Science.gov

Sample records for oligonucleotide probes

  1. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  2. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays.

    PubMed

    O'Sullivan, Paul J; Burke, Martina; Soini, Aleksi E; Papkovsky, Dmitri B

    2002-11-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3'- or 5'-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5'-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY 7 dye (dark quencher) showed strong (approximately 20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  3. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays

    PubMed Central

    O’Sullivan, Paul J.; Burke, Martina; Soini, Aleksi E.; Papkovsky, Dmitri B.

    2002-01-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3′- or 5′-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5′-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY® 7 dye (dark quencher) showed strong (∼20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  4. Oligonucleotide probe for detection and identification of Campylobacter pylori.

    PubMed Central

    Morotomi, M; Hoshina, S; Green, P; Neu, H C; LoGerfo, P; Watanabe, I; Mutai, M; Weinstein, I B

    1989-01-01

    We have developed a novel and practical DNA-RNA hybridization assay for the detection and identification of Campylobacter pylori in the gastric mucosa. This technique utilizes a [32P]ddATP-labeled synthetic oligonucleotide probe complementary to a nucleotide sequence present in C. pylori 16S rRNA. This probe is very sensitive and reacted with all 23 strains of C. pylori tested. It is also highly specific, since there was no cross-reactivity with the heterologous organisms Campylobacter coli, C. fetus subsp. fetus, C. jejuni, and C. laridis or with Escherichia coli. Hybridization of the oligonucleotide probe with C. pylori RNA was completely inhibited by treatment of the membrane filters with RNase but not DNase. Although a gastric mucosa tissue homogenate slightly inhibited the hybridization, as few as 10(4) C. pylori cells could be detected even in the presence of 5 mg of gastric mucosa. Gastric biopsy specimens obtained from patients referred for upper gastrointestinal tract endoscopy were tested for C. pylori infection by direct oligonucleotide hybridization, and the results were compared with those of bacteriological cultures, the urease test, and histological observations. A comparison of the urease test and the oligonucleotide hybridization results showed an excellent correlation between the two methods. The clinical usefulness of this oligonucleotide-RNA hybridization method is discussed. Images PMID:2480360

  5. Molecular Crowding Effects on Microgel-Tethered Oligonucleotide Probes.

    PubMed

    Ma, Youlong; Libera, Matthew

    2016-06-28

    Microgel tethering is a nontraditional method with which to bind oligonucleotide hybridization probes to a solid surface. Microgel-tethering physically positions the probes away from the underlying hard substrate and maintains them in a highly waterlike environment. This paper addresses the question of whether molecular crowding affects the performance of microgel-tethered molecular beacon probes. The density of probe-tethering sites is controlled experimentally using thin-film blends of biotin-terminated [PEG-B] and hydroxyl-terminated [PEG-OH] poly(ethylene glycol) from which microgels are synthesized and patterned by electron beam lithography. Fluorescence measurements indicate that the number of streptavidins, linear DNA probes, hairpin probes, and molecular beacon probes bound to the microgels increases linearly with increasing PEG-B/PEG-OH ratio. For a given tethering-site concentration, more linear probes can bind than structured probes. Crowding effects emerge during the hybridization of microgel-tethered molecular beacons but not during the hybridization of linear probes, as the tethering density increases. Crowding during hybridization is associated with conformational constraints imposed by the close proximity of closed and hybridized structured probes. The signal-to-background ratio (SBR) of hybridized beacons is highest and roughly constant for low tethering densities and decreases at the highest tethering densities. Despite differences between microgel tethering and traditional oligonucleotide surface-immobilization approaches, these results show that crowding defines an optimum tethering density for molecular beacon probes that is less than the maximum possible, which is consistent with previous studies involving various linear and structured oligonucleotide probes. PMID:27253904

  6. Molecular Probe Data Base: a database on synthetic oligonucleotides.

    PubMed Central

    Romano, P; Aresu, O; Parodi, B; Manniello, A; Campi, G; Angelini, G; Romani, M; Iannotta, B; Rondanina, G; Ruzzon, T

    1993-01-01

    The Molecular Probe Data Base (MPDB) was designed to collect and make information on synthetic oligonucleotides available on-line. This paper briefly describes its purpose, contents and structure, forms and mode of data distribution. Particular emphasis is given to recent data extension and system enhancements that have been carried out in order to simplify access to MPDB for unskilled users. PMID:8332523

  7. Molecular Probe Database: a database on synthetic oligonucleotides

    PubMed Central

    Aresu, Ottavia; Parodi, Barbara; Romano, Paolo; Romani, Massimo; Angelini, Giovanna; Manniello, Assunta; Ianotta, Beatrice; Rondanina, Gabriella; Ruzzon, Tiziana; Santi, Leonardo

    1992-01-01

    The Molecular Probe Data Base (MPDB) is designed to collect and make available on-line information on synthetic oligonucleotides. This paper briefly describes the purpose of MPDB, its content and structure, forms and mode of data distribution, and a series of additional services available to scientists using MPDB. PMID:1598231

  8. [Research progress of probe design software of oligonucleotide microarrays].

    PubMed

    Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

    2014-02-01

    DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software. PMID:24804514

  9. probeCheck--a central resource for evaluating oligonucleotide probe coverage and specificity.

    PubMed

    Loy, Alexander; Arnold, Roland; Tischler, Patrick; Rattei, Thomas; Wagner, Michael; Horn, Matthias

    2008-10-01

    The web server probeCheck, freely accessible at http://www.microbial-ecology.net/probecheck, provides a pivotal forum for rapid specificity and coverage evaluations of probes and primers against selected databases of phylogenetic and functional marker genes. Currently, 24 widely used sequence collections including the Ribosomal Database Project (RDP) II, Greengenes, SILVA and the Functional Gene Pipeline/Repository can be queried. For this purpose, probeCheck integrates a new online version of the popular ARB probe match tool with free energy (DeltaG) calculations for each perfectly matched and mismatched probe-target hybrid, allowing assessment of the theoretical binding stabilities of oligo-target and non-target hybrids. For each output sequence, the accession number, the GenBank taxonomy and a link to the respective entry at GenBank, EMBL and, if applicable, the query database are displayed. Filtering options allow customizing results on the output page. In addition, probeCheck is linked with probe match tools of RDP II and Greengenes, NCBI blast, the Oligonucleotide Properties Calculator, the two-state folding tool of the DINAMelt server and the rRNA-targeted probe database probeBase. Taken together, these features provide a multifunctional platform with maximal flexibility for the user in the choice of databases and options for the evaluation of published and newly developed probes and primers. PMID:18647333

  10. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries

    PubMed Central

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2016-01-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection–based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization. PMID:26054766

  11. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  12. Selection of optimal oligonucleotide probes for microarrays using multiple criteria, global alignment and parameter estimation

    PubMed Central

    Li, Xingyuan; He, Zhili; Zhou, Jizhong

    2005-01-01

    The oligonucleotide specificity for microarray hybridization can be predicted by its sequence identity to non-targets, continuous stretch to non-targets, and/or binding free energy to non-targets. Most currently available programs only use one or two of these criteria, which may choose ‘false’ specific oligonucleotides or miss ‘true’ optimal probes in a considerable proportion. We have developed a software tool, called CommOligo using new algorithms and all three criteria for selection of optimal oligonucleotide probes. A series of filters, including sequence identity, free energy, continuous stretch, GC content, self-annealing, distance to the 3′-untranslated region (3′-UTR) and melting temperature (Tm), are used to check each possible oligonucleotide. A sequence identity is calculated based on gapped global alignments. A traversal algorithm is used to generate alignments for free energy calculation. The optimal Tm interval is determined based on probe candidates that have passed all other filters. Final probes are picked using a combination of user-configurable piece-wise linear functions and an iterative process. The thresholds for identity, stretch and free energy filters are automatically determined from experimental data by an accessory software tool, CommOligo_PE (CommOligo Parameter Estimator). The program was used to design probes for both whole-genome and highly homologous sequence data. CommOligo and CommOligo_PE are freely available to academic users upon request. PMID:16246912

  13. probeBase--an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016.

    PubMed

    Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

    2016-01-01

    probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

  14. FRET study of G-quadruplex forming fluorescent oligonucleotide probes at the lipid monolayer interface

    NASA Astrophysics Data System (ADS)

    Swiatkowska, Angelika; Kosman, Joanna; Juskowiak, Bernard

    2016-01-01

    Spectral properties and G-quadruplex folding ability of fluorescent oligonucleotide probes at the cationic dioctadecyldimethylammonium bromide (DODAB) monolayer interface are reported. Two oligonucleotides, a 19-mer bearing thrombin binding aptamer sequence and a 21-mer with human telomeric sequence, were end-labeled with fluorescent groups (FAM and TAMRA) to give FRET probes F19T and F21T, respectively. The probes exhibited abilities to fold into a quadruplex structure and to bind metal cations (Na+ and K+). Fluorescence spectra of G-quadruplex FRET probes at the monolayer interface are reported for the first time. Investigations included film balance measurements (π-A isotherms) and fluorescence spectra recording using a fiber optic accessory interfaced with a spectrofluorimeter. The effect of the presence of DODAB monolayer, metal cations and the surface pressure of monolayer on spectral behavior of FRET probes were examined. Adsorption of probe at the cationic monolayer interface resulted in the FRET signal enhancement even in the absence of metal cations. Variation in the monolayer surface pressure exerted rather modest effect on the spectral properties of probes. The fluorescence energy transfer efficiency of monolayer adsorbed probes increased significantly in the presence of sodium or potassium ion in subphase, which indicated that the probes retained their cation binding properties when adsorbed at the monolayer interface.

  15. Evaluating bacterial activity from cell-specific ribosomal RNA content measured with oligonucleotide probes

    SciTech Connect

    Kemp, P.F.; Lee, S.; LaRoche, J.

    1992-10-01

    We describe a procedure for measuring the cell-specific quantity of ribosomal RNA (rRNA) and DNA in order to evaluate the frequency distribution of activity among cells. The procedure is inherently quantitative, does not require sample incubation and potentially can be taxon-specific. Fluorescently-labelled oligonucleotide probes are hybridized to the complementary 16S rRNA sequences in preserved, intact cells. The resulting cell fluorescence is proportional to cellular rRNA content and can be measured with a microscope-mounted photometer system, by image analysis, or by flow cytometry. Similarly, DNA content is measured as fluorescence of cells stained with the DNA specific fluorochrome DAPI. These are either prepared as separate samples for purposes of enumeration and DNA measurements, or are dual-labelled cells which are also hybridized with oligonucleotide probes.

  16. Evaluating bacterial activity from cell-specific ribosomal RNA content measured with oligonucleotide probes

    SciTech Connect

    Kemp, P.F.; Lee, S.; LaRoche, J.

    1992-01-01

    We describe a procedure for measuring the cell-specific quantity of ribosomal RNA (rRNA) and DNA in order to evaluate the frequency distribution of activity among cells. The procedure is inherently quantitative, does not require sample incubation and potentially can be taxon-specific. Fluorescently-labelled oligonucleotide probes are hybridized to the complementary 16S rRNA sequences in preserved, intact cells. The resulting cell fluorescence is proportional to cellular rRNA content and can be measured with a microscope-mounted photometer system, by image analysis, or by flow cytometry. Similarly, DNA content is measured as fluorescence of cells stained with the DNA specific fluorochrome DAPI. These are either prepared as separate samples for purposes of enumeration and DNA measurements, or are dual-labelled cells which are also hybridized with oligonucleotide probes.

  17. Identification and classification of Oxalobacter formigenes strains by using oligonucleotide probes and primers.

    PubMed Central

    Sidhu, H; Allison, M; Peck, A B

    1997-01-01

    Genomic DNAs of various strains of Oxalobacter formigenes were subjected to restriction endonuclease fragment length polymorphism- and PCR-based amplification analyses with DNA probes and primers complementary to sequences within either the oxc gene, encoding oxalyl coenzyme A (oxalyl-CoA) decarboxylase, or the frc gene, encoding formyl-CoA transferase. Oligonucleotide probes based on nonconserved sequences of oxc or frc were able to divide O. formigenes strains into at least two groups, consistent with the current separation of O. formigenes strains into groups I and II on the basis of 16S rRNA sequence similarities and lipid content. In contrast, an oligonucleotide probe based on the conserved 5' end of oxc appeared to bind all group I and the majority of group II strains. PCR amplification of the oxc gene showed even greater sensitivity in detecting O. formigenes and provided support for further division of the strains into subgroups. In addition, these oligonucleotides failed to hybridize to or amplify PCR products from whole fecal DNA isolated from fresh stool samples from an individual not colonized with O. formigenes, indicating unique specificity. Thus, these DNA analyses permit both detection as well as classification of O. formigenes strains. PMID:9003594

  18. Methicillin-Resistant Bacteria Inhabiting Surface Waters Monitored by mecA-Targeted Oligonucleotide Probes.

    PubMed

    Seyedmonir, Elnaz; Yilmaz, Fadime; Icgen, Bulent

    2016-08-01

    Part of a 20-60 kb staphylococcal chromosome cassette called mecA encodes low-affinity penicillin-binding protein PBP2a and causes methicillin resistance. Among all methicillin-resistant bacteria, methicillin-resistant Staphylococcus aureus is a major pathogen and main concern worldwide. Although the origin of the mecA is not very well-defined, mecA homologues are also ubiquitous in methicillin-resistant non-staphylococcal bacteria. Due to the dissemination of methicillin resistance through the transmission of mecA gene among staphylococcal and non-staphylococcal bacteria inhabiting surface waters, there is a need to monitor mecA gene in these waters for public health safety. Therefore, this study aimed at monitoring mecA harboring bacteria inhabiting surface waters by using fluorescently labelled mecA-targeted oligonucleotide probes. Under the hybridization conditions of 55 % formamide and 0.020 M NaCl at 46°C, the oligonucleotide probe used in the study showed high hybridization stringency to the mecA gene targeted. The strong linear relationships observed between the signal intensity and the target gene were used to assess the population dynamics of mecA harboring isolates over a 2-year-period. The results indicated that mecA-targeted oligonucleotide probes can be effectively used for in situ monitoring of methicillin resistant isolates inhabiting surface waters. PMID:27156085

  19. Selection of oligonucleotide probes and experimental conditions for multiplex hybridization experiments.

    PubMed

    Bains, W

    1994-01-01

    Different DNA probes hybridize under different conditions. I examine the constraints of the design of oligonucleotide probes that are meant to hybridize to different unique sites in human genomic DNA under a single set of hybridization conditions as a parallel array. In 522 kb of human genomic DNA, 75% of 12-base and 89% of 22-base are unique, as opposed to 90% and 100% as expected of unstructured DNA, and this is not due solely to repetitive elements in the DNA. Hybridization in TMAC to reduce A+T content effects on melting temperature allows only 90% of unique targets to be hybridized under one set of conditions if a 2 degrees C difference between matched and mismatched sequences is required. Standard hybridization conditions allow no more than 60% of unique probes to be used together. This suggests that probe, hybridization conditions, and instrument design for multiple-probe hybridization applications will be harder than previously suggested. PMID:7803130

  20. Quantification of methanogenic groups in anaerobic biological reactors by oligonucleotide probe hybridization.

    PubMed Central

    Raskin, L; Poulsen, L K; Noguera, D R; Rittmann, B E; Stahl, D A

    1994-01-01

    The microbial community structure of anaerobic biological reactors was evaluated by using oligonucleotide probes complementary to conserved tracts of the 16S rRNAs of phylogenetically defined groups of methanogens. Phylogenetically defined groups of methanogens were quantified and visualized, respectively, by hybridization of 32P- and fluorescent-dye-labeled probes to the 16S rRNAs from samples taken from laboratory acetate-fed chemostats, laboratory municipal solid waste digestors, and full-scale sewage sludge digestors. Methanosarcina species, members of the order Methanobacteriales, and Methanosaeta species were the most abundant methanogens present in the chemostats, the solid-waste digestors, and the sewage sludge digestors, respectively. PMID:7517129

  1. Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution: II. Polycondensations

    NASA Technical Reports Server (NTRS)

    Kolb, V.; Orgel, L. E.

    1995-01-01

    We have prepared a [32P]-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.

  2. Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution. 2: Polycondensations

    NASA Technical Reports Server (NTRS)

    Kolb, Vera; Orgel, Leslie E.

    1995-01-01

    We have prepared a (P-32)-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.

  3. Design, Validation and Annotation of Transcriptome-Wide Oligonucleotide Probes for the Oligochaete Annelid Eisenia fetida

    PubMed Central

    Gong, Ping; Pirooznia, Mehdi; Guan, Xin; Perkins, Edward J.

    2010-01-01

    High density oligonucleotide probe arrays have increasingly become an important tool in genomics studies. In organisms with incomplete genome sequence, one strategy for oligo probe design is to reduce the number of unique probes that target every non-redundant transcript through bioinformatic analysis and experimental testing. Here we adopted this strategy in making oligo probes for the earthworm Eisenia fetida, a species for which we have sequenced transcriptome-scale expressed sequence tags (ESTs). Our objectives were to identify unique transcripts as targets, to select an optimal and non-redundant oligo probe for each of these target ESTs, and to annotate the selected target sequences. We developed a streamlined and easy-to-follow approach to the design, validation and annotation of species-specific array probes. Four 244K-formatted oligo arrays were designed using eArray and were hybridized to a pooled E. fetida cRNA sample. We identified 63,541 probes with unsaturated signal intensities consistently above the background level. Target transcripts of these probes were annotated using several sequence alignment algorithms. Significant hits were obtained for 37,439 (59%) probed targets. We validated and made publicly available 63.5K oligo probes so the earthworm research community can use them to pursue ecological, toxicological, and other functional genomics questions. Our approach is efficient, cost-effective and robust because it (1) does not require a major genomics core facility; (2) allows new probes to be easily added and old probes modified or eliminated when new sequence information becomes available, (3) is not bioinformatics-intensive upfront but does provide opportunities for more in-depth annotation of biological functions for target genes; and (4) if desired, EST orthologs to the UniGene clusters of a reference genome can be identified and selected in order to improve the target gene specificity of designed probes. This approach is particularly

  4. Thiol- and biotin-labeled probes for oligonucleotide quartz crystal microbalance biosensors of microalga alexandrium minutum.

    PubMed

    Lazerges, Mathieu; Perrot, Hubert; Rabehagasoa, Niriniony; Compère, Chantal

    2012-01-01

    Two quartz crystal microbalance oligonucleotide biosensors of a toxic microalga gene sequence (Alexandrium Minutum) have been designed. Grafting on a gold surface of 20-base thiol- or biotin-labeled probe, and selective hybridization with the complementary 20-base target, have been monitored in situ with a 27 MHz quartz crystal microbalance under controlled hydrodynamic conditions. The frequency of the set up is stable to within a few hertz, corresponding to the nanogram scale, for three hour experiments. DNA recognition by the two biosensors is efficient and selective. Hybridization kinetic curves indicate that the biosensor designed with the thiol-labeled probe is more sensitive, and that the biosensor designed with the biotin-labeled probe has a shorter time response and a higher hybridization efficiency. PMID:25585927

  5. Thiol- and Biotin-Labeled Probes for Oligonucleotide Quartz Crystal Microbalance Biosensors of Microalga Alexandrium Minutum

    PubMed Central

    Lazerges, Mathieu; Perrot, Hubert; Rabehagasoa, Niriniony; Compère, Chantal

    2012-01-01

    Two quartz crystal microbalance oligonucleotide biosensors of a toxic microalga gene sequence (Alexandrium Minutum) have been designed. Grafting on a gold surface of 20-base thiol- or biotin-labeled probe, and selective hybridization with the complementary 20-base target, have been monitored in situ with a 27 MHz quartz crystal microbalance under controlled hydrodynamic conditions. The frequency of the set up is stable to within a few hertz, corresponding to the nanogram scale, for three hour experiments. DNA recognition by the two biosensors is efficient and selective. Hybridization kinetic curves indicate that the biosensor designed with the thiol-labeled probe is more sensitive, and that the biosensor designed with the biotin-labeled probe has a shorter time response and a higher hybridization efficiency. PMID:25585927

  6. Label-free liquid crystal biosensor based on specific oligonucleotide probes for heavy metal ions.

    PubMed

    Yang, Shengyuan; Wu, Chao; Tan, Hui; Wu, Yan; Liao, Shuzhen; Wu, Zhaoyang; Shen, Guoli; Yu, Ruqin

    2013-01-01

    In this study, to enhance the capability of metal ions disturbing the orientation of liquid crystals (LCs), we designed a new label-free LC biosensor for the highly selective and sensitive detection of heavy metal ions. This strategy makes use of the target-induced DNA conformational change to enhance the disruption of target molecules for the orientation of LC leading to an amplified optical signal. The Hg(2+) ion, which possesses a unique property to bind specifically to two DNA thymine (T) bases, is used as a model heavy metal ion. In the presence of Hg(2+), the specific oligonucleotide probes form a conformational reorganization of the oligonucleotide probes from hairpin structure to duplex-like complexes. The duplex-like complexes are then bound on the triethoxysilylbutyraldehyde/N,N-dimethyl-N-octadecyl (3-aminopropyl) trimethoxysilyl chloride (TEA/DMOAP)-coated substrate modified with capture probes, which can greatly distort the orientational profile of LC, making the optical image of LC cell birefringent as a result. The optical signal of LC sensor has a visible change at the Hg(2+) concentration of low to 0.1 nM, showing good detection sensitivity. The cost-effective LC sensing method can translate the concentration signal of heavy metal ions in solution into the presence of DNA duplexes and is expected to be a sensitive detection platform for heavy metal ions and other small molecule monitors. PMID:23214408

  7. Solid- and solution-phase synthesis and application of R6G dual-labeled oligonucleotide probes.

    PubMed

    Skoblov, Aleksander Yu; Vichuzhanin, Maxim V; Farzan, Valentina M; Veselova, Olga A; Konovalova, Tatiana A; Podkolzin, Alexander T; Shipulin, German A; Zatsepin, Timofei S

    2015-10-15

    A novel N-TFA-protected carboxyrhodamine 6G (R6G) phosphoramidite was synthesized for use in an automated DNA synthesis to prepare 5'-labeled oligonucleotides. Deprotection and purification conditions were optimized for 5'-labeled and dual-labeled oligonucleotide probes. As an alternative we synthesized an azide derivative of R6G for CuAAC post-synthetic oligonucleotide labeling. Dual-labeled probes obtained by both methods showed the same efficacy in a quantitative PCR assay. R6G-labeled probes demonstrated superior properties in a qPCR assay in comparison with alternative HEX, JOE and SIMA dyes due to more efficient fluorescence quenching by BHQ-1. We successfully used R6G dual-labeled probes for rotavirus genotyping. PMID:26392371

  8. Design and Verification of a Pangenome Microarray Oligonucleotide Probe Set for Dehalococcoides spp. ▿ †

    PubMed Central

    Hug, Laura A.; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R.; Edwards, Elizabeth A.

    2011-01-01

    Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This “pangenome” probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined. PMID:21666017

  9. PhylOPDb: a 16S rRNA oligonucleotide probe database for prokaryotic identification

    PubMed Central

    Jaziri, Faouzi; Parisot, Nicolas; Abid, Anis; Denonfoux, Jérémie; Ribière, Céline; Gasc, Cyrielle; Boucher, Delphine; Brugère, Jean-François; Mahul, Antoine; Hill, David R.C.; Peyretaillade, Eric; Peyret, Pierre

    2014-01-01

    In recent years, high-throughput molecular tools have led to an exponential growth of available 16S rRNA gene sequences. Incorporating such data, molecular tools based on target-probe hybridization were developed to monitor microbial communities within complex environments. Unfortunately, only a few 16S rRNA gene-targeted probe collections were described. Here, we present PhylOPDb, an online resource for a comprehensive phylogenetic oligonucleotide probe database. PhylOPDb provides a convivial and easy-to-use web interface to browse both regular and explorative 16S rRNA-targeted probes. Such probes set or subset could be used to globally monitor known and unknown prokaryotic communities through various techniques including DNA microarrays, polymerase chain reaction (PCR), fluorescent in situ hybridization (FISH), targeted gene capture or in silico rapid sequence identification. PhylOPDb contains 74 003 25-mer probes targeting 2178 genera including Bacteria and Archaea. Database URL: http://g2im.u-clermont1.fr/phylopdb/ PMID:24771669

  10. Non-radioactive detection of oligonucleotide probes by photochemical amplification of dioxetanes.

    PubMed Central

    Schubert, F; Knaf, A; Möller, U; Cech, D

    1995-01-01

    We describe a new method of non-radioactive labelling and detection of oligonucleotide probes. The approach is based on a simple chemical principle. Oligonucleotides labelled with methylene blue (a photosensitizer) are hybridized on a membrane to immobilized DNA target sequences. After hybridization and stringency washing 2(-)[3-(hydroxyphenyl)methoxymethylene] adamantane is added to the membrane and the membrane is irradiated with a tungsten lamp light source through a cut-off filter. Thermally stable dioxetanes are amplified during irradiation at the positions of the labelled probe. These amplified dioxetanes are detected using chemically triggered chemiluminescent decay. Signals are recorded on commercial X-ray film. Detection is possible immediately after the last washing step and a hard copy of the blot is obtained within 1 h. Dependent on the level of the target sequences, the sensitivity of the method allows detection of 0.3 pg single-stranded M13mp18(+) plasmid DNA in dot blots and 75 pg in Southern blots. Additional immunological reaction steps and washing steps with blocking reagents and buffers are avoided. Furthermore, expensive reagents and equipment for physical detection are not necessary. The method might be particularly useful for fast routine analysis in forensic and medical applications. The synthesis of the olefin, conditions of hybridization and the protocol of detection are described in detail. Images PMID:8524657

  11. Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution

    NASA Technical Reports Server (NTRS)

    Kolb, V.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1994-01-01

    We have prepared a [32P]-labled oligonucleotide probe carrying a free primary amine at its 3'-terminus. This probe is used to initiate polymerization of aziridine (ethyleneimine) in aqueous solution. The nature of the oligomeric products and the kinetics of their formation are then monitored by gel electrophoresis. Our results are generally consistent with those obtained using conventional techniques. We have also investigated the effect of polyanionic templates on the rate of oligomerization of aziridine. We find that water-soluble polyanions generally accelerate the polymerization. The sodium salt of polymethacrylic acid is the most effective of the templates that we studied. The methods introduced in this paper should be applicable to a variety of polymerization reactions in aqueous solution. They should greatly simplify the screening of potentially prebiotic polymerization reactions.

  12. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    PubMed

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  13. An in vitro selection scheme for oligonucleotide probes to discriminate between closely related DNA sequences

    PubMed Central

    Brukner, Ivan; El-Ramahi, Razan; Gorska-Flipot, Izabella; Krajinovic, Maja; Labuda, Damian

    2007-01-01

    Using an in vitro selection, we have obtained oligonucleotide probes with high discriminatory power against multiple, similar nucleic acid sequences, which is often required in diagnostic applications for simultaneous testing of such sequences. We have tested this approach, referred to as iterative hybridizations, by selecting probes against six 22-nt-long sequence variants representing human papillomavirus, (HPV). We have obtained probes that efficiently discriminate between HPV types that differ by 3–7 nt. The probes were found effective to recognize HPV sequences of the type 6, 11, 16, 18 and a pair of type 31 and 33, either when immobilized on a solid support or in a reverse configuration, as well to discriminate HPV types from the clinical samples. This methodology can be extended to generate diagnostic kits that rely on nucleic acid hybridization between closely related sequences. In this approach, instead of adjusting hybridization conditions to the intended set of probe–target pairs, we ‘adjust’, through in vitro selection, the probes to the conditions we have chosen. Importantly, these conditions have to be ‘relaxed’, allowing the formation of a variety of not fully complementary complexes from which those that efficiently recognize and discriminate intended from non-intended targets can be readily selected. PMID:17426126

  14. A facile and sensitive electrochemiluminescence biosensor for Hg2+ analysis based on a dual-function oligonucleotide probe.

