipping oligonucleotides in Duchenne muscular dystrophy.

    PubMed

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense 'splice-switching' oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2'O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R² 0.89) and 53 (R² 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of

  9. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each

  10. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. PMID:24727531

  11. Sugar radicals formed by photo-excitation of guanine cation radical in oligonucleotides

    PubMed Central

    Adhikary, Amitava; Collins, Sean; Khanduri, Deepti; Sevilla, Michael D.

    2008-01-01

    This work presents evidence that photo-excitation of guanine cation radical (G•+) in dGpdG and DNA-oligonucleotides: TGT, TGGT, TGGGT, TTGTT, TTGGTT, TTGGTTGGTT, AGA and AGGGA in frozen glassy aqueous solutions at low temperatures leads to hole transfer to the sugar phosphate backbone and results in high yields of deoxyribose radicals. In this series of oligonucleotides we find that, G•+ on photo-excitation, at 143 K leads to the formation of predominantly C5′• and C1′• with small amounts of C3′•. Photo-conversion yields of G•+ to sugar radicals in oligonucleotides decreased as the overall chain length increased. However, for high molecular weight dsDNA (salmon testes) in frozen aqueous solutions substantial conversion of G•+ to C1′• (only) sugar radical is still found (ca. 50%). Within the cohort of sugar radicals formed we find a relative increase in the formation of C1′• with length of the oligonucleotide along with decreases in C3′• and C5′• For dsDNA in frozen solutions, only the formation of C1′• is found via photo-excitation of G•+ without a significant temperature dependence (77 K to 180 K). Long wavelength visible light (>540 nm) is observed to be about as effective as light under 540 nm for photoconversion of G•+ to sugar radicals for short oligonucleotides but gradually loses effectiveness with chain length. This wavelength dependence is attributed to base-to-base hole transfer for wavelengths >540 nm. Base-to-sugar hole transfer is suggested to dominate under 540 nm. These results may have implications for a number of investigations of hole transfer through DNA in which DNA-holes are subjected to continuous visible illumination. PMID:17547448

  12. Inhibition of dengue virus by novel, modified antisense oligonucleotides.

    PubMed Central

    Raviprakash, K; Liu, K; Matteucci, M; Wagner, R; Riffenburgh, R; Carl, M

    1995-01-01

    Five different target regions along the length of the dengue virus type 2 genome were compared for inhibition of the virus following intracellular injection of the cognate antisense oligonucleotides and their analogs. Unmodified phosphodiester oligonucleotides as well as the corresponding phosphorothioate oligonucleotides were ineffective in bringing about a significant inhibition of the virus. Novel modified phosphorothioate oligonucleotides in which the C-5 atoms of uridines and cytidines were replaced by propynyl groups caused a significant inhibition of the virus. Antisense oligonucleotide directed against the target region near the translation initiation site of dengue virus RNA was the most effective, followed by antisense oligonucleotide directed against a target in the 3' untranslated region of the virus RNA. It is suggested that the inhibitory effect of these novel modified oligonucleotides is due to their increased affinity for the target sequences and that they probably function via an RNase H cleavage of the oligonucleotide:RNA heteroduplex. PMID:7983769

  13. Electron Donor Acceptor Interactions. Final Progress Report

    SciTech Connect

    2002-08-16

    The Gordon Research Conference (GRC) on Electron Donor Acceptor Interactions was held at Salve Regina University, Newport, Rhode Island, 8/11-16/02. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  14. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  15. PERFORMANCE CHARACTERISTICS OF 65-MER OLIGONUCLEOTIDE MICROARRAYS

    PubMed Central

    Lee, Myoyong; Xiang, Charlie C.; Trent, Jeffrey M.; Bittner, Michael L.

    2009-01-01

    Microarray fabrication using pre-synthesized long oligonucleotide is becoming increasingly important, but a study of large-scale array productions is not published yet. We addressed the issue of fabricating oligonucleotide microarrays by spotting commercial, pre-synthesized 65-mers with 5′ amines representing 7500 murine genes. Amine-modified oligonucleotides were immobilized on glass slides having aldehyde groups via transient Schiff base formation followed by reduction to produce a covalent conjugate. When RNA derived from the same source was used for Cy3 and Cy5 labeling and hybridized to the same array, signal intensities spanning three orders of magnitude were observed, and the coefficient of variation between the two channels for all spots was 8–10%. To ascertain the reproducibility of ratio determination of these arrays, two triplicate hybridizations (with fluorochrome reversal) comparing RNAs from a fibroblast (NIH3T3) and a breast cancer (JC) cell line were carried out. The 95% confidence interval for all spots in the six hybridizations was 0.60 – 1.66. This level of reproducibility allows use of the full range of pattern finding and discriminant analysis typically applied to cDNA microarrays. Further comparative testing was carried out with oligonucleotide microarrays, cDNA microarrays and RT-PCR assays to examine the comparability of results across these different methodologies. PMID:17617369

  16. Oligonucleotide recombination in gram negative bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This report describes several key aspects of a novel form of RecA-independent homologous recombination. We found that synthetic single stranded DNA oligonucleotides (oligos) introduced into bacteria by transformation can site-specifically recombine with bacterial chromosomes in the absence of any a...

  17. Alteration of the Donor/Acceptor Spectrum of the (S)-Amine Transaminase from Vibrio fluvialis.

    PubMed

    Genz, Maika; Vickers, Clare; van den Bergh, Tom; Joosten, Henk-Jan; Dörr, Mark; Höhne, Matthias; Bornscheuer, Uwe T

    2015-01-01

    To alter the amine donor/acceptor spectrum of an (S)-selective amine transaminase (ATA), a library based on the Vibrio fluvialis ATA targeting four residues close to the active site (L56, W57, R415 and L417) was created. A 3DM-derived alignment comprising fold class I pyridoxal-5'-phosphate (PLP)-dependent enzymes allowed identification of positions, which were assumed to determine substrate specificity. These positions were targeted for mutagenesis with a focused alphabet of hydrophobic amino acids to convert an amine:α-keto acid transferase into an amine:aldehyde transferase. Screening of 1200 variants revealed three hits, which showed a shifted amine donor/acceptor spectrum towards aliphatic aldehydes (mainly pentanal), as well as an altered pH profile. Interestingly, all three hits, although found independently, contained the same mutation R415L and additional W57F and L417V substitutions. PMID:26569229

  18. Alteration of the Donor/Acceptor Spectrum of the (S)-Amine Transaminase from Vibrio fluvialis

    PubMed Central

    Genz, Maika; Vickers, Clare; van den Bergh, Tom; Joosten, Henk-Jan; Dörr, Mark; Höhne, Matthias; Bornscheuer, Uwe T.

    2015-01-01

    To alter the amine donor/acceptor spectrum of an (S)-selective amine transaminase (ATA), a library based on the Vibrio fluvialis ATA targeting four residues close to the active site (L56, W57, R415 and L417) was created. A 3DM-derived alignment comprising fold class I pyridoxal-5′-phosphate (PLP)-dependent enzymes allowed identification of positions, which were assumed to determine substrate specificity. These positions were targeted for mutagenesis with a focused alphabet of hydrophobic amino acids to convert an amine:α-keto acid transferase into an amine:aldehyde transferase. Screening of 1200 variants revealed three hits, which showed a shifted amine donor/acceptor spectrum towards aliphatic aldehydes (mainly pentanal), as well as an altered pH profile. Interestingly, all three hits, although found independently, contained the same mutation R415L and additional W57F and L417V substitutions. PMID:26569229

  19. Circulation of oligonucleotides by disulfide bridge formation.

    PubMed Central

    Gao, H; Yang, M; Patel, R; Cook, A F

    1995-01-01

    An effective, convenient method for the circularization of oligonucleotides has been developed. This procedure involved preparation of an oligonucleotide with backbone-linked 5'- and 3'-terminal hexamethylenethiol groups, followed by oxidation of the thiol groups with air of oxygen to produce the corresponding circular sequence bridged via a bis(hexamethylene)-disulfide moiety. The method has been applied to the circularization of oligodeoxynucleotide sequences of varying lengths (5, 10, 15, 20, 30 and 40 bases), and the circularization process was highly efficient as shown by HPLC or gel electrophoresis of the crude reaction mixtures. Competing reactions such as dimerization were not significant except for the longer sequences (30 and 40 bases). The circularization of an eight base RNA sequence was also accomplished, as well as hexa-ethylene glycol bridged poly-T sequences capable of triplex formation. PMID:7596832

  20. DNA analysis and diagnostics on oligonucleotide microchips.

    PubMed Central

    Yershov, G; Barsky, V; Belgovskiy, A; Kirillov, E; Kreindlin, E; Ivanov, I; Parinov, S; Guschin, D; Drobishev, A; Dubiley, S; Mirzabekov, A

    1996-01-01

    We present a further development in the technology of sequencing by hybridization to oligonucleotide microchips (SHOM) and its application to diagnostics for genetic diseases. A robot has been constructed to manufacture sequencing "microchips." The microchip is an array of oligonucleotides immobilized into gel elements fixed on a glass plate. Hybridization of the microchip with fluorescently labeled DNA was monitored in real time simultaneously for all microchip elements with a two-wavelength fluorescent microscope equipped with a charge-coupled device camera. SHOM has been used to detect beta-thalassemia mutations in patients by hybridizing PCR-amplified DNA with the microchips. A contiguous stacking hybridization technique has been applied for the detection of mutations; it can simplify medical diagnostics and enhance its reliability. The use of multicolor monitoring of contiguous stacking hybridization is suggested for large-scale diagnostics and gene polymorphism studies. Other applications of the SHOM technology are discussed. Images Fig. 2 Fig. 3 Fig. 4 PMID:8643503

  1. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J

    2015-01-01

    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  2. Solid-Phase Synthesis and Hybrization Behavior of Partially 2′/3′-O-Acetylated RNA Oligonucleotides

    PubMed Central

    2014-01-01

    Synthesis of partially 2′/3′-O-acetylated oligoribonucleotides has been accomplished by using a 2′/3′-O-acetyl orthogonal protecting group strategy in which non-nucleophilic strong-base (DBU) labile nucleobase protecting groups and a UV-light cleavable linker were used. Strong-base stability of the photolabile linker allowed on-column nucleobase and phosphate deprotection, followed by a mild cleavage of the acetylated oligonucleotides from the solid support with UV light. Two 17nt oligonucleotides, which were synthesized possessing one specific internal 2′- or 3′-acetyl group, were used as synthetic standards in a recent report from this laboratory detailing the prebiotically plausible ligation of RNA oligonucleotides. In order to further investigate the effect of 2′/3′-O-acetyl groups on the stability of RNA duplex structure, two complementary bis-acetylated RNA oligonucleotides were also expediently obtained with the newly developed protocols. UV melting curves of 2′-O-acetylated RNA duplexes showed a consistent ∼3.1 °C decrease in Tm per 2′-O-acetyl group. PMID:24666354

  3. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  4. Bifunctional phosphoramidite reagents for the introduction of histidyl and dihistidyl residues into oligonucleotides.

    PubMed

    Smith, T H; LaTour, J V; Bochkariov, D; Chaga, G; Nelson, P S

    1999-01-01

    The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is described. Automated oligonucleotide synthesis utilizing a bifunctional reagent for the incorporation of a dihistidyl residue into oligonucleotides is described. Oligonucleotides incorporating one to three dihistidyl residues were prepared and characterized. The interaction of these oligonucleotides with a metal chelating IMAC matrix was explored. PMID:10411463

  5. Alkyl Chlorides as Hydrogen Bond Acceptors

    SciTech Connect

    Nadas, Janos I; Vukovic, Sinisa; Hay, Benjamin

    2012-01-01

    To gain an understanding of the role of an alkyl chloride as a hydrogen bond acceptor, geometries and interaction energies were calculated at the MP2/aug-cc-pVDZ level of theory for complexes between ethyl chloride and representative hydrogen donor groups. The results establish that these donors, which include hydrogen cyanide, methanol, nitrobenzene, pyrrole, acetamide, and N-methylurea, form X-H {hor_ellipsis} Cl hydrogen bonds (X = C, N, O) of weak to moderate strength, with {Delta}E values ranging from -2.8 to -5.3 kcal/mol.

  6. Donor/acceptor chromophores-decorated triazolyl unnatural nucleosides: synthesis, photophysical properties and study of interaction with BSA.

    PubMed

    Bag, Subhendu Sekhar; Talukdar, Sangita; Das, Suman Kalyan; Pradhan, Manoj Kumar; Mukherjee, Soumen

    2016-06-14

    Much effort has been put forth to develop unnatural, stable, hydrophobic base pairs with orthogonal recognition properties and study their effect on DNA duplex stabilisation. Our continuous efforts on the design of fluorescent unnatural biomolecular building blocks lead us to the synthesis of some triazolyl donor/acceptor unnatural nucleosides via an azide-alkyne 1,3-dipolar cycloaddition reaction as a key step, which we want to report herein. We have studied their photophysical properties and found interesting solvatochromic fluorescence for two of the nucleosides. Photophysical interactions among two donor-acceptor β-nucleosides as well as a pair of α/β-nucleosides have also been evaluated. Furthermore, we have exploited one of the fluorescent nucleosides in studying its interaction with BSA with the help of UV-visible and steady state fluorescence techniques. Our design concept is based on the hypothesis that a pair of such donor/acceptor nucleosides might be involved in π-stacking as well as in photophysical interactions, leading to stabilization of the DNA duplex if such nucleosides can be incorporated into short oligonucleotide sequences. Therefore, the designed bases may find application in biophysical studies in the context of DNA. PMID:27181694

  7. Terahertz spectroscopy of oligonucleotides in aqueous solutions.

    PubMed

    Tang, Mingjie; Huang, Qing; Wei, Dongshan; Zhao, Guozhong; Chang, Tianying; Kou, Kuan; Wang, Min; Du, Chunlei; Fu, Wei-ling; Cui, Hong-Liang

    2015-01-01

    A terahertz (THz) spectroscopic study is carried out to analyze DNA mutations in a label-free manner. Three newly designed liquid sample cells are considered and the best is selected as the sample carrier for THz transmission spectroscopic analyses. Discrimination based on spectral signatures of single-base mutations on single-stranded 20 nt oligonucleotides has been shown possible experimentally. The results clearly attest the ability of this promising approach for label-free analyses of single-base mutations of DNA molecules. This study has demonstrated that the THz spectroscopic technology can be considered as a potential diagnostic tool for investigating molecular reactions, such as DNA mutations. PMID:26385423

  8. New oligonucleotide derivatives as unreactive substrate analogues and potential inhibitors of human apurinic/apyrimidinic endonuclease APE1.

    PubMed

    Kuznetsov, Nikita A; Kupryushkin, Maxim S; Abramova, Tatyana V; Kuznetsova, Alexandra A; Miroshnikova, Anastasia D; Stetsenko, Dmitry A; Pyshnyi, Dmitrii V; Fedorova, Olga S

    2016-01-01

    Human apurinic/apyrimidinic endonuclease APE1 is one of the key enzymes of the base excision DNA repair system. The main biological function of APE1 is the hydrolysis of the phosphodiester bond on the 5'-side of an apurinic/apyrimidinic site (AP-site) to give the 5'-phosphate and 3'-hydroxyl group. It has long been known that AP-sites have mutagenic and cytotoxic effects and their accumulation in DNA is a potential hazard to the cell lifecycle. The structural and biochemical studies of APE1 are complicated by its high catalytic activity towards the AP-site and its cyclic or acyclic analogues. This work has focussed on the design, synthesis and analysis of oligonucleotide derivatives as potentially unreactive APE1 substrates. We have shown that the replacement of oxygen atoms in the phosphate group on the 5'-side from the AP-site analogue tetrahydrofuran (F) considerably decreases the rate of enzymatic hydrolysis of modified oligonucleotides. We have calculated that a N3'-P5' phosphoramidate linkage is hydrolysed about 30 times slower than the native phosphodiester bond while phosphorothioate or primary phosphoramidate linkages are cleaved more than three orders of magnitude slower. The value of IC50 of the oligonucleotide duplex containing a primary phosphoramidate linkage is 2.5 × 10(-7) M, which is in accordance with the APE1 association constant of DNA duplexes containing AP-sites. Thus, it is demonstrated that oligonucleotide duplexes with chemical modifications could be used as unreactive substrates and potential competitive inhibitors of APE1. PMID:26548492

  9. Bioconjugation of oligonucleotides for treating liver fibrosis.

    PubMed

    Ye, Zhaoyang; Houssein, Houssam S Hajj; Mahato, Ram I

    2007-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is urgently needed to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remain the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of alpha1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in-depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  10. BIOCONJUGATION OF OLIGONUCLEOTIDES FOR TREATING LIVER FIBROSIS

    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.

    2009-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  11. An imputation approach for oligonucleotide microarrays.

    PubMed

    Li, Ming; Wen, Yalu; Lu, Qing; Fu, Wenjiang J

    2013-01-01

    Oligonucleotide microarrays are commonly adopted for detecting and qualifying the abundance of molecules in biological samples. Analysis of microarray data starts with recording and interpreting hybridization signals from CEL images. However, many CEL images may be blemished by noises from various sources, observed as "bright spots", "dark clouds", and "shadowy circles", etc. It is crucial that these image defects are correctly identified and properly processed. Existing approaches mainly focus on detecting defect areas and removing affected intensities. In this article, we propose to use a mixed effect model for imputing the affected intensities. The proposed imputation procedure is a single-array-based approach which does not require any biological replicate or between-array normalization. We further examine its performance by using Affymetrix high-density SNP arrays. The results show that this imputation procedure significantly reduces genotyping error rates. We also discuss the necessary adjustments for its potential extension to other oligonucleotide microarrays, such as gene expression profiling. The R source code for the implementation of approach is freely available upon request. PMID:23505547

  12. Use of Immunostimulatory Sequence-Containing Oligonucleotides as Topical Therapy for Genital Herpes Simplex Virus Type 2 Infection

    PubMed Central

    Pyles, Richard B.; Higgins, Debbie; Chalk, Claudia; Zalar, Anthony; Eiden, Joseph; Brown, Carrie; Van Nest, Gary; Stanberry, Lawrence R.

    2002-01-01

    Synthetic oligonucleotides containing CpG motifs in specific sequence contexts have been shown to induce potent immune responses. We have evaluated mucosal administration of two immunostimulatory sequence (ISS)-containing phosphorothioate-stabilized oligonucleotides for antiherpetic efficacy in animal models. The ISS oligonucleotides, suspended in phosphate-buffered saline, were tested in mouse and guinea pig vaginal models of herpes simplex virus type 2 (HSV-2) infection. For comparison, groups of untreated, non-ISS oligonucleotide-treated, and acyclovir-treated animals also were monitored. The results indicated that vaginal epithelial application of ISS (up to 6 h after viral inoculation) with mice lethally challenged with HSV-2 delayed disease onset and reduced the number of animals that developed signs of disease (P = 0.003). ISS application significantly increased survival rates over those of controls (P = 0.0014). The ISS also impacted an established infection in the guinea pig model of HSV-2 disease. A single administration of ISS (21 days after viral inoculation) significantly reduced the frequency and severity of HSV-2 lesions compared to results with non-ISS oligonucleotide-treated and untreated guinea pigs (P < 0.01). HSV-2 is shed from the vaginal cavity of the guinea pig in the absence of lesions, similar to the case with humans. As an additional indication of ISS efficacy, the magnitude of viral shedding also was significantly reduced in ISS-treated animals (P < 0.001). These effects appeared to be immunologically mediated, since ISS had no direct effect on HSV-2 replication in vitro using standard plaque assays. These data suggest that ISS may be useful in the treatment and control of genital herpes in humans. PMID:12388699

  13. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  14. Uptake and antifungal activity of oligonucleotides in Candida albicans

    PubMed Central

    Disney, Matthew D.; Haidaris, Constantine G.; Turner, Douglas H.

    2003-01-01

    Candida albicans is a significant cause of disease in immunocompromised humans. Because the number of people infected by fungal pathogens is increasing, strategies are being developed to target RNAs in fungi. This work shows that oligonucleotides can serve as therapeutics against C. albicans. In particular, oligonucleotides are taken up from cell culture medium in an energy-dependent process. After uptake, oligonucleotides, including RNA, remain mostly intact after 12 h in culture. For culture conditions designed for mammalian cells, intracellular concentrations of oligonucleotides in C. albicans exceed those in COS-7 mammalian cells, suggesting that uptake can provide selective targeting of fungi over human cells. A 19-mer 2′OMe (oligonucleotide with a 2′-O-methyl backbone) hairpin is described that inhibits growth of a C. albicans strain at pH < 4.0. This pH is easily tolerated in some parts of the body subject to C. albicans infections. In vivo dimethyl sulfate modification of ribosomal RNA and the decreased rate of protein synthesis suggest that this hairpin's activity may be due to targeting the ribosome in a way that does not depend on base pairing. Addition of anti-C. albicans oligonucleotides to COS-7 mammalian cells has no effect on cell growth. Evidently, oligonucleotides can selectively serve as therapeutics toward C. albicans and, presumably, other pathogens. Information from genome sequencing and functional genomics studies on C. albicans and other pathogens should allow rapid design and testing of other approaches for oligonucleotide therapies. PMID:12552085

  15. Disulfide-linked oligonucleotide phosphorothioates - Novel analogues of nucleic acids

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1991-01-01

    The synthesis of phosphorothioate analogs of oligonucleotides by the oxidation of deoxyadenosine 3',5'-bisphosphorothioate (3) was attempted. Cyclization of 3 is much more efficient than oligomerization under all the conditions investigated. However, a preformed oligonucleotide carrying a 5'-terminal phosphorotioate group undergoes efficient chain-extension when oxidized in the presence of 3.

  16. Quantum computing with acceptor spins in silicon

    NASA Astrophysics Data System (ADS)

    Salfi, Joe; Tong, Mengyang; Rogge, Sven; Culcer, Dimitrie

    2016-06-01

    The states of a boron acceptor near a Si/SiO2 interface, which bind two low-energy Kramers pairs, have exceptional properties for encoding quantum information and, with the aid of strain, both heavy hole and light hole-based spin qubits can be designed. Whereas a light-hole spin qubit was introduced recently (arXiv:1508.04259), here we present analytical and numerical results proving that a heavy-hole spin qubit can be reliably initialised, rotated and entangled by electrical means alone. This is due to strong Rashba-like spin–orbit interaction terms enabled by the interface inversion asymmetry. Single qubit rotations rely on electric-dipole spin resonance (EDSR), which is strongly enhanced by interface-induced spin–orbit terms. Entanglement can be accomplished by Coulomb exchange, coupling to a resonator, or spin–orbit induced dipole–dipole interactions. By analysing the qubit sensitivity to charge noise, we demonstrate that interface-induced spin–orbit terms are responsible for sweet spots in the dephasing time {T}2* as a function of the top gate electric field, which are close to maxima in the EDSR strength, where the EDSR gate has high fidelity. We show that both qubits can be described using the same starting Hamiltonian, and by comparing their properties we show that the complex interplay of bulk and interface-induced spin–orbit terms allows a high degree of electrical control and makes acceptors potential candidates for scalable quantum computation in Si.

  17. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  18. Aromatic donor-acceptor interactions in non-polar environments.

    PubMed

    Prentice, Giles M; Pascu, Sofia I; Filip, Sorin V; West, Kevin R; Pantoş, G Dan

    2015-05-14

    We have evaluated the strength of aromatic donor-acceptor interactions between dialkyl naphthalenediimide and dialkoxynaphthalene in non-polar environments. (1)H NMR, UV-vis spectroscopy and isothermal titration calorimetry were used to characterise this interaction. We concluded that the strength of donor-acceptor interactions in heptane is sufficient to drive supramolecular assemblies in this and other aliphatic solvents. PMID:25875729

  19. Long synthetic oligonucleotides for microarray expression measurement

    NASA Astrophysics Data System (ADS)

    Li, Jiong; Wang, Hong; Liu, Heping; Zhang, M.; Zhang, Chunxiu; Lu, Zu-Hong; Gao, Xiang; Kong, Dong

    2001-09-01

    There are generally two kinds of DNA microarray used for genomic-scale gene expression profiling of mRNA: cDNA and DNA chip, but both of them suffer from some drawbacks. To meet more requirements, another oligonucleotide microarray with long was produced. This type of microarray had the advantages of low cost, minimal Cross-hybridization, flexible and easy to make, which is most fit for small laboratories with special purposes. In this paper, we devised different probes with different probe lengths, GC contents and gene positions to optimization the probe design. Experiments showed 70 mer probes are suitable for both sufficient sensitivity and reasonable costs. Higher G-C content produces stronger signal intensity thus better sensitivity and probes designed at 3 untranslated region of gene within the range of 300 pb should be best for both sensitivity and specificity.

  20. Phosphoramidate Ligation of Oligonucleotides in Nanoscale Structures.

    PubMed

    Kalinowski, Matthäus; Haug, Rüdiger; Said, Hassan; Piasecka, Sylwia; Kramer, Markus; Richert, Clemens

    2016-06-16

    The folding of long DNA strands into designed nanostructures has evolved into an art. Being based on linear chains only, the resulting nanostructures cannot readily be transformed into covalently linked frameworks. Covalently linking strands in the context of folded DNA structures requires a robust method that avoids sterically demanding reagents or enzymes. Here we report chemical ligation of the 3'-amino termini of oligonucleotides and 5'-phosphorylated partner strands in templated reactions that produce phosphoramidate linkages. These reactions produce inter-nucleotide linkages that are isoelectronic and largely isosteric to phosphodiesters. Ligations were performed at three levels of complexity, including the extension of branched DNA hybrids and the ligation of six scaffold strands in a small origami. PMID:27225865

  1. MALDI analysis of oligonucleotides directly from montmorillonite.

    PubMed

    Zagorevskii, Dmitri V; Aldersley, Michael F; Ferris, James P

    2006-09-01

    Oligonucleotides synthesized on a montmorillonite catalyst were analyzed directly. By mixing the catalyst with a matrix (2,4,6-trihydroxyacetophenone or 6-aza-2-thiothymine) and dibasic ammonium citrate, higher molecular weight products were detected compared with "classical" methods such as gel electrophoresis and HPLC with UV as a detector. The oligomers (30-mers and higher) were detected by mass spectrometry even though their concentration was less than 10(-4)% of the total content of the RNA. This method is different from the (MALDI) analysis of the eluates from montmorillonite, which otherwise requires desalting. Placing reaction mixtures with a high concentration of buffers on homoionic, preferably Li-containing, montmorillonite does not require desalting. PMID:16809045

  2. Use of nanoparticles to deliver immunomodulatory oligonucleotides.

    PubMed

    Klinman, Dennis M; Sato, Takashi; Shimosato, Takeshi

    2016-07-01

    Synthetic oligonucleotides (ODNs) containing unmethylated 'CpG motifs' stimulate the innate immune system to produce cytokines, chemokines, and polyreactive antibodies. CpG ODNs have shown promise as vaccine adjuvants and for the treatment of infectious diseases and cancer. The immunostimulatory activity of CpG ODNs is inhibited by DNA-containing 'suppressive' motifs. ODNs expressing suppressive motifs (Sup ODNs) reduce ongoing immune reactions and show promise in the treatment of autoimmune and inflammatory diseases. This work reviews recent progress in the use of nanoparticles as carriers of CpG and Sup ODNs to target their delivery to the GI tract and lungs. WIREs Nanomed Nanobiotechnol 2016, 8:631-637. doi: 10.1002/wnan.1382 For further resources related to this article, please visit the WIREs website. PMID:26663867

  3. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    PubMed

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity. PMID:24557899

  4. Structure Activity Relationships of α-L-LNA Modified Phosphorothioate Gapmer Antisense Oligonucleotides in Animals.

    PubMed

    Seth, Punit P; Jazayeri, Ali; Yu, Jeff; Allerson, Charles R; Bhat, Balkrishen; Swayze, Eric E

    2012-01-01

    We report the structure activity relationships of short 14-mer phosphorothioate gapmer antisense oligonucleotides (ASOs) modified with α-L-locked nucleic acid (LNA) and related modifications targeting phosphatase and tensin homologue (PTEN) messenger RNA in mice. α-L-LNA represents the α-anomer of enantio-LNA and modified oligonucleotides show LNA like binding affinity for complementary RNA. In contrast to sequence matched LNA gapmer ASOs which showed elevations in plasma alanine aminotransferase (ALT) levels indicative of hepatotoxicity, gapmer ASOs modified with α-L-LNA and related analogs in the flanks showed potent downregulation of PTEN messenger RNA in liver tissue without producing elevations in plasma ALT levels. However, the α-L-LNA ASO showed a moderate dose-dependent increase in liver and spleen weights suggesting a higher propensity for immune stimulation. Interestingly, replacing α-L-LNA nucleotides in the 3'- and 5'-flanks with R-5'-Me-α-L-LNA but not R-6'-Me- or 3'-Me-α-L-LNA nucleotides, reversed the drug induced increase in organ weights. Examination of structural models of dinucleotide units suggested that the 5'-Me group increases steric bulk in close proximity to the phosphorothioate backbone or produces subtle changes in the backbone conformation which could interfere with recognition of the ASO by putative immune receptors. Our data suggests that introducing steric bulk at the 5'-position of the sugar-phosphate backbone could be a general strategy to mitigate the immunostimulatory profile of oligonucleotide drugs. In a clinical setting, proinflammatory effects manifest themselves as injection site reactions and flu-like symptoms. Thus, a mitigation of these effects could increase patient comfort and compliance when treated with ASOs.Molecular Therapy - Nucleic Acids (2012) 1, e47; doi:10.1038/mtna.2012.34; published online 18 September 2012. PMID:23344239

  5. Acceptor impurity activation in III-nitride light emitting diodes

    SciTech Connect

    Römer, Friedhard Witzigmann, Bernd

    2015-01-12

    In this work, the role of the acceptor doping and the acceptor activation and its impact on the internal quantum efficiency (IQE) of a Gallium Nitride (GaN) based multi-quantum well light emitting diode is studied by microscopic simulation. Acceptor impurities in GaN are subject to a high activation energy which depends on the presence of proximate dopant atoms and the electric field. A combined model for the dopant ionization and activation barrier reduction has been developed and implemented in a semiconductor carrier transport simulator. By model calculations, we demonstrate the impact of the acceptor activation mechanisms on the decay of the IQE at high current densities, which is known as the efficiency droop. A major contributor to the droop is the electron leakage which is largely affected by the acceptor doping.

  6. The frequency of oligonucleotides in mammalian genic regions.

    PubMed

    Volinia, S; Gambari, R; Bernardi, F; Barrai, I

    1989-02-01

    The large body of nucleic acid sequence data now available offers a unique opportunity for the characterization of individual oligonucleotides which may be specific to sequence functional domains. We have prepared algorithms for the study of the frequency distribution of all oligonucleotides of length 2-6 in DNA sequences. We have implemented them in the study of 634 mammalian DNA sequences spanning 1.782 Mb, and have obtained the distribution of the ratio between the observed frequency of oligonucleotides and their expected frequency based on independent nucleotide probabilities. We then studied the distribution of oligonucleotides (or k-tuples) of each length in a subset of 129 complete mammalian genes spanning 0.607 Mb. Eight distinct genomic regions, namely 5'-non-transcribed, first exon, first intron, intermediate exons, intermediate introns, last intron, last exon and 3'-non-transcribed, were considered. We observed that some oligonucleotides show a statistical behaviour and a regional distribution similar to that of known signal sequences. Moreover the frequency distribution of oligonucleotides of length 5 and 6 tends to become bimodal, indicating the existence of a population of very frequent oligonucleotides. PMID:2924169

  7. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  8. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  9. Antisense oligonucleotide induction of progerin in human myogenic cells.

    PubMed

    Luo, Yue-Bei; Mitrpant, Chalermchai; Adams, Abbie M; Johnsen, Russell D; Fletcher, Sue; Mastaglia, Frank L; Wilton, Steve D

    2014-01-01

    We sought to use splice-switching antisense oligonucleotides to produce a model of accelerated ageing by enhancing expression of progerin, translated from a mis-spliced lamin A gene (LMNA) transcript in human myogenic cells. The progerin transcript (LMNA Δ150) lacks the last 150 bases of exon 11, and is translated into a truncated protein associated with the severe premature ageing disease, Hutchinson-Gilford progeria syndrome (HGPS). HGPS arises from de novo mutations that activate a cryptic splice site in exon 11 of LMNA and result in progerin accumulation in tissues of mesodermal origin. Progerin has also been proposed to play a role in the 'natural' ageing process in tissues. We sought to test this hypothesis by producing a model of accelerated muscle ageing in human myogenic cells. A panel of splice-switching antisense oligonucleotides were designed to anneal across exon 11 of the LMNA pre-mRNA, and these compounds were transfected into primary human myogenic cells. RT-PCR showed that the majority of oligonucleotides were able to modify LMNA transcript processing. Oligonucleotides that annealed within the 150 base region of exon 11 that is missing in the progerin transcript, as well as those that targeted the normal exon 11 donor site induced the LMNA Δ150 transcript, but most oligonucleotides also generated variable levels of LMNA transcript missing the entire exon 11. Upon evaluation of different oligomer chemistries, the morpholino phosphorodiamidate oligonucleotides were found to be more efficient than the equivalent sequences prepared as oligonucleotides with 2'-O-methyl modified bases on a phosphorothioate backbone. The morpholino oligonucleotides induced nuclear localised progerin, demonstrated by immunostaining, and morphological nuclear changes typical of HGPS cells. We show that it is possible to induce progerin expression in myogenic cells using splice-switching oligonucleotides to redirect splicing of LMNA. This may offer a model to investigate

  10. Oligonucleotide-Mediated Genome Editing Provides Precision and Function to Engineered Nucleases and Antibiotics in Plants.

    PubMed

    Sauer, Noel J; Narváez-Vásquez, Javier; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Woodward, Melody J; Mihiret, Yohannes A; Lincoln, Tracey A; Segami, Rosa E; Sanders, Steven L; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-04-01

    Here, we report a form of oligonucleotide-directed mutagenesis for precision genome editing in plants that uses single-stranded oligonucleotides (ssODNs) to precisely and efficiently generate genome edits at DNA strand lesions made by DNA double strand break reagents. Employing a transgene model in Arabidopsis (Arabidopsis thaliana), we obtained a high frequency of precise targeted genome edits when ssODNs were introduced into protoplasts that were pretreated with the glycopeptide antibiotic phleomycin, a nonspecific DNA double strand breaker. Simultaneous delivery of ssODN and a site-specific DNA double strand breaker, either transcription activator-like effector nucleases (TALENs) or clustered, regularly interspaced, short palindromic repeats (CRISPR/Cas9), resulted in a much greater targeted genome-editing frequency compared with treatment with DNA double strand-breaking reagents alone. Using this site-specific approach, we applied the combination of ssODN and CRISPR/Cas9 to develop an herbicide tolerance trait in flax (Linum usitatissimum) by precisely editing the 5'-ENOLPYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) genes. EPSPS edits occurred at sufficient frequency that we could regenerate whole plants from edited protoplasts without employing selection. These plants were subsequently determined to be tolerant to the herbicide glyphosate in greenhouse spray tests. Progeny (C1) of these plants showed the expected Mendelian segregation of EPSPS edits. Our findings show the enormous potential of using a genome-editing platform for precise, reliable trait development in crop plants. PMID:26864017

  11. Electrochromism of a fused acceptor-donor-acceptor triad covering entire UV-vis and near-infrared regions.

    PubMed

    Yao, Bin; Ye, Xichong; Zhang, Jie; Wan, Xinhua

    2014-10-17

    A novel fused acceptor-donor-acceptor (A-D-A) type panchromatically electrochromic compound was synthesized. It exhibited intensive absorption bands covering entire UV-vis and near-infrared regions upon reduction to the radical anionic state, owing to the simultaneous presence of π*-π* transitions and intervalence charge transfer. PMID:25268224

  12. Acceptor and Excitation Density Dependence of the Ultrafast Polaron Absorption Signal in Donor-Acceptor Organic Solar Cell Blends.

    PubMed

    Zarrabi, Nasim; Burn, Paul L; Meredith, Paul; Shaw, Paul E

    2016-07-21

    Transient absorption spectroscopy on organic semiconductor blends for solar cells typically shows efficient charge generation within ∼100 fs, accounting for the majority of the charge carriers. In this Letter, we show using transient absorption spectroscopy on blends containing a broad range of acceptor content (0.01-50% by weight) that the rise of the polaron signal is dependent on the acceptor concentration. For low acceptor content (<10% by weight), the polaron signal rises gradually over ∼1 ps with most polarons generated after 200 fs, while for higher acceptor concentrations (>10%) most polarons are generated within 200 fs. The rise time in blends with low acceptor content was also found to be sensitive to the pump fluence, decreasing with increasing excitation density. These results indicate that the sub-100 fs rise of the polaron signal is a natural consequence of both the high acceptor concentrations in many donor-acceptor blends and the high excitation densities needed for transient absorption spectroscopy, which results in a short average distance between the exciton and the donor-acceptor interface. PMID:27355877

  13. Transition metal-free generation of the acceptor/acceptor-carbene viaα-elimination: synthesis of fluoroacetyl cyclopropanes.

    PubMed

    Wang, Yongdong; Han, Jing; Chen, Jie; Cao, Weiguo

    2016-05-21

    An efficient transition metal-free approach for the generation of acceptor/acceptor-carbene followed by trapping with alkenes to provide fluoroacetyl cyclopropanes has been described. The resulting cyclopropanes could be further converted into the fluoromethyl dihydrofurans or fluorodihydropyrroles through ring-expansion processes. PMID:27125517

  14. A Microplate Format Assay for Real-Time Screening for New Aldolases that Accept Aryl-Substituted Acceptor Substrates.

    PubMed

    Ma, Huan; Enugala, Thilak Reddy; Widersten, Mikael

    2015-12-01

    Aldolases are potentially important biocatalysts for asymmetric synthesis of polyhydroxylated compounds. Fructose 6-phosphate aldolase (FSA) is of particular interest by virtue of its unusually relaxed dependency on phosphorylated substrates. FSA has been reported to be a promising catalyst of aldol addition involving aryl-substituted acceptors such as phenylacetaldehyde that can react with donor ketones such as hydroxyacetone. Improvement of the low intrinsic activity with bulky acceptor substrates of this type is of great interest but has been hampered by the lack of powerful screening protocols applicable in directed evolution strategies. Here we present a new screen allowing for direct spectrophotometric recording of retro-aldol cleavage. The assay utilizes an aldehyde reductase produced in vitro by directed evolution; it reduces the aldehyde product formed after cleavage of the aldol by FSA. The assay is suitable both for steady-state enzyme kinetics and for real-time activity screening in a 96-well format. PMID:26449620

  15. Microbial solubilization of phosphate

    DOEpatents

    Rogers, R.D.; Wolfram, J.H.

    1993-10-26

    A process is provided for solubilizing phosphate from phosphate containing ore by treatment with microorganisms which comprises forming an aqueous mixture of phosphate ore, microorganisms operable for solubilizing phosphate from the phosphate ore and maintaining the aqueous mixture for a period of time and under conditions operable to effect the microbial solubilization process. An aqueous solution containing soluble phosphorus can be separated from the reacted mixture by precipitation, solvent extraction, selective membrane, exchange resin or gravity methods to recover phosphate from the aqueous solution. 6 figures.

  16. Microbial solubilization of phosphate

    DOEpatents

    Rogers, Robert D.; Wolfram, James H.

    1993-01-01

    A process is provided for solubilizing phosphate from phosphate containing ore by treatment with microorganisms which comprises forming an aqueous mixture of phosphate ore, microorganisms operable for solubilizing phosphate from the phosphate ore and maintaining the aqueous mixture for a period of time and under conditions operable to effect the microbial solubilization process. An aqueous solution containing soluble phosphorous can be separated from the reacted mixture by precipitation, solvent extraction, selective membrane, exchange resin or gravity methods to recover phosphate from the aqueous solution.

  17. Glucose-6-phosphate dehydrogenase

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003671.htm Glucose-6-phosphate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) is a type of ...

  18. Chloroquine Phosphate Oral

    MedlinePlus

    ... allergic to chloroquine phosphate, chloroquine hydrochloride (Aralen HCl), hydroxychloroquine (Plaquenil), or any other drugs.tell your doctor ... taking chloroquine phosphate, chloroquine hydrochloride (Aralen HCl), or hydroxychloroquine (Plaquenil).tell your doctor if you are pregnant ...

  19. Chloroquine Phosphate Oral

    MedlinePlus

    ... allergic to chloroquine phosphate, chloroquine hydrochloride (Aralen HCl), hydroxychloroquine (Plaquenil), or any other drugs.tell your doctor and ... taking chloroquine phosphate, chloroquine hydrochloride (Aralen HCl), or hydroxychloroquine (Plaquenil).tell your doctor if you are pregnant ...

  20. Uranium from phosphate ores

    SciTech Connect

    Hurst, F.J.

    1983-01-01

    The following topics are described briefly: the way phosphate fertilizers are made; how uranium is recovered in the phosphate industry; and how to detect covert uranium recovery operations in a phsophate plant.

  1. Molecular Selection, Modification and Development of Therapeutic Oligonucleotide Aptamers

    PubMed Central

    Yu, Yuanyuan; Liang, Chao; Lv, Quanxia; Li, Defang; Xu, Xuegong; Liu, Baoqin; Lu, Aiping; Zhang, Ge

    2016-01-01

    Monoclonal antibodies are the dominant agents used in inhibition of biological target molecules for disease therapeutics, but there are concerns of immunogenicity, production, cost and stability. Oligonucleotide aptamers have comparable affinity and specificity to targets with monoclonal antibodies whilst they have minimal immunogenicity, high production, low cost and high stability, thus are promising inhibitors to rival antibodies for disease therapy. In this review, we will compare the detailed advantages and disadvantages of antibodies and aptamers in therapeutic applications and summarize recent progress in aptamer selection and modification approaches. We will present therapeutic oligonucleotide aptamers in preclinical studies for skeletal diseases and further discuss oligonucleotide aptamers in different stages of clinical evaluation for various disease therapies including macular degeneration, cancer, inflammation and coagulation to highlight the bright commercial future and potential challenges of therapeutic oligonucleotide aptamers. PMID:26978355

  2. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  3. Sequence-dependent theory of oligonucleotide hybridization kinetics

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail: rajc@andrew.cmu.edu

    2014-05-07

    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions.

  4. Micro- and nano-structure based oligonucleotide sensors.

    PubMed

    Ferrier, David C; Shaver, Michael P; Hands, Philip J W

    2015-06-15

    This paper presents a review of micro- and nano-structure based oligonucleotide detection and quantification techniques. The characteristics of such devices make them very attractive for Point-of-Care or On-Site-Testing biosensing applications. Their small scale means that they can be robust and portable, their compatibility with modern CMOS electronics means that they can easily be incorporated into hand-held devices and their suitability for mass production means that, out of the different approaches to oligonucleotide detection, they are the most suitable for commercialisation. This review discusses the advantages of micro- and nano-structure based sensors and covers the various oligonucleotide detection techniques that have been developed to date. These include: Bulk Acoustic Wave and Surface Acoustic Wave devices, micro- and nano-cantilever sensors, gene Field Effect Transistors, and nanowire and nanopore based sensors. Oligonucleotide immobilisation techniques are also discussed. PMID:25655465

  5. Highly parallel oligonucleotide purification and functionalization using reversible chemistry

    PubMed Central

    York, Kerri T.; Smith, Ryan C.; Yang, Rob; Melnyk, Peter C.; Wiley, Melissa M.; Turk, Casey M.; Ronaghi, Mostafa; Gunderson, Kevin L.; Steemers, Frank J.

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5′-labeled oligonucleotides. The approach is based on 5′-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5′-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90–99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  6. Highly parallel oligonucleotide purification and functionalization using reversible chemistry.

    PubMed

    York, Kerri T; Smith, Ryan C; Yang, Rob; Melnyk, Peter C; Wiley, Melissa M; Turk, Casey M; Ronaghi, Mostafa; Gunderson, Kevin L; Steemers, Frank J

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5'-labeled oligonucleotides. The approach is based on 5'-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5'-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90-99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  7. Oligonucleotide-based theranostic nanoparticles in cancer therapy.

    PubMed

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-05-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  8. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  9. Three holes bound to a double acceptor - Be(+) in germanium

    NASA Technical Reports Server (NTRS)

    Haller, E. E.; Mcmurray, R. E., Jr.; Falicov, L. M.; Haegel, N. M.; Hansen, W. L.

    1983-01-01

    A double acceptor binding three holes has been observed for the first time with photoconductive far-infrared spectroscopy in beryllium-doped germanium single crystals. This new center, Be(+), has a hole binding energy of about 5 meV and is only present when free holes are generated by ionization of either neutral shallow acceptors or neutral Be double acceptors. The Be(+) center thermally ionizes above 4 K. It disappears at a uniaxial stress higher than about a billion dyn/sq cm parallel to (111) as a result of the lifting of the valence-band degeneracy.

  10. Intramolecular charge transfer in donor-acceptor molecules

    SciTech Connect

    Slama-Schwok, A.; Blanchard-Desce, M.; Lehn, J.M. )

    1990-05-17

    The photophysical properties of donor-acceptor molecules, push-pull polyenes and carotenoids, have been studied by absorption and fluorescence spectroscopy. The compounds bear various acceptor and donor groups, linked together by chains of different length and structure. The position of the absorption and fluorescence maxima and their variation in solvents of increasing polarity are in agreement with long-distance intramolecular charge-transfer processes, the linker acting as a molecular wire. The effects of the linker length and structure and of the nature of acceptor and donor are presented.

  11. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays.

    PubMed

    O'Sullivan, Paul J; Burke, Martina; Soini, Aleksi E; Papkovsky, Dmitri B

    2002-11-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3'- or 5'-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5'-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY 7 dye (dark quencher) showed strong (approximately 20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  12. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays

    PubMed Central

    O’Sullivan, Paul J.; Burke, Martina; Soini, Aleksi E.; Papkovsky, Dmitri B.

    2002-01-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3′- or 5′-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5′-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY® 7 dye (dark quencher) showed strong (∼20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  13. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.

    PubMed

    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M

    2016-10-01

    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications. PMID:27521696

  14. Oligonucleotide and Long Polymeric DNA Encoding

    SciTech Connect

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  15. Oligonucleotide Therapies: The Past and the Present

    PubMed Central

    Lundin, Karin E.; Gissberg, Olof; Smith, C.I. Edvard

    2015-01-01

    In this review we address the development of oligonucleotide (ON) medicines from a historical perspective by listing the landmark discoveries in this field. The various biological processes that have been targeted and the corresponding ON interventions found in the literature are discussed together with brief updates on some of the more recent developments. Most ON therapies act through antisense mechanisms and are directed against various RNA species, as exemplified by gapmers, steric block ONs, antagomirs, small interfering RNAs (siRNAs), micro-RNA mimics, and splice switching ONs. However, ONs binding to Toll-like receptors and those forming aptamers have completely different modes of action. Similar to other novel medicines, the path to success has been lined with numerous failures, where different therapeutic ONs did not stand the test of time. Since the first ON drug was approved for clinical use in 1998, the therapeutic landscape has changed considerably, but many challenges remain until the expectations for this new form of medicine are met. However, there is room for cautious optimism. PMID:26160334

  16. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  17. Antisense Oligonucleotide Therapy for Inherited Retinal Dystrophies.

    PubMed

    Gerard, Xavier; Garanto, Alejandro; Rozet, Jean-Michel; Collin, Rob W J

    2016-01-01

    Inherited retinal dystrophies (IRDs) are an extremely heterogeneous group of genetic diseases for which currently no effective treatment strategies exist. Over the last decade, significant progress has been made utilizing gene augmentation therapy for a few genetic subtypes of IRD, although several technical challenges so far prevent a broad clinical application of this approach for other forms of IRD. Many of the mutations leading to these retinal diseases affect pre-mRNA splicing of the mutated genes . Antisense oligonucleotide (AON)-mediated splice modulation appears to be a powerful approach to correct the consequences of such mutations at the pre-mRNA level , as demonstrated by promising results in clinical trials for several inherited disorders like Duchenne muscular dystrophy, hypercholesterolemia and various types of cancer. In this mini-review, we summarize ongoing pre-clinical research on AON-based therapy for a few genetic subtypes of IRD , speculate on other potential therapeutic targets, and discuss the opportunities and challenges that lie ahead to translate splice modulation therapy for retinal disorders to the clinic. PMID:26427454

  18. Photophysical deactivation pathways in adenine oligonucleotides.

    PubMed

    Spata, Vincent A; Matsika, Spiridoula

    2015-12-14

    In this work we study deactivation processes in adenine oligomers after absorption of UV radiation using Quantum Mechanics combined with Molecular Mechanics (QM/MM). Correlated electronic structure methods appropriate for describing the excited states are used to describe a π-stacked dimer of adenine bases incorporated into (dA)20(dT)20. The results of these calculations reveal three different types of excited state minima which play a role in deactivation processes. Within this set of minima there are minima where the excited state is localized on one adenine (monomer-like) as well as minima where the excited state is delocalized on two adenines, forming different types of excimers and bonded excimers of varying but inter-related character. The proximity of their energies reveals that the minima can decay into one another along a flat potential energy surface dependent on the interbase separation. Additionally, analysis of the emissive energies and other physical properties, including theoretical anisotropy calculations, and comparison with fluorescence experiments, provides evidence that excimers play an important role in long-lived signals in adenine oligonucleotides while the subpicosecond decay is attributed to monomer-like minima. The necessity for a close approach of the nucleobases reveals that the deactivation mechanism is tied to macro-molecular motion. PMID:26536353

  19. Development of Therapeutic Splice-Switching Oligonucleotides

    PubMed Central

    Kryczka, Adrianna; Liu, Yuqi; Badi, Yusef E.; Wong, Jessie J.; Owen, James S.; Khoo, Bernard

    2014-01-01

    Abstract Synthetic splice-switching oligonucleotides (SSOs) target nuclear pre-mRNA molecules to change exon splicing and generate an alternative protein isoform. Clinical trials with two competitive SSO drugs are underway to treat Duchenne muscular dystrophy (DMD). Beyond DMD, many additional therapeutic applications are possible, with some in phase 1 clinical trials or advanced preclinical evaluation. Here, we present an overview of the central factors involved in developing therapeutic SSOs for the treatment of diseases. The selection of susceptible pre-mRNA target sequences, as well as the design and chemical modification of SSOs to increase SSO stability and effectiveness, are key initial considerations. Identification of effective SSO target sequences is still largely empirical and published guidelines are not a universal guarantee for success. Specifically, exon-targeted SSOs, which are successful in modifying dystrophin splicing, can be ineffective for splice-switching in other contexts. Chemical modifications, importantly, are associated with certain characteristic toxicities, which need to be addressed as target diseases require chronic treatment with SSOs. Moreover, SSO delivery in adequate quantities to the nucleus of target cells without toxicity can prove difficult. Last, the means by which these SSOs are administered needs to be acceptable to the patient. Engineering an efficient therapeutic SSO, therefore, necessarily entails a compromise between desirable qualities and effectiveness. Here, we describe how the application of optimal solutions may differ from case to case. PMID:24826963

  20. Optimizing antisense oligonucleotides using phosphorodiamidate morpholino oligomers.

    PubMed

    Popplewell, Linda J; Malerba, Alberto; Dickson, George

    2012-01-01

    Duchenne muscular dystrophy (DMD) is caused by mutations that disrupt the reading frame of the human DMD gene. Selective removal of exons flanking an out-of-frame DMD mutation can result in an in-frame mRNA transcript that may be translated into an internally deleted Becker muscular dystrophy-like functionally active dystrophin protein with therapeutic activity. Antisense oligonucleotides (AOs) can be designed to bind to complementary sequences in the targeted mRNA and modify pre-mRNA splicing to correct the reading frame of a mutated transcript. AO-induced exon skipping resulting in functional truncated dystrophin has been demonstrated in animal models of DMD both in vitro and in vivo, in DMD patient cells in vitro in culture, and in DMD muscle explants. The recent advances made in this field suggest that it is likely that AO-induced exon skipping will be the first gene therapy for DMD to reach the clinic. However, it should be noted that personalized molecular medicine may be necessary, since the various reading frame-disrupting mutations are spread across the DMD gene. The different deletions that cause DMD would require skipping of different exons, which would require the optimization and clinical trial workup of many specific AOs. This chapter describes the methodologies available for the optimization of AOs, in particular phosphorodiamidate morpholino oligomers, for the targeted skipping of specific exons on the DMD gene. PMID:22454060

  1. Nitrogen is a deep acceptor in ZnO

    DOE PAGESBeta

    Tarun, M. C.; Iqbal, M. Zafar; McCluskey, M. D.