    PubMed

    Huang, Rong-Fu; Liu, Hui-Xin; Gai, Qi-Qi; Liu, Gai-Juan; Wei, Zheng

    2015-09-15

    In this study, a sensitive electrochemiluminescent (ECL) biosensor for the detection of Hg(2+) was easily prepared by self-assembling mercury-specific oligonucleotide on the surface of gold nanoparticles (AuNPs) modified indium tin oxide (ITO) electrode. A conformation change of the oligonucleotide from linear chain to hairpin occurs upon the binding of Hg(2+) through thymine-Hg(2+)-thymine coordination. The dual-function oligonucleotide serves as the probe to Hg(2+) but also a carrier of signal-generating molecules, [Ru(bpy)2(dppz)](BF4)2. It was estimated that one oligonucleotide was able to load with eight ECL signal molecules; a ratio of four or five oligonucleotides per gold nanoparticle was obtained basing on the calculation with surface density. Without tedious multiple-labeling procedures and special modification of oligonucleotide probe for signal transduction/amplification, a detection limit of 5.1 pM Hg(2+) was outstanding from the interference of other ten metal ions. Results of spiked water samples were in good agreement with that obtained by atomic fluorescent spectrometry. PMID:25909339

  15. Using triplex-forming oligonucleotide probes for the reagentless, electrochemical detection of double-stranded DNA.

    PubMed

    Patterson, Adriana; Caprio, Felice; Vallée-Bélisle, Alexis; Moscone, Danila; Plaxco, Kevin W; Palleschi, Giuseppe; Ricci, Francesco

    2010-11-01

    We report a reagentless, electrochemical sensor for the detection of double-stranded DNA targets that employs triplex-forming oligonucleotides (TFOs) as its recognition element. These sensors are based on redox-tagged TFO probes strongly chemisorbed onto an interrogating gold electrode. Upon the addition of the relevant double-stranded DNA target, the probe forms a rigid triplex structure via reverse Hoogsteen base pairing in the major groove. The formation of the triplex impedes contact between the probe's redox moiety and the interrogating electrode, thus signaling the presence of the target. We first demonstrated the proof of principle of this approach by using a well-characterized 22-base polypurine TFO sequence that readily detects a synthetic, double-stranded DNA target. We then confirmed the generalizability of our platform with a second probe, a 19-base polypyrimidine TFO sequence that targets a polypurine tract (PPT) sequence conserved in all HIV-1 strains. Both sensors rapidly and specifically detect their double-stranded DNA targets at concentrations as low as ~10 nM and are selective enough to be employed directly in complex sample matrices such as blood serum. Moreover, to demonstrate real-world applicability of this new sensor platform, we have successfully detected unpurified, double-stranded PCR amplicons containing the relevant conserved HIV-1 sequence. PMID:20936782

  16. Development of mercury (II) ion biosensors based on mercury-specific oligonucleotide probes.

    PubMed

    Li, Lanying; Wen, Yanli; Xu, Li; Xu, Qin; Song, Shiping; Zuo, Xiaolei; Yan, Juan; Zhang, Weijia; Liu, Gang

    2016-01-15

    Mercury (II) ion (Hg(2+)) contamination can be accumulated along the food chain and cause serious threat to the public health. Plenty of research effort thus has been devoted to the development of fast, sensitive and selective biosensors for monitoring Hg(2+). Thymine was demonstrated to specifically combine with Hg(2+) and form a thymine-Hg(2+)-thymine (T-Hg(2+)-T) structure, with binding constant even higher than T-A Watson-Crick pair in DNA duplex. Recently, various novel Hg(2+) biosensors have been developed based on T-rich Mercury-Specific Oligonucleotide (MSO) probes, and exhibited advanced selectivity and excellent sensitivity for Hg(2+) detection. In this review, we explained recent development of MSO-based Hg(2+) biosensors mainly in 3 groups: fluorescent biosensors, colorimetric biosensors and electrochemical biosensors. PMID:26356764

  17. Using Triplex-Forming Oligonucleotide Probes for the Reagentless, Electrochemical Detection of Double-Stranded DNA

    PubMed Central

    Patterson, Adriana; Caprio, Felice; Vallée-Bélisle, Alexis; Moscone, Danila; Plaxco, Kevin W.; Palleschi, Giuseppe; Ricci, Francesco

    2011-01-01

    We report a reagentless, electrochemical sensor for the detection of double-stranded DNA targets that employs triplex-forming oligonucleotides (TFOs) as its recognition element. These sensors are based on redox-tagged TFO probes strongly chemisorbed onto an interrogating gold electrode. Upon the addition of the relevant double-stranded DNA target, the probe forms a rigid triplex structure via reverse Hoogsteen base pairing in the major groove. The formation of the triplex impedes contact between the probe’s redox moiety and the interrogating electrode, thus signaling the presence of the target. We first demonstrated the proof of principle of this approach by using a well-characterized 22-base polypurine TFO sequence that readily detects a synthetic, double-stranded DNA target. We then confirmed the generalizability of our platform with a second probe, a 19-base polypyrimidine TFO sequence that targets a polypurine tract (PPT) sequence conserved in all HIV-1 strains. Both sensors rapidly and specifically detect their double-stranded DNA targets at concentrations as low as ~10 nM and are selective enough to be employed directly in complex sample matrices such as blood serum. Moreover, to demonstrate real-world applicability of this new sensor platform, we have successfully detected unpurified, double-stranded PCR amplicons containing the relevant conserved HIV-1 sequence. PMID:20936782

  18. Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy

    PubMed Central

    Miotke, Laura; Maity, Arindam; Ji, Hanlee; Brewer, Jonathan; Astakhova, Kira

    2015-01-01

    Background Rapid reliable diagnostics of DNA mutations are highly desirable in research and clinical assays. Current development in this field goes simultaneously in two directions: 1) high-throughput methods, and 2) portable assays. Non-enzymatic approaches are attractive for both types of methods since they would allow rapid and relatively inexpensive detection of nucleic acids. Modern fluorescence microscopy is having a huge impact on detection of biomolecules at previously unachievable resolution. However, no straightforward methods to detect DNA in a non-enzymatic way using fluorescence microscopy and nucleic acid analogues have been proposed so far. Methods and Results Here we report a novel enzyme-free approach to efficiently detect cancer mutations. This assay includes gene-specific target enrichment followed by annealing to oligonucleotides containing locked nucleic acids (LNAs) and finally, detection by fluorescence microscopy. The LNA containing probes display high binding affinity and specificity to DNA containing mutations, which allows for the detection of mutation abundance with an intercalating EvaGreen dye. We used a second probe, which increases the overall number of base pairs in order to produce a higher fluorescence signal by incorporating more dye molecules. Indeed we show here that using EvaGreen dye and LNA probes, genomic DNA containing BRAF V600E mutation could be detected by fluorescence microscopy at low femtomolar concentrations. Notably, this was at least 1000-fold above the potential detection limit. Conclusion Overall, the novel assay we describe could become a new approach to rapid, reliable and enzyme-free diagnostics of cancer or other associated DNA targets. Importantly, stoichiometry of wild type and mutant targets is conserved in our assay, which allows for an accurate estimation of mutant abundance when the detection limit requirement is met. Using fluorescence microscopy, this approach presents the opportunity to detect DNA

  19. Kinetics of Oligonucleotide Hybridization to DNA Probe Arrays on High-Capacity Porous Silica Substrates

    PubMed Central

    Glazer, Marc I.; Fidanza, Jacqueline A.; McGall, Glenn H.; Trulson, Mark O.; Forman, Jonathan E.; Frank, Curtis W.

    2007-01-01

    We have investigated the kinetics of DNA hybridization to oligonucleotide arrays on high-capacity porous silica films that were deposited by two techniques. Films created by spin coating pure colloidal silica suspensions onto a substrate had pores of ∼23 nm, relatively low porosity (35%), and a surface area of 17 times flat glass (for a 0.3-μm film). In the second method, latex particles were codeposited with the silica by spin coating and then pyrolyzed, which resulted in larger pores (36 nm), higher porosity (65%), and higher surface area (26 times flat glass for a 0.3-μm film). As a result of these favorable properties, the templated silica hybridized more quickly and reached a higher adsorbed target density (11 vs. 8 times flat glass at 22°C) than the pure silica. Adsorption of DNA onto the high-capacity films is controlled by traditional adsorption and desorption coefficients, as well as by morphology factors and transient binding interactions between the target and the probes. To describe these effects, we have developed a model based on the analogy to diffusion of a reactant in a porous catalyst. Adsorption values (ka, kd, and K) measured on planar arrays for the same probe/target system provide the parameters for the model and also provide an internally consistent comparison for the stability of the transient complexes. The interpretation of the model takes into account factors not previously considered for hybridization in three-dimensional films, including the potential effects of heterogeneous probe populations, partial probe/target complexes during diffusion, and non-1:1 binding structures. The transient complexes are much less stable than full duplexes (binding constants for full duplexes higher by three orders of magnitude or more), which may be a result of the unique probe density and distribution that is characteristic of the photolithographically patterned arrays. The behavior at 22°C is described well by the predictive equations for

  20. Transcription profiling of the early gravitropic response in Arabidopsis using high-density oligonucleotide probe microarrays

    NASA Technical Reports Server (NTRS)

    Moseyko, Nick; Zhu, Tong; Chang, Hur-Song; Wang, Xun; Feldman, Lewis J.

    2002-01-01

    Studies of plant tropisms, the directed growth toward or away from external stimuli such as light and gravity, began more than a century ago. Yet biochemical, physiological, and especially molecular mechanisms of plant tropic responses remain for the most part unclear. We examined expression of 8,300 genes during early stages of the gravitropic response using high-density oligonucleotide probe microarrays. Approximately 1.7% of the genes represented on the array exhibited significant expression changes within the first 30 min of gravity stimulation. Among gravity-induced genes were a number of genes previously implicated to be involved in gravitropism. However, a much larger number of the identified genes have not been previously associated with gravitropism. Because reorientation of plants may also expose plants to mechanical perturbations, we also compared the effects of a gentle mechanical perturbation on mRNA levels during the gravity response. It was found that approximately 39% of apparently gravity-regulated genes were also regulated by the mechanical perturbation caused by plant reorientation. Our study revealed the induction of complex gene expression patterns as a consequence of gravitropic reorientation and points to an interplay between the gravitropic and mechanical responses and to the extreme sensitivity of plants to even very gentle mechanical perturbations.

  1. Microarray-based long oligonucleotides probe designed for Brucella Spp. detection and identification of antibiotic susceptibility pattern

    PubMed Central

    Khazaei, Zahra; Najafi, Ali; Piranfar, Vahhab; Mirnejad, Reza

    2016-01-01

    Brucella spp. is a common zoonotic infection referred to as Brucellosis, and it is a serious public health problem around the world. There are currently six classical species (pathogenic species in both animals and humans) within the genus Brucella. The ability and practicality facilitated by a microarray experiment help us to recognize Brucella spp. and its antibiotic resistant gene. Rapid phenotypic determination of antibiotic resistance is not possible by disk diffusion methods. Thus, evaluating antibiotics pattern and Brucella detection appear necessary technique by molecular methods in brucellosis. So, the aim of this study was to design a microarray long oligonucleotides probe and primer for the complete diagnosis of Brucella spp. and obtaining genetic profiles for antibiotic resistance in bacteria at the same time. In this study, we designed 16 antibiotic-resistant gene solid-phase primers with similar melting temperatures of 60 °C and 16 long oligonucleotide probes. These primers and probes can identify tetracycline-, chloramphenicol-, and aminoglycoside-resistant genes, respectively. The design of microarray probes is a versatile process that be done in a wide range of selections. Since the long oligo microarray probes are the best choices for specific diagnosis and definite treatment, this group of probes was designed in the present survey. PMID:27280008

  2. Microarray-based long oligonucleotides probe designed for Brucella Spp. detection and identification of antibiotic susceptibility pattern.

    PubMed

    Khazaei, Zahra; Najafi, Ali; Piranfar, Vahhab; Mirnejad, Reza

    2016-04-01

    Brucella spp. is a common zoonotic infection referred to as Brucellosis, and it is a serious public health problem around the world. There are currently six classical species (pathogenic species in both animals and humans) within the genus Brucella. The ability and practicality facilitated by a microarray experiment help us to recognize Brucella spp. and its antibiotic resistant gene. Rapid phenotypic determination of antibiotic resistance is not possible by disk diffusion methods. Thus, evaluating antibiotics pattern and Brucella detection appear necessary technique by molecular methods in brucellosis. So, the aim of this study was to design a microarray long oligonucleotides probe and primer for the complete diagnosis of Brucella spp. and obtaining genetic profiles for antibiotic resistance in bacteria at the same time. In this study, we designed 16 antibiotic-resistant gene solid-phase primers with similar melting temperatures of 60 °C and 16 long oligonucleotide probes. These primers and probes can identify tetracycline-, chloramphenicol-, and aminoglycoside-resistant genes, respectively. The design of microarray probes is a versatile process that be done in a wide range of selections. Since the long oligo microarray probes are the best choices for specific diagnosis and definite treatment, this group of probes was designed in the present survey. PMID:27280008

  3. Hairpin oligonucleotides anchored terbium ion: a fluorescent probe to specifically detect lead(II) at sub-nM levels.

    PubMed

    Wei, Yueteng; Liu, Ru; Wang, Yaling; Zhao, Yuliang; Cai, Zhifang; Gao, Xueyun

    2013-04-21

    A terbium based fluorescent probe was synthesized by coordinating terbium ions with a designed oligonucleotides (5'-ATATGGGGGATAT-3', termed GH5). GH5 improved the fluorescence of terbium ions by four orders of magnitude. The fluorescence enhancement of terbium ions by different oligonucleotides sequences indicated that the polyguanine loop of the hairpin GH5 is key to enhance terbium ion emission. The quantum yield of Tb-GH5 probe was 10.5% and the probe was photo-stable. The result of conductivity titration indicated that the stoichiometry of the probe is 3.5 Tb: 1 GH5, which is confirmed by fluorescence titration. This probe had high sensitivity and specificity for the detection of lead ions. The fluorescence intensity of this probe was linear with respect to lead concentration over a range 0.3-2.1 nM (R(2) = 0.99). The limit of detection for lead ions was 0.1 nM at a signal-to-noise ratio of 3. PMID:23446487

  4. In situ identification of nocardioform actinomycetes in activated sludge using fluorescent rRNA-targeted oligonucleotide probes.

    PubMed

    Schuppler, M; Wagner, M; Schön, G; Göbel, U B

    1998-01-01

    Hitherto, few environmental samples have been investigated by a 'full cycle rRNA analysis'. Here the results of in situ hybridization experiments with specific rRNA-targeted oligonucleotide probes developed on the basis of new sequences derived from a previously described comparative 16S rRNA analysis of nocardioform actinomycetes in activated sludge are reported. Application of the specific probes enabled identification and discrimination of the distinct populations of nocardioform actinomycetes in activated sludge. One of the specific probes (DLP) detected rod-shaped bacteria which were found in 13 of the 16 investigated sludge samples from various wastewater treatment plants, suggesting their importance in the wastewater treatment process. Another probe (GLP2) hybridized with typically branched filaments of nocardioforms mainly found in samples from enhanced biological phosphorus removal plants, suggesting that these bacteria are involved in sludge foaming. The combination of in situ hybridization with fluorescently labelled rRNA-targeted oligonucleotide probes and confocal laser scanning microscopy improved the detection of nocardioform actinomycetes, which often showed only weak signals inside the activated-sludge flocs. PMID:9467916

  5. Direct application to dairy foods of a Listeria-specific oligonucleotide probe to 16S rRNA.

    PubMed

    Brooks, J L; Back, J P; Kroll, R G

    1992-08-01

    A potentially Listeria-specific 28 base oligonucleotide probe was designed from 16S rRNA sequence data. Using either 32P or non-radioactive (alkaline phosphatase) labels, the probe was shown to be highly specific as it hybridised to RNA extracted from all of the species of Listeria but not to any of the other bacteria tested. Both probe methods were highly sensitive and ca 10(2) cfu/ml Listeria could be detected in pure cultures. A rapid procedure for extracting RNA from milk, Camembert and cottage cheese was developed. This allowed the direct application of the probe to these foods and gave a rapid and specific method of detecting > 10(2) cfu/g or ml Listeria in these foods. PMID:1280986

  6. Selective and sensitive turn-on detection of adenosine triphosphate and thrombin based on bifunctional fluorescent oligonucleotide probe.

    PubMed

    Li, Feng; Du, Zongfeng; Yang, Limin; Tang, Bo

    2013-03-15

    A bifunctional fluorescent oligonucleotide probe for small molecules and protein detection has been developed based on turn on fluorescence response via the target induced structure-switching of molecular beacon. The two loops of this molecular beacon are designed in such a manner that they consist of thrombin (Tmb) aptamer sequence and adenosine triphosphate (ATP) aptamer sequence, respectively, which are utilized to sense thrombin and ATP. The oligonucleotide forms double stem-loops in the absence of targets, yielding no fluorescence emission because of the FRET from the excited fluorophore to the proximal quencher. Upon addition of the target, the ATP or Tmb, its specific interaction with loop sequence of the hairpin structure induce the separation of reporter fluorophore and the fluorescence quencher of the molecular beacon, resulting in an increase of fluorescence response. Hence, the separate analysis of ATP and Tmb could be realized through only one designed molecular beacon. The detection limits were estimated to be 25 nM for ATP and 12 nM for Tmb, respectively. The results of this study should substantially broaden the perspective for future development of oligonucleotide probe for analysis of other analytes. PMID:23102434

  7. Immobilization of oligonucleotide probes on silicon surfaces using biotin-streptavidin system examined with microscopic and spectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Awsiuk, K.; Rysz, J.; Petrou, P.; Budkowski, A.; Bernasik, A.; Kakabakos, S.; Marzec, M. M.; Raptis, I.

    2014-01-01

    To immobilize effectively oligonucleotide probes on SiO2 modified with (3-aminopropyl)triethoxysilane, four procedures based on streptavidin-biotin system are compared with Atomic Force Microscopy, Angle-Resolved X-ray Photoelectron Spectroscopy and Time-of-Flight Secondary Ion Mass Spectrometry. The first approach involves: adsorption of biotinylated Bovine Serum Albumin, blocking free surface sites with BSA, binding of streptavidin and biotinylated oligonucleotide (b-oligo). Final steps are exchanged in the second procedure with immobilization of preformed streptavidin-b-oligo conjugate. The third approach consists of streptavidin adsorption, blocking with BSA and b-oligo binding. Finally, streptavidin-b-oligo conjugate is immobilized directly within the fourth method. Surface coverage with biomolecules, determined from ARXPS, accords with average AFM height, and is anti-correlated with the intensity of Si+ ions. Higher biomolecular coverage was achieved during the last steps of the first (2.45(±0.38) mg/m2) and second (1.31(±0.22) mg/m2) approach, as compared to lower surface density resulting from the third (0.58(±0.20) mg/m2) and fourth (0.41(±0.11) mg/m2) method. Phosphorus atomic concentration indicates effectiveness of oligonucleotide immobilization. Secondary ions intensities, characteristic for oligonucleotides, streptavidin, BSA, and proteins, allow additional insight into overlayer composition. These measurements verify the ARXPS results and show the superiority of the first two immobilization approaches in terms of streptavidin and oligonucleotide density achieved onto the surface.

  8. Pigeons: A Novel GUI Software for Analysing and Parsing High Density Heterologous Oligonucleotide Microarray Probe Level Data

    PubMed Central

    Lai, Hung-Ming; May, Sean T.; Mayes, Sean

    2014-01-01

    Genomic DNA-based probe selection by using high density oligonucleotide arrays has recently been applied to heterologous species (Xspecies). With the advent of this new approach, researchers are able to study the genome and transcriptome of a non-model or an underutilised crop species through current state-of-the-art microarray platforms. However, a software package with a graphical user interface (GUI) to analyse and parse the oligonucleotide probe pair level data is still lacking when an experiment is designed on the basis of this cross species approach. A novel computer program called Pigeons has been developed for customised array data analysis to allow the user to import and analyse Affymetrix GeneChip® probe level data through XSpecies. One can determine empirical boundaries for removing poor probes based on genomic hybridisation of the test species to the Xspecies array, followed by making a species-specific Chip Description File (CDF) file for transcriptomics in the heterologous species, or Pigeons can be used to examine an experimental design to identify potential Single-Feature Polymorphisms (SFPs) at the DNA or RNA level. Pigeons is also focused around visualization and interactive analysis of the datasets. The software with its manual (the current release number version 1.2.1) is freely available at the website of the Nottingham Arabidopsis Stock Centre (NASC).

  9. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    PubMed Central

    Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT

    2009-01-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539

  10. Design and application of two oligonucleotide probes for the identification of Geodermatophilaceae strains using fluorescence in situ hybridization (FISH).

    PubMed

    Urzì, Clara; La Cono, Violetta; Stackebrandt, Erko

    2004-07-01

    Bacteria of the family of Geodermatophilaceae are actively involved in the decay processes [Urzì, C. and Realini, M. (1998) Int Biodeterior Biodegrad 42: 45-54; Urzì, C., Salamone, P., Schumann, P., and Stackebrandt, E. (2000) Int J Syst Evol Microbiol 50: 529-536] of stone monuments. Characterization of isolates includes phenotypic, chemotaxonomic and genetic analysis often requiring long-term procedures. The use of specific probes for members of Geodermatophilaceae family could be useful for the easy detection of those strains colonizing rock surfaces and involved in the biodeterioration. Two 16S rRNA-targeted oligonucleotide probes were designed for the specific detection of members of the family Geodermatophilaceae using fluorescence in situ hybridization (FISH); one probe specific for members of the two genera Geodermatophilus/Blastococcus and the second for members of the genus Modestobacter. PMID:15186346

  11. Invader Assisted Enzyme-Linked Immunosorbent Assay for Colorimetric Detection of Disease Biomarkers Using Oligonucleotide Probe-Modified Gold Nanoparticles.

    PubMed

    Song, Qinxin; Qi, Xiemin; Jia, Huning; He, Liang; Kumar, Shalen; Pitman, Janet L; Zou, Bingjie; Zhou, Guohua

    2016-04-01

    We successfully developed an invader assisted ELISA assay (iaELISA) for sensitive detection of disease biomarkers. The method includes three key steps as follows; biotinylated detection antibody was at first used to capture targeted antigen by sandwich ELISA. The biotinylated oligonucleotide was then attached to detection antibody via streptavidin. Finally, the cascade invader reactions were employed to amplify the biotinylated oligonucleotide specific to the antigen so that detection of the antigen was transformed into signal amplification of the antigen-specific DNA. To achieve colorimetric detection, oligonucleotide probe and modified gold nanoparticles (AuNPs) were coupled with the invader assay. Utilization of the hairpin probes in the invader reaction brought about free AuNPs, resulting in the positive read-out (red color). On the other hand, aggregation of the AuNPs occurred when the hairpin probes were not utilized in the reaction. This method was successfully used to detect as low as 2.4 x 10(-11) g/mL of HBsAg by both naked eye and spectrophotometer. This sensitivity was about 100 times higher than that of conventional ELISA method. The method was also used to assay 16 serum specimens from HBV-infected patients and 8 serum specimens from HBV-negative donors and results were in good agreement with those obtained from the conventional ELISA. As the invader assay is sensitive to one base sequence, a good specificity was also obtained by detecting other antigens like hepatitis A virus (HAV) and BSA. The method has therefore much potential for ultrasensitive and cost-effective detection of targeted proteins that have clinical importance. PMID:27301208

  12. Rapid In Situ Hybridization using Oligonucleotide Probes on Paraformaldehyde-prefixed Brain of Rats with Serotonin Syndrome.

    PubMed

    Shokry, Ibrahim M; Callanan, John J; Sousa, John; Tao, Rui

    2015-01-01

    3,4-Methylenedioxymethamphetamine (MDMA; ecstasy) toxicity may cause region-specific changes in serotonergic mRNA expression due to acute serotonin (5-hydroxytryptamine; 5-HT) syndrome. This hypothesis can be tested using in situ hybridization to detect the serotonin 5-HT2A receptor gene htr2a. In the past, such procedures, utilizing radioactive riboprobe, were difficult because of the complicated workflow that needs several days to perform and the added difficulty that the technique required the use of fresh frozen tissues maintained in an RNase-free environment. Recently, the development of short oligonucleotide probes has simplified in situ hybridization procedures and allowed the use of paraformaldehyde-prefixed brain sections, which are more widely available in laboratories. Here, we describe a detailed protocol using non-radioactive oligonucleotide probes on the prefixed brain tissues. Hybridization probes used for this study include dapB (a bacterial gene coding for dihydrodipicolinate reductase), ppiB (a housekeeping gene coding for peptidylprolyl isomerase B), and htr2a (a serotonin gene coding for 5-HT2A receptors). This method is relatively simply, cheap, reproducible and requires less than two days to complete. PMID:26437182

  13. Quantification of Gordona amarae Strains in Foaming Activated Sludge and Anaerobic Digester Systems with Oligonucleotide Hybridization Probes

    PubMed Central

    de los Reyes, M. Fiorella; de los Reyes, Francis L.; Hernandez, Mark; Raskin, Lutgarde

    1998-01-01

    Previous studies have shown the predominance of mycolic acid-containing filamentous actinomycetes (mycolata) in foam layers in activated sludge systems. Gordona (formerly Nocardia) amarae often is considered the major representative of this group in activated sludge foam. In this study, small-subunit rRNA genes of four G. amarae strains were sequenced, and the resulting sequences were compared to the sequence of G. amarae type strain SE-6. Comparative sequence analysis showed that the five strains used represent two lines of evolutionary descent; group 1 consists of strains NM23 and ASAC1, and group 2 contains strains SE-6, SE-102, and ASF3. The following three oligonucleotide probes were designed: a species-specific probe for G. amarae, a probe specific for group 1, and a probe targeting group 2. The probes were characterized by dissociation temperature and specificity studies, and the species-specific probe was evaluated for use in fluorescent in situ hybridizations. By using the group-specific probes, it was possible to place additional G. amarae isolates in their respective groups. The probes were used along with previously designed probes in membrane hybridizations to determine the abundance of G. amarae, group 1, group 2, bacterial, mycolata, and Gordona rRNAs in samples obtained from foaming activated sludge systems in California, Illinois, and Wisconsin. The target groups were present in significantly greater concentrations in activated sludge foam than in mixed liquor and persisted in anaerobic digesters. Hybridization results indicated that the presence of certain G. amarae strains may be regional or treatment plant specific and that previously uncharacterized G. amarae strains may be present in some systems. PMID:9647822

  14. Quantification of Gordona amarae strains in foaming activated sludge and anaerobic digester systems with oligonucleotide hybridization probes.

    PubMed

    de los Reyes, M F; de los Reyes, F L; Hernandez, M; Raskin, L

    1998-07-01

    Previous studies have shown the predominance of mycolic acid-containing filamentous actinomycetes (mycolata) in foam layers in activated sludge systems. Gordona (formerly Nocardia) amarae often is considered the major representative of this group in activated sludge foam. In this study, small-subunit rRNA genes of four G. amarae strains were sequenced, and the resulting sequences were compared to the sequence of G. amarae type strain SE-6. Comparative sequence analysis showed that the five strains used represent two lines of evolutionary descent; group 1 consists of strains NM23 and ASAC1, and group 2 contains strains SE-6, SE-102, and ASF3. The following three oligonucleotide probes were designed: a species-specific probe for G. amarae, a probe specific for group 1, and a probe targeting group 2. The probes were characterized by dissociation temperature and specificity studies, and the species-specific probe was evaluated for use in fluorescent in situ hybridizations. By using the group-specific probes, it was possible to place additional G. amarae isolates in their respective groups. The probes were used along with previously designed probes in membrane hybridizations to determine the abundance of G. amarae, group 1, group 2, bacterial, mycolata, and Gordona rRNAs in samples obtained from foaming activated sludge systems in California, Illinois, and Wisconsin. The target groups were present in significantly greater concentrations in activated sludge foam than in mixed liquor and persisted in anaerobic digesters. Hybridization results indicated that the presence of certain G. amarae strains may be regional or treatment plant specific and that previously uncharacterized G. amarae strains may be present in some systems. PMID:9647822

  15. Highly specific identification of single nucleic polymorphism in M. tuberculosis using smart probes and single-molecule fluorescence spectroscopy in combination with blocking oligonucleotides

    NASA Astrophysics Data System (ADS)

    Friedrich, Achim; Müller, Matthias; Nolte, Oliver; Wolfrum, Jürgen; Sauer, Markus; Hoheisel, Jörg D.; Knemeyer, Jens-Peter; Marme, Nicole

    2008-02-01

    In this article we present a method for the highly specific identification of single nucleotide polymorphism (SNP) responsible for rifampicin resistance of Mycobacterium tuberculosis. This approach applies fluorescently labeled hairpin-structured oligonucleotides (smart probes) and confocal single-molecule fluorescence spectroscopy. Smart probes are fluorescently labeled at the 5'-end. The dye's fluorescence is quenched in the closed hairpin conformation due to close proximity of the guanosine residues located at the 3'-end. As a result of the hybridization to the complementary target sequence the hairpin structure and thus fluorescence quenching gets lost and a strong fluorescence increase appears. To enhance the specificity of the SNP detection unlabeled "blocking oligonucleotides" were added to the sample. These oligonucleotides hybridizes to the DNA sequence containing the mismatch thus masking this sequence and hereby preventing the smart probe from hybridizing to the mismatched sequence.

  16. A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

    PubMed

    Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

    2015-10-15

    Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. PMID:26515000

  17. Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

    PubMed

    Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

    2016-04-19

    2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (Up) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes

  18. Quantification of syntrophic fatty acid-{beta}-oxidizing bacteria in a mesophilic biogas reactor by oligonucleotide probe hybridization

    SciTech Connect

    Hansen, K.H.; Ahring, B.K.; Raskin, L.

    1999-11-01

    Small-subunit rRNA sequences were obtained for two saturated fatty acid-{beta}-oxidizing syntrophic bacteria, Syntrophomonas sapovorans and Syntrophomonas wolfei LYB, and sequence analysis confirmed their classification as members of the family Syntrophomonadaceae. S.wolfei LYB was closely related to S.wolfei subsp. solfei, but S. sapovorans did not cluster with the other members of the genus Syntrophomonas. Five oligonucleotide probes targeting the small-subunit rRNA of different groups within the family Syntrophomonadaceae, which contains all currently known saturated fatty acid-{beta}-oxidizing syntrophic bacteria, were developed and characterized. The probes were designed to be specific at the family, genus, and species levels and were characterized by temperature-of-dissociation and specificity studies. To demonstrate the usefulness of the probes for the detection and quantification of saturated fatty acid-{beta}-oxidizing syntrophic bacteria in methanogenic environments, the microbial community structure of a sample from a full-scale biogas plant was determined. Hybridization results with probes for syntrophic bacteria and methanogens were compared to specific methanogenic activities and microbial numbers determined with most-probable-number estimates. Most of the methanogenic rRNA was comprised of Methanomicrobiales rRNA, suggesting that members of this order served as the main hydrogen-utilizing microorganisms. Between 0.2 and 1% of the rRNA was attributed to the Syntrophomonadaceae, or which the majority was accounted for by the genus Syntrophomonas.

  19. Detection of supercoiled hepatitis B virus DNA and related forms by means of molecular hybridization to an oligonucleotide probe

    SciTech Connect

    Lin, H.J.; Chung, H.T.; Lai, C.L.; Leong, S.; Tam, O.S. )

    1989-12-01

    A novel assay for supercoiled and other fully double-stranded forms of hepatitis B virus (HBV) DNA in blood is presented that utilizes molecular hybridisation to a radiophosphorous-labeled oligonucleotide probe. The probe (5'-d(ACGTGCAGAGGTGAAGCGA)) is complementary to the S(+)-strand sequence furthest downstream, at the end of the gap. We examined blood specimens from 137 healthy HBsAg-positive individuals, applying the probe to dots representing 2-3.5 ml serum or plasma. We found that supercoiled HBV is present in many HBV DNA-positive blood specimens albeit in small quantities. Of the 104 specimens that were positive for HBV DNA of any form, 53 annealed to the probe. Serial specimens from the same subject taken over a period of months showed that the proportion of supercoil to other HBV DNA forms was variable. The presence of supercoil HBV DNA was not closely correlated with the level of serum HBV DNA polymerase. The supercoil is an HBV DNA form that can persist in the liver in the presence or absence of other replicative intermediates. This assay may enable further characterization of the status of HBV infection.

  20. Quantification of Syntrophic Fatty Acid-β-Oxidizing Bacteria in a Mesophilic Biogas Reactor by Oligonucleotide Probe Hybridization

    PubMed Central

    Hansen, Kaare H.; Ahring, Birgitte K.; Raskin, Lutgarde

    1999-01-01

    Small-subunit rRNA sequences were obtained for two saturated fatty acid-β-oxidizing syntrophic bacteria, Syntrophomonas sapovorans and Syntrophomonas wolfei LYB, and sequence analysis confirmed their classification as members of the family Syntrophomonadaceae. S. wolfei LYB was closely related to S. wolfei subsp. wolfei, but S. sapovorans did not cluster with the other members of the genus Syntrophomonas. Five oligonucleotide probes targeting the small-subunit rRNA of different groups within the family Syntrophomonadaceae, which contains all currently known saturated fatty acid-β-oxidizing syntrophic bacteria, were developed and characterized. The probes were designed to be specific at the family, genus, and species levels and were characterized by temperature-of-dissociation and specificity studies. To demonstrate the usefulness of the probes for the detection and quantification of saturated fatty acid-β-oxidizing syntrophic bacteria in methanogenic environments, the microbial community structure of a sample from a full-scale biogas plant was determined. Hybridization results with probes for syntrophic bacteria and methanogens were compared to specific methanogenic activities and microbial numbers determined with most-probable-number estimates. Most of the methanogenic rRNA was comprised of Methanomicrobiales rRNA, suggesting that members of this order served as the main hydrogen-utilizing microorganisms. Between 0.2 and 1% of the rRNA was attributed to the Syntrophomonadaceae, of which the majority was accounted for by the genus Syntrophomonas. PMID:10543784

  1. Poly(o-phenylenediamine) colloid-quenched fluorescent oligonucleotide as a probe for fluorescence-enhanced nucleic acid detection.

    PubMed

    Tian, Jingqi; Li, Hailong; Luo, Yonglan; Wang, Lei; Zhang, Yingwei; Sun, Xuping

    2011-02-01

    In this Letter, we demonstrate that chemical oxidation polymerization of o-phenylenediamine (OPD) by potassium bichromate at room temperature results in the formation of submicrometer-scale poly(o-phenylenediamine) (POPD) colloids. Such colloids can absorb and quench dye-labeled single-stranded DNA (ssDNA) very effectively. In the presence of a target, a hybridization event occurs, which produces a double-stranded DNA (dsDNA) that detaches from the POPD surface, leading to recovery of dye fluorescence. With the use of an oligonucleotide (OND) sequence associated with human immunodeficiency virus (HIV) as a model system, we demonstrate the proof of concept that POPD colloid-quenched fluorescent OND can be used as a probe for fluorescence-enhanced nucleic acid detection with selectivity down to single-base mismatch. PMID:21186809

  2. Use of a multiplexed CMOS microarray to optimize and compare oligonucleotide binding to DNA probes synthesized or immobilized on individual electrodes.

    PubMed

    Maurer, Karl; Yazvenko, Nina; Wilmoth, Jodi; Cooper, John; Lyon, Wanda; Danley, David

    2010-01-01

    The CombiMatrix microarray with 12,544 electrodes supports in situ electrochemical synthesis of user-defined DNA probes. As an alternative, we immobilized commercially synthesized DNA probes on individual electrodes coated with electropolymerized polypyrrole (Ppy). Hybridization was measured using a biotinylated target oligonucleotide and either Cy5-streptavidin and fluorescence detection or horseradish peroxidase-streptavidin and enzyme-enhanced electrochemical detection. Detection efficiencies were optimized by varying the deposition of the Ppy, the terminal groups on the DNA probes, and other factors that impacted fluorescence quenching and electrical conductivity. Optimized results were compared against those obtained using a microarray with the same DNA sequences synthesized in situ. Immobilized probes produced higher fluorescence signals, possibly by providing a greater stand off between the Cy5 on the target oligonucleotide and the quenching effects of the Ppy and the platinum electrode. PMID:22163607

  3. Use of a Multiplexed CMOS Microarray to Optimize and Compare Oligonucleotide Binding to DNA Probes Synthesized or Immobilized on Individual Electrodes

    PubMed Central

    Maurer, Karl; Yazvenko, Nina; Wilmoth, Jodi; Cooper, John; Lyon, Wanda; Danley, David

    2010-01-01

    The CombiMatrix microarray with 12,544 electrodes supports in situ electrochemical synthesis of user-defined DNA probes. As an alternative, we immobilized commercially synthesized DNA probes on individual electrodes coated with electropolymerized polypyrrole (Ppy). Hybridization was measured using a biotinylated target oligonucleotide and either Cy5-streptavidin and fluorescence detection or horseradish peroxidase-streptavidin and enzyme-enhanced electrochemical detection. Detection efficiencies were optimized by varying the deposition of the Ppy, the terminal groups on the DNA probes, and other factors that impacted fluorescence quenching and electrical conductivity. Optimized results were compared against those obtained using a microarray with the same DNA sequences synthesized in situ. Immobilized probes produced higher fluorescence signals, possibly by providing a greater stand off between the Cy5 on the target oligonucleotide and the quenching effects of the Ppy and the platinum electrode. PMID:22163607

  4. Designation of Streptomycete 16S and 23S rRNA-based target regions for oligonucleotide probes.

    PubMed Central

    Stackebrandt, E; Witt, D; Kemmerling, C; Kroppenstedt, R; Liesack, W

    1991-01-01

    The 16S and 23S rRNA of various Streptomyces species were partially sequenced and screened for the presence of stretches that could define all members of the genus, groups of species, or individual species. Nucleotide 929 (Streptomyces ambofaciens nomenclature [J.L. Pernodet, M.T. Alegre, F. Boccard, and M. Guerineau, Gene 79:33-46, 1989]) is a nucleotide highly unique to Streptomyces species which, in combination with flanking regions, allowed the designation of a genus-specific probe. Regions 158 through 203 of the 16S rRNA and 1518 through 1645 of the 23S rRNA (helix 54 [Pernodet et al., Gene 79:33-46, 1989]) have a high potential to define species, whereas the degree of variation in regions 982 through 998 and 1102 through 1122 of the 16S rRNA is less pronounced but characteristic for at least certain species. Alone or in combination with each other, these regions may serve as target sites for synthetic oligonucleotide probes and primers to be used in the determination of pure cultures and in the characterization of community structures. The specificity of several probes is demonstrated by dot blot hybridization. Images PMID:1854202

  5. In Situ Accessibility of Saccharomyces cerevisiae 26S rRNA to Cy3-Labeled Oligonucleotide Probes Comprising the D1 and D2 Domains

    PubMed Central

    Inácio, João; Behrens, Sebastian; Fuchs, Bernhard M.; Fonseca, Álvaro; Spencer-Martins, Isabel; Amann, Rudolf

    2003-01-01

    Fluorescence in situ hybridization (FISH) has proven to be most useful for the identification of microorganisms. However, species-specific oligonucleotide probes often fail to give satisfactory results. Among the causes leading to low hybridization signals is the reduced accessibility of the targeted rRNA site to the oligonucleotide, mainly for structural reasons. In this study we used flow cytometry to determine whole-cell fluorescence intensities with a set of 32 Cy3-labeled oligonucleotide probes covering the full length of the D1 and D2 domains in the 26S rRNA of Saccharomyces cerevisiae PYCC 4455T. The brightest signal was obtained with a probe complementary to positions 223 to 240. Almost half of the probes conferred a fluorescence intensity above 60% of the maximum, whereas only one probe could hardly detect the cells. The accessibility map based on the results obtained can be extrapolated to other yeasts, as shown experimentally with 27 additional species (14 ascomycetes and 13 basidiomycetes). This work contributes to a more rational design of species-specific probes for yeast identification and monitoring. PMID:12732564

  6. Vasopressin mRNA in situ hybridization: localization and regulation studied with oligonucleotide cDNA probes in normal and Brattleboro rat hypothalamus

    SciTech Connect

    Uhl, G.R.; Zingg, H.H.; Habener, J.F.

    1985-08-01

    Hybridizable vasopressin mRNA may be quantitatively localized in situ in sections from rat hypothalamus. Radiolabeled oligonucleotide cDNA probes, synthesized by chemical and enzymatic means, provide strong hybridization in zones known to contain vasopressin cell bodies. Multiple single-stranded /sup 32/P-, /sup 35/S-, or /sup 3/H-labeled oligonucleotides demonstrate localized hybridization that increases as probes are lengthened from 8 to 75 bases. Competition studies, RNase experiments, anatomic localization, and use of multiple probes all support hybridization specificity. An approximate doubling of hybridizable mRNA in both supraoptic and paraventricular nuclei can be detected with dehydration of the animals. Hybridizable mRNA densities are virtually normal in hypothalamic nuclei of Brattleboro rats given free access to water. These methods can provide insight into regional mRNA dynamics and may reflect functional activity of peptidergic neurons.

  7. Population variation of human mtDNA control region sequences detected by enzymatic amplification and sequence-specific oligonucleotide probes.

    PubMed Central

    Stoneking, M; Hedgecock, D; Higuchi, R G; Vigilant, L; Erlich, H A

    1991-01-01

    A method for detecting sequence variation of hypervariable segments of the mtDNA control region was developed. The technique uses hybridization of sequence-specific oligonucleotide (SSO) probes to DNA sequences that have been amplified by PCR. The nucleotide sequences of the two hypervariable segments of the mtDNA control region from 52 individuals were determined; these sequences were then used to define nine regions suitable for SSO typing. A total of 23 SSO probes were used to detect sequence variants at these nine regions in 525 individuals from five ethnic groups (African, Asian, Caucasian, Japanese, and Mexican). The SSO typing revealed an enormous amount of variability, with 274 mtDNA types observed among these 525 individuals and with diversity values, for each population, exceeding .95. For each of the nine mtDNA regions significant differences in the frequencies of sequence variants were observed between these five populations. The mtDNA SSO-typing system was successfully applied to a case involving individual identification of skeletal remains; the probability of a random match was approximately 0.7%. The potential useful applications of this mtDNA SSO-typing system thus include the analysis of individual identity as well as population genetic studies. Images Figure 3 PMID:1990843

  8. In situ detection of bacteria in continuous-flow cultures of seawater sediment suspensions with fluorescently labelled rRNA-directed oligonucleotide probes.

    PubMed

    Bruns, A; Berthe-Corti, L

    1998-10-01

    rRNA-targeted and fluorescently labelled oligonucleotide probes were used to study the composition of natural bacterial populations in continuous-flow cultures of seawater sediment suspensions. The cultures were run as enrichment cultures with increasing dilution rates, and hexadecane as the sole carbon source. Total cell numbers were analysed by counting DAPI (4',6-diamidino-2-phenylindole)-stained cells. To differentiate the population composition, oligonucleotide probes for eubacteria, for Cytophaga/Flavobacteria, and for four subclasses of the Proteobacteria (alpha, beta, gamma and delta) were used. About 40-80% of the DAPI-stained cells could be detected with the EUB338 probe. Moreover, it was possible to detect a shift in the composition of the natural bacterial population with increasing dilution rate of the continuous culture, from large amounts of Cytophaga/Flavobacteria to large numbers of members of the gamma-Proteobacteria. The cell recovery rate for bacteria labelled with specific oligonucleotide probes was analysed with defined cell numbers of Rhodospirillum rubrum, Comamonas testosteroni and Desulfovibrio vulgaris subsp. vulgaris introduced into the seawater sediment suspension, and was determined to be 13.9-33.5%. The standard deviation determined for this method applied to sediment suspensions was +/- 8.3%. The results suggest that the application of the in situ hybridization technique allows a good insight into the structure of populations growing in sediment suspensions. PMID:9802019

  9. Structurally responsive oligonucleotide-based single-probe lateral-flow test for detection of miRNA-21 mimics.

    PubMed

    Kor, Kamalodin; Turner, Anthony P F; Zarei, Kobra; Atabati, Morteza; Beni, Valerio; Mak, Wing Cheung

    2016-02-01

    A single-probe strip test for the rapid and sensitive detection of miRNA-21 mimics is reported herein. Highly specific structurally responsive bi-functional, thiol and biotin, DNA/LNA oligonucleotide probes (molecular beacons-MB) were designed and conjugated with gold nanoparticles (AuNPs) (i.e. biotin-MB-AuNPs). The proposed design had the ability to modulate the accessibility of the biotin group as a function of the presence of a miRNA target allowing the interaction of the boilable with the streptavidin test zone only in the presence of the miRNA-21 mimics. For quantitative evaluation, images of the strip tests were recorded using a flatbed scanner (Epson Perfection V370 Photo). The colour intensities of the test zones of the strip tests were analysed with the ImageJ software (Scion Corp., USA) and quantified as a function of pixel intensity. The response of the strip test was linear over the range 0.5 to 20 nM miRNA-21 (limit of detection of 115 pM) and showed good reproducibility (intra and inter CVs below 8%); furthermore, the assay was shown to be highly selective, discriminating other interference miRNAs mimics (e.g. miRNA-221 and miRNA-205). Finally, the proposed strip test was used for detection of miRNA-21 mimics in spiked serum samples, demonstrating its potential for point-of-care clinical applications. Main advantages of the single-probe strip test design are its versatility, simplicity and robustness, which can be easily extended to other miRNA targets by tuning the sequence of the single probe. Furthermore, the use of the structurally responsive single probe is particularly relevant in the case of short-length targets, such as miRNA, whereas a conventional sandwich approach might require a careful control of assay conditions such as hybridization temperature and salt concentration. PMID:26700447

  10. Programmable oligonucleotide probes design and applications for in situ and in vivo RNA imaging in cells

    NASA Astrophysics Data System (ADS)

    Cheglakov, Zoya

    Unequal spreading of mRNA is a frequent experience observed in varied cell lines. The study of cellular processes dynamics and precise localization of mRNAs offers a vital toolbox to target specific proteins in precise cytoplasmic areas and provides a convenient instrument to uncover their mechanisms and functions. Latest methodological innovations have allowed imaging of a single mRNA molecule in situ and in vivo. Today, Fluorescent In Situ Hybridization (FISH) methods allow the studying of mRNA expression and offer a vital toolbox for accurate biological models. Studies enable analysis of the dynamics of an individual mRNA, have uncovered the multiplex RNA transport systems. With all current approaches, a single mRNA tracking in the mammalian cells is still challenging. This thesis describes mRNA detection methods based on programmable fluorophore-labeled DNA structures complimentary to native targets providing an accurate mRNA imaging in mammalian cells. First method represents beta-actin (ACTB) transcripts in situ detection in human cells, the technique strategy is based on programmable DNA probes, amplified by rolling circle amplification (RCA). The method reports precise localization of molecule of interest with an accuracy of a single-cell. Visualization and localization of specific endogenous mRNA molecules in real-time in vivo has the promising to innovate cellular biology studies, medical analysis and to provide a vital toolbox in drugs invention area. Second method described in this thesis represents miR-21 miRNA detection within a single live-cell resolution. The method using fluorophore-labeled short synthetic DNAs probes forming a stem-loop shape and generating Fluorescent Resonance Energy Transfer (FRET) as a result of target-probes hybridization. Catalytic nucleic acid (DNAzymes) probes are cooperative tool for precise detection of different mRNA targets. With assistance of a complementary fluorophore-quencher labeled substrate, the DNAzymes provide

  11. Successful application of enzyme-labeled oligonucleotide probe for rapid and accurate cholera diagnosis in a clinical laboratory.

    PubMed

    Miyagi, K; Matsumoto, Y; Hayashi, K; Yoh, M; Yamamoto, K; Honda, T

    1994-01-01

    Two cholera cases were diagnosed using an enzyme-labeled oligonucleotide probe (ELONP) hybridization test for detection of cholera toxin gene (ctx) in a clinical laboratory at Osaka Airport Quarantine Station. The ELONP test with suspicious colonies of Vibrio cholerae O1 grown on TCBS or Vibrio agar plates gave positive result for ctx within 3 hr. We also tried to apply the ELONP test for direct detection of ctx in their stool and their non-selective culture. Specimens from Case #1, which contained 5.9 x 10(5) CFU/g of V. cholerae O1 in the stool, cultured for 7-8 hr or longer in alkaline peptone water or Marine broth at 37C, became positive for ctx. On the other hand, specimens from Case #2, which contained 8.7 x 10(8) CFU/ml (of V. cholerae O1 in the stool), gave positive result in this stool itself without any further culture. These data suggest that the ELONP test provides successfully a more rapid and accurate means of identifying "toxigenic" V. cholerae O1 in a clinical laboratory. PMID:7935049

  12. Analysis of HLA-DQB and HLA-DPB alleles in Graves' disease by oligonucleotide probing of enzymatically amplified DNA.

    PubMed

    Weetman, A P; Zhang, L; Webb, S; Shine, B

    1990-07-01

    We have tested the possible association of HLA-DQB and HLA-DPB alleles with Graves' thyrotoxicosis, with or without severe ophthalmopathy, by polymerase chain amplification of genomic DNA and allele-specific oligonucleotide probing. There was no significantly abnormal distribution of DQB alleles compared to 50 control subjects except for a reduced prevalence of DQw 3.1 in the Graves' patients with severe ophthalmopathy (X2 = 6.23, P less than 0.02). HLA-DPB 2.1/8 was found in only 1 of 40 of these patients compared with 15 of the controls (X2 = 11.49, P less than 0.001). Ten of 48 patients with Graves' disease but without clinically significant eye involvement were HLA-DPB 2.1/8 positive, not significantly different from controls, but significantly different from the ophthalmopathy group (X2 = 6.70, P less than 0.01). The other DPB alleles in both groups of Graves' disease patients were the same as controls. These results suggest that HLA-DPB 2.1/8 may confer a protective effect in Graves' disease with respect to ophthalmopathy. PMID:2401099

  13. A versatile label-free and signal-on electrochemical biosensing platform based on triplex-forming oligonucleotide probe.

    PubMed

    Wang, Xiuzhong; Jiang, Aiwen; Hou, Ting; Li, Feng

    2015-08-26

    Nucleic acid and protein assays are very important in modern life sciences, and the recently developed triplex-forming oligonucleotide probes provide a unique means for biological analysis of different kinds of analytes. Herein, we report a label-free and signal-on electrochemical sensor for the detection of specific targets, which is based on the triple-helix structure formation between the hairpin molecular beacon and the capture probe through the intermolecular DNA hybridization induced by Watson-Crick and Hoogsteen base pairings. Upon the introduction of a specific target, the triple-helical stem region is dissembled to liberate the hemin aptamer, and a G-quadruplex- hemin complex can be formed in the presence of K(+) and hemin on the electrode surface to give an electrochemical response, thus signaling the presence of the target. With the use of Human Immunodeficiency Virus type 1 (HIV-1) as a proof-of-principle analyte, we first demonstrated this approach by using a molecular beacon, which consists of a central section with the DNA sequence complementary to HIV-1, flanked by two arm segments. This newly designed protocol provides an ultrasensitive electrochemical detection of HIV-1 with a limit of detection down to 0.054 nM, and also exhibit good selectivity. Therefore, the as-proposed strategy holds a great potential for early diagnosis in gene-related diseases, and with further development, it could be used as a universal protocol for the detection of various DNA sequences and may be extended for the detection of aptamer-binding molecules. PMID:26347170

  14. Detection of Cryptosporidium parvum in raw milk by PCR and oligonucleotide probe hybridization.

    PubMed Central

    Laberge, I; Ibrahim, A; Barta, J R; Griffiths, M W

    1996-01-01

    Cryptosporidium spp. are potential contaminants of food. Suspected cases of food-borne cryptosporidiosis are rarely confirmed because of the limited numbers of oocysts in the samples and the lack of sensitive detection methods adaptable to food. PCR was investigated as a means of overcoming this problem. A PCR assay was designed for the specific amplification of a previously sequenced portion of an oocyst protein gene fragment of Cryptosporidium parvum (N. C. Lally, G. D. Baird, S. J. McQuay, F. Wright, and J. J. Oliver, Mol. Biochem. Parasitol. 56:69-78, 1992) and compared with the primer set of Laxer et al. (M. A. Laxer, B. K. Timblin, and R. J. Patel, Am. J. Trop. Med. Hyg. 45:688-694, 1991). The PCR products were hybridized with digoxigenin-labeled internal probes and detected by chemiluminescence to enhance sensitivity. The two sets of primers were compared with regard to their sensitivity and specificity by using a variety of human and animal isolates of C. parvum and related parasites. Both assays enabled the detection of 1 to 10 oocysts in 20 ml of artificially contaminated raw milk. The assay based on the PCR set and probe of Laxer et al. detected DNAs from Eimeria acervulina and Giardia intestinalis. The new assay has good specificity for C. parvum bovine isolates and hence has a better potential for monitoring the prevalence of C. parvum in raw milk and other environmental samples. PMID:8795214

  15. Platinated DNA oligonucleotides: new probes forming ultrastable conjugates with graphene oxide

    NASA Astrophysics Data System (ADS)

    Wang, Feng; Liu, Juewen

    2014-05-01

    Metal containing polymers have expanded the property of polymers by involving covalently associated metal complexes. DNA is a special block copolymer. While metal ions are known to influence DNA, little is explored on its polymer property when strong metal complexes are associated. In this work, we study cisplatin modified DNA as a new polymer and probe. Out of the complexes formed between cisplatin-A15, HAuCl4-A15, Hg2+-T15 and Ag+-C15, only the cisplatin adduct is stable under the denaturing gel electrophoresis condition. Each Pt-nucleobase bond gives a positive charge and thus makes DNA a zwitterionic polymer. This allows ultrafast adsorption of DNA by graphene oxide (GO) and the adsorbed complex is highly stable. Non-specific DNA, protein, surfactants and thiolated compounds cannot displace platinated DNA from GO, while non-modified DNA is easily displaced in most cases. The stable GO/DNA conjugate is further tested for surface hybridization. This is the first demonstration of using metallated DNA as a polymeric material for interfacing with nanoscale materials.Metal containing polymers have expanded the property of polymers by involving covalently associated metal complexes. DNA is a special block copolymer. While metal ions are known to influence DNA, little is explored on its polymer property when strong metal complexes are associated. In this work, we study cisplatin modified DNA as a new polymer and probe. Out of the complexes formed between cisplatin-A15, HAuCl4-A15, Hg2+-T15 and Ag+-C15, only the cisplatin adduct is stable under the denaturing gel electrophoresis condition. Each Pt-nucleobase bond gives a positive charge and thus makes DNA a zwitterionic polymer. This allows ultrafast adsorption of DNA by graphene oxide (GO) and the adsorbed complex is highly stable. Non-specific DNA, protein, surfactants and thiolated compounds cannot displace platinated DNA from GO, while non-modified DNA is easily displaced in most cases. The stable GO/DNA conjugate

  16. Development of 18S rRNA-targeted oligonucleotide probes for specific detection of Hartmannella and Naegleria in Legionella-positive environmental samples.

    PubMed

    Grimm, D; Ludwig, W F; Brandt, B C; Michel, R; Schleifer, K H; Hacker, J; Steinert, M

    2001-04-01

    Aquatic protozoa are natural hosts of the human pathogen Legionella pneumophila. The fluorescence labeled 16S rRNA-targeted oligonucleotide probe LEGPNE1 has recently been shown to specifically detect extracellular legionellae as well as intracellular legionellae parasitizing protozoa. In this study we designed oligonucleotide probes which are complementary to distinct regions of the 18S rRNA of the Legionella host organisms of the genera Hartmannella and Naegleria. The specificity of the probes, HART498 and NAEG1088, was tested by in situ hybridization of various laboratory reference strains. In order to evaluate the fluorescent probes for environmental studies three selected Legionella-positive cold water habitats were examined for the presence of these protozoa. Traditional culture methods followed by morphological identification revealed an almost consistent presence of Naegleria spp. in cold water habitats. Other protozoa species including Acanthamoeba spp., Echinamoeba spp., Hartmannella spp., Platyamoeba placida, Saccamoeba spp., Thecamoeba quadrilineata, and Vexillifera spp. were found sporadically. Concomitant analysis of the pH, conductivity and temperature of the water samples revealed no preference of Legionella or the respective protozoa for certain environmental conditions. The specificity of the newly designed 18S rRNA probes demonstrates that they are valuable and rapid tools for the identification of culturable environmental protozoa. PMID:11403402

  17. 18S rRNA Gene Variation among Common Airborne Fungi, and Development of Specific Oligonucleotide Probes for the Detection of Fungal Isolates

    PubMed Central

    Wu, Zhihong; Tsumura, Yoshihiko; Blomquist, Göran; Wang, Xiao-Ru

    2003-01-01

    In this study, we sequenced 18S rRNA genes (rDNA) from 49 fungal strains representing 31 species from 15 genera. Most of these species are common airborne fungi and pathogens that may cause various public health concerns. Sequence analysis revealed distinct divergence between Zygomycota and Ascomycota. Within Ascomycota, several strongly supported clades were identified that facilitate the taxonomic placement of several little-studied fungi. Wallemia appeared as the group most diverged from all the other Ascomycota species. Based on the 18S rDNA sequence variation, 108 oligonucleotide probes were designed for each genus and species included in this study. After homology searches and DNA hybridization evaluations, 33 probes were verified as genus or species specific. The optimal hybridization temperatures to achieve the best specificity for these 33 probes were determined. These new probes can contribute to the molecular diagnostic research for environmental monitoring. PMID:12957927

  18. Development of an rRNA-targeted oligonucleotide probe specific for the genus Acinetobacter and its application for in situ monitoring in activated sludge.