    2011-04-14

    Zinc oxide is a promising material for blue and UV solid-state lighting devices, among other applications. Nitrogen has been regarded as a potential p-type dopant for ZnO. However, recent calculations indicate that nitrogen is a deep acceptor. This paper presents experimental evidence that nitrogen is, in fact, a deep acceptor and therefore cannot produce p-type ZnO. A broad photoluminescence (PL) emission band near 1.7 eV, with an excitation onset of ~2.2 eV, was observed, in agreement with the deep-acceptor model of the nitrogen defect. Thus the deep-acceptor behavior can be explained by the low energy of the ZnO valence bandmore » relative to the vacuum level.« less

  2. Nitrogen is a deep acceptor in ZnO

    SciTech Connect

    Tarun, M. C.; Iqbal, M. Zafar; McCluskey, M. D.

    2011-04-14

    Zinc oxide is a promising material for blue and UV solid-state lighting devices, among other applications. Nitrogen has been regarded as a potential p-type dopant for ZnO. However, recent calculations indicate that nitrogen is a deep acceptor. This paper presents experimental evidence that nitrogen is, in fact, a deep acceptor and therefore cannot produce p-type ZnO. A broad photoluminescence (PL) emission band near 1.7 eV, with an excitation onset of ~2.2 eV, was observed, in agreement with the deep-acceptor model of the nitrogen defect. Thus the deep-acceptor behavior can be explained by the low energy of the ZnO valence band relative to the vacuum level.

  3. Donor-acceptor electron transport mediated by solitons.

    PubMed

    Brizhik, L S; Piette, B M A G; Zakrzewski, W J

    2014-11-01

    We study the long-range electron and energy transfer mediated by solitons in a quasi-one-dimensional molecular chain (conjugated polymer, alpha-helical macromolecule, etc.) weakly bound to a donor and an acceptor. We show that for certain sets of parameter values in such systems an electron, initially located at the donor molecule, can tunnel to the molecular chain, where it becomes self-trapped in a soliton state, and propagates to the opposite end of the chain practically without energy dissipation. Upon reaching the end, the electron can either bounce back and move in the opposite direction or, for suitable parameter values of the system, tunnel to the acceptor. We estimate the energy efficiency of the donor-acceptor electron transport depending on the parameter values. Our calculations show that the soliton mechanism works for the parameter values of polypeptide macromolecules and conjugated polymers. We also investigate the donor-acceptor electron transport in thermalized molecular chains. PMID:25493866

  4. Donor-acceptor electron transport mediated by solitons

    NASA Astrophysics Data System (ADS)

    Brizhik, L. S.; Piette, B. M. A. G.; Zakrzewski, W. J.

    2014-11-01

    We study the long-range electron and energy transfer mediated by solitons in a quasi-one-dimensional molecular chain (conjugated polymer, alpha-helical macromolecule, etc.) weakly bound to a donor and an acceptor. We show that for certain sets of parameter values in such systems an electron, initially located at the donor molecule, can tunnel to the molecular chain, where it becomes self-trapped in a soliton state, and propagates to the opposite end of the chain practically without energy dissipation. Upon reaching the end, the electron can either bounce back and move in the opposite direction or, for suitable parameter values of the system, tunnel to the acceptor. We estimate the energy efficiency of the donor-acceptor electron transport depending on the parameter values. Our calculations show that the soliton mechanism works for the parameter values of polypeptide macromolecules and conjugated polymers. We also investigate the donor-acceptor electron transport in thermalized molecular chains.

  5. Synthesis, Properties, and Design Principles of Donor–Acceptor Nanohoops

    PubMed Central

    2015-01-01

    We have synthesized a series of aza[8]cycloparaphenylenes containing one, two, and three nitrogens to probe the impact of nitrogen doping on optoelectronic properties and solid state packing. Alkylation of these azananohoops afforded the first donor–acceptor nanohoops where the phenylene backbone acts as the donor and the pyridinium units act as the acceptor. The impact on the optoelectronic properties was then studied experimentally and computationally to provide new insight into the effect of functionalization on nanohoops properties. PMID:27162989

  6. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  7. Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.

    PubMed

    Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V

    2014-10-01

    Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. PMID:25087479

  8. Injection site reactions after subcutaneous oligonucleotide therapy.

    PubMed

    van Meer, Leonie; Moerland, Matthijs; Gallagher, Jolie; van Doorn, Martijn B A; Prens, Errol P; Cohen, Adam F; Rissmann, Robert; Burggraaf, Jacobus

    2016-08-01

    Oligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including more severe manifestations such as ulceration or necrosis. These injection site reactions (ISRs) are common, but rather poorly described in the literature. With this review, we aim to provide an overview on the extent of the problem of ISRs, based on reported incidence. A structured literature search was performed to identify reported incidence and clinical features of ISRs which yielded 70 manuscripts that contained information regarding ISRs. The data from literature was combined with data on file available at our institution. All sc administered ONs described in the literature lead to the occurrence of ISRs. The percentage of trial subjects that developed ISRs ranged from 22 to 100% depending on ON. The majority of ONs caused ISRs in more than 70% of the trial subjects. The severity of the observed reactions varied between different ONs. Occurrence rate as well as severity of ISRs increases with higher doses. For chemistry and target of the compounds, no clear association regarding ISR incidence or severity was identified. All ONs developed to date are associated with ISRs. Overcoming the problem of ISRs might add greatly to the potential success of sc-administered ONs. Knowledge of these skin reactions and their specific immunostimulatory properties should be increased in order to obtain ONs that are more suitable for long-term use and clinically applicable in a broader patient population. PMID:27061947

  9. Mechanism of oligonucleotide release from cationic liposomes.

    PubMed Central

    Zelphati, O; Szoka, F C

    1996-01-01

    We propose a mechanism for oligonucleotide (ODN) release from cationic lipid complexes in cells that accounts for various observations on cationic lipid-nucleic acid-cell interactions. Fluorescent confocal microscopy of cells treated with rhodamine-labeled cationic liposome/ fluorescein-labeled ODN (F-ODN) complexes show the F-ODN separates from the lipid after internalization and enters the nucleus leaving the fluorescent lipid in cytoplasmic structures. ODN displacement from the complex was studied by fluorescent resonance energy transfer. Anionic liposome compositions (e.g., phosphatidylserine) that mimic the cytoplasmic facing monolayer of the cell membrane released ODN from the complex at about a 1:1 (-/+) charge ratio. Release was independent of ionic strength and pH. Physical separation of the F-ODN from monovalent and multivalent cationic lipids was confirmed by gel electrophoresis. Fluid but not solid phase anionic liposomes are required, whereas the physical state of the cationic lipids does not effect the release. Water soluble molecules with a high negative linear charge density, dextran sulfate, or heparin also release ODN. However, ATP, spermidine, spermine, tRNA, DNA, polyglutamic acid, polylysine, bovine serum albumin, or histone did not release ODN, even at 100-fold charge excess (-/+). Based upon these results, we propose that the complex, after internalization by endocytosis, induces flip-flop of anionic lipids from the cytoplasmic facing monolayer. Anionic lipids laterally diffuse into the complex and form a charged neutralized ion-pair with the cationic lipids. This leads to displacement of the ODN from the cationic lipid and its release into the cytoplasm. Images Fig. 1 Fig. 3 PMID:8876163

  10. Novel complex MAD phasing and RNase H structural insights using selenium oligonucleotides

    SciTech Connect

    Abdur, Rob; Gerlits, Oksana O.; Gan, Jianhua; Jiang, Jiansheng; Salon, Jozef; Kovalevsky, Andrey Y.; Chumanevich, Alexander A.; Weber, Irene T.; Huang, Zhen

    2014-02-01

    Selenium-derivatized oligonucleotides may facilitate phase determination and high-resolution structure determination for protein–nucleic acid crystallography. The Se atom-specific mutagenesis (SAM) strategy may also enhance the study of nuclease catalysis. The crystal structures of protein–nucleic acid complexes are commonly determined using selenium-derivatized proteins via MAD or SAD phasing. Here, the first protein–nucleic acid complex structure determined using selenium-derivatized nucleic acids is reported. The RNase H–RNA/DNA complex is used as an example to demonstrate the proof of principle. The high-resolution crystal structure indicates that this selenium replacement results in a local subtle unwinding of the RNA/DNA substrate duplex, thereby shifting the RNA scissile phosphate closer to the transition state of the enzyme-catalyzed reaction. It was also observed that the scissile phosphate forms a hydrogen bond to the water nucleophile and helps to position the water molecule in the structure. Consistently, it was discovered that the substitution of a single O atom by a Se atom in a guide DNA sequence can largely accelerate RNase H catalysis. These structural and catalytic studies shed new light on the guide-dependent RNA cleavage.

  11. Tuning the Electron Acceptor in Phthalocyanine-Based Electron Donor-Acceptor Conjugates.

    PubMed

    Sekita, Michael; Jiménez, Ángel J; Marcos, M Luisa; Caballero, Esmeralda; Rodríguez-Morgade, M Salomé; Guldi, Dirk M; Torres, Tomás

    2015-12-21

    Zinc phthalocyanines (ZnPc) have been attached to the peri-position of a perylenemonoimide (PMI) and a perylenemonoanhydride (PMA), affording electron donor-acceptor conjugates 1 and 2, respectively. In addition, a perylene-monoimide-monoanhydride (PMIMA) has been connected to a ZnPc through its imido position to yield the ZnPc-PMIMA conjugate 10. The three conjugates have been studied for photoinduced electron transfer. For ZnPc-PMIMA 10, electron transfer occurs upon both ZnPc and PMIMA excitation, giving rise to a long-lived (340 ps) charge-separated state. For ZnPc-PMI 1 and ZnPc-PMA 2, stabilization of the radical ion pair states by using polar media is necessary. In THF, photoexcitation of either ZnPc or PMI/PMA produces charge-separated states with lifetimes of 375 and 163 ps, respectively. PMID:26593778

  12. The Impact of Heterogeneity and Dark Acceptor States on FRET: Implications for Using Fluorescent Protein Donors and Acceptors

    PubMed Central

    Vogel, Steven S.; Nguyen, Tuan A.; van der Meer, B. Wieb; Blank, Paul S.

    2012-01-01

    Förster resonance energy transfer (FRET) microscopy is widely used to study protein interactions in living cells. Typically, spectral variants of the Green Fluorescent Protein (FPs) are incorporated into proteins expressed in cells, and FRET between donor and acceptor FPs is assayed. As appreciable FRET occurs only when donors and acceptors are within 10 nm of each other, the presence of FRET can be indicative of aggregation that may denote association of interacting species. By monitoring the excited-state (fluorescence) decay of the donor in the presence and absence of acceptors, dual-component decay analysis has been used to reveal the fraction of donors that are FRET positive (i.e., in aggregates)._However, control experiments using constructs containing both a donor and an acceptor FP on the same protein repeatedly indicate that a large fraction of these donors are FRET negative, thus rendering the interpretation of dual-component analysis for aggregates between separately donor-containing and acceptor-containing proteins problematic. Using Monte-Carlo simulations and analytical expressions, two possible sources for such anomalous behavior are explored: 1) conformational heterogeneity of the proteins, such that variations in the distance separating donor and acceptor FPs and/or their relative orientations persist on time-scales long in comparison with the excited-state lifetime, and 2) FP dark states. PMID:23152925

  13. Phosphate, inositol and polyphosphates.

    PubMed

    Livermore, Thomas M; Azevedo, Cristina; Kolozsvari, Bernadett; Wilson, Miranda S C; Saiardi, Adolfo

    2016-02-15

    Eukaryotic cells have ubiquitously utilized the myo-inositol backbone to generate a diverse array of signalling molecules. This is achieved by arranging phosphate groups around the six-carbon inositol ring. There is virtually no biological process that does not take advantage of the uniquely variable architecture of phosphorylated inositol. In inositol biology, phosphates are able to form three distinct covalent bonds: phosphoester, phosphodiester and phosphoanhydride bonds, with each providing different properties. The phosphoester bond links phosphate groups to the inositol ring, the variable arrangement of which forms the basis of the signalling capacity of the inositol phosphates. Phosphate groups can also form the structural bridge between myo-inositol and diacylglycerol through the phosphodiester bond. The resulting lipid-bound inositol phosphates, or phosphoinositides, further expand the signalling potential of this family of molecules. Finally, inositol is also notable for its ability to host more phosphates than it has carbons. These unusual organic molecules are commonly referred to as the inositol pyrophosphates (PP-IPs), due to the presence of high-energy phosphoanhydride bonds (pyro- or diphospho-). PP-IPs themselves constitute a varied family of molecules with one or more pyrophosphate moiety/ies located around the inositol. Considering the relationship between phosphate and inositol, it is no surprise that members of the inositol phosphate family also regulate cellular phosphate homoeostasis. Notably, the PP-IPs play a fundamental role in controlling the metabolism of the ancient polymeric form of phosphate, inorganic polyphosphate (polyP). Here we explore the intimate links between phosphate, inositol phosphates and polyP, speculating on the evolution of these relationships. PMID:26862212

  14. Strand-Specificity in the Transformation of Yeast with Synthetic Oligonucleotides

    PubMed Central

    Yamamoto, T.; Moerschell, R. P.; Wakem, L. P.; Komar-Panicucci, S.; Sherman, F.

    1992-01-01

    Cyc1 mutants of the yeast Saccharomyces cerevisiae were directly transformed with both sense and antisense oligonucleotides to examine the involvement of the two genomic DNA strands in transformation. Sense oligonucleotides yielded approximately 20-fold more transformants than antisense oligonucleotides. This differential effect was observed with oligonucleotides designed to make alterations at six different sites along the gene and was independent of the oligonucleotide sequence and length, number of mismatches and the host strain. Competition studies showed that antisense oligonucleotides did not inhibit transformation. Although the mechanism for this strand specificity is unknown, this difference was maintained even when CYC1 transcription was diminished to approximately 2% of the normal level. PMID:1325385

  15. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  16. Stability measurements of antisense oligonucleotides by capillary gel electrophoresis.

    PubMed

    Bruin, G J; Börnsen, K O; Hüsken, D; Gassmann, E; Widmer, H M; Paulus, A

    1995-08-11

    The approach of using antisense oligonucleotides as potential drugs is based on hybridization of a short chemically-modified oligonucleotide with complementary cellular DNA or RNA sequences. A critical question is the stability of chemically modified antisense oligonucleotides in cellular environments. In a model system, resistance against various nucleases was evaluated by capillary gel electrophoresis (CGE). For some of the samples, matrix assisted laser desorption and ionization mass spectrometry (MALDI-MS) was used as an additional analytical tool to perform stability measurements. Using CGE, the enzymatic degradation of single nucleotides from the oligomer can be followed after different incubation times. 10% T polyacrylamide gels give baseline resolution for oligonucleotides ranging between 5 and 30 bases in length. The kinetic influence of a specific nuclease concentration and the antisense oligonucleotide structure on the cleavage reaction are discussed. Also, a simple desalting method to improve the injection efficiency and sensitivity of the method are described. Examples of measurements of chemically modified antisense 19-mers are presented. PMID:7581844

  17. Oligonucleotide probe for detection and identification of Campylobacter pylori.

    PubMed Central

    Morotomi, M; Hoshina, S; Green, P; Neu, H C; LoGerfo, P; Watanabe, I; Mutai, M; Weinstein, I B

    1989-01-01

    We have developed a novel and practical DNA-RNA hybridization assay for the detection and identification of Campylobacter pylori in the gastric mucosa. This technique utilizes a [32P]ddATP-labeled synthetic oligonucleotide probe complementary to a nucleotide sequence present in C. pylori 16S rRNA. This probe is very sensitive and reacted with all 23 strains of C. pylori tested. It is also highly specific, since there was no cross-reactivity with the heterologous organisms Campylobacter coli, C. fetus subsp. fetus, C. jejuni, and C. laridis or with Escherichia coli. Hybridization of the oligonucleotide probe with C. pylori RNA was completely inhibited by treatment of the membrane filters with RNase but not DNase. Although a gastric mucosa tissue homogenate slightly inhibited the hybridization, as few as 10(4) C. pylori cells could be detected even in the presence of 5 mg of gastric mucosa. Gastric biopsy specimens obtained from patients referred for upper gastrointestinal tract endoscopy were tested for C. pylori infection by direct oligonucleotide hybridization, and the results were compared with those of bacteriological cultures, the urease test, and histological observations. A comparison of the urease test and the oligonucleotide hybridization results showed an excellent correlation between the two methods. The clinical usefulness of this oligonucleotide-RNA hybridization method is discussed. Images PMID:2480360

  18. A status update of modified oligonucleotides for chemotherapeutics applications.

    PubMed

    Sanghvi, Yogesh S

    2011-09-01

    This unit presents an update of recent developments and clinical progress in chemically modified oliogonucleotides useful for therapeutic applications. During the last decade, the number of therapeutic oligonucleotides in clinical trials has nearly tripled. This is primarily due to advances in the synthesis protocols, better understanding of the biology, improved delivery, and better formulation technologies. Currently, over 100 clinical trials with oligonucleotide-based drugs are ongoing in the United States for potential treatment of a variety of life-threatening diseases. Among various oligonucleotides, antisense technology has been at the forefront, with one product on the market. Antisense technologies represent about half of the active clinical trials. Similarly, siRNA, aptamers, spiegelmers microRNA, shRNA, IMO, and CpG have been other active classes of oligonucleotides that are also undergoing clinical trials. This review attempts to summarize the current status of synthesis, chemical modifications, purification, and analysis in light of the rapid progress with multitude of oligonucleotides pursued as therapeutic modality. PMID:21901670

  19. Survival of the fittest before the beginning of life: selection of the first oligonucleotide-like polymers by UV light

    PubMed Central

    Mulkidjanian, Armen Y; Cherepanov, Dmitry A; Galperin, Michael Y

    2003-01-01

    Background A key event in the origin of life on this planet has been formation of self-replicating RNA-type molecules, which were complex enough to undergo a Darwinian-type evolution (origin of the "RNA world"). However, so far there has been no explanation of how the first RNA-like biopolymers could originate and survive on the primordial Earth. Results As condensation of sugar phosphates and nitrogenous bases is thermodynamically unfavorable, these compounds, if ever formed, should have undergone rapid hydrolysis. Thus, formation of oligonucleotide-like structures could have happened only if and when these structures had some selective advantage over simpler compounds. It is well known that nitrogenous bases are powerful quenchers of UV quanta and effectively protect the pentose-phosphate backbones of RNA and DNA from UV cleavage. To check if such a protection could play a role in abiogenic evolution on the primordial Earth (in the absence of the UV-protecting ozone layer), we simulated, by using Monte Carlo approach, the formation of the first oligonucleotides under continuous UV illumination. The simulations confirmed that UV irradiation could have worked as a selective factor leading to a relative enrichment of the system in longer sugar-phosphate polymers carrying nitrogenous bases as UV-protectors. Partial funneling of the UV energy into the condensation reactions could provide a further boost for the oligomerization. Conclusion These results suggest that accumulation of the first polynucleotides could be explained by their abiogenic selection as the most UV-resistant biopolymers. PMID:12773209

  20. Electron acceptor-dependent respiratory and physiological stratifications in biofilms.

    PubMed

    Yang, Yonggang; Xiang, Yinbo; Sun, Guoping; Wu, Wei-Min; Xu, Meiying

    2015-01-01

    Bacterial respiration is an essential driving force in biogeochemical cycling and bioremediation processes. Electron acceptors respired by bacteria often have solid and soluble forms that typically coexist in the environment. It is important to understand how sessile bacteria attached to solid electron acceptors respond to ambient soluble alternative electron acceptors. Microbial fuel cells (MFCs) provide a useful tool to investigate this interaction. In MFCs with Shewanella decolorationis, azo dye was used as an alternative electron acceptor in the anode chamber. Different respiration patterns were observed for biofilm and planktonic cells, with planktonic cells preferred to respire with azo dye while biofilm cells respired with both the anode and azo dye. The additional azo respiration dissipated the proton accumulation within the anode biofilm. There was a large redox potential gap between the biofilms and anode surface. Changing cathodic conditions caused immediate effects on the anode potential but not on the biofilm potential. Biofilm viability showed an inverse and respiration-dependent profile when respiring with only the anode or azo dye and was enhanced when respiring with both simultaneously. These results provide new insights into the bacterial respiration strategies in environments containing multiple electron acceptors and support an electron-hopping mechanism within Shewanella electrode-respiring biofilms. PMID:25495895

  1. Zinc phosphate conversion coatings

    DOEpatents

    Sugama, T.

    1997-02-18

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate {alpha}-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal. 33 figs.

  2. Zinc phosphate conversion coatings

    DOEpatents

    Sugama, Toshifumi

    1997-01-01

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate .alpha.-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal.

  3. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

    2012-01-01

    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  4. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  5. Oligonucleotide Array for Identification and Detection of Pythium Species†

    PubMed Central

    Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

    2006-01-01

    A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples

  6. Finding a most likely clone ordering from oligonucleotide hybridization data

    SciTech Connect

    Newberg, L.A.

    1994-06-01

    Using an extension of a statistical model given by E. Lander and M. Waterman, the authors define the a posteriori probability of a clone ordering based upon oligonucleotide hybridization data. They give algorithms for computing the likelihood of a clone ordering and for finding a clone ordering of maximum likelihood. The dynamic programming algorithm for computing likelihoods runs in time O(mnc), where m is the number of oligonucleotide probes, n is the number of clones, and c is the coverage of the clone library. They use the Expectation-Maximization technique to maximize likelihoods. 21 refs., 3 figs.

  7. Use of phosphorus oxychloride in synthesizing nucleotides and oligonucleotides

    PubMed Central

    Mungall, W.S.; Greene, G.L.; Miller, P.S.; Letsinger, R.L.

    1974-01-01

    Procedures are described for phosphorylating protected nucleotides, oligonucleotides and phosphoramidate oligonucleotide derivatives at the 3′-hydroxyl group. The conditions (phosphorylation with phosphorus oxychloride and pyridine in dioxane followed by hydrolysis with aqueous pyridine) are sufficiently mild that base labile (trifluoroacetylamino; β-cyanoethyl phosphotriester) and acid labile (O-monomethoxytrityl; phosphoramidate) functions are retained intact. Application of the technique is illustrated by the synthesis of dpT, dTp, d(CF3CONH)Tp, dTpNTp, and dTpNTpNTp. In addition, the utilization of phosphorus oxychloride in joining thymidine derivatives and dinucleoside phosphotriester blocks via phosphodiester links is described. PMID:10793743

  8. Theory of Primary Photoexcitations in Donor-Acceptor Copolymers

    NASA Astrophysics Data System (ADS)

    Aryanpour, Karan; Dutta, Tirthankar; Huynh, Uyen N. V.; Vardeny, Zeev Valy; Mazumdar, Sumit

    2015-12-01

    We present a generic theory of primary photoexcitations in low band gap donor-acceptor conjugated copolymers. Because of the combined effects of strong electron correlations and broken symmetry, there is considerable mixing between a charge-transfer exciton and an energetically proximate triplet-triplet state with an overall spin singlet. The triplet-triplet state, optically forbidden in homopolymers, is allowed in donor-acceptor copolymers. For an intermediate difference in electron affinities of the donor and the acceptor, the triplet-triplet state can have a stronger oscillator strength than the charge-transfer exciton. We discuss the possibility of intramolecular singlet fission from the triplet-triplet state, and how such fission can be detected experimentally.

  9. Theory of Primary Photoexcitations in Donor-Acceptor Copolymers.

    PubMed

    Aryanpour, Karan; Dutta, Tirthankar; Huynh, Uyen N V; Vardeny, Zeev Valy; Mazumdar, Sumit

    2015-12-31

    We present a generic theory of primary photoexcitations in low band gap donor-acceptor conjugated copolymers. Because of the combined effects of strong electron correlations and broken symmetry, there is considerable mixing between a charge-transfer exciton and an energetically proximate triplet-triplet state with an overall spin singlet. The triplet-triplet state, optically forbidden in homopolymers, is allowed in donor-acceptor copolymers. For an intermediate difference in electron affinities of the donor and the acceptor, the triplet-triplet state can have a stronger oscillator strength than the charge-transfer exciton. We discuss the possibility of intramolecular singlet fission from the triplet-triplet state, and how such fission can be detected experimentally. PMID:26765027

  10. An overview of molecular acceptors for organic solar cells

    NASA Astrophysics Data System (ADS)

    Hudhomme, Piétrick

    2013-07-01

    Organic solar cells (OSCs) have gained serious attention during the last decade and are now considered as one of the future photovoltaic technologies for low-cost power production. The first dream of attaining 10% of power coefficient efficiency has now become a reality thanks to the development of new materials and an impressive work achieved to understand, control and optimize structure and morphology of the device. But most of the effort devoted to the development of new materials concerned the optimization of the donor material, with less attention for acceptors which to date remain dominated by fullerenes and their derivatives. This short review presents the progress in the use of non-fullerene small molecules and fullerene-based acceptors with the aim of evaluating the challenge for the next generation of acceptors in organic photovoltaics.

  11. A Comparative Study of Normalization Methods Used in Statistical Analysis of Oligonucleotide Microarray Data

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Normalization methods used in the statistical analysis of oligonucleotide microarray data were evaluated. The oligonucleotide microarray is considered an efficient analytical tool for analyzing thousands of genes simultaneously in a single experiment. However, systematic variation in microarray, ori...

  12. Donor-acceptor chemistry in the main group.

    PubMed

    Rivard, Eric

    2014-06-21

    This Perspective article summarizes recent progress from our laboratory in the isolation of reactive main group species using a general donor-acceptor protocol. A highlight of this program is the use of carbon-based donors in combination with suitable Lewis acidic acceptors to yield stable complexes of parent Group 14 element hydrides (e.g. GeH2 and H2SiGeH2). It is anticipated that this strategy could be extended to include new synthetic targets from throughout the Periodic Table with possible applications in bottom-up materials synthesis and main group element catalysis envisioned. PMID:24788390

  13. Acceptors in bulk and nanoscale ZnO

    NASA Astrophysics Data System (ADS)

    McCluskey, M. D.

    2012-02-01

    Zinc oxide (ZnO) is a semiconductor that emits bright UV light, with little wasted heat. This intrinsic feature makes it a promising material for energy-efficient white lighting, nano-lasers, and other optical applications. For devices to be competitive, however, it is necessary to develop reliable p-type doping. Although substitutional nitrogen has been considered as a potential p-type dopant for ZnO, theoretical and experimental work indicates that nitrogen is a deep acceptor and will not lead to p-type conductivity. This talk will highlight recent experiments on ZnO:N at low temperatures. A red/near-IR photoluminescence (PL) band is correlated with the presence of deep nitrogen acceptors. PL excitation (PLE) measurements show an absorption threshold of 2.26 eV, in good agreement with theory. Magnetic resonance experiments provide further evidence for this assignment. The results of these studies seem to rule out group-V elements as shallow acceptors in ZnO, contradicting numerous reports in the literature. If these acceptors do not work as advertised, is there a viable alternative? Optical studies on ZnO nanocrystals show some intriguing leads. At liquid-helium temperatures, a series of sharp IR absorption peaks arise from an unknown acceptor impurity. The data are consistent with a hydrogenic acceptor 0.46 eV above the valence band edge. While this binding energy is still too deep for many practical applications, it represents a significant improvement over the ˜ 1.3 eV binding energy for nitrogen acceptors. Nanocrystals present another twist. Due to their high surface-to-volume ratio, surface states are especially important. Specifically, electron-hole recombination at the surface give rises to a red luminescence band. From our PL and IR experiments, we have developed a ``unified'' model that attempts to explain acceptor and surface states in ZnO nanocrystals. This model could provide a useful framework for designing future nanoscale ZnO devices.

  14. Sodium acceptor doping of ZnO crystals

    NASA Astrophysics Data System (ADS)

    Parmar, Narendra S.; Joni, I. Made; Lynn, Kelvin G.

    2016-02-01

    ZnO bulk single crystals were doped with sodium by thermal diffusion using sodium dispensers. Secondary-ion mass spectrometry measurement shows the diffusion of sodium with concentration ˜1×1018 cm-3 in near surface region. Photoluminescence (PL) measurements show donor acceptor pair (DAP) emission at 408 nm at room temperature which exhibits a blue-shift to 404 nm at 9 K. DC Hall measurements show the mixed conduction due to low Hall voltage in these samples. PL measurements and variable temperature resistivity measurements suggest that the sodium acceptor activation energy is ˜0.300 eV.

  15. CADMIUM PHOSPHATE GLASS

    DOEpatents

    Carpenter, H.W.; Johnson, P.D.

    1963-04-01

    A method of preparing a cadmium phosphate glass that comprises providing a mixture of solid inorganic compounds of cadmuim and phosphate having vaporizable components and heating the resulting composition to a temperature of at least 850 un. Concent 85% C is presented. (AEC)

  16. Does phosphate enhance the natural attenuation of crude oil in groundwater under defined redox conditions?

    PubMed

    Ponsin, Violaine; Mouloubou, Olsen Raïnness; Prudent, Pascale; Höhener, Patrick

    2014-11-15

    After a crude oil spill caused by a broken pipeline in 2009 to a gravel aquifer in southern France, degradation processes under various redox conditions progressively established, but at rates that predict a long life-time of the source under natural attenuation after partial source removal. In this study, we aimed at identifying the rate-limiting factors for each redox condition, with special emphasis on phosphate as limiting nutrient. The study was conducted in laboratory microcosms assembled with material collected on site: sediments, water from monitoring wells, oil and microbial sludge. Redox conditions were promoted by adding electron acceptors (either oxygen, nitrate, limonite (FeO(OH)), cryptomelane (K(Mn(4+),Mn(2+))8O16), or sulfate). For each condition, the role of phosphate was studied by repeated additions for up to 290days. The results showed a very strong stimulation of aerobic and denitrifying rates of oil degradation by phosphate, provided that oxygen and nitrate were repeatedly supplied. Phosphate caused also a marked stimulation of methanogenic degradation, and a relatively small stimulation of metal reduction. These anaerobic processes started only after marked lag phases, and phosphate shortened the lag phase for methanogenic degradation. Degradation of aromatic and aliphatic hydrocarbons with less than 8 carbons, including benzene, was confirmed even under unstimulated conditions. It is concluded that degradation rates at the site are limited by both, availability of electron acceptors and availability of phosphate needed for promoting microbial growth. PMID:24795042

  17. Does phosphate enhance the natural attenuation of crude oil in groundwater under defined redox conditions?

    NASA Astrophysics Data System (ADS)

    Ponsin, Violaine; Mouloubou, Olsen Raïnness; Prudent, Pascale; Höhener, Patrick

    2014-11-01

    After a crude oil spill caused by a broken pipeline in 2009 to a gravel aquifer in southern France, degradation processes under various redox conditions progressively established, but at rates that predict a long life-time of the source under natural attenuation after partial source removal. In this study, we aimed at identifying the rate-limiting factors for each redox condition, with special emphasis on phosphate as limiting nutrient. The study was conducted in laboratory microcosms assembled with material collected on site: sediments, water from monitoring wells, oil and microbial sludge. Redox conditions were promoted by adding electron acceptors (either oxygen, nitrate, limonite (FeO(OH)), cryptomelane (K(Mn4 +,Mn2 +)8O16), or sulfate). For each condition, the role of phosphate was studied by repeated additions for up to 290 days. The results showed a very strong stimulation of aerobic and denitrifying rates of oil degradation by phosphate, provided that oxygen and nitrate were repeatedly supplied. Phosphate caused also a marked stimulation of methanogenic degradation, and a relatively small stimulation of metal reduction. These anaerobic processes started only after marked lag phases, and phosphate shortened the lag phase for methanogenic degradation. Degradation of aromatic and aliphatic hydrocarbons with less than 8 carbons, including benzene, was confirmed even under unstimulated conditions. It is concluded that degradation rates at the site are limited by both, availability of electron acceptors and availability of phosphate needed for promoting microbial growth.

  18. Three Redox States of a Diradical Acceptor-Donor-Acceptor Triad: Gating the Magnetic Coupling and the Electron Delocalization.

    PubMed

    Souto, Manuel; Lloveras, Vega; Vela, Sergi; Fumanal, Maria; Ratera, Imma; Veciana, Jaume

    2016-06-16

    The diradical acceptor-donor-acceptor triad 1(••), based on two polychlorotriphenylmethyl (PTM) radicals connected through a tetrathiafulvalene(TTF)-vinylene bridge, has been synthesized. The generation of the mixed-valence radical anion, 1(•-), and triradical cation species, 1(•••+), obtained upon electrochemical reduction and oxidation, respectively, was monitored by optical and ESR spectroscopy. Interestingly, the modification of electron delocalization and magnetic coupling was observed when the charged species were generated and the changes have been rationalized by theoretical calculations. PMID:27231856

  19. Solid-phase-supported synthesis of morpholinoglycine oligonucleotide mimics

    PubMed Central

    Belov, Sergey S; Tarasenko, Yulia V; Silnikov, Vladimir N

    2014-01-01

    Summary An efficient solid-phase-supported peptide synthesis (SPPS) of morpholinoglycine oligonucleotide (MorGly) mimics has been developed. The proposed strategy includes a novel specially designed labile linker group containing the oxalyl residue and the 2-aminomethylmorpholino nucleoside analogues as first subunits. PMID:24991266

  20. Oligonucleotide-directed mutagenesis for precision gene editing.

    PubMed

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed. PMID:26503400

  1. Gene expression profiling in peanut using oligonucleotide microarrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently have a moderately significant number of ESTs been released into the public domain. Utilization of these ESTs for the oligonucleotide microarrays provides a means to investigate l...

  2. Chromosome-specific painting in Cucumis species using bulked oligonucleotides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a sing...

  3. Molecular Probe Data Base: a database on synthetic oligonucleotides.

    PubMed Central

    Romano, P; Aresu, O; Parodi, B; Manniello, A; Campi, G; Angelini, G; Romani, M; Iannotta, B; Rondanina, G; Ruzzon, T

    1993-01-01

    The Molecular Probe Data Base (MPDB) was designed to collect and make information on synthetic oligonucleotides available on-line. This paper briefly describes its purpose, contents and structure, forms and mode of data distribution. Particular emphasis is given to recent data extension and system enhancements that have been carried out in order to simplify access to MPDB for unskilled users. PMID:8332523

  4. Molecular Probe Database: a database on synthetic oligonucleotides

    PubMed Central

    Aresu, Ottavia; Parodi, Barbara; Romano, Paolo; Romani, Massimo; Angelini, Giovanna; Manniello, Assunta; Ianotta, Beatrice; Rondanina, Gabriella; Ruzzon, Tiziana; Santi, Leonardo

    1992-01-01

    The Molecular Probe Data Base (MPDB) is designed to collect and make available on-line information on synthetic oligonucleotides. This paper briefly describes the purpose of MPDB, its content and structure, forms and mode of data distribution, and a series of additional services available to scientists using MPDB. PMID:1598231

  5. Discovery of Genomic DNA Polymorphisms using oligonucleotide arrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We are applying oligonucleotide microarray technology as a means of rapidly discovering DNA-based markers for genetic mapping in finger millet and rice. A test genome scan was conducted using the full genome sequences of rice varieties 93-11 (indica) and Nipponbare (japonica) compared with the Affy...

  6. Identification of Medically Important Molds by an Oligonucleotide Array†

    PubMed Central

    Hsiao, Chen Ren; Huang, Liyin; Bouchara, Jean-Philippe; Barton, Richard; Li, Hsin Chieh; Chang, Tsung Chain

    2005-01-01

    Infections caused by fungi have increased in recent years. Accurate and rapid identification of fungal pathogens is important for appropriate treatment with antifungal agents. On the basis of the internal transcribed spacer 1 (ITS 1) and ITS 2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 64 species (32 genera) of clinically important filamentous (or dimorphic) fungi. These 64 species included fungi causing superficial, cutaneous, subcutaneous, and invasive infections. The method consisted of PCR amplification of the ITS regions using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species- or group-specific oligonucleotides immobilized on a nylon membrane. Of 397 fungal strains (290 target and 107 nontarget strains) tested, the sensitivity and specificity of the array was 98.3% (285/290) and 98.1% (105/107), respectively. Misidentified strains were usually those belonging to the same genus of the target species or having partial homology with oligonucleotide probes on the membrane. The whole procedure can be finished within 24 h starting from isolated colonies; reproductive structures, which are essential for the conventional identification methods, are not needed. In conclusion, the present array is a powerful tool for identification of clinically important filamentous fungi and may have the potential to be continually extended by adding further oligonucleotides to the array without significantly increasing the cost or complexity. PMID:16081907

  7. PHOSPHATE MANAGEMENT: FY2010 RESULTS OF PHOSPHATE PRECIPITATION TESTS

    SciTech Connect

    Hay, M.; King, W.

    2011-04-04

    The Phosphate Management program seeks to develop treatment options for caustic phosphate solutions resulting from the caustic leaching of the bismuth phosphate sludge. The SRNL subtask investigated the precipitation of phosphate salts from caustic solutions through addition of fluoride and by crystallization. The scoping tests examined the: precipitation of phosphate by the addition of sodium fluoride to form the sodium fluorophosphate double salt, Na{sub 7}F(PO{sub 4}){sub 2} {center_dot} 19H{sub 2}O, crystallization of phosphate by reducing the temperature of saturated phosphate solutions, and combinations of precipitation and crystallization. A simplified leachate simulant was used in the study produced by dissolving sodium phosphate in 1 M to 3.5 M sodium hydroxide solutions. The results show that all three processes; precipitation with sodium fluoride, crystallization, and combined precipitation/crystallization can be effective for removing large amounts of phosphate from solution. The combined process of precipitation/crystallization showed >90% removal of phosphate at all hydroxide concentrations when cooling a non-saturated phosphate solution from 65 C to 25 C. Based on the measured solubility of sodium phosphate, pH adjustment/caustic addition will also remove large amounts of phosphate from solution (>80%). For all three processes, the phosphate concentration in the caustic solution must be managed to keep the phosphate from becoming too concentrated and thereby potentially forming a solid mass of sodium phosphate after an effective phosphate removal process.

  8. Covalent non-fused tetrathiafulvalene-acceptor systems.

    PubMed

    Pop, Flavia; Avarvari, Narcis

    2016-06-28

    Covalent donor-acceptor (D-A) systems have significantly contributed to the development of many organic materials and to molecular electronics. Tetrathiafulvalene (TTF) represents one of the most widely studied donor precursors and has been incorporated into the structure of many D-A derivatives with the objective of obtaining redox control and modulation of the intramolecular charge transfer (ICT), in order to address switchable emissive systems and to take advantage of its propensity to form regular stacks in the solid state. In this review, we focus on the main families of non-fused TTF-acceptors, which are classified according to the nature of the acceptor: nitrogen-containing heterocycles, BODIPY, perylenes and electron poor unsaturated hydrocarbons, as well as radical acceptors. We describe herein the most representative members of each family with a brief mention of their synthesis and a special focus on their D-A characteristics. Special attention is given to ICT and its modulation, fluorescence quenching and switching, photoconductivity, bistability and spin distribution by discussing and comparing spectroscopic and electrochemical features, photophysical properties, solid-state properties and theoretical calculations. PMID:27193500

  9. Fine structure of the Mn acceptor in GaAs

    NASA Astrophysics Data System (ADS)

    Krainov, I. V.; Debus, J.; Averkiev, N. S.; Dimitriev, G. S.; Sapega, V. F.; Lähderanta, E.

    2016-06-01

    We reveal the electronic level structure of the Mn acceptor, which consists of a valence-band hole bound to an Mn2 + ion, in presence of applied uniaxial stress and an external magnetic field in bulk GaAs. Resonant spin-flip Raman scattering is used to measure the g factor of the AMn0 center in the ground and excited states with the total angular momenta F =1 and F =2 and characterize the optical selection rules of the spin-flip transitions between these Mn-acceptor states. We determine the random stress fields near the Mn acceptor, the constant of the antiferromagnetic exchange interaction between the valence-band holes and the electrons of the inner Mn2 + shell as well as the deformation potential for the exchange energy. The p -d exchange energy, in particular, decreases significantly with increasing compressive stress. By combining the experimental Raman study with the developed theoretical model on the scattering efficiency, in which also the random local and external uniaxial stresses and magnetic field are considered, the fine structure of the Mn acceptor is determined in full detail.

  10. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  11. Development of imide- and imidazole-containing electron acceptors for use in donor-acceptor conjugated compounds and polymers

    NASA Astrophysics Data System (ADS)

    Li, Duo

    Conjugated organic compounds and polymers have attracted significant attention due to their potential application in electronic devices as semiconducting materials, such as organic solar cells (OSCs). In order to tune band gaps, donor-acceptor (D-A) structure is widely used, which has been proved to be one of the most effective strategies. This thesis consists of three parts: 1) design, syntheses and characterization of new weak acceptors based on imides and the systematic study of the structure-property relationship; (2) introduction of weak and strong acceptors in one polymer to achieve a broad coverage of light absorption and improve the power conversion efficiency (PCE); (3) modification of benzothiadiazole (BT) acceptor in order to increase the electron withdrawing ability. Imide-based electron acceptors, 4-(5-bromothiophen-2-y1)-2-(2-ethylhexyl)-9- phenyl- 1H-benzo[f]isoindole-1,3(2H)-dione (BIDO-1) and 4,9-bis(5-bromothiophen-2-yl)-2-(2-ethylhexyl)-benzo[f]isoindole-1,3-dione (BIDO-2), were designed and synthesized. In this design, naphthalene is selected as its main core to maintain a planar structure, and thienyl groups are able to facilitate the bromination reaction and lower the band gap. BIDO-1 and BIDO-2 were successfully coupled with different donors by both Suzuki cross-coupling and Stille cross-coupling reactions. Based on the energy levels and band gaps of the BIDO-containing compounds and polymers, BIDO-1 and BIDO-2 are proved to be weak electron acceptors. Pyromellitic diimide (PMDI) was also studied and found to be a stronger electron acceptor than BIDO . In order to obtain broad absorption coverage, both weak acceptor ( BIDO-2) and strong acceptor diketopyrrolopyrrole (DPP) were introduced in the same polymer. The resulting polymers show two absorption bands at 400 and 600 nm and two emission peaks at 500 and 680 nm. The band gaps of the polymers are around 1.6 eV, which is ideal for OSC application. The PCE of 1.17% was achieved. Finally

  12. Anaerobic methanotrophy in tidal wetland: Effects of electron acceptors

    NASA Astrophysics Data System (ADS)

    Lin, Li-Hung; Yu, Zih-Huei; Wang, Pei-Ling

    2016-04-01

    Wetlands have been considered to represent the largest natural source of methane emission, contributing substantially to intensify greenhouse effect. Despite in situ methanogenesis fueled by organic degradation, methanotrophy also plays a vital role in controlling the exact quantity of methane release across the air-sediment interface. As wetlands constantly experience various disturbances of anthropogenic activities, biological burrowing, tidal inundation, and plant development, rapid elemental turnover would enable various electron acceptors available for anaerobic methanotrophy. The effects of electron acceptors on stimulating anaerobic methanotrophy and the population compositions involved in carbon transformation in wetland sediments are poorly explored. In this study, sediments recovered from tidally influenced, mangrove covered wetland in northern Taiwan were incubated under the static conditions to investigate whether anaerobic methanotrophy could be stimulated by the presence of individual electron acceptors. Our results demonstrated that anaerobic methanotrophy was clearly stimulated in incubations amended with no electron acceptor, sulfate, or Fe-oxyhydroxide. No apparent methane consumption was observed in incubations with nitrate, citrate, fumarate or Mn-oxides. Anaerobic methanotrophy in incubations with no exogenous electron acceptor appears to proceed at the greatest rates, being sequentially followed by incubations with sulfate and Fe-oxyhydroxide. The presence of basal salt solution stimulated methane oxidation by a factor of 2 to 3. In addition to the direct impact of electron acceptor and basal salts, incubations with sediments retrieved from low tide period yielded a lower rate of methane oxidation than from high tide period. Overall, this study demonstrates that anaerobic methanotrophy in wetland sediments could proceed under various treatments of electron acceptors. Low sulfate content is not a critical factor in inhibiting methane

  13. Structural Basis of Duplex Thermodynamic Stability and Enhanced Nuclease Resistance of 5'-C-Methyl Pyrimidine-Modified Oligonucleotides.

    PubMed

    Kel'in, Alexander V; Zlatev, Ivan; Harp, Joel; Jayaraman, Muthusamy; Bisbe, Anna; O'Shea, Jonathan; Taneja, Nate; Manoharan, Rajar M; Khan, Saeed; Charisse, Klaus; Maier, Martin A; Egli, Martin; Rajeev, Kallanthottathil G; Manoharan, Muthiah

    2016-03-18

    Although judicious use of chemical modifications has contributed to the success of nucleic acid therapeutics, poor systemic stability remains a major hurdle. The introduction of functional groups around the phosphate backbone can enhance the nuclease resistance of oligonucleotides (ONs). Here, we report the synthesis of enantiomerically pure (R)- and (S)-5'-C-methyl (C5'-Me) substituted nucleosides and their incorporation into ONs. These modifications generally resulted in a decrease in thermal stability of oligonucleotide (ON) duplexes in a manner dependent on the stereoconfiguration at C5' with greater destabilization characteristic of (R)-epimers. Enhanced stability against snake venom phosphodiesterase resulted from modification of the 3'-end of an ON with either (R)- or (S)-C5'-Me nucleotides. The (S)-isomers with different 2'-substituents provided greater resistance against 3'-exonucleases than the corresponding (R)-isomers. Crystal structure analyses of RNA octamers with (R)- or (S)-5'-C-methyl-2'-deoxy-2'-fluorouridine [(R)- or (S)-C5'-Me-2'-FU, respectively] revealed that the stereochemical orientation of the C5'-Me and the steric effects that emanate from the alkyl substitution are the dominant determinants of thermal stability and are likely molecular origins of resistance against nucleases. X-ray and NMR structural analyses showed that the (S)-C5'-Me epimers are spatially and structurally more similar to their natural 5' nonmethylated counterparts than the corresponding (R)-epimers. PMID:26940174

  14. Oligonucleotide-Mediated Genome Editing Provides Precision and Function to Engineered Nucleases and Antibiotics in Plants[OPEN

    PubMed Central

    Sauer, Noel J.; Narváez-Vásquez, Javier; Mozoruk, Jerry; Miller, Ryan B.; Warburg, Zachary J.; Woodward, Melody J.; Mihiret, Yohannes A.; Lincoln, Tracey A.; Segami, Rosa E.; Sanders, Steven L.; Walker, Keith A.; Beetham, Peter R.; Schöpke, Christian R.; Gocal, Greg F.W.

    2016-01-01

    Here, we report a form of oligonucleotide-directed mutagenesis for precision genome editing in plants that uses single-stranded oligonucleotides (ssODNs) to precisely and efficiently generate genome edits at DNA strand lesions made by DNA double strand break reagents. Employing a transgene model in Arabidopsis (Arabidopsis thaliana), we obtained a high frequency of precise targeted genome edits when ssODNs were introduced into protoplasts that were pretreated with the glycopeptide antibiotic phleomycin, a nonspecific DNA double strand breaker. Simultaneous delivery of ssODN and a site-specific DNA double strand breaker, either transcription activator-like effector nucleases (TALENs) or clustered, regularly interspaced, short palindromic repeats (CRISPR/Cas9), resulted in a much greater targeted genome-editing frequency compared with treatment with DNA double strand-breaking reagents alone. Using this site-specific approach, we applied the combination of ssODN and CRISPR/Cas9 to develop an herbicide tolerance trait in flax (Linum usitatissimum) by precisely editing the 5′-ENOLPYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) genes. EPSPS edits occurred at sufficient frequency that we could regenerate whole plants from edited protoplasts without employing selection. These plants were subsequently determined to be tolerant to the herbicide glyphosate in greenhouse spray tests. Progeny (C1) of these plants showed the expected Mendelian segregation of EPSPS edits. Our findings show the enormous potential of using a genome-editing platform for precise, reliable trait development in crop plants. PMID:26864017

  15. Oligonucleotide Immobilization and Hybridization on Aldehyde-Functionalized Poly(2-hydroxyethyl methacrylate) Brushes.

    PubMed

    Bilgic, Tugba; Klok, Harm-Anton

    2015-11-01

    DNA biosensing requires high oligonucleotide binding capacity interface chemistries that can be tuned to maximize probe presentation as well as hybridization efficiency. This contribution investigates the feasibility of aldehyde-functionalized poly(2-hydroxyethyl methacrylate) (PHEMA) brush-based interfaces for oligonucleotide binding and hybridization. These polymer brushes, which allow covalent immobilization of oligonucleotides, are prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of HEMA followed by a postpolymerization oxidation step to generate side chain aldehyde groups. A series of polymer brushes covering a range of film thicknesses and grafting densities was investigated with regard to their oligonucleotide binding capacity as well as their ability to support oligonucleotide hybridization. Densely grafted brushes were found to have probe oligonucleotide binding capacities of up to ∼30 pmol/cm(2). Increasing the thickness of these densely grafted brush films, however, resulted in a decrease in the oligonucleotide binding capacity. Less densely grafted brushes possess binding capacities of ∼10 pmol/cm(2), which did not significantly depend on film thickness. The oligonucleotide hybridization efficiencies, however, were highest (93%) on those brushes that present the lowest surface concentration of the probe oligonucleotide. These results highlight the importance of optimizing the probe oligonucleotide surface concentration and binding interface chemistry. The versatility and tunability of the PHEMA-based brushes presented herein makes these films a very attractive platform for the immobilization and hybridization of oligonucleotides. PMID:26441148

  16. [Preparative isolation of tetra-, penta- and hexapurine oligonucleotides from partial hydrolysates of depyrimidinated herring sperm DNA].

    PubMed

    Schott, H; Schrade, H

    1984-02-01

    Herring sperm DNA is chemically degraded to a complex mixture of purine nucleotides. The oligonucleotides are separated from the partial hydrolysates by column chromatography. The resulting mixture of trimer to hexamer purine oligonucleotides is subsequently fractionated on QAE-Sephadex into different mixtures of sequence-isomeric purine oligonucleotides. In a final separation, which uses reversed-phase (Nucleosil C18) high-performance liquid chromatography, these mixtures are separated under isocratic conditions into 35 pure defined purine oligonucleotides with four to six monomer units, 14 defined mixtures of sequence-isomeric purine oligonucleotides and several unidentified products. Purity and sequence of the isolated oligonucleotides are determined by the "fingerprint" method. The results of the high-performance liquid chromatographic and the "fingerprint" methods of the isolated oligonucleotides are discussed. PMID:6707126

  17. Metal-phosphate binders

    DOEpatents

    Howe, Beth Ann [Lewistown, IL; Chaps-Cabrera, Jesus Guadalupe [Coahuila, MX

    2009-05-12

    A metal-phosphate binder is provided. The binder may include an aqueous phosphoric acid solution, a metal-cation donor including a metal other than aluminum, an aluminum-cation donor, and a non-carbohydrate electron donor.

  18. Phosphate control in dialysis

    PubMed Central

    Cupisti, Adamasco; Gallieni, Maurizio; Rizzo, Maria Antonietta; Caria, Stefania; Meola, Mario; Bolasco, Piergiorgio

    2013-01-01

    Prevention and correction of hyperphosphatemia is a major goal of chronic kidney disease–mineral and bone disorder (CKD–MBD) management, achievable through avoidance of a positive phosphate balance. To this aim, optimal dialysis removal, careful use of phosphate binders, and dietary phosphate control are needed to optimize the control of phosphate balance in well-nourished patients on a standard three-times-a-week hemodialysis schedule. Using a mixed diffusive–convective hemodialysis tecniques, and increasing the number and/or the duration of dialysis tecniques are all measures able to enhance phosphorus (P) mass removal through dialysis. However, dialytic removal does not equal the high P intake linked to the high dietary protein requirement of dialysis patients; hence, the use of intestinal P binders is mandatory to reduce P net intestinal absorption. Unfortunately, even a large dose of P binders is able to bind approximately 200–300 mg of P on a daily basis, so it is evident that their efficacy is limited in the case of an uncontrolled dietary P load. Hence, limitation of dietary P intake is needed to reach the goal of neutral phosphate balance in dialysis, coupled to an adequate protein intake. To this aim, patients should be informed and educated to avoid foods that are naturally rich in phosphate and also processed food with P-containing preservatives. In addition, patients should preferentially choose food with a low P-to-protein ratio. For example, patients could choose egg white or protein from a vegetable source. Finally, boiling should be the preferred cooking procedure, because it induces food demineralization, including phosphate loss. The integrated approach outlined in this article should be actively adapted as a therapeutic alliance by clinicians, dieticians, and patients for an effective control of phosphate balance in dialysis patients. PMID:24133374

  19. Modelling of calcium phosphates

    NASA Astrophysics Data System (ADS)

    Calderin Hidalgo, Lazaro Juan

    This work is a contribution to a large scale joint experimental and theoretical effort to understand the biological properties of silicon doped calcium phosphates undertaken by Queen's University and Millenium Biologix Corp. We have modeled calcium phosphates and silicon doped calcium phosphates in close relation to experiment in order to study possible location of silicon in the lattice. Density functional theory has been used to study the structural and dynamical properties of small systems of calcium phosphates to gain preliminary information on phosphates and the performance of the theoretical methods. The same methods were used to investigate structural and electronic properties of larger scale calcium phosphate systems, while a classical shell model was developed to investigate the dynamical properties of such large and complex systems. In the context of the shell model a method was devised to calculate the dynamical matrix corrected for the long range Coulomb interaction in the long wave length limit. It was necessary also to develop a theoretical expression for the dielectric function in the context of the shell model. Infrared spectra and thermal parameters were calculated based on these methods. We also propose some directions for future research.

  20. Mechanisms of electron acceptor utilization: Implications for simulating anaerobic biodegradation

    USGS Publications Warehouse

    Schreiber, M.E.; Carey, G.R.; Feinstein, D.T.; Bahr, J.M.

    2004-01-01

    Simulation of biodegradation reactions within a reactive transport framework requires information on mechanisms of terminal electron acceptor processes (TEAPs). In initial modeling efforts, TEAPs were approximated as occurring sequentially, with the highest energy-yielding electron acceptors (e.g. oxygen) consumed before those that yield less energy (e.g., sulfate). Within this framework in a steady state plume, sequential electron acceptor utilization would theoretically produce methane at an organic-rich source and Fe(II) further downgradient, resulting in a limited zone of Fe(II) and methane overlap. However, contaminant plumes often display much more extensive zones of overlapping Fe(II) and methane. The extensive overlap could be caused by several abiotic and biotic processes including vertical mixing of byproducts in long-screened monitoring wells, adsorption of Fe(II) onto aquifer solids, or microscale heterogeneity in Fe(III) concentrations. Alternatively, the overlap could be due to simultaneous utilization of terminal electron acceptors. Because biodegradation rates are controlled by TEAPs, evaluating the mechanisms of electron acceptor utilization is critical for improving prediction of contaminant mass losses due to biodegradation. Using BioRedox-MT3DMS, a three-dimensional, multi-species reactive transport code, we simulated the current configurations of a BTEX plume and TEAP zones at a petroleum- contaminated field site in Wisconsin. Simulation results suggest that BTEX mass loss due to biodegradation is greatest under oxygen-reducing conditions, with smaller but similar contributions to mass loss from biodegradation under Fe(III)-reducing, sulfate-reducing, and methanogenic conditions. Results of sensitivity calculations document that BTEX losses due to biodegradation are most sensitive to the age of the plume, while the shape of the BTEX plume is most sensitive to effective porosity and rate constants for biodegradation under Fe(III)-reducing and

  1. Mechanisms of electron acceptor utilization: implications for simulating anaerobic biodegradation.

    PubMed

    Schreiber, M E; Carey, G R; Feinstein, D T; Bahr, J M

    2004-09-01

    Simulation of biodegradation reactions within a reactive transport framework requires information on mechanisms of terminal electron acceptor processes (TEAPs). In initial modeling efforts, TEAPs were approximated as occurring sequentially, with the highest energy-yielding electron acceptors (e.g. oxygen) consumed before those that yield less energy (e.g., sulfate). Within this framework in a steady state plume, sequential electron acceptor utilization would theoretically produce methane at an organic-rich source and Fe(II) further downgradient, resulting in a limited zone of Fe(II) and methane overlap. However, contaminant plumes often display much more extensive zones of overlapping Fe(II) and methane. The extensive overlap could be caused by several abiotic and biotic processes including vertical mixing of byproducts in long-screened monitoring wells, adsorption of Fe(II) onto aquifer solids, or microscale heterogeneity in Fe(III) concentrations. Alternatively, the overlap could be due to simultaneous utilization of terminal electron acceptors. Because biodegradation rates are controlled by TEAPs, evaluating the mechanisms of electron acceptor utilization is critical for improving prediction of contaminant mass losses due to biodegradation. Using BioRedox-MT3DMS, a three-dimensional, multi-species reactive transport code, we simulated the current configurations of a BTEX plume and TEAP zones at a petroleum-contaminated field site in Wisconsin. Simulation results suggest that BTEX mass loss due to biodegradation is greatest under oxygen-reducing conditions, with smaller but similar contributions to mass loss from biodegradation under Fe(III)-reducing, sulfate-reducing, and methanogenic conditions. Results of sensitivity calculations document that BTEX losses due to biodegradation are most sensitive to the age of the plume, while the shape of the BTEX plume is most sensitive to effective porosity and rate constants for biodegradation under Fe(III)-reducing and

  2. A study of fast and metastable dissociations of adenine-thymine binary-base oligonucleotides by using positive-ion MALDI-TOF mass spectrometry.

    PubMed

    Chan, T W Dominic; Fung, Y M Eva; Li, Y C Leo

    2002-09-01

    In the present study, fast and metastable dissociations of a number of adenine-thymine binary-base oligonucleotides under the conditions of UV matrix-assisted laser desorption/ionization mass spectrometry were investigated. 2-Aminobenzoic acid/ammonium fluoride (ABA/NH4F) matrix system was used. The spectra obtained under metastable and fast dissociation conditions exhibit distinctive dissociation products. From the post-source-decay analysis, all oligonucleotides underwent predominantly metastable dissociations at the 3' C-O linkages to form [a(n)-B]+ and w(n)+ complimentary ion series. Based on the present results, the so-called "[wn+80]+" ions were postulated to be the complimentary [Z(8-n)AH]+ ions rather than the expected phosphate rearrangement products. In addition, these oligonucleotides were found to generate fast dissociation products of b(n)+, d(N)+, w(N)+ and y(N)+ ions through backbone cleavages at 5' C-O, 5' O-P, 3' C-O and 3' P-O linkages, respectively. Product ion series formed under PSD conditions were not observed. The implications of this mutually exclusive occurrence of the two sets of fragment ions under fast and metastable conditions using ABA/NH4F matrix would be discussed. A model of ion activation under UV-MALDI conditions was also proposed. PMID:12322953

  3. More Than Charged Base Loss — Revisiting the Fragmentation of Highly Charged Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Nyakas, Adrien; Eberle, Rahel P.; Stucki, Silvan R.; Schürch, Stefan

    2014-07-01

    Tandem mass spectrometry is a well-established analytical tool for rapid and reliable characterization of oligonucleotides (ONs) and their gas-phase dissociation channels. The fragmentation mechanisms of native and modified nucleic acids upon different mass spectrometric activation techniques have been studied extensively, resulting in a comprehensive catalogue of backbone fragments. In this study, the fragmentation behavior of highly charged oligodeoxynucleotides (ODNs) comprising up to 15 nucleobases was investigated. It was found that ODNs exhibiting a charge level (ratio of the actual to the total possible charge) of 100% follow significantly altered dissociation pathways compared with low or medium charge levels if a terminal pyrimidine base (3' or 5') is present. The corresponding product ion spectra gave evidence for the extensive loss of a cyanate anion (NCO-), which frequently coincided with the abstraction of water from the 3'- and 5'-end in the presence of a 3'- and 5'-terminal pyrimidine nucleobase, respectively. Subsequent fragmentation of the M-NCO- ion by MS3 revealed a so far unreported consecutive excision of a metaphosphate (PO3 -)-ion for the investigated sequences. Introduction of a phosphorothioate group allowed pinpointing of PO3 - loss to the ultimate phosphate group. Several dissociation mechanisms for the release of NCO- and a metaphosphate ion were proposed and the validity of each mechanism was evaluated by the analysis of backbone- or sugar-modified ONs.

  4. Cleavage properties of an oligonucleotide containing a bridged internucleotide 5'-phosphorothioate RNA linkage.

    PubMed Central

    Kuimelis, R G; McLaughlin, L W

    1995-01-01

    An oligonucleotide has been synthesized that contains a single bridging 5'-phosphorothioate at an RNA linkage (5'-ApCpGpGpTpCpTprCpsApCpGpApGpC-3'). This new phosphodiester linkage is found to be particularly susceptible to cleavage when compared with the corresponding oxo, deoxy and thiodeoxy derivatives. Divalent metal cations were observed to dramatically increase the cleavage rate. The products of the cleavage under a variety of conditions are a 5'-thiol-containing fragment (6mer) and a 2',3'-cyclic phosphate-containing fragment (8mer). The pseudo-first order rate constant, kobs, for cleavage at pH 7.5 (50 mM Tris-HCI) in the presence of 5 mM EDTA is 1.5 x 10(-4)/min. In the presence of 5 mM metal dichloride and 50 mM Tris-HCI, pH 7.5, the relative cleavage rate enhancements are 10, 24, 71, 98, 370 and 3400 for Mg2+, Ca2+, Mn2+, Co2+, Zn2+ and Cd2+ respectively. The rate enhancements correlate well with Pearson's HSAB principle, suggesting that cleavage is mediated in part by coordination of the metal to the 5'-mercapto leaving group. RNA linkages containing bridging 5'-phosphorothioates should prove valuable for studying the mechanistic details of a variety of RNA cleaving agents, such as ribozymes. Images PMID:8532515

  5. Total Phosphate Influences the Rate of Hydrocarbon Degradation but Phosphate Mineralogy Shapes Microbial Community Composition in Cold-Region Calcareous Soils.

    PubMed

    Siciliano, Steven D; Chen, Tingting; Phillips, Courtney; Hamilton, Jordan; Hilger, David; Chartrand, Blaine; Grosskleg, Jay; Bradshaw, Kris; Carlson, Trevor; Peak, Derek

    2016-05-17

    Managing phosphorus bioaccessibility is critical for the bioremediation of hydrocarbons in calcareous soils. This paper explores how soil mineralogy interacts with a novel biostimulatory solution to both control phosphorus bioavailability and influence bioremediation. Two large bore infiltrators (1 m diameter) were installed at a PHC contaminated site and continuously supplied with a solution containing nutrients and an electron acceptor. Soils from eight contaminated sites were prepared and pretreated, analyzed pretrial, spiked with diesel, placed into nylon bags into the infiltrators, and removed after 3 months. From XAS, we learned that three principal phosphate phases had formed: adsorbed phosphate, brushite, and newberyite. All measures of biodegradation in the samples (in situ degradation estimates, mineralization assays, culturable bacteria, catabolic genes) varied depending upon the soil's phosphate speciation. Notably, adsorbed phosphate increased anaerobic phenanthrene degradation and bzdN catabolic gene prevalence. The dominant mineralogical constraints on community composition were the relative amounts of adsorbed phosphate, brushite, and newberyite. Overall, this study finds that total phosphate influences microbial community phenotypes whereas relative percentages of phosphate minerals influences microbial community genotype composition. PMID:27082646

  6. Rigid Conjugated Twisted Truxene Dimers and Trimers as Electron Acceptors.

    PubMed

    Zhang, Gang; Lami, Vincent; Rominger, Frank; Vaynzof, Yana; Mastalerz, Michael

    2016-03-14

    A new class of rigid twisted truxenone oligomers with an enlarged π backbone has been established by oxidative dimerization reactions. The resulting extended conjugated systems have large extinction coefficients and low-lying LUMO levels and show good solubility in common organic solvents, thus making them attractive compounds as new electron acceptors in organic electronics. Their suitability as electron acceptors has been demonstrated in bulk-heterojunction organic solar cells with poly({4,8-bis[(2-ethylhexyl)oxy]benzo[1,2-b:4,5-b']dithiophene-2,6-diyl}{3-fluoro-2-[(2-ethylhexyl)carbonyl]thieno[3,4-b]thiophenediyl}) (PTB7) as the donor material. PMID:26891096

  7. Probing the spin states of a single acceptor atom.

    PubMed

    van der Heijden, Joost; Salfi, Joe; Mol, Jan A; Verduijn, Jan; Tettamanzi, Giuseppe C; Hamilton, Alex R; Collaert, Nadine; Rogge, Sven

    2014-03-12

    We demonstrate a single-hole transistor using an individual acceptor dopant embedded in a silicon channel. Magneto-transport spectroscopy reveals that the ground state splits as a function of magnetic field into four states, which is unique for a single hole bound to an acceptor in a bulk semiconductor. The two lowest spin states are heavy (|m(j)| = 3/2) and light (|m(j)| = 1/2) hole-like, a two-level system that can be electrically driven and is characterized by a magnetic field dependent and long relaxation time, which are properties of interest for qubits. Although the bulklike spin splitting of a boron atom is preserved in our nanotransistor, the measured Landé g-factors, |g(hh)| = 0.81 ± 0.06 and |g(lh)| = 0.85 ± 0.21 for heavy and light holes respectively, are lower than the bulk value. PMID:24571637

  8. Interface effects on acceptor qubits in silicon and germanium.

    PubMed

    Abadillo-Uriel, J C; Calderón, M J

    2016-01-15

    Dopant-based quantum computing implementations often require the dopants to be situated close to an interface to facilitate qubit manipulation with local gates. Interfaces not only modify the energies of the bound states but also affect their symmetry. Making use of the successful effective mass theory we study the energy spectra of acceptors in Si or Ge taking into account the quantum confinement, the dielectric mismatch and the central cell effects. The presence of an interface puts constraints to the allowed symmetries and leads to the splitting of the ground state in two Kramers doublets (Mol et al 2015 Appl. Phys. Lett. 106 203110). Inversion symmetry breaking also implies parity mixing which affects the allowed optical transitions. Consequences for acceptor qubits are discussed. PMID:26618443

  9. Defect Donor and Acceptor in GaN

    SciTech Connect

    Look, D.C.; Reynolds, D.C.; Hemsky, J.W.; Sizelove, J.R.; Jones, R.L.

    1997-09-01

    High-energy (0.7{endash}1MeV) electron irradiation in GaN grown on sapphire produces shallow donors and deep or shallow acceptors at equal rates, 1{plus_minus}0.2 cm{sup {minus}1}. The data, in conjunction with theory, are consistent only with the shallow donor being the N vacancy, and the acceptor the N interstitial. The N-vacancy donor energy is 64{plus_minus}10 meV, much larger than the value of 18meV found for the residual donor (probably Si) in this material. The Hall-effect measurements also reveal a degenerate n -type layer at the GaN/sapphire interface which must be accounted for to get the proper donor activation energy. {copyright} {ital 1997} {ital The American Physical Society}

  10. Selective release of multiple DNA oligonucleotides from gold nanorods.

    PubMed

    Wijaya, Andy; Schaffer, Stefan B; Pallares, Ivan G; Hamad-Schifferli, Kimberly

    2009-01-27

    Combination therapy, or the use of multiple drugs, has been proven to be effective for complex diseases, but the differences in chemical properties and pharmacokinetics can be challenging in terms of the loading, delivering, and releasing multiple drugs. Here we demonstrate that we can load and selectively release two different DNA oligonucleotides from two different gold nanorods. DNA was loaded on the nanorods via thiol conjugation. Selective releases were induced by selective melting of gold nanorods via ultrafast laser irradiation at the nanorods' longitudinal surface plasmon resonance peaks. Excitation at one wavelength could selectively melt one type of gold nanorods and selectively release one type of DNA strand. Releases were efficient (50-80%) and externally tunable by laser fluence. Released oligonucleotides were still functional. This proof of concept is potentially a powerful method for multiple-drug delivery strategies. PMID:19206252

  11. Synthesis and properties of oligonucleotides containing aminodeoxythymidine units.

    PubMed Central

    Gryaznov, S M; Letsinger, R L

    1992-01-01

    Procedures are described for synthesis via solid support methodology of oligonucleotide analogues derived in part from 3'-amino-3'-deoxythymidine or 5'-amino-5'-deoxythymidine. Oligothymidylate decamers terminated with a 3'-amino group or containing a 3'-NHP(O)(O-)O-5' internucleoside link are found to form unusually stable complexes with poly(dA), poly(A), and oligo(dA). For related derivatives of 5'-amino-5'-deoxythymidine enhancement is less or absent, and in the case of multiple substitution destabilization of the heteroduplex may be observed. That the effect of the 3'-amino group is general for oligonucleotide derivatives is indicated by enhanced Tm values for heteroduplex complexes of the mixed-base oligomer, d(TATTCAGTCAT(NH2)), and the methyl phosphonate derivatives, TmTmTmTmTmTmTmTmTmT(NH2) and d(TmAmTmTmCmAmGmTmCmAmT(NH2)). PMID:1630911

  12. Oligonucleotide-directed site-specific mutagenesis in Drosophila melanogaster.

    PubMed Central

    Banga, S S; Boyd, J B

    1992-01-01

    An efficient technique has been developed for performing in vivo site-directed mutagenesis in Drosophila melanogaster. This procedure involves directed repair of P-element-induced DNA lesions after injection of a modified DNA sequence into early embryos. An oligonucleotide of 50 base pairs, whose sequence spans the P-element insertion site, mediates base replacement in the endogenous gene. Restriction mapping, DNA sequencing, and polymerase chain reaction analysis demonstrate that base substitutions present in an injected oligonucleotide are incorporated into genomic sequences flanking a P insertion site in the white gene. This analysis suggests that progeny bearing directed mutations are recovered with a frequency of about 0.5 x 10(-3). Because Drosophila remains a premier organism for the analysis of eukaryotic gene regulation, this system should find strong application in that analysis as well as in the analysis of DNA recombination, conversion, repair, and mutagenesis. Images PMID:1311850

  13. Cell-penetrating Peptides as Versatile Vehicles for Oligonucleotide Delivery

    PubMed Central

    Margus, Helerin; Padari, Kärt; Pooga, Margus

    2012-01-01

    Short regulatory oligonucleotides (ONs) have a great therapeutic potential for the modulation of gene expression due to their high specificity and low toxicity. The major obstacles for in vivo clinical applications of ONs are the poor permeability of plasma membrane to nucleic acids and the sensitivity of ONs to enzymatic degradation. Hence, various delivery vehicles have been developed to ensure the transduction of ONs into cells. Among these, the cell-penetrating peptides (CPPs) have gained quickly broadening popularity as promising nonviral transmembrane delivery vectors. For coupling of nucleic acids to CPPs, two distinct strategies may be applied—covalent and noncovalent. The majority of earlier studies have used covalent coupling of CPPs to ONs. However, the number of studies demonstrating very high therapeutic potential of noncovalent complexes of ONs with novel CPP-based delivery vehicles is explosively increasing. In this review, the recent developments in the application of CPP-mediated oligonucleotide delivery by noncovalent strategy will be discussed. PMID:22233581

  14. 2012 ELECTRON DONOR-ACCEPTOR INTERACTIONS GORDON RESEARCH CONFERENCE, AUGUST 5-10, 2012

    SciTech Connect

    McCusker, James

    2012-08-10

    The upcoming incarnation of the Gordon Research Conference on Electron Donor Acceptor Interactions will feature sessions on classic topics including proton-coupled electron transfer, dye-sensitized solar cells, and biological electron transfer, as well as emerging areas such as quantum coherence effects in donor-acceptor interactions, spintronics, and the application of donor-acceptor interactions in chemical synthesis.

  15. An extended Foerster-Dexter model for correlated donor-acceptor placement in solid state materials

    NASA Astrophysics Data System (ADS)

    Rotman, S. R.; Hartmann, F. X.

    1987-09-01

    The current theory of donor-acceptor interactions in solid-state materials is based on a random distribution of donors and acceptors through the crystal. In this paper, we present a model to calculate the observable transfer rates for the correlated positioning of donors and acceptors in laser materials. Chemical effects leading to such correlations are discussed.

  16. Free Carrier Generation in Organic Photovoltaic Bulk Heterojunctions of Conjugated Polymers with Molecular Acceptors: Planar versus Spherical Acceptors

    SciTech Connect

    Nardes, Alexandre M.; Ferguson, Andrew J.; Wolfer, Pascal; Gui, Kurt; Burn, Paul L.; Meredith, Paul; Kopidakis, Nikos

    2014-03-05

    We present a comparative study of the photophysical performance of the prototypical fullerene derivative PC61BM with a planar small-molecule acceptor in an organic photovoltaic device. The small-molecule planar acceptor is 2-[{7-(9,9-di-n-propyl-9H-fluoren-2-yl)benzo[c][1,2,5]thiadiazol-4-yl}methylene]malononitrile, termed K12. We discuss photoinduced free charge-carrier generation and transport in blends of PC61BM or K12 with poly(3-n-hexylthiophene) (P3HT), surveying literature results for P3HT:PC61BM and presenting new results on P3HT:K12. For both systems we also review previous work on film structure and correlate the structural and photophysical results. In both cases, a disordered mixed phase is formed between P3HT and the acceptor, although the photophysical properties of this mixed phase differ markedly for PC61BM and K12. In the case of PC61BM the mixed phase acts as a free carrier generation region that can efficiently shuttle carriers to the pure polymer and fullerene domains. As a result, the vast majority of excitons quenched in P3HT:PC61BM blends yield free carriers detected by the contactless time-resolved microwave conductivity (TRMC) method. In contrast, approximately 85 % of the excitons quenched in P3HT:K12 do not result in free carriers over the nanosecond timescale of the TRMC experiment. We attribute this to poor electron-transport properties in the mixed P3HT:K12 phase. Here, we propose that the observed differences can be traced to the respective shapes of PC61BM and K12: the three-dimensional nature of the fullerene cage facilitates coupling between PC61BM molecules irrespective of their relative orientation, whereas for K12 strong electronic coupling is only expected for molecules oriented with their π systems parallel to each other. Comparison between the eutectic compositions of the P3HT:PC61BM and P3HT:K12 shows that the former contains enough fullerene to form a percolation pathway for electrons, whereas the latter contains a sub

  17. Quantum confined acceptors and donors in InSe nanosheets

    SciTech Connect

    Mudd, G. W.; Patanè, A. Makarovsky, O.; Eaves, L.; Kudrynskyi, Z. R.; Kovalyuk, Z. D.; Fay, M. W.; Zólyomi, V.; Falko, V.

    2014-12-01

    We report on the radiative recombination of photo-excited carriers bound at native donors and acceptors in exfoliated nanoflakes of nominally undoped rhombohedral γ-polytype InSe. The binding energies of these states are found to increase with the decrease in flake thickness, L. We model their dependence on L using a two-dimensional hydrogenic model for impurities and show that they are strongly sensitive to the position of the impurities within the nanolayer.

  18. Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair

    NASA Astrophysics Data System (ADS)

    Marson, D.; Laurini, E.; Posocco, P.; Fermeglia, M.; Pricl, S.

    2015-02-01

    Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction.Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction. Electronic supplementary information (ESI) available: Additional figures and tables. See DOI: 10.1039/c4nr04510f

  19. Design directed self-assembly of donor-acceptor polymers.

    PubMed

    Marszalek, Tomasz; Li, Mengmeng; Pisula, Wojciech

    2016-09-21

    Donor-acceptor polymers with an alternating array of donor and acceptor moieties have gained particular attention during recent years as active components of organic electronics. By implementation of suitable subunits within the conjugated backbone, these polymers can be made either electron-deficient or -rich. Additionally, their band gap and light absorption can be precisely tuned for improved light-harvesting in solar cells. On the other hand, the polymer design can also be modified to encode the desired supramolecular self-assembly in the solid-state that is essential for an unhindered transport of charge carriers. This review focuses on three major factors playing a role in the assembly of donor-acceptor polymers on surfaces which are (1) nature, geometry and substitution position of solubilizing alkyl side chains, (2) shape of the conjugated polymer defined by the backbone curvature, and (3) molecular weight which determines the conjugation length of the polymer. These factors adjust the fine balance between attractive and repulsive forces and ensure a close polymer packing important for an efficient charge hopping between neighboring chains. On the microscopic scale, an appropriate domain formation with a low density of structural defects in the solution deposited thin film is crucial for the charge transport. The charge carrier transport through such thin films is characterized by field-effect transistors as basic electronic elements. PMID:27440174

  20. Virtual screening of electron acceptor materials for organic photovoltaic applications

    NASA Astrophysics Data System (ADS)

    Halls, Mathew D.; Djurovich, Peter J.; Giesen, David J.; Goldberg, Alexander; Sommer, Jonathan; McAnally, Eric; Thompson, Mark E.

    2013-10-01

    Virtual screening involves the generation of structure libraries, automated analysis to predict properties related to application performance and subsequent screening to identify lead systems and estimate critical structure-property limits across a targeted chemical design space. This approach holds great promise for informing experimental discovery and development efforts for next-generation materials, such as organic semiconductors. In this work, the virtual screening approach is illustrated for nitrogen-substituted pentacene molecules to identify systems for development as electron acceptor materials for use in organic photovoltaic (OPV) devices. A structure library of tetra-azapentacenes (TAPs) was generated by substituting four nitrogens for CH at 12 sites on the pentacene molecular framework. Molecular properties (e.g. ELUMO, Eg and μ) were computed for each candidate structure using hybrid DFT at the B3LYP/6-311G** level of theory. The resulting TAPs library was then analyzed with respect to intrinsic properties associated with OPV acceptor performance. Marcus reorganization energies for charge transport for the most favorable TAP candidates were then calculated to further determine suitability as OPV electron acceptors. The synthesis, characterization and OPV device testing of TAP materials is underway, guided by these results.

  1. Engineered oligosaccharyltransferases with greatly relaxed acceptor site specificity

    PubMed Central

    Ollis, Anne A.; Zhang, Sheng; Fisher, Adam C.; DeLisa, Matthew P.

    2015-01-01

    The Campylobacter jejuni protein glycosylation locus (pgl) encodes machinery for asparagine-linked (N-linked) glycosylation and serves as the archetype for bacterial N-glycosylation. This machinery has been functionally transferred into Escherichia coli, thereby enabling convenient mechanistic dissection of the N-glycosylation process in this genetically tractable host. Here, we sought to identify sequence determinants in the oligosaccharyltransferase PglB that restrict its specificity to only those glycan acceptor sites containing a negatively charged residue at the −2 position relative to asparagine. This involved creation of a genetic assay named glycoSNAP (glycosylation of secreted N-linked acceptor proteins) that facilitates high-throughput screening of glycophenotypes in E. coli. Using this assay, we isolated several C. jejuni PglB variants that were capable of glycosylating an array of noncanonical acceptor sequences including one in a eukaryotic N-glycoprotein. Collectively, these results underscore the utility of glycoSNAP for shedding light on poorly understood aspects of N-glycosylation and for engineering designer N-glycosylation biocatalysts. PMID:25129029

  2. Engineered oligosaccharyltransferases with greatly relaxed acceptor-site specificity.

    PubMed

    Ollis, Anne A; Zhang, Sheng; Fisher, Adam C; DeLisa, Matthew P

    2014-10-01

    The Campylobacter jejuni protein glycosylation locus (pgl) encodes machinery for asparagine-linked (N-linked) glycosylation and serves as the archetype for bacterial N-linked glycosylation. This machinery has been functionally transferred into Escherichia coli, enabling convenient mechanistic dissection of the N-linked glycosylation process in this genetically tractable host. Here we sought to identify sequence determinants in the oligosaccharyltransferase PglB that restrict its specificity to only those glycan acceptor sites containing a negatively charged residue at the -2 position relative to asparagine. This involved creation of a genetic assay, glycosylation of secreted N-linked acceptor proteins (glycoSNAP), that facilitates high-throughput screening of glycophenotypes in E. coli. Using this assay, we isolated several C. jejuni PglB variants that could glycosylate an array of noncanonical acceptor sequences, including one in a eukaryotic N-glycoprotein. These results underscore the utility of glycoSNAP for shedding light on poorly understood aspects of N-linked glycosylation and for engineering designer N-linked glycosylation biocatalysts. PMID:25129029

  3. Fullerene derivatives as electron acceptors for organic photovoltaic cells.

    PubMed

    Mi, Dongbo; Kim, Ji-Hoon; Kim, Hee Un; Xu, Fei; Hwang, Do-Hoon

    2014-02-01

    Energy is currently one of the most important problems humankind faces. Depletion of traditional energy sources such as coal and oil results in the need to develop new ways to create, transport, and store electricity. In this regard, the sun, which can be considered as a giant nuclear fusion reactor, represents the most powerful source of energy available in our solar system. For photovoltaic cells to gain widespread acceptance as a source of clean and renewable energy, the cost per watt of solar energy must be decreased. Organic photovoltaic cells, developed in the past two decades, have potential as alternatives to traditional inorganic semiconductor photovoltaic cells, which suffer from high environmental pollution and energy consumption during production. Organic photovoltaic cells are composed of a blended film of a conjugated-polymer donor and a soluble fullerene-derivative acceptor sandwiched between a poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate)-coated indium tin oxide positive electrode and a low-work-function metal negative electrode. Considerable research efforts aim at designing and synthesizing novel fullerene derivatives as electron acceptors with up-raised lowest unoccupied molecular orbital energy, better light-harvesting properties, higher electron mobility, and better miscibility with the polymer donor for improving the power conversion efficiency of the organic photovoltaic cells. In this paper, we systematically review novel fullerene acceptors synthesized through chemical modification for enhancing the photovoltaic performance by increasing open-circuit voltage, short-circuit current, and fill factor, which determine the performance of organic photovoltaic cells. PMID:24749413

  4. Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

    PubMed Central

    Moreno, Pedro M. D.; Pêgo, Ana P.

    2014-01-01

    Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

  5. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

    2014-01-01

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  6. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing.

    PubMed

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P; Low, Audrey; Yoshida, Masayuki; Bennett, C Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  7. Rapid bacterial identification using evanescent-waveguide oligonucleotide microarray classification.

    PubMed

    Francois, Patrice; Charbonnier, Yvan; Jacquet, Jean; Utinger, Dominic; Bento, Manuela; Lew, Daniel; Kresbach, Gerhard M; Ehrat, Markus; Schlegel, Werner; Schrenzel, Jacques

    2006-06-01

    Bacterial identification relies primarily on culture-based methodologies and requires 48-72 h to deliver results. We developed and used i) a bioinformatics strategy to select oligonucleotide signature probes, ii) a rapid procedure for RNA labelling and hybridization, iii) an evanescent-waveguide oligoarray with exquisite signal/noise performance, and iv) informatics methods for microarray data analysis. Unique 19-mer signature oligonucleotides were selected in the 5'-end of 16s rDNA genes of human pathogenic bacteria. Oligonucleotides spotted onto a Ta(2)O(5)-coated microarray surface were incubated with chemically labelled total bacterial RNA. Rapid hybridization and stringent washings were performed before scanning and analyzing the slide. In the present paper, the eight most abundant bacterial pathogens representing >54% of positive blood cultures were selected. Hierarchical clustering analysis of hybridization data revealed characteristic patterns, even for closely related species. We then evaluated artificial intelligence-based approaches that outperformed conventional threshold-based identification schemes on cognate probes. At this stage, the complete procedure applied to spiked blood cultures was completed in less than 6 h. In conclusion, when coupled to optimal signal detection strategy, microarrays provide bacterial identification within a few hours post-sampling, allowing targeted antimicrobial prescription. PMID:16216356

  8. Recursive construction of perfect DNA molecules from imperfect oligonucleotides

    PubMed Central

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2008-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms. PMID:18463615

  9. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  10. Targeting Several CAG Expansion Diseases by a Single Antisense Oligonucleotide

    PubMed Central

    Evers, Melvin M.; Pepers, Barry A.; van Deutekom, Judith C. T.; Mulders, Susan A. M.; den Dunnen, Johan T.; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.; van Roon-Mom, Willeke M. C.

    2011-01-01

    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2′-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)7, also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  11. Targeting several CAG expansion diseases by a single antisense oligonucleotide.

    PubMed

    Evers, Melvin M; Pepers, Barry A; van Deutekom, Judith C T; Mulders, Susan A M; den Dunnen, Johan T; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B; van Roon-Mom, Willeke M C

    2011-01-01

    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2'-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)(7), also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  12. Sequence-selective metal ion binding to DNA oligonucleotides.

    PubMed

    Frøystein, N A; Davis, J T; Reid, B R; Sletten, E

    1993-07-01

    Metal ion titrations of several DNA oligonucleotides, 10 dodecamers and one decamer have been monitored by 1H NMR spectroscopy in order to elucidate metal ion binding patterns. Also, the effects of paramagnetic impurities on resonance linewidths and NOESY cross-peak intensities have been reversed by EDTA back-titration experiments. 1H 1D NMR spectra were recorded after successive additions of aliquots of different metal salts to oligonucleotide samples. Paramagnetic manganese(II) salts were used in most cases, but a few samples were also titrated with diamagnetic zinc(II). From this study, we conclude that there exists a sequence-selective metal ion binding pattern. The metal ions bind predominantly to 5'-G in the contexts 5'-GC and 5'-GA. The order of preference seems to be GG > or = GA > GT > > GC. No evidence of metal ion binding to 5'-G in 5'-GC steps or to non-G residues was found. The H6 or H8 resonances on preceding (5'-) bases were affected by the adjacent bound paramagnetic metal ion, but no effect was observed on the protons of the succeeding (3'-) base. The metal binding site in the duplexes is most likely at G-N7, as manifested by the pronounced paramagnetic line broadening or diamagnetic shift of the G-H8 signal. This sequence selectivity may be qualitatively explained by a sequence-dependent variation in the molecular electrostatic potentials of guanine residues (MEPs) along the oligonucleotide chain. PMID:8363924

  13. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  14. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors

    NASA Astrophysics Data System (ADS)

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-11-01

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis.

  15. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors.

    PubMed

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-01-01

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis. PMID:26559132

  16. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors

    PubMed Central

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-01-01

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis. PMID:26559132

  17. Spectral, thermal and kinetic studies of charge-transfer complexes formed between the highly effective antibiotic drug metronidazole and two types of acceptors: σ- and π-acceptors.

    PubMed

    Refat, Moamen S; Saad, Hosam A; Adam, Abdel Majid A

    2015-04-15

    Understanding the interaction between drugs and small inorganic or organic molecules is critical in being able to interpret the drug-receptor interactions and acting mechanism of these drugs. A combined solution and solid state study was performed to describe the complexation chemistry of drug metronidazole (MZ) which has a broad-spectrum antibacterial activity with two types of acceptors. The acceptors include, σ-acceptor (i.e., iodine) and π-acceptors (i.e., dichlorodicyanobenzoquinone (DDQ), chloranil (CHL) and picric acid (PA)). The molecular structure, spectroscopic characteristics, the binding modes as well as the thermal stability were deduced from IR, UV-vis, (1)H NMR and thermal studies. The binding ratio of complexation (MZ: acceptor) was determined to be 1:2 for the iodine acceptor and 1:1 for the DDQ, CHL or PA acceptor, according to the CHN elemental analyses and spectrophotometric titrations. It has been found that the complexation with CHL and PA acceptors increases the values of enthalpy and entropy, while the complexation with DDQ and iodine acceptors decreases the values of these parameters compared with the free MZ donor. PMID:25677533

  18. Spectral, thermal and kinetic studies of charge-transfer complexes formed between the highly effective antibiotic drug metronidazole and two types of acceptors: σ- and π-acceptors

    NASA Astrophysics Data System (ADS)

    Refat, Moamen S.; Saad, Hosam A.; Adam, Abdel Majid A.

    2015-04-01

    Understanding the interaction between drugs and small inorganic or organic molecules is critical in being able to interpret the drug-receptor interactions and acting mechanism of these drugs. A combined solution and solid state study was performed to describe the complexation chemistry of drug metronidazole (MZ) which has a broad-spectrum antibacterial activity with two types of acceptors. The acceptors include, σ-acceptor (i.e., iodine) and π-acceptors (i.e., dichlorodicyanobenzoquinone (DDQ), chloranil (CHL) and picric acid (PA)). The molecular structure, spectroscopic characteristics, the binding modes as well as the thermal stability were deduced from IR, UV-vis, 1H NMR and thermal studies. The binding ratio of complexation (MZ: acceptor) was determined to be 1:2 for the iodine acceptor and 1:1 for the DDQ, CHL or PA acceptor, according to the CHN elemental analyses and spectrophotometric titrations. It has been found that the complexation with CHL and PA acceptors increases the values of enthalpy and entropy, while the complexation with DDQ and iodine acceptors decreases the values of these parameters compared with the free MZ donor.

  19. Glucose-6-phosphate isomerase.

    PubMed

    Achari, A; Marshall, S E; Muirhead, H; Palmieri, R H; Noltmann, E A

    1981-06-26

    Glucose-6-phosphate isomerase (EC 5.3.1.9) is a dimeric enzyme of molecular mass 132000 which catalyses the interconversion of D-glucose-6-phosphate and D-fructose-6-phosphate. The crystal structure of the enzyme from pig muscle has been determined at a nominal resolution of 2.6 A. The structure is of the alpha/beta type. Each subunit consists of two domains and the active site is in both the domain interface and the subunit interface (P.J. Shaw & H. Muirhead (1976), FEBS Lett. 65, 50-55). Each subunit contains 13 methionine residues so that cyanogen bromide cleavage will produce 14 fragments, most of which have been identified and at least partly purified. Sequence information is given for about one-third of the molecule from 5 cyanogen bromide fragments. One of the sequences includes a modified lysine residue. Modification of this residue leads to a parallel loss of enzymatic activity. A tentative fit of two of the peptides to the electron density map has been made. It seems possible that glucose-6-phosphate isomerase, triose phosphate isomerase and pyruvate kinase all contain a histidine and a glutamate residue at the active site. PMID:6115414

  20. Development of an rRNA-targeted oligonucleotide probe specific for the genus Acinetobacter and its application for in situ monitoring in activated sludge.

    PubMed Central

    Wagner, M; Erhart, R; Manz, W; Amann, R; Lemmer, H; Wedi, D; Schleifer, K H

    1994-01-01

    Enhanced biological phosphate removal in an anaerobic-aerobic activated sludge system has generally been ascribed to members of the genus Acinetobacter. A genus-specific 16S rRNA-targeted oligonucleotide probe was developed to investigate the role of Acinetobacter spp. in situ. Nonisotopic dot blot hybridization to 66 reference strains, including the seven described Acinetobacter spp., demonstrated the expected probe specificity. Fluorescent derivatives were used for in situ monitoring of Acinetobacter spp. in the anaerobic and aerobic compartments of a sewage treatment plant with enhanced biological phosphate removal. Microbial community structures were further analyzed with oligonucleotide probes specific for the alpha, beta, or gamma subclasses of the class Proteobacteria, for the Cytophaga-Flavobacterium cluster, for gram-positive bacteria with a high G + C DNA content, and for all bacteria. Total cell counts were determined by 4',6-diamidino-2-phenylindole staining. In both the anaerobic and the aerobic basins, the activated sludge samples were dominated by members of the class Proteobacteria belonging to the beta subclass and by gram-positive bacteria with a high G + C DNA content. Acinetobacter spp. constituted less than 10% of all bacteria. For both basins, the microbial community structures determined with molecular techniques were compared with the compositions of the heterotrophic saprophytic microbiota determined with agar plating techniques. Isolates on nutrient-rich medium were classified by whole-cell hybridization with rRNA-targeted probes and fatty acid analysis.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:7512807

  1. Method for producing and regenerating a synthetic CO[sub 2] acceptor

    DOEpatents

    Lancet, M. S.; Curran, G. P.; Gorin, E.

    1982-05-18

    A method is described for producing a synthetic CO[sub 2] acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO[sub 2] acceptor and recovering the pellets of synthetic CO[sub 2] acceptor from the fluidized bed. Optionally, spent synthetic CO[sub 2] acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO[sub 2] acceptor. 1 fig.

  2. Method for producing and regenerating a synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S [Pittsburgh, PA; Curran, George P [Pittsburgh, PA; Gorin, Everett [San Rafael, CA

    1982-01-01

    A method for producing a synthetic CO.sub.2 acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO.sub.2 acceptor and recovering the pellets of synthetic CO.sub.2 acceptor from the fluidized bed. Optionally, spent synthetic CO.sub.2 acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO.sub.2 acceptor.

  3. Dynamics of iron-acceptor-pair formation in co-doped silicon

    SciTech Connect

    Bartel, T.; Gibaja, F.; Graf, O.; Gross, D.; Kaes, M.; Heuer, M.; Kirscht, F.; Möller, C.; Lauer, K.

    2013-11-11

    The pairing dynamics of interstitial iron and dopants in silicon co-doped with phosphorous and several acceptor types are presented. The classical picture of iron-acceptor pairing dynamics is expanded to include the thermalization of iron between different dopants. The thermalization is quantitatively described using Boltzmann statistics and different iron-acceptor binding energies. The proper understanding of the pairing dynamics of iron in co-doped silicon will provide additional information on the electronic properties of iron-acceptor pairs and may become an analytical method to quantify and differentiate acceptors in co-doped silicon.

  4. Phosphate Mines, Jordan

    NASA Technical Reports Server (NTRS)

    2008-01-01

    Jordan's leading industry and export commodities are phosphate and potash, ranked in the top three in the world. These are used to make fertilizer. The Jordan Phosphate Mines Company is the sole producer, having started operations in 1935. In addition to mining activities, the company produces phosphoric acid (for fertilizers, detergents, pharmaceuticals), diammonium phosphate (for fertilizer), sulphuric acid (many uses), and aluminum fluoride (a catalyst to make aluminum and magnesium).

    The image covers an area of 27.5 x 49.4 km, was acquired on September 17, 2005, and is located near 30.8 degrees north latitude, 36.1 degrees east longitude.

    The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

  5. Fundamentals of phosphate transfer.

    PubMed

    Kirby, Anthony J; Nome, Faruk

    2015-07-21

    Historically, the chemistry of phosphate transfer-a class of reactions fundamental to the chemistry of Life-has been discussed almost exclusively in terms of the nucleophile and the leaving group. Reactivity always depends significantly on both factors; but recent results for reactions of phosphate triesters have shown that it can also depend strongly on the nature of the nonleaving or "spectator" groups. The extreme stabilities of fully ionised mono- and dialkyl phosphate esters can be seen as extensions of the same effect, with one or two triester OR groups replaced by O(-). Our chosen lead reaction is hydrolysis-phosphate transfer to water: because water is the medium in which biological chemistry takes place; because the half-life of a system in water is an accepted basic index of stability; and because the typical mechanisms of hydrolysis, with solvent H2O providing specific molecules to act as nucleophiles and as general acids or bases, are models for reactions involving better nucleophiles and stronger general species catalysts. Not least those available in enzyme active sites. Alkyl monoester dianions compete with alkyl diester monoanions for the slowest estimated rates of spontaneous hydrolysis. High stability at physiological pH is a vital factor in the biological roles of organic phosphates, but a significant limitation for experimental investigations. Almost all kinetic measurements of phosphate transfer reactions involving mono- and diesters have been followed by UV-visible spectroscopy using activated systems, conveniently compounds with good leaving groups. (A "good leaving group" OR* is electron-withdrawing, and can be displaced to generate an anion R*O(-) in water near pH 7.) Reactivities at normal temperatures of P-O-alkyl derivatives-better models for typical biological substrates-have typically had to be estimated: by extended extrapolation from linear free energy relationships, or from rate measurements at high temperatures. Calculation is free

  6. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  7. Flexibility of C3h -Symmetrical Linkers in Tris-oligonucleotide-Based Tetrahedral Scaffolds.

    PubMed

    Panagiotidis, Christos; Kath-Schorr, Stephanie; von Kiedrowski, Günter

    2016-02-01

    Flexibility of tris-oligonucleotides is determined by the length of their connecting hydrocarbon chains. Tris-oligonucleotides are branched DNA building blocks with three oligonucleotide arms attached to a C3h -symmetrical linker core at these chains. Four tris-oligonucleotides hybridise into a tetrahedral nanocage by sequence-determined self-assembly. The influence of methylene, ethylene and propylene chains was studied by synthesising sets of tris-oligonucleotides and analysing the relative stability of the hybridisation products against digestion by mung bean nuclease by using gel electrophoresis. Linkers with ethylene chains showed sufficient flexibility, whereas methylene-chain linkers were too rigid. Tris-oligonucleotides based on the latter still formed tetrahedral scaffolds in intermixing experiments with linkers of higher flexibility. Thus, a new generation of versatile isocyanurate-based linkers was established. PMID:26593127

  8. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    NASA Astrophysics Data System (ADS)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  9. Nanoparticle-bridge assay for amplification-free electrical detection of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Teimouri, Manouchehr

    The aim of this research is to investigate a highly sensitive, fast, inexpensive, and field-applicable amplification-free nanoparticle-based oligonucleotide detection method which does not rely on any enzymatic or signal amplification process. In this approach, target oligonucleotide strands are detected through the formation of nanoparticle satellites which make an electrical path between two electrodes. This method enables an extremely sensitive oligonucleotide detection because even a few oligonucleotide strands can form a single nanoparticle satellite which can solely generates an electrical output signal. Results showed that this oligonucleotide detection method can detect oligonucleotide single strands at concentrations as low as 50 femtomolar without any amplification process. This detection method can be implemented in many fields such as biodefense, food safety, clinical research, and forensics.

  10. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    NASA Astrophysics Data System (ADS)

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-11-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes.

  11. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries.

    PubMed

    Schmidt, Thorsten L; Beliveau, Brian J; Uca, Yavuz O; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  12. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore.