    PubMed Central

    Wagner, M; Erhart, R; Manz, W; Amann, R; Lemmer, H; Wedi, D; Schleifer, K H

    1994-01-01

    Enhanced biological phosphate removal in an anaerobic-aerobic activated sludge system has generally been ascribed to members of the genus Acinetobacter. A genus-specific 16S rRNA-targeted oligonucleotide probe was developed to investigate the role of Acinetobacter spp. in situ. Nonisotopic dot blot hybridization to 66 reference strains, including the seven described Acinetobacter spp., demonstrated the expected probe specificity. Fluorescent derivatives were used for in situ monitoring of Acinetobacter spp. in the anaerobic and aerobic compartments of a sewage treatment plant with enhanced biological phosphate removal. Microbial community structures were further analyzed with oligonucleotide probes specific for the alpha, beta, or gamma subclasses of the class Proteobacteria, for the Cytophaga-Flavobacterium cluster, for gram-positive bacteria with a high G + C DNA content, and for all bacteria. Total cell counts were determined by 4',6-diamidino-2-phenylindole staining. In both the anaerobic and the aerobic basins, the activated sludge samples were dominated by members of the class Proteobacteria belonging to the beta subclass and by gram-positive bacteria with a high G + C DNA content. Acinetobacter spp. constituted less than 10% of all bacteria. For both basins, the microbial community structures determined with molecular techniques were compared with the compositions of the heterotrophic saprophytic microbiota determined with agar plating techniques. Isolates on nutrient-rich medium were classified by whole-cell hybridization with rRNA-targeted probes and fatty acid analysis.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:7512807

  19. Superiorities of time-correlated single-photon counting against standard fluorimetry in exploiting the potential of fluorochromized oligonucleotide probes for biomedical investigation

    NASA Astrophysics Data System (ADS)

    Lamperti, Marco; Nardo, Luca; Bondani, Maria

    2015-05-01

    Site-specific fluorescence-resonance-energy-transfer donor-acceptor dual-labelled oligonucleotide probes are widely used in state-of-art biotechnological applications. Such applications include their usage as primers in polymerase chain reaction. However, the steady-state fluorescence intensity signal emitted by these molecular tools strongly depends from the specificities of the probe conformation. For this reason, the information which can be reliably inferred by steady-state fluorimetry performed on such samples is forcedly confined to a semi-qualitative level. Namely, fluorescent emission is frequently used as ON/OFF indicator of the probe hybridization state, i.e. detection of fluorescence signals indicates either hybridization to or detachment from the template DNA of the probe. Nonetheless, a fully quantitative analysis of their fluorescence emission properties would disclose other exciting applications of dual-labelled probes in biosensing. Here we show how time-correlated single-photon counting can be applied to get rid of the technical limitations and interpretational ambiguities plaguing the intensity analysis, and to derive information on the template DNA reaching single-base.

  20. Comparative study of colony hybridization with synthetic oligonucleotide probes and enzyme-linked immunosorbent assay for identification of enterotoxigenic Escherichia coli.

    PubMed Central

    Sommerfelt, H; Svennerholm, A M; Kalland, K H; Haukanes, B I; Bjorvatn, B

    1988-01-01

    On the basis of the published nucleotide sequences of the genes that code for the heat-labile toxin LTh and the heat-stable toxins STaI and STaII of human enterotoxigenic Escherichia coli, a 34-mer and two 33-mer oligonucleotide probes were synthesized. To compare their relative efficacies in the detection and differentiation of enterotoxigenic E. coli, a colony hybridization technique using these probes and a GM1 ganglioside enzyme-linked immunosorbent assay using monoclonal anti-LT and anti-ST antibodies were used with 76 strains of E. coli with known enterotoxin profiles. For further evaluation of probe specificity, the enterotoxigenic bacteria Vibrio cholerae O1 and non-O1 and Yersinia enterocolitica were examined with the colony hybridization technique. The sensitivity of colony hybridization compared favorably with that of GM1 ganglioside enzyme-linked immunosorbent assay, and the two assays showed a high level of concordance in specific detection and differentiation of E. coli with various enterotoxin profiles (kappa = 0.906, P less than 0.00001). The probes did not hybridize with DNAs from strains of V. cholerae O1 or non-O1 or Y. enterocolitica. PMID:3281978

  1. In situ identification of bacteria in drinking water and adjoining biofilms by hybridization with 16S and 23S rRNA-directed fluorescent oligonucleotide probes.

    PubMed Central

    Manz, W; Szewzyk, U; Ericsson, P; Amann, R; Schleifer, K H; Stenström, T A

    1993-01-01

    Free-water-phase and surface-associated microorganisms from drinking water were detected and roughly identified by hybridization with fluorescence-labeled oligonucleotide probes complementary to regions of 16S and 23S rRNA characteristic for the domains Bacteria, Archaea, and Eucarya and the beta and gamma subclasses of Proteobacteria. Samples of glass-attached biofilms and plankton were taken from a Robbins device installed in a water distribution system. More than 70% of the surface-associated cells and less than 40% of the planktonic cells visualized by 4',6-diamidino-2-phenylindole staining bound detectable amounts of rRNA-targeted probes. These findings are an indication for higher average rRNA content and consequently higher physiological activity of the attached microbial cells compared with the free-living cells. All detectable cells hybridized with the bacterial probe, whereas no Archaea and no Eucarya cells could be detected. Simultaneous hybridization with probes specific for the beta and gamma subclasses of Proteobacteria revealed that microcolonies already consisted of mixed populations in early stages with fewer than 50 cells. These observations provide further evidence that the coexistence and interaction of bacteria in drinking water biofilms may be an integral part of their growth and survival strategies. Images PMID:8357261

  2. Application of Sequence-Specific Labeled 16S rRNA Gene Oligonucleotide Probes for Genetic Profiling of Cyanobacterial Abundance and Diversity by Array Hybridization

    PubMed Central

    Rudi, Knut; Skulberg, Olav M.; Skulberg, Randi; Jakobsen, Kjetill S.

    2000-01-01

    DNA sequence information for the small-subunit rRNA gene (16S rDNA) obtained from cyanobacterial cultures was used to investigate the presence of cyanobacteria and their abundance in natural habitats. Eight planktonic communities developing in lakes characterized by relatively low algal biomass (mesotrophic) and in lakes with correspondingly high biomass (eutrophic) were selected for the study. The organismal compositions of the water samples were analyzed genetically, using multiplex sequence-specific labeling of oligonucleotide probes targeted to 16S rDNA and subsequent hybridization of the labeled probes to their respective complements spotted onto a solid support (DNA array). Ten probes were established to determine the relative abundances of the discernible cyanobacteria encountered in the selected lakes. The probes were generally specific for their targets, as determined through analyses of clone cultures. Reproducible abundance profiles were established for the lakes investigated in the subsequent analyses of natural cyanobacterial communities. The results from the genetic analyses were then compared with information obtained from standard hydrobiological and hydrochemical analyses. Qualitatively, there were relatively good correlations among the groups of organisms (Nostoc, Microcystis, and Planktothrix species) found in the different lakes. The levels of correlation were lower for the quantitative data. This may, however, be due to differences in sample processing technique. The conclusions from these comparisons are that the genetic abundance profiles may provide a foundation for separating and quantifying genetically distinct groups of cyanobacteria in their natural habitats. PMID:10966421

  3. Detection of harmful algal bloom causing microalgae using covalently immobilised capture oligonucleotide probes on glass and poly(dimethylsiloxane) surfaces

    NASA Astrophysics Data System (ADS)

    Bruce, Karen L.; Ellis, Amanda V.; Leterme, Sophie C.; Khodakov, Dmitriy A.; Lenehan, Claire E.

    2013-12-01

    Harmful algal bloom (HAB) events have been on the rise in the last few decades with some of the causative microalgae exhibiting toxic properties. Therefore, detection is essential in order to prevent mortality of aquatic life and poisoning events from consumption of these biotoxins. Here, oligonucleotide modified glass and poly(dimethylsiloxane) (PDMS) surfaces have been developed for the detection of the HAB causing microalgae, Alexandrium catenella, in a model system. Our preliminary studies show that the glass surface offers superior stability and analytical response when compared to those prepared from PDMS.

  4. Development of a Flow Cytometry-Based Method for Rapid Detection of Escherichia coli and Shigella Spp. Using an Oligonucleotide Probe

    PubMed Central

    Xue, Yong; Wilkes, Jon G.; Moskal, Ted J.; Williams, Anna J.; Cooper, Willie M.; Nayak, Rajesh; Rafii, Fatemeh; Buzatu, Dan A.

    2016-01-01

    Standard methods to detect Escherichia coli contamination in food use the polymerase chain reaction (PCR) and agar culture plates. These methods require multiple incubation steps and take a long time to results. An improved rapid flow-cytometry based detection method was developed, using a fluorescence-labeled oligonucleotide probe specifically binding a16S rRNA sequence. The method positively detected 51 E. coli isolates as well as 4 Shigella species. All 27 non-E. coli strains tested gave negative results. Comparison of the new genetic assay with a total plate count (TPC) assay and agar plate counting indicated similar sensitivity, agreement between cytometry cell and colony counts. This method can detect a small number of E.coli cells in the presence of large numbers of other bacteria. This method can be used for rapid, economical, and stable detection of E. coli and Shigella contamination in the food industry and other contexts. PMID:26913737

  5. Development of a Flow Cytometry-Based Method for Rapid Detection of Escherichia coli and Shigella Spp. Using an Oligonucleotide Probe.

    PubMed

    Xue, Yong; Wilkes, Jon G; Moskal, Ted J; Williams, Anna J; Cooper, Willie M; Nayak, Rajesh; Rafii, Fatemeh; Buzatu, Dan A

    2016-01-01

    Standard methods to detect Escherichia coli contamination in food use the polymerase chain reaction (PCR) and agar culture plates. These methods require multiple incubation steps and take a long time to results. An improved rapid flow-cytometry based detection method was developed, using a fluorescence-labeled oligonucleotide probe specifically binding a16S rRNA sequence. The method positively detected 51 E. coli isolates as well as 4 Shigella species. All 27 non-E. coli strains tested gave negative results. Comparison of the new genetic assay with a total plate count (TPC) assay and agar plate counting indicated similar sensitivity, agreement between cytometry cell and colony counts. This method can detect a small number of E.coli cells in the presence of large numbers of other bacteria. This method can be used for rapid, economical, and stable detection of E. coli and Shigella contamination in the food industry and other contexts. PMID:26913737

  6. Whole-Cell versus Total RNA Extraction for Analysis of Microbial Community Structure with 16S rRNA-Targeted Oligonucleotide Probes in Salt Marsh Sediments

    PubMed Central

    Frischer, Marc E.; Danforth, Jean M.; Healy, Michele A. Newton; Saunders, F. Michael

    2000-01-01

    rRNA-targeted oligonucleotide probes have become powerful tools for describing microbial communities, but their use in sediments remains difficult. Here we describe a simple technique involving homogenization, detergents, and dispersants that allows the quantitative extraction of cells from formalin-preserved salt marsh sediments. Resulting cell extracts are amenable to membrane blotting and hybridization protocols. Using this procedure, the efficiency of cell extraction was high (95.7% ± 3.7% [mean ± standard deviation]) relative to direct DAPI (4′,6′-diamidino-2-phenylindole) epifluorescence cell counts for a variety of salt marsh sediments. To test the hypothesis that cells were extracted without phylogenetic bias, the relative abundance (depth distribution) of five major divisions of the gram-negative mesophilic sulfate-reducing delta proteobacteria were determined in sediments maintained in a tidal mesocosm system. A suite of six 16S rRNA-targeted oligonucleotide probes were utilized. The apparent structure of sulfate-reducing bacteria communities determined from whole-cell and RNA extracts were consistent with each other (r2 = 0.60), indicating that the whole-cell extraction and RNA extraction hybridization approaches for describing sediment microbial communities are equally robust. However, the variability associated with both methods was high and appeared to be a result of the natural heterogeneity of sediment microbial communities and methodological artifacts. The relative distribution of sulfate-reducing bacteria was similar to that observed in natural marsh systems, providing preliminary evidence that the mesocosm systems accurately simulate native marsh systems. PMID:10877803

  7. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    PubMed Central

    2011-01-01

    Background The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH) probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to Abiotrophia/Granulicatella. Results As lactobacilli are known for notorious resistance to probe penetration, probe-specific assay protocols were experimentally developed to provide maximum cell wall permeability, probe accessibility, hybridization stringency, and fluorescence intensity. The new assays were then applied in a pilot study to three biofilm samples harvested from variably demineralized bovine enamel discs that had been carried in situ for 10 days by different volunteers. Best probe penetration and fluorescent labeling of reference strains were obtained after combined lysozyme and achromopeptidase treatment followed by exposure to lipase. Hybridization stringency had to be established strictly for each probe. Thereafter all probes showed the expected specificity with reference strains and labeled the anticipated morphotypes in dental plaques. Applied to in situ grown biofilms the set of probes detected only Lactobacillus fermentum and bacteria of the Lactobacillus casei group. The most cariogenic biofilm contained two orders of magnitude higher L. fermentum cell numbers than the other biofilms. Abiotrophia/Granulicatella and streptococci from the mitis group were found in all samples at high levels, whereas Streptococcus mutans was detected in only one sample in very low numbers. Conclusions Application of these new group- and species-specific FISH probes to oral biofilm-forming lactic acid bacteria will allow a clearer understanding of the supragingival biome, its spatial architecture and of structure-function relationships implicated during plaque homeostasis and caries development. The probes should prove of value far beyond the field of oral microbiology, as many of

  8. Design and application of rRNA-targeted oligonucleotide probes for the dissimilatory iron- and manganese-reducing bacterium Shewanella putrefaciens.

    PubMed Central

    DiChristina, T J; DeLong, E F

    1993-01-01

    A 16S rRNA-targeted oligonucleotide probe specific for the iron (Fe3+)- and manganese (Mn4+)-reducing bacterium Shewanella putrefaciens was constructed and tested in both laboratory- and field-based hybridization experiments. The radioactively labeled probe was used to detect S. putrefaciens in field samples collected from the water column and sediments of Oneida Lake in New York and its major southern tributary, Chittenango Creek. S. putrefaciens was quantified by (i) hybridization of the probe to bulk RNA extracted from field samples and normalization of the S. putrefaciens-specific rRNA to total eubacterial rRNA, (ii) a colony-based probe hybridization assay, and (iii) a colony-based biochemical assay which detected the formation of iron sulfide precipitates on triple-sugar iron agar. The results of field applications indicated that the three detection methods were comparable in sensitivity for detecting S. putrefaciens in water column and sediment samples. S. putrefaciens rRNA was detected in the surficial layers of the lake and creek sediments, but the levels of S. putrefaciens rRNA were below the detection limits in the lake and creek water samples. The highest concentrations of S. putrefaciens rRNA, corresponding to approximately 2% of the total eubacterial rRNA, were detected in the surficial sediments of Chittenango Creek and at a midlake site where the Oneida Lake floor is covered by a high concentration of ferromanganese nodules. This finding supports the hypothesis that metal-reducing bacteria such as S. putrefaciens are important components in the overall biogeochemical cycling of iron, manganese and other elements in seasonally anoxic freshwater basins. Images PMID:7506899

  9. Evaluation of a fluorescence-labelled oligonucleotide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears.

    PubMed Central

    Nordentoft, S; Christensen, H; Wegener, H C

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all of the S. enterica subspecies and S. bongori, an 18-mer oligonucleotide probe was selected. The specificity of the probe was tested by in situ hybridization to bacterial cell smears of pure cultures. Forty-nine of 55 tested Salmonella serovars belonging to subspecies I, II, IIIb, IV, and VI hybridized with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed, paraffin-embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific oligonucleotide probe makes the FISH technique a promising tool for the rapid identification of S. enterica in bacterial smears, as well as for the detection of S. enterica in histological tissue sections. PMID:9316923

  10. Isolation of a Pseudomonas solanacearum-specific DNA probe by subtraction hybridization and construction of species-specific oligonucleotide primers for sensitive detection by the polymerase chain reaction.

    PubMed Central

    Seal, S E; Jackson, L A; Daniels, M J

    1992-01-01

    A subtraction hybridization technique was employed to make a library enriched for Pseudomonas solanacearum-specific sequences. One cloned fragment, PS2096, hybridized under stringent conditions to DNA of 82 P. solanacearum strains representing all subgroups of the species. Other plant-associated bacteria, including closely related species such as Pseudomonas capacia, Pseudomonas picketti, or Pseudomonas syzygii, did not hybridize to PS2096. A minimum number of between 4 x 10(5) and 4 x 10(6) P. solanacearum cells could routinely be detected with PS2096 labelled either with [32P]dCTP or with digoxigenin-11-dUTP. To improve the sensitivity of detection, PS2096 was sequenced to allow the construction of specific oligonucleotide primers to be used for polymerase chain reaction (PCR) amplification. After 50 cycles of amplification, 5 to 116 cells, depending on the strain, could reproducibly be detected by visualization of a 148-bp PCR product on an agarose gel. A preliminary field trial in Burundi with the probe and PCR primers has confirmed that they are sensitive tools for specifically detecting low-level infections of P. solanacearum in potato tubers. Images PMID:1482193

  11. HLA-B allele dropout in PCR sequence-specific oligonucleotide probe typing due to intronic polymorphism in the novel B*58:01:01:02 allele.

    PubMed

    He, Y; Wang, W; Han, Z; He, J; Chen, N; Dong, L; Tao, S; Zhang, W; He, J; Zhu, F; Lv, H

    2016-06-01

    Currently, Luminex technology based on the PCR sequence-specific oligonucleotide (SSO) probe method has been widely used for HLA genotyping in the immunogenetics laboratories. Here, we reported a case with HLA-B allele dropout by Luminex technology. The initial HLA-B result of the Luminex method with a commercial agent kit was inconclusive, and then, the result of PCR-SBT technology indicated the dropout as a HLA-B*58 allele. Subsequently, the full-length sequence of HLA-B allele was determined by TOPO-TA cloning, and a novel allele B*58:01:01:02 was identified in the individual. Compared with HLA-B*58:01:01:01, the novel allele showed some nucleotides difference at 509 C>T, 521 T>G and CCC insertion in position 503 of intron 2. According to the full-length sequence, the new mutations of intron 2 were contributed to HLA-B locus allele dropout in the sample. Our results indicated multiplatform should be used to improve the HLA typing accuracy when a conclusive HLA genotype cannot be determined. PMID:27016176

  12. Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

    PubMed Central

    Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir

    2014-01-01

    Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

  13. Cytokines and therapeutic oligonucleotides.

    PubMed

    Hartmann, G; Bidlingmaier, M; Eigler, A; Hacker, U; Endres, S

    1997-12-01

    Therapeutic oligonucleotides - short strands of synthetic nucleic acids - encompass antisense and aptamer oligonucleotides. Antisense oligonucleotides are designed to bind to target RNA by complementary base pairing and to inhibit translation of the target protein. Antisense oligonucleotides enable specific inhibition of cytokine synthesis. In contrast, aptamer oligonucleotides are able to bind directly to specific proteins. This binding depends on the sequence of the oligonucleotide. Aptamer oligonucleotides with CpG motifs can exert strong immunostimulatory effects. Both kinds of therapeutic oligonucleotides - antisense and aptamer oligonucleotides - provide promising tools to modulate immunological functions. Recently, therapeutic oligonucleotides have moved towards clinical application. An antisense oligonucleotide directed against the proinflammatory intercellular adhesion molecule 1 (ICAM-1) is currently being tested in clinical trials for therapy of inflammatory disease. Immunostimulatory aptamer oligonucleotides are in preclinical development for immunotherapy. In the present review we summarize the application of therapeutic oligonucleotides to modulate immunological functions. We include technological aspects as well as current therapeutic concepts and clinical studies. PMID:9740353

  14. Community Structure and Dynamics of Small Eukaryotes Targeted by New Oligonucleotide Probes: New Insight into the Lacustrine Microbial Food Web▿

    PubMed Central

    Mangot, Jean-François; Lepère, Cécile; Bouvier, Christophe; Debroas, Didier; Domaizon, Isabelle

    2009-01-01

    The seasonal dynamics of the small eukaryotic fraction (cell diameter, 0.2 to 5 μm) was investigated in a mesotrophic lake by tyramide signal amplification-fluorescence in situ hybridization targeting seven different phylogenetic groups: Chlorophyceae, Chrysophyceae, Cryptophyceae, Cercozoa, LKM11, Perkinsozoa (two clades), and Fungi. The abundance of small eukaryotes ranged from 1,692 to 10,782 cells ml−1. The dominant groups were the Chrysophyceae and the Chlorophyceae, which represented 19.6% and 17.9% of small eukaryotes, respectively. The results also confirmed the quantitative importance of putative parasites, Fungi and Perkinsozoa, in the small heterotrophic eukaryotic assemblage. The relative abundances recorded for the Perkinsozoa group reached as much as 31.6% of total targeted eukaryotes during the summer. The dynamics of Perkinsozoa clade 1 coincided with abundance variations in Peridinium and Ceratium spp. (Dinoflagellates), while the dynamics of Perkinsozoa clade 2 was linked to the presence of Dinobryon spp. (Chrysophyceae). Fungi, represented by chytrids, reached maximal abundance in December (569 cells ml−1) and were mainly correlated with the dynamics of diatoms, especially Melosira varians. A further new finding of this study is the recurrent presence of Cercozoa (6.2%) and LKM11 (4.5%) cells. This quantitative approach based on newly designed probes offers a promising means of in-depth analysis of microbial food webs in lakes, especially by revealing the phylogenetic composition of the small heterotrophic flagellate assemblage, for which an important fraction of cells are generally unidentified by classical microscopy (on average, 96.8% of the small heterotrophic flagellates were identified by the specific probes we used in this study). PMID:19666727

  15. Development of oligonucleotide primers and probes against structural and regulatory genes of human immunodeficiency virus type 1 (HIV-1) and their use for amplification of HIV-1 provirus by using polymerase chain reaction.

    PubMed Central

    Dawood, M R; Allan, R; Fowke, K; Embree, J; Hammond, G W

    1992-01-01

    The polymerase chain reaction is a powerful technique for amplifying a few copies of double-stranded genetic material to millions of copies in a few hours. The sensitivity and specificity of the polymerase chain reaction technique depend to some extent on the nucleotide sequences of the oligonucleotide primer pair used in the amplification. We report new oligonucleotide primers and probes which can be used for the amplification and detection of human immunodeficiency virus type 1 provirus sequences of not only structural but also regulatory genes. These primers are very sensitive and specific and can be used for the detection of African and North American strains of human immunodeficiency virus type 1. Images PMID:1400991

  16. An oligonucleotide-based label-free luminescent switch-on probe for RNA detection utilizing a G-quadruplex-selective iridium(iii) complex

    NASA Astrophysics Data System (ADS)

    Ma, Dik-Lung; Lin, Sheng; Leung, Ka-Ho; Zhong, Hai-Jing; Liu, Li-Juan; Chan, Daniel Shiu-Hin; Bourdoncle, Anne; Mergny, Jean-Louis; Wang, Hui-Min David; Leung, Chung-Hang

    2014-07-01

    We report herein the synthesis and application of a novel G-quadruplex-selective luminescent iridium(iii) complex for the construction of an oligonucleotide-based, label-free, rapid and convenient luminescent RNA detection platform.We report herein the synthesis and application of a novel G-quadruplex-selective luminescent iridium(iii) complex for the construction of an oligonucleotide-based, label-free, rapid and convenient luminescent RNA detection platform. Electronic supplementary information (ESI) available: Experimental details and spectral data. See DOI: 10.1039/c4nr00541d

  17. Development of an oligonucleotide probe targeting 16S rRNA and its application for detection and quantitation of the ruminal bacterium Synergistes jonesii in a mixed-population chemostat.

    PubMed Central

    McSweeney, C S; Mackie, R I; Odenyo, A A; Stahl, D A

    1993-01-01

    Radiolabelled and fluorescent-dye-conjugated oligonucleotide probes which targeted rRNA sequences were developed for the enumeration of the ruminal bacterium Synergistes jonesii 78-1 in mixed culture. Two probes were tested, and both were highly specific for the respective complementary sequences of the target organism. Individual cells of S. jonesii in pure and mixed cultures were clearly visualized in situ by hybridization with the fluorescent-dye-conjugated probe but could not be detected in natural samples. Therefore the radiolabelled probe was used to monitor the population of S. jonesii introduced into a chemostat which simulated the rumen ecosystem. The S. jonesii probe did not hybridize to RNA extracted from the culture prior to inoculation with the target organism. After inoculation, S. jonesii rRNA represented 4.5% of the total bacterial rRNA and then rapidly declined to < 0.2% before increasing to about 1% of the total bacterial rRNA during the following 3 weeks. This study demonstrates that rRNA-targeted probes could be used for tracking organisms introduced into the rumen ecosystem. Images PMID:7686002

  18. Working with Oligonucleotide Arrays.

    PubMed

    Carvalho, Benilton S

    2016-01-01

    Preprocessing microarray data consists of a number of statistical procedures that convert the observed intensities into quantities that represent biological events of interest, like gene expression and allele-specific abundances. Here, we present a summary of the theory behind microarray data preprocessing for expression, whole transcriptome and SNP designs and focus on the computational protocol used to obtain processed data that will be used on downstream analyses. We describe the main features of the oligo Bioconductor package, an application designed to support oligonucleotide microarrays using the R statistical environment and the infrastructure provided by Bioconductor, allowing the researcher to handle probe-level data and interface with advanced statistical tools under a simplified framework. We demonstrate the use of the package by preprocessing data originated from three different designs. PMID:27008013

  19. Evolution of the MIDTAL microarray: the adaption and testing of oligonucleotide 18S and 28S rDNA probes and evaluation of subsequent microarray generations with Prymnesium spp. cultures and field samples.

    PubMed

    McCoy, Gary R; Touzet, Nicolas; Fleming, Gerard T A; Raine, Robin

    2015-07-01

    The toxic microalgal species Prymnesium parvum and Prymnesium polylepis are responsible for numerous fish kills causing economic stress on the aquaculture industry and, through the consumption of contaminated shellfish, can potentially impact on human health. Monitoring of toxic phytoplankton is traditionally carried out by light microscopy. However, molecular methods of identification and quantification are becoming more common place. This study documents the optimisation of the novel Microarrays for the Detection of Toxic Algae (MIDTAL) microarray from its initial stages to the final commercial version now available from Microbia Environnement (France). Existing oligonucleotide probes used in whole-cell fluorescent in situ hybridisation (FISH) for Prymnesium species from higher group probes to species-level probes were adapted and tested on the first-generation microarray. The combination and interaction of numerous other probes specific for a whole range of phytoplankton taxa also spotted on the chip surface caused high cross reactivity, resulting in false-positive results on the microarray. The probe sequences were extended for the subsequent second-generation microarray, and further adaptations of the hybridisation protocol and incubation temperatures significantly reduced false-positive readings from the first to the second-generation chip, thereby increasing the specificity of the MIDTAL microarray. Additional refinement of the subsequent third-generation microarray protocols with the addition of a poly-T amino linker to the 5' end of each probe further enhanced the microarray performance but also highlighted the importance of optimising RNA labelling efficiency when testing with natural seawater samples from Killary Harbour, Ireland. PMID:25631743

  20. Poly(dG) spacers lead to increased surface coverage of DNA probes: an XPS study of oligonucleotide binding to zirconium phosphonate modified surfaces.

    PubMed

    Lane, Sarah M; Monot, Julien; Petit, Marc; Tellier, Charles; Bujoli, Bruno; Talham, Daniel R

    2008-07-15

    A spacer is often employed between the surface linking group and the probe sequence to improve the performance of DNA microarrays. Previous work demonstrated that a consecutive stretch of guanines as a spacer increased target capture during hybridization relative to probes with either no spacer or a similar stretch of one of the other nucleotides. Using zirconium phosphonate modified surfaces with 5'-phosphorylated ssDNA probes, the present study compares the surface coverage of ssDNA probes containing either a poly(dG) spacer or a poly(dA) spacer. Surface coverages are quantified by XPS using a modified overlayer model. The results show that after treatment to mimic conditions of the passivation and hybridization steps the probe with the poly(dG) spacer has about twice the surface coverage as the probe with the poly(dA) spacer, indicating that increased target capture is due to higher probe coverage. When monitoring the surface coverage after each rinsing step, it is observed that the probe with the poly(dA) spacer is more susceptible to rinsing, suggesting the interaction with the surface is different for the two probes. It is suggested that the formation of G quadruplexes causes an increased avidity of the probe for the zirconium phosphonate surface. PMID:18547070

  1. Oligonucleotide Immobilization and Hybridization on Aldehyde-Functionalized Poly(2-hydroxyethyl methacrylate) Brushes.

    PubMed

    Bilgic, Tugba; Klok, Harm-Anton

    2015-11-01

    DNA biosensing requires high oligonucleotide binding capacity interface chemistries that can be tuned to maximize probe presentation as well as hybridization efficiency. This contribution investigates the feasibility of aldehyde-functionalized poly(2-hydroxyethyl methacrylate) (PHEMA) brush-based interfaces for oligonucleotide binding and hybridization. These polymer brushes, which allow covalent immobilization of oligonucleotides, are prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of HEMA followed by a postpolymerization oxidation step to generate side chain aldehyde groups. A series of polymer brushes covering a range of film thicknesses and grafting densities was investigated with regard to their oligonucleotide binding capacity as well as their ability to support oligonucleotide hybridization. Densely grafted brushes were found to have probe oligonucleotide binding capacities of up to ∼30 pmol/cm(2). Increasing the thickness of these densely grafted brush films, however, resulted in a decrease in the oligonucleotide binding capacity. Less densely grafted brushes possess binding capacities of ∼10 pmol/cm(2), which did not significantly depend on film thickness. The oligonucleotide hybridization efficiencies, however, were highest (93%) on those brushes that present the lowest surface concentration of the probe oligonucleotide. These results highlight the importance of optimizing the probe oligonucleotide surface concentration and binding interface chemistry. The versatility and tunability of the PHEMA-based brushes presented herein makes these films a very attractive platform for the immobilization and hybridization of oligonucleotides. PMID:26441148

  2. New Degenerate Cytophaga-Flexibacter-Bacteroides-Specific 16S Ribosomal DNA-Targeted Oligonucleotide Probes Reveal High Bacterial Diversity in River Taff Epilithon

    PubMed Central

    O’Sullivan, Louise A.; Weightman, Andrew J.; Fry, John C.