    PubMed

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I. PMID:27111839

  13. Lithium related deep and shallow acceptors in Li-doped ZnO nanocrystals

    NASA Astrophysics Data System (ADS)

    Rauch, C.; Gehlhoff, W.; Wagner, M. R.; Malguth, E.; Callsen, G.; Kirste, R.; Salameh, B.; Hoffmann, A.; Polarz, S.; Aksu, Y.; Driess, M.

    2010-01-01

    We study the existence of Li-related shallow and deep acceptor levels in Li-doped ZnO nanocrystals using electron paramagnetic resonance (EPR) and photoluminescence (PL) spectroscopy. ZnO nanocrystals with adjustable Li concentrations between 0% and 12% have been prepared using organometallic precursors and show a significant lowering of the Fermi energy upon doping. The deep Li acceptor with an acceptor energy of 800 meV could be identified in both EPR and PL measurements and is responsible for the yellow luminescence at 2.2 eV. Additionally, a shallow acceptor state at 150 meV above the valence band maximum is made responsible for the observed donor-acceptor pair and free electron-acceptor transitions at 3.235 and 3.301 eV, possibly stemming from the formation of Li-related defect complexes acting as acceptors.

  14. Electron-Donor-Acceptor (EDA) Complexes Of Aromatic Hydrocarbons With Organic Acceptors In Solution And In The Solid State. A Quantitative FT-IR Investigation.

    NASA Astrophysics Data System (ADS)

    Bruni, Paolo; Giorgini, Elisabetta; Tosi, Giorgio; Zampini, Angela

    1989-12-01

    Liquid phase FT-IR investigation on π-π Electron-Donor-Acceptor (EDA) complexes between arenes and organic acceptors leads to values of formation constants that are in good agreement with the ones from other techniques (UV-Vis and NMR). In addition solid state FT-IR and UV-Vis determinations on the complexes are also reported and discussed.

  15. MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

    PubMed

    Chen, Wei-Yu; Chen, Yu-Chie

    2007-11-01

    The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol. PMID:17902633

  16. Direct measurement of oligonucleotide binding stoichiometry of gene V protein by mass spectrometry.

    PubMed Central

    Cheng, X; Harms, A C; Goudreau, P N; Terwilliger, T C; Smith, R D

    1996-01-01

    The binding stoichiometry of gene V protein from bacteriophage f1 to several oligonucleotides was studied using electrospray ionization-mass spectrometry (ESI-MS). Using mild mass spectrometer interface conditions that preserve noncovalent associations in solution, gene V protein was observed as dimer ions from a 10 mM NH4OAc solution. Addition of oligonucleotides resulted in formation of protein-oligonucleotide complexes with stoichiometry of approximately four nucleotides (nt) per protein monomer. A 16-mer oligonucleotide gave predominantly a 4:1 (protein monomer: oligonucleotide) complex while oligonucleotides shorter than 15 nt showed stoichiometries of 2:1. Stoichiometries and relative binding constants for a mixture of oligonucleotides were readily measured using mass spectrometry. The binding stoichiometry of the protein with the 16-mer oligonucleotide was measured independently using size-exclusion chromatography and the results were consistent with the mass spectrometric data. These results demonstrate, for the first time, the observation and stoichiometric measurement of protein-oligonucleotide complexes using ESI-MS. The sensitivity and high resolution of ESI-MS should make it a useful too] in the study of protein-DNA interactions. PMID:8692937

  17. 2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

    SciTech Connect

    Prakash, T.P.; Puschl, A.; Lesnik, E.; Mohan, V.; Tereshko, V.; Egli, M.; Manoharan, M.

    2010-03-08

    Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA ({Delta}T{sub m} 3.2 C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 {angstrom} resolution.

  18. Chemopreventive Agents from Physalis minima Function as Michael Reaction Acceptors

    PubMed Central

    Men, Ruizhi; Li, Ning; Ding, Chihong; Tang, Yingzhan; Xing, Yachao; Ding, Wanjing; Ma, Zhongjun

    2016-01-01

    Background: The fruits of some varieties of genus Physalis have been used as delicious fruits and functional food in the Northeast of China. Materials and Methods: To reveal the functional material basis, we performed bioactivity-guided phytochemical research and chemopreventive effect assay of the constituents from Physalis minima. Results: It was demonstrated that the ethyl acetate extract of P. minima L. (EEPM) had potential quinone reductase (QR) inducing activity with induction ratio (IR, QR induction activity) value of 1.47 ± 0.24, and glutathione binding property as potential Michael reaction acceptors (with an α, β-unsaturated ketone moiety). Furthermore, bioactivity-guided phytochemical research led eight compounds (1–8), which were elucidated as 3-isopropyl-5-acetoxycyclohexene-2-one-1 (1), isophysalin B (2), physalin G (3), physalin D (4), physalin I (5), physordinose B (6), stigmasterol-3-O-β-D-glucopyranoside (7) and 5α-6β-dihydroxyphysalin R (8) on the basis of nuclear magnetic resonance spectroscopy analyses and HRESIMS. Then, isophysalin B (2) and physordinose B (6) showed significant QR inducing activity with IR value of 2.80 ± 0.19 and 2.38 ± 0.46, respectively. SUMMARY An ultra-performance liquid chromatographic method with glutathione as the substrate was used to detect the Michael reaction acceptors in extracts of Physalis minima (EPM)We investigated the chemical constituents of EPM guided by biological activity methodIsophysalin B (1) and physordinose B (6) showed strong quinone reductase inducing activity with induction ratio values of 2.80 ± 0.19 and 2.38 ± 0.46This study generated useful information for consumers and many encourage researchers to utilize edible fruits from Physalis as a source of phytochemicals Abbreviations used: EPM: Extracts of Physalis minima, EEPM: Ethyl acetate extract of Physalis minima L., GSH: Glutathione, MRAs: Michael reaction acceptors, QR: Quinone reductase. PMID:27279713

  19. Nanostructured donor-acceptor self assembly with improved photoconductivity.

    PubMed

    Saibal, B; Ashar, A Z; Devi, R Nandini; Narayan, K S; Asha, S K

    2014-11-12

    Nanostructured supramolecular donor-acceptor assemblies were formed when an unsymmetrical N-substituted pyridine functionalized perylenebisimide (UPBI-Py) was complexed with oligo(p-phenylenevinylene) (OPVM-OH) complementarily functionalized with hydroxyl unit and polymerizable methacrylamide unit at the two termini. The resulting supramolecular complex [UPBI-Py (OPVM-OH)]1.0 upon polymerization by irradiation in the presence of photoinitiator formed well-defined supramolecular polymeric nanostructures. Self-assembly studies using fluorescence emission from thin film samples showed that subtle structural changes occurred on the OPV donor moiety following polymerization. The 1:1 supramolecular complex showed red-shifted aggregate emission from both OPV (∼500 nm) and PBI (∼640 nm) units, whereas the OPV aggregate emission was replaced by intense monomeric emission (∼430 nm) upon polymerizing the methacrylamide units on the OPVM-OH. The bulk structure was studied using wide-angle X-ray diffraction (WXRD). Complex formation resulted in distinct changes in the cell parameters of OPVM-OH. In contrast, a physical mixture of 1 mol each of OPVM-OH and UPBI-Py prepared by mixing the powdered solid samples together showed only a combination of reflections from both parent molecules. Thin film morphology of the 1:1 molecular complex as well as the supramolecular polymer complex showed uniform lamellar structures in the domain range <10 nm. The donor-acceptor supramolecular complex [UPBI-Py (OPVM-OH)]1.0 exhibited space charge limited current (SCLC) with a bulk mobility estimate of an order of magnitude higher accompanied by a higher photoconductivity yield compared to the pristine UPBI-Py. This is a very versatile method to obtain spatially defined organization of n and p-type semiconductor materials based on suitably functionalized donor and acceptor molecules resulting in improved photocurrent response using self-assembly. PMID:25283356

  20. Carbon and group II acceptor coimplantation in GaAs

    SciTech Connect

    Morton, R.; Lau, S.S.; Poker, D.B.; Chu, P.K.; Fung, K.K.; Wang, N.

    1998-11-01

    Coimplantations of carbon and one of the group II acceptors, Mg, Zn, or Cd, were performed and compared to implantations involving only a single element (Mg, Zn, or Cd) or Ga and C coimplanted into GaAs substrates. The group II and C (II/C) coimplantations act to balance the crystal stoichiometry since group II atoms prefer to reside in the Ga sublattice and C prefers to reside in the As sublattice. The electrical characteristics of the various implantations were obtained from sheet and differential Hall measurements. Rutherford backscattering spectrometry was employed to determine the amount of implantation-induced damage which was then correlated to the amount of C activation in the group II/C coimplanted samples. It was found that coimplantation of the heavier group II acceptors, Zn and Cd, resulted in layers with larger peak hole concentrations. This is a result of the large amount of lattice damage created by these elements which is thought to provide the necessary abundance of As vacancies for C activation. Secondary ion mass spectroscopy measurements of the samples after implant activation indicate that C coimplantation significantly reduces the diffusivity of the group II acceptors. Cross-sectional transmission electron microscopy indicated a unique defect structure (extrinsic dislocation loops) for the cases of group II/C coimplantation. These dislocation loops are located at the diffusion front of the group II element in the samples and therefore have a rather profound influence on the diffusion of the group II elements. A rationalization of the defect structure and the effect it has on the diffusion of group II elements is given. {copyright} {ital 1998 American Institute of Physics.}

  1. Assembly and Comparison of Plasma Membrane SNARE Acceptor Complexes.

    PubMed

    Kreutzberger, Alex J B; Liang, Binyong; Kiessling, Volker; Tamm, Lukas K

    2016-05-24

    Neuronal exocytotic membrane fusion occurs on a fast timescale and is dependent on interactions between the vesicle SNARE synaptobrevin-2 and the plasma membrane SNAREs syntaxin-1a and SNAP-25 with a 1:1:1 stoichiometry. Reproducing fast fusion rates as observed in cells by reconstitution in vitro has been hindered by the spontaneous assembly of a 2:1 syntaxin-1a:SNAP-25 complex on target membranes that kinetically alters the binding of synaptobrevin-2. Previously, an artificial SNARE acceptor complex consisting of 1:1:1 syntaxin-1a(residues 183-288):SNAP-25:syb(residues 49-96) was found to greatly accelerate the rates of lipid mixing of reconstituted target and vesicle SNARE proteoliposomes. Here we present two (to our knowledge) new procedures to assemble membrane-bound 1:1 SNARE acceptor complexes that produce fast and efficient fusion without the need of the syb(49-96) peptide. In the first procedure, syntaxin-1a is purified in a strictly monomeric form and subsequently assembled with SNAP-25 in detergent with the correct 1:1 stoichiometry. In the second procedure, monomeric syntaxin-1a and dodecylated (d-)SNAP-25 are separately reconstituted into proteoliposomes and subsequently assembled in the plane of merged target lipid bilayers. Examining single particle fusion between synaptobrevin-2 proteoliposomes and planar-supported bilayers containing the two different SNARE acceptor complexes revealed similar fast rates of fusion. Changing the stoichiometry of syntaxin-1a and d-SNAP-25 in the target bilayer had significant effects on docking, but little effect on the rates of synaptobrevin-2 proteoliposome fusion. PMID:27178662

  2. Prodrugs of phosphonates and phosphates: crossing the membrane barrier

    PubMed Central

    Wiemer, Andrew J.; Wiemer, David F.

    2016-01-01

    A substantial portion of metabolism involves transformation of phosphate esters, including pathways leading to nucleotides and oligonucleotides, carbohydrates, isoprenoids and steroids, and phosphorylated proteins. Because the natural substrates bear one or more negative charges, drugs that target these enzymes generally must be charged as well but small charged molecules can have difficulty traversing the cell membrane other than by endocytosis. The resulting dichotomy has stimulated abundant effort to develop effective prodrugs, compounds that carry little or no charge to enable them to transit biological membranes but then able to release the parent drug once inside the target cell. This chapter will present recent studies on advances in prodrug forms, along with representative examples of their application to marketed and developmental drugs. PMID:25391982

  3. Human glucose phosphate isomerase: Exon mapping and gene structure

    SciTech Connect

    Xu, Weiming; Lee, Pauline; Beutler, E.

    1995-10-10

    The structure of the gene for human glucose phosphate isomerase (GPI) has been determined. Three GPI clones were isolated from a human genomic library by using a full-length GPI cDNA probe and were characterized. Oligonucleotides based on the known cDNA sequence were used as primers in amplification and sequence analyses. This led to the identification of the exon-intron junctions. By this approach, 18 exons and 17 introns have been identified. The exons range in size from 44 to 431 nucleotides. The intronic sequences surrounding the exons provide useful information for the identification of mutations that give rise to human GPI deficiency associated with chronic hemolytic anemia. 13 refs., 4 figs., 1 tab.

  4. Unraveling the Photoswitching Mechanism in Donor-Acceptor Stenhouse Adducts.

    PubMed

    Lerch, Michael M; Wezenberg, Sander J; Szymanski, Wiktor; Feringa, Ben L

    2016-05-25

    Molecular photoswitches have opened up a myriad of opportunities in applications ranging from responsive materials and control of biological function to molecular logics. Here, we show that the photoswitching mechanism of donor-acceptor Stenhouse adducts (DASA), a recently reported class of photoswitches, proceeds by photoinduced Z-E isomerization, followed by a thermal, conrotatory 4π-electrocyclization. The photogenerated intermediate is manifested by a bathochromically shifted band in the visible absorption spectrum of the DASA. The identification of the role of this intermediate reveals a key step in the photoswitching mechanism that is essential to the rational design of switching properties via structural modification. PMID:27152878

  5. Incorporation of Cu Acceptors in ZnO Nanocrystals

    SciTech Connect

    Oo, W.M.H.; Mccluskey, Matthew D.; Huso, Jesse; Morrison, J.; Bergman, Leah; Engelhard, Mark H.; Saraf, Laxmikant V.

    2010-09-16

    Doping of semiconductor nanocrystals is an important problem in nanomaterials research. Using infrared (IR) and x-ray photoelectron spectroscopy (XPS), we have observed Cu acceptor dopants that were intentionally introduced into ZnO nanocrystals. The incorporation of Cu2+ dopants increased as the diameter of the nanocrystals was increased from ~3 to 5 nm. Etching the nanocrystals with acetic acid revealed a core-shell structure, where a 2-nm lightly doped core is surrounded by a heavily doped shell. These observations are consistent with the trapped dopant model, in which dopant atoms stick to the surface of the core and are overgrown by the nanocrystal material.

  6. Molecular Crowding Effects on Microgel-Tethered Oligonucleotide Probes.

    PubMed

    Ma, Youlong; Libera, Matthew

    2016-06-28

    Microgel tethering is a nontraditional method with which to bind oligonucleotide hybridization probes to a solid surface. Microgel-tethering physically positions the probes away from the underlying hard substrate and maintains them in a highly waterlike environment. This paper addresses the question of whether molecular crowding affects the performance of microgel-tethered molecular beacon probes. The density of probe-tethering sites is controlled experimentally using thin-film blends of biotin-terminated [PEG-B] and hydroxyl-terminated [PEG-OH] poly(ethylene glycol) from which microgels are synthesized and patterned by electron beam lithography. Fluorescence measurements indicate that the number of streptavidins, linear DNA probes, hairpin probes, and molecular beacon probes bound to the microgels increases linearly with increasing PEG-B/PEG-OH ratio. For a given tethering-site concentration, more linear probes can bind than structured probes. Crowding effects emerge during the hybridization of microgel-tethered molecular beacons but not during the hybridization of linear probes, as the tethering density increases. Crowding during hybridization is associated with conformational constraints imposed by the close proximity of closed and hybridized structured probes. The signal-to-background ratio (SBR) of hybridized beacons is highest and roughly constant for low tethering densities and decreases at the highest tethering densities. Despite differences between microgel tethering and traditional oligonucleotide surface-immobilization approaches, these results show that crowding defines an optimum tethering density for molecular beacon probes that is less than the maximum possible, which is consistent with previous studies involving various linear and structured oligonucleotide probes. PMID:27253904

  7. Repair of DNA lesions associated with triplex-forming oligonucleotides.

    PubMed

    Chin, Joanna Y; Glazer, Peter M

    2009-04-01

    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision repair pathway. This review examines the evidence for DNA repair of triplex-associated lesions. PMID:19072762

  8. Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

    PubMed Central

    Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei

    2002-01-01

    A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

  9. A convenient and efficient purification method for chemically labeled oligonucleotides.

    PubMed

    Hwang, Jihee; Kang, Junhee; Kim, Seong Keun; Kim, Younggyu

    2013-05-01

    We developed an efficient, cost-effective, and rapid purification method for chemically-labeled oligonucleotides that requires less time than conventional procedures such as ethanol precipitation or size-exclusion chromatography. Based on the hydrophilic and hydrophobic properties of DNA and amine-reactive fluorophores, we show that n-butanol saturated with distilled water may be used to remove unreacted fluorophores by sequestering them in the organic phase, while labeled DNA remains in the aqueous phase. This phase extraction method is simple, fast, and allows for processing multiple samples simultaneously, a necessity for high-throughput labeling strategies. PMID:23662899

  10. On the rapid deprotection of synthetic oligonucleotides and analogs.

    PubMed Central

    Polushin, N N; Morocho, A M; Chen, B C; Cohen, J S

    1994-01-01

    The efficiency of oligodeoxynucleotide deprotection is greatly enhanced using a combination of: (a) ethanolamine, and especially a mixture of hydrazine, ethanolamine and methanol, in place of the usual aqueous ammonia; (b) tert-butylphenoxyacetyl amino protecting groups, and (c) oxalyl link between the first nucleotide and the polymeric support. The extent of base modification, particularly of C, is shown to be extremely low, and the quality of deprotected oligonucleotides is as high as in the case of ammonia deprotection. This method is also shown to be applicable to the preparation of phosphorothioate and methylphosphonate oligodeoxynucleotides and oligoribonucleotides. Images PMID:8127712

  11. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  12. Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides

    DOEpatents

    Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.

    2003-04-15

    A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

  13. Oligonucleotide microarray for subtyping of influenza A viruses

    NASA Astrophysics Data System (ADS)

    Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.

    2012-02-01

    Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

  14. Nicotinamide Adenine Dinucleotide Phosphate-Dependent Formate Dehydrogenase from Clostridium thermoaceticum: Purification and Properties

    PubMed Central

    Andreesen, Jan R.; Ljungdahl, Lars G.

    1974-01-01

    The nicotinamide adenine dinucleotide phosphate (NADP)-dependent formate dehydrogenase in Clostridium thermoaceticum used, in addition to its natural electron acceptor, methyl and benzyl viologen. The enzyme was purified to a specific activity of 34 (micromoles per minute per milligram of protein) with NADP as electron acceptor. Disc gel electrophoresis of the purified enzyme yielded two major and two minor protein bands, and during centrifugation in sucrose gradients two components of apparent molecular weights of 270,000 and 320,000 were obtained, both having formate dehydrogenase activity. The enzyme preparation catalyzed the reduction of riboflavine 5′-phosphate flavine adenine dinucleotide and methyl viologen by using reduced NADP as a source of electrons. It also had reduced NADP oxidase activity. The enzyme was strongly inhibited by cyanide and ethylenediaminetetraacetic acid. It was also inhibited by hypophosphite, an inhibition that was reversed by formate. Sulfite inhibited the activity with NADP but not with methyl viologen as acceptor. The apparent Km at 55 C and pH 7.5 for formate was 2.27 × 10−4 M with NADP and 0.83 × 10−4 with methyl viologen as acceptor. The apparent Km for NADP was 1.09 × 10−4 M and for methyl viologen was 2.35 × 10−3 M. NADP showed substrate inhibition at 5 × 10−3 M and higher concentrations. With NADP as electron acceptor, the enzyme had a broad pH optimum between 7 and 9.5. The apparent temperature optimum was 85 C. In the absence of substrates, the enzyme was stable at 70 C but was rapidly inactivated at temperatures above 73 C. The enzyme was very sensitive to oxygen but was stabilized by thiol-iron complexes and formate. PMID:4154039

  15. Tuning of Stepwise Neutral-Ionic Transitions by Acceptor Site Doping in Alternating Donor/Acceptor Chains.

    PubMed

    Nakabayashi, Keita; Nishio, Masaki; Miyasaka, Hitoshi

    2016-03-01

    The stepwise neutral-ionic (N-I) phase transition found in the alternating donor/acceptor (DA) chain [Ru2(2,3,5,6-F4PhCO2)4(DMDCNQI)]·2(p-xylene) (0; 2,3,5,6-F4PhCO2(-) = 2,3,5,6-tetrafluorobenzoate; DMDCNQI = 2,5-dimethyl-N,N'-dicyanoquinonediimine) was tuned by partly substituting the acceptor DMDCNQI with 2,5-dimethoxy-N,N'-dicyanoquinonediimine (DMeODCNQI), which displays a poorer electron affinity in an isostructural series. The site-doped series comprised [Ru2(2,3,5,6-F4PhCO2)4(DMDCNQI)1-x(DMeODCNQI)x]·2(p-xylene) for doping rates (x) = 0.05 (0.05-MeO), 0.10 (0.10-MeO), 0.15 (0.15-MeO), and 0.20 (0.20-MeO). The neutral chain [Ru2(2,3,5,6-F4PhCO2)4(DMeODCNQI)]·4(p-xylene) (1), which only contained DMeODCNQI, was also characterized. All site-doped compounds were isostructural to 0 except 1 despite their identical DA chain motif. Except at an x value of 0.20, they displayed a two-step N-I transition involving an intermediate phase. This transition occurred at high temperatures in 0 but shifted to lower temperatures in a parallel manner with increasing doping rate. Simultaneously, each transition broadened with increasing doping rate, leading to a convergence of two transitions at an x value approximating 0.2. Donor/acceptor-site-doping techniques present somewhat different impacts in terms of interchain Coulomb effects. PMID:26878151

  16. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Magnesium phosphate. 184.1434 Section 184.1434 Food... Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate, dibasic...

  17. Glycosylation of closely spaced acceptor sites in human glycoproteins

    PubMed Central

    Shrimal, Shiteshu; Gilmore, Reid

    2013-01-01

    Summary Asparagine-linked glycosylation of proteins by the oligosaccharyltransferase (OST) occurs when acceptor sites or sequons (N-x≠P-T/S) on nascent polypeptides enter the lumen of the rough endoplasmic reticulum. Metazoan organisms assemble two isoforms of the OST that have different catalytic subunits (STT3A or STT3B) and partially non-overlapping cellular roles. Potential glycosylation sites move past the STT3A complex, which is associated with the translocation channel, at the protein synthesis elongation rate. Here, we investigated whether close spacing between acceptor sites in a nascent protein promotes site skipping by the STT3A complex. Biosynthetic analysis of four human glycoproteins revealed that closely spaced sites are efficiently glycosylated by an STT3B-independent process unless the sequons contain non-optimal sequence features, including extreme close spacing between sequons (e.g. NxTNxT) or the presence of paired NxS sequons (e.g. NxSANxS). Many, but not all, glycosylation sites that are skipped by the STT3A complex can be glycosylated by the STT3B complex. Analysis of a murine glycoprotein database revealed that closely spaced sequons are surprisingly common, and are enriched for paired NxT sites when the gap between sequons is less than three residues. PMID:24105266

  18. Donor and acceptor concentrations in degenerate InN

    SciTech Connect

    Look, D.C.; Lu, H.; Schaff, W.J.; Jasinski, J.; Liliental-Weber, Z.

    2002-01-28

    A formalism is presented to determine donor (N{sub D}) and acceptor (N{sub A}) concentrations in wurtzitic InN characterized by degenerate carrier concentration (n) and mobility ({mu}). The theory includes scattering not only by charged point defects and impurities, but also by charged threading dislocations, of concentration N{sub dis}. For an 0.45-{micro}m-thick InN layer grown on Al{sub 2}O{sub 3} by molecular beam epitaxy, having N{sub dis} = 5 x 10{sup 10} cm{sup -2}, determined by transmission electron microscopy, n(20 K) = 3.5 x 10{sup 18} cm{sup -3}, and {mu}(20 K) = 1055 cm{sup 2}/V-s, determined by Hall-effect measurements, the fitted values are N{sub D} = 4.7 x 10{sup 18} cm{sup -3} and N{sub A} = 1.2 x 10{sup 18} cm{sup -3}. The identities of the donors and acceptors are not known, although a comparison of N{sub D} with analytical data, and also with calculations of defect formation energies, suggests that a potential candidate for the dominant donor is H.

  19. Nitrite and nitrate as electron acceptors for biological sulphide oxidation.

    PubMed

    Munz, G; Mannucci, A; Arreola-Vargas, J; Alatriste-Mondragon, F; Giaccherini, F; Mori, G

    2015-01-01

    Autotrophic denitrification with sulphide using nitrate (R1) and nitrite (R2) as electron acceptor was investigated at bench scale. Different solids retention times (SRT) (5 and 20 d) have been tested in R1 while R2 was operated at SRT=13 d. The results indicated that the process allows complete sulphide removal to be achieved in all tested conditions. Tested sulphide loads were estimated from the H2S produced in a pilot-scale anaerobic digester treating vegetable tannery primary sludge; nitrogen loads originated from the nitrification of the supernatant. Average nitrogen removal efficiencies higher than 80% were observed in all the tested conditions once steady state was reached. A maximum specific nitrate removal rate equal to 0.35 g N-NO3- g VSS(-1) d(-1) was reached in R1. Due to sulphide limitation, incomplete denitrification was observed and nitrite and thiosulphate tend to accumulate especially in the presence of variable environmental conditions in both R1 and R2. Lower SRT caused higher NO2accumulated/NO3reduced ratios (0.22 and 0.24, with SRT of 5 d and 20 d, respectively) using nitrate as electron acceptor in steady-state condition. Temperature decrease caused sudden NO2accumulated/NO3reduced ratio increase in R1 and NO2- removal decrease in R2. PMID:26247758

  20. Mercury removal from waste gases by manganese oxide acceptors

    SciTech Connect

    Cavallaro, S.; Bertuccio, N.; Antonucci, P.; Giordano, N.

    1982-02-01

    Removal of mercury vapor from a waste gas has been investigated at atmospheric pressure and at ambient temperature using a series of manganese-based reagents supported on an inert medium. The effect of catalyst composition on activity and the influence of relative humidity of the air stream have been studied. Whereas ..gamma..-Al/sub 2/O/sub 3/ has a very low mercury sorption capacity, sorption occurs copiously on impregnated silver- and copper-doped MnO/sub 2/ acceptors but the much higher activity is reduced by the presence of water vapour in the carrier gas. The morphological and microstructural characterization of the (MnO/sub 2/, AgNO/sub 3/) ..gamma..-Al/sub 2/O/sub 3/ reagents has shown selective deposition of AgNO/sub 3/ particles on ..beta..-MnO/sub 2/ crystallites which are dispersed on the ..gamma..-Al/sub 2/O/sub 3/ matrix. As the adsorption is associated with a sequence of specific colour changes a chemical oxidation mechanism is proposed. Acceptor deactivation is discussed. 9 figures, 3 tables.

  1. Donor-acceptor complexation and dehydrogenation chemistry of aminoboranes.

    PubMed

    Malcolm, Adam C; Sabourin, Kyle J; McDonald, Robert; Ferguson, Michael J; Rivard, Eric

    2012-12-01

    A series of formal donor-acceptor adducts of aminoborane (H(2)BNH(2)) and its N-substituted analogues (H(2)BNRR') were prepared: LB-H(2)BNRR'(2)-BH(3) (LB = DMAP, IPr, IPrCH(2) and PCy(3); R and R' = H, Me or tBu; IPr = [(HCNDipp)(2)C:] and Dipp = 2,6-iPr(2)C(6)H(3)). To potentially access complexes of molecular boron nitride, LB-BN-LA (LA = Lewis acid), preliminary dehydrogenation chemistry involving the parent aminoborane adducts LB-H(2)BNH(2)-BH(3) was investigated using [Rh(COD)Cl](2), CuBr, and NiBr(2) as dehydrogenation catalysts. In place of isolating the intended dehydrogenated BN donor-acceptor complexes, the formation of borazine was noted as a major product. Attempts to prepare the fluoroarylborane-capped aminoborane complexes, LB-H(2)BNH(2)-B(C(6)F(5))(3), are also described. PMID:23153209

  2. Preliminary time-of-flight neutron diffraction studies of Escherichia coli ABC transport receptor phosphate-binding protein at the Protein Crystallography Station

    PubMed Central

    Sippel, K. H.; Bacik, J.; Quiocho, F. A.; Fisher, S. Z.

    2014-01-01

    Inorganic phosphate is an essential molecule for all known life. Organisms have developed many mechanisms to ensure an adequate supply, even in low-phosphate conditions. In prokaryotes phosphate transport is instigated by the phosphate-binding protein (PBP), the initial receptor for the ATP-binding cassette (ABC) phosphate transporter. In the crystal structure of the PBP–phosphate complex, the phosphate is completely desolvated and sequestered in a deep cleft and is bound by 13 hydrogen bonds: 12 to protein NH and OH donor groups and one to a carboxylate acceptor group. The carboxylate plays a key recognition role by accepting a phosphate hydrogen. PBP phosphate affinity is relatively consistent across a broad pH range, indicating the capacity to bind monobasic (H2PO4 −) and dibasic (HPO4 2−) phosphate; however, the mechanism by which it might accommodate the second hydrogen of monobasic phosphate is unclear. To answer this question, neutron diffraction studies were initiated. Large single crystals with a volume of 8 mm3 were grown and subjected to hydrogen/deuterium exchange. A 2.5 Å resolution data set was collected on the Protein Crystallography Station at the Los Alamos Neutron Science Center. Initial refinement of the neutron data shows significant nuclear density, and refinement is ongoing. This is the first report of a neutron study from this superfamily. PMID:24915101

  3. Biomediated continuous release phosphate fertilizer

    DOEpatents

    Goldstein, A.H.; Rogers, R.D.

    1999-06-15

    A composition is disclosed for providing phosphate fertilizer to the root zone of plants. The composition comprises a microorganism capable of producing and secreting a solubilization agent, a carbon source for providing raw material for the microorganism to convert into the solubilization agent, and rock phosphate ore for providing a source of insoluble phosphate that is solubilized by the solubilization agent and released as soluble phosphate. The composition is provided in a physical form, such as a granule, that retains the microorganism, carbon source, and rock phosphate ore, but permits water and soluble phosphate to diffuse into the soil. A method of using the composition for providing phosphate fertilizer to plants is also disclosed. 13 figs.

  4. Biomediated continuous release phosphate fertilizer

    SciTech Connect

    Goldstein, Alan H.; Rogers, Robert D.

    1999-01-01

    A composition is disclosed for providing phosphate fertilizer to the root zone of plants. The composition comprises a microorganism capable of producing and secreting a solubilization agent, a carbon source for providing raw material for the microorganism to convert into the solubilization agent, and rock phosphate ore for providing a source of insoluble phosphate that is solubilized by the solubilization agent and released as soluble phosphate. The composition is provided in a physical form, such as a granule, that retains the microorganism, carbon source, and rock phosphate ore, but permits water and soluble phosphate to diffuse into the soil. A method of using the composition for providing phosphate fertilizer to plants is also disclosed.

  5. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  6. DOTAP/UDCA vesicles: novel approach in oligonucleotide delivery.

    PubMed

    Ruozi, Barbara; Battini, Renata; Montanari, Monica; Mucci, Adele; Tosi, Giovanni; Forni, Flavio; Vandelli, Maria Angela

    2007-03-01

    The relatively hydrophilic bile acid, ursodeoxycholic acid (UDCA), was used as an additive to DOTAP cationic liposomes to evaluate the effect on the cellular uptake of an oligonucleotide. Nuclear magnetic resonance studies were applied to estimate the relative amount of incorporated UDCA into the lipidic bilayers. DOTAP or DOTAP-UDCA vesicles (MixVes; DOTAP/UDCA molar ratios 1:0.25, 1:0.5, 1:1, and 1:2) formed complexes with 5'-fluorescein conjugated 29-mer phosphorothioate oligonucleotides (PS-ODNs) and studied using gel electrophoresis. In addition, the complexes were tested after transfection to assess the cellular uptake and the localization of the oligo in a HaCaT cell line by the use of cytofluorimetric and confocal microscopic analysis. DOTAP lipid formulated in the presence of a defined amount of UDCA forms more stable, flexible, and active MixVes. In particular, the MixVes at 1:0.25 and 1:0.5 molar ratios increase and modify the cellular uptake of PS-ODNs if compared with DOTAP liposomes 3 hours after the transfection studies. Moreover, the in vitro data suggest that these new formulations are not toxic. PMID:17379164

  7. Multiplex pairwise assembly of array-derived DNA oligonucleotides

    PubMed Central

    Klein, Jason C.; Lajoie, Marc J.; Schwartz, Jerrod J.; Strauch, Eva-Maria; Nelson, Jorgen; Baker, David; Shendure, Jay

    2016-01-01

    While the cost of DNA sequencing has dropped by five orders of magnitude in the past decade, DNA synthesis remains expensive for many applications. Although DNA microarrays have decreased the cost of oligonucleotide synthesis, the use of array-synthesized oligos in practice is limited by short synthesis lengths, high synthesis error rates, low yield and the challenges of assembling long constructs from complex pools. Toward addressing these issues, we developed a protocol for multiplex pairwise assembly of oligos from array-synthesized oligonucleotide pools. To evaluate the method, we attempted to assemble up to 2271 targets ranging in length from 192–252 bases using pairs of array-synthesized oligos. Within sets of complexity ranging from 131–250 targets, we observed error-free assemblies for 90.5% of all targets. When all 2271 targets were assembled in one reaction, we observed error-free constructs for 70.6%. While the assembly method intrinsically increased accuracy to a small degree, we further increased accuracy by using a high throughput ‘Dial-Out PCR’ protocol, which combines Illumina sequencing with an in-house set of unique PCR tags to selectively amplify perfect assemblies from complex synthetic pools. This approach has broad applicability to DNA assembly and high-throughput functional screens. PMID:26553805

  8. Dendritic nanoconjugates for intracellular delivery of neutral oligonucleotides

    NASA Astrophysics Data System (ADS)

    Ming, Xin; Wu, Lin; Carver, Kyle; Yuan, Ahu; Min, Yuanzeng

    2015-07-01

    Dendrimer-based gene delivery has been constrained by intrinsic toxicity and suboptimal nanostructure. Conjugation of neutral morpholino oligonucleotides (ONs) with PAMAM dendrimers resulted in neutral, uniform, and ultra-small (~10 nm) nanoconjugates. The nanoconjugates dramatically enhanced cellular delivery of the ONs in cancer cells. After release from the dendrimer in the cytosol, the ONs produced potent functional activity without causing significant cytotoxicity. When carrying an apoptosis-promoting ON, the nanoconjugates produced cancer cell killing directly. Thus, the dendritic nanoconjugates may provide an effective tool for delivering ONs to tumors and other diseased tissues.Dendrimer-based gene delivery has been constrained by intrinsic toxicity and suboptimal nanostructure. Conjugation of neutral morpholino oligonucleotides (ONs) with PAMAM dendrimers resulted in neutral, uniform, and ultra-small (~10 nm) nanoconjugates. The nanoconjugates dramatically enhanced cellular delivery of the ONs in cancer cells. After release from the dendrimer in the cytosol, the ONs produced potent functional activity without causing significant cytotoxicity. When carrying an apoptosis-promoting ON, the nanoconjugates produced cancer cell killing directly. Thus, the dendritic nanoconjugates may provide an effective tool for delivering ONs to tumors and other diseased tissues. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01665g

  9. In vivo delivery of transcription factors with multifunctional oligonucleotides

    NASA Astrophysics Data System (ADS)

    Lee, Kunwoo; Rafi, Mohammad; Wang, Xiaojian; Aran, Kiana; Feng, Xuli; Lo Sterzo, Carlo; Tang, Richard; Lingampalli, Nithya; Kim, Hyun Jin; Murthy, Niren

    2015-07-01

    Therapeutics based on transcription factors have the potential to revolutionize medicine but have had limited clinical success as a consequence of delivery problems. The delivery of transcription factors is challenging because it requires the development of a delivery vehicle that can complex transcription factors, target cells and stimulate endosomal disruption, with minimal toxicity. Here, we present a multifunctional oligonucleotide, termed DARTs (DNA assembled recombinant transcription factors), which can deliver transcription factors with high efficiency in vivo. DARTs are composed of an oligonucleotide that contains a transcription-factor-binding sequence and hydrophobic membrane-disruptive chains that are masked by acid-cleavable galactose residues. DARTs have a unique molecular architecture, which allows them to bind transcription factors, trigger endocytosis in hepatocytes, and stimulate endosomal disruption. The DARTs have enhanced uptake in hepatocytes as a result of their galactose residues and can disrupt endosomes efficiently with minimal toxicity, because unmasking of their hydrophobic domains selectively occurs in the acidic environment of the endosome. We show that DARTs can deliver the transcription factor nuclear erythroid 2-related factor 2 (Nrf2) to the liver, catalyse the transcription of Nrf2 downstream genes, and rescue mice from acetaminophen-induced liver injury.

  10. Portable system for microbial sample preparation and oligonucleotide microarray analysis.

    PubMed

    Bavykin, S G; Akowski, J P; Zakhariev, V M; Barsky, V E; Perov, A N; Mirzabekov, A D

    2001-02-01

    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager. PMID:11157263

  11. Portable system for microbial sample preparation and oligonucleotide microarray analysis.

    SciTech Connect

    Bavykin, S. G.; Akowski, J. P.; Zakhariev, V. M.; Barsky, V. E.; Mirzabekov, A. D.; Perov, A. N.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2001-02-01

    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager.

  12. Multiplex pairwise assembly of array-derived DNA oligonucleotides.

    PubMed

    Klein, Jason C; Lajoie, Marc J; Schwartz, Jerrod J; Strauch, Eva-Maria; Nelson, Jorgen; Baker, David; Shendure, Jay

    2016-03-18

    While the cost of DNA sequencing has dropped by five orders of magnitude in the past decade, DNA synthesis remains expensive for many applications. Although DNA microarrays have decreased the cost of oligonucleotide synthesis, the use of array-synthesized oligos in practice is limited by short synthesis lengths, high synthesis error rates, low yield and the challenges of assembling long constructs from complex pools. Toward addressing these issues, we developed a protocol for multiplex pairwise assembly of oligos from array-synthesized oligonucleotide pools. To evaluate the method, we attempted to assemble up to 2271 targets ranging in length from 192-252 bases using pairs of array-synthesized oligos. Within sets of complexity ranging from 131-250 targets, we observed error-free assemblies for 90.5% of all targets. When all 2271 targets were assembled in one reaction, we observed error-free constructs for 70.6%. While the assembly method intrinsically increased accuracy to a small degree, we further increased accuracy by using a high throughput 'Dial-Out PCR' protocol, which combines Illumina sequencing with an in-house set of unique PCR tags to selectively amplify perfect assemblies from complex synthetic pools. This approach has broad applicability to DNA assembly and high-throughput functional screens. PMID:26553805

  13. Identification of Dermatophytes by an Oligonucleotide Array▿ †

    PubMed Central

    Li, Hsin Chieh; Bouchara, Jean-Philippe; Hsu, Mark Ming-Long; Barton, Richard; Chang, Tsung Chain

    2007-01-01

    Species of dermatophytes are classified into three anamorphic (asexual) genera, Epidermophyton, Microsporum, and Trichophyton. Conventional methods used to identify dermatophytes are often lengthy and may be inconclusive because of atypical microscopic or colony morphology. Based on the internal transcribed spacer 1 (ITS-1) and ITS-2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 17 dermatophyte species. The method consisted of PCR amplification of the ITS regions using universal primers, followed by hybridization of the digoxigenin-labeled PCR products to an array of oligonucleotides (17- to 30-mers) immobilized on a nylon membrane. Of 198 dermatophyte strains and 90 nontarget strains tested, the sensitivity and specificity of the array were 99.5% and 97.8%, respectively. The only strain not identified (Microsporum audouinii LMA 597) was found to have a nucleotide insertion at the ITS-2 region where the probe was designed. Two nontarget strains, Microsporum equinum LMA 40396666 and Trichophyton gourvilii var. intermedium CBS 170.65, were misidentified as Microsporum canis and Trichophyton soudanense, respectively. Sequence analysis of the ITS regions revealed that the two misidentified strains displayed high sequence homology with the probes designed for M. canis and T. soudanense, respectively. The present method can be used as a reliable alternative to conventional identification methods and can be completed with isolated colonies within 24 h. PMID:17687010

  14. Synthesis of dithienosilole-based highly photoluminescent donor-acceptor type compounds.

    PubMed

    Ohshita, Joji; Tominaga, Yuta; Tanaka, Daiki; Ooyama, Yousuke; Mizumo, Tomonobu; Kobayashi, Norifumi; Higashimura, Hideyuki

    2013-03-14

    Highly photoluminescent acceptor-donor-acceptor (A-D-A) and donor-acceptor (D-A) type compounds with a dithienosilole unit as the donor and perfluorotolyl or dimesitylboryl group(s) as the acceptor were prepared by the reaction of lithiated dithienosilole derivatives with perfluorotoluene or fluorodimesitylborane, respectively. The resulting A-D-A and D-A type compounds showed red-shifted UV absorption and PL bands compared to those of simple dithienosiloles having no acceptor units, reported previously, and were highly photoluminescent in the solid state as well as in solution. Solvatochromic behaviour that would arise from the intramolecular donor-acceptor interaction were observed for the D-A type compounds with respect to the UV absorption and PL spectra. In addition, it was found that bis(dimesitylboryl)dithienosilole and (dimesitylboryl)(methylthio)dithienosilole responded to coexisting fluoride anions, leading to clear UV absorption and PL spectral changes in solutions. PMID:23295388

  15. The structure and bonding of iron-acceptor pairs in silicon

    SciTech Connect

    Zhao, S.; Assali, L.V.C.; Kimerling, L.C.

    1995-08-01

    The highly mobile interstitial iron and Group III impurities (B, Al, Ga, In) form iron-acceptor pairs in silicon. Based on the migration kinetics and taking host silicon as a dielectric medium, we have simulated the pairing process in a static silicon lattice. Different from the conventional point charge ionic model, our phenomenological calculations include (1) a correction that takes into account valence electron cloud polarization which adds a short range, attractive interaction in the iron-acceptor pair bonding; and (2) silicon lattice relaxation due to the atomic size difference which causes a local strain field. Our model explains qualitatively (1) trends among the iron-acceptor pairs revealing an increase of the electronic state hole emission energy with increasing principal quantum number of acceptor and decreasing pair separation distance; and (2) the stable and metastable sites and configurational symmetries of the iron-acceptor pairs. The iron-acceptor pairing and bonding mechanism is also discussed.

  16. Dysregulation of phosphate metabolism and conditions associated with phosphate toxicity.

    PubMed

    Brown, Ronald B; Razzaque, Mohammed S

    2015-01-01

    Phosphate homeostasis is coordinated and regulated by complex cross-organ talk through delicate hormonal networks. Parathyroid hormone (PTH), secreted in response to low serum calcium, has an important role in maintaining phosphate homeostasis by influencing renal synthesis of 1,25-dihydroxyvitamin D, thereby increasing intestinal phosphate absorption. Moreover, PTH can increase phosphate efflux from bone and contribute to renal phosphate homeostasis through phosphaturic effects. In addition, PTH can induce skeletal synthesis of another potent phosphaturic hormone, fibroblast growth factor 23 (FGF23), which is able to inhibit renal tubular phosphate reabsorption, thereby increasing urinary phosphate excretion. FGF23 can also fine-tune vitamin D homeostasis by suppressing renal expression of 1-alpha hydroxylase (1α(OH)ase). This review briefly discusses how FGF23, by forming a bone-kidney axis, regulates phosphate homeostasis, and how its dysregulation can lead to phosphate toxicity that induces widespread tissue injury. We also provide evidence to explain how phosphate toxicity related to dietary phosphorus overload may facilitate incidence of noncommunicable diseases including kidney disease, cardiovascular disease, cancers and skeletal disorders. PMID:26131357

  17. Dysregulation of phosphate metabolism and conditions associated with phosphate toxicity

    PubMed Central

    Brown, Ronald B; Razzaque, Mohammed S

    2015-01-01

    Phosphate homeostasis is coordinated and regulated by complex cross-organ talk through delicate hormonal networks. Parathyroid hormone (PTH), secreted in response to low serum calcium, has an important role in maintaining phosphate homeostasis by influencing renal synthesis of 1,25-dihydroxyvitamin D, thereby increasing intestinal phosphate absorption. Moreover, PTH can increase phosphate efflux from bone and contribute to renal phosphate homeostasis through phosphaturic effects. In addition, PTH can induce skeletal synthesis of another potent phosphaturic hormone, fibroblast growth factor 23 (FGF23), which is able to inhibit renal tubular phosphate reabsorption, thereby increasing urinary phosphate excretion. FGF23 can also fine-tune vitamin D homeostasis by suppressing renal expression of 1-alpha hydroxylase (1α(OH)ase). This review briefly discusses how FGF23, by forming a bone–kidney axis, regulates phosphate homeostasis, and how its dysregulation can lead to phosphate toxicity that induces widespread tissue injury. We also provide evidence to explain how phosphate toxicity related to dietary phosphorus overload may facilitate incidence of noncommunicable diseases including kidney disease, cardiovascular disease, cancers and skeletal disorders. PMID:26131357

  18. Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II

    SciTech Connect

    2000-06-15

    The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank{reg_sign} finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

  19. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  20. HELP (high efficiency liquid phase) new oligonucleotide synthesis on soluble polymeric support.

    PubMed

    Bonora, G M; Scremin, C L; Colonna, F P; Garbesi, A

    1990-06-11

    A simple, rapid and high-yielding method for the synthesis of oligonucleotides by the phosphotriesters approach is described. The use of polyethylene glycol (PEG) as soluble polymeric support preserves some convenient features of the solid-phase synthesis with new interesting advantages. Short oligonucleotides in hundred milligrams scale can be obtained from few grams of functionalized PEG. PMID:2356115

  1. HELP (high efficiency liquid phase) new oligonucleotide synthesis on soluble polymeric support.

    PubMed Central

    Bonora, G M; Scremin, C L; Colonna, F P; Garbesi, A

    1990-01-01

    A simple, rapid and high-yielding method for the synthesis of oligonucleotides by the phosphotriesters approach is described. The use of polyethylene glycol (PEG) as soluble polymeric support preserves some convenient features of the solid-phase synthesis with new interesting advantages. Short oligonucleotides in hundred milligrams scale can be obtained from few grams of functionalized PEG. PMID:2356115

  2. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. II - Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1992-01-01

    Hairpin oligonucleotides were prepared with 5-prime-terminal single-stranded sequments containing cytidylate (C) and guanylate (G) residues. It was found that incubation of these hairpin oligonucleotides with a mixutre of cytidine and guanosine 5-prime-phosphoro (2-methyl)imidazolides results in sequence-specific addition of C and G residues to the 3-prime terminus of the hairpin.

  3. Stepwise charge transfer complexation of some pyrimidines with σ-acceptor iodine involving a new unconventional acceptor

    NASA Astrophysics Data System (ADS)

    Rabie, Usama. M.; Mohamed, Ramadan. A.; Abou-El-Wafa, Moustafa. H.

    2007-11-01

    Interactions of some pyrimidine derivatives, 4-amino-2,6-dimethylpyrimidine, kyanmethin, (4AP), 2-amino-4,6-dimethylpyrimidine (2AP), 2-aminopyrimidine (AP), 2-amino-4-methylpyrimidine (AMP), 2-amino-4-methoxy-6-methylpyrimidine (AMMP), and 4-amino-5-chloro-2,6-dimethylpyrimidine (ACDP) as electron donors, with iodine (I 2), as a typical σ-electron acceptor, have been studied. Electronic absorption spectra of these interactions in several organic solvents of different polarities have performed instant appearance of clear charge transfer (CT) bands. Formation constants ( KCT), molar absorption coefficients ( ɛCT) and thermodynamic properties, Δ H, Δ S, and Δ G, of these interactions have been determined and discussed. Electronic absorption spectra of the solutions of the synthesized pyrimidines-iodine, P-I 2, CT complexes have shown the characteristic bands of the triiodide ion, I 3-. UV/vis spectral tracking of these interactions have shown that by lapse of time the first formed CT complex, P-I 2, is transformed to the corresponding triiodide complex, P +I.I 3-, then, the later interacts as a new unconventional acceptor and it forms a CT complex of the form (P).(P +I.I 3-). Elemental analyses of these solid complexes have indicated the stoichiometric ratio 2:2, or formally 1:1, P:I 2.

  4. Stepwise charge transfer complexation of some pyrimidines with sigma-acceptor iodine involving a new unconventional acceptor.

    PubMed

    Rabie, Usama M; Mohamed, Ramadan A; Abou-El-Wafa, Moustafa H

    2007-11-01

    Interactions of some pyrimidine derivatives, 4-amino-2,6-dimethylpyrimidine, kyanmethin, (4AP), 2-amino-4,6-dimethylpyrimidine (2AP), 2-aminopyrimidine (AP), 2-amino-4-methylpyrimidine (AMP), 2-amino-4-methoxy-6-methylpyrimidine (AMMP), and 4-amino-5-chloro-2,6-dimethylpyrimidine (ACDP) as electron donors, with iodine (I(2)), as a typical sigma-electron acceptor, have been studied. Electronic absorption spectra of these interactions in several organic solvents of different polarities have performed instant appearance of clear charge transfer (CT) bands. Formation constants (KCT), molar absorption coefficients (epsilonCT) and thermodynamic properties, DeltaH, DeltaS, and DeltaG, of these interactions have been determined and discussed. Electronic absorption spectra of the solutions of the synthesized pyrimidines-iodine, P-I2, CT complexes have shown the characteristic bands of the triiodide ion, I3*. UV/vis spectral tracking of these interactions have shown that by lapse of time the first formed CT complex, P-I2, is transformed to the corresponding triiodide complex, P(+)I.I3*, then, the later interacts as a new unconventional acceptor and it forms a CT complex of the form (P).(P+I.I3*). Elemental analyses of these solid complexes have indicated the stoichiometric ratio 2:2, or formally 1:1, P:I2. PMID:17317281

  5. Donor-Acceptor-Type Semiconducting Polymers Consisting of Benzothiadiazole Derivatives as Electron-Acceptor Units for Organic Photovoltaic Cells.

    PubMed

    Kim, Hee Su; Park, Jong Baek; Kim, Ji-Hoon; Hwang, Do-Hoon

    2015-11-01

    We synthesized two fused pentacyclic donor-acceptor structures, where the two different outer electron rich thiophene (DTPBT) and electron poor benzene (ICTh) moieties are covalently bonded to the central electron-deficient benzothiadiazole core by two nitrogen bridges. These new electron-acceptor DTPBT and ICTh building blocks were copolymerized with fluorene, as the electron donor group, via Suzuki coupling polymerization, to produce two new alternating copolymers, PFDTPBT and PFICTh, respectively. The average molecular weights of the synthesized polymers were determined by GPC. The number-average molecular weights of PFDTPBT and PFICTh were 19,000 (PDI = 2.5) and 20,000 (PDI = 4.0), respectively. The optical bandgap energies of the polymers were measured from their absorption onsets to be 2.15 and 2.55 eV, depending on the polymer structure. The HOMO energy levels of the polymers were determined, by measuring the oxidation onsets of the polymer films by cyclic voltammetry. The measured HOMO energy levels of PFDTPBT and PFICTh were -5.10 and -5.57 eV, respectively. When the polymers were blended with PC71BM, as the active layer for bulk-heterojunction photovoltaic devices, power conversion efficiencies were 2.08% and 0.34%, respectively, under AM 1.5 G (100 mW cm(-2)) conditions. PMID:26726610

  6. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids.

    PubMed

    Carpini, Guido; Lucarelli, Fausto; Marrazza, Giovanna; Mascini, Marco

    2004-09-15

    An electrochemical genosensor for the detection of specific sequences of DNA has been developed using disposable screen-printed gold electrodes. Screen-printed gold electrodes were firstly modified with a mixed monolayer of a 25-mer thiol-tethered DNA probe and a spacer thiol, 6-mercapto-1-hexanol (MCH). The DNA probe sequence was internal to the sequence of the 35S promoter, which sequence is inserted in the genome of GMOs regulating the transgene expression. An enzyme-amplified detection scheme, based on the coupling of a streptavidin-alkaline phosphatase conjugate and biotinylated target sequences was then applied. The enzyme catalysed the hydrolysis of the electroinactive alpha-naphthyl phosphate to alpha-naphthol; this product is electroactive and has been detected by means of differential pulse voltammetry. The assay was, firstly, characterised using synthetic oligonucleotides. Relevant parameters, such as the probe concentration and the immobilisation time, the use of the MCH and different enzymatic conjugates, were investigated and optimised. The genosensor response was found to be linearly related to the target concentration between 0 and 25 nmol/L; the detection limit was 0.25 nmol/L. The analytical procedure was then applied for the detection of the 35S promoter sequence, which was amplified from the pBI121 plasmid by polymerase chain reaction (PCR). Hybridisation conditions (i.e., hybridisation buffer and hybridisation time) were further optimised. The selectivity of the assay was confirmed using biotinylated non-complementary amplicons and PCR blanks. The results showed that the genosensor enabled sensitive (detection limit: 1 nmol/L) and specific detection of GMO-related sequences, thus providing a useful tool for the screening analysis of bioengineered food samples. PMID:15308218

  7. Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports.

    PubMed Central

    Guo, Z; Guilfoyle, R A; Thiel, A J; Wang, R; Smith, L M

    1994-01-01

    A simple and rapid method for the analysis of genetic polymorphisms has been developed using allele-specific oligonucleotide arrays bound to glass supports. Allele-specific oligonucleotides are covalently immobilized on glass slides in arrays of 3 mm spots. Genomic DNA is amplified by PCR using one fluorescently tagged primer oligonucleotide and one biotinylated primer oligonucleotide. The two complementary DNA strands are separated, the fluorescently tagged strand is hybridized to the support-bound oligonucleotide array, and the hybridization pattern is detected by fluorescence scanning. Multiple polymorphisms present in the PCR product may be detected in parallel. The effect of spacer length, surface density and hybridization conditions were evaluated, as was the relative efficacy of hybridization with single or double-stranded PCR products. The utility of the method was demonstrated in the parallel analysis of 5 point mutations from exon 4 of the human tyrosinase gene. Images PMID:7816638

  8. Stable dye-labelled oligonucleotide-nanoparticle conjugates for nucleic acid detection

    NASA Astrophysics Data System (ADS)

    Barrett, Lee; Dougan, Jennifer A.; Faulds, Karen; Graham, Duncan

    2011-08-01

    Metallic nanoparticles functionalized with oligonucleotides are used for a number of nucleic acid detection strategies. However, oligonucleotide-nanoparticle conjugates suffer from a lack of stability when exposed to certain conditions associated with DNA detection assays. In this study, we report the synthesis of thiol and thioctic acid-modified oligonucleotide gold nanoparticle (OGNs) conjugates functionalized with a dye label and varying spacer groups. The thioctic acid-modified conjugates exhibit increased stability when treated with dithiothreitol (DTT) compared to the more commonly used thiol modification. When the dye labelled oligonucleotide nanoparticle conjugates are exposed to the same conditions there is a pronounced increase in the stability for both thioctic acid and thiol modified sequences. These results open up the possibility of simply using a dye label to enhance the stability of oligonucleotide-nanoparticle conjugates in DNA detection assays where the enhanced stability of the conjugate system can be advantageous in more complex biological environments.

  9. Generation of Nitrogen Acceptors in ZnO using Pulse Thermal Processing

    SciTech Connect

    Xu, Jun; Ott, Ronald D; Sabau, Adrian S; Pan, Zhengwei; Xiu, Faxian; Liu, Jilin; Erie, Jean-Marie; Norton, David P

    2008-01-01

    Bipolar doping in wide bandgap semiconductors is difficult to achieve under equilibrium conditions because of the spontaneous formation of compensating defects and unfavorable energetics for dopant substitution. In this work, we explored the use of rapid pulse thermal processing for activating nitrogen dopants into acceptor states in ZnO. Low-temperature photoluminescence spectra revealed both acceptor-bound exciton (A{sup 0}X) and donor-acceptor pair emissions, which present direct evidence for acceptors generated after pulse thermal processing of nitrogen-doped ZnO. This work suggests that pulse thermal processing is potentially an effective method for p-type doping of ZnO.

  10. Fermi Surface of Donor and Acceptor Graphite Intercalation Compounds.

    NASA Astrophysics Data System (ADS)

    Wang, Guonan

    The Fermi surfaces and the electronic properties of the donor-type stage-1 C_8K and stage-2 C_{24}K, as well as the acceptor-type stage-2 BiCl_3, stage-3 HgCl_2 and stage-3 SbF _5 graphite intercalation compounds were investigated by means of the de Haas-van Alphen effect. The dHvA spectra of the stage-1 C_8 K exhibit two dHvA frequencies, 3126 T and 4250 T. The corresponding effective masses were 0.86 m _0 and 0.92 m_0, respectively. The angular dependence of the dHvA frequencies for a direction within +/-18^circ of the c-axis showed that there are both three-dimensional and two dimensional parts of the Fermi surfaces in C _8K. The three-dimensional Fermi surface has a cross-sectional area corresponding to the dHvA frequency of 3126 T. The charge transfer per potassium atom measured from the dHvA effect is 0.97. This implies that the potassium is ionized completely. These dHvA experimental results support both the Tatar and Rabii model and the revised Ohno, Nakao and Kamimura model for C_8K. Two dominant dHvA frequencies were obtained in stage-2 C_{24}K. They are 286 T and 2570 T, respectively. The predictions of Blinowski's model are in agreement with the experimental data. The charge transfer per potassium is found to be 0.88. This suggests that the potassium s-band is above the Fermi level in C_{24}K. The dHvA measurements for the acceptor compounds show that the stage-2 BiCl_3 GIC had two dHvA frequencies, 327T and 1012T, and each stage -3 compound had three dominant frequencies. They are 121T, 523T and 664T for HgCl_2, and 172T, 656T and 852T for SbF_5. The cyclotron masses corresponding to the dHvA frequencies for these compounds were measured from the temperature dependence of the dHvA amplitudes. The theoretical predictions of the dHvA frequencies and the cyclotron masses from the Blinowski's band models for stage-2 and stage-3 compounds are in agreement with the experimental results. The angular dependence of the dHvA frequencies show that the Fermi

  11. Verification of the structural alerts for Michael acceptors.

    PubMed

    Schultz, T Wayne; Yarbrough, Jason W; Hunter, Robert S; Aptula, Aynur O

    2007-09-01

    A diverse series of polarized alpha,beta-unsaturated and related compounds were evaluated for reactivity with a spectrophotometric assay using the sulfhydryl group in the form of the cysteine residue of the tripeptide GSH as a model nucleophile. The reactive end point (RC 50) calculations were compared to previously described structural alerts based on conventional organic chemistry. This comparison focused on polarized alpha,beta-unsaturates, including ones containing an aldehyde, ketone, ester, sulfoxide, sulfone, sulfonate, nitro, or cyano moiety as well as ortho- and para-pyridino compounds and ortho- and para-quinones. The alerts were coded by substructure and are available in open-source software ( http://sourceforge.net/projects/chemeval). Comparisons of reactivity between selected analogues revealed that only the polarized alpha,beta-unsaturates were reactive. These results verified the coded structural alerts that define the applicability domain for Michael acceptor electrophiles. PMID:17672510

  12. D-Fructose-6-phosphate aldolase-catalyzed one-pot synthesis of iminocyclitols.

    PubMed

    Sugiyama, Masakazu; Hong, Zhangyong; Liang, Pi-Hui; Dean, Stephen M; Whalen, Lisa J; Greenberg, William A; Wong, Chi-Huey

    2007-11-28

    A one-pot chemoenzymatic method for the synthesis of a variety of new iminocyclitols from readily available, non-phosphorylated donor substrates has been developed. The method utilizes the recently discovered fructose-6-phosphate aldolase (FSA), which is functionally distinct from known aldolases in its tolerance of different donor substrates as well as acceptor substrates. Kinetic studies were performed with dihydroxyacetone (DHA), the presumed endogenous substrate for FSA, as well as hydroxy acetone (HA) and 1-hydroxy-2-butanone (HB) as donor substrates, in each case using glyceraldehyde-3-phosphate as acceptor substrate. Remarkably, FSA used the three donor substrates with equal efficiency, with kcat/KMvalues of 33, 75, and 20 M-1 s-1, respectively. This level of donor substrate tolerance is unprecedented for an aldolase. Furthermore, DHA, HA, and HB were accepted as donors in FSA-catalyzed aldol reactions with a variety of azido- and Cbz-amino aldehyde acceptors. The broad substrate tolerance of FSA and the ability to circumvent the need for phosphorylated substrates allowed for one-pot synthesis of a number of known and novel iminocyclitols in good yields, and in a very concise fashion. New iminocyclitols were assayed as inhibitors against a panel of glycosidases. Compounds 15 and 16 were specific alpha-mannosidase inhibitors, and 24 and 26 were potent and selective inhibitors of beta-N-acetylglucosaminidases in the submicromolar range. Facile access to these compounds makes them attractive core structures for further inhibitor optimization. PMID:17985886

  13. Mass transfer of electron acceptor aross the capillary fringe

    NASA Astrophysics Data System (ADS)

    Liu, S.; Piepenbrink, M.; Grathwohl, P.

    2005-12-01

    Transverse dispersion has been identified as a potentially limiting parameter controlling the mixing of electron donors and electron acceptors for natural attenuation of plumes originating from continuously emitting sources, however determining reactive transverse dispersion coefficients is not a simple task. The objective of this work is to elaborate the mass transfer of electron acceptor across the capillary fringe. A two-dimensional numerical reactive transport model and a fully controlled tank experiment are set up to investigate the mass transfer across the capillary and reactive fringe, where the oxygen supply is the limiting factor. The tank (77.9 times 14 times 0.8 cm) is made from acrylic-glass and filled with glass beads (0.5-0.75mm). Sodium dithionite, an easily oxidizable compound, is used as a surrogate for contaminants and is continuously injected from the inlets of the tank and reaches a steady state flow. Air circulates on the top of the glass beads. The oxygen concentrations as well as the reactive products (sulfate) are measured at the outlets of the tank with an oxygen sensor and via IC. In addition to that, resazurine, a redox indicator, is added to visualize the redox zones. These two-dimensional experimental results show quantitatively and qualitatively how the oxygen concentrations decrease at the plume fringe. Two dimensional numerical simulations with Min3P predicted oxygen distributions are compared with the experimental results. Acknowledgements: This work was funded by Helmholtz Association and Helmholtz Research Center UFZ; Project: `Virtual Institute for isotope biogeochemistry-biologically mediated processes at geochemical gradients and interfaces in soil - aquifer systems', Contract VH-VI-155.

  14. Recommendations for safety pharmacology evaluations of oligonucleotide-based therapeutics.

    PubMed

    Berman, Cindy L; Cannon, Keri; Cui, Yi; Kornbrust, Douglas J; Lagrutta, Armando; Sun, Sunny Z; Tepper, Jeff; Waldron, Gareth; Younis, Husam S

    2014-08-01

    This document was prepared by the Safety Pharmacology Subcommittee of the Oligonucleotide Safety Working Group (OSWG), a group of industry and regulatory scientists involved in the development and regulation of therapeutic oligonucleotides. The mission of the Subcommittee was to develop scientific recommendations for the industry regarding the appropriate scope and strategies for safety pharmacology evaluations of oligonucleotides (ONs). These recommendations are the consensus opinion of the Subcommittee and do not necessarily reflect the current expectations of regulatory authorities. 1) Safety pharmacology testing, as described in the International Conference on Harmonisation (ICH) S7 guidance, is as applicable to ONs as it is to small molecule drugs and biotherapeutics. 2) Study design considerations for ONs are similar to those for other classes of drugs. In general, as with other therapeutics, studies should evaluate the drug product administered via the clinical route. Species selection should ideally consider relevance of the model with regard to the endpoints of interest, pharmacological responsiveness, and continuity with the nonclinical development program. 3) Evaluation of potential effects in the core battery (cardiovascular, central nervous, and respiratory systems) is recommended. In general: a. In vitro human ether-a-go-go-related gene (hERG) testing does not provide any specific value and is not warranted. b. Emphasis should be placed on in vivo evaluation of cardiovascular function, typically in nonhuman primates (NHPs). c. Due to the low level of concern, neurologic and respiratory function can be assessed concurrently with cardiovascular safety pharmacology evaluation in NHPs, within repeat-dose toxicity studies, or as stand-alone studies. In the latter case, rodents are most commonly used. 4) Other dedicated safety pharmacology studies, beyond the core battery, may have limited value for ONs. Although ONs can accumulate in the kidney and liver

  15. Frequent oligonucleotides and peptides of the Haemophilus influenzae genome.

    PubMed Central

    Karlin, S; Mrázek, J; Campbell, A M

    1996-01-01

    The complete Haemophilus influenzae genome (1.83 Mb, Rd strain) provides opportunities for characterizing global genomic inhomogeneities and for detecting important sequence signals. Along these lines, new methods for identifying frequent words (oligonucleotides and/or peptides) and their distributions are applied to the H.influenzae genome with some comparisons and contrasts made with frequent words of other bacterial genomes. Three major classes of frequent oligonucleotides stand out: (i) oligos related to the familiar uptake signal sequences (USSs), AAGTGCGGT (USS+) and its inverted complement (USS-), (ii) multiple tetranucleotide iterations and (iii) intergenic dyad sequences (ISDs) found as AAGCCCACCCTAC and its dyad form. The USS+ and USS- occur in almost equal counts, are remarkably evenly spaced around the genome, and appear predominantly in the same reading frame of protein coding domains (USS+ translated to Ser-Ala-Val, USS- translated to Thr-Ala-Leu). These observations suggest that USSs contribute to global genomic functions, for example, in replication and/or repair processes, or as membrane attachment sites, or as sequences helping to pack DNA. The long tetranucleotide iterations, virtually unique to H.influenzae (i.e., unknown in other prokaryotes), through polymerase slippage during replication and/or homologous recombination may produce subpopulations expressing alternative proteins. The 13 bp frequent IDS words, invariably intergenic, occur mostly in clusters and provide potential for complex secondary structures suggesting that these sequences may be important signals for regulating the activity of their flanking genes. The frequent oligopeptides of H.influenzae are principally of two kinds--those induced by oligonucleotide frequent words (USSs, tetranucleotide iterations), and those associated with ATP or GTP binding sites that are generally composed of three motifs: the A-box which contributes to delineating the binding pocket; the B-box which

  16. Acceptor-donor-acceptor-based small molecules with varied crystallinity: processing additive-induced nanofibril in blend film for photovoltaic applications

    NASA Astrophysics Data System (ADS)

    Li, Chao; Chen, Yujin; Zhao, Yue; Wang, Huifang; Zhang, Wei; Li, Yaowen; Yang, Xiaoming; Ma, Changqi; Chen, Liwei; Zhu, Xiulin; Tu, Yingfeng

    2013-09-01

    A series of acceptor-donor-acceptor-based small molecules (SMs) with varied crystallinity were successfully synthesized. The processing additive can induce the SMs to self-organize as nanofibrils with higher crystallinity and controlled scales of nanofibrils, which have significant influence on the photovoltaic performance.A series of acceptor-donor-acceptor-based small molecules (SMs) with varied crystallinity were successfully synthesized. The processing additive can induce the SMs to self-organize as nanofibrils with higher crystallinity and controlled scales of nanofibrils, which have significant influence on the photovoltaic performance. Electronic supplementary information (ESI) available: Synthetic process and characterizations of SMs; TGA, electrochemical properties, molecular orbital surfaces of SMs; AFM images of SM:PC71BM blend films; EQE curves; optical, electrochemical properties and photovoltaic parameters. See DOI: 10.1039/c3nr03048b

  17. The transfer of mannose from guanosine diphosphate mannose to dolichol phosphate and protein by pig liver endoplasmic reticulum

    PubMed Central

    Richards, J. B.; Hemming, F. W.

    1972-01-01

    When pig liver microsomal preparations were incubated with GDP-[14C]mannose, 10–40% of the 14C was transferred to mannolipid and 1–3% to mannoprotein. The transfer to mannolipid was readily reversible and GDP was one of the products of the reaction. It was possible to reverse the reaction by adding excess of GDP and to show the incorporation of [14C]GDP into GDP-mannose. When excess of unlabelled GDP-mannose was added to a partially completed incubation there was a rapid transfer back of [14C]mannose from the mannolipid to GDP-mannose. The other product of the reaction, the mannolipid, had the properties of a prenol phosphate mannose. This was illustrated by its lability to dilute acid but stability to dilute alkali, and by its chromatographic properties. Dolichol phosphate stimulated the incorporation of [14C]mannose into both mannolipid and into protein, although the former effect was larger and more consistent than the latter. The incorporation of exogenous [3H]dolichol phosphate into the mannolipid, and its release, accompanied by mannose, on treatment of the mannolipid with dilute acid, confirmed that exogenous dolichol phosphate can act as an acceptor of mannose in this system. It was shown that other exogenous polyprenol phosphates (but not farnesol phosphate or cetyl phosphate) can substitute for dolichol phosphate in this respect but that they are much less efficient than dolichol phosphate in stimulating the transfer of mannose to protein. Since pig liver contained substances with the chromatographic properties of both dolichol phosphate and dolichol phosphate mannose, which caused an increase in transfer of [14C]mannose from GDP-[14C]mannose to mannolipid, it was concluded that endogenous dolichol phosphate acts as an acceptor of mannose in the microsomal preparation. The results indicate that the mannolipid is an intermediate in the transfer of mannose from GDP-mannose to protein. Some 4% of the mannose of a sample of mannolipid added to an

  18. Probing the donor and acceptor substrate specificity of the γ-glutamyl transpeptidase.

    PubMed

    Hu, Xin; Legler, Patricia M; Khavrutskii, Ilja; Scorpio, Angelo; Compton, Jaimee R; Robertson, Kelly L; Friedlander, Arthur M; Wallqvist, Anders

    2012-02-14

    γ-Glutamyl transpeptidase (GGT) is a two-substrate enzyme that plays a central role in glutathione metabolism and is a potential target for drug design. GGT catalyzes the cleavage of γ-glutamyl donor substrates and the transfer of the γ-glutamyl moiety to an amine of an acceptor substrate or water. Although structures of bacterial GGT have revealed details of the protein-ligand interactions at the donor site, the acceptor substrate site is relatively undefined. The recent identification of a species-specific acceptor site inhibitor, OU749, suggests that these inhibitors may be less toxic than glutamine analogues. Here we investigated the donor and acceptor substrate preferences of Bacillus anthracis GGT (CapD) and applied computational approaches in combination with kinetics to probe the structural basis of the enzyme's substrate and inhibitor binding specificities and compare them with human GGT. Site-directed mutagenesis studies showed that the R432A and R520S variants exhibited 6- and 95-fold decreases in hydrolase activity, respectively, and that their activity was not stimulated by the addition of the l-Cys acceptor substrate, suggesting an additional role in acceptor binding and/or catalysis of transpeptidation. Rat GGT (and presumably HuGGT) has strict stereospecificity for L-amino acid acceptor substrates, while CapD can utilize both L- and D-acceptor substrates comparably. Modeling and kinetic analysis suggest that R520 and R432 allow two alternate acceptor substrate binding modes for L- and D-acceptors. R432 is conserved in Francisella tularensis, Yersinia pestis, Burkholderia mallei, Helicobacter pylori and Escherichia coli, but not in human GGT. Docking and MD simulations point toward key residues that contribute to inhibitor and acceptor substrate binding, providing a guide to designing novel and specific GGT inhibitors. PMID:22257032

  19. Surface Modified Gadolinium Phosphate Nanoparticles as MRI Contrast Agents

    NASA Astrophysics Data System (ADS)

    Dumont, Matthieu F.; Baligand, Celine; Knowles, Elisabeth S.; Meisel, Mark W.; Walter, Glenn A.; Talham, Daniel R.

    2012-02-01

    Nanoparticles of GdPO4H2O were synthesized in a water/oil microemulsion using IGEPAL CO-520 as surfactant resulting in 50 nm to 100 nm particles that are dispersible and stable in water. Using surface modification chemistry previously established for zirconium phosphonate surfaces,ootnotetext J. Monot et al., J. Am. Chem. Soc. 130 (2008) 6243. the particles are directly modified with 5'-phosphate terminated oligonucleotides, and the specific interaction of the divalent phosphate with Gd^3+ sites at the surface is demonstrated. The ability of the modified nanoparticles to act as MRI contrast agents was determined by performing MR relaxivity measurements at 14 T. Solutions of nanopure water, Feridex and Omniscan (FDA cleared contrast agents) in 0.25% agarose were used for comparison and control purposes. MRI data confirm that GdPO4H2O nanoparticles have relaxivities (r1,r2) comparable to commercially available contrast agents.ootnotetext H. Hifumi et al., J. Am. Chem. Soc. 128 (2006) 15090. In addition, biofunctionalization of the surface of the nanoparticles does not prevent their function as MRI contrast agents.

  20. L-DNAs as potential antimessenger oligonucleotides: a reassessment.

    PubMed

    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J

    1993-09-11

    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. PMID:8414968

  1. L-DNAs as potential antimessenger oligonucleotides: a reassessment.

    PubMed Central

    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J

    1993-01-01

    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. Images PMID:8414968

  2. Synthesis of oligonucleotides on cellulose by a phosphotriester method.

    PubMed Central

    Crea, R; Horn, T

    1980-01-01

    The synthesis of oligothymidilic acids, (dT)m (where m = 4, 7, 10, 13, 16, 19, 22, and 25), was carried out using a solid phase approach in combination with the modified phosphotriester methodology developed in solution. Cellulose was used as the solid support after its functionalization with a specially featured dinucleoside diphosphate, 5'-0-p-chlorophenylphospho-2'(3')-0-acetyluridilyl-[2'(3')-3']-5'-0-dimethoxytritylthymidine p-chlorophenylester. The fully protected trideoxynucleoside triphosphate containing only thymidine was repeatedly used to elongate the oligonucleotide chain in the 3'-5' direction. Individual coupling yields ranged from 45% to 75%. The total time needed to prepare (dT)25 was four days. Similarly, the tridecanucleotide d(AGAAGGTACTTTT) was synthesized in good yield. The results show that this approach can be used for a fast and economic way to synthesize oligodeoxynucleotides. Images PMID:7433092

  3. [Research progress of probe design software of oligonucleotide microarrays].

    PubMed

    Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

    2014-02-01

    DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software. PMID:24804514

  4. Efficient site-directed saturation mutagenesis using degenerate oligonucleotides.

    PubMed

    Steffens, David L; Williams, John G K

    2007-07-01

    We describe a reliable protocol for constructing single-site saturation mutagenesis libraries consisting of all 20 naturally occurring amino acids at a specific site within a protein. Such libraries are useful for structure-function studies and directed evolution. This protocol extends the utility of Stratagene's QuikChange Site-Directed Mutagenesis Kit, which is primarily recommended for single amino acid substitutions. Two complementary primers are synthesized, containing a degenerate mixture of the four bases at the three positions of the selected codon. These primers are added to starting plasmid template and thermal cycled to produce mutant DNA molecules, which are subsequently transformed into competent bacteria. The protocol does not require purification of mutagenic oligonucleotides or PCR products. This reduces both the cost and turnaround time in high-throughput directed evolution applications. We have utilized this protocol to generate over 200 site-saturation libraries in a DNA polymerase, with a success rate of greater than 95%. PMID:17595310

  5. Oligonucleotide synthesis catalyzed by the Zn/2+/ ion

    NASA Technical Reports Server (NTRS)

    Sawai, H.; Orgel, L. E.

    1975-01-01

    Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.

  6. Computer simulation in template-directed oligonucleotide synthesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia; Benasconi, Claude F.

    1990-01-01

    It is commonly assumed that template-directed polymerizations have played a key role in prebiotic evolution. A computer simulation that models up to 33 competing reactions was used to investigate the product distribution in a template-directed oligonucleotide synthesis as a function of time and concentration of the reactants. The study focuses on the poly(C)-directed elongation reaction of oligoguanylates, and how it is affected by the competing processes of hydrolysis and dimerization of the activated monomer, which have the potential of severely curtailing the elongation and reducing the size and yield of the synthesized polymers. The simulations show that realistic and probably prebiotically plausible conditions can be found where hydrolysis and dimerization are either negligible or where a high degree of polymerization can be attained even in the face of substantial hydrolysis and/or dimerization.

  7. Insights to primitive replication derived from structures of small oligonucleotides

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Fox, G. E.

    1995-01-01

    Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

  8. Direct microcontact printing of oligonucleotides for biochip applications

    PubMed Central

    Thibault, C; Le Berre, V; Casimirius, S; Trévisiol, E; François, J; Vieu, C

    2005-01-01

    Background A critical step in the fabrication of biochips is the controlled placement of probes molecules on solid surfaces. This is currently performed by sequential deposition of probes on a target surface with split or solid pins. In this article, we present a cost-effective procedure namely microcontact printing using stamps, for a parallel deposition of probes applicable for manufacturing biochips. Results Contrary to a previous work, we showed that the stamps tailored with an elastomeric poly(dimethylsiloxane) material did not require any surface modification to be able to adsorb oligonucleotides or PCR products. The adsorbed DNA molecules are subsequently printed efficiently on a target surface with high sub-micron resolution. Secondly, we showed that successive stamping is characterized by an exponential decay of the amount of transferred DNA molecules to the surface up the 4th print, then followed by a second regime of transfer that was dependent on the contact time and which resulted in reduced quality of the features. Thus, while consecutive stamping was possible, this procedure turned out to be less reproducible and more time consuming than simply re-inking the stamps between each print. Thirdly, we showed that the hybridization signals on arrays made by microcontact printing were 5 to 10-times higher than those made by conventional spotting methods. Finally, we demonstrated the validity of this microcontact printing method in manufacturing oligonucleotides arrays for mutations recognition in a yeast gene. Conclusion The microcontact printing can be considered as a new potential technology platform to pattern DNA microarrays that may have significant advantages over the conventional spotting technologies as it is easy to implement, it uses low cost material to make the stamp, and the arrays made by this technology are 10-times more sensitive in term of hybridization signals than those manufactured by conventional spotting technology. PMID:15992404

  9. Stereospecificity of Oligonucleotide Interactions Revisited: No Evidence for Heterochiral Hybridization and Ribozyme/DNAzyme Activity

    PubMed Central

    Hoehlig, Kai; Bethge, Lucas; Klussmann, Sven

    2015-01-01

    A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-)oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be) stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa) prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications. PMID:25679211

  10. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    PubMed

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  11. Oligonucleotides Designed to Inhibit TLR9 Block Herpes Simplex Virus type 1 Infection at Multiple Steps

    PubMed Central

    Sauter, Monica M.; Gauger, Joshua J. L.; Brandt, Curtis R.

    2014-01-01

    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor–kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLR) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2 hours prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10 to 20 micromolar. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution. PMID:24995383

  12. Dichotomous Role of Exciting the Donor or the Acceptor on Charge Generation in Organic Solar Cells.

    PubMed

    Hendriks, Koen H; Wijpkema, Alexandra S G; van Franeker, Jacobus J; Wienk, Martijn M; Janssen, René A J

    2016-08-10

    In organic solar cells, photoexcitation of the donor or acceptor phase can result in different efficiencies for charge generation. We investigate this difference for four different 2-pyridyl diketopyrrolopyrrole (DPP) polymer-fullerene solar cells. By comparing the external quantum efficiency spectra of the polymer solar cells fabricated with either [60]PCBM or [70]PCBM fullerene derivatives as acceptor, the efficiency of charge generation via donor excitation and acceptor excitation can both be quantified. Surprisingly, we find that to make charge transfer efficient, the offset in energy between the HOMO levels of donor and acceptor that govern charge transfer after excitation of the acceptor must be larger by ∼0.3 eV than the offset between the corresponding two LUMO levels when the donor is excited. As a consequence, the driving force required for efficient charge generation is significantly higher for excitation of the acceptor than for excitation of the donor. By comparing charge generation for a total of 16 different DPP polymers, we confirm that the minimal driving force, expressed as the photon energy loss, differs by about 0.3 eV for exciting the donor and exciting the acceptor. Marcus theory may explain the dichotomous role of exciting the donor or the acceptor on charge generation in these solar cells. PMID:27452683

  13. Optical activation behavior of ion implanted acceptor species in GaN

    SciTech Connect

    Skromme, B.J.; Martinez, G.L.

    2000-07-01

    Ion implantation is used to investigate the spectroscopic properties of Mg, Be, and C acceptors in GaN. Activation of these species is studied using low temperature photoluminescence (PL). Low dose implants into high quality undoped hydride vapor phase epitaxial (HVPE) material are used in conjunction with high temperature (1300 C) rapid thermal anneals to obtain high quality spectra. Dramatic, dose-dependent evidence of Mg acceptor activation is observed without any co-implants, including a strong, sharp neutral Mg acceptor-bound exciton and strong donor-acceptor pair peaks. Variable temperature measurements reveal a band-to-acceptor transition, whose energy yields an optical binding energy of 224 meV. Be and C implants yield only slight evidence of shallow acceptor-related features and produce dose-correlated 2.2 eV PL, attributed to residual implantation damage. Their poor optical activation is tentatively attributed to insufficient vacancy production by these lighter ions. Clear evidence is obtained for donor-Zn acceptor pair and acceptor-bound exciton peaks in Zn-doped HVPE material.

  14. Physiological and electrochemical effects of different electron acceptors on bacterial anode respiration in bioelectrochemical systems.

    PubMed

    Yang, Yonggang; Xiang, Yinbo; Xia, Chunyu; Wu, Wei-Min; Sun, Guoping; Xu, Meiying

    2014-07-01

    To understand the interactions between bacterial electrode respiration and the other ambient bacterial electron acceptor reductions, alternative electron acceptors (nitrate, Fe2O3, fumarate, azo dye MB17) were added singly or multiply into Shewanella decolorationis microbial fuel cells (MFCs). All the added electron acceptors were reduced simultaneously with current generation. Adding nitrate or MB17 resulted in more rapid cell growth, higher flavin concentration and higher biofilm metabolic viability, but lower columbic efficiency (CE) and normalized energy recovery (NER) while the CE and NER were enhanced by Fe2O3 or fumarate. The added electron acceptors also significantly influenced the cyclic voltammetry profile of anode biofilm probably via altering the cytochrome c expression. The highest power density was observed in MFCs added with MB17 due to the electron shuttle role of the naphthols from MB17 reduction. The results provided important information for MFCs applied in practical environments where contains various electron acceptors. PMID:24862003

  15. Identification of acceptor states in Li-doped p-type ZnO thin films

    NASA Astrophysics Data System (ADS)

    Zeng, Y. J.; Ye, Z. Z.; Lu, J. G.; Xu, W. Z.; Zhu, L. P.; Zhao, B. H.; Limpijumnong, Sukit

    2006-07-01

    We investigate photoluminescence from reproducible Li-doped p-type ZnO thin films prepared by dc reactive magnetron sputtering. The LiZn acceptor state, with an energy level located at 150meV above the valence band maximum, is identified from free-to-neutral-acceptor transitions. Another deeper acceptor state located at 250meV emerges with the increased Li concentration. A broad emission centered at 2.96eV is attributed to a donor-acceptor pair recombination involving zinc vacancy. In addition, two chemical bonding states of Li, evident in x-ray photoelectron spectroscopy, are probably associated with the two acceptor states observed.

  16. Purification and characterization of a carbohydrate: acceptor oxidoreductase from Paraconiothyrium sp. that produces lactobionic acid efficiently.

    PubMed

    Kiryu, Takaaki; Nakano, Hirofumi; Kiso, Taro; Murakami, Hiromi

    2008-03-01

    A carbohydrate:acceptor oxidoreductase from Paraconiothyrium sp. was purified and characterized. The enzyme efficiently oxidized beta-(1-->4) linked sugars, such as lactose, xylobiose, and cellooligosaccharides. The enzyme also oxidized maltooligosaccharides, D-glucose, D-xylose, D-galactose, L-arabinose, and 6-deoxy-D-glucose. It specifically oxidized the beta-anomer of lactose. Molecular oxygen and 2,6-dichlorophenol indophenol were reduced by the enzyme as electron acceptors. The Paraconiothyrium enzyme was identified as a carbohydrate:acceptor oxidoreductase according to its specificity for electron donors and acceptors, and its molecular properties, as well as the N-terminal amino acid sequence. Further comparison of the amino acid sequences of lactose oxidizing enzymes indicated that carbohydrate:acceptor oxidoreductases belong to the same group as glucooligosaccharide oxidase, while they differ from cellobiose dehydrogenases and cellobiose:quinone oxidoreductases. PMID:18323642

  17. 2′-Fluoro-modified phosphorothioate oligonucleotide can cause rapid degradation of P54nrb and PSF

    PubMed Central

    Shen, Wen; Liang, Xue-hai; Sun, Hong; Crooke, Stanley T.

    2015-01-01

    Synthetic oligonucleotides are used to regulate gene expression through different mechanisms. Chemical modifications of the backbone of the nucleic acid and/or of the 2′ moiety of the ribose can increase nuclease stability and/or binding affinity of oligonucleotides to target molecules. Here we report that transfection of 2′-F-modified phosphorothioate oligonucleotides into cells can reduce the levels of P54nrb and PSF proteins through proteasome-mediated degradation. Such deleterious effects of 2′-F-modified oligonucleotides were observed in different cell types from different species, and were independent of oligonucleotide sequence, positions of the 2′-F-modified nucleotides in the oligonucleotides, method of delivery or mechanism of action of the oligonucleotides. Four 2′-F-modified nucleotides were sufficient to cause the protein reduction. P54nrb and PSF belong to Drosophila behavior/human splicing (DBHS) family. The third member of the family, PSPC1, was also reduced by the 2′-F-modified oligonucleotides. Preferential association of 2′-F-modified oligonucleotides with P54nrb was observed, which is partially responsible for the protein reduction. Consistent with the role of DBHS proteins in double-strand DNA break (DSB) repair, elevated DSBs were observed in cells treated with 2′-F-modified oligonucleotides, which contributed to severe impairment in cell proliferation. These results suggest that oligonucleotides with 2′-F modifications can cause non-specific loss of cellular protein(s). PMID:25855809

  18. Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.

    PubMed

    Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro

    2016-02-19

    A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS. PMID:26845521

  19. Antisense c-myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo

    NASA Astrophysics Data System (ADS)

    Simons, Michael; Edelman, Elazer R.; Dekeyser, Jean-Luc; Langer, Robert; Rosenberg, Robert D.

    1992-09-01

    SYNTHETIC antisense oligonucleotides have been used to dissect gene function in vitro. Technical difficulties prevented the use of this approach for investigating the effect of gene products in vivo. Here we report the use of local delivery of antisense c-myb oligonu-cleotide to suppress intimal accumulation of rat carotid arterial smooth muscle cells. Our results suggest that antisense oligonucleotides can be used to define the in vivo biological role of specific macromolecules in the blood vessel wall and could potentially serve as a new class of therapeutic agents for cardiovascular disorders.

  20. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  1. Regulation of human dihydrodiol dehydrogenase by Michael acceptor xenobiotics.

    PubMed

    Ciaccio, P J; Jaiswal, A K; Tew, K D

    1994-06-01

    A human oxidoreductase (H-37) that is overexpressed in ethacrynic acid-resistant HT29 colon cells (Ciaccio, P. J., Stuart, J.E., and Tew, K.D. (1993) Mol. Pharmacol. 43, 845-853) has been identified as a dihydrodiol dehydrogenase. Translated protein from a dihydrodiol dehydrogenase cDNA isolated from a library prepared from ethacrynic acid-resistant HT29 cell poly(A+) RNA was recognized by anti-H-37 IgG and was identical in molecular weight with H-37. The isolated cDNA was identical in both nucleotide and amino acid sequences with the recently cloned liver dihydrodiol dehydrogenase (Stolz, A., Hammond, L., Lou, H., Takikawa, H., Ronk, M., and Shively, J.E. (1993) J. Biol. Chem. 268, 10448-10457). Using this cDNA as probe, we have examined its induction by Michael acceptors. The steady state dihydrodiol dehydrogenase mRNA level in the ethacrynic acid-resistant line was increased 30-fold relative to that of wild-type cells. Twenty-four hour treatment of wild-type cells with ethacrynic acid or dimethyl maleate increased mRNA 10-fold and 5-fold, respectively. These changes are accompanied by both increased protein expression and increased NADP-dependent 1-acenaphthenol oxidative activity in cell cytosol. In gel shift assays, compared to wild type controls, increased binding of NAD(P)H quinone oxidoreductase human antioxidant response element (hARE) DNA to redox labile protein complexes present in treated and resistant cell nuclear extract was observed. Ethacrynic acid induced CAT activity 2-fold in Hepa1 cells stably transfected with NAD(P)H quinone oxidoreductase hARE-tk-CAT chimeric gene construct. Thus, dihydrodiol dehydrogenase protein is inducible by de novo synthesis from mRNA by structurally related monofunctional inducer Michael acceptors. Altered in vitro binding of nuclear protein to the hARE is indirect evidence for the involvement of an element similar to hARE in the regulation of dihydrodiol dehydrogenase by these agents. PMID:7515059

  2. Phosphonomethyl analogues of hexose phosphates.

    PubMed

    Webster, D; Jondorf, W R; Dixon, H B

    1976-05-01

    The analogue of fructose 1,6-bisphosphate in which the phosphate group, -O-PO3H2, on C-6 is replaced by the phosphonomethyl group, -CH2-PO3H2, was made enzymically from the corresponding analogue of 3-phosphoglycerate. It was a substrate for aldolase, which was used to form it, but not for fructose 1,6-bisphosphatase. It was hydrolysed chemically to yield the corresponding analogue of fructose 6-phosphate [i.e. 6-deoxy-6-(phosphonomethyl)-D-fructose, or, more strictly, 6,7-dideoxy-7-phosphono-D-arabino-2-heptulose]. This proved to be a substrate for the sequential actions of glucose 6-phosphate isomerase, glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase. Thus seven out of the nine enzymes of the glycolytic and pentose phosphate pathways so far tested catalyse the reactions of the phosphonomethyl isosteres of their substrates. PMID:7247

  3. Swift Electrofluorochromism of Donor-Acceptor Conjugated Polytriphenylamines.

    PubMed

    Sun, Jingwei; Liang, Ziqi

    2016-07-20

    Electrofluorochromic (EFC) materials, which exhibit electrochemically controllable fluorescence, hold great promise in optoelectronic devices and biological analysis. Here we design such donor-acceptor (D-A) conjugated polymers-P(TPACO) and P(TCEC)-that contain the same electron-rich and oxidizable polytriphenylamine (PTPA) as π-backbone, yet with different electron-deficient ketone and cyano units as pendant groups, respectively. They both exhibit solvatochromic effects due to intrinsic characteristics of intramolecular charge transfer (ICT). Compared to P(TPACO), P(TCEC) shows stronger ICT, which leads to higher electrochemical oxidation potential and lower ion diffusion coefficient. Moreover, both polymers present simultaneous electrochromic (EC) and EFC behaviors with multistate display and remarkably rapid fluorescence response. The response time of P(TPACO) is as short as 0.19 s, nearly 4-fold faster than that of P(TCEC) (0.92 s). Such rapid response is found to be determined by the ion diffusion coefficient which is associated with the ICT nature. Finally, the EFC display device based on P(TPACO) is successfully demonstrated, which shows green fluorescence ON/OFF switching upon applied potentials. This work has successfully demonstrated that swift EFCs can be achieved by rational modulation of the ICT effect in such D-A conjugated polymers. PMID:27347724

  4. Ultrafast Energy Transfer in Ultrathin Organic Donor/Acceptor Blend

    PubMed Central

    Kandada, Ajay Ram Srimath; Grancini, Giulia; Petrozza, Annamaria; Perissinotto, Stefano; Fazzi, Daniele; Raavi, Sai Santosh Kumar; Lanzani, Guglielmo

    2013-01-01

    It is common knowledge that poly(3-hexylthiophene) (P3HT)/[6,6]-phenyl-C61-butyric acid methyl ester (PCBM) blend, a prototype system for bulk heterojunction (BHJ) solar cells, consists of a network of tens of nanometers-large donor-rich and acceptor-rich phases separated by extended finely intermixed border regions where PCBM diffuse into P3HT. Here we specifically address the photo-induced dynamics in a 10 nm thin P3HT/PCBM blend that consists of the intermixed region only. Using the multi-pass transient absorption technique (TrAMP) that enables us to perform ultra high sensitive measurements, we find that the primary process upon photoexcitation is ultrafast energy transfer from P3HT to PCBM. The expected charge separation due to hole transfer from PCBM to P3HT occurs in the 100 ps timescale. The derived picture is much different from the accepted view of ultra-fast electron transfer at the polymer/PCBM interface and provides new directions for the development of efficient devices. PMID:23797845

  5. Poly(trifluoromethyl)azulenes: structures and acceptor properties

    SciTech Connect

    Clikeman, Tyler T.; Bukovsky, Eric V.; Kuvychko, Igor V.; San, Long K.; Deng, Shihu; Wang, Xue B.; Chen, Yu-Sheng; Strauss, Steven H.; Boltalina, Olga V.

    2014-07-10

    Azulene is a non-alternant, non-benzenoid aromatic hydrocarbon with an intense blue colour, a dipole moment of 1.0 D,1 positive electron affinity, and an “anomalous” emission from the second excited state in violation of Kasha’s rule.2,3 Azulene’s unique properties have potential uses in molecular switches,4,5 molecular diodes,6 organic photovoltaics,7 and charge transfer complexes.8-12 Introduction of electron-withdrawing groups to the azulenic core, such as CN,8,13,14 halogens,15-19 and CF3,20,21 can enhance certain electrical and photophysical properties. In this work, we report six new trifluoromethyl derivatives of azulene (AZUL), three isomers of AZUL(CF3)3 and three isomers of AZUL(CF3)4, and the first X-ray structure of a π-stacked donor-acceptor complex of a trifluoromethyl azulene with donor pyrene.

  6. Potassium acceptor doping of ZnO crystals

    SciTech Connect

    Parmar, Narendra S. Lynn, K. G.; Corolewski, Caleb D.; McCluskey, Matthew D.

    2015-05-15

    ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ∼1 × 10{sup 16} cm{sup −3}. IR measurements show a local vibrational mode (LVM) at 3226 cm{sup −1}, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O–H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm{sup −1}. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  7. Molecular insights into the terminal energy acceptor in cyanobacterial phycobilisome.

    PubMed

    Gao, Xiang; Wei, Tian-Di; Zhang, Nan; Xie, Bin-Bin; Su, Hai-Nan; Zhang, Xi-Ying; Chen, Xiu-Lan; Zhou, Bai-Cheng; Wang, Zhi-Xin; Wu, Jia-Wei; Zhang, Yu-Zhong

    2012-09-01

    The linker protein L(CM) (ApcE) is postulated as the major component of the phycobilisome terminal energy acceptor (TEA) transferring excitation energy from the phycobilisome to photosystem II. L(CM) is the only phycobilin-attached linker protein in the cyanobacterial phycobilisome through auto-chromophorylation. However, the underlying mechanism for the auto-chromophorylation of L(CM) and the detailed molecular architecture of TEA is still unclear. Here, we demonstrate that the N-terminal phycobiliprotein-like domain of L(CM) (Pfam00502, LP502) can specifically recognize phycocyanobilin (PCB) by itself. Biochemical assays indicated that PCB binds into the same pocket in LP502 as that in the allophycocyanin α-subunit and that Ser152 and Asp155 play a vital role in LP502 auto-chromophorylation. By carefully conducting computational simulations, we arrived at a rational model of the PCB-LP502 complex structure that was supported by extensive mutational studies. In the PCB-LP502 complex, PCB binds into a deep pocket of LP502 with a distorted conformation, and Ser152 and Asp155 form several hydrogen bonds to PCB fixing the PCB Ring A and Ring D. Finally, based on our results, the dipoles and dipole-dipole interactions in TEA are analysed and a molecular structure for TEA is proposed, which gives new insights into the energy transformation mechanism of cyanobacterial phycobilisome. PMID:22758351

  8. Analysis of nonlinear optical properties in donor–acceptor materials

    SciTech Connect

    Day, Paul N.; Pachter, Ruth; Nguyen, Kiet A.

    2014-05-14

    Time-dependent density functional theory has been used to calculate nonlinear optical (NLO) properties, including the first and second hyperpolarizabilities as well as the two-photon absorption cross-section, for the donor-acceptor molecules p-nitroaniline and dimethylamino nitrostilbene, and for respective materials attached to a gold dimer. The CAMB3LYP, B3LYP, PBE0, and PBE exchange-correlation functionals all had fair but variable performance when compared to higher-level theory and to experiment. The CAMB3LYP functional had the best performance on these compounds of the functionals tested. However, our comprehensive analysis has shown that quantitative prediction of hyperpolarizabilities is still a challenge, hampered by inadequate functionals, basis sets, and solvation models, requiring further experimental characterization. Attachment of the Au{sub 2}S group to molecules already known for their relatively large NLO properties was found to further enhance the response. While our calculations show a modest enhancement for the first hyperpolarizability, the enhancement of the second hyperpolarizability is predicted to be more than an order of magnitude.

  9. Potassium acceptor doping of ZnO crystals

    NASA Astrophysics Data System (ADS)

    Parmar, Narendra S.; Corolewski, Caleb D.; McCluskey, Matthew D.; Lynn, K. G.

    2015-05-01

    ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ˜1 × 1016 cm-3. IR measurements show a local vibrational mode (LVM) at 3226 cm-1, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O-H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm-1. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  10. Ultrafast Energy Transfer in Ultrathin Organic Donor/Acceptor Blend

    NASA Astrophysics Data System (ADS)

    Kandada, Ajay Ram Srimath; Grancini, Giulia; Petrozza, Annamaria; Perissinotto, Stefano; Fazzi, Daniele; Raavi, Sai Santosh Kumar; Lanzani, Guglielmo

    2013-06-01

    It is common knowledge that poly(3-hexylthiophene) (P3HT)/[6,6]-phenyl-C61-butyric acid methyl ester (PCBM) blend, a prototype system for bulk heterojunction (BHJ) solar cells, consists of a network of tens of nanometers-large donor-rich and acceptor-rich phases separated by extended finely intermixed border regions where PCBM diffuse into P3HT. Here we specifically address the photo-induced dynamics in a 10 nm thin P3HT/PCBM blend that consists of the intermixed region only. Using the multi-pass transient absorption technique (TrAMP) that enables us to perform ultra high sensitive measurements, we find that the primary process upon photoexcitation is ultrafast energy transfer from P3HT to PCBM. The expected charge separation due to hole transfer from PCBM to P3HT occurs in the 100 ps timescale. The derived picture is much different from the accepted view of ultra-fast electron transfer at the polymer/PCBM interface and provides new directions for the development of efficient devices.

  11. Sphingosine 1-phosphate signalling.

    PubMed

    Mendelson, Karen; Evans, Todd; Hla, Timothy

    2014-01-01

    Sphingosine 1-phosphate (S1P) is a lipid mediator formed by the metabolism of sphingomyelin. In vertebrates, S1P is secreted into the extracellular environment and signals via G protein-coupled S1P receptors to regulate cell-cell and cell-matrix adhesion, and thereby influence cell migration, differentiation and survival. The expression and localization of S1P receptors is dynamically regulated and controls vascular development, vessel stability and immune cell trafficking. In addition, crucial events during embryogenesis, such as angiogenesis, cardiogenesis, limb development and neurogenesis, are regulated by S1P signalling. Here, and in the accompanying poster, we provide an overview of S1P signalling in development and in disease. PMID:24346695

  12. Templated, layered manganese phosphate

    DOEpatents

    Thoma, Steven G.; Bonhomme, Francois R.

    2004-08-17

    A new crystalline maganese phosphate composition having an empirical formula: O). The compound was determined to crystallize in the trigonal space group P-3c1 with a=8.8706(4) .ANG., c=26.1580(2) .ANG., and V (volume)=1783 .ANG..sup.3. The structure consists of sheets of corner sharing Mn(II)O.sub.4 and PO.sub.4 tetrahedra with layers of (H.sub.3 NCH.sub.2 CH.sub.2).sub.3 N and water molecules in-between. The pronated (H.sub.3 NCH.sub.2 CH.sub.2).sub.3 N molecules provide charge balancing for the inorganic sheets. A network of hydrogen bonds between water molecules and the inorganic sheets holds the structure together.