    2002-01-01

    River microbial communities play an important role in global nutrient cycles, and aggregated bacteria such as those in epilithic biofilms may be major contributors. In this study the bacterial diversity of River Taff epilithon in South Wales was investigated. A 16S ribosomal DNA (rDNA) clone library was constructed and analyzed by partial sequencing of 76 of 347 clones and hybridization with taxon-specific probes. The epilithon was found to be very diverse, with an estimated 59.6% of the bacterial populations not accounted for by these clones. Members of the Cytophaga-Flexibacter-Bacteroides division (CFBs) were most abundant in the library, representing 25% of clones, followed by members of the α subdivision of the division Proteobacteria (α-Proteobacteria), γ-Proteobacteria, gram-positive bacteria, Cyanobacteria, β-Proteobacteria, δ-Proteobacteria, and the Prosthecobacter group. This study concentrated on the epilithic CFB populations, and a new set of degenerate 16S rDNA probes was developed to enhance their detection, namely, CFB560, CFB562, and CFB376. The commonly used probe CF319a/b may frequently lead to the underestimation of CFB populations in environmental studies, because it does not fully detect members of the division. CFB560 had exact matches to 95.6% of CFBs listed in the Ribosomal Database Project (release 8.0) small-subunit phylogenetic trees, compared to 60% for CF319a/b. The CFB probes detected 66 of 347 epilithon TAF clones, and 60 of these were partially sequenced. They affiliated with the RDP-designated groups Cytophaga, Sphingobacterium, Lewinella, and Cytophaga aurantiaca. CFB560 and CF319a/b detected 94% (62 of 66) and 48.5% (32 of 66) of clones, respectively, and therefore CFB560 is recommended for future use. Probe design in this study illustrated that multiple degenerate positions can greatly increase target range without adversely effecting specificity or experimental performance. PMID:11772628

  3. In situ hybridisation for the detection of Leishmania species in paraffin wax-embedded canine tissues using a digoxigenin-labelled oligonucleotide probe.

    PubMed

    Dinhopl, N; Mostegl, M M; Richter, B; Nedorost, N; Maderner, A; Fragner, K; Weissenböck, H

    2011-11-12

    The diagnosis of canine leishmaniosis (CanL) is currently predominantly achieved by cytological or histological identification of amastigotes in biopsy samples, demonstration of specific anti-Leishmania antibodies and PCR-based approaches. All these methods have the advantage of being sensitive and more or less specific; nevertheless, most of them also have disadvantages. A chromogenic in situ hybridisation (ISH) procedure with a digoxigenin-labelled probe, targeting a fragment of the 5.8S rRNA was developed for the detection of all species of Leishmania parasites in routinely paraffin wax-embedded canine tissues. This method was validated in comparison with traditional techniques (histology, PCR), on various tissues from three dogs with histological changes consistent with a florid leishmaniosis. Amastigote forms of Leishmania gave clear signals and were easily identified using ISH. Various tissues from 10 additional dogs with clinical suspicion or/and a positive serological test but without histological presence of amastigotes did not show any ISH signals. Potential cross-reactivity of the probe was ruled out by negative outcome of the ISH against selected protozoa (including the related Trypanosoma cruzi) and fungi. Thus, ISH proved to be a powerful tool for unambiguous detection of Leishmania parasites in paraffin wax-embedded tissues. PMID:21921059

  4. Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species

    PubMed Central

    Arif, Mohammad; Opit, George; Mendoza-Yerbafría, Abigail; Dobhal, Shefali; Li, Zhihong; Kučerová, Zuzana; Ochoa-Corona, Francisco M.

    2015-01-01

    Several species of the genus Liposcelis are common insect pests that cause serious qualitative and quantitative losses to various stored grains and processed grain products. They also can contaminate foods, transmit pathogenic microorganisms and cause allergies in humans. The common occurrence of multi-species infestations and the fact that it is difficult to identify and discriminate Liposcelis spp. make accurate, rapid detection and discriminatory tools absolutely necessary for confirmation of their identity. In this study, PCR primers and probes specific to different Liposcelis spp. were designed based on nucleotide sequences of the cytochrome oxidase 1 (CO1) gene. Primer sets ObsCo13F/13R, PeaCo15F/14R, BosCO7F/7R, BruCo5F/5R, and DecCo11F/11R were used to specifically detect Liposcelis obscura Broadhead, Liposcelis pearmani Lienhard, Liposcelis bostrychophila Badonnel, Liposcelis brunnea Motschulsky and Liposcelis decolor (Pearman) in multiplex endpoint PCRs, which amplified products of 438-, 351-, 191-, 140-, and 87-bp, respectively. In multiplex TaqMan qPCR assays, orange, yellow, red, crimson and green channels corresponding to reporter dyes 6-ROXN, HEX, Cy5, Quasar705 and 6-FAM specifically detected L. obscura, L. brunnea, L. bostrychophila, L. pearmani and L. decolor, respectively. All developed primer and probe sets allowed specific amplification of corresponding targeted Liposcelis species. The development of multiplex endpoint PCR and multiplex TaqMan qPCR will greatly facilitate psocid identification and their management. The use of APCs will streamline and standardize PCR assays. APC will also provide the opportunity to have all positive controls in a single tube, which reduces maintenance cost and labor, but increases the accuracy and reliability of the assays. These novel methods from our study will have applications in pest management, biosecurity, quarantine, food safety, and routine diagnostics. PMID:26086728

  5. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald

    2001-01-01

    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  6. Long synthetic oligonucleotides for microarray expression measurement

    NASA Astrophysics Data System (ADS)

    Li, Jiong; Wang, Hong; Liu, Heping; Zhang, M.; Zhang, Chunxiu; Lu, Zu-Hong; Gao, Xiang; Kong, Dong

    2001-09-01

    There are generally two kinds of DNA microarray used for genomic-scale gene expression profiling of mRNA: cDNA and DNA chip, but both of them suffer from some drawbacks. To meet more requirements, another oligonucleotide microarray with long was produced. This type of microarray had the advantages of low cost, minimal Cross-hybridization, flexible and easy to make, which is most fit for small laboratories with special purposes. In this paper, we devised different probes with different probe lengths, GC contents and gene positions to optimization the probe design. Experiments showed 70 mer probes are suitable for both sufficient sensitivity and reasonable costs. Higher G-C content produces stronger signal intensity thus better sensitivity and probes designed at 3 untranslated region of gene within the range of 300 pb should be best for both sensitivity and specificity.

  7. Poly(oligonucleotide)

    PubMed Central

    2015-01-01

    Here we report the preparation of poly(oligonucleotide) brush polymers and amphiphilic brush copolymers from nucleic acid monomers via graft-through polymerization. We describe the polymerization of PNA-norbornyl monomers to yield poly-PNA (poly(peptide nucleic acid)) via ring-opening metathesis polymerization (ROMP) with the initiator, (IMesH2)(C5H5N)2(Cl)2RuCHPh.1 In addition, we present the preparation of poly-PNA nanoparticles from amphiphilic block copolymers and describe their hybridization to a complementary single-stranded DNA (ssDNA) oligonucleotide. PMID:25077676

  8. The delivery of therapeutic oligonucleotides.

    PubMed

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  9. Fluorescent oligonucleotides can serve as suitable alternatives to radiolabeled oligonucleotides.

    PubMed

    Ballal, Rahul; Cheema, Amrita; Ahmad, Waaqar; Rosen, Eliot M; Saha, Tapas

    2009-09-01

    Prolonged exposure to radiation from radionuclei used in medical research can cause DNA damage and mutation, which lead to several diseases including cancer. Radioactivity-based experiments are expensive and associated with specialized training, dedication of instruments, approvals, and cleanup with potential hazardous waste. The objective of this study was to find an alternative to the use of radioactivity in medical research using nucleic acid chemistry. FITC-labeled oligonucleotides that contain wild-type (wt) and modified base (8-oxo-G) at the same position and their complementary unlabeled strand were synthesized. Purified DNA repair enzyme, OGG1, and nuclear lysates from MCF-7 breast cancer cells were incubated with double-stranded FITC-labeled wt and 8-oxo-G oligonucleotide to demonstrate the OGG1 incision assay. We found that FITC-coupled oligonucleotides do not impose a steric hindrance during duplex formation, and the fluorescence intensity of the oligonucleotide is comparable with the intensity of the radioactive oligonucleotide. Moreover, we have seen that the OGG1 incision assay can be performed using these fluorescence oligonucleotides, replacing conventional use of radiolabeled oligonucleotides in the assay. Although the use of fluorescent-labeled oligonucleotides was described in detail for incision assays, the technique can be applied to replace a broad range of experiments, where radioactive oligonucleotides are used, eliminating the hazardous consequences of radiation. PMID:19721820

  10. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

    2013-01-01

    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  11. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  12. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    NASA Astrophysics Data System (ADS)

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-11-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes.

  13. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries.

    PubMed

    Schmidt, Thorsten L; Beliveau, Brian J; Uca, Yavuz O; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  14. Finding a most likely clone ordering from oligonucleotide hybridization data

    SciTech Connect

    Newberg, L.A.

    1994-06-01

    Using an extension of a statistical model given by E. Lander and M. Waterman, the authors define the a posteriori probability of a clone ordering based upon oligonucleotide hybridization data. They give algorithms for computing the likelihood of a clone ordering and for finding a clone ordering of maximum likelihood. The dynamic programming algorithm for computing likelihoods runs in time O(mnc), where m is the number of oligonucleotide probes, n is the number of clones, and c is the coverage of the clone library. They use the Expectation-Maximization technique to maximize likelihoods. 21 refs., 3 figs.

  15. MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

    PubMed

    Chen, Wei-Yu; Chen, Yu-Chie

    2007-11-01

    The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol. PMID:17902633

  16. Amplification-Free Detection of Circulating microRNA Biomarkers from Body Fluids Based on Fluorogenic Oligonucleotide-Templated Reaction between Engineered Peptide Nucleic Acid Probes: Application to Prostate Cancer Diagnosis.

    PubMed

    Metcalf, Gavin A D; Shibakawa, Akifumi; Patel, Hinesh; Sita-Lumsden, Ailsa; Zivi, Andrea; Rama, Nona; Bevan, Charlotte L; Ladame, Sylvain

    2016-08-16

    Highly abundant in cells, microRNAs (or miRs) play a key role as regulators of gene expression. A proportion of them are also detectable in biofluids making them ideal noninvasive biomarkers for pathologies in which miR levels are aberrantly expressed, such as cancer. Peptide nucleic acids (PNAs) are engineered uncharged oligonucleotide analogues capable of hybridizing to complementary nucleic acids with high affinity and high specificity. Herein, novel PNA-based fluorogenic biosensors have been designed and synthesized that target miR biomarkers for prostate cancer (PCa). The sensing strategy is based on oligonucleotide-templated reactions where the only miR of interest serves as a matrix to catalyze an otherwise highly unfavorable fluorogenic reaction. Validated in vitro using synthetic RNAs, these newly developed biosensors were then shown to detect endogenous concentrations of miR in human blood samples without the need for any amplification step and with minimal sample processing. This low-cost, quantitative, and versatile sensing technology has been technically validated using gold-standard RT-qPCR. Compared to RT-qPCR however, this enzyme-free, isothermal blood test is amenable to incorporation into low-cost portable devices and could therefore be suitable for widespread public screening. PMID:27498854

  17. Electrochemical uranyl cation biosensor with DNA oligonucleotides as receptor layer.

    PubMed

    Jarczewska, Marta; Ziółkowski, Robert; Górski, Łukasz; Malinowska, Elżbieta

    2014-04-01

    The present study aims at the further development of the uranyl oligonucleotide-based voltammetric biosensor, which takes advantage of strong interaction between UO2(2+) and phosphate DNA backbone. Herein we report the optimization of working parameters of previously elaborated electrochemical DNA biosensor. It is shown that the sensor sensitivity is highly dependent on the oligonucleotide probe length and the incubation time of sensor in a sample solution. Consequently, the highest sensitivity was obtained for 10-nucleotide sequence and 60 min incubation time. The lower detection limit towards uranyl cation for developed biosensor was 30 nM. The influence of mixed monolayers and the possibility of developing a non-calibration device were also investigated. The selectivity of the proposed biosensor was significantly improved via elimination of adenine nucleobases from the DNA probe. Moreover, the regeneration procedure was elaborated and tested to prolong the use of the same biosensor for 4 subsequent determinations of UO2(2+). PMID:24334186

  18. Probing the Influence of Stereoelectronic Effects on the Biophysical Properties of Oligonucleotides: Comprehensive Analysis of the RNA Affinity, Nuclease Resistance, and Crystal Structure of Ten 2'-O-Ribonucleic Acid Modifications

    SciTech Connect

    Egli, Martin; Minasov, George; Tereshko, Valentina; Pallan, Pradeep S.; Teplova, Marianna; Inamati, Gopal B.; Lesnik, Elena A.; Owens, Steve R.; Ross, Bruce S.; Prakash, Thazha P.; Manoharan, Muthiah

    2010-03-05

    The syntheses of 10 new RNA 2'-O-modifications, their incorporation into oligonucleotides, and an evaluation of their properties such as RNA affinity and nuclease resistance relevant to antisense activity are presented. All modifications combined with the natural phosphate backbone lead to significant gains in terms of the stability of hybridization to RNA relative to the first-generation DNA phosphorothioates (PS-DNA). The nuclease resistance afforded in particular by the 2'-O-modifications carrying a positive charge surpasses that of PS-DNA. However, small electronegative 2'-O-substituents, while enhancing the RNA affinity, do not sufficiently protect against degradation by nucleases. Similarly, oligonucleotides containing 3'-terminal residues modified with the relatively large 2'-O-[2-(benzyloxy)ethyl] substituent are rapidly degraded by exonucleases, proving wrong the assumption that steric bulk will generally improve protection against nuclease digestion. To analyze the factors that contribute to the enhanced RNA affinity and nuclease resistance we determined crystal structures of self-complementary A-form DNA decamer duplexes containing single 2'-O-modified thymidines per strand. Conformational preorganization of substituents, favorable electrostatic interactions between substituent and sugar-phosphate backbone, and a stable water structure in the vicinity of the 2'-O-modification all appear to contribute to the improved RNA affinity. Close association of positively charged substituents and phosphate groups was observed in the structures with modifications that protect most effectively against nucleases. The promising properties exhibited by some of the analyzed 2'-O-modifications may warrant a more detailed evaluation of their potential for in vivo antisense applications. Chemical modification of RNA can also be expected to significantly improve the efficacy of small interfering RNAs (siRNA). Therefore, the 2'-O-modifications introduced here may benefit the

  19. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes

    2013-01-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  20. Advanced surface-enhanced Raman gene probe systems and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    2001-01-01

    The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

  1. Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

    PubMed Central

    Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei

    2002-01-01

    A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

  2. Identification of Medically Important Molds by an Oligonucleotide Array†

    PubMed Central

    Hsiao, Chen Ren; Huang, Liyin; Bouchara, Jean-Philippe; Barton, Richard; Li, Hsin Chieh; Chang, Tsung Chain

    2005-01-01

    Infections caused by fungi have increased in recent years. Accurate and rapid identification of fungal pathogens is important for appropriate treatment with antifungal agents. On the basis of the internal transcribed spacer 1 (ITS 1) and ITS 2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 64 species (32 genera) of clinically important filamentous (or dimorphic) fungi. These 64 species included fungi causing superficial, cutaneous, subcutaneous, and invasive infections. The method consisted of PCR amplification of the ITS regions using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species- or group-specific oligonucleotides immobilized on a nylon membrane. Of 397 fungal strains (290 target and 107 nontarget strains) tested, the sensitivity and specificity of the array was 98.3% (285/290) and 98.1% (105/107), respectively. Misidentified strains were usually those belonging to the same genus of the target species or having partial homology with oligonucleotide probes on the membrane. The whole procedure can be finished within 24 h starting from isolated colonies; reproductive structures, which are essential for the conventional identification methods, are not needed. In conclusion, the present array is a powerful tool for identification of clinically important filamentous fungi and may have the potential to be continually extended by adding further oligonucleotides to the array without significantly increasing the cost or complexity. PMID:16081907

  3. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  4. [Study toward practical use of oligonucleotide therapeutics].

    PubMed

    Inoue, Takao; Yoshida, Tokuyuki

    2014-01-01

    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics. PMID:25707197

  5. Rapid bacterial identification using evanescent-waveguide oligonucleotide microarray classification.

    PubMed

    Francois, Patrice; Charbonnier, Yvan; Jacquet, Jean; Utinger, Dominic; Bento, Manuela; Lew, Daniel; Kresbach, Gerhard M; Ehrat, Markus; Schlegel, Werner; Schrenzel, Jacques

    2006-06-01

    Bacterial identification relies primarily on culture-based methodologies and requires 48-72 h to deliver results. We developed and used i) a bioinformatics strategy to select oligonucleotide signature probes, ii) a rapid procedure for RNA labelling and hybridization, iii) an evanescent-waveguide oligoarray with exquisite signal/noise performance, and iv) informatics methods for microarray data analysis. Unique 19-mer signature oligonucleotides were selected in the 5'-end of 16s rDNA genes of human pathogenic bacteria. Oligonucleotides spotted onto a Ta(2)O(5)-coated microarray surface were incubated with chemically labelled total bacterial RNA. Rapid hybridization and stringent washings were performed before scanning and analyzing the slide. In the present paper, the eight most abundant bacterial pathogens representing >54% of positive blood cultures were selected. Hierarchical clustering analysis of hybridization data revealed characteristic patterns, even for closely related species. We then evaluated artificial intelligence-based approaches that outperformed conventional threshold-based identification schemes on cognate probes. At this stage, the complete procedure applied to spiked blood cultures was completed in less than 6 h. In conclusion, when coupled to optimal signal detection strategy, microarrays provide bacterial identification within a few hours post-sampling, allowing targeted antimicrobial prescription. PMID:16216356

  6. Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections.

    PubMed

    Hong, Bang-Xing; Jiang, Li-Fang; Hu, Yu-Shan; Fang, Dan-Yun; Guo, Hui-Yu

    2004-09-01

    A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology. Nylon membrane was used as the array support. A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species. A pair of universal primers was designed for PCR amplification of the 23S rRNA gene. Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes. The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array. Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E. coli, but the reaction did not affect their detection. After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not with Clostridium perfringens and Streptococcus pyogenes. The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections. PMID:15279944

  7. The synthesis of oligonucleotides containing a primary amino group at the 5'-terminus.

    PubMed Central

    Connolly, B A

    1987-01-01

    Oligonucleotides containing a primary amino group at their 5'-termini have been prepared and further derivatised with amino specific probes. The sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed with N-monomethoxytrityl-0-methoxydiisopropylaminophosphinyl 3-aminopropan(1)ol. After cleavage from the resin, removal of the phosphate and base protecting groups and purification gives a monomethoxytrityl-NH(CH2)3PO4-oligomer. The monomethoxytrityl group can be removed with acetic acid to give the desired amino containing oligomer. The amino group can be further derivatised with amino specific probes yielding fluorescent or biotinylated oligonucleotide products. PMID:3562247

  8. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  9. Biopolymer synthesis on polypropylene supports. I. Oligonucleotides.

    PubMed

    Matson, R S; Rampal, J B; Coassin, P J

    1994-03-01

    We have modified polypropylene to serve as a new solid-phase support for oligonucleotide synthesis. The plastic is first surface aminated by exposure to an ammonia plasma generated by radiofrequency plasma discharge. The aminated polypropylene has been found to be useful as a support for the in situ synthesis of oligonucleotides from monomers. Furthermore, oligonucleotides synthesized on the surface of the plastic remain attached following deprotection and can be used directly for hybridization. PMID:8203760

  10. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.

    1974-01-01

    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  11. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  12. A novel, one-step amplification and oligonucleotide ligation procedure for multiplex genetic typing

    SciTech Connect

    Eggerding, F.A.

    1994-09-01

    A new technique, coupled amplification and oligonucleotide ligation (CAL), has been developed for simultaneous multiplex amplification and genotyping of DNA. CAL is a biphasic method which combines in one assay DNA amplification by the polymerase chain reaction (PCR) with DNA genotyping by the oligonucleotide ligation assay (OLA). By virtue of a difference in the melting temperatures of PCR primer-target DNA and OLA probe-target DNA hybrids, the method allows preferential amplification of DNA during stage I and oligonucleotide ligation during stage II of the reaction. In stage I target DNA is amplified using high-melting primers in a two-step PCR cycle that employs a 72{degrees}C anneal-elongation step. In stage II genotyping of PCR products by competitive oligonucleotide ligation with oligonucleotide probes located between PCR primers is accomplished by several cycles of denaturation at 94{degrees}C followed by anneal-ligation at 55{degrees}C. Ligation products are fluorochrome-labeled at their 3{prime}-ends and analyzed electrophoretically on a fluorescent DNA sequencer. The CAL procedure has been used for multiplex detection of 30 cystic fibrosis mutations and for analysis of ras gene point mutations. Because mutation detection occurs concurrently with target amplification, the technique is rapid, highly sensitive and specific, easily automatable, and requires minimal sample processing.

  13. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian

    2014-01-01

    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  14. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central

    2013-01-01

    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different

  15. Electron Transfer Dissociation of Oligonucleotide Cations.

    PubMed

    Smith, Suncerae I; Brodbelt, Jennifer S

    2009-06-01

    Electron transfer dissociation (ETD) of multi-protonated 6 - 20-mer oligonucleotides and 12- and 14-mer duplexes is compared to collision activated dissociation (CAD). ETD causes efficient charge reduction of the multi-protonated oligonucleotides in addition to limited backbone cleavages to yield sequence ions of low abundance. Subsequent CAD of the charge-reduced oligonucleotides formed upon electron transfer, in a net process termed electron transfer collision activated dissociation (ETcaD), results in rich fragmentation in terms of w, a, z, and d products, with a marked decrease in the abundance of base loss ions and internal fragments. Complete sequencing was possible for nearly all oligonucleotides studied. ETcaD of an oligonucleotide duplex resulted in specific backbone cleavages, with conservation of weaker non-covalent bonds. PMID:20161288

  16. Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II

    SciTech Connect

    2000-06-15

    The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank{reg_sign} finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

  17. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  18. Synthesis of 5'-Aldehyde Oligonucleotide.

    PubMed

    Lartia, Rémy

    2016-01-01

    Synthesis of oligonucleotide ending with an aldehyde functional group at their 5'-end (5'-AON) is possible for both DNA (5'-AODN) and RNA (5'-AORN) series irrespectively of the nature of the last nucleobase. The 5'-alcohol of on-support ODN is mildly oxidized under Moffat conditions. Transient protection of the resulting aldehyde by N,N'-diphenylethylenediamine derivatives allows cleavage, deprotection, and RP-HPLC purification of the protected 5'-AON. Finally, 5'-AON is deprotected by usual acetic acid treatment. In the aggregates, 5'-AON can be now synthesized and purified as routinely as non-modified ODNs, following procedures similar to the well-known "DMT-On" strategy. PMID:26967469

  19. Identification of Dermatophytes by an Oligonucleotide Array▿ †

    PubMed Central

    Li, Hsin Chieh; Bouchara, Jean-Philippe; Hsu, Mark Ming-Long; Barton, Richard; Chang, Tsung Chain

    2007-01-01

    Species of dermatophytes are classified into three anamorphic (asexual) genera, Epidermophyton, Microsporum, and Trichophyton. Conventional methods used to identify dermatophytes are often lengthy and may be inconclusive because of atypical microscopic or colony morphology. Based on the internal transcribed spacer 1 (ITS-1) and ITS-2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 17 dermatophyte species. The method consisted of PCR amplification of the ITS regions using universal primers, followed by hybridization of the digoxigenin-labeled PCR products to an array of oligonucleotides (17- to 30-mers) immobilized on a nylon membrane. Of 198 dermatophyte strains and 90 nontarget strains tested, the sensitivity and specificity of the array were 99.5% and 97.8%, respectively. The only strain not identified (Microsporum audouinii LMA 597) was found to have a nucleotide insertion at the ITS-2 region where the probe was designed. Two nontarget strains, Microsporum equinum LMA 40396666 and Trichophyton gourvilii var. intermedium CBS 170.65, were misidentified as Microsporum canis and Trichophyton soudanense, respectively. Sequence analysis of the ITS regions revealed that the two misidentified strains displayed high sequence homology with the probes designed for M. canis and T. soudanense, respectively. The present method can be used as a reliable alternative to conventional identification methods and can be completed with isolated colonies within 24 h. PMID:17687010

  20. Tandem oligonucleotide synthesis using linker phosphoramidites

    PubMed Central

    Pon, Richard T.; Yu, Shuyuan

    2005-01-01

    Multiple oligonucleotides of the same or different sequence, linked end-to-end in tandem can be synthesized in a single automated synthesis. A linker phosphoramidite [R. T. Pon and S. Yu (2004) Nucleic Acids Res., 32, 623–631] is added to the 5′-terminal OH end of a support-bound oligonucleotide to introduce a cleavable linkage (succinic acid plus sulfonyldiethanol) and the 3′-terminal base of the new sequence. Conventional phosphoramidites are then used for the rest of the sequence. After synthesis, treatment with ammonium hydroxide releases the oligonucleotides from the support and cleaves the linkages between each sequence. Mixtures of one oligonucleotide with both 5′- and 3′-terminal OH ends and other oligonucleotides with 5′-phosphorylated and 3′-OH ends are produced, which are deprotected and worked up as a single product. Tandem synthesis can be used to make pairs of PCR primers, sets of cooperative oligonucleotides or multiple copies of the same sequence. When tandem synthesis is used to make two self-complementary sequences, double-stranded structures spontaneously form after deprotection. Tandem synthesis of oligonucleotide chains containing up to six consecutive 20mer (120 bases total), various trinucleotide codons and primer pairs for PCR, or self-complementary strands for in situ formation of double-stranded DNA fragments has been demonstrated. PMID:15814811

  1. Rapid, high-resolution in situ hybridization histochemistry with radioiodinated synthetic oligonucleotides

    SciTech Connect

    Lewis, M.E.; Arentzen, R.; Baldino, F. Jr.

    1986-01-01

    In situ hybridization histochemistry is a valuable technique for localizing specific messenger RNA (mRNA) and detecting changes in gene expression. Generally, the mRNA of interest has been detected by probes obtained from cloned DNA and labelled to high specific activity by nick translation. Such probes have a number of disadvantages which can be circumvented by the use of short synthetic oligonucleotides designed to be complementary to a known mRNA sequence. We report here that synthetic oligonucleotides complementary to part of the mRNA coding for rat arginine-vasopressin (AVP) can be labelled to high specific activity with (/sup 125/I), using either the primer extension method with the Klenow fragment of DNA polymerase I or the 3'-tailing method with terminal deoxynucleotidyl transferase. Both AVP probes hybridized well to the magnocellular neurons of the hypothalamic paraventricular and supraoptic nuclei. A strong autoradiographic signal was present by 2 days, with grains largely confined to the perikaryon. These results compare favorably to those obtained with (/sup 32/P)- or (/sup 3/H)-labelled probes. Given the ease of the 3'-tailing method, (/sup 125/I)-labelled oligonucleotides appear to be especially useful probes for in situ hybridization histochemistry.

  2. Oligonucleotides labeled with single fluorophores as sensors for deoxynucleotide triphosphate binding by DNA polymerases.

    PubMed

    Nikiforov, Theo T

    2014-01-01

    Oligonucleotides labeled with a single fluorophore (fluorescein or tetramethylrhodamine) have been used previously as fluorogenic substrates for a number of DNA modifying enzymes. Here, it is shown that such molecules can be used as fluorogenic probes to detect the template-dependent binding of deoxynucleotide triphosphates by DNA polymerases. Two polymerases were used in this work: the Klenow fragment of the Escherichia coli DNA polymerase I and the Bacillus stearothermophilus polymerase, Bst. When complexes of these polymerases with dye-labeled hairpin-type oligonucleotides were mixed with various deoxynucleotide triphosphates in the presence of Sr²⁺ as the divalent metal cation, the formation of ternary DNA-polymerase-dNTP complexes was detected by concentration-dependent changes in the fluorescence intensities of the dyes. Fluorescein- and tetramethylrhodamine-labeled probes of identical sequences responded differently to the two polymerases. With Bst polymerase, the fluorescence intensities of all probes increased with the next correct dNTP; with Klenow polymerase, tetramethylrhodamine-labeled probes increased their fluorescence, but the intensity of fluorescein-labeled probes decreased on formation of ternary complexes with the correct incoming nucleotides. The use of Sr²⁺ as the divalent metal ion allowed the formation of catalytically inactive ternary complexes and obviated the need for using 2',3'-dideoxy-terminated oligonucleotides as would have been needed in the case of Mg²⁺ as the metal ion. PMID:24096197

  3. Minimizing DNA microarrays to a single molecule per spot: using zero-mode waveguide technology to obtain kinetic data for a large number of short oligonucleotide hybridization reactions

    NASA Astrophysics Data System (ADS)

    Sobek, Jens; Rehrauer, Hubert; Kuhn, Gerrit; Schlapbach, Ralph

    2016-03-01

    We have shown recently that the hybridization of short oligonucleotides can be studied in a zero-mode waveguide nanostructure (ZMW) chip using a modified DNA sequencer.[1] Here we present an extension of this method enabling the parallel measurement of kinetic constants of a large number of hybridization reactions on a single chip. This can be achieved by immobilization of a mixture of oligonucleotides, which leads to a statistical and random distribution of single molecules in the 150'000 ZMWs of a SMRT™ cell. This setup is comparable to a classical microarray with ZMWs in place of spots but unknown allocation of probes. The probe surface density is reduced by a factor of ~1010 allowing the study of hybridization in the absence of interactions with neighboring probes. Hybridization with a dye labelled oligonucleotide results in trains of fluorescence pulses from which interpulse durations (IPDs) and pulse widths (PWs) can be extracted. Since the identity of a probe in a ZMW is unknown, the immobilized oligonucleotide is sequenced in a subsequent step. After mapping the fluorescence traces to the sequence, the association and dissociation rate constant for each oligonucleotide can be calculated. By selecting suitable probes, the method can be used to determine rate constants of hybridization for a large number of mismatch oligonucleotides in a single measurement and at single-molecule level.

  4. Quantitation of phosphorothioate oligonucleotides in human plasma.

    PubMed

    Leeds, J M; Graham, M J; Truong, L; Cummins, L L

    1996-03-01

    Methods are presented for the extraction of phosphorothioate oligonucleotides from human plasma to permit quantitation by capillary gel electrophoresis. Extraction of the phosphorothioate oligonucleotides from plasma was accomplished using two solid-phase extraction columns, a strong anion-exchange column to remove plasma proteins and lipids, followed by a reverse-phase column to remove salts. A second desalting step, achieved by dialysis utilizing a membrane with a molecular weight cutoff of 2500 Da floating on distilled water, was required to remove residual ionic material from the extracted sample. This method should be generally applicable to the analysis and quantitation of phosphorothioate oligonucleotides. PMID:8850544

  5. Hydrolysis of microporous polyamide-6 membranes as substrate for in situ synthesis of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tang, Jianxin; He, Nongyue; Nie, Libo; Xiao, Pengfeng; Chen, Hong

    2004-02-01

    This article provides a novel method of preparing substrate for in situ synthesis of oligonucleotide by hydrolyzing microporous polyamide-6 membranes in a 0.01 mol/l/NaOH/(H 2O-CH 3OH) mixture medium with refluxing about 36 h. Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR) demonstrated the emergence of amines (NH 2) on the surface. Optimum hydrolyzing conditions were determined through the ultra-violet (UV) spectra. A pH value of 12 and a hydrolysis time of 36 h are the preferred conditions for the modification. The treated membrane can be applied to in situ synthesis of oligonucleotide and, for example, the oligonucleotide probes of 5 '-AAC CAC CAA ACA CAC-3 ' were successfully synthesized on the hydrolyzed membrane. The single step coupling efficiency determined by ultraviolet (UV) spectra is above 98%.

  6. Electron migration in 5-bromouracil-substituted DNA and oligonucleotides in irradiated aqueous solutions

    SciTech Connect

    Zimbrick, J.D.; Beach, C.M.; Fuciarelli, A.G.; Sisk, E.C.

    1992-06-01

    Results of work by other investigators support the hypothesis that negative charge can migrate in DNA. Charge transfer between nucleotides and electron migration in solid state DNA has been demonstrated, with migration distances as great as 110 bases. Here we report a series of studies on aqueous solutions of DNA and oligonucleotides in which the radiolysis of 5-bromouracil (BU) substituted for thymine is used as a molecular probe to detect and measure the extent of electron migration. In studies using oligonucleotides, BU was substituted for thymine at specific locations in defined base sequences using automated phosphoramidite synthesis techniques. Using these single-stranded oligonucleotides with BU located at the 5 in. end of the sequence, electrons do not appear to migrate more than one base, if any.

  7. Development of a New Oligonucleotide Array To Identify Staphylococcal Strains at Species Level

    PubMed Central

    Giammarinaro, Philippe; Leroy, Sabine; Chacornac, Jean-Paul; Delmas, Julien; Talon, Regine

    2005-01-01

    The genus Staphylococcus is made up of 36 validated species which contain strains that are pathogenic, saprophytic, or used as starter cultures for the food industry. An oligonucleotide array targeting the manganese-dependent superoxide dismutase (sodA) gene was developed to overcome the drawbacks of the conventional methods of identification. Divergences of the sodA gene were used to design oligonucleotide probes, and we showed that each of the 36 species had a characteristic pattern of hybridization. To evaluate the array, we analyzed 38 clinical and 38 food or food plant Staphylococcus isolates identified by the phenotype-based system VITEK 2 (bioMérieux). This commercial kit failed to identify 8 (21%) of the clinical isolates and 32 (84%) of the food and food plant isolates. In contrast, the oligonucleotide array we designed provided an accurate and rapid method for the identification of staphylococcal strains, isolated from clinical, environmental, or food samples, at species level. PMID:16081895

  8. Immobilization of DNA in polyacrylamide gel for the manufacture of DNA and DNA-oligonucleotide microchips.

    SciTech Connect

    Proudnikov, D.; Timofeev, E.; Mirzabekov, A.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology

    1998-05-15

    Activated DNA was immobilized in aldehyde-containing polyacrylamide gel for use in manufacturing the MAGIChip (microarrays of gel-immobilized compounds on a chip). First, abasic sites were generated in DNA by partial acidic depurination. Amino groups were then introduced into the abasic sites by reaction with ethylenediamine and reduction of the aldimine bonds formed. It was found that DNA could be fragmented at the site of amino group incorporation or preserved mostly unfragmented. In similar reactions, both amino-DNA and amino-oligonucleotides were attached through their amines to polyacrylamide gel derivatized with aldehyde groups. Single- and double-stranded DNA of 40 to 972 nucleotides or base pairs were immobilized on the gel pads to manufacture a DNA microchip. The microchip was hybridized with fluorescently labeled DNA-specific oligonucleotide probes. This procedure for immobilization of amino compounds was used to manufacture MAGIChips containing both DNA and oligonucleotides.

  9. Visualizing genomes with Oligopaint FISH probes

    PubMed Central

    Beliveau, Brian J.; Apostolopoulos, Nicholas; Wu, Chao-ting

    2014-01-01

    Oligopaint probes are fluorescently-labeled, single-stranded DNA oligonucleotides that can be used to visualize genomic regions ranging in size from tens of kilobases to many megabases. This unit details how Oligopaint probes can be synthesized using basic molecular biological techniques as well as provides protocols for FISH, 3D-FISH, and sample preparation. PMID:24510436

  10. Gene Assembly from Chip-Synthesized Oligonucleotides

    PubMed Central

    Eroshenko, Nikolai; Kosuri, Sriram; Marblestone, Adam H; Conway, Nicholas; Church, George M.

    2012-01-01

    De novo synthesis of long double-stranded DNA constructs has a myriad of applications in biology and biological engineering. However, its widespread adoption has been hindered by high costs. Cost can be significantly reduced by using oligonucleotides synthesized on high-density DNA chips. However, most methods for using off-chip DNA for gene synthesis have failed to scale due to the high error rates, low yields, and high chemical complexity of the chip-synthesized oligonucleotides. We have recently demonstrated that some commercial DNA chip manufacturers have improved error rates, and that the issues of chemical complexity and low yields can be solved by using barcoded primers to accurately and efficiently amplify subpools of oligonucleotides. This article includes protocols for computationally designing the DNA chip, amplifying the oligonucleotide subpools, and assembling 500-800 basepair (bp) constructs. PMID:25077042

  11. Transformation of yeast with synthetic oligonucleotides.

    PubMed Central

    Moerschell, R P; Tsunasawa, S; Sherman, F

    1988-01-01

    Genomic DNA of the yeast, Saccharomyces cerevisiae, can be conveniently and specifically altered by transforming spheroplasts or lithium acetate-treated cells directly with synthetic oligonucleotides. Altered forms of iso-1-cytochrome c were generated by transforming a cyc1 mutant with oligonucleotides and selecting for at least partially functional revertants; the oligonucleotides contained a sequence that corrected the cyc1 mutation and produced additional alterations at nearby sites. Transformation has been accomplished with oligonucleotides as short as 20 nucleotides and with amounts as low as 100 micrograms. This method of site-directed mutagenesis in vivo has been used to produce alterations in the NH2-terminal region of iso-1-cytochrome c in which the NH2-terminal methionine is excised and the penultimate residue is acetylated. PMID:2829192

  12. Antisense oligonucleotides as therapeutics for malignant diseases.

    PubMed

    Ho, P T; Parkinson, D R

    1997-04-01

    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  13. Direct microcontact printing of oligonucleotides for biochip applications

    PubMed Central

    Thibault, C; Le Berre, V; Casimirius, S; Trévisiol, E; François, J; Vieu, C

    2005-01-01

    Background A critical step in the fabrication of biochips is the controlled placement of probes molecules on solid surfaces. This is currently performed by sequential deposition of probes on a target surface with split or solid pins. In this article, we present a cost-effective procedure namely microcontact printing using stamps, for a parallel deposition of probes applicable for manufacturing biochips. Results Contrary to a previous work, we showed that the stamps tailored with an elastomeric poly(dimethylsiloxane) material did not require any surface modification to be able to adsorb oligonucleotides or PCR products. The adsorbed DNA molecules are subsequently printed efficiently on a target surface with high sub-micron resolution. Secondly, we showed that successive stamping is characterized by an exponential decay of the amount of transferred DNA molecules to the surface up the 4th print, then followed by a second regime of transfer that was dependent on the contact time and which resulted in reduced quality of the features. Thus, while consecutive stamping was possible, this procedure turned out to be less reproducible and more time consuming than simply re-inking the stamps between each print. Thirdly, we showed that the hybridization signals on arrays made by microcontact printing were 5 to 10-times higher than those made by conventional spotting methods. Finally, we demonstrated the validity of this microcontact printing method in manufacturing oligonucleotides arrays for mutations recognition in a yeast gene. Conclusion The microcontact printing can be considered as a new potential technology platform to pattern DNA microarrays that may have significant advantages over the conventional spotting technologies as it is easy to implement, it uses low cost material to make the stamp, and the arrays made by this technology are 10-times more sensitive in term of hybridization signals than those manufactured by conventional spotting technology. PMID:15992404

  14. Chromosome-Specific Painting in Cucumis Species Using Bulked Oligonucleotides

    PubMed Central

    Han, Yonghua; Zhang, Tao; Thammapichai, Paradee; Weng, Yiqun; Jiang, Jiming

    2015-01-01

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a single chromosome of cucumber were identified using a newly developed bioinformatic pipeline and then massively synthesized de novo in parallel. The synthesized oligos were amplified and labeled with biotin or digoxigenin for use in fluorescence in situ hybridization (FISH). We developed three different probes with each containing 23,000–27,000 oligos. These probes spanned 8.3–17 Mb of DNA on targeted cucumber chromosomes and had the densities of 1.5–3.2 oligos per kilobases. These probes produced FISH signals on a single cucumber chromosome and were used to paint homeologous chromosomes in other Cucumis species diverged from cucumber for up to 12 million years. The bulked oligo probes allowed us to track a single chromosome in early stages during meiosis. We were able to precisely map the pairing between cucumber chromosome 7 and chromosome 1 of Cucumis hystrix in a F1 hybrid. These two homeologous chromosomes paired in 71% of prophase I cells but only 25% of metaphase I cells, which may provide an explanation of the higher recombination rates compared to the chiasma frequencies between homeologous chromosomes reported in plant hybrids. PMID:25971668

  15. Portable system for microbial sample preparation and oligonucleotide microarray analysis.

    PubMed

    Bavykin, S G; Akowski, J P; Zakhariev, V M; Barsky, V E; Perov, A N; Mirzabekov, A D

    2001-02-01

    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager. PMID:11157263

  16. Portable system for microbial sample preparation and oligonucleotide microarray analysis.

    SciTech Connect

    Bavykin, S. G.; Akowski, J. P.; Zakhariev, V. M.; Barsky, V. E.; Mirzabekov, A. D.; Perov, A. N.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2001-02-01

    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager.

  17. Caged oligonucleotides for studying biological systems

    PubMed Central

    Ruble, Brittani K.; Yeldell, Sean B.; Dmochowski, Ivan J.

    2015-01-01

    Light-activated (“caged”) compounds have been widely employed for studying biological processes with high spatial and temporal control. In the past decade, several new approaches for caging the structure and function of DNA and RNA oligonucleotides have been developed. This review focuses on caged oligonucleotides that incorporate site-specifically one or two photocleavable linkers, whose photolysis yields oligonucleotides with dramatic structural and functional changes. This technique has been employed by our laboratory and others to photoregulate gene expression in cells and living organisms, typically using near UV-activated organic chromophores. To improve capabilities for in vivo studies, we harnessed the rich inorganic photochemistry of ruthenium bipyridyl complexes to synthesize Ru-caged morpholino antisense oligonucleotides that remain inactive in zebrafish embryos until uncaged with visible light. Expanding into new caged oligonucleotide applications, our lab has developed Transcriptome In Vivo Analysis (TIVA) technology, which provides the first noninvasive, unbiased method for isolating mRNA from single neurons in brain tissues. TIVA-isolated mRNA can be amplified and then analyzed using next-generation sequencing (RNA-seq). PMID:25865001

  18. Detection and Genotyping of Arcobacter and Campylobacter Isolates from Retail Chicken Samples by Use of DNA Oligonucleotide Arrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To explore the use of DNA microarrays for pathogen detection in food, we have produced DNA oligonucleotide arrays to identify the presence of Arcobacter and Campylobacter in retail chicken. Probes were selected that target housekeeping and virulence-associated genes in both Arcobacter butzleri and ...

  19. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile.

    PubMed

    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B

    2016-01-01

    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride ("DQAsomes") have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2'-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription-translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We describe

  20. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile

    PubMed Central

    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B

    2016-01-01

    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride (“DQAsomes”) have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2′-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription–translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We

  1. Optimization of an oligonucleotide microchip for microbial identification studies: a non-equilibrium dissociation approach

    NASA Technical Reports Server (NTRS)

    Liu, W. T.; Mirzabekov, A. D.; Stahl, D. A.

    2001-01-01

    The utility of a high-density oligonucleotide microarray (microchip) for identifying strains of five closely related bacilli (Bacillus anthracis, Bacillus cereus, Bacillus mycoides, Bacillus medusa and Bacillus subtilis) was demonstrated using an approach that compares the non-equilibrium dissociation rates ('melting curves') of all probe-target duplexes simultaneously. For this study, a hierarchical set of 30 oligonucleotide probes targeting the 16S ribosomal RNA of these bacilli at multiple levels of specificity (approximate taxonomic ranks of domain, kingdom, order, genus and species) was designed and immobilized in a high-density matrix of gel pads on a glass slide. Reproducible melting curves for probes with different levels of specificity were obtained using an optimized salt concentration. Clear discrimination between perfect match (PM) and mismatch (MM) duplexes was achieved. By normalizing the signals to an internal standard (a universal probe), a more than twofold discrimination (> 2.4x) was achieved between PM and 1-MM duplexes at the dissociation temperature at which 50% of the probe-target duplexes remained intact. This provided excellent differentiation among representatives of different Bacillus species, both individually and in mixtures of two or three. The overall pattern of hybridization derived from this hierarchical probe set also provided a clear 'chip fingerprint' for each of these closely related Bacillus species.

  2. Development, Characterization and Experimental Validation of a Cultivated Sunflower (Helianthus annuus L.) Gene Expression Oligonucleotide Microarray

    PubMed Central

    Fernandez, Paula; Soria, Marcelo; Blesa, David; DiRienzo, Julio; Moschen, Sebastian; Rivarola, Maximo; Clavijo, Bernardo Jose; Gonzalez, Sergio; Peluffo, Lucila; Príncipi, Dario; Dosio, Guillermo; Aguirrezabal, Luis; García-García, Francisco; Conesa, Ana; Hopp, Esteban; Dopazo, Joaquín; Heinz, Ruth Amelia; Paniego, Norma

    2012-01-01

    Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs) curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de). The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons). The resulting Sunflower Unigen Resource (SUR version 1.0) was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls) and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01) allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement. PMID:23110046

  3. Development, characterization and experimental validation of a cultivated sunflower (Helianthus annuus L.) gene expression oligonucleotide microarray.

    PubMed

    Fernandez, Paula; Soria, Marcelo; Blesa, David; DiRienzo, Julio; Moschen, Sebastian; Rivarola, Maximo; Clavijo, Bernardo Jose; Gonzalez, Sergio; Peluffo, Lucila; Príncipi, Dario; Dosio, Guillermo; Aguirrezabal, Luis; García-García, Francisco; Conesa, Ana; Hopp, Esteban; Dopazo, Joaquín; Heinz, Ruth Amelia; Paniego, Norma

    2012-01-01

    Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs) curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de). The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons). The resulting Sunflower Unigen Resource (SUR version 1.0) was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls) and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01) allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement. PMID:23110046

  4. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. PMID:24727531

  5. Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes.

    PubMed

    Hwang, Gyoyeon; Lee, Hansol; Lee, Jiyeon

    2015-11-13

    The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Pt conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. PMID:26449454

  6. Inhibition of dengue virus by novel, modified antisense oligonucleotides.

    PubMed Central

    Raviprakash, K; Liu, K; Matteucci, M; Wagner, R; Riffenburgh, R; Carl, M

    1995-01-01

    Five different target regions along the length of the dengue virus type 2 genome were compared for inhibition of the virus following intracellular injection of the cognate antisense oligonucleotides and their analogs. Unmodified phosphodiester oligonucleotides as well as the corresponding phosphorothioate oligonucleotides were ineffective in bringing about a significant inhibition of the virus. Novel modified phosphorothioate oligonucleotides in which the C-5 atoms of uridines and cytidines were replaced by propynyl groups caused a significant inhibition of the virus. Antisense oligonucleotide directed against the target region near the translation initiation site of dengue virus RNA was the most effective, followed by antisense oligonucleotide directed against a target in the 3' untranslated region of the virus RNA. It is suggested that the inhibitory effect of these novel modified oligonucleotides is due to their increased affinity for the target sequences and that they probably function via an RNase H cleavage of the oligonucleotide:RNA heteroduplex. PMID:7983769

  7. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. PMID:27117425

  8. PERFORMANCE CHARACTERISTICS OF 65-MER OLIGONUCLEOTIDE MICROARRAYS

    PubMed Central

    Lee, Myoyong; Xiang, Charlie C.; Trent, Jeffrey M.; Bittner, Michael L.

    2009-01-01

    Microarray fabrication using pre-synthesized long oligonucleotide is becoming increasingly important, but a study of large-scale array productions is not published yet. We addressed the issue of fabricating oligonucleotide microarrays by spotting commercial, pre-synthesized 65-mers with 5′ amines representing 7500 murine genes. Amine-modified oligonucleotides were immobilized on glass slides having aldehyde groups via transient Schiff base formation followed by reduction to produce a covalent conjugate. When RNA derived from the same source was used for Cy3 and Cy5 labeling and hybridized to the same array, signal intensities spanning three orders of magnitude were observed, and the coefficient of variation between the two channels for all spots was 8–10%. To ascertain the reproducibility of ratio determination of these arrays, two triplicate hybridizations (with fluorochrome reversal) comparing RNAs from a fibroblast (NIH3T3) and a breast cancer (JC) cell line were carried out. The 95% confidence interval for all spots in the six hybridizations was 0.60 – 1.66. This level of reproducibility allows use of the full range of pattern finding and discriminant analysis typically applied to cDNA microarrays. Further comparative testing was carried out with oligonucleotide microarrays, cDNA microarrays and RT-PCR assays to examine the comparability of results across these different methodologies. PMID:17617369

  9. Oligonucleotide recombination in gram negative bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This report describes several key aspects of a novel form of RecA-independent homologous recombination. We found that synthetic single stranded DNA oligonucleotides (oligos) introduced into bacteria by transformation can site-specifically recombine with bacterial chromosomes in the absence of any a...

  10. Construction and Evaluation of a Clostridium thermocellum ATCC 27405 Whole-Genome Oligonucleotide Microarray

    NASA Astrophysics Data System (ADS)

    Brown, Steven D.; Raman, Babu; McKeown, Catherine K.; Kale, Shubha P.; He, Zhili; Mielenz, Jonathan R.

    Clostridium thermocellum is an anaerobic, thermophilic bacterium that can directly convert cellulosic substrates into ethanol. Microarray technology is a powerful tool to gain insights into cellular processes by examining gene expression under various physiological states. Oligonucleotide microarray probes were designed for 96.7% of the 3163 C. thermocellum ATCC 27405 candidate protein-encoding genes and then a partial-genome microarray containing 70 C. thermocellum specific probes was constructed and evaluated. We detected a signal-to-noise ratio of three with as little as 1.0 ng of genomic DNA and only low signals from negative control probes (nonclostridial DNA), indicating the probes were sensitive and specific. In order to further test the specificity of the array we amplified and hybridized 10 C. thermocellum polymerase chain reaction products that represented different genes and found gene specific hybridization in each case. We also constructed a whole-genome microarray and prepared total cellular RNA from the same point in early-logarithmic growth phase from two technical replicates during cellobiose fermentation. The reliability of the microarray data was assessed by cohybridization of labeled complementary DNA from the cellobiose fermentation samples and the pattern of hybridization revealed a linear correlation. These results taken together suggest that our oligonucleotide probe set can be used for sensitive and specific C. thermocellum transcriptomic studies in the future.

  11. Construction and evaluation of a Clostridium thermocellum ATCC 27405 whole-genome oligonucleotide microarray

    SciTech Connect

    Brown, Steven David; Raman, Babu; McKeown, Catherine K; Kale, Shubhangi P; He, Zhili; Mielenz, Jonathan R

    2007-04-01

    Clostridium thermocellum is an anaerobic, thermophilic bacterium that can directly convert cellulosic substrates into ethanol. Microarray technology is a powerful tool to gain insights into cellular processes by examining gene expression under various physiological states. Oligonucleotide microarray probes were designed for 96.7% of the 3163 C. thermocellum ATCC 27405 candidate protein-encoding genes and then a partial-genome microarray containing 70 C. thermocellum specific probes was constructed and evaluated. We detected a signal-to-noise ratio of three with as little as 1.0 ng of genomic DNA and only low signals from negative control probes (nonclostridial DNA), indicating the probes were sensitive and specific. In order to further test the specificity of the array we amplified and hybridized 10 C. thermocellum polymerase chain reaction products that represented different genes and found gene specific hybridization in each case. We also constructed a whole-genome microarray and prepared total cellular RNA from the same point in early-logarithmic growth phase from two technical replicates during cellobiose fermentation. The reliability of the microarray data was assessed by cohybridization of labeled complementary DNA from the cellobiose fermentation samples and the pattern of hybridization revealed a linear correlation. These results taken together suggest that our oligonucleotide probe set can be used for sensitive and specific C. thermocellum transcriptomic studies in the future.

  12. Hybridization of binary monolayers of single stranded oligonucleotides and short blocking molecules

    NASA Astrophysics Data System (ADS)

    Vikholm-Lundin, Inger; Auer, Sanna; Munter, Tony; Fiegl, Heidi; Apostolidou, Sophia

    2009-02-01

    We have studied the immobilization of single stranded (ss) DNA oligonucleotides of 16-27 base pairs on gold. The oligonucleotides were thiol-modified (SH-ssDNA) or disulfide-modified via a dimethoxytrityl-group (DMT-S-S-ssDNA). Immobilization was performed by adsorption of the probes on the gold surface for 10-15 min, a time within which saturation coverage was obtained for both thiol- and disulfide-modified probes. Hereafter the layer was post-treated with hydroxyalkyl substituted lipoamides also for a time of 10-15 min. The surface density of layers with shorter probes (16-18 mer) was twice (2.4 ± 0.2 × 10 13 probes/cm 2) that of the longer probes (25-27 mer) as studied with surface plasmon resonance. Hybridization of single stranded polymerase chain reaction (PCR) amplified products with a length above 300 base pairs gave a very low hybridization response. For amplicons with about 100 base pairs the response was high. The surface coverage was comparable to that of complementary ssDNA binding (3.0 × 10 12 strands/cm 2). Surfaces made from SH-ssDNA showed a 30% higher hybridization response than surfaces made from DMT-S-S-ssDNA. The PCR amplified products used are of relevance in breast cancer diagnosis. The results clearly demonstrate that the single stranded PCR products might be used in label-free cancer diagnostics.

  13. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-02-24

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  14. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    1998-01-01

    The subject invention disclosed herein is a new gene probe biosensor and methods thereof based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays.

  15. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-09-29

    The subject invention disclosed herein is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  16. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-07-21

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  17. Detection of Glucose with Atomic Absorption Spectroscopy by Using Oligonucleotide Functionalized Gold Nanoparticle.

    PubMed

    Zhang, Hong; Yan, Honglian; Ling, Liansheng

    2016-06-01

    A novel method for the detection of glucose was established with atomic absorption spectroscopy by using the label of gold nanoparticle (AuNP). Silver-coated glass assembled with oligonucleotide 5'-SH-T12-AGA CAA GAG AGG-3' (Oligo 1) was acted as separation probe, oligonucleotide 5'-CAA CAG AGA ACG-T12-SH-3' modified gold nanoparticle (AuNP-Oligo 2) was acted as signal-reporting probe. Oligonucleotide 5'-CGT TCT CTG TTG CCT CTC TTG TCT-3' (Oligo 3) could hybridize with Oligo 1 on the surface of silver-coated glass and AuNP-Oligo 2, and free AuNP-Oligo 2 could be removed by rinsing with buffer. Hence the concentration of Oligo 3 was transformed into the concentration of gold element. In addition, Oligo 3 could be cleaved into DNA fragments by glucose, glucose oxidase and Fe(2+)-EDTA through Fenton reaction. Thereby the concentration of glucose could be transformed to the absorbance of gold element. Under the optimum conditions, the integrated absorbance decreased proportionally to the concentration of glucose over the range from 50.0 μM to 1.0 mM with a detection limit of 40.0 μM. Moreover, satisfactory result was obtained when the assay was used to determinate glucose in human serum. PMID:27427698

  18. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

    2002-01-01

    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  19. Human papilloma virus strain detection utilising custom-designed oligonucleotide microarrays.

    PubMed

    Ayers, Duncan; Platt, Mark; Javad, Farzad; Day, Philip J R

    2011-01-01

    Within the past 15 years, the utilisation of microarray technology for the detection of specific pathogen strains has increased rapidly. Presently, it is possible to simply purchase a pre-manufactured "off the shelf " oligonucleotide microarray bearing a wide variety of known signature DNA sequences previously identified in the organism being studied. Consequently, a hybridisation analysis may be used to pinpoint which strain/s is present in any given clinical sample. However, there exists a problem if the study necessitates the identification of novel sequences which are not represented in commercially available microarray chips. Ideally, such investigations require an in situ oligonucleotide microarray platform with the capacity to synthesise microarrays bearing probe sequences designed solely by the researcher. This chapter will focus on the employment of the Combimatrix® B3 CustomArray™ for the synthesis of reusable, bespoke microarrays for the purpose of discerning multiple Human Papilloma Virus strains. PMID:20938834

  20. PROBES FOR THE SPECIFIC DETECTION OF CRYPTOSPORIDIUM PARVUM

    EPA Science Inventory

    A probe set, consisting of two synthetic oligonucleotides each tagged with a fluorescent reporter molecule, has been developed for specific detection of Cryptosporidium parvum.Each probe strand detects ribosomal RNA from a range of isolates of this species, and the combination is...

  1. Circulation of oligonucleotides by disulfide bridge formation.

    PubMed Central

    Gao, H; Yang, M; Patel, R; Cook, A F

    1995-01-01

    An effective, convenient method for the circularization of oligonucleotides has been developed. This procedure involved preparation of an oligonucleotide with backbone-linked 5'- and 3'-terminal hexamethylenethiol groups, followed by oxidation of the thiol groups with air of oxygen to produce the corresponding circular sequence bridged via a bis(hexamethylene)-disulfide moiety. The method has been applied to the circularization of oligodeoxynucleotide sequences of varying lengths (5, 10, 15, 20, 30 and 40 bases), and the circularization process was highly efficient as shown by HPLC or gel electrophoresis of the crude reaction mixtures. Competing reactions such as dimerization were not significant except for the longer sequences (30 and 40 bases). The circularization of an eight base RNA sequence was also accomplished, as well as hexa-ethylene glycol bridged poly-T sequences capable of triplex formation. PMID:7596832

  2. DNA analysis and diagnostics on oligonucleotide microchips.

    PubMed Central

    Yershov, G; Barsky, V; Belgovskiy, A; Kirillov, E; Kreindlin, E; Ivanov, I; Parinov, S; Guschin, D; Drobishev, A; Dubiley, S; Mirzabekov, A

    1996-01-01

    We present a further development in the technology of sequencing by hybridization to oligonucleotide microchips (SHOM) and its application to diagnostics for genetic diseases. A robot has been constructed to manufacture sequencing "microchips." The microchip is an array of oligonucleotides immobilized into gel elements fixed on a glass plate. Hybridization of the microchip with fluorescently labeled DNA was monitored in real time simultaneously for all microchip elements with a two-wavelength fluorescent microscope equipped with a charge-coupled device camera. SHOM has been used to detect beta-thalassemia mutations in patients by hybridizing PCR-amplified DNA with the microchips. A contiguous stacking hybridization technique has been applied for the detection of mutations; it can simplify medical diagnostics and enhance its reliability. The use of multicolor monitoring of contiguous stacking hybridization is suggested for large-scale diagnostics and gene polymorphism studies. Other applications of the SHOM technology are discussed. Images Fig. 2 Fig. 3 Fig. 4 PMID:8643503

  3. The prebiotic synthesis of deoxythymidine oligonucleotides

    NASA Technical Reports Server (NTRS)

    Stephen-Sherwood, E.; Odom, D. G.; Oro, J.

    1974-01-01

    Deoxythymidine 5 prime-triphosphate in the presence of deoxythymidine 5 prime-phosphate, cyanamide and 4-amino-5-imidazole carboxamide polymerizes under drying conditions at moderate temperatures (60 to 90 C) to yield oligonucleotides of up to four units in length. Enzymatic analysis indicated that the majority of these oligomers contained natural 3 prime-5 prime phosphodiester bonds. This reaction offers a possible method for the formation of deoxyoligonucleotides under primitive earth conditions.

  4. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J

    2015-01-01

    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  5. Sensitive detection of glucose in human serum with oligonucleotide modified gold nanoparticles by using dynamic light scattering technique.

    PubMed

    Miao, Xiangmin; Ling, Liansheng; Shuai, Xintao

    2013-03-15

    Dynamic light scattering based sensor for glucose was developed with oligonucleotide functionalized gold nanoparticles (Oligo-AuNPs). Oligonucleotide 5'-SH-(A)(12)-AGACAAGAGAGG-3' (Oligo 1) modified AuNPs and oligonucleotide 5'-CAACAGAGAACG-(A)(12)-HS-3' (Oligo 2) modified AuNPs could hybridize with oligonulceotide 5'-CGTTCTCTGTTGCCTCTCTTGTCT-3' (Oligo 3), which resulted in the aggregation of Oligo-AuNPs probes, and triggered the increase of their average diameter. However, Oligo 3 could be cleaved into DNA fragments by the mixture of glucose, glucose oxidase (GOD) and Fe(2+), and the DNA fragments could not hybridize with Oligo-AuNPs probes. Under the conditions of 3.7 nM Oligo 1-AuNPs, 3.7 nM Oligo 2-AuNPs, 8.0 μg/mL GOD, 100 nM Oligo 3 and 900 nM Fe(2+), the average diameter of Oligo-AuNPs probes decreased linearly with the increasing concentration of glucose over the range from 50 pmol/L to 5.0 nmol/L, with a detection limit of 38 pmol/L (3σ/slope). Moreover, five sugars had no effect on the average diameter of mixture of Oligo-AuNPs probes, GOD and Fe(2+), which demonstrated the good selectivity of the assay. PMID:23084753

  6. Fluorescence detection of single-nucleotide polymorphism with single-strand triplex-forming DNA probes.

    PubMed

    Li, Xinpeng; Wang, Yuan; Guo, Jiajie; Tang, Xinjing

    2011-12-16

    Triple-helix-forming oligonucleotides (TFOs) are widespread in the genome and have been found in regulatory regions, especially in promoter zones and recombination hotspots of DNA. To specifically detect these polypurine sequences, we designed and synthesized two dual pyrene-labeled single-strand oligonucleotide probes (TFO-FPs) consisting of recognition, linker, and detection sequences. The hybridization processes of TFO-FPs with target polypurine oligonucleotides involve both Watson-Crick and Hoogsteen base-pairings. Through double sensing of oligonucleotide sequences, single mutations of target oligonucleotides are detected by monitoring changes in pyrene fluorescence. The high specificities of the probes are maintained over a wide temperature range without sacrifice of hybridization kinetics. PMID:22095630

  7. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  8. Bifunctional phosphoramidite reagents for the introduction of histidyl and dihistidyl residues into oligonucleotides.

    PubMed

    Smith, T H; LaTour, J V; Bochkariov, D; Chaga, G; Nelson, P S

    1999-01-01

    The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is described. Automated oligonucleotide synthesis utilizing a bifunctional reagent for the incorporation of a dihistidyl residue into oligonucleotides is described. Oligonucleotides incorporating one to three dihistidyl residues were prepared and characterized. The interaction of these oligonucleotides with a metal chelating IMAC matrix was explored. PMID:10411463

  9. Distance-Dependent Emission from Dye-Labeled Oligonucleotides on Striped Au/Ag Nanowires: Effect of Secondary Structure and Hybridization Efficiency

    PubMed Central

    Stoermer, Rebecca L.; Keating, Christine D.

    2010-01-01

    When fluorescently tagged oligonucleotides are located near metal surfaces, their emission intensity is impacted by both electromagnetic effects (i.e., quenching and/or enhancement of emission) and the structure of the nucleic acids (e.g., random coil, hairpin, or duplex). We present experiments exploring the effect of label position and secondary structure in oligonucleotide probes as a function of hybridization buffer, which impacts the percentage of double-stranded probes on the surface after exposure to complementary DNA. Nanowires containing identifiable patterns of Au and Ag segments were used as the metal substrates in this work, which enabled us to directly compare different dye positions in a single multiplexed experiment and differences in emission for probes attached to the two metals. The observed metal–dye separation dependence for unstructured surface-bound oligonucleotides is highly sensitive to hybridization efficiency, due to substantial changes in DNA extension from the surface upon hybridization. In contrast, fluorophore labeled oligonucleotides designed to form hairpin secondary structures analogous to solution-phase molecular beacon probes are relatively insensitive to hybridization efficiency, since the folded form is quenched and therefore does not appreciably impact the observed distance-dependence of the response. Differences in fluorescence patterning on Au and Ag were noted as a function of not only chromophore identity but also metal–dye separation. For example, emission intensity for TAMRA-labeled oligonucleotides changed from brighter on Ag for 24-base probes to brighter on Au for 48-base probes. We also observed fluorescence enhancement at the ends of nanowires and at surface defects where heightened electromagnetic fields affect the fluorescence. PMID:17017805

  10. Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ.

    PubMed

    Mignardi, Marco; Mezger, Anja; Qian, Xiaoyan; La Fleur, Linnea; Botling, Johan; Larsson, Chatarina; Nilsson, Mats

    2015-12-15

    In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) preserving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ. PMID:26240388

  11. Small molecule aptamer assays based on fluorescence anisotropy signal-enhancer oligonucleotides.

    PubMed

    Perrier, Sandrine; Bouilloud, Prisca; De Oliveira Coelho, Gisella; Henry, Mickael; Peyrin, Eric

    2016-08-15

    Herein, we design novel fluorescence anisotropy (FA) aptamer sensing platforms dedicated to small molecule detection. The assay strategy relied on enhanced fluctuations of segmental motion dynamics of the aptamer tracer mediated by an unlabelled, partially complementary oligonucleotide. The signal-enhancer oligonucleotide (SEO) essentially served as a free probe fraction revealer. By targeting specific regions of the signalling functional nucleic acid, the SEO binding to the unbound aptamer triggered perturbations of both the internal DNA flexibility and the localized dye environment upon the free probe to duplex structure transition. This potentiating effect determined increased FA variations between the duplex and target bound states of the aptameric probe. FA assay responses were obtained with both pre-structured (adenosine) and unstructured (tyrosinamide) aptamers and with dyes of different photochemical properties (fluorescein and texas red). The multiplexed analysis ability was further demonstrated through the simultaneous multicolour detection of the two small targets. The FA method appears to be especially simple, sensitive and widely applicable. PMID:27085946

  12. Optically Triggered Immune Response through Photocaged Oligonucleotides

    PubMed Central

    Govan, Jeane M.; Young, Douglas D.; Lively, Mark O.

    2015-01-01

    Bacterial and viral CpG oligonculeotides are unmethylated cytosine-phosphate-guanosine dinucleotide sequences and trigger an innate immune response through activation of the toll-like receptor 9 (TLR9). We have developed synthetic photocaged CpGs via site-specific incorporation of nitropiperonyloxymethyl (NPOM)-caged thymidine residues. These oligonucleotides enable the optical control of TLR9 function and thereby provide light-activation of an immune response. We provide a proof-of-concept model by applying a reporter assay in live cells and by quantification of endogenous production of interleukin 6. PMID:26034339

  13. Terahertz spectroscopy of oligonucleotides in aqueous solutions.

    PubMed

    Tang, Mingjie; Huang, Qing; Wei, Dongshan; Zhao, Guozhong; Chang, Tianying; Kou, Kuan; Wang, Min; Du, Chunlei; Fu, Wei-ling; Cui, Hong-Liang

    2015-01-01

    A terahertz (THz) spectroscopic study is carried out to analyze DNA mutations in a label-free manner. Three newly designed liquid sample cells are considered and the best is selected as the sample carrier for THz transmission spectroscopic analyses. Discrimination based on spectral signatures of single-base mutations on single-stranded 20 nt oligonucleotides has been shown possible experimentally. The results clearly attest the ability of this promising approach for label-free analyses of single-base mutations of DNA molecules. This study has demonstrated that the THz spectroscopic technology can be considered as a potential diagnostic tool for investigating molecular reactions, such as DNA mutations. PMID:26385423

  14. Oligonucleotide-based systems: DNA, microRNAs, DNA/RNA aptamers.

    PubMed

    Jolly, Pawan; Estrela, Pedro; Ladomery, Michael

    2016-06-30

    There are an increasing number of applications that have been developed for oligonucleotide-based biosensing systems in genetics and biomedicine. Oligonucleotide-based biosensors are those where the probe to capture the analyte is a strand of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or a synthetic analogue of naturally occurring nucleic acids. This review will shed light on various types of nucleic acids such as DNA and RNA (particularly microRNAs), their role and their application in biosensing. It will also cover DNA/RNA aptamers, which can be used as bioreceptors for a wide range of targets such as proteins, small molecules, bacteria and even cells. It will also highlight how the invention of synthetic oligonucleotides such as peptide nucleic acid (PNA) or locked nucleic acid (LNA) has pushed the limits of molecular biology and biosensor development to new perspectives. These technologies are very promising albeit still in need of development in order to bridge the gap between the laboratory-based status and the reality of biomedical applications. PMID:27365033

  15. Bisulfite oligonucleotide-capture sequencing for targeted base- and strand-specific absolute 5-methylcytosine quantitation.

    PubMed

    Masser, Dustin R; Stanford, David R; Hadad, Niran; Giles, Cory B; Wren, Jonathan D; Sonntag, William E; Richardson, Arlan; Freeman, Willard M

    2016-06-01

    Epigenetic regulation through DNA methylation (5mC) plays an important role in development, aging, and a variety of diseases. Genome-wide studies of base- and strand-specific 5mC are limited by the extensive sequencing required. Targeting bisulfite sequencing to specific genomic regions through sequence capture with complimentary oligonucleotide probes retains the advantages of bisulfite sequencing while focusing sequencing reads on regions of interest, enables analysis of more samples by decreasing the amount of sequence required per sample, and provides base- and strand-specific absolute quantitation of CG and non-CG methylation levels. As an example, an oligonucleotide capture set to interrogate 5mC levels in all rat RefSeq gene promoter regions (18,814) and CG islands, shores, and shelves (18,411) was generated. Validation using whole-genome methylation standards and biological samples demonstrates enrichment of the targeted regions and accurate base-specific quantitation of CG and non-CG methylation for both forward and reverse genomic strands. A total of 170 Mb of the rat genome is covered including 6.6 million CGs and over 67 million non-CG sites, while reducing the amount of sequencing required by ~85 % as compared to existing whole-genome sequencing methods. This oligonucleotide capture targeting approach and quantitative validation workflow can also be applied to any genome of interest. PMID:27091453

  16. Ultrasensitive Detection of Ebola Virus Oligonucleotide Based on Upconversion Nanoprobe/Nanoporous Membrane System.

    PubMed

    Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua

    2016-01-26

    Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application. PMID:26720408

  17. Monitoring of microenvironmental changes in the major and minor grooves of DNA by dan-modified oligonucleotides.

    PubMed

    Kimura, Takumi; Kawai, Kiyohiko; Majima, Tetsuro

    2005-12-22

    [graph: see text] We describe the synthesis of new environmentally sensitive fluorescence probes to elucidate DNA structures. DNA oligonucleotides containing fluorophore dan (6-(dimethylamino)-2-acylnaphthalene)-modified dC or dG were able to monitor the microenvironmental changes in both the major and minor grooves of DNA with a B- to A-DNA conformational transition and RNA hybridization. PMID:16354077

  18. High-throughput detection of food-borne pathogenic bacteria using oligonucleotide microarray with quantum dots as fluorescent labels.

    PubMed

    Huang, Aihua; Qiu, Zhigang; Jin, Min; Shen, Zhiqiang; Chen, Zhaoli; Wang, Xinwei; Li, Jun-Wen

    2014-08-18

    Bacterial pathogens are mostly responsible for food-borne diseases, and there is still substantial room for improvement in the effective detection of these organisms. In the present study, we explored a new method to detect target pathogens easily and rapidly with high sensitivity and specificity. This method uses an oligonucleotide microarray combined with quantum dots as fluorescent labels. Oligonucleotide probes targeting the 16SrRNA gene were synthesized to create an oligonucleotide microarray. The PCR products labeled with biotin were subsequently hybridized using an oligonucleotide microarray. Following incubation with CdSe/ZnS quantum dots coated with streptavidin, fluorescent signals were detected with a PerkinElmer Gx Microarray Scanner. The results clearly showed specific hybridization profiles corresponding to the bacterial species assessed. Two hundred and sixteen strains of food-borne bacterial pathogens, including standard strains and isolated strains from food samples, were used to test the specificity, stability, and sensitivity of the microarray system. We found that the oligonucleotide microarray combined with quantum dots used as fluorescent labels can successfully discriminate the bacterial organisms at the genera or species level, with high specificity and stability as well as a sensitivity of 10 colony forming units (CFU)/mL of pure culture. We further tested 105 mock-contaminated food samples and achieved consistent results as those obtained from traditional biochemical methods. Together, these results indicate that the quantum dot-based oligonucleotide microarray has the potential to be a powerful tool in the detection and identification of pathogenic bacteria in foods. PMID:24927399

  19. Approaches for the detection of harmful algal blooms using oligonucleotide interactions.

    PubMed

    Bruce, Karen L; Leterme, Sophie C; Ellis, Amanda V; Lenehan, Claire E

    2015-01-01

    Blooms of microscopic algae in our waterways are becoming an increasingly important environmental concern. Many are sources of harmful biotoxins that can lead to death in humans, marine life and birds. Additionally, their biomass can cause damage to ecosystems such as oxygen depletion, displacement of species and habitat alteration. Globally, the number and frequency of harmful algal blooms has increased over the last few decades, and monitoring and detection strategies have become essential for managing these events. This review discusses developments in the use of oligonucleotide-based 'molecular probes' for the selective monitoring of algal cell numbers. Specifically, hybridisation techniques will be a focus. PMID:25381608

  20. A novel multifunctional oligonucleotide microarray for Toxoplasma gondii

    PubMed Central

    2010-01-01

    Background Microarrays are invaluable tools for genome interrogation, SNP detection, and expression analysis, among other applications. Such broad capabilities would be of value to many pathogen research communities, although the development and use of genome-scale microarrays is often a costly undertaking. Therefore, effective methods for reducing unnecessary probes while maintaining or expanding functionality would be relevant to many investigators. Results Taking advantage of available genome sequences and annotation for Toxoplasma gondii (a pathogenic parasite responsible for illness in immunocompromised individuals) and Plasmodium falciparum (a related parasite responsible for severe human malaria), we designed a single oligonucleotide microarray capable of supporting a wide range of applications at relatively low cost, including genome-wide expression profiling for Toxoplasma, and single-nucleotide polymorphism (SNP)-based genotyping of both T. gondii and P. falciparum. Expression profiling of the three clonotypic lineages dominating T. gondii populations in North America and Europe provides a first comprehensive view of the parasite transcriptome, revealing that ~49% of all annotated genes are expressed in parasite tachyzoites (the acutely lytic stage responsible for pathogenesis) and 26% of genes are differentially expressed among strains. A novel design utilizing few probes provided high confidence genotyping, used here to resolve recombination points in the clonal progeny of sexual crosses. Recent sequencing of additional T. gondii isolates identifies >620 K new SNPs, including ~11 K that intersect with expression profiling probes, yielding additional markers for genotyping studies, and further validating the utility of a combined expression profiling/genotyping array design. Additional applications facilitating SNP and transcript discovery, alternative statistical methods for quantifying gene expression, etc. are also pursued at pilot scale to inform

  1. Bioconjugation of oligonucleotides for treating liver fibrosis.

    PubMed

    Ye, Zhaoyang; Houssein, Houssam S Hajj; Mahato, Ram I

    2007-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is urgently needed to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remain the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of alpha1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in-depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  2. BIOCONJUGATION OF OLIGONUCLEOTIDES FOR TREATING LIVER FIBROSIS

    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.

    2009-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  3. An imputation approach for oligonucleotide microarrays.

    PubMed

    Li, Ming; Wen, Yalu; Lu, Qing; Fu, Wenjiang J

    2013-01-01

    Oligonucleotide microarrays are commonly adopted for detecting and qualifying the abundance of molecules in biological samples. Analysis of microarray data starts with recording and interpreting hybridization signals from CEL images. However, many CEL images may be blemished by noises from various sources, observed as "bright spots", "dark clouds", and "shadowy circles", etc. It is crucial that these image defects are correctly identified and properly processed. Existing approaches mainly focus on detecting defect areas and removing affected intensities. In this article, we propose to use a mixed effect model for imputing the affected intensities. The proposed imputation procedure is a single-array-based approach which does not require any biological replicate or between-array normalization. We further examine its performance by using Affymetrix high-density SNP arrays. The results show that this imputation procedure significantly reduces genotyping error rates. We also discuss the necessary adjustments for its potential extension to other oligonucleotide microarrays, such as gene expression profiling. The R source code for the implementation of approach is freely available upon request. PMID:23505547

  4. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  5. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  6. Uptake and antifungal activity of oligonucleotides in Candida albicans

    PubMed Central

    Disney, Matthew D.; Haidaris, Constantine G.; Turner, Douglas H.

    2003-01-01

    Candida albicans is a significant cause of disease in immunocompromised humans. Because the number of people infected by fungal pathogens is increasing, strategies are being developed to target RNAs in fungi. This work shows that oligonucleotides can serve as therapeutics against C. albicans. In particular, oligonucleotides are taken up from cell culture medium in an energy-dependent process. After uptake, oligonucleotides, including RNA, remain mostly intact after 12 h in culture. For culture conditions designed for mammalian cells, intracellular concentrations of oligonucleotides in C. albicans exceed those in COS-7 mammalian cells, suggesting that uptake can provide selective targeting of fungi over human cells. A 19-mer 2′OMe (oligonucleotide with a 2′-O-methyl backbone) hairpin is described that inhibits growth of a C. albicans strain at pH < 4.0. This pH is easily tolerated in some parts of the body subject to C. albicans infections. In vivo dimethyl sulfate modification of ribosomal RNA and the decreased rate of protein synthesis suggest that this hairpin's activity may be due to targeting the ribosome in a way that does not depend on base pairing. Addition of anti-C. albicans oligonucleotides to COS-7 mammalian cells has no effect on cell growth. Evidently, oligonucleotides can selectively serve as therapeutics toward C. albicans and, presumably, other pathogens. Information from genome sequencing and functional genomics studies on C. albicans and other pathogens should allow rapid design and testing of other approaches for oligonucleotide therapies. PMID:12552085

  7. Disulfide-linked oligonucleotide phosphorothioates - Novel analogues of nucleic acids

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1991-01-01

    The synthesis of phosphorothioate analogs of oligonucleotides by the oxidation of deoxyadenosine 3',5'-bisphosphorothioate (3) was attempted. Cyclization of 3 is much more efficient than oligomerization under all the conditions investigated. However, a preformed oligonucleotide carrying a 5'-terminal phosphorotioate group undergoes efficient chain-extension when oxidized in the presence of 3.

  8. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  9. Phosphoramidate Ligation of Oligonucleotides in Nanoscale Structures.

    PubMed

    Kalinowski, Matthäus; Haug, Rüdiger; Said, Hassan; Piasecka, Sylwia; Kramer, Markus; Richert, Clemens

    2016-06-16

    The folding of long DNA strands into designed nanostructures has evolved into an art. Being based on linear chains only, the resulting nanostructures cannot readily be transformed into covalently linked frameworks. Covalently linking strands in the context of folded DNA structures requires a robust method that avoids sterically demanding reagents or enzymes. Here we report chemical ligation of the 3'-amino termini of oligonucleotides and 5'-phosphorylated partner strands in templated reactions that produce phosphoramidate linkages. These reactions produce inter-nucleotide linkages that are isoelectronic and largely isosteric to phosphodiesters. Ligations were performed at three levels of complexity, including the extension of branched DNA hybrids and the ligation of six scaffold strands in a small origami. PMID:27225865

  10. MALDI analysis of oligonucleotides directly from montmorillonite.

    PubMed

    Zagorevskii, Dmitri V; Aldersley, Michael F; Ferris, James P

    2006-09-01

    Oligonucleotides synthesized on a montmorillonite catalyst were analyzed directly. By mixing the catalyst with a matrix (2,4,6-trihydroxyacetophenone or 6-aza-2-thiothymine) and dibasic ammonium citrate, higher molecular weight products were detected compared with "classical" methods such as gel electrophoresis and HPLC with UV as a detector. The oligomers (30-mers and higher) were detected by mass spectrometry even though their concentration was less than 10(-4)% of the total content of the RNA. This method is different from the (MALDI) analysis of the eluates from montmorillonite, which otherwise requires desalting. Placing reaction mixtures with a high concentration of buffers on homoionic, preferably Li-containing, montmorillonite does not require desalting. PMID:16809045

  11. Use of nanoparticles to deliver immunomodulatory oligonucleotides.

    PubMed

    Klinman, Dennis M; Sato, Takashi; Shimosato, Takeshi

    2016-07-01

    Synthetic oligonucleotides (ODNs) containing unmethylated 'CpG motifs' stimulate the innate immune system to produce cytokines, chemokines, and polyreactive antibodies. CpG ODNs have shown promise as vaccine adjuvants and for the treatment of infectious diseases and cancer. The immunostimulatory activity of CpG ODNs is inhibited by DNA-containing 'suppressive' motifs. ODNs expressing suppressive motifs (Sup ODNs) reduce ongoing immune reactions and show promise in the treatment of autoimmune and inflammatory diseases. This work reviews recent progress in the use of nanoparticles as carriers of CpG and Sup ODNs to target their delivery to the GI tract and lungs. WIREs Nanomed Nanobiotechnol 2016, 8:631-637. doi: 10.1002/wnan.1382 For further resources related to this article, please visit the WIREs website. PMID:26663867

  12. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    PubMed

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity. PMID:24557899

  13. DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme.

    PubMed

    Camden, Alison J; Walsh, Shannon M; Suk, Sarah H; Silverman, Scott K

    2016-05-10

    T4 polynucleotide kinase is widely used for 5'-phosphorylation of DNA and RNA oligonucleotide termini, but no natural protein enzyme is capable of 3'-phosphorylation. Here, we report the in vitro selection of deoxyribozymes (DNA enzymes) capable of DNA oligonucleotide 3'-phosphorylation, using a 5'-triphosphorylated RNA transcript (pppRNA) as the phosphoryl donor. The basis of selection was the capture, during each selection round, of the 3'-phosphorylated DNA substrate terminus by 2-methylimidazole activation of the 3'-phosphate (forming 3'-MeImp) and subsequent splint ligation with a 5'-amino DNA oligonucleotide. Competing and precedented DNA-catalyzed reactions were DNA phosphodiester hydrolysis or deglycosylation, each also leading to a 3'-phosphate but at a different nucleotide position within the DNA substrate. One oligonucleotide 3'-kinase deoxyribozyme, obtained from an N40 random pool and named 3'Kin1, can 3'-phosphorylate nearly any DNA oligonucleotide substrate for which the 3'-terminus has the sequence motif 5'-NKR-3', where N denotes any oligonucleotide sequence, K = T or G, and R = A or G. These results establish the viabilty of in vitro selection for identifying DNA enzymes that 3'-phosphorylate DNA oligonucleotides. PMID:27063020

  14. The frequency of oligonucleotides in mammalian genic regions.

    PubMed

    Volinia, S; Gambari, R; Bernardi, F; Barrai, I

    1989-02-01

    The large body of nucleic acid sequence data now available offers a unique opportunity for the characterization of individual oligonucleotides which may be specific to sequence functional domains. We have prepared algorithms for the study of the frequency distribution of all oligonucleotides of length 2-6 in DNA sequences. We have implemented them in the study of 634 mammalian DNA sequences spanning 1.782 Mb, and have obtained the distribution of the ratio between the observed frequency of oligonucleotides and their expected frequency based on independent nucleotide probabilities. We then studied the distribution of oligonucleotides (or k-tuples) of each length in a subset of 129 complete mammalian genes spanning 0.607 Mb. Eight distinct genomic regions, namely 5'-non-transcribed, first exon, first intron, intermediate exons, intermediate introns, last intron, last exon and 3'-non-transcribed, were considered. We observed that some oligonucleotides show a statistical behaviour and a regional distribution similar to that of known signal sequences. Moreover the frequency distribution of oligonucleotides of length 5 and 6 tends to become bimodal, indicating the existence of a population of very frequent oligonucleotides. PMID:2924169

  15. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides.

    PubMed

    Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-10-30

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca(2+) enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ~100 nm in size are found in Ca(2+)-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  16. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides

    PubMed Central

    Hori, Shin-ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-01-01

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca2+ enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ∼100 nm in size are found in Ca2+-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  17. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  18. Antisense oligonucleotide induction of progerin in human myogenic cells.

    PubMed

    Luo, Yue-Bei; Mitrpant, Chalermchai; Adams, Abbie M; Johnsen, Russell D; Fletcher, Sue; Mastaglia, Frank L; Wilton, Steve D

    2014-01-01

    We sought to use splice-switching antisense oligonucleotides to produce a model of accelerated ageing by enhancing expression of progerin, translated from a mis-spliced lamin A gene (LMNA) transcript in human myogenic cells. The progerin transcript (LMNA Δ150) lacks the last 150 bases of exon 11, and is translated into a truncated protein associated with the severe premature ageing disease, Hutchinson-Gilford progeria syndrome (HGPS). HGPS arises from de novo mutations that activate a cryptic splice site in exon 11 of LMNA and result in progerin accumulation in tissues of mesodermal origin. Progerin has also been proposed to play a role in the 'natural' ageing process in tissues. We sought to test this hypothesis by producing a model of accelerated muscle ageing in human myogenic cells. A panel of splice-switching antisense oligonucleotides were designed to anneal across exon 11 of the LMNA pre-mRNA, and these compounds were transfected into primary human myogenic cells. RT-PCR showed that the majority of oligonucleotides were able to modify LMNA transcript processing. Oligonucleotides that annealed within the 150 base region of exon 11 that is missing in the progerin transcript, as well as those that targeted the normal exon 11 donor site induced the LMNA Δ150 transcript, but most oligonucleotides also generated variable levels of LMNA transcript missing the entire exon 11. Upon evaluation of different oligomer chemistries, the morpholino phosphorodiamidate oligonucleotides were found to be more efficient than the equivalent sequences prepared as oligonucleotides with 2'-O-methyl modified bases on a phosphorothioate backbone. The morpholino oligonucleotides induced nuclear localised progerin, demonstrated by immunostaining, and morphological nuclear changes typical of HGPS cells. We show that it is possible to induce progerin expression in myogenic cells using splice-switching oligonucleotides to redirect splicing of LMNA. This may offer a model to investigate

  19. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  20. Probe assembly

    SciTech Connect

    Avera, C.J.

    1981-01-06

    A hand-held probe assembly, suitable for monitoring a radioactive fibrinogen tracer, is disclosed comprising a substantially cylindrically shaped probe handle having an open end. The probe handle is adapted to be interconnected with electrical circuitry for monitoring radioactivity that is sensed or detected by the probe assembly. Mounted within the probe handle is a probe body assembly that includes a cylindrically shaped probe body inserted through the open end of the probe handle. The probe body includes a photomultiplier tube that is electrically connected with a male connector positioned at the rearward end of the probe body. Mounted at the opposite end of the probe body is a probe head which supports an optical coupler therewithin. The probe head is interconnected with a probe cap which supports a detecting crystal. The probe body assembly, which consists of the probe body, the probe head, and the probe cap is supported within the probe handle by means of a pair of compressible o-rings which permit the probe assembly to be freely rotatable, preferably through 360*, within the probe handle and removable therefrom without requiring any disassembly.