  13. Light weight phosphate cements

    DOEpatents

    Wagh, Arun S.; Natarajan, Ramkumar,; Kahn, David

    2010-03-09

    A sealant having a specific gravity in the range of from about 0.7 to about 1.6 for heavy oil and/or coal bed methane fields is disclosed. The sealant has a binder including an oxide or hydroxide of Al or of Fe and a phosphoric acid solution. The binder may have MgO or an oxide of Fe and/or an acid phosphate. The binder is present from about 20 to about 50% by weight of the sealant with a lightweight additive present in the range of from about 1 to about 10% by weight of said sealant, a filler, and water sufficient to provide chemically bound water present in the range of from about 9 to about 36% by weight of the sealant when set. A porous ceramic is also disclosed.

  14. Carboranyl Nucleosides & Oligonucleotides for Neutron Capture Therapy Final Report

    SciTech Connect

    Schinazi, Raymond F.

    2004-12-01

    This proposal enabled us to synthesize and develop boron-rich nucleosides and oligonucleotide analogues for boron neutron capture therapy (BNCT) and the treatment of various malignancies. First, we determined the relationship between structure, cellular accumulation and tissue distribution of 5-o-carboranyl-2'-deoxyuridine (D-CDU) and its derivatives D-ribo-CU and 5-o-carboranyluracil (CU), to potentially target brain and other solid tumors for neutron capture therapy. Synthesized carborane containing nucleoside derivatives of CDU, D- and L-enantiomers of CDU, D-ribo-CU and CU were used. We measured tissue disposition in xenografted mice bearing 9479 human prostate tumors xenografts and in rats bearing 9L gliosarcoma isografts in their flanks and intracranially. The accumulation of D-CDU, 1-({beta}-L-arabinosyl)-5-o-carboranyluracil, D-ribo-CU, and CU were also studied in LnCap human prostate tumor cells and their retention was measured in male nude mice bearing LnCap and 9479 human prostate tumor xenografts. D-CDU, D-ribo-CU and CU levels were measured after administration in mice bearing 9479 human prostate tumors in their flanks. D-CDU achieved high cellular concentrations in LnCap cells and up to 2.5% of the total cellular compound was recovered in the 5'-monophosphorylated form. D-CDU cellular concentrations were similar in LnCap and 9479 tumor xenografts. Studies in tumor bearing animals indicated that increasing the number of hydroxyl moieties in the sugar constituent of the carboranyl nucleosides lead to increased rate and extent of renal elimination, a decrease in serum half-lives and an increased tissue specificity. Tumor/brain ratios were greatest for CDU and D-ribo-CU, while tumor/prostate ratios were greatest with CU. CDU and D-ribo-CU have potential for BNCT of brain malignancies, while CU may be further developed for prostate cancer. A method was developed for the solid phase synthesis of oligonucleotides containing (ocarboran-1-yl

  15. Rates of primary electron transfer reactions in the photosystem I reaction center reconstituted with different quinones as the secondary acceptor

    SciTech Connect

    Kumazaki, Shigeichi; Kandori, Hideki; Yoshihara, Keitaro ); Iwaki, Masayo; Itoh, Shigeru ); Ikegamu, Isamu )

    1994-10-27

    Rates of sequential electron transfer reactions from the primary electron donor chlorophyll dimer (P700) to the electron acceptor chlorophyll a-686 (A[sub 0]) and to the secondary acceptor quinone (Q[sub [phi

  16. Synthesis of eight-arm, branched oligonucleotide hybrids and studies on the limits of DNA-driven assembly.

    PubMed

    Schwenger, Alexander; Gerlach, Claudia; Griesser, Helmut; Richert, Clemens

    2014-12-01

    Oligonucleotide hybrids with organic cores as rigid branching elements and four or six CG dimer strands have been shown to form porous materials from dilute aqueous solution. In order to explore the limits of this form of DNA-driven assembly, we prepared hybrids with three or eight DNA arms via solution-phase syntheses, using H-phosphonates of protected dinucleoside phosphates. This included the synthesis of (CG)8TREA, where TREA stands for the tetrakis[4-(resorcin-5-ylethynyl)phenyl]adamantane core. The ability of the new compounds to assemble in a DNA-driven fashion was studied by UV-melting analysis and NMR, using hybrids with self-complementary CG zipper arms or non-self-complementary TC dimer arms. The three-arm hybrid failed to form a material under conditions where four-arm hybrids did so. Further, the assembly of TREA hybrids appears to be dominated by hydrophobic interactions, not base pairing of the DNA arms. These results help in the design of materials forming by multivalent DNA-DNA interactions. PMID:25407332

  17. A Polyethylenimine-Containing and Transferrin-Conjugated Lipid Nanoparticle System for Antisense Oligonucleotide Delivery to AML

    PubMed Central

    Yuan, Yiming; Zhang, Lijing; Cao, Hua; Yang, Yi; Zheng, Yu; Yang, Xiao-juan

    2016-01-01

    Limited success of antisense oligonucleotides (ASO) in clinical anticancer therapy calls for more effective delivery carriers. The goal of this study was to develop a nanoparticle system for delivery of ASO G3139, which targets mRNA of antiapoptotic protein Bcl-2, to acute myeloid leukemia (AML) cells. The synthesized nanoparticle Tf-LPN-G3139 contained a small molecular weight polyethylenimine and two cationic lipids as condensing agents, with transferrin on its surface for selective binding and enhanced cellular uptake. The optimized nitrogen to phosphate (N/P) ratio was 4 to achieve small particle size and high G3139 entrapment efficiency. The Tf-LPN-G3139 exhibited excellent colloidal stability during storage for at least 12 weeks and remained intact for 4 hours in nuclease-containing serum. The cellular uptake results showed extensive internalization of fluorescence-labelled G3139 in MV4-11 cells through Tf-LPN. Following transfection, Tf-LPN-G3139 at 1 µM ASO level induced 54% Bcl-2 downregulation and >20-fold apoptosis compared to no treatment. When evaluated in mice bearing human xenograft AML tumors, Tf-LPN-G3139 suppressed tumor growth by ~60% at the end of treatment period, accompanied by remarkable pharmacological effect of Bcl-2 inhibition in tumor. In conclusion, Tf-LPN-G3139 is a promising nanoparticle system for ASO G3139 delivery to AML and warrants further investigations. PMID:27034925

  18. The Fidelity of Template-Directed Oligonucleotide Ligation and the Inevitability of Polymerase Function

    NASA Astrophysics Data System (ADS)

    James, Kenneth D.; Ellington, Andrew D.

    1999-08-01

    The first living systems may have employed template-directed oligonucleotide ligation for replication. The utility of oligonucleotide ligation as a mechanism for the origin and evolution of life is in part dependent on its fidelity. We have devised a method for evaluating ligation fidelity in which ligation substrates are selected from random sequence libraries. The fidelities of chemical and enzymatic ligation are compared under a variety of conditions. While reaction conditions can be found that promote high fidelity copying, departure from these conditions leads to error-prone copying. In particular, ligation reactions with shorter oligonucleotide substrates are less efficient but more faithful. These results support a model for origins in which there was selective pressure for template-directed oligonucleotide ligation to be gradually supplanted by mononucleotide polymerization.

  19. On-line coupling of capillary gel electrophoresis with electrospray mass spectrometry for oligonucleotide analysis.

    PubMed

    Freudemann, T; von Brocke, A; Bayer, E

    2001-06-01

    Homooligodeoxyribonucleotides differing one nucleotide in length from 12- to 15-mer and from 17- to 20-mer were separated by size with capillary gel electrophoresis (CGE) using an entangled polymer solution in coated capillaries. The resolved components were analyzed by on-line coupling of CGE with electrospray mass spectrometry (ES-MS), denoted as CGE/ES-MS, in the full-scan negative ion detection mode. Baseline separation was achieved for the 12-15-mer oligonucleotide mixtures. Both synthetic phosphodiester oligonucleotide mixtures as well as their phosphorothioate analogues, serving as model compounds for antisense oligonucleotides, could be analyzed by on-line CGE/ES-MS coupling. Terminally phosphorylated and nonphosphorylated synthetic failure sequences could be electrophoretically separated and mass spectrometically characterized as well. This methodology might be a useful tool for synthesis control of phosphodiester oligonucleotides as well as for analysis of phosphorothioate analogues as they are used in antisense drug development. PMID:11403304

  20. Synthesis and thermodynamics of oligonucleotides containing chirally pure R(P) methylphosphonate linkages.

    PubMed Central

    Reynolds, M A; Hogrefe, R I; Jaeger, J A; Schwartz, D A; Riley, T A; Marvin, W B; Daily, W J; Vaghefi, M M; Beck, T A; Knowles, S K; Klem, R E; Arnold, L J

    1996-01-01

    Methylphosphonate (MP) oligodeoxynucleotides (MPOs) are metabolically stable analogs of conventional DNA containing a methyl group in place of one of the non-bonding phosphoryl oxygens. All 16 possible chiral R(P) MP dinucleotides were synthesized and derivatized for automated oligonucleotide synthesis. These dimer synthons can be used to prepare (i) all-MP linked oligonucleotides having defined R(P) chirality at every other position (R(P) chirally enriched MPOs) or (ii) alternating R(P) MP/phosphodiester backbone oligonucleotides, depending on the composition of the 3'-coupling group. Chirally pure dimer synthons were also prepared with 2'-O-methyl sugar modifications. Oligonucleotides prepared with these R(P) chiral methylphosphonate linkage synthons bind RNA with significantly higher affinity than racemic MPOs. PMID:8948653

  1. Use of synthetic oligonucleotides for genomic DNA dot hybridization to split the DQw3 haplotype.

    PubMed Central

    Martell, M; Le Gall, I; Millasseau, P; Dausset, J; Cohen, D

    1988-01-01

    Comparison of two different HLA-DQ beta gene sequences from two DR4 individuals, probably corresponding to DQw3.2 (DQR4) and DQw3.1 (DQR5) specificities, has shown several nucleotide variations. Eight oligonucleotides (24 bases long), derived from these polymorphic areas, have been synthesized. Each oligonucleotide was hybridized to BamHI-digested DNA samples from eight families with HLA-DR4 individuals. Four polymorphic BamHI fragments were detected. Two of eight oligonucleotides gave a single signal (8.9 kilobases) on DQw3.2-positive haplotypes. We used one of these oligonucleotides in a genomic DNA dot hybridization and detected a hybridization signal only in DQw3.2-positive individuals. A very simple test like this allows the screening of a large population sample within a very short period. Images PMID:2895927

  2. Sequence identity of the n-1 product of a synthetic oligonucleotide.

    PubMed Central

    Temsamani, J; Kubert, M; Agrawal, S

    1995-01-01

    After synthesis and purification of an oligonucleotide, the final product usually contains a low level of n-1 congeneric species. We have sequenced the n-1 population of a 25mer phosphodiester oligonucleotide. The n-1 band was cut from the gel and eluted. Oligonucleotides were tailed with dA and annealed to a dT-tailed plasmid. The recombinant plasmid was ligated and used to transform competent bacteria. Our results show that the n-1 population was heterogeneous. The frequency of truncated nucleotides at the 3'-end was much higher than at the 5'-end of the oligomer. No truncated nucleotides were found in the last four nucleotides at the 5'-end. Our results also show that the chain of oligonucleotides can grow on unreacted sites of a controlled-pore glass support. Images PMID:7596808

  3. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .... (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance produced by the growth of Streptomyces erythreus or the same antibiotic substance produced by any other...

  4. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .... (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance produced by the growth of Streptomyces erythreus or the same antibiotic substance produced by any other...

  5. New organic donor-acceptor-π-acceptor sensitizers for efficient dye-sensitized solar cells and photocatalytic hydrogen evolution under visible-light irradiation.

    PubMed

    Li, Xing; Cui, Shicong; Wang, Dan; Zhou, Ying; Zhou, Hao; Hu, Yue; Liu, Jin-Gang; Long, Yitao; Wu, Wenjun; Hua, Jianli; Tian, He

    2014-10-01

    Two organic donor-acceptor-π-acceptor (D-A-π-A) sensitizers (AQ and AP), containing quinoxaline/pyrido[3,4-b]pyrazine as the auxiliary acceptor, have been. Through fine-tuning of the auxiliary acceptor, a higher designed and synthesized photoelectric conversion efficiency of 6.02% for the AQ-based dye-sensitized solar cells under standard global AM1.5 solar conditions was achieved. Also, it was found that AQ-Pt/TiO2 photocatalysts displayed a better rate of H2 evolution under visible-light irradiation (420 nm<λ<780 nm) because of the stability of the oxidized states and the lower rates of electron recombination. Importantly, sensitizers AQ and AP-Pt/TiO2 showed strong photocatalytic activity during continuous light soaking for 10 h with methanol as the sacrificial electron donor. Additionally, the processes of their intermolecular electron transfer were further investigated theoretically by using time-dependent DFT. The calculated results indicate that the auxiliary acceptor plays the role of an electron trap and results in broad spectral responses. PMID:25154958

  6. Analysis of Shewanella oneidensis Membrane Protein Expression in Response to Electron Acceptor Availability

    SciTech Connect

    Giometti, Carol S.; Khare, Tripti; Verberkmoes, Nathan; O'Loughlin, Ed; Lindberg, Carl; Thompson, Melissa; Hettich, Robert

    2006-04-05

    Shewanella oneidensis MR-1, a gram negative metal-reducing bacterium, can utilize a large number of electron acceptors. In the natural environment, S. oneidensis utilizes insoluble metal oxides as well as soluble terminal electron acceptors. The purpose of this ERSP project is to identify differentially expressed proteins associated with the membranes of S. oneidensis MR-1 cells grown with different electron acceptors, including insoluble metal oxides. We hypothesize that through the use of surface labeling, subcellular fractionation, and a combination of proteome analysis tools, proteins involved in the reduction of different terminal electron acceptors will be elucidated. We are comparing the protein profiles from cells grown with the soluble electron acceptors oxygen and fumarate and with those from cells grown with the insoluble iron oxides goethite, ferrihydrite and lepidocrocite. Comparison of the cell surface proteins isolated from cells grown with oxygen or anaerobically with fumarate revealed an increase in the abundance of over 25 proteins in anaerobic cells, including agglutination protein and flagellin proteins along with the several hypothetical proteins. In addition, the surface protein composition of cells grown with the insoluble iron oxides varies considerably from the protein composition observed with either soluble electron acceptor as well as between the different insoluble acceptors.

  7. Diversity of sugar acceptor of glycosyltransferase 1 from Bacillus cereus and its application for glucoside synthesis.

    PubMed

    Chiu, Hsi-Ho; Shen, Mo-Yuan; Liu, Yuan-Ting; Fu, Yu-Lieh; Chiu, Yu-An; Chen, Ya-Huei; Huang, Chin-Ping; Li, Yaw-Kuen

    2016-05-01

    Glycosyltransferase 1 from Bacillus cereus (BcGT1) catalyzes the transfer of a glucosyl moiety from uridine diphosphate glucose (UDP-glucose) to various acceptors; it was expressed and characterized. The specificity of acceptors was found to be broad: more than 20 compounds classified into O-, S-, and N-linkage glucosides can be prepared with BcGT1 catalysis. Based on this work, we conclude that the corresponding acceptors of these compounds must possess the following features: (1) the acceptors must contain at least one aromatic or fused-aromatic or heteroaromatic ring; (2) the reactive hydroxyl or sulfhydryl or amino group can attach either on the aromatic ring or on its aliphatic side chain; and (3) the acceptors can be a primary, secondary, or even a tertiary amine. Four representative acceptors-fluorescein methyl ester, 17-β-estradiol, 7-mercapto-4-methylcoumarin, and 6-benzylaminopurine-were chosen as a candidate acceptor for O-, S-, and N-glucosidation, respectively. These enzymatic products were purified and the structures were confirmed with mass and NMR spectra. As all isolated glucosides are β-anomers, BcGT1 is confirmed to be an inverting enzyme. This study not only demonstrates the substrate promiscuity of BcGT1 but also showed the great application prospect of this enzyme in bioconversion of valuable bioactive molecules. PMID:26795959

  8. Complexes of carbon nanotubes with oligonucleotides in thin Langmuir-Blodgett films to detect electrochemically hybridization

    NASA Astrophysics Data System (ADS)

    Egorov, A. S.; Egorova, V. P.; Krylova, H. V.; Lipnevich, I. V.; Orekhovskaya, T. I.; Veligura, A. A.; Govorov, M. I.; Shulitsky, B. G.

    2014-10-01

    Self-assembled complexes consisting of thin multi-walled carbon nanotubes (MWCNTs) and DNA-oligonucleotides which are able to a cooperative binding to complementary oligonucleotides have been investigated. It was establised a high-performance charge transport in nanostructured Langmuir-Blodgett complexes thin MWCNTs/DNA. A method to electrochemically detect DNA hybridization on the self-organized structures has been proposed.

  9. Cationic nanoemulsion as a delivery system for oligonucleotides targeting malarial topoisomerase II.

    PubMed

    Bruxel, F; Cojean, S; Bochot, A; Teixeira, H; Bories, C; Loiseau, P-M; Fattal, E

    2011-09-20

    A promising strategy based on the antisense oligonucleotides against the Plasmodium falciparum topoisomerase II has been considered using cationic nanoemulsion as oligonucleotide delivery system. Phosphodiester and chemically modified phosphorothioate oligonucleotides bearing negative charges were adsorbed on positively charged emulsion composed of medium chain triglycerides, egg lecithin, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), and water, at different +/- charge ratios (positive charges from cationic lipid/negative charges from oligonucleotide): +0.5/-, +2/-, +4/- and +6/-. The physicochemical properties of the complexes were determined, as well as their stability in culture medium. Their interaction with erythrocytes through hemolysis, binding experiments and confocal microscopy were also evaluated. Finally, the in vitro evaluation of parasite growth and reinfection capacity was performed. The overall results showed that antisense oligonucleotides against P. falciparum topoisomerase II gene can be efficiently adsorbed onto a cationic nanoemulsion forming complexes. Whereas unloaded nanoemulsion displayed an hemolytic effect due to the presence of the cationic lipid, this was not the case of loaded nanoemulsion at low +/- ratios. Oligonucleotide-loaded nanoemulsions were found to be located inside the infected erythrocytes, inhibiting efficiently parasite growth (until 80%) and causing a delay in P. falciparum life cycle. PMID:21291974

  10. Fragment-based solid-phase assembly of oligonucleotide conjugates with peptide and polyethylene glycol ligands.

    PubMed

    Dirin, Mehrdad; Urban, Ernst; Noe, Christian R; Winkler, Johannes

    2016-10-01

    Ligand conjugation to oligonucleotides is an attractive strategy for enhancing the therapeutic potential of antisense and siRNA agents by inferring properties such as improved cellular uptake or better pharmacokinetic properties. Disulfide linkages enable dissociation of ligands and oligonucleotides in reducing environments found in endosomal compartments after cellular uptake. Solution-phase fragment coupling procedures for producing oligonucleotide conjugates are often tedious, produce moderate yields and reaction byproducts are frequently difficult to remove. We have developed an improved method for solid-phase coupling of ligands to oligonucleotides via disulfides directly after solid-phase synthesis. A 2'-thiol introduced using a modified nucleotide building block was orthogonally deprotected on the controlled pore glass solid support with N-butylphosphine. Oligolysine peptides and a short monodisperse ethylene glycol chain were successfully coupled to the deprotected thiol. Cleavage from the resin and full removal of oligonucleotide protection groups were achieved using methanolic ammonia. After standard desalting, and without further purification, homogenous conjugates were obtained as demonstrated by HPLC, gel electrophoresis, and mass spectrometry. The attachment of both amphiphilic and cationic ligands proves the versatility of the conjugation procedure. An antisense oligonucleotide conjugate with hexalysine showed pronounced gene silencing in a cell culture tumor model in the absence of a transfection reagent and the corresponding ethylene glycol conjugate resulted in down regulation of the target gene to nearly 50% after naked application. PMID:27236069

  11. In vitro characterization of two novel biodegradable vectors for the delivery of radiolabeled antisense oligonucleotides.

    PubMed

    von Guggenberg, Elisabeth; Shahhosseini, Soraya; Koslowsky, Ingrid; Lavasanifar, Afsaneh; Murray, David; Mercer, John

    2010-12-01

    The development of antisense oligonucleotides suitable for tumor targeting applications is hindered by low stability and bioavailability of oligonucleotides in vivo and by the absence of efficient and safe vectors for oligonucleotide delivery. Stabilization in vivo has been achieved through chemical modification of oligonucleotides by various means, but effective approaches to enhance their intracellular delivery are lacking. This study reports on the characterization in vitro of a fully phosphorothioated 20-mer oligonucleotide, complementary to p21 mRNA, radiolabeled with fluorine-18 using a thiol reactive prosthetic group. The potential of two novel synthetic block copolymers containing grafted polyamines on their hydrophobic blocks for vector-assisted cell delivery was studied in vitro. Extensive cellular uptake studies were performed in human colon carcinoma cell lines with enhanced or deficient p21 expression to evaluate and compare the uptake mechanism of naked and vectorized radiolabeled formulations. Uptake studies with the two novel biodegradable vectors showed a moderate increase in cell uptake of the radiofluorinated antisense oligonucleotide. The two vectors show, however, promising advantages over conventional lipidic vectors regarding their biocompatibility and subcellular distribution. PMID:21204767

  12. Peptide nanoparticle delivery of charge-neutral splice-switching morpholino oligonucleotides.

    PubMed

    Järver, Peter; Zaghloul, Eman M; Arzumanov, Andrey A; Saleh, Amer F; McClorey, Graham; Hammond, Suzan M; Hällbrink, Mattias; Langel, Ülo; Smith, C I Edvard; Wood, Matthew J A; Gait, Michael J; El Andaloussi, Samir

    2015-04-01

    Oligonucleotide analogs have provided novel therapeutics targeting various disorders. However, their poor cellular uptake remains a major obstacle for their clinical development. Negatively charged oligonucleotides, such as 2'-O-Methyl RNA and locked nucleic acids have in recent years been delivered successfully into cells through complex formation with cationic polymers, peptides, liposomes, or similar nanoparticle delivery systems. However, due to the lack of electrostatic interactions, this promising delivery method has been unsuccessful to date using charge-neutral oligonucleotide analogs. We show here that lipid-functionalized cell-penetrating peptides can be efficiently exploited for cellular transfection of the charge-neutral oligonucleotide analog phosphorodiamidate morpholino. The lipopeptides form complexes with splice-switching phosphorodiamidate morpholino oligonucleotide and can be delivered into clinically relevant cell lines that are otherwise difficult to transfect while retaining biological activity. To our knowledge, this is the first study to show delivery through complex formation of biologically active charge-neutral oligonucleotides by cationic peptides. PMID:25594433

  13. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.

    PubMed

    Beaucage, S L

    2001-08-01

    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips. PMID:11472237

  14. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells.

    PubMed

    Kotula, Jonathan W; Pratico, Elizabeth D; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L; Sullenger, Bruce A

    2012-06-01

    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  15. Improved DNA microarray detection sensitivity through immobilization of preformed in solution streptavidin/biotinylated oligonucleotide conjugates.

    PubMed

    Mavrogiannopoulou, E; Petrou, P S; Koukouvinos, G; Yannoukakos, D; Siafaka-Kapadai, A; Fornal, K; Awsiuk, K; Budkowski, A; Kakabakos, S E

    2015-04-01

    A novel immobilization approach involving binding of preformed streptavidin/biotinylated oligonucleotide conjugates onto surfaces coated with biotinylated bovine serum albumin is presented. Microarrays prepared according to the proposed method were compared, in terms of detection sensitivity and specificity, with other immobilization schemes employing coupling of biotinylated oligonucleotides onto directly adsorbed surface streptavidin, or sequential coupling of streptavidin and biotinylated oligonucleotides onto a layer of adsorbed biotinylated bovine serum albumin. A comparison was performed employing biotinylated oligonucleotides corresponding to wild- and mutant-type sequences of seven single point mutations of the BRCA1 gene. With respect to the other immobilization protocols, the proposed oligonucleotide immobilization approach offered the highest hybridization signals (at least 5 times higher) and permitted more elaborative washings, thus providing considerably higher discrimination between complimentary and non-complementary DNA sequences for all mutations tested. In addition, the hybridization kinetics were significantly enhanced compared to two other immobilization protocols, permitting PCR sample analysis in less than 40 min. Thus, the proposed oligonucleotide immobilization approach offered improved detection sensitivity and discrimination ability along with considerably reduced analysis time, and it is expected to find wide application in DNA mutation detection. PMID:25805150

  16. Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections.

    PubMed

    Hong, Bang-Xing; Jiang, Li-Fang; Hu, Yu-Shan; Fang, Dan-Yun; Guo, Hui-Yu

    2004-09-01

    A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology. Nylon membrane was used as the array support. A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species. A pair of universal primers was designed for PCR amplification of the 23S rRNA gene. Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes. The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array. Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E. coli, but the reaction did not affect their detection. After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not with Clostridium perfringens and Streptococcus pyogenes. The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections. PMID:15279944

  17. Aptamer-Mediated Delivery of Splice-Switching Oligonucleotides to the Nuclei of Cancer Cells

    PubMed Central

    Kotula, Jonathan W.; Pratico, Elizabeth D.; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L.

    2012-01-01

    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  18. Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor

    NASA Technical Reports Server (NTRS)

    Myers, Charles R.; Nealson, Kenneth H.

    1988-01-01

    Microbes that couple growth to the reduction of manganese could play an important role in the biogeochemistry of certain anaerobic environments. Such a bacterium, Alteromonas putrefaciens MR-1, couples its growth to the reduction of manganese oxides only under anaerobic conditions. The characteristics of this reduction are consistent with a biological, and not an indirect chemical, reduction of manganese, which suggest that this bacterium uses manganic oxide as a terminal electron acceptor. It can also utilize a large number of other compounds as terminal electron acceptors; this versatility could provide a distinct advantage in environments where electron-acceptor concentrations may vary.

  19. Determination of Na acceptor level in Na+ ion-implanted ZnO single crystal

    NASA Astrophysics Data System (ADS)

    Wang, Zheng; Liu, Huibin; He, Haiping; Huang, Jingyun; Chen, Lingxiang; Ye, Zhizhen

    2015-03-01

    Ion implantation was used to dope Na acceptor into ZnO single crystals. With three mixed implantation energies, uniform depth distribution of Na ion in the surface region (~300 nm) of ZnO bulk crystals is achieved. Via post-implantation annealing, a donor-acceptor pair recombination band is identified in the low-temperature photoluminescence spectra, from which the energy level of Na-related acceptor in single crystalline ZnO is estimated to be 300 meV. A p-n junction based on this ZnO-Na layer shows rectifying characteristics, confirming the p-type conductivity.

  20. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation.

    PubMed

    Kim, Jinho; Olsen, Timothy R; Zhu, Jing; Hilton, John P; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  1. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  2. Annexin A2 facilitates endocytic trafficking of antisense oligonucleotides

    PubMed Central

    Wang, Shiyu; Sun, Hong; Tanowitz, Michael; Liang, Xue-hai; Crooke, Stanley T.

    2016-01-01

    Chemically modified antisense oligonucleotides (ASOs) designed to mediate site-specific cleavage of RNA by RNase H1 are used as research tools and as therapeutics. ASOs modified with phosphorothioate (PS) linkages enter cells via endocytotic pathways. The mechanisms by which PS-ASOs are released from membrane-enclosed endocytotic organelles to reach target RNAs remain largely unknown. We recently found that annexin A2 (ANXA2) co-localizes with PS-ASOs in late endosomes (LEs) and enhances ASO activity. Here, we show that co-localization of ANXA2 with PS-ASO is not dependent on their direct interactions or mediated by ANXA2 partner protein S100A10. Instead, ANXA2 accompanies the transport of PS-ASOs to LEs, as ANXA2/PS-ASO co-localization was observed inside LEs. Although ANXA2 appears not to affect levels of PS-ASO internalization, ANXA2 reduction caused significant accumulation of ASOs in early endosomes (EEs) and reduced localization in LEs and decreased PS-ASO activity. Importantly, the kinetics of PS-ASO activity upon free uptake show that target mRNA reduction occurs at least 4 hrs after PS-ASOs exit from EEs and is coincident with release from LEs. Taken together, our results indicate that ANXA2 facilitates PS-ASO trafficking from early to late endosomes where it may also contribute to PS-ASO release. PMID:27378781

  3. Template-directed synthesis of oligonucleotides under eutectic conditions

    NASA Technical Reports Server (NTRS)

    Stribling, R.; Miller, S. L.

    1991-01-01

    One of the most important sets of model prebiotic experiments consists of reactions that synthesize complementary oligonucleotides from preformed templates under nonenzymatic conditions. Most of these experiments are conducted at 4 degrees C using 0.01-0.1 M concentrations of activated nucleotide monomer and template (monomer equivalent). In an attempt to extend the conditions under which this type of reaction can occur, we have concentrated the reactants by freezing at -18 degrees C, which is close to the NaCl-H2O eutectic at -21 degrees C. The results from this set of experiments suggest that successful syntheses can occur with poly(C) concentrations as low at 5 x 10(-4) M and 2MeImpG concentrations at 10(-3) M. It was also anticipated that this mechanism might allow the previously unsuccessful poly(A)-directed synthesis of oligo(U)s to occur. However, no template effect was seen with the poly(A) and ImpU system. The failure of these conditions to allow template-directed synthesis of oligo(U)s supports the previously proposed idea that pyrimidines may not have been part of the earliest genetic material. Because of the low concentrations of monomer and template that would be expected from prebiotic syntheses, this lower temperature could be considered a more plausible geologic setting for template-directed synthesis than the standard reaction conditions.

  4. Dicationic Surfactants with Glycine Counter Ions for Oligonucleotide Transportation.

    PubMed

    Pietralik, Zuzanna; Skrzypczak, Andrzej; Kozak, Maciej

    2016-08-01

    Gemini surfactants are good candidates to bind, protect, and deliver nucleic acids. Herein, the concept of amino acids (namely glycine) as counter ions of gemini surfactants for gene therapy application was explored. This study was conducted on DNA and RNA oligomers and two quaternary bis-imidazolium salts, having 2,5-dioxahexane and 2,8-dioxanonane spacer groups. The toxicity level of surfactants was assessed by an MTT assay, and their ability to bind nucleic acids was tested through electrophoresis. The nucleic acid conformation was established based on circular dichroism and infrared spectroscopic analyses. The structures of the formed complexes were characterized by small-angle scattering of synchrotron radiation. Both studied surfactants appear to be suitable for gene therapy; however, although they vary by only three methylene groups in the spacer, they differ in binding ability and toxicity. The tested oligonucleotides maintained their native conformations upon surfactant addition and the studied lipoplexes formed a variety of structures. In systems based on a 2,5-dioxahexane spacer, a hexagonal phase was observed for DNA-surfactant complexes and a micellar phase was dominant with RNA. For the surfactant with a 2,8-dioxanonane spacer group, the primitive cubic phase prevailed. PMID:27214208

  5. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  6. Triplex formation on DNA targets: how to choose the oligonucleotide.

    PubMed

    Vekhoff, Pierre; Ceccaldi, Alexandre; Polverari, David; Pylouster, Jean; Pisano, Claudio; Arimondo, Paola B

    2008-11-25

    Triplex-forming oligonucleotides (TFOs) are sequence-specific DNA binders. TFOs provide a tool for controlling gene expression or, when attached to an appropriate chemical reagent, for directing DNA damage. Here, we report a set of rules for predicting the best out of five different triple-helical binding motifs (TM, UM, GA, GT, and GU, where M is 5-methyldeoxycytidine and U is deoxyuridine) by taking into consideration the sequence composition of the underlying duplex target. We tested 11 different triplex targets present in genes having an oncogenic role. The rules have predictive power and are very useful in the design of TFOs for antigene applications. Briefly, we retained motifs GU and TM, and when they do form a triplex, TFOs containing G and U are preferred over those containing T and M. In the case of the G-rich TFOs, triplex formation is principally dependent on the percentage of G and the length of the TFO. In the case of the pyrimidine motif, replacement of T with U is destabilizing; triplex formation is dependent on the percentage of T and destabilized by the presence of several contiguous M residues. An equation to choose between a GU and TM motif is given. PMID:18954091

  7. Mechanism for radical cation transport in duplex DNA oligonucleotides.

    PubMed

    Liu, Chu-Sheng; Hernandez, Rigoberto; Schuster, Gary B

    2004-03-10

    We investigated the photoinduced one-electron oxidation of a series of DNA oligomers having a covalently linked anthraquinone group (AQ) and containing [(A)(n)GG](m) or [(T)(n)GG](m) segments. These oligomers have m GG steps, where m = 4 or 6, separated by (A)(n) or (T)(n) segments, where n = 1-7 for the (A)(n) set and 1-5 for the (T)(n) set. Irradiation with UV light that is absorbed by the AQ causes injection of a radical cation into the DNA. The radical cation migrates through the DNA, causing chemical reaction, primarily at GG steps, that leads to strand cleavage after piperidine treatment. The uniform, systematic structure of the DNA oligonucleotides investigated permits the numerical solution of a kinetic scheme that models these reactions. This analysis yields two rate constants, k(hop), for hopping of the radical cation from one site to adjacent sites, and k(trap), for irreversible reaction of the radical cation with H(2)O or O(2). Analysis of these findings indicates that radical cation hopping in these duplex DNA oligomers is a process that occurs on a microsecond time scale. The value of k(hop) depends on the number of base pairs in the (A)(n) and (T)(n) segments in a systematic way. We interpret these results in terms of a thermally activated adiabatic mechanism for radical cation hopping that we identify as phonon-assisted polaron hopping. PMID:14995205

  8. Chromosome-Specific Painting in Cucumis Species Using Bulked Oligonucleotides

    PubMed Central

    Han, Yonghua; Zhang, Tao; Thammapichai, Paradee; Weng, Yiqun; Jiang, Jiming

    2015-01-01

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a single chromosome of cucumber were identified using a newly developed bioinformatic pipeline and then massively synthesized de novo in parallel. The synthesized oligos were amplified and labeled with biotin or digoxigenin for use in fluorescence in situ hybridization (FISH). We developed three different probes with each containing 23,000–27,000 oligos. These probes spanned 8.3–17 Mb of DNA on targeted cucumber chromosomes and had the densities of 1.5–3.2 oligos per kilobases. These probes produced FISH signals on a single cucumber chromosome and were used to paint homeologous chromosomes in other Cucumis species diverged from cucumber for up to 12 million years. The bulked oligo probes allowed us to track a single chromosome in early stages during meiosis. We were able to precisely map the pairing between cucumber chromosome 7 and chromosome 1 of Cucumis hystrix in a F1 hybrid. These two homeologous chromosomes paired in 71% of prophase I cells but only 25% of metaphase I cells, which may provide an explanation of the higher recombination rates compared to the chiasma frequencies between homeologous chromosomes reported in plant hybrids. PMID:25971668

  9. Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol

    PubMed Central

    Nishina, Tomoko; Numata, Junna; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Nitta, Keiko; Piao, Wenying; Iwata, Rintaro; Ito, Shingo; Kuwahara, Hiroya; Wada, Takeshi; Mizusawa, Hidehiro; Yokota, Takanori

    2015-01-01

    We developed an efficient system for delivering short interfering RNA (siRNA) to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid)-DNA gapmer antisense oligonucleotide (ASO) was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA) as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS) molecules are bound to ASO with UNA sequences. PMID:25584900

  10. Phosphorothioate Antisense Oligonucleotides Induce the Formation of Nuclear Bodies

    PubMed Central

    Lorenz, Peter; Baker, Brenda F.; Bennett, C. Frank; Spector, David L.

    1998-01-01

    Antisense oligonucleotides are powerful tools for the in vivo regulation of gene expression. We have characterized the intracellular distribution of fluorescently tagged phosphorothioate oligodeoxynucleotides (PS-ONs) at high resolution under conditions in which PS-ONs have the potential to display antisense activity. Under these conditions PS-ONs predominantly localized to the cell nucleus where they accumulated in 20–30 bright spherical foci designated phosphorothioate bodies (PS bodies), which were set against a diffuse nucleoplasmic population excluding nucleoli. PS bodies are nuclear structures that formed in cells after PS-ON delivery by transfection agents or microinjection but were observed irrespectively of antisense activity or sequence. Ultrastructurally, PS bodies corresponded to electron-dense structures of 150–300 nm diameter and resembled nuclear bodies that were found with lower frequency in cells lacking PS-ONs. The environment of a living cell was required for the de novo formation of PS bodies, which occurred within minutes after the introduction of PS-ONs. PS bodies were stable entities that underwent noticeable reorganization only during mitosis. Upon exit from mitosis, PS bodies were assembled de novo from diffuse PS-ON pools in the daughter nuclei. In situ fractionation demonstrated an association of PS-ONs with the nuclear matrix. Taken together, our data provide evidence for the formation of a nuclear body in cells after introduction of phosphorothioate oligodeoxynucleotides. PMID:9571236

  11. Evolutionary sequence comparisons using high-density oligonucleotide arrays.

    PubMed

    Hacia, J G; Makalowski, W; Edgemon, K; Erdos, M R; Robbins, C M; Fodor, S P; Brody, L C; Collins, F S

    1998-02-01

    We explored the utility of high-density oligonucleotide arrays (DNA chips) for obtaining sequence information from homologous genes in closely related species. Orthologues of the human BRCA1 exon 11, all approximately 3.4 kb in length and ranging from 98.2% to 83.5% nucleotide identity, were subjected to hybridization-based and conventional dideoxysequencing analysis. Retrospective guidelines for identifying high-fidelity hybridization-based sequence calls were formulated based upon dideoxysequencing results. Prospective application of these rules yielded base-calling with at least 98.8% accuracy over orthologous sequence tracts shown to have approximately 99% identity. For higher primate sequences with greater than 97% nucleotide identity, base-calling was made with at least 99.91% accuracy covering a minimum of 97% of the sequence. Using a second-tier confirmatory hybridization chip strategy, shown in several cases to confirm the identity of predicted sequence changes, the complete sequence of the chimpanzee, gorilla and orangutan orthologues should be deducible solely through hybridization-based methodologies. Analysis of less highly conserved orthologues can still identify conserved nucleotide tracts of at least 15 nucleotides and can provide useful information for designing primers. DNA-chip based assays can be a valuable new technology for obtaining high-throughput cost-effective sequence information from related genomes. PMID:9462745

  12. Antineoplastic Effect of Decoy Oligonucleotide Derived from MGMT Enhancer

    PubMed Central

    Refael, Miri; Zrihan, Daniel; Siegal, Tali; Lavon, Iris

    2014-01-01

    Silencing of O(6)-methylguanine-DNA-methyltransferase (MGMT) in tumors, mainly through promoter methylation, correlates with a better therapeutic response and with increased survival. Therefore, it is conceivable to consider MGMT as a potential therapeutic target for the treatment of cancers. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through p65/NF-kappaB homodimers. Here we show that the non-canonical NF-KappaB motif (MGMT-kappaB1) within MGMT enhancer is probably the major inducer of MGMT expression following NF-kappaB activation. Thus, in an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA) modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN). Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to the NF-KappaB motif within MGMT enhancer, the efficacy of the decoy was studied in-vitro and in-vivo. The results of these experiments show that the decoy MGMT-kB1-LODN have a substantial antineoplastic effect when used either in combination with temozolomide or as monotherapy. Our results suggest that MGMT-kB1-LODN may provide a novel strategy for cancer therapy. PMID:25460932

  13. Splice-switching antisense oligonucleotides as therapeutic drugs.

    PubMed

    Havens, Mallory A; Hastings, Michelle L

    2016-08-19

    Splice-switching oligonucleotides (SSOs) are short, synthetic, antisense, modified nucleic acids that base-pair with a pre-mRNA and disrupt the normal splicing repertoire of the transcript by blocking the RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. Splicing of pre-mRNA is required for the proper expression of the vast majority of protein-coding genes, and thus, targeting the process offers a means to manipulate protein production from a gene. Splicing modulation is particularly valuable in cases of disease caused by mutations that lead to disruption of normal splicing or when interfering with the normal splicing process of a gene transcript may be therapeutic. SSOs offer an effective and specific way to target and alter splicing in a therapeutic manner. Here, we discuss the different approaches used to target and alter pre-mRNA splicing with SSOs. We detail the modifications to the nucleic acids that make them promising therapeutics and discuss the challenges to creating effective SSO drugs. We highlight the development of SSOs designed to treat Duchenne muscular dystrophy and spinal muscular atrophy, which are currently being tested in clinical trials. PMID:27288447

  14. Crystallization and crystal packing analysis of DNA oligonucleotides

    NASA Astrophysics Data System (ADS)

    Wang, Andrew H.-J.; Teng, M.-K.

    1988-07-01

    There are now over 30 DNA oligonucleotides that have been crystallized and their structure determined by X-ray diffraction analysis. From these studies there is a new wealth of information available to us concerning the fine details of the conformation of DNA molecules and their interactions with other ligands such as antitumor drugs and ions. In addition, the intensive efforts in attempting to crystallize many DNA fragments from several laboratories have resulted in a considerable amount of data related to the crystallization conditions for DNA molecules. Various factors such as the types of metal ion, precipitant, buffer and pH all play important roles in obtaining suitable crystals. We have also analyzed the packings of DNA molecules in the crystal lattice and found that they can be arranged into four different general categories. Those four types of packing interactions are: (1) base-base stacking plus intermolecular hydrogen bonds such as in the crystals of Z-DNA, daunomycin/DNA complex, triostin A/DNA complex, etc.; (2) base pair/A-DNA minor groove stacking, as in several DNA oligomer crystals in the A-DNA conformation; (3) guanine-guanine pairing in the minor groove of B-DNA dodecamers; (4) miscellaneous hydrogen bonding and stacking interactions. Many of those intermolecular interactions are examined in details and their possible biological relevance is discussed.

  15. [The use of oligonucleotide aptamers in cancer therapy].

    PubMed

    Odrzywolski, Adrian; Waśko, Adam

    2016-01-01

    Aptamers are a new class of molecules which originated in the 1990s. They are usually RNA or DNA oligonucleotides, the length of which ranges between 20 and 80 nt. They are produced using the SELEX method that allows one to obtain aptamers that bind to virtually any molecule of interest, providing a high specificity. Aptamers are an alternative to antibodies because on the one hand, their sensitivity is at a similar or sometimes even higher level, while on the other hand they do not show immunogenicity, and may be synthesized in vitro. To date, a broad range of different applications of aptamers has been described: as components of biosensors, or use in various laboratory techniques, such as microarrays or chromatography. One of the most important is the use of aptamers in medicine, especially in the fight against cancer. They can be used both for diagnosis and for the eradication of cancers - particularly through the delivery of drugs. Currently, most transport-related research is devoted to the delivery of chemotherapeutic drugs, such as doxorubicin. This was used in research on liver cancer cells, prostate, and acute lymphoblastic leukemia blast cells. Another possibility is to use aptamers to deliver siRNAs. In this way inhibition of the quality control process of the mRNA in tumor cells is possible. An aptamer complex with the drug allows for direct delivery of the active substance in a particular cell type, substantially eliminating the non-specific effect of the drug. PMID:27180958

  16. High performance weak donor-acceptor polymers in thin film transistors: effect of the acceptor on electronic properties, ambipolar conductivity, mobility, and thermal stability.

    PubMed

    Yuen, Jonathan D; Fan, Jian; Seifter, Jason; Lim, Bogyu; Hufschmid, Ryan; Heeger, Alan J; Wudl, Fred

    2011-12-28

    We have studied the electronic, physical, and transistor properties of a family of donor-acceptor polymers consisting of diketopyrrolopyrrole (DPP) coupled with different accepting companion units in order to determine the effects of donor-acceptor interaction. Using the electronically neutral benzene (B), the weakly accepting benzothiadiazole (BT), and the strongly accepting benzobisthiadiazole (BBT), the accepting strength of the companion unit was systematically modulated. All polymers exhibited excellent transistor performance, with mobilities above 0.1 cm(2)V(-1)s(-1), even exceeding 1 cm(2)V(-1)s(-1) for one of the BBT-containing polymers. We find that the BBT is the strongest acceptor, enabling the BBT-containing polymers to be strongly ambipolar. The BBT moiety also strengthens interchain interactions, which provides higher thermal stability and performance for transistors with BBT-containing polymers as the active layer. PMID:22043809

  17. Molecular Engineering of Pyrido[3,4-b]pyrazine-Based Donor-Acceptor-π-Acceptor Organic Sensitizers: Effect of Auxiliary Acceptor in Cobalt- and Iodine-Based Electrolytes.

    PubMed

    Liu, Bo; Giordano, Fabrizio; Pei, Kai; Decoppet, Jean-David; Zhu, Wei-Hong; Zakeeruddin, Shaik M; Grätzel, Michael

    2015-12-14

    Due to the ease of tuning its redox potential, the cobalt-based redox couple has been extensively applied for highly efficient dye-sensitized solar cells (DSSCs) with extraordinarily high photovoltages. However, a cobalt electrolyte needs particular structural changes in the organic dye components to obtain such high photovoltages. To achieve high device performance, specific requirements in the molecular tailoring of organic sensitizers still need to be met. Besides the need for large electron donors, studies of the auxiliary acceptor segment of donor-acceptor-π-acceptor (D-A-π-A) organic sensitizers are still rare in molecular optimization in the context of cobalt electrolytes. In this work, two novel organic D-A-π-A-type sensitizers (IQ13 and IQ17) have been developed and exploited in cobalt- and iodine-based redox electrolyte DSSCs, specifically to provide insight into the effect of π-bridge modification in different electrolytes. The investigation has been focused on the additional electron-withdrawing acceptor capability with grafted long alkoxy chains. Optoelectronic transient measurements have indicated that IQ17 containing a pyrido[3,4-b]pyrazine moiety bearing long alkoxyphenyl chains is more suitable for application in cobalt-based DSSCs. PMID:26548926

  18. Single-site copper(II) water oxidation electrocatalysis: rate enhancements with HPO₄²⁻ as a proton acceptor at pH 8.

    PubMed

    Coggins, Michael K; Zhang, Ming-Tian; Chen, Zuofeng; Song, Na; Meyer, Thomas J

    2014-11-01

    The complex Cu(II)(Py3P) (1) is an electrocatalyst for water oxidation to dioxygen in H2PO4(-)/HPO4(2-) buffered aqueous solutions. Controlled potential electrolysis experiments with 1 at pH 8.0 at an applied potential of 1.40 V versus the normal hydrogen electrode resulted in the formation of dioxygen (84% Faradaic yield) through multiple catalyst turnovers with minimal catalyst deactivation. The results of an electrochemical kinetics study point to a single-site mechanism for water oxidation catalysis with involvement of phosphate buffer anions either through atom-proton transfer in a rate-limiting O-O bond-forming step with HPO4(2-) as the acceptor base or by concerted electron-proton transfer with electron transfer to the electrode and proton transfer to the HPO4(2-) base. PMID:25243584

  19. 2-O-[2-(Methylthio)ethyl]-Modified Oligonucleotide: An Analog of 2-O-[2-(Methoxy)ethyl]-Modified Oligonucleotide with Improved Protein Binding Properties and High Binding Affinity to Target RNA

    SciTech Connect

    Prakash, T.P.; Manoharan, M.; Fraser, A.S.; Kawasaki, A.M.; Lesnik, E.; Sioufi, N.; Leeds, J.M.; Teplova, M.; Egli, M.

    2010-03-08

    A novel 2'-modification, 2'-O-[2-(methylthio)ethyl] or 2'-O-MTE, has been incorporated into oligonucleotides and evaluated for properties relevant to antisense activity. The results were compared with the previously characterized 2'-O-[2-(methoxy)ethyl] 2'-O-MOE modification. As expected, the 2'-O-MTE modified oligonucleotides exhibited improved binding to human serum albumin compared to the 2'-O-MOE modified oligonucleotides. The 2'-O-MTE oligonucleotides maintained high binding affinity to target RNA. Nuclease digestion of 2'-O-MTE oligonucleotides showed that they have limited resistance to exonuclease degradation. We analyzed the crystal structure of a decamer DNA duplex containing the 2'-O-MTE modifcation. Analysis of the crystal structure provides insight into the improved RNA binding affinity, protein binding affinity and limited resistance of 2'-O-MTE modified oligonucleotides to exonuclease degradation.

  20. A Donor-Acceptor Conjugated Polymer with Alternating Isoindigo Derivative and Bithiophene Units for Near-Infrared Modulated Cancer Thermo-Chemotherapy.

    PubMed

    Li, Dong-Dong; Wang, Jun-Xia; Ma, Yan; Qian, Hai-Sheng; Wang, Dong; Wang, Li; Zhang, Guobing; Qiu, Longzhen; Wang, Yu-Cai; Yang, Xian-Zhu

    2016-08-01

    Conjugated polymers containing alternating donor/acceptor units have strong and sharp absorbance peaks in near-infrared (NIR) region, which could be suitable for photothermal therapy. However, these polymers as photothermal transducers are rarely reported because of their water insolubility, which limits their applications for cancer therapy. Herein, we report the donor-acceptor conjugated polymer PBIBDF-BT with alternating isoindigo derivative (BIBDF) and bithiophene (BT) units as a novel photothermal transducer, which exhibited strong near-infrared (NIR) absorbance due to its low band gap (1.52 eV). To stabilize the conjugated polymer physiological environments, we utilized an amphiphilic copolymer, poly(ethylene glycol)-block-poly(hexyl ethylene phosphate) (mPEG-b-PHEP), to stabilize PBIBDF-BT-based nanoparticles (PBIBDF-BT@NPPPE) through a single emulsion method. The obtained nanoparticles PBIBDF-BT@NPPPE showed great stability in physiological environments and excellent photostability. Moreover, the PBIBDF-BT@NPPPE exhibited high photothermal conversion efficiency, reaching 46.7%, which is relatively high compared with those of commonly used materials for photothermal therapy. Accordingly, in vivo and in vitro experiments demonstrated that PBIBDF-BT@NPPPE exhibits efficient photothermal anticancer efficacy. More importantly, PBIBDF-BT@NPPPE could simultaneously encapsulate other types of therapeutic agents though hydrophobic interactions with the PHEP core and achieve NIR-triggered intracellular drug release and a synergistic combination therapy of thermo-chemotherapy for the treatment of cancer. PMID:27404741

  1. The role of anaerobic respiration in the immobilization of uranium through biomineralization of phosphate minerals

    NASA Astrophysics Data System (ADS)

    Salome, Kathleen R.; Green, Stefan J.; Beazley, Melanie J.; Webb, Samuel M.; Kostka, Joel E.; Taillefert, Martial

    2013-04-01

    Although bioreduction of uranyl ions (U(VI)) and biomineralization of U(VI)-phosphate minerals are both able to immobilize uranium in contaminated sediments, the competition between these processes and the role of anaerobic respiration in the biomineralization of U(VI)-phosphate minerals has yet to be investigated. In this study, contaminated sediments incubated anaerobically in static microcosms at pH 5.5 and 7.0 were amended with the organophosphate glycerol-2-phosphate (G2P) as sole phosphorus and external carbon source and iron oxides, sulfate, or nitrate as terminal electron acceptors to determine the most favorable geochemical conditions to these two processes. While sulfate reduction was not observed even in the presence of G2P at both pHs, iron reduction was more significant at circumneutral pH irrespective of the addition of G2P. In turn, nitrate reduction was stimulated by G2P at both pH 5.5 and 7.0, suggesting nitrate-reducing bacteria provided the main source of inorganic phosphate in these sediments. U(VI) was rapidly removed from solution in all treatments but was not reduced as determined by X-ray absorption near edge structure (XANES) spectroscopy. Simultaneously, wet chemical extractions and extended X-ray absorption fine structure (EXAFS) spectroscopy of these sediments indicated the presence of U-P species in reactors amended with G2P at both pHs. The rapid removal of dissolved U(VI), the simultaneous production of inorganic phosphate, and the existence of U-P species in the solid phase indicate that uranium was precipitated as U(VI)-phosphate minerals in sediments amended with G2P. Thus, under reducing conditions and in the presence of G2P, bioreduction of U(VI) was outcompeted by the biomineralization of U(VI)-phosphate minerals and U(VI) sorption at both pHs.

  2. Chemoenzymatic synthesis of polyprenyl phosphates.

    PubMed

    Hartley, Meredith D; Larkin, Angelyn; Imperiali, Barbara

    2008-05-01

    Polyprenyl phosphates, including undecaprenyl phosphate and dolichyl phosphate, are essential intermediates in several important biochemical pathways including N-linked protein glycosylation in eukaryotes and prokaryotes and prokaryotic cell wall biosynthesis. Herein, we describe the evaluation of three potential undecaprenol kinases as agents for the chemoenzymatic synthesis of polyprenyl phosphates. Target enzymes were expressed in crude cell envelope fractions and quantified via the use of luminescent lanthanide-binding tags (LBTs). The Streptococcus mutans diacylglycerol kinase (DGK) was shown to be a very useful agent for polyprenol phosphorylation using ATP as the phosphoryl transfer agent. In addition, the S. mutans DGK can be coupled with two Campylobacter jejuni glycosyltransferases involved in N-linked glycosylation to efficiently biosynthesize the undecaprenyl pyrophosphate-linked disaccharide needed for studies of PglB, the C. jejuni oligosaccharyl transferase. PMID:18374576

  3. SOURCE ASSESSMENT: PHOSPHATE FERTILIZER INDUSTRY

    EPA Science Inventory

    The report describes a study of air emissions, water effluents, and solid residues resulting from the manufacture of phosphate fertilizers. It includes the production of wet process phosphoric acid, superphosphoric acid, normal superphosphate, triple superphosphate, and ammonium ...

  4. INFLUENCE OF ALTERNATIVE ELECTRON ACCEPTORS ON THE ANAEROBIC BIODEGRADABILITY OF CHLORINATED PHENOLS AND BENZOIC ACIDS

    EPA Science Inventory

    Nitrate, sulfate, and carbonate were used as electron acceptors to examine the anaerobic biodegradability of chlorinated aromatic compounds in estuarine and freshwater sediments. he respective denitrifying, sulfidogenic, and methanogenic enrichment cultures were established on ea...

  5. TIO2 ADVANCED PHOTO-OXIDATION TECHNOLOGY: EFFECT OF ELECTRON ACCEPTORS

    EPA Science Inventory

    The effects of electron acceptors (additives) such as hydrogen peroxide, ammonium persulphate, potassium bromate and potassium peroxymonosulphate (ozone) on the TiO2 photocatalytic degradation of various organic pollutants were examined at various conditions. he individual and th...

  6. Interface-induced heavy-hole/light-hole splitting of acceptors in silicon

    NASA Astrophysics Data System (ADS)

    Mol, J. A.; Salfi, J.; Rahman, R.; Hsueh, Y.; Miwa, J. A.; Klimeck, G.; Simmons, M. Y.; Rogge, S.

    2015-05-01

    The energy spectrum of spin-orbit coupled states of individual sub-surface boron acceptor dopants in silicon have been investigated using scanning tunneling spectroscopy at cryogenic temperatures. The spatially resolved tunnel spectra show two resonances, which we ascribe to the heavy- and light-hole Kramers doublets. This type of broken degeneracy has recently been argued to be advantageous for the lifetime of acceptor-based qubits [R. Ruskov and C. Tahan, Phys. Rev. B 88, 064308 (2013)]. The depth dependent energy splitting between the heavy- and light-hole Kramers doublets is consistent with tight binding calculations, and is in excess of 1 meV for all acceptors within the experimentally accessible depth range (<2 nm from the surface). These results will aid the development of tunable acceptor-based qubits in silicon with long coherence times and the possibility for electrical manipulation.

  7. Photoinduced electron tunneling between randomly dispersed donors and acceptors in frozen glasses and other rigid matrices.

    PubMed

    Wenger, Oliver S

    2013-07-14

    In fluid solution un-tethered donors and acceptors can diffuse freely, and consequently the donor-acceptor distance is usually not fixed on the timescale of an electron transfer event. When attempting to investigate the influence of driving-force changes or donor-acceptor distance variations on electron transfer rates this can be a problem. In rigid matrices diffusion is suppressed, and it becomes possible to investigate fixed-distance electron transfer. This method represents an attractive alternative to investigate rigid rod-like donor-bridge-acceptor molecules which have to be made in elaborate syntheses. This perspective focuses specifically on the distance dependence of photoinduced electron transfer which occurs via tunneling of charge carriers through rigid matrices over distances between 1 and 33 Å. Some key aspects of the theoretical models commonly used for analyzing kinetic data of electron tunneling through rigid matrices are recapitulated. New findings from this rather mature field of research are emphasized. PMID:23722299

  8. Interface-induced heavy-hole/light-hole splitting of acceptors in silicon

    SciTech Connect

    Mol, J. A.; Salfi, J.; Simmons, M. Y.; Rogge, S.; Rahman, R.; Hsueh, Y.; Klimeck, G.; Miwa, J. A.

    2015-05-18

    The energy spectrum of spin-orbit coupled states of individual sub-surface boron acceptor dopants in silicon have been investigated using scanning tunneling spectroscopy at cryogenic temperatures. The spatially resolved tunnel spectra show two resonances, which we ascribe to the heavy- and light-hole Kramers doublets. This type of broken degeneracy has recently been argued to be advantageous for the lifetime of acceptor-based qubits [R. Ruskov and C. Tahan, Phys. Rev. B 88, 064308 (2013)]. The depth dependent energy splitting between the heavy- and light-hole Kramers doublets is consistent with tight binding calculations, and is in excess of 1 meV for all acceptors within the experimentally accessible depth range (<2 nm from the surface). These results will aid the development of tunable acceptor-based qubits in silicon with long coherence times and the possibility for electrical manipulation.

  9. Computational design of donor-bridge-acceptor systems exhibiting pronounced quantum interference effects.

    PubMed

    Gorczak, Natalie; Renaud, Nicolas; Galan, Elena; Eelkema, Rienk; Siebbeles, Laurens D A; Grozema, Ferdinand C

    2016-03-01

    Quantum interference is a well-known phenomenon that dictates charge transport properties of single molecule junctions. However, reports on quantum interference in donor-bridge-acceptor molecules are scarce. This might be due to the difficulties in meeting the conditions for the presence of quantum interference in a donor-bridge-acceptor system. The electronic coupling between the donor, bridge, and acceptor moieties must be weak in order to ensure localised initial and final states for charge transfer. Yet, it must be strong enough to allow all bridge orbitals to mediate charge transfer. We present the computational route to the design of a donor-bridge-acceptor molecule that features the right balance between these contradicting requirements and exhibits pronounced interference effects. PMID:26878200

  10. Photoelectric covalent organic frameworks: converting open lattices into ordered donor-acceptor heterojunctions.

    PubMed

    Chen, Long; Furukawa, Ko; Gao, Jia; Nagai, Atsushi; Nakamura, Toshikazu; Dong, Yuping; Jiang, Donglin

    2014-07-16

    Ordered one-dimensional open channels represent the typical porous structure of two-dimensional covalent organic frameworks (COFs). Here we report a general synthetic strategy for converting these open lattice structures into ordered donor-acceptor heterojunctions. A three-component topological design scheme was explored to prepare electron-donating intermediate COFs, which upon click reaction were transformed to photoelectric COFs with segregated donor-acceptor alignments, whereas electron-accepting buckyballs were spatially confined within the nanochannels via covalent anchoring on the channel walls. The donor-acceptor heterojunctions trigger photoinduced electron transfer and allow charge separation with radical species delocalized in the π-arrays, whereas the charge separation efficiency was dependent on the buckyball content. This new donor-acceptor strategy explores both skeletons and pores of COFs for charge separation and photoenergy conversion. PMID:24963896

  11. 21 CFR 184.1301 - Ferric phosphate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ferric chloride or ferric citrate. (b) The ingredient meets the specifications of the Food Chemicals... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Ferric phosphate. 184.1301 Section 184.1301 Food... GRAS § 184.1301 Ferric phosphate. (a) Ferric phosphate (ferric orthophosphate, iron (III) phosphate,...

  12. 21 CFR 184.1301 - Ferric phosphate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... reaction of sodium phosphate with ferric chloride or ferric citrate. (b) The ingredient meets the... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Ferric phosphate. 184.1301 Section 184.1301 Food... Specific Substances Affirmed as GRAS § 184.1301 Ferric phosphate. (a) Ferric phosphate...

  13. 21 CFR 184.1301 - Ferric phosphate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... reaction of sodium phosphate with ferric chloride or ferric citrate. (b) The ingredient meets the... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Ferric phosphate. 184.1301 Section 184.1301 Food... Specific Substances Affirmed as GRAS § 184.1301 Ferric phosphate. (a) Ferric phosphate...

  14. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Erythromycin phosphate. 520.823 Section 520.823... DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.823 Erythromycin phosphate. (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance...

  15. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Erythromycin phosphate. 520.823 Section 520.823... DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.823 Erythromycin phosphate. (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance...

  16. Benzodipyrrole-based Donor-Acceptor-type Boron Complexes as Tunable Near-infrared-Absorbing Materials.

    PubMed

    Nakamura, Tomoya; Furukawa, Shunsuke; Nakamura, Eiichi

    2016-07-20

    Benzodipyrrole-based donor-acceptor boron complexes were designed and synthesized as near-infrared-absorbing materials. The electron-rich organic framework combined with the Lewis acidic boron co-ordination enabled us to tune the LUMO energy level and the HOMO-LUMO gap (i.e.,the absorption wavelength) by changing the organic acceptor units, the number of boron atoms, and the substituents on the boron atoms. PMID:27311060

  17. Process for gasification using a synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S.; Curran, George P.

    1980-01-01

    A gasification process is disclosed using a synthetic CO.sub.2 acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca.sub.5 (SiO.sub.4).sub.2 CO.sub.3. A method for producing the synthetic CO.sub.2 acceptor is also disclosed.

  18. Responses to phosphate deprivation in yeast cells.

    PubMed

    Yadav, Kamlesh Kumar; Singh, Neelima; Rajasekharan, Ram

    2016-05-01

    Inorganic phosphate is an essential nutrient because it is required for the biosynthesis of nucleotides, phospholipids and metabolites in energy metabolism. During phosphate starvation, phosphatases play a major role in phosphate acquisition by hydrolyzing phosphorylated macromolecules. In Saccharomyces cerevisiae, PHM8 (YER037W), a lysophosphatidic acid phosphatase, plays an important role in phosphate acquisition by hydrolyzing lysophosphatidic acid and nucleotide monophosphate that results in accumulation of triacylglycerol and nucleotides under phosphate limiting conditions. Under phosphate limiting conditions, it is transcriptionally regulated by Pho4p, a phosphate-responsive transcription factor. In this review, we focus on triacylglycerol metabolism in transcription factors deletion mutants involved in phosphate metabolism and propose a link between phosphate and triacylglycerol metabolism. Deletion of these transcription factors results in an increase in triacylglycerol level. Based on these observations, we suggest that PHM8 is responsible for the increase in triacylglycerol in phosphate metabolising gene deletion mutants. PMID:26615590

  19. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells

    PubMed Central

    Zhong, Yu; Trinh, M. Tuan; Chen, Rongsheng; Purdum, Geoffrey E.; Khlyabich, Petr P.; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; Zhang, Boyuan; Wang, Wei; Nam, Chang-Yong; Sfeir, Matthew Y.; Black, Charles T.; Steigerwald, Michael L.; Loo, Yueh-Lin; Ng, Fay; Zhu, X.-Y.; Nuckolls, Colin

    2015-01-01

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor−acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. This study describes a new motif for designing highly efficient acceptors for organic solar cells. PMID:26382113

  20. Differences in gene expression of human xylosyltransferases and determination of acceptor specificities for various proteoglycans

    SciTech Connect

    Roch, Christina; Kuhn, Joachim; Kleesiek, Knut; Goetting, Christian

    2010-01-01

    The xylosyltransferase (XT) isoforms XT-I and XT-II initiate the posttranslational glycosaminoglycan (GAG) synthesis. Here, we determined the relative expression of both isoforms in 33 human cell lines. The majority of tested cell lines showed dominant XYLT2 gene expression, while only in 23132/87, JAR, NCI-H510A and THP-1 was the XT-I mRNA expression higher. Nearly equal expression levels were detected in six cell lines. Additionally, to shed light on putative differences in acceptor specificities the acceptor properties of potential acceptor sequences were determined. Peptides were expressed as glutathione-S-transferase fusion proteins containing putative or known GAG attachment sites of in vivo proteoglycans. Kinetic analysis showed that K{sub m} and V{sub max} values for XT-I mediated xylosylation were slightly higher than those for XT-II, and that XT-I showed a lesser stringency concerning the acceptor sequence. Mutagenesis of the bikunin peptide sequence in the G-S-G attachment site and flanking regions generated potential acceptor molecules. Here, mutations on the N-terminal side and the attachment site were found to be more susceptible to a loss of acceptor function than mutations in the C-terminus. Altogether the known consensus sequence a-a-a-a-G-S-G-a-a/G-a ('a' representing Asp or Glu) for XT-I mediated xylosylation could be approved and additionally extended to apply to XT-II as well.

  1. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells

    DOE PAGESBeta

    Yu M. Zhong; Nam, Chang -Yong; Trinh, M. Tuan; Chen, Rongsheng; Purdum, Geoffrey E.; Khlyabich, Petr P.; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; et al

    2015-09-18

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealedmore » both electron and hole transfer processes at the donor–acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. As a result, this study describes a new motif for designing highly efficient acceptors for organic solar cells.« less

  2. Non-fullerene acceptors: exciton dissociation with PTCDA versus C60.

    PubMed

    Dutton, Gregory J; Robey, Steven W

    2015-06-28

    Extensive development of new polymer and small molecule donors has helped produce a steady increase in the efficiency of organic photovoltaic (OPV) devices. However, OPV technology would also benefit from the introduction of non-fullerene acceptors. Unfortunately, efforts to replace fullerenes have typically led to significantly reduced efficiencies. A number of possible explanations for reduced efficiencies with non-fullerene acceptors compared to fullerene acceptors have been suggested, including the formation of unfavorable morphologies in non-fullerene systems and/or favorable excitation/carrier delocalization in fullerenes. In addition, enhanced exciton dissociation associated with fundamental characteristics of the fullerene molecular electronic states has also been suggested. We used time-resolved two-photon photoemission (TR-2PPE) to directly compare exciton dissociation at interfaces between zinc phthalocyanine (ZnPc) interfaces and the non-fullerene acceptor, perylene tetracarboxylic dianhydride (PTCDA) versus dissociation measured at the analogous interface with C60, and thus help discriminate between these potential explanations. Exciton dissociation rates are comparable for phthalocyanine interfaces with both acceptors, allowing us to suggest a hierarchy for the importance of various effects producing higher efficiencies with fullerene acceptors. PMID:26027544

  3. Interface-split Kramers doublets for acceptor-based qubits in silicon

    NASA Astrophysics Data System (ADS)

    Mol, Jan; Salfi, Joseph; Rahman, Rajib; Rogge, Sven

    2013-03-01

    Single dopants in silicon form a particular attractive platform for hosting spin quantum bits (qubits). The effective spin-3/2 states of acceptor-bound holes in silicon can be used to store bits of quantum information for several μs. Strong coupling of spin and momentum in the silicon valence band allows for rapid electrical manipulation of the hole spin. Acceptors in silicon have a four-fold degenerate ground-state, reflecting character of the top of the valence band. Symmetry breaking, by an electric field, strain or confinement, lifts this degeneracy, resulting in two Kramers doublets. The states within these isolated Kramers doublets are protected against decoherence by time reversal symmetry and form the working levels of a hole spin qubit. Here we investigate the effect of the presence of an interface on the ground-state energy splitting of individual sub-surface acceptors, as a function of dopant depth, by means of low temperature scanning tunneling spectroscopy. The depth of individual acceptors is determined by probing the Coulomb potential of the ionized acceptor nuclei. Resonant tunneling through the localized acceptor states provides a direct measure of the excited state spectrum of single dopants.

  4. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells.

    PubMed

    Zhong, Yu; Trinh, M Tuan; Chen, Rongsheng; Purdum, Geoffrey E; Khlyabich, Petr P; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; Zhang, Boyuan; Wang, Wei; Nam, Chang-Yong; Sfeir, Matthew Y; Black, Charles T; Steigerwald, Michael L; Loo, Yueh-Lin; Ng, Fay; Zhu, X-Y; Nuckolls, Colin

    2015-01-01

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor-acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. This study describes a new motif for designing highly efficient acceptors for organic solar cells. PMID:26382113

  5. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells

    SciTech Connect

    Yu M. Zhong; Nam, Chang -Yong; Trinh, M. Tuan; Chen, Rongsheng; Purdum, Geoffrey E.; Khlyabich, Petr P.; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; Zhang, Boyuan; Wang, Wei; Sfeir, Matthew Y.; Black, Charles T.; Steigerwald, Michael L.; Loo, Yueh -Lin; Ng, Fay; Zhu, X. -Y.; Nuckolls, Colin

    2015-09-18

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor–acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. As a result, this study describes a new motif for designing highly efficient acceptors for organic solar cells.

  6. Candidatus Accumulibacter phosphatis clades enriched under cyclic anaerobic and microaerobic conditions simultaneously use different electron acceptors.

    PubMed

    Camejo, Pamela Y; Owen, Brian R; Martirano, Joseph; Ma, Juan; Kapoor, Vikram; Santo Domingo, Jorge; McMahon, Katherine D; Noguera, Daniel R

    2016-10-01

    Lab- and pilot-scale simultaneous nitrification, denitrification and phosphorus removal-sequencing batch reactors were operated under cyclic anaerobic and micro-aerobic conditions. The use of oxygen, nitrite, and nitrate as electron acceptors by Candidatus Accumulibacter phosphatis during the micro-aerobic stage was investigated. A complete clade-level characterization of Accumulibacter in both reactors was performed using newly designed qPCR primers targeting the polyphosphate kinase gene (ppk1). In the lab-scale reactor, limited-oxygen conditions led to an alternated dominance of Clade IID and IC over the other clades. Results from batch tests when Clade IC was dominant (i.e., >92% of Accumulibacter) showed that this clade was capable of using oxygen, nitrite and nitrate as electron acceptors for P uptake. A more heterogeneous distribution of clades was found in the pilot-scale system (Clades IIA, IIB, IIC, IID, IA, and IC), and in this reactor, oxygen, nitrite and nitrate were also used as electron acceptors coupled to phosphorus uptake. However, nitrite was not an efficient electron acceptor in either reactor, and nitrate allowed only partial P removal. The results from the Clade IC dominated reactor indicated that either organisms in this clade can simultaneously use multiple electron acceptors under micro-aerobic conditions, or that the use of multiple electron acceptors by Clade IC is due to significant microdiversity within the Accumulibacter clades defined using the ppk1 gene. PMID:27340814

  7. A new classification of the amino acid side chains based on doublet acceptor energy levels.

    PubMed Central

    Sneddon, S F; Morgan, R S; Brooks, C L

    1988-01-01

    We describe a new classification of the amino acid side chains based on the potential energy level at which each will accept an extra (doublet) electron. The doublet acceptor energy level, and the doublet acceptor orbital were calculated using semiempirical INDO/2-UHF molecular orbital theory. The results of these calculations show that the side chains fall into four groups. We have termed these groups repulsive, insulating, semiconducting, and attractive in accordance with where each lies on the relative energy scale. We use this classification to examine the role of residues between the donor and acceptor in modulating the rate and mechanism of electron transfer in proteins. With the calculated acceptor levels, we construct a potential barrier for those residues between the donor and acceptor. It is the area beneath this barrier that determines the decay of electronic coupling between donor and acceptor, and thus the transfer rate. We have used this schematic approach to characterize the four electron transfer pathways in myoglobin recently studied by Mayo et al. (Mayo, S.L., W.R. Ellis, R.J. Crutchley, and H.B. Gray. 1986. Science [Wash. DC]. 233:948-952). PMID:3342271

  8. Inhibition of transcription by platinated triplex-forming oligonucleotides.

    PubMed

    Graham, Mindy K; Miller, Paul S

    2012-12-01

    Platinated triplex-forming oligonucleotides (TFOs) consisting of 2'-methoxythymidine and 2'-methoxy-5-methylcytidine and an N-7 platinated deoxyguanosine ((Pt)G) at the 5'-((Pt)G-TFO), 3'-(TFO-G(Pt)), or 3'- and 5'-((Pt)G-TFO-G(Pt)) ends of the TFO form mono-((Pt)G-TFO and TFO-G(Pt)) and interstrand ((Pt)G-TFO-G(Pt)) cross-links with target DNA as a result of reaction of the (Pt)G with guanines adjacent to the homopurine TFO binding site in the target. The extent of cross-linking is greatest when the (Pt)G is located on the 3' end of the TFO and the target guanine is on the same strand as the TFO binding site. Multiple, contiguous deoxyguanosines in the TFO binding site or a cytosine adjacent to the G(Pt) of the TFO significantly reduce cross-linking. DNA reporter plasmids in which platinated TFOs were cross-linked at a site in the transcribed region between a CMV promoter and a luciferase reporter gene were transfected into Chinese hamster ovary cells, and luciferase expression was compared with that for the corresponding non-cross-linked plasmid. Luciferase expression was inhibited 95 % when TFO-G(Pt) was bound and cross-linked to the transcribed strand, demonstrating that the cross-linked TFO was able to block transcription elongation. Further inhibition (99 %) was observed in nucleotide excision repair (NER) deficient cells, suggesting that NER may repair this lesion. The 3'-G(Pt) group of TFO-G(Pt) protects the TFO from degradation by exonucleases found in mammalian serum. Taken together, these results suggest that platinated TFOs of the type TFO-G(Pt) may find applications as agents for suppressing DNA transcription and consequently inhibiting gene expression in mammalian cells. PMID:22965663

  9. Application of heteronuclear couplings to conformational analysis of oligonucleotides

    SciTech Connect

    Zhu, G.; Live, D.; Bax, A.

    1994-12-01

    The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1{prime} and C1{prime} atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3{prime}-endo and C2{prime}-endo conformations of the sugars and syn and anti bases arrangements.

  10. Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

    PubMed

    Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

    2016-02-01

    Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing. PMID:26553470

  11. Oligonucleotide facilitators may inhibit or activate a hammerhead ribozyme.

    PubMed Central

    Jankowsky, E; Schwenzer, B

    1996-01-01

    Facilitators are oligonucleotides capable of affecting hammerhead ribozyme activity by interacting with the substrate at the termini of the ribozyme. Facilitator effects were determined in vitro using a system consisting of a ribozyme with 7 nucleotides in every stem sequence and two substrates with inverted facilitator binding sequences. The effects of 9mer and 12mer RNA as well as DNA facilitators which bind either adjacent to the 3'- or 5'-end of the ribozyme were investigated. A kinetic model was developed which allows determination of the apparent dissociation constant of the ribozyme-substrate complex from single turnover reactions. We observed a decreased dissociation constant of the ribozyme-substrate complex due to facilitator addition corresponding to an additional stabilization energy of delta delta G=-1.7 kcal/mol with 3'-end facilitators. The cleavage rate constant was increased by 3'-end facilitators and decreased by 5'-end facilitators. Values for Km were slightly lowered by all facilitators and kcat was increased by 3'-end facilitators and decreased by 5'-end facilitators in our system. Generally the facilitator effects increased with the length of the facilitators and RNA provided greater effects than DNA of the same sequence. Results suggest facilitator influences on several steps of the hammerhead reaction, substrate association, cleavage and dissociation of products. Moreover, these effects are dependent in different manners on ribozyme and substrate concentration. This leads to the conclusion that there is a concentration dependence whether activation or inhibition is caused by facilitators. Conclusions are drawn with regard to the design of hammerhead ribozyme facilitator systems. PMID:8602353

  12. A novel dysferlin mutant pseudoexon bypassed with antisense oligonucleotides

    PubMed Central

    Dominov, Janice A; Uyan, Özgün; Sapp, Peter C; McKenna-Yasek, Diane; Nallamilli, Babi R R; Hegde, Madhuri; Brown, Robert H

    2014-01-01

    Objective Mutations in dysferlin (DYSF), a Ca2+-sensitive ferlin family protein important for membrane repair, vesicle trafficking, and T-tubule function, cause Miyoshi myopathy, limb-girdle muscular dystrophy type 2B, and distal myopathy. More than 330 pathogenic DYSF mutations have been identified within exons or near exon–intron junctions. In ~17% of patients who lack normal DYSF, only a single disease-causing mutation has been identified. We studied one family with one known mutant allele to identify both the second underlying genetic defect and potential therapeutic approaches. Methods We sequenced the full DYSF cDNA and investigated antisense oligonucleotides (AONs) as a tool to modify splicing of the mRNA transcripts in order to process out mutant sequences. Results We identified a novel pseudoexon between exons 44 and 45, (pseudoexon 44.1, PE44.1), which inserts an additional 177 nucleotides into the mRNA and 59 amino acids within the conserved C2F domain of the DYSF protein. Two unrelated dysferlinopathy patients were also found to carry this mutation. Using AONs targeting PE44.1, we blocked the abnormal splicing event, yielding normal, full-length DYSF mRNA, and increased DYSF protein expression. Interpretation This is the first report of a deep intronic mutation in DYSF that alters mRNA splicing to include a mutant peptide fragment within a key DYSF domain. We report that AON-mediated exon-skipping restores production of normal, full-length DYSF in patients’ cells in vitro, offering hope that this approach will be therapeutic in this genetic context, and providing a foundation for AON therapeutics targeting other pathogenic DYSF alleles. PMID:25493284

  13. Superiorities of time-correlated single-photon counting against standard fluorimetry in exploiting the potential of fluorochromized oligonucleotide probes for biomedical investigation

    NASA Astrophysics Data System (ADS)

    Lamperti, Marco; Nardo, Luca; Bondani, Maria

    2015-05-01

    Site-specific fluorescence-resonance-energy-transfer donor-acceptor dual-labelled oligonucleotide probes are widely used in state-of-art biotechnological applications. Such applications include their usage as primers in polymerase chain reaction. However, the steady-state fluorescence intensity signal emitted by these molecular tools strongly depends from the specificities of the probe conformation. For this reason, the information which can be reliably inferred by steady-state fluorimetry performed on such samples is forcedly confined to a semi-qualitative level. Namely, fluorescent emission is frequently used as ON/OFF indicator of the probe hybridization state, i.e. detection of fluorescence signals indicates either hybridization to or detachment from the template DNA of the probe. Nonetheless, a fully quantitative analysis of their fluorescence emission properties would disclose other exciting applications of dual-labelled probes in biosensing. Here we show how time-correlated single-photon counting can be applied to get rid of the technical limitations and interpretational ambiguities plaguing the intensity analysis, and to derive information on the template DNA reaching single-base.

  14. Biphasic calcium phosphate in periapical surgery

    PubMed Central

    Suneelkumar, Chinni; Datta, Krithika; Srinivasan, Manali R; Kumar, Sampath T

    2008-01-01

    Calcium phosphate ceramics like hydroxyapatite and β -tricalcium phosphate (β -TCP) possess mineral composition that closely resembles that of the bone. They can be good bone substitutes due to their excellent biocompatibility. Biphasic calcium phosphate is a bone substitute which is a mixture of hydroxyapatite and β -tricalcium phosphate in fixed ratios. Studies have demonstrated the osteoconductive potential of this composition. This paper highlights the clinical use of biphasic calcium phosphate as a bone substitute in periapical surgery. PMID:20142892

  15. Recombinant sucrose phosphorylase from Leuconostoc mesenteroides: characterization, kinetic studies of transglucosylation, and application of immobilised enzyme for production of alpha-D-glucose 1-phosphate.

    PubMed

    Goedl, Christiane; Schwarz, Alexandra; Minani, Alphonse; Nidetzky, Bernd

    2007-03-30

    Sucrose phosphorylase catalyzes the reversible conversion of sucrose (alpha-D-glucopyranosyl-1,2-beta-D-fructofuranoside) and phosphate into D-fructose and alpha-D-glucose 1-phosphate. We report on the molecular cloning and expression of the structural gene encoding sucrose phosphorylase from Leuconostoc mesenteroides (LmSPase) in Escherichia coli DH10B. The recombinant enzyme, containing an 11 amino acid-long N-terminal metal affinity fusion peptide, was overproduced 60-fold in comparison with the natural enzyme. It was purified to apparent homogeneity using copper-loaded Chelating Sepharose and obtained in 20% yield with a specific activity of 190 Umg(-1). LmSPase was covalently attached onto Eupergit C with a binding efficiency of 50% and used for the continuous production of alpha-D-glucose 1-phosphate from sucrose and phosphate (600 mM each) in a packed-bed immobilised enzyme reactor (30 degrees C, pH 7.0). The reactor was operated at a stable conversion of 91% (550 mM product) and productivity of approximately 11 gl(-1)h(-1) for up to 600 h. A kinetic study of transglucosylation by soluble LmSPase was performed using alpha-d-glucose 1-phosphate as the donor substrate and various alcohols as acceptors. D- and L-arabitol were found to be good glucosyl acceptors. PMID:17215056

  16. Uranium phosphate biomineralization by fungi.

    PubMed

    Liang, Xinjin; Hillier, Stephen; Pendlowski, Helen; Gray, Nia; Ceci, Andrea; Gadd, Geoffrey Michael

    2015-06-01

    Geoactive soil fungi were investigated for phosphatase-mediated uranium precipitation during growth on an organic phosphorus source. Aspergillus niger and Paecilomyces javanicus were grown on modified Czapek-Dox medium amended with glycerol 2-phosphate (G2P) as sole P source and uranium nitrate. Both organisms showed reduced growth on uranium-containing media but were able to extensively precipitate uranium and phosphorus-containing minerals on hyphal surfaces, and these were identified by X-ray powder diffraction as uranyl phosphate species, including potassium uranyl phosphate hydrate (KPUO6 .3H2 O), meta-ankoleite [(K1.7 Ba0.2 )(UO2 )2 (PO4 )2 .6H2 O], uranyl phosphate hydrate [(UO2 )3 (PO4 )2 .4H2 O], meta-ankoleite (K(UO2 )(PO4 ).3H2 O), uramphite (NH4 UO2 PO4 .3H2 O) and chernikovite [(H3 O)2 (UO2 )2 (PO4 )2 .6H2 O]. Some minerals with a morphology similar to bacterial hydrogen uranyl phosphate were detected on A. niger biomass. Geochemical modelling confirmed the complexity of uranium speciation, and the presence of meta-ankoleite, uramphite and uranyl phosphate hydrate between pH 3 and 8 closely matched the experimental data, with potassium as the dominant cation. We have therefore demonstrated that fungi can precipitate U-containing phosphate biominerals when grown with an organic source of P, with the hyphal matrix serving to localize the resultant uranium minerals. The findings throw further light on potential fungal roles in U and P biogeochemistry as well as the application of these mechanisms for element recovery or bioremediation. PMID:25580878

  17. Conduction electrons in acceptor-doped GaAs/GaAlAs heterostructures: a review

    NASA Astrophysics Data System (ADS)

    Zawadzki, Wlodek; Raymond, Andre; Kubisa, Maciej

    2016-05-01

    We review magneto-optical and magneto-transport effects in GaAs/GaAlAs heterostructures doped in GaAlAs barriers with donors, providing two-dimensional (2D) electron gas (2DEG) in GaAs quantum wells (QWS), and additionally doped with smaller amounts of acceptors (mostly Be atoms) in the vicinity of 2DEG. One may also deal with residual acceptors (mostly C atoms). The behavior of such systems in the presence of a magnetic field differs appreciably from those doped in the vicinity of 2DEG with donors. Three subjects related to the acceptor-doped heterostructures are considered. First is the problem of bound states of conduction electrons confined to the vicinity of negatively charged acceptors by the joint effect of a QW and an external magnetic field parallel to the growth direction. A variational theory of such states is presented, demonstrating that an electron turning around a repulsive center has discrete energies above the corresponding Landau levels. Experimental evidence for the discrete electron energies comes from the work on interband photo-magneto-luminescence, intraband cyclotron resonance and quantum magneto-transport (the Quantum Hall and Shubnikov-de Haas effects). An electron rain-down effect at weak electric fields and a boil-off effect at strong electric fields are introduced. It is demonstrated, both theoretically and experimentally, that a negatively charged acceptor can localize more than one electron. The second subject describes experiment and theory of asymmetric quantized Hall and Shubnikov-de Haas plateaus in acceptor-doped GaAs/GaAlAs heterostructures. It is shown that the main features of the plateau asymmetry can be attributed to asymmetric density of Landau states in the presence of acceptors. However, at high magnetic fields, the rain-down effect is also at work. The third subject deals with the so-called disorder modes (DMs) in the cyclotron resonance of conduction electrons. The DMs originate from random distributions of negatively

  18. Glyceraldehyde-3-phosphate dehydrogenase antisense oligodeoxynucleotides protect against cytosine arabinonucleoside-induced apoptosis in cultured cerebellar neurons.

    PubMed Central

    Ishitani, R; Chuang, D M

    1996-01-01

    Cytosine arabinonucleoside (AraC) is a pyrimidine antimetabolite that kills proliferating cells by inhibiting DNA synthesis and, importantly, is also an inducer of apoptosis. We recently reported that age-induced apoptotic cell death of cultured cerebellar neurons is directly associated with an over-expression of a particulate 38-kDa protein, identified by us as glyceraldehyde-3-phosphate dehydrogenase (GAPDH; EC 1.2.1.12). We now show that the AraC-induced neuronal death of immature cerebellar granule cells in culture is effectively delayed by actinomycin-D, cycloheximide, or aurintricarboxylic acid (a DNase inhibitor). Furthermore, two GAPDH antisense, but not their corresponding sense, oligodeoxyribonucleotides markedly arrested AraC-induced apoptosis. This protection was more effective than that induced by the above-mentioned classical inhibitors of apoptosis. Prior to AraC-induced neuronal death, GAPDH mRNA levels increased by approximately 2.5-fold, and this mRNA accumulation was blocked by actinomycin-D and the GAPDH antisense (but not sense) oligonucleotide. Like actinomycin-D, a GAPDH antisense oligonucleotide also suppressed the AraC-induced over-expression of the 38-kDa particulate protein (i.e., GAPDH), while the corresponding sense oligonucleotide was totally ineffective. Thus, the present results show that GAPDH over-expression is involved in AraC-induced apoptosis of cultured cerebellar granule cells. Images Fig. 2 Fig. 3 Fig. 4 PMID:8790435

  19. Oligonucleotide delivery with cell surface binding and cell penetrating Peptide amphiphile nanospheres.

    PubMed

    Mumcuoglu, Didem; Sardan, Melis; Tekinay, Turgay; Guler, Mustafa O; Tekinay, Ayse B

    2015-05-01

    A drug delivery system designed specifically for oligonucleotide therapeutics can ameliorate the problems associated with the in vivo delivery of these molecules. The internalization of free oligonucleotides is challenging, and cytotoxicity is the main obstacle for current transfection vehicles. To develop nontoxic delivery vehicles for efficient transfection of oligonucleotides, we designed a self-assembling peptide amphiphile (PA) nanosphere delivery system decorated with cell penetrating peptides (CPPs) containing multiple arginine residues (R4 and R8), and a cell surface binding peptide (KRSR), and report the efficiency of this system in delivering G-3129, a Bcl-2 antisense oligonucleotide (AON). PA/AON (peptide amphiphile/antisense oligonucleotide) complexes were characterized with regards to their size and secondary structure, and their cellular internalization efficiencies were evaluated. The effect of the number of arginine residues on the cellular internalization was investigated by both flow cytometry and confocal imaging, and the results revealed that uptake efficiency improved as the number of arginines in the sequence increased. The combined effect of cell penetration and surface binding property on the cellular internalization and its uptake mechanism was also evaluated by mixing R8-PA and KRSR-PA. R8 and R8/KRSR decorated PAs were found to drastically increase the internalization of AONs compared to nonbioactive PA control. Overall, the KRSR-decorated self-assembled PA nanospheres were demonstrated to be noncytotoxic delivery vectors with high transfection rates and may serve as a promising delivery system for AONs. PMID:25828697

  20. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries

    PubMed Central

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2016-01-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection–based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization. PMID:26054766

  1. Oligonucleotide-induced alternative splicing of serotonin 2C receptor reduces food intake.

    PubMed

    Zhang, Zhaiyi; Shen, Manli; Gresch, Paul J; Ghamari-Langroudi, Masoud; Rabchevsky, Alexander G; Emeson, Ronald B; Stamm, Stefan

    2016-01-01

    The serotonin 2C receptor regulates food uptake, and its activity is regulated by alternative pre-mRNA splicing. Alternative exon skipping is predicted to generate a truncated receptor protein isoform, whose existence was confirmed with a new antiserum. The truncated receptor sequesters the full-length receptor in intracellular membranes. We developed an oligonucleotide that promotes exon inclusion, which increases the ratio of the full-length to truncated receptor protein. Decreasing the amount of truncated receptor results in the accumulation of full-length, constitutively active receptor at the cell surface. After injection into the third ventricle of mice, the oligonucleotide accumulates in the arcuate nucleus, where it changes alternative splicing of the serotonin 2C receptor and increases pro-opiomelanocortin expression. Oligonucleotide injection reduced food intake in both wild-type and ob/ob mice. Unexpectedly, the oligonucleotide crossed the blood-brain barrier and its systemic delivery reduced food intake in wild-type mice. The physiological effect of the oligonucleotide suggests that a truncated splice variant regulates the activity of the serotonin 2C receptor, indicating that therapies aimed to change pre-mRNA processing could be useful to treat hyperphagia, characteristic for disorders like Prader-Willi syndrome. PMID:27406820

  2. Sequence specific inhibition of human type II phospholipase A2 enzyme activity by phosphorothioate oligonucleotides.

    PubMed Central

    Bennett, C F; Chiang, M Y; Wilson-Lingardo, L; Wyatt, J R

    1994-01-01

    Phosphorothioate oligonucleotides were identified which directly inhibited human type II phospholipase A2 (PLA2) enzyme activity in a sequence specific manner. The minimum pharmacophore common to all oligonucleotides which inhibited PLA2 enzyme activity consisted of two sets of three or more consecutive guanosine residues in a row. These oligonucleotides appear to form G quartets resulting in the formation of oligonucleotide aggregates. Additionally, a phosphorothioate backbone was required to be effective inhibitors of type II PLA2. The activity of one oligodeoxynucleotide, IP 3196 (5'-GGGTGGGTATAGAAGGGCTCC-3') has been characterized in more detail. IP 3196 inhibited PLA2 enzyme activity when the substrate was presented in the form of a phospholipid bilayer but not when presented in the form of a mixed micelle with anionic detergents. Human type II PLA2 was 50-fold more sensitive to inhibition by IP 3196 than venom and pancreatic type I enzymes. These data demonstrate that phosphorothioate oligonucleotides can specifically inhibit human type II PLA2 enzyme activity in a sequence specific manner. PMID:8065936

  3. Liposome-encapsulated polyethylenimine/oligonucleotide polyplexes prepared by reverse-phase evaporation technique.

    PubMed

    Ko, Young Tag; Bickel, Ulrich

    2012-06-01

    Liposome-encapsulated polyplex system represents a promising delivery system for oligonucleotide-based therapeutics such as siRNA and asODN. Here, we report a novel method to prepare liposome-encapsulated cationic polymer/oligonucleotide polyplexes based on the reverse-phase evaporation following organic extraction of the polyplexes. The polyplexes of polyethylenimine and oligonucleotide were first formed in aqueous buffer at an N/P ratio of 6. The overall positively charged polyplexes were then mixed with the anionic phospholipids in overall organic media. The overall organic environment and electrostatic interaction between anionic phospholipids and positively charged polyplexes resulted in inverted micelle-like particles with the polyplexes in the core. After phase separation, the hydrophobic particles were recovered in organic phase. Reverse-phase evaporation of the organic solvent in the presence of hydrophilic polymer-grafted lipids resulted in a stable aqueous dispersion of hydrophilic lipid-coated particles with the polyplex in the core. Transmission electron microscopy visualization revealed spherical structures with heavily stained polyplex cores surrounded by lightly stained lipid coats. The lipid-coated polyplex particles showed colloidal stability, complete protection of the loaded oligonucleotide molecules from enzymatic degradation, and high loading efficiency of more than 80%. Thus, this technique represents an alternative method to prepare lipid-coated polyplex particles as a delivery system of oligonucleotide therapeutics. PMID:22328240

  4. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.

    PubMed

    Choi, Y C; Busch, H

    1978-06-27

    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  5. Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating.

    PubMed

    Abel, Biebele; Aslan, Kadir

    2012-11-01

    This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization), where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. PMID:23645933

  6. Oligonucleotide directed misfolding of RNA inhibits Candida albicans group I intron splicing

    PubMed Central

    Childs, Jessica L.; Disney, Matthew D.; Turner, Douglas H.

    2002-01-01

    RNA is becoming an important therapeutic target. Many potential RNA targets require secondary or tertiary structure for function. Examples include ribosomal RNAs, RNase P RNAs, mRNAs with untranslated regions that regulate translation, and group I and group II introns. Here, a method is described to inhibit RNA function by exploiting the propensity of RNA to adopt multiple folded states that are of similar free energy. This method, called oligonucleotide directed misfolding of RNA (ODMiR), uses short oligonucleotides to stabilize inactive structures. The ODMiR method is demonstrated with the group I intron from Candida albicans, a human pathogen. The oligonucleotides, L(TACCTTTC) and TLCTLACLGALCGLGCLC, with L denoting a locked nucleic acid residue, inhibit 50% of group I intron splicing in a transcription mixture at about 150 and 30 nM oligonucleotide concentration, respectively. Both oligonucleotides induce misfolds as determined by native gel electrophoresis and diethyl pyrocarbonate modification. The ODMiR approach provides a potential therapeutic strategy applicable to RNAs with secondary or tertiary structures required for function. PMID:12169671

  7. Delivery of oligonucleotides into mammalian cells by anionic peptides: comparison between monomeric and dimeric peptides.

    PubMed Central

    Freulon, I; Roche, A C; Monsigny, M; Mayer, R

    2001-01-01

    The use of antisense oligonucleotides as putative therapeutic agents is limited by their poor delivery into the cytosol and/or the nucleus because they are not able to efficiently cross lipid bilayers. To circumvent this pitfall, anionic amphipathic peptides derived from the influenza virus fusogenic peptide have been used to destabilize membranes in an acidic environment. In this paper, we compare the ability of a monomeric and a dimeric peptide to introduce oligonucleotides into the cytosol and nuclei of several types of cultured cells. Cells incubated at pH 6.2 or at a slightly lower pH in the presence of the monomeric peptide but not the dimeric peptide were efficiently permeabilized. The location of fluorescent derivatives of peptides and of oligonucleotides was assessed by confocal microscopy. Both the peptides and oligonucleotides remained entrapped in vesicular compartments at neutral pH; at acidic pH, oligonucleotides in the presence of the monomeric peptide were mainly in the nucleus, while in the presence of the dimeric peptide they co-localized with the peptide into vesicles. The data are interpreted on the basis of the spectroscopic behaviour of monomeric and dimeric peptides in relation to the environmental pH. PMID:11237872

  8. Novel Efficient Cell-Penetrating, Peptide-Mediated Strategy for Enhancing Telomerase Inhibitor Oligonucleotides.

    PubMed

    Muñoz-Alarcón, Andrés; Eriksson, Jonas; Langel, Ülo

    2015-12-01

    At present, there are several therapeutic approaches for targeting telomerase in tumors. One in particular, currently undergoing clinical trials, is based on synthetic lipid-modified oligonucleotide antagonists aimed at inhibiting the ribonucleoprotein subunit of human telomerase. However, while enabling efficient uptake, the lipid modifications reduce the potency of the therapeutic oligonucleotides compared to nonmodified oligonucleotides. Moreover, lipid modification may increase oligonucleotide accumulation in the liver causing undesirable hepatotoxicity. Noncovalent complexation strategies for cell-penetrating peptide (CPP)-mediated delivery present an option to circumvent the need for potency-reducing modifications, while allowing for a highly efficient uptake, and could significantly improve the efficiency of telomerase-targeting cancer therapeutics. Delivery of a nonlipidated locked nucleic acid/2'-O-methyl mixmer significantly inhibits the telomerase activity in treated HeLa cells. The inhibitory effect was further improved through addition of a CPP. Furthermore, calculated IC50-values for the oligonucleotide delivered by CPPs into HeLa cells are more than 20 times lower than telomerase inhibitor Imetelstat, currently undergoing clinical trials. These results emphasize the potential of CPP-mediated delivery of future pharmaceuticals and provide means by which to enhance an already promising therapeutic strategy for cancer treatment. PMID:26479411

  9. Achieving successful delivery of oligonucleotides--From physico-chemical characterization to in vivo evaluation.

    PubMed

    Scomparin, Anna; Polyak, Dina; Krivitsky, Adva; Satchi-Fainaro, Ronit

    2015-11-01

    RNA interference is one of the most promising fields in modern medicine to treat several diseases, ranging from cancer to cardiac diseases, passing through viral infections and metabolic pathologies. Since the discovery of the potential therapeutic properties of non-self oligonucleotides, it was clear that it is important to develop delivery systems that are able to increase plasma stability and bestow membrane-crossing abilities to the oligonucleotides in order to reach their cytoplasmic targets. Polymer therapeutics, among other systems, are widely investigated as delivery systems for therapeutic agents, such as oligonucleotides. Physico-chemical characterization of the supramolecular polyplexes obtained upon charge interaction or covalent conjugation between the polymeric carrier and the oligonucleotides is critical. Appropriate characterization is fundamental in order to predict and understand the in vivo silencing efficacy and to avoid undesired side effects and toxicity profile. Shedding light on the physico-chemical and in vitro requirements of a polyplex leads to an efficient in vivo delivery system for RNAi therapeutics. In this review, we will present the most common techniques for characterization of obtained polymer/oligonucleotide polyplexes and an up-to-date state of the art in vivo preclinical and clinical studies. This is the first review to deal with the difficulties in appropriate characterization of small interfering RNA (siRNA) or microRNA (miRNA) polyplexes and conjugates which limit the clinical translation of this promising technology. PMID:25916823

  10. High-quality gene assembly directly from unpurified mixtures of microarray-synthesized oligonucleotides

    PubMed Central

    Borovkov, Alex Y.; Loskutov, Andrey V.; Robida, Mark D.; Day, Kristen M.; Cano, Jose A.; Le Olson, Tien; Patel, Hetal; Brown, Kevin; Hunter, Preston D.; Sykes, Kathryn F.

    2010-01-01

    To meet the growing demand for synthetic genes more robust, scalable and inexpensive gene assembly technologies must be developed. Here, we present a protocol for high-quality gene assembly directly from low-cost marginal-quality microarray-synthesized oligonucleotides. Significantly, we eliminated the time- and money-consuming oligonucleotide purification steps through the use of hybridization-based selection embedded in the assembly process. The protocol was tested on mixtures of up to 2000 oligonucleotides eluted directly from microarrays obtained from three different chip manufacturers. These mixtures containing <5% perfect oligos, and were used directly for assembly of 27 test genes of different sizes. Gene quality was assessed by sequencing, and their activity was tested in coupled in vitro transcription/translation reactions. Genes assembled from the microarray-eluted material using the new protocol matched the quality of the genes assembled from >95% pure column-synthesized oligonucleotides by the standard protocol. Both averaged only 2.7 errors/kb, and genes assembled from microarray-eluted material without clonal selection produced only 30% less protein than sequence-confirmed clones. This report represents the first demonstration of cost-efficient gene assembly from microarray-synthesized oligonucleotides. The overall cost of assembly by this method approaches 5¢ per base, making gene synthesis more affordable than traditional cloning. PMID:20693531

  11. A novel, one-step amplification and oligonucleotide ligation procedure for multiplex genetic typing

    SciTech Connect

    Eggerding, F.A.