  1. Polyphosphorylation and non-enzymatic template-directed ligation of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Oligonucleotide 5'-polyphosphates are formed under potentially prebiotic conditions from oligonucleotide 5'-phosphates and sodium trimetaphosphate. Oligonucleotides activated as polyphosphates undergo template-directed ligation. We believe that these reactions could have produced longer oligonucleotide products from shorter substrates under prebiotic conditions.

  2. Traceback identification of plant components in commercial compound feed through an oligonucleotide microarray based on tubulin intron polymorphism.

    PubMed

    Ponzoni, Elena; Morello, Laura; Gianì, Silvia; Breviario, Diego

    2014-11-01

    According to EU Regulations, all components of commercial compound feed need to be declared on the label. Effective protection against fraud requires severe controls based on accurate analytical methods to ascertain what is declared by the producers. The aim of this work was to develop an oligonucleotide microarray for the molecular recognition of multiple plant components in commercial feeds. We tested the potential of the highly polymorphic first intron sequences from members of the plant β-tubulin gene family as a target for plant DNA identification. 23 oligonucleotide capture probes, targeting species-specific intron sequences, were assembled within a low density microarray for the identification of 10 plant species, selected from among those most commonly used in cattle feed formulation. The ability of the array to detect specific components in complex flour blends and in compound feed was evaluated. PMID:24874359

  3. Molecular Selection, Modification and Development of Therapeutic Oligonucleotide Aptamers

    PubMed Central

    Yu, Yuanyuan; Liang, Chao; Lv, Quanxia; Li, Defang; Xu, Xuegong; Liu, Baoqin; Lu, Aiping; Zhang, Ge

    2016-01-01

    Monoclonal antibodies are the dominant agents used in inhibition of biological target molecules for disease therapeutics, but there are concerns of immunogenicity, production, cost and stability. Oligonucleotide aptamers have comparable affinity and specificity to targets with monoclonal antibodies whilst they have minimal immunogenicity, high production, low cost and high stability, thus are promising inhibitors to rival antibodies for disease therapy. In this review, we will compare the detailed advantages and disadvantages of antibodies and aptamers in therapeutic applications and summarize recent progress in aptamer selection and modification approaches. We will present therapeutic oligonucleotide aptamers in preclinical studies for skeletal diseases and further discuss oligonucleotide aptamers in different stages of clinical evaluation for various disease therapies including macular degeneration, cancer, inflammation and coagulation to highlight the bright commercial future and potential challenges of therapeutic oligonucleotide aptamers. PMID:26978355

  4. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  5. Sequence-dependent theory of oligonucleotide hybridization kinetics

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail: rajc@andrew.cmu.edu

    2014-05-07

    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions.

  6. Micro- and nano-structure based oligonucleotide sensors.

    PubMed

    Ferrier, David C; Shaver, Michael P; Hands, Philip J W

    2015-06-15

    This paper presents a review of micro- and nano-structure based oligonucleotide detection and quantification techniques. The characteristics of such devices make them very attractive for Point-of-Care or On-Site-Testing biosensing applications. Their small scale means that they can be robust and portable, their compatibility with modern CMOS electronics means that they can easily be incorporated into hand-held devices and their suitability for mass production means that, out of the different approaches to oligonucleotide detection, they are the most suitable for commercialisation. This review discusses the advantages of micro- and nano-structure based sensors and covers the various oligonucleotide detection techniques that have been developed to date. These include: Bulk Acoustic Wave and Surface Acoustic Wave devices, micro- and nano-cantilever sensors, gene Field Effect Transistors, and nanowire and nanopore based sensors. Oligonucleotide immobilisation techniques are also discussed. PMID:25655465

  7. Highly parallel oligonucleotide purification and functionalization using reversible chemistry

    PubMed Central

    York, Kerri T.; Smith, Ryan C.; Yang, Rob; Melnyk, Peter C.; Wiley, Melissa M.; Turk, Casey M.; Ronaghi, Mostafa; Gunderson, Kevin L.; Steemers, Frank J.

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5′-labeled oligonucleotides. The approach is based on 5′-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5′-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90–99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  8. Highly parallel oligonucleotide purification and functionalization using reversible chemistry.

    PubMed

    York, Kerri T; Smith, Ryan C; Yang, Rob; Melnyk, Peter C; Wiley, Melissa M; Turk, Casey M; Ronaghi, Mostafa; Gunderson, Kevin L; Steemers, Frank J

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5'-labeled oligonucleotides. The approach is based on 5'-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5'-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90-99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  9. Oligonucleotide-based theranostic nanoparticles in cancer therapy.

    PubMed

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-05-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  10. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  11. Mechanosensitive membrane probes.

    PubMed

    Dal Molin, Marta; Verolet, Quentin; Soleimanpour, Saeideh; Matile, Stefan

    2015-04-13

    This article assembles pertinent insights behind the concept of planarizable push-pull probes. As a response to the planarization of their polarized ground state, a red shift of their excitation maximum is expected to report on either the disorder, the tension, or the potential of biomembranes. The combination of chromophore planarization and polarization contributes to various, usually more complex processes in nature. Examples include the color change of crabs or lobsters during cooking or the chemistry of vision, particularly color vision. The summary of lessons from nature is followed by an overview of mechanosensitive organic materials. Although often twisted and sometimes also polarized, their change of color under pressure usually originates from changes in their crystal packing. Intriguing exceptions include the planarization of several elegantly twisted phenylethynyl oligomers and polymers. Also mechanosensitive probes in plastics usually respond to stretching by disassembly. True ground-state planarization in response to molecular recognition is best exemplified with the binding of thoughtfully twisted cationic polythiophenes to single- and double-stranded oligonucleotides. Molecular rotors, en vogue as viscosity sensors in cells, operate by deplanarization of the first excited state. Pertinent recent examples are described, focusing on λ-ratiometry and intracellular targeting. Complementary to planarization of the ground state with twisted push-pull probes, molecular rotors report on environmental changes with quenching or shifts in emission rather than absorption. The labeling of mechanosensitive channels is discussed as a bioengineering approach to bypass the challenge to create molecular mechanosensitivity and use biological systems instead to sense membrane tension. With planarizable push-pull probes, this challenge is met not with twistome screening, but with "fluorescent flippers," a new concept to insert large and bright monomers into oligomeric

  12. Fluorescent probes for G-quadruplex structures.

    PubMed

    Vummidi, Balayeshwanth R; Alzeer, Jawad; Luedtke, Nathan W

    2013-03-18

    Mounting evidence supports the presence of biologically relevant G-quadruplexes in single-cell organisms, but the existence of endogenous G-quadruplex structures in mammalian cells remains highly controversial. This is due, in part, to the common misconception that DNA and RNA molecules are passive information carriers with relatively little structural or functional complexity. For those working in the field, however, the lack of available tools for characterizing DNA structures in vivo remains a major limitation to addressing fundamental questions about structure-function relationships of nucleic acids. In this review, we present progress towards the direct detection of G-quadruplex structures by using small molecules and modified oligonucleotides as fluorescent probes. While most development has focused on cell-permeable probes that selectively bind to G-quadruplex structures with high affinity, these same probes can induce G-quadruplex folding, thereby making the native conformation of the DNA or RNA molecule (i.e., in the absence of probe) uncertain. For this reason, modified oligonucleotides and fluorescent base analogues that serve as "internal" fluorescent probes are presented as an orthogonal means for detecting conformational changes, without necessarily perturbing the equilibria between G-quadruplex, single-stranded, and duplex DNA. The major challenges and motivation for the development of fluorescent probes for G-quadruplex structures are presented, along with a summary of the key photophysical, biophysical, and biological properties of reported examples. PMID:23440895

  13. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.

    PubMed

    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M

    2016-10-01

    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications. PMID:27521696

  14. Oligonucleotide and Long Polymeric DNA Encoding

    SciTech Connect

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  15. Oligonucleotide Therapies: The Past and the Present

    PubMed Central

    Lundin, Karin E.; Gissberg, Olof; Smith, C.I. Edvard

    2015-01-01

    In this review we address the development of oligonucleotide (ON) medicines from a historical perspective by listing the landmark discoveries in this field. The various biological processes that have been targeted and the corresponding ON interventions found in the literature are discussed together with brief updates on some of the more recent developments. Most ON therapies act through antisense mechanisms and are directed against various RNA species, as exemplified by gapmers, steric block ONs, antagomirs, small interfering RNAs (siRNAs), micro-RNA mimics, and splice switching ONs. However, ONs binding to Toll-like receptors and those forming aptamers have completely different modes of action. Similar to other novel medicines, the path to success has been lined with numerous failures, where different therapeutic ONs did not stand the test of time. Since the first ON drug was approved for clinical use in 1998, the therapeutic landscape has changed considerably, but many challenges remain until the expectations for this new form of medicine are met. However, there is room for cautious optimism. PMID:26160334

  16. Antisense Oligonucleotide Therapy for Inherited Retinal Dystrophies.

    PubMed

    Gerard, Xavier; Garanto, Alejandro; Rozet, Jean-Michel; Collin, Rob W J

    2016-01-01

    Inherited retinal dystrophies (IRDs) are an extremely heterogeneous group of genetic diseases for which currently no effective treatment strategies exist. Over the last decade, significant progress has been made utilizing gene augmentation therapy for a few genetic subtypes of IRD, although several technical challenges so far prevent a broad clinical application of this approach for other forms of IRD. Many of the mutations leading to these retinal diseases affect pre-mRNA splicing of the mutated genes . Antisense oligonucleotide (AON)-mediated splice modulation appears to be a powerful approach to correct the consequences of such mutations at the pre-mRNA level , as demonstrated by promising results in clinical trials for several inherited disorders like Duchenne muscular dystrophy, hypercholesterolemia and various types of cancer. In this mini-review, we summarize ongoing pre-clinical research on AON-based therapy for a few genetic subtypes of IRD , speculate on other potential therapeutic targets, and discuss the opportunities and challenges that lie ahead to translate splice modulation therapy for retinal disorders to the clinic. PMID:26427454

  17. Photophysical deactivation pathways in adenine oligonucleotides.

    PubMed

    Spata, Vincent A; Matsika, Spiridoula

    2015-12-14

    In this work we study deactivation processes in adenine oligomers after absorption of UV radiation using Quantum Mechanics combined with Molecular Mechanics (QM/MM). Correlated electronic structure methods appropriate for describing the excited states are used to describe a π-stacked dimer of adenine bases incorporated into (dA)20(dT)20. The results of these calculations reveal three different types of excited state minima which play a role in deactivation processes. Within this set of minima there are minima where the excited state is localized on one adenine (monomer-like) as well as minima where the excited state is delocalized on two adenines, forming different types of excimers and bonded excimers of varying but inter-related character. The proximity of their energies reveals that the minima can decay into one another along a flat potential energy surface dependent on the interbase separation. Additionally, analysis of the emissive energies and other physical properties, including theoretical anisotropy calculations, and comparison with fluorescence experiments, provides evidence that excimers play an important role in long-lived signals in adenine oligonucleotides while the subpicosecond decay is attributed to monomer-like minima. The necessity for a close approach of the nucleobases reveals that the deactivation mechanism is tied to macro-molecular motion. PMID:26536353

  18. Development of Therapeutic Splice-Switching Oligonucleotides

    PubMed Central

    Kryczka, Adrianna; Liu, Yuqi; Badi, Yusef E.; Wong, Jessie J.; Owen, James S.; Khoo, Bernard

    2014-01-01

    Abstract Synthetic splice-switching oligonucleotides (SSOs) target nuclear pre-mRNA molecules to change exon splicing and generate an alternative protein isoform. Clinical trials with two competitive SSO drugs are underway to treat Duchenne muscular dystrophy (DMD). Beyond DMD, many additional therapeutic applications are possible, with some in phase 1 clinical trials or advanced preclinical evaluation. Here, we present an overview of the central factors involved in developing therapeutic SSOs for the treatment of diseases. The selection of susceptible pre-mRNA target sequences, as well as the design and chemical modification of SSOs to increase SSO stability and effectiveness, are key initial considerations. Identification of effective SSO target sequences is still largely empirical and published guidelines are not a universal guarantee for success. Specifically, exon-targeted SSOs, which are successful in modifying dystrophin splicing, can be ineffective for splice-switching in other contexts. Chemical modifications, importantly, are associated with certain characteristic toxicities, which need to be addressed as target diseases require chronic treatment with SSOs. Moreover, SSO delivery in adequate quantities to the nucleus of target cells without toxicity can prove difficult. Last, the means by which these SSOs are administered needs to be acceptable to the patient. Engineering an efficient therapeutic SSO, therefore, necessarily entails a compromise between desirable qualities and effectiveness. Here, we describe how the application of optimal solutions may differ from case to case. PMID:24826963

  19. Optimizing antisense oligonucleotides using phosphorodiamidate morpholino oligomers.

    PubMed

    Popplewell, Linda J; Malerba, Alberto; Dickson, George

    2012-01-01

    Duchenne muscular dystrophy (DMD) is caused by mutations that disrupt the reading frame of the human DMD gene. Selective removal of exons flanking an out-of-frame DMD mutation can result in an in-frame mRNA transcript that may be translated into an internally deleted Becker muscular dystrophy-like functionally active dystrophin protein with therapeutic activity. Antisense oligonucleotides (AOs) can be designed to bind to complementary sequences in the targeted mRNA and modify pre-mRNA splicing to correct the reading frame of a mutated transcript. AO-induced exon skipping resulting in functional truncated dystrophin has been demonstrated in animal models of DMD both in vitro and in vivo, in DMD patient cells in vitro in culture, and in DMD muscle explants. The recent advances made in this field suggest that it is likely that AO-induced exon skipping will be the first gene therapy for DMD to reach the clinic. However, it should be noted that personalized molecular medicine may be necessary, since the various reading frame-disrupting mutations are spread across the DMD gene. The different deletions that cause DMD would require skipping of different exons, which would require the optimization and clinical trial workup of many specific AOs. This chapter describes the methodologies available for the optimization of AOs, in particular phosphorodiamidate morpholino oligomers, for the targeted skipping of specific exons on the DMD gene. PMID:22454060

  20. Sequence of a DNA probe specific for Anopheles quadrimaculatus species A (Diptera: Culicidae).

    PubMed

    Johnson, D W; Cockburn, A F; Seawright, J A

    1993-09-01

    The nucleotide sequence was determined for a portion of a 12-kb genomic DNA clone specific for Anopheles quadrimaculatus species A. Four short, internally repeated sequences were identified. Synthetic oligonucleotide probes were prepared based on these four repeats. The oligonucleotides are highly specific and can be reliably used to separate individuals of An. quadrimaculatus species A from members of other species of the complex. PMID:8254645

  1. Simplified Paper Format for Detecting HIV Drug Resistance in Clinical Specimens by Oligonucleotide Ligation

    PubMed Central

    Panpradist, Nuttada; Beck, Ingrid A.; Chung, Michael H.; Kiarie, James N.; Frenkel, Lisa M.; Lutz, Barry R.

    2016-01-01

    Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207

  2. Simplified Paper Format for Detecting HIV Drug Resistance in Clinical Specimens by Oligonucleotide Ligation.

    PubMed

    Panpradist, Nuttada; Beck, Ingrid A; Chung, Michael H; Kiarie, James N; Frenkel, Lisa M; Lutz, Barry R

    2016-01-01

    Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207

  3. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  4. Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.

    PubMed

    Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V

    2014-10-01

    Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. PMID:25087479

  5. Injection site reactions after subcutaneous oligonucleotide therapy.

    PubMed

    van Meer, Leonie; Moerland, Matthijs; Gallagher, Jolie; van Doorn, Martijn B A; Prens, Errol P; Cohen, Adam F; Rissmann, Robert; Burggraaf, Jacobus

    2016-08-01

    Oligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including more severe manifestations such as ulceration or necrosis. These injection site reactions (ISRs) are common, but rather poorly described in the literature. With this review, we aim to provide an overview on the extent of the problem of ISRs, based on reported incidence. A structured literature search was performed to identify reported incidence and clinical features of ISRs which yielded 70 manuscripts that contained information regarding ISRs. The data from literature was combined with data on file available at our institution. All sc administered ONs described in the literature lead to the occurrence of ISRs. The percentage of trial subjects that developed ISRs ranged from 22 to 100% depending on ON. The majority of ONs caused ISRs in more than 70% of the trial subjects. The severity of the observed reactions varied between different ONs. Occurrence rate as well as severity of ISRs increases with higher doses. For chemistry and target of the compounds, no clear association regarding ISR incidence or severity was identified. All ONs developed to date are associated with ISRs. Overcoming the problem of ISRs might add greatly to the potential success of sc-administered ONs. Knowledge of these skin reactions and their specific immunostimulatory properties should be increased in order to obtain ONs that are more suitable for long-term use and clinically applicable in a broader patient population. PMID:27061947

  6. Mechanism of oligonucleotide release from cationic liposomes.

    PubMed Central

    Zelphati, O; Szoka, F C

    1996-01-01

    We propose a mechanism for oligonucleotide (ODN) release from cationic lipid complexes in cells that accounts for various observations on cationic lipid-nucleic acid-cell interactions. Fluorescent confocal microscopy of cells treated with rhodamine-labeled cationic liposome/ fluorescein-labeled ODN (F-ODN) complexes show the F-ODN separates from the lipid after internalization and enters the nucleus leaving the fluorescent lipid in cytoplasmic structures. ODN displacement from the complex was studied by fluorescent resonance energy transfer. Anionic liposome compositions (e.g., phosphatidylserine) that mimic the cytoplasmic facing monolayer of the cell membrane released ODN from the complex at about a 1:1 (-/+) charge ratio. Release was independent of ionic strength and pH. Physical separation of the F-ODN from monovalent and multivalent cationic lipids was confirmed by gel electrophoresis. Fluid but not solid phase anionic liposomes are required, whereas the physical state of the cationic lipids does not effect the release. Water soluble molecules with a high negative linear charge density, dextran sulfate, or heparin also release ODN. However, ATP, spermidine, spermine, tRNA, DNA, polyglutamic acid, polylysine, bovine serum albumin, or histone did not release ODN, even at 100-fold charge excess (-/+). Based upon these results, we propose that the complex, after internalization by endocytosis, induces flip-flop of anionic lipids from the cytoplasmic facing monolayer. Anionic lipids laterally diffuse into the complex and form a charged neutralized ion-pair with the cationic lipids. This leads to displacement of the ODN from the cationic lipid and its release into the cytoplasm. Images Fig. 1 Fig. 3 PMID:8876163

  7. Detection of adenosine 5'-triphosphate by fluorescence variation of oligonucleotide-templated silver nanoclusters.

    PubMed

    Lee, Jennifer Daneen; Cang, Jinshun; Chen, Ying-Chieh; Chen, Wei-Yu; Ou, Chung-Mao; Chang, Huan-Tsung

    2014-08-15

    Oligonucleotide-templated Ag nanoclusters (DNA-Ag NCs) prepared from AgNO3 using an oligonucleotide (5'-TAACCCCTAACCCCT-3') as a template and NaBH4 as a reducing agent have been used for sensing of adenosine 5'-triphosphate (ATP). The fluorescence intensity and emission wavelength of DNA-Ag NCs are dependent on the pH value and ATP concentration. At pH 3.0 and 11.0, ATP shows greater effects on fluorescence of the DNA-Ag NCs. Upon increasing ATP concentration from 10 to 50μM, their emission wavelength at pH 3.0 shifts from 525 to 585nm. At pH 11.0, their fluorescence intensity (510nm) increases upon increasing ATP concentration. The circular dichroism (CD), electrospray ionization-mass spectrometry (ESI-MS), absorption, and fluorescence results indicate that ATP and pH affect the interactions between DNAs and Ag atoms, resulting in changes in their fluorescence. The DNA-Ag NCs allow detection of ATP over a concentration range of 0.1-10μM, with a limit of detection 33nM. Practicality of the DNA-Ag NCs probe has been validated with the determination of ATP concentrations in the lysate of MDA-MB-231 breast carcinoma cells. PMID:24657647

  8. Strand-Specificity in the Transformation of Yeast with Synthetic Oligonucleotides

    PubMed Central

    Yamamoto, T.; Moerschell, R. P.; Wakem, L. P.; Komar-Panicucci, S.; Sherman, F.

    1992-01-01

    Cyc1 mutants of the yeast Saccharomyces cerevisiae were directly transformed with both sense and antisense oligonucleotides to examine the involvement of the two genomic DNA strands in transformation. Sense oligonucleotides yielded approximately 20-fold more transformants than antisense oligonucleotides. This differential effect was observed with oligonucleotides designed to make alterations at six different sites along the gene and was independent of the oligonucleotide sequence and length, number of mismatches and the host strain. Competition studies showed that antisense oligonucleotides did not inhibit transformation. Although the mechanism for this strand specificity is unknown, this difference was maintained even when CYC1 transcription was diminished to approximately 2% of the normal level. PMID:1325385

  9. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  10. Stability measurements of antisense oligonucleotides by capillary gel electrophoresis.

    PubMed

    Bruin, G J; Börnsen, K O; Hüsken, D; Gassmann, E; Widmer, H M; Paulus, A

    1995-08-11

    The approach of using antisense oligonucleotides as potential drugs is based on hybridization of a short chemically-modified oligonucleotide with complementary cellular DNA or RNA sequences. A critical question is the stability of chemically modified antisense oligonucleotides in cellular environments. In a model system, resistance against various nucleases was evaluated by capillary gel electrophoresis (CGE). For some of the samples, matrix assisted laser desorption and ionization mass spectrometry (MALDI-MS) was used as an additional analytical tool to perform stability measurements. Using CGE, the enzymatic degradation of single nucleotides from the oligomer can be followed after different incubation times. 10% T polyacrylamide gels give baseline resolution for oligonucleotides ranging between 5 and 30 bases in length. The kinetic influence of a specific nuclease concentration and the antisense oligonucleotide structure on the cleavage reaction are discussed. Also, a simple desalting method to improve the injection efficiency and sensitivity of the method are described. Examples of measurements of chemically modified antisense 19-mers are presented. PMID:7581844

  11. A status update of modified oligonucleotides for chemotherapeutics applications.

    PubMed

    Sanghvi, Yogesh S

    2011-09-01

    This unit presents an update of recent developments and clinical progress in chemically modified oliogonucleotides useful for therapeutic applications. During the last decade, the number of therapeutic oligonucleotides in clinical trials has nearly tripled. This is primarily due to advances in the synthesis protocols, better understanding of the biology, improved delivery, and better formulation technologies. Currently, over 100 clinical trials with oligonucleotide-based drugs are ongoing in the United States for potential treatment of a variety of life-threatening diseases. Among various oligonucleotides, antisense technology has been at the forefront, with one product on the market. Antisense technologies represent about half of the active clinical trials. Similarly, siRNA, aptamers, spiegelmers microRNA, shRNA, IMO, and CpG have been other active classes of oligonucleotides that are also undergoing clinical trials. This review attempts to summarize the current status of synthesis, chemical modifications, purification, and analysis in light of the rapid progress with multitude of oligonucleotides pursued as therapeutic modality. PMID:21901670

  12. Rapid oligonucleotide-templated fluorogenic tetrazine ligations

    PubMed Central

    Šečkutė, Jolita; Yang, Jun; Devaraj, Neal K.

    2013-01-01

    Template driven chemical ligation of fluorogenic probes represents a powerful method for DNA and RNA detection and imaging. Unfortunately, previous techniques have been hampered by requiring chemistry with sluggish kinetics and background side reactions. We have developed fluorescent DNA probes containing quenched fluorophore-tetrazine and methyl-cyclopropene groups that rapidly react by bioorthogonal cycloaddition in the presence of complementary DNA or RNA templates. Ligation increases fluorescence with negligible background signal in the absence of hybridization template. Reaction kinetics depend heavily on template length and linker structure. Using this technique, we demonstrate rapid discrimination between single template mismatches both in buffer and cell media. Fluorogenic bioorthogonal ligations offer a promising route towards the fast and robust fluorescent detection of specific DNA or RNA sequences. PMID:23775794

  13. Event-specific detection of seven genetically modified soybean and maizes using multiplex-PCR coupled with oligonucleotide microarray.

    PubMed

    Xu, Jia; Zhu, Shuifang; Miao, Haizhen; Huang, Wensheng; Qiu, Minyan; Huang, Yan; Fu, Xuping; Li, Yao

    2007-07-11

    With the increasing development of genetically modified organism (GMO) detection techniques, the polymerase chain reaction (PCR) technique has been the mainstay for GMO detection. An oligonucleotide microarray is a glass chip to the surface of which an array of oligonucleotides was fixed as spots, each containing numerous copies of a sequence-specific probe that is complementary to a gene of interest. So it is used to detect ten or more targets synchronously. In this research, an event-specific detection strategy based on the unique and specific integration junction sequences between the host plant genome DNA and the integrated gene is being developed for its high specificity using multiplex-PCR together with oligonucleotide microarray. A commercial GM soybean (GTS 40-3-2) and six GM maize events (MON810, MON863, Bt176, Bt11, GA21, and T25) were detected by this method. The results indicate that it is a suitable method for the identification of these GM soybean and maizes. PMID:17559227

  14. Synthesis of full-length oligonucleotides: cleavage of apurinic molecules on a novel support.

    PubMed Central

    Kwiatkowski, M; Nilsson, M; Landegren, U

    1996-01-01

    The synthesis of oligodeoxynucleotides is marred by several problems that contribute to the formation of defective molecules. This in turn seriously limits the usefulness of such reagents in DNA diagnostics, molecular cloning, DNA structural analysis and in antisense therapy. In particular, depurination reactions during the cyclical steps of synthesis lead to strand scission during cleavage of the completed molecules from the support. Here we present a remedy to this problem: a novel disiloxyl linkage that connects oligonucleotides to the support withstands reaction conditions that allow the removal of the 5' parts of any depurinated molecules. This ensures that all molecules that preserve the 5' protecting group when cleaved from the support will have both correct 3'- and 5'-ends. We demonstrate the application of the support for synthesis of padlock probe molecules. PMID:8972847

  15. Rapid oligonucleotide suspension array-based multiplex detection of bacterial pathogens.

    PubMed

    Zhao, Jinyin; Kang, Lin; Hu, Rui; Gao, Shan; Xin, Wenwen; Chen, Weijun; Wang, Jinglin

    2013-10-01

    A gene-specific microsphere suspension array coupled with 15-plex polymerase chain reaction (PCR) was developed to screen bacterial samples rapidly for 10 strains of bacteria: Shigella spp. (S. flexneri, S. dysenteriae, and S. sonnei), Staphylococcus aureus, Vibrio cholerae (serology O1 and O139), Legionella pneumophila, and Clostridium botulinum (types A, B, and E). Fifteen sets of highly validated primers were chosen to amplify target genes simultaneously. Corresponding oligonucleotide probes directly conjugated with microsphere sets were used to specifically identify PCR amplicons. Sensitivity tests revealed that the array coupled with single PCR was able to detect purified genomic DNA at concentrations as low as 10 copies/μL, while the multiplex detection limit was 10-10⁴ copies/μL. The assay was validated using water samples artificially spiked with S. aureus and S. dysenteriae, as well as water specimens from swimming pools previously identified to contain S. aureus. PMID:23947819

  16. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

    2012-01-01

    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  17. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  18. Synthesis of chimeric oligonucleotides containing phosphodiester, phosphorothioate, and phosphoramidate linkages.

    PubMed

    Maier, M A; Guzaev, A P; Manoharan, M

    2000-06-29

    [reaction: see text] H-Phosphonate monomers of 2'-O-(2-methoxyethyl) ribonucleosides have been synthesized. Oxidation of oligonucleotide H-phosphonates has been optimized to allow the synthesis of oligonucleotides containing either 2'-deoxy or 2'-O-(2-methoxyethyl) ribonucleoside residues combined with three different phosphate modifications in the backbone, i.e., phosphodiester (PO), phosphorothioate (PS), and phosphoramidate (PN). Phosphodiester linkages were introduced by oxidation with a cocktail of 0.1 M Et(3)N in CCl(4)/Pyr/H(2)O (5:9:1) without affecting phosphorothioate or phosphoramidate linkages. For the synthesis of phosphoramidate-modified oligonucleotides, N(4)-acetyl deoxycytidine-3'-H-phosphonate monomers were used to avoid transamination during the oxidation step. PMID:10891166

  19. Oligonucleotide Array for Identification and Detection of Pythium Species†

    PubMed Central

    Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

    2006-01-01

    A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples

  20. Evaluation of inhibition of miRNA expression induced by anti-miRNA oligonucleotides.

    PubMed

    Chae, Dong-Kyu; Ban, Eunmi; Yoo, Young Sook; Baik, Ja-Hyun; Song, Eun Joo

    2016-07-01

    MicroRNAs (miRNAs) are short RNA molecules that control the expression of mRNAs associated with various biological processes. Therefore, deregulated miRNAs play an important role in the pathogenesis of diseases. Numerous studies aimed at developing novel