    1994-09-01

    A new technique, coupled amplification and oligonucleotide ligation (CAL), has been developed for simultaneous multiplex amplification and genotyping of DNA. CAL is a biphasic method which combines in one assay DNA amplification by the polymerase chain reaction (PCR) with DNA genotyping by the oligonucleotide ligation assay (OLA). By virtue of a difference in the melting temperatures of PCR primer-target DNA and OLA probe-target DNA hybrids, the method allows preferential amplification of DNA during stage I and oligonucleotide ligation during stage II of the reaction. In stage I target DNA is amplified using high-melting primers in a two-step PCR cycle that employs a 72{degrees}C anneal-elongation step. In stage II genotyping of PCR products by competitive oligonucleotide ligation with oligonucleotide probes located between PCR primers is accomplished by several cycles of denaturation at 94{degrees}C followed by anneal-ligation at 55{degrees}C. Ligation products are fluorochrome-labeled at their 3{prime}-ends and analyzed electrophoretically on a fluorescent DNA sequencer. The CAL procedure has been used for multiplex detection of 30 cystic fibrosis mutations and for analysis of ras gene point mutations. Because mutation detection occurs concurrently with target amplification, the technique is rapid, highly sensitive and specific, easily automatable, and requires minimal sample processing.

  12. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    PubMed Central

    Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

    2006-01-01

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  13. Design and Application of an Easy to Use Oligonucleotide Mass Calculation Program

    NASA Astrophysics Data System (ADS)

    Yang, Jiong; Leopold, Peter; Helmy, Roy; Parish, Craig; Arvary, Becky; Mao, Bing; Meng, Fanyu

    2013-08-01

    With the development of new synthesis procedures, an ever increasing number of chemical modifications can now be incorporated into synthetic oligonucleotides, representing new challenges for analytical chemists to efficiently identify and characterize such molecules. While conventional mass spectrometry (MS) has proven to be a powerful tool to study nucleic acids, new and improved methods and software are now needed to address this emerging challenge. In this report, we describe a simple yet powerful program that affords great flexibility in the calculation of theoretical masses for conventional as well as modified oligonucleotide molecules. This easy to use program can accept input oligonucleotide sequences and then calculate the theoretical mass values for full length products, process impurities, potential metabolites, and gas phase fragments. We intentionally designed this software so that modified nucleotide residues can be incorporated into oligonucleotide sequences, and corresponding mass values can be rapidly calculated. To test the utility of this program, two oligonucleotides that contain a large number of chemical modifications were synthesized. We have analyzed these samples using a Q-TOF mass spectrometer and compared the calculated masses to the observed ones. We found that all of the data matched very well with less than 30 ppm mass errors, well within the expectation for our instrument operated in its current mode. These data confirmed the validity of calculations performed with this new software.

  14. [Denitrifying phosphate uptake of biological phosphorous removal granular sludge in SBR].

    PubMed

    Liu, Xiao-ying; Zhao, Hong-mei; Peng, Dang-cong; Sui, Xian-jie

    2008-08-01

    The denitrification and excessive P removal can be realized by denitrifying phosphate-accumulating organisms (DNPAOs) under low carbon condition. DNPAOs use poly-3-hydroxy- butyrate (PHB) as electron donor, and use nitrate and nitrite as electron acceptor during the denitrifying phosphate uptake. In this study the biological phosphorus removal granular sludge was induced into the denitrifying and phosphate uptake granular sludge under an anaerobic/anoxic/aerobic alternating operation (referred to as an A/A/O) in a sequencing batch reactor (SBR). When the system is stable, the P and N removal ratio is over 90% and 93% respectively; the release phosphorus is 25-33 mg/L at anaerobic stage; 1g NOx-N approximately takes up P 1.3 g at anoxic stage. In the typical cycle the anaerobic maximum specific release phosphorus rate (max. SRPR) is 18.39 mg/(g x h); the anoxic max. specific uptake phosphorus rate (SUPR) and the max. specific denitrification rate (SDNR) is 23.72 mg/(g x h) and 18.19 mg/(g x h) respectively; the aerobic max. SUPR is 17.15 mg/(g x h). The fraction of DNPAOs rises from 14.9% to 80.7%. Compared with the physical-chemical property of the biological phosphorus removal granular sludge, the settling velocity and the specific gravity of the denitrifying phosphate uptake granular sludge is elevated 0.16-0.7 times and 0.0031 respectively. PMID:18839581

  15. The glucose 6-phosphate shunt around the Calvin-Benson cycle.

    PubMed

    Sharkey, Thomas D; Weise, Sean E

    2016-07-01

    It is just over 60 years since a cycle for the regeneration of the CO2-acceptor used in photosynthesis was proposed. In this opinion paper, we revisit the origins of the Calvin-Benson cycle that occurred at the time that the hexose monophosphate shunt, now called the pentose phosphate pathway, was being worked out. Eventually the pentose phosphate pathway was separated into two branches, an oxidative branch and a non-oxidative branch. It is generally thought that the Calvin-Benson cycle is the reverse of the non-oxidative branch of the pentose phosphate pathway but we describe crucial differences and also propose that some carbon routinely passes through the oxidative branch of the pentose phosphate pathway. This creates a futile cycle but may help to stabilize photosynthesis. If it occurs it could explain a number of enigmas including the lack of complete labelling of the Calvin-Benson cycle intermediates when carbon isotopes are fed to photosynthesizing leaves. PMID:26585224

  16. Uranium endowments in phosphate rock.

    PubMed

    Ulrich, Andrea E; Schnug, Ewald; Prasser, Horst-Michael; Frossard, Emmanuel

    2014-04-15

    This study seeks to identify and specify the components that make up the prospects of U recovery from phosphate rock. A systems approach is taken. The assessment includes i) reviewing past recovery experience and lessons learned; ii) identifying factors that determine recovery; and iii) establishing a contemporary evaluation of U endowments in phosphate rock reserves, as well as the available and recoverable amounts from phosphate rock and phosphoric acid production. We find that in the past, recovery did not fulfill its potential and that the breakup of the Soviet Union worsened then-favorable recovery market conditions in the 1990s. We find that an estimated 5.7 million tU may be recoverable from phosphate rock reserves. In 2010, the recoverable tU from phosphate rock and phosphoric acid production may have been 15,000 tU and 11,000 tU, respectively. This could have filled the world U supply-demand gap for nuclear energy production. The results suggest that the U.S., Morocco, Tunisia, and Russia would be particularly well-suited to recover U, taking infrastructural considerations into account. We demonstrate future research needs, as well as sustainability orientations. We conclude that in order to promote investment and production, it seems necessary to establish long-term contracts at guaranteed prices, ensuring profitability for phosphoric acid producers. PMID:24556272

  17. Fundamental Studies on Donor-acceptor Conjugated Polymers Containing 'Heavy' Group 14 and Group 16 Elements

    NASA Astrophysics Data System (ADS)

    Gibson, Gregory Laird

    One advantage of conjugated polymers as organic materials is that their properties may be readily tuned through covalent modifications. This thesis presents studies on the structure-property relationships resulting from single- and double-atom substitutions on an alternating donor-acceptor conjugated polymer. Specifically, single selenium and tellurium atoms have been incorporated into the acceptor monomer in place of sulfur; silicon and germanium atoms have been substituted in place of carbon at the donor monomer bridge position. The carbon-donor/ tellurium-acceptor polymer was synthesized by a post-polymerization reaction sequence and demonstrated the utility of heavy group 16 atoms to red shift a polymer absorption spectrum. Density functional theory calculations point to a new explanation for this result invoking the lower heavy atom ionization energy and reduced aromaticity of acceptor monomers containing selenium and tellurium compared to sulfur. Absorption and emission experiments demonstrate that both silicon and germanium substitutions in the donor slightly blue shift the polymer absorption spectrum. Polymers containing sulfur in the acceptor are the strongest light absorbers of all polymers studied here. Molecular weight and phenyl end capping studies show that molecular weight appears to affect polymer absorption to the greatest degree in a medium molecular weight regime and that these effects have a significant aggregation component. Solar cell devices containing either the silicon- or germanium-donor/selenium-acceptor polymer display improved red light harvesting or hole mobility relative to their structural analogues. Overall, these results clarify the effects of single atom substitution on donor-acceptor polymers and aid in the future design of polymers containing heavy atoms.

  18. [Effect of C/N ratio on nitrous oxide production during denitrification with different electron acceptors].

    PubMed

    Shang, Hui-Lai; Peng, Yong-Zhen; Zhang, Jing-Rong; Wang, Shu-Ying

    2009-07-15

    The experiment investigated the nitrous oxide production under different C/N ratios during denitrification, taking nitrate and nitrite as electron acceptor respectively. Ethanol was selected as carbon source. The C/N ratios were 0, 1.2, 2.4, 3.5, 5.0 and 20 when nitrate was taken as electron acceptor and C/N ratios 0, 1.8, 2.4, 3.0, 4.3, 5.2, 6.6, 20.6 when electron acceptor was nitrite. The results indicated that: the optimum C/N ratio was 3.0 taking nitrite as electron acceptor and the N2O production was 0.044 mg x L(-1); the optimum C/N ratio was 5.0 taking nitrate as electron acceptor and the N2O production was 0.135 mg x L(-1) which was 3 times higher than that of nitrite as electron acceptor. Though the electron acceptor changed, the trend of N2O production was similar: when carbon source was badly insufficient, the production of N2O and denitrification rate were both quite small; the N2O production increased with the increasing of the quantity of carbon source; when the carbon source was excessive, the N2O production sharply raised. Consequently, compared to complete nitrification and denitrification, short-cut nitrification and denitrification could save 40% carbon source. Moreover, controlling C/N = 3 could reduce the production of N2O in short-cut nitrification. PMID:19775000

  19. A novel multifunctional oligonucleotide microarray for Toxoplasma gondii

    PubMed Central

    2010-01-01

    Background Microarrays are invaluable tools for genome interrogation, SNP detection, and expression analysis, among other applications. Such broad capabilities would be of value to many pathogen research communities, although the development and use of genome-scale microarrays is often a costly undertaking. Therefore, effective methods for reducing unnecessary probes while maintaining or expanding functionality would be relevant to many investigators. Results Taking advantage of available genome sequences and annotation for Toxoplasma gondii (a pathogenic parasite responsible for illness in immunocompromised individuals) and Plasmodium falciparum (a related parasite responsible for severe human malaria), we designed a single oligonucleotide microarray capable of supporting a wide range of applications at relatively low cost, including genome-wide expression profiling for Toxoplasma, and single-nucleotide polymorphism (SNP)-based genotyping of both T. gondii and P. falciparum. Expression profiling of the three clonotypic lineages dominating T. gondii populations in North America and Europe provides a first comprehensive view of the parasite transcriptome, revealing that ~49% of all annotated genes are expressed in parasite tachyzoites (the acutely lytic stage responsible for pathogenesis) and 26% of genes are differentially expressed among strains. A novel design utilizing few probes provided high confidence genotyping, used here to resolve recombination points in the clonal progeny of sexual crosses. Recent sequencing of additional T. gondii isolates identifies >620 K new SNPs, including ~11 K that intersect with expression profiling probes, yielding additional markers for genotyping studies, and further validating the utility of a combined expression profiling/genotyping array design. Additional applications facilitating SNP and transcript discovery, alternative statistical methods for quantifying gene expression, etc. are also pursued at pilot scale to inform

  20. Probing the Influence of Stereoelectronic Effects on the Biophysical Properties of Oligonucleotides: Comprehensive Analysis of the RNA Affinity, Nuclease Resistance, and Crystal Structure of Ten 2'-O-Ribonucleic Acid Modifications

    SciTech Connect

    Egli, Martin; Minasov, George; Tereshko, Valentina; Pallan, Pradeep S.; Teplova, Marianna; Inamati, Gopal B.; Lesnik, Elena A.; Owens, Steve R.; Ross, Bruce S.; Prakash, Thazha P.; Manoharan, Muthiah

    2010-03-05

    The syntheses of 10 new RNA 2'-O-modifications, their incorporation into oligonucleotides, and an evaluation of their properties such as RNA affinity and nuclease resistance relevant to antisense activity are presented. All modifications combined with the natural phosphate backbone lead to significant gains in terms of the stability of hybridization to RNA relative to the first-generation DNA phosphorothioates (PS-DNA). The nuclease resistance afforded in particular by the 2'-O-modifications carrying a positive charge surpasses that of PS-DNA. However, small electronegative 2'-O-substituents, while enhancing the RNA affinity, do not sufficiently protect against degradation by nucleases. Similarly, oligonucleotides containing 3'-terminal residues modified with the relatively large 2'-O-[2-(benzyloxy)ethyl] substituent are rapidly degraded by exonucleases, proving wrong the assumption that steric bulk will generally improve protection against nuclease digestion. To analyze the factors that contribute to the enhanced RNA affinity and nuclease resistance we determined crystal structures of self-complementary A-form DNA decamer duplexes containing single 2'-O-modified thymidines per strand. Conformational preorganization of substituents, favorable electrostatic interactions between substituent and sugar-phosphate backbone, and a stable water structure in the vicinity of the 2'-O-modification all appear to contribute to the improved RNA affinity. Close association of positively charged substituents and phosphate groups was observed in the structures with modifications that protect most effectively against nucleases. The promising properties exhibited by some of the analyzed 2'-O-modifications may warrant a more detailed evaluation of their potential for in vivo antisense applications. Chemical modification of RNA can also be expected to significantly improve the efficacy of small interfering RNAs (siRNA). Therefore, the 2'-O-modifications introduced here may benefit the

  1. Phosphoryl transfer from α-d-glucose 1-phosphate catalyzed by Escherichia coli sugar-phosphate phosphatases of two protein superfamily types.

    PubMed

    Wildberger, Patricia; Pfeiffer, Martin; Brecker, Lothar; Rechberger, Gerald N; Birner-Gruenberger, Ruth; Nidetzky, Bernd

    2015-03-01

    The Cori ester α-d-glucose 1-phosphate (αGlc 1-P) is a high-energy intermediate of cellular carbohydrate metabolism. Its glycosidic phosphomonoester moiety primes αGlc 1-P for flexible exploitation in glucosyl and phosphoryl transfer reactions. Two structurally and mechanistically distinct sugar-phosphate phosphatases from Escherichia coli were characterized in this study for utilization of αGlc 1-P as a phosphoryl donor substrate. The agp gene encodes a periplasmic αGlc 1-P phosphatase (Agp) belonging to the histidine acid phosphatase family. Had13 is from the haloacid dehydrogenase-like phosphatase family. Cytoplasmic expression of Agp (in E. coli Origami B) gave a functional enzyme preparation (kcat for phosphoryl transfer from αGlc 1-P to water, 40 s(-1)) that was shown by mass spectrometry to exhibit no free cysteines and the native intramolecular disulfide bond between Cys(189) and Cys(195). Enzymatic phosphoryl transfer from αGlc 1-P to water in H2 (18)O solvent proceeded with complete (18)O label incorporation into the phosphate released, consistent with catalytic reaction through O-1-P, but not C-1-O, bond cleavage. Hydrolase activity of both enzymes was not restricted to a glycosidic phosphomonoester substrate, and d-glucose 6-phosphate was converted with a kcat similar to that of αGlc 1-P. By examining phosphoryl transfer from αGlc 1-P to an acceptor substrate other than water (d-fructose or d-glucose), we discovered that Agp exhibited pronounced synthetic activity, unlike Had13, which utilized αGlc 1-P mainly for phosphoryl transfer to water. By applying d-fructose in 10-fold molar excess over αGlc 1-P (20 mM), enzymatic conversion furnished d-fructose 1-phosphate as the main product in a 55% overall yield. Agp is a promising biocatalyst for use in transphosphorylation from αGlc 1-P. PMID:25527541

  2. Hydrolysis of microporous polyamide-6 membranes as substrate for in situ synthesis of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tang, Jianxin; He, Nongyue; Nie, Libo; Xiao, Pengfeng; Chen, Hong

    2004-02-01

    This article provides a novel method of preparing substrate for in situ synthesis of oligonucleotide by hydrolyzing microporous polyamide-6 membranes in a 0.01 mol/l/NaOH/(H 2O-CH 3OH) mixture medium with refluxing about 36 h. Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR) demonstrated the emergence of amines (NH 2) on the surface. Optimum hydrolyzing conditions were determined through the ultra-violet (UV) spectra. A pH value of 12 and a hydrolysis time of 36 h are the preferred conditions for the modification. The treated membrane can be applied to in situ synthesis of oligonucleotide and, for example, the oligonucleotide probes of 5 '-AAC CAC CAA ACA CAC-3 ' were successfully synthesized on the hydrolyzed membrane. The single step coupling efficiency determined by ultraviolet (UV) spectra is above 98%.

  3. Electron migration in 5-bromouracil-substituted DNA and oligonucleotides in irradiated aqueous solutions

    SciTech Connect

    Zimbrick, J.D.; Beach, C.M.; Fuciarelli, A.G.; Sisk, E.C.

    1992-06-01

    Results of work by other investigators support the hypothesis that negative charge can migrate in DNA. Charge transfer between nucleotides and electron migration in solid state DNA has been demonstrated, with migration distances as great as 110 bases. Here we report a series of studies on aqueous solutions of DNA and oligonucleotides in which the radiolysis of 5-bromouracil (BU) substituted for thymine is used as a molecular probe to detect and measure the extent of electron migration. In studies using oligonucleotides, BU was substituted for thymine at specific locations in defined base sequences using automated phosphoramidite synthesis techniques. Using these single-stranded oligonucleotides with BU located at the 5 in. end of the sequence, electrons do not appear to migrate more than one base, if any.

  4. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    SciTech Connect

    Sebastiani, F.; Comez, L.; Sacchetti, F.; Orecchini, A.; Petrillo, C.; Paciaroni, A.; De Francesco, A.; Teixeira, S. C. M.

    2015-07-07

    The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  5. Potent triple helix stabilization by 5',3'-modified triplex-forming oligonucleotides.

    PubMed

    Ben Gaied, Nouha; Zhao, Zhengyun; Gerrard, Simon R; Fox, Keith R; Brown, Tom

    2009-07-20

    Anthraquinone and pyrene analogues attached to the 3' and/or 5' termini of triplex-forming oligonucleotides (TFOs) by various linkers increased the stability of parallel triple helices. The modifications are simple to synthesize and can be introduced during standard solid-phase oligonucleotide synthesis. Potent triplex stability was achieved by using doubly modified TFOs, which in the most favourable cases gave an increase in melting temperature of 30 degrees C over the unmodified counterparts and maintained their selectivity for the correct target duplex. Such TFOs can produce triplexes with melting temperatures of 40 degrees C at pH 7 even though they do not contain any triplex-stabilizing base analogues. These studies have implications for the design of triplex-forming oligonucleotides for use in biology and nanotechnology. PMID:19554592

  6. Dipentafluorophenyl carbonate--a reagent for the synthesis of oligonucleotides and their conjugates.

    PubMed Central

    Efimov, V A; Kalinkina, A L; Chakhmakhcheva, O G

    1993-01-01

    Dipentafluorophenyl carbonate has been successfully used as condensing agent for the internucleotide bond formation in the synthesis of oligonucleotides via H-phosphonate approach. The mechanism of a nucleotide component activation with this reagent has been investigated with the help of 31P NMR spectroscopy. It was shown that preactivation of deoxynucleoside H-phosphonate with dipentafluorophenyl carbonate has no influence on the efficiency of the synthesis. This reagent is highly reactive, nonhygroscopic and stable on storage at room temperature. The effectiveness of dipentafluorophenyl carbonate in the oligonucleotide chemistry has been demonstrated in the solid-phase synthesis of 10-50-mers on 0.2, 1 and 10 mumol scales. The use of this reagent for the derivatisation of polymer supports as well as for the synthesis of oligonucleotide conjugates with polyethylene glycol and a lipid is described. Images PMID:8265346

  7. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  8. Pinpointing RNA-Protein Cross-Links with Site-Specific Stable Isotope-Labeled Oligonucleotides

    PubMed Central

    2015-01-01

    High affinity RNA-protein interactions are critical to cellular function, but directly identifying the determinants of binding within these complexes is often difficult. Here, we introduce a stable isotope mass labeling technique to assign specific interacting nucleotides in an oligonucleotide-protein complex by photo-cross-linking. The method relies on generating site-specific oxygen-18-labeled phosphodiester linkages in oligonucleotides, such that covalent peptide-oligonucleotide cross-link sites arising from ultraviolet irradiation can be assigned to specific sequence positions in both RNA and protein simultaneously by mass spectrometry. Using Lin28A and a let-7 pre-element RNA, we demonstrate that mass labeling permits unambiguous identification of the cross-linked sequence positions in the RNA-protein complex. PMID:26583201

  9. Development of a New Oligonucleotide Array To Identify Staphylococcal Strains at Species Level

    PubMed Central

    Giammarinaro, Philippe; Leroy, Sabine; Chacornac, Jean-Paul; Delmas, Julien; Talon, Regine

    2005-01-01

    The genus Staphylococcus is made up of 36 validated species which contain strains that are pathogenic, saprophytic, or used as starter cultures for the food industry. An oligonucleotide array targeting the manganese-dependent superoxide dismutase (sodA) gene was developed to overcome the drawbacks of the conventional methods of identification. Divergences of the sodA gene were used to design oligonucleotide probes, and we showed that each of the 36 species had a characteristic pattern of hybridization. To evaluate the array, we analyzed 38 clinical and 38 food or food plant Staphylococcus isolates identified by the phenotype-based system VITEK 2 (bioMérieux). This commercial kit failed to identify 8 (21%) of the clinical isolates and 32 (84%) of the food and food plant isolates. In contrast, the oligonucleotide array we designed provided an accurate and rapid method for the identification of staphylococcal strains, isolated from clinical, environmental, or food samples, at species level. PMID:16081895

  10. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  11. Smart polymeric micelles as nanocarriers for oligonucleotides and siRNA delivery.

    PubMed

    Kataoka, Kazunori; Itaka, Keiji; Nishiyama, Nobuhiro; Yamasaki, Yuichi; Oishi, Motoi; Nagasaki, Yukio

    2005-01-01

    The development of in vivo delivery systems for oligonucleotides and siRNA is strongly desired to achieve their clinical applications. Recently, polyplex micelles, which are formed through an electrostatic interaction between nucleic acid compounds (DNA and RNA) and poly(ethylene glycol) (PEG)-polycation block copolymers, have received much attention due to their nanometric-scaled size and excellent biocompatibility. Here, three types of newly engineered block copolymers were developed to construct polyplex micelles useful for oligonucleotides and siRNA delivery: (1) PEG-polycation diblock copolymers possessing diamine side-chain with distinctive pKa for siRNA encapsulation into polyplex micelles with high endosomal escaping ability, (2) Lactosylated PEG-(oligonucleotide or siRNA) conjugate through acid-labile beta-thiopropionate linkage to construct pH-sensitive PIC micelles, and (3) PEG-poly(methacrylic acid) block copolymer for the construction of organic/inorganic hybrid nanoparticles encapsulating siRNA. PMID:17150611

  12. Immobilization of DNA in polyacrylamide gel for the manufacture of DNA and DNA-oligonucleotide microchips.

    SciTech Connect

    Proudnikov, D.; Timofeev, E.; Mirzabekov, A.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology

    1998-05-15

    Activated DNA was immobilized in aldehyde-containing polyacrylamide gel for use in manufacturing the MAGIChip (microarrays of gel-immobilized compounds on a chip). First, abasic sites were generated in DNA by partial acidic depurination. Amino groups were then introduced into the abasic sites by reaction with ethylenediamine and reduction of the aldimine bonds formed. It was found that DNA could be fragmented at the site of amino group incorporation or preserved mostly unfragmented. In similar reactions, both amino-DNA and amino-oligonucleotides were attached through their amines to polyacrylamide gel derivatized with aldehyde groups. Single- and double-stranded DNA of 40 to 972 nucleotides or base pairs were immobilized on the gel pads to manufacture a DNA microchip. The microchip was hybridized with fluorescently labeled DNA-specific oligonucleotide probes. This procedure for immobilization of amino compounds was used to manufacture MAGIChips containing both DNA and oligonucleotides.

  13. Detergent phosphate bans and eutrophication

    SciTech Connect

    Lee, G.F.; Jones, R.A.

    1986-04-01

    The Vollenweider-OECD eutrophication model has been expanded to approximately 400 lakes. It is possible to make a quantitative prediction of the effects of a detergent phosphate ban and thereby to ascertain the potential benefits of such a ban. In order to assess the effect of a detergent phosphate ban on water quality it is necessary to know the percentage of phosphorus in the domestic waste water that enters the water body, either directly or indirectly, and the percentage of the total phosphorus load that is derived from domestic wastewater. Although detergent phosphate bans generally will not result in an overall improvement to water quality, there may be some situations in which eutrophication-related water quality would be improved by a ban. 8 references, 1 figure, 1 table.

  14. Non-fullerene electron acceptors for use in organic solar cells.

    PubMed

    Nielsen, Christian B; Holliday, Sarah; Chen, Hung-Yang; Cryer, Samuel J; McCulloch, Iain

    2015-11-17

    The active layer in a solution processed organic photovoltaic device comprises a light absorbing electron donor semiconductor, typically a polymer, and an electron accepting fullerene acceptor. Although there has been huge effort targeted to optimize the absorbing, energetic, and transport properties of the donor material, fullerenes remain as the exclusive electron acceptor in all high performance devices. Very recently, some new non-fullerene acceptors have been demonstrated to outperform fullerenes in comparative devices. This Account describes this progress, discussing molecular design considerations and the structure-property relationships that are emerging. The motivation to replace fullerene acceptors stems from their synthetic inflexibility, leading to constraints in manipulating frontier energy levels, as well as poor absorption in the solar spectrum range, and an inherent tendency to undergo postfabrication crystallization, resulting in device instability. New acceptors have to address these limitations, providing tunable absorption with high extinction coefficients, thus contributing to device photocurrent. The ability to vary and optimize the lowest unoccupied molecular orbital (LUMO) energy level for a specific donor polymer is also an important requirement, ensuring minimal energy loss on electron transfer and as high an internal voltage as possible. Initially perylene diimide acceptors were evaluated as promising acceptor materials. These electron deficient aromatic molecules can exhibit good electron transport, facilitated by close packed herringbone crystal motifs, and their energy levels can be synthetically tuned. The principal drawback of this class of materials, their tendency to crystallize on too large a length scale for an optimal heterojunction nanostructure, has been shown to be overcome through introduction of conformation twisting through steric effects. This has been primarily achieved by coupling two units together, forming dimers with

  15. Non-Fullerene Electron Acceptors for Use in Organic Solar Cells

    PubMed Central

    2015-01-01

    Conspectus The active layer in a solution processed organic photovoltaic device comprises a light absorbing electron donor semiconductor, typically a polymer, and an electron accepting fullerene acceptor. Although there has been huge effort targeted to optimize the absorbing, energetic, and transport properties of the donor material, fullerenes remain as the exclusive electron acceptor in all high performance devices. Very recently, some new non-fullerene acceptors have been demonstrated to outperform fullerenes in comparative devices. This Account describes this progress, discussing molecular design considerations and the structure–property relationships that are emerging. The motivation to replace fullerene acceptors stems from their synthetic inflexibility, leading to constraints in manipulating frontier energy levels, as well as poor absorption in the solar spectrum range, and an inherent tendency to undergo postfabrication crystallization, resulting in device instability. New acceptors have to address these limitations, providing tunable absorption with high extinction coefficients, thus contributing to device photocurrent. The ability to vary and optimize the lowest unoccupied molecular orbital (LUMO) energy level for a specific donor polymer is also an important requirement, ensuring minimal energy loss on electron transfer and as high an internal voltage as possible. Initially perylene diimide acceptors were evaluated as promising acceptor materials. These electron deficient aromatic molecules can exhibit good electron transport, facilitated by close packed herringbone crystal motifs, and their energy levels can be synthetically tuned. The principal drawback of this class of materials, their tendency to crystallize on too large a length scale for an optimal heterojunction nanostructure, has been shown to be overcome through introduction of conformation twisting through steric effects. This has been primarily achieved by coupling two units together

  16. Insights on the design and electron-acceptor properties of conjugated organophosphorus materials.

    PubMed

    Baumgartner, Thomas

    2014-05-20

    The development of conjugated organic materials has become a rapidly evolving field of research, particularly with a view toward practical applications in so-called organic electronics that encompass a variety of device types, such as OLEDs, OPVs, and OFETs. Almost all of these devices minimally require the presence of electron-donor and -acceptor components that act as p- and n-type semiconductors, respectively. Research over the past two decades has shown that while there is an abundant resource of organic p-type materials, suitable n-type species are few and far between. To overcome this severe bottleneck for the further development of organic electronics, researchers have identified organo-main-group avenues as valuable alternatives toward organic electron-acceptor materials that may ultimately be used as n-type components in practical devices. One particular element of interest in this context is phosphorus, which at first glance may not necessarily suggest such properties. In this Account, I provide detailed insights on the origin of the electron-acceptor properties of organophosphorus-based conjugated materials and include an overview of important molecular species that have been developed by my group and others. To this end, I explain that the electron-acceptor properties of conjugated organophosphorus materials originate from an interaction known as negative hyperconjugation. While this particular interaction creates a simply inductively withdrawing phosphoryl substituent for π-conjugated scaffolds, incorporation of a phosphorus atom as an integral part of a cyclic substructure within a π-conjugated system provides a much more complex, versatile, and consequently highly valuable tool for the tuning of the electron-acceptor properties of the materials. Notably, the degree of negative hyperconjugation can effectively be tailored in various ways via simple substitution at the phosphorus center. This is now well established for phosphole-based molecular

  17. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile.

    PubMed

    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B

    2016-01-01

    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride ("DQAsomes") have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2'-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription-translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We describe

  18. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile

    PubMed Central

    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B

    2016-01-01

    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride (“DQAsomes”) have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2′-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription–translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We

  19. Toll-like receptor 9 mediates CpG oligonucleotide-induced cellular invasion.

    PubMed

    Ilvesaro, Joanna M; Merrell, Melinda A; Li, Li; Wakchoure, Savita; Graves, David; Brooks, Sonja; Rahko, Eeva; Jukkola-Vuorinen, Arja; Vuopala, Katri S; Harris, Kevin W; Selander, Katri S

    2008-10-01

    Toll-like receptor 9 (TLR9) belongs to the innate immune system and recognizes microbial and vertebrate DNA. We showed previously that treatment with the TLR9-agonistic ODN M362 (a CpG sequence containing oligonucleotide) induces matrix metalloproteinase-13-mediated invasion in TLR9-expressing human cancer cell lines. Here, we further characterized the role of the TLR9 pathway in this process. We show that CpG oligonucleotides induce invasion in macrophages from wild-type C57/B6 and MyD88 knockout mice and in human MDA-MB-231 breast cancer cells lacking MyD88 expression. This effect was significantly inhibited in macrophages from TLR9 knockout mice and in human MDA-MB-231 breast cancer cells stably expressing TLR9 small interfering RNA or dominant-negative tumor necrosis factor receptor-associated factor 6 (TRAF6). Sequence modifications to the CpG oligonucleotides that targeted the stem loop and other secondary structures were shown to influence the invasion-inducing effect in MDA-MB-231 cells. In contrast, methylation of the cytosine residues of the parent CpG oligonucleotide did not affect the TLR9-mediated invasion compared with the unmethylated parent CpG oligonucleotide. Finally, expression of TLR9 was studied in clinical breast cancer samples and normal breast epithelium with immunohistochemistry. TLR9 staining localized in epithelial cells in both cancer and normal samples. The mean TLR9 staining intensity was significantly increased in the breast cancer cells compared with normal breast epithelial cells. In conclusion, our results suggest that TLR9 expression is increased in breast cancer and CpG oligonucleotide-induced cellular invasion is mediated via TLR9 and TRAF6, independent of MyD88. Further, our findings suggest that the structure and/or stability of DNA may influence the induction of TLR9-mediated invasion in breast cancer. PMID:18922969

  20. [Phosphate metabolism and iron deficiency].

    PubMed

    Yokoyama, Keitaro

    2016-02-01

    Autosomal dominant hypophosphatemic rickets(ADHR)is caused by gain-of-function mutations in FGF23 that prevent its proteolytic cleavage. Fibroblast growth factor 23(FGF23)is a hormone that inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D biosynthesis. Low iron status plays a role in the pathophysiology of ADHR. Iron deficiency is an environmental trigger that stimulates FGF23 expression and hypophosphatemia in ADHR. It was reported that FGF23 elevation in patients with CKD, who are often iron deficient. In patients with nondialysis-dependent CKD, treatment with ferric citrate hydrate resulted in significant reductions in serum phosphate and FGF23. PMID:26813504

  1. Catalytic reaction of cytokinin dehydrogenase: preference for quinones as electron acceptors.

    PubMed Central

    Frébortová, Jitka; Fraaije, Marco W; Galuszka, Petr; Sebela, Marek; Pec, Pavel; Hrbác, Jan; Novák, Ondrej; Bilyeu, Kristin D; English, James T; Frébort, Ivo

    2004-01-01

    The catalytic reaction of cytokinin oxidase/dehydrogenase (EC 1.5.99.12) was studied in detail using the recombinant flavoenzyme from maize. Determination of the redox potential of the covalently linked flavin cofactor revealed a relatively high potential dictating the type of electron acceptor that can be used by the enzyme. Using 2,6-dichlorophenol indophenol, 2,3-dimethoxy-5-methyl-1,4-benzoquinone or 1,4-naphthoquinone as electron acceptor, turnover rates with N6-(2-isopentenyl)adenine of approx. 150 s(-1) could be obtained. This suggests that the natural electron acceptor of the enzyme is quite probably a p-quinone or similar compound. By using the stopped-flow technique, it was found that the enzyme is rapidly reduced by N6-(2-isopentenyl)adenine (k(red)=950 s(-1)). Re-oxidation of the reduced enzyme by molecular oxygen is too slow to be of physiological relevance, confirming its classification as a dehydrogenase. Furthermore, it was established for the first time that the enzyme is capable of degrading aromatic cytokinins, although at low reaction rates. As a result, the enzyme displays a dual catalytic mode for oxidative degradation of cytokinins: a low-rate and low-substrate specificity reaction with oxygen as the electron acceptor, and high activity and strict specificity for isopentenyladenine and analogous cytokinins with some specific electron acceptors. PMID:14965342

  2. Donor-acceptor type co-crystals of arylthio-substituted tetrathiafulvalenes and fullerenes.

    PubMed

    Lu, Xiaofeng; Sun, Jibin; Zhang, Shangxi; Ma, Longfei; Liu, Lei; Qi, Hui; Shao, Yongliang; Shao, Xiangfeng

    2015-01-01

    A series of donor-acceptor type co-crystals of fullerene (as the acceptor) and arylthio-substituted tetrathiafulvalene derivatives (Ar-S-TTF, as the donor) were prepared and their structural features were thoroughly investigated. The formation of co-crystals relies on the flexibility of Ar-S-TTF and the size matches between Ar-S-TTF and fullerene. Regarding their compositions, the studied co-crystals can be divided into two types, where types I and II have donor:acceptor ratios of 1:1 and 1:2, respectively. Multiple intermolecular interactions are observed between the donor and acceptor, which act to stabilize the structures of the resulting co-crystals. In the type I co-crystals, the fullerene molecule is surrounded by four Ar-S-TTF molecules, that is, two Ar-S-TTF molecules form a sandwich structure with one fullerene molecule and the other two Ar-S-TTF molecules interact with the fullerene molecule along their lateral axes. In the type II co-crystals, one fullerene molecule has the donor-acceptor mode similar to that in type I, whereas the other fullerene molecule is substantially surrounded by the aryl groups on Ar-S-TTF molecules and the solvent molecules. PMID:26199659

  3. Theoretical calculation of the miniband-to-acceptor magnetoluminescence of semiconductor superlattices

    NASA Astrophysics Data System (ADS)

    Latgé, A.; Porras-Montenegro, N.; de Dios-Leyva, M.; Oliveira, L. E.

    1997-05-01

    The acceptor-related photoluminescence of a GaAs-(Ga,Al)As superlattice, under the influence of a magnetic field applied parallel to the interfaces, is theoretically studied following a variational procedure within the effective-mass approximation. Electron and hole magnetic Landau levels and envelope wave functions were obtained by an expansion in terms of sine functions, whereas for the impurity levels the envelope functions were taken as products of sine and hydrogenic-like variational functions. Impurity binding energies and wave functions are obtained for acceptors at a general position in the superlattice and for different in-plane magnetic fields. Theoretical results corresponding to transitions from the conduction subband to states of acceptors (miniband-to-acceptor e-A0 transitions) at the edge and center positions of the GaAs quantum well compare well with available experimental data by Skromme et al. [Phys. Rev. Lett. 65, 2050 (1990)] on the magnetic-field dependence of the photoluminescence peak position of conduction miniband-to-acceptor transitions for different temperatures and values of the superlattice period.

  4. Electronic structure of sub-surface Boron acceptors in silicon for potential qubits

    NASA Astrophysics Data System (ADS)

    Rahman, Rajib; Mol, Jan; Klimeck, Gerhard; Rogge, Sven

    2013-03-01

    Single acceptors in silicon are investigated as potential qubits. Due to the p-type nature of the valence band (VB), the acceptor states are less susceptible to the hyperfine interaction of the neighboring nuclear spins. The presence of a stronger spin-orbit coupling in the VB also enables the possibility of an all-electric qubit control. Whereas donor qubits exhibit exchange oscillation with separation distance due to conduction band valleys, Boron acceptors are expected to have smoother exchange curves. We investigate the electronic structure of single Boron acceptors in silicon in the presence of electric field, strain, magnetic field, and interfaces. Bulk Boron acceptors have a four-fold degenerate ground state 45 meV above the VB with angular momentum states of 3/2 and 1/2. An interface splits this manifold into Kramer's doublets. Application of E and B fields allow several possibilities for forming a two-level qubit driven by an ac electric field. We compare calculations from atomistic tight-binding theory to scanning tunneling microscope (STM) measurements and k.p calculations. The tight-binding method captures additional wavefunction symmetries due to the crystal that help to explain the STM measurements.

  5. Natural organic matter as electron acceptor: experimental evidence for its important role in anaerobic respiration

    NASA Astrophysics Data System (ADS)

    Lau, Maximilian Peter; Sander, Michael; Gelbrecht, Jörg; Hupfer, Michael

    2014-05-01

    Microbial respiration is a key driver of element cycling in oxic and anoxic environments. Upon depletion of oxygen as terminal electron acceptor (TEA), a number of anaerobic bacteria can employ alternative TEA for intracellular energy generation. Redox active quinone moieties in dissolved organic matter (DOM) are well known electron acceptors for microbial respiration. However, it remains unclear whether quinones in adsorbed and particulate OM accept electrons in a same way. In our studies we aim to understand the importance of natural organic matter (NOM) as electron acceptors for microbial energy gain and its possible implications for methanogenesis. Using a novel electrochemical approach, mediated electrochemical reduction and -oxidation, we can directly quantify reduced hydroquinone and oxidized quionone moieties in dissolved and particulate NOM samples. In a mesocosm experiment, we rewetted sediment and peat soil and followed electron transfer to the inorganic and organic electron acceptors over time. We found that inorganic and organic electron acceptor pools were depleted over the same timescales. More importantly, we showed that organic, NOM-associated electron accepting moieties represent as much as 21 40% of total TEA inventories. These findings support earlier studies that propose that the reduction of quinone moieties in particulate organic matter competitively suppresses methanogenesis in wetland soils. Our results indicate that electron transfer to organic, particulate TEA in inundated ecosystems has to be accounted for when establishing carbon budgets in and projecting greenhouse gas emissions from these systems.

  6. An alpha-glucose-1-phosphate phosphodiesterase is present in rat liver cytosol

    SciTech Connect

    Srisomsap, C.; Richardson, K.L.; Jay, J.C.; Marchase, R.B. )

    1989-12-05

    UDP-glucose:glycoprotein glucose-1-phosphotransferase (Glc-phosphotransferase) catalyzes the transfer of alpha-Glc-1-P from UDP-Glc to mannose residues on acceptor glycoproteins. The predominant acceptor for this transfer in both mammalian cells and Paramecium is a cytoplasmic glycoprotein of 62-63 kDa. When cytoplasmic proteins from rat liver were fractionated by preparative isoelectric focusing following incubation of a liver homogenate with the 35S-labeled phosphorothioate analogue of UDP-Glc ((beta-35S)UDP-Glc), the acceptor was found to have a pI of about 6.0. This fraction, when not labeled prior to the focusing, became very heavily labeled when mixed with (beta-35S). UDP-Glc and intact liver microsomes, a rich source of the Glc-phosphotransferase. In addition, it was observed that the isoelectric fractions of the cytosol having pI values of 2-3.2 contained a degradative activity, alpha-Glc-1-P phosphodiesterase, that was capable of removing alpha-Glc-1-P, monitored through radioactive labeling both in the sugar and the phosphate, as an intact unit from the 62-kDa acceptor. Identification of the product of this cleavage was substantiated by its partial transformation to UDP-Glc in the presence of UTP and UDP-Glc pyrophosphorylase. The alpha-Glc-1-P phosphodiesterase had a pH optimum of 7.5 and was not effectively inhibited by any of the potential biochemical inhibitors that were tested. Specificity for the Glc-alpha-1-P-6-Man diester was suggested by the diesterase's inability to degrade UDP-Glc or glucosylphosphoryldolichol. This enzyme may be important in the regulation of secretion since the alpha-Glc-1-P present on the 62-kDa phosphoglycoprotein appears to be removed and then rapidly replaced in response to secretagogue.

  7. Oxalyl-CPG: a labile support for synthesis of sensitive oligonucleotide derivatives.

    PubMed Central

    Alul, R H; Singman, C N; Zhang, G R; Letsinger, R L

    1991-01-01

    A procedure is described for linking nucleosides covalently to controlled pore glass or cross-linked polystyrene supports by means of an oxalyl anchor. Though stable to triethylamine and diisopropylamine, the nucleoside-oxalyl link can be cleaved within a few minutes at room temperature with ammonium hydroxide in methanol. This new anchor can be used in automated synthesis of conventional oligonucleotides. The primary value, however, is that it enables one to employ solid support methodology to synthesize a variety of base-sensitive oligonucleotide derivatives, as illustrated here by synthesis of oligomers with base protecting groups intact and with methyl phosphotriester groups at the internucleoside links. PMID:2027761

  8. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    PubMed

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye. PMID:26774580

  9. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

    2013-01-01

    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  10. Immobilization of DNA via oligonucleotides containing an aldehyde or carboxylic acid group at the 5' terminus.

    PubMed Central

    Kremsky, J N; Wooters, J L; Dougherty, J P; Meyers, R E; Collins, M; Brown, E L

    1987-01-01

    A general method for the immobilization of DNA through its 5'-end has been developed. A synthetic oligonucleotide, modified at its 5'-end with an aldehyde or carboxylic acid, was attached to latex microspheres containing hydrazide residues. Using T4 polynucleotide ligase and an oligonucleotide splint, a single stranded 98mer was efficiently joined to the immobilized synthetic fragment. After impregnation of the latex microspheres with the fluorescent dye, Nile Red and attachment of an aldehyde 16mer, 5 X 10(5) bead-DNA conjugates could be detected with a conventional fluorimeter. Images PMID:3562241

  11. Large scale, liquid phase synthesis of oligonucleotides by the phosphoramidite approach.

    PubMed Central

    Bonora, G M; Biancotto, G; Maffini, M; Scremin, C L

    1993-01-01

    A new method for the liquid phase synthesis of oligonucleotides is described which makes use of polyethylene glycol (PEG) as soluble support and phosphoramidite derivatives as synthons. The new synthetic protocol was applied to a quite large scale production (about 100 mumoles) of such compounds up to the 20mer level. This solution method, called HELP High Efficiency Liquid Phase) Plus, appears effective in terms of speed and coupling yield and can be evaluated for the production of large amount of oligonucleotides. PMID:8464706

  12. Oligonucleotide-based label-free detection with optical microresonators: strategies and challenges.

    PubMed

    Toren, Pelin; Ozgur, Erol; Bayindir, Mehmet

    2016-07-01

    This review targets diversified oligonucleotide-based biodetection techniques, focusing on the use of microresonators of whispering gallery mode (WGM) type as optical biosensors mostly integrated with lab-on-a-chip systems. On-chip and microfluidics combined devices along with optical microresonators provide rapid, robust, reproducible and multiplexed biodetection abilities in considerably small volumes. We present a detailed overview of the studies conducted so far, including biodetection of various oligonucleotide biomarkers as well as deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs) and proteins. We particularly advert to chemical surface modifications for specific and selective biosensing. PMID:27306702

  13. Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

    DOEpatents

    Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

    2002-01-01

    This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

  14. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    PubMed

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-09-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  15. Approach to the synthesis of natural and modified oligonucleotides by the phosphotriester method using O-nucleophilic intramolecular catalysis.

    PubMed

    Efimov, Vladimir A; Molchanova, Natalia S; Chakhmakhcheva, Oksana G

    2007-01-01

    An approach to the solid phase synthesis of natural and modified oligonucleotides using phosphotriester technique has been developed. Particularly, this method allows the synthesis of ribo- and deoxyribo-oligonucleotides containing various 2'-modified mononucleotides as well as stereodefined nucleotide phosphorothioate analogues. PMID:18058542

  16. Proficiency of acceptor-donor-acceptor organic dye with spiro-MeOTAD HTM on the photovoltaic performance of dye sensitized solar cell

    NASA Astrophysics Data System (ADS)

    Ramavenkateswari, K.; Venkatachalam, P.

    2016-08-01

    This work investigates the proficiency of acceptor-donor-acceptor (A-D-A) organic dye Diisopropyl azodicarboxylate (DIAC) as photosensitizer on the photovoltaic parameters of silver (Ag) doped TiO2 photoanode dye-sensitized solar cells (DSSCs) with quasi-solid state electrolyte/hole transport material (HTM) spiro-MeOTAD. TNSs (TiO2 nanosticks) photoanodes are prepared through sol-gel method and hydrothermal technique. X-ray powder diffraction (XRD), transmission electron microscope (TEM), scanning electron microscopy (SEM) and BET measurement were used to characterize the structure and morphology of TiO2 nanostructures. The Diisopropyl azodicarboxylate organic dye with TNPs-Ag@TNSs composite photoanode structure and spiro-MeOTAD HTM exhibited better power conversion efficiency (PCE). [Figure not available: see fulltext.

  17. Energy Level Tuning of Non-Fullerene Acceptors in Organic Solar Cells.

    PubMed

    Cnops, Kjell; Zango, German; Genoe, Jan; Heremans, Paul; Martinez-Diaz, M Victoria; Torres, Tomas; Cheyns, David

    2015-07-22

    The use of non-fullerene acceptors in organic photovoltaic (OPV) devices could lead to enhanced efficiencies due to increased open-circuit voltage (VOC) and improved absorption of solar light. Here we systematically investigate planar heterojunction devices comprising peripherally substituted subphthalocyanines as acceptors and correlate the device performance with the heterojunction energetics. As a result of a balance between VOC and the photocurrent, tuning of the interface energy gap is necessary to optimize the power conversion efficiency in these devices. In addition, we explore the role of the charge transport layers in the device architecture. It is found that non-fullerene acceptors require adjusted buffer layers with aligned electron transport levels to enable efficient charge extraction, while the insertion of an exciton-blocking layer at the anode interface further boosts photocurrent generation. These adjustments result in a planar-heterojunction OPV device with an efficiency of 6.9% and a VOC above 1 V. PMID:26104833

  18. Influence of the local environment on Mn acceptors in GaAs.

    PubMed

    Lee, Donghun; Gohlke, David; Benjamin, Anne; Gupta, Jay A

    2015-04-22

    As transistors continue to shrink toward nanoscale dimensions, their characteristics are increasingly dependent on the statistical variations of impurities in the semiconductor material. The scanning tunneling microscope (STM) can be used to not only study prototype devices with atomically precise placement of impurity atoms, but can also probe how the properties of these impurities depend on the local environment. Tunneling spectroscopy of Mn acceptors in GaAs indicates that surface-layer Mn act as a deep acceptor, with a hole binding energy that can be tuned by positioning charged defects nearby. Band bending induced by the tip or by these defects can also tune the ionization state of the acceptor complex, evident as a ring-like contrast in STM images. The interplay of these effects is explored over a wide range of defect distances, and understood using iterative simulations of tip-induced band bending. PMID:25782688

  19. Spectroscopic studies of charge transfer complexes between colchicine and some π acceptors

    NASA Astrophysics Data System (ADS)

    Arslan, Mustafa; Duymus, Hulya

    2007-07-01

    Charge transfer complexes between colchicine as donor and π acceptors such as tetracyanoethylene (TCNE), 2,3-dichloro-5,6-dicyano- p-benzoquinone (DDQ), p-chloranil ( p-CHL) have been studied spectrophotometrically in dichloromethane at 21 °C. The stoichiometry of the complexes was found to be 1:1 ratio by the Job method between donor and acceptors with the maximum absorption band at a wavelength of 535, 585 and 515 nm. The equilibrium constant and thermodynamic parameters of the complexes were determined by Benesi-Hildebrand and van't Hoff equations. Colchicine in pure form and in dosage form was applied in this study. The formation constants for the complexes were shown to be dependent on the structure of the electron acceptors used.

  20. Donor-Acceptor Heterojunction Configurations Based on DNA-Multichromophore Arrays.

    PubMed

    Nakamura, Mitsunobu; Tsuto, Koji; Jomura, Ayumi; Takada, Tadao; Yamana, Kazushige

    2015-08-10

    Multichromophore arrays of bis(2-thienyl)diketopyrrolopyrrole (DPP) and naphthalenediimide (NDI) with two Zn(II) -cyclens were constructed using thymidine DNA as a scaffold through the binding of the Zn(II) -cyclens with thymine bases. We demonstrate photocurrent generation in a donor-acceptor heterojunction configuration consisting of the DPP (donor) and NDI (acceptor) arrays co-immobilized on an Au electrode. The co-immobilized electrode exhibited good photocurrent responses because of the efficient charge separation between the DPP and NDI arrays. In contrast, an immobilized electrode consisting of randomly assembled DPP-NDI arrays generated no photocurrent response because DPP formed ground-state charge-transfer complexes with NDI in the randomly assembled arrays. Therefore, our approach to generate donor-acceptor heterojunctions based on DNA-multichromophore arrays is a useful method to efficiently generate photocurrent. PMID:26179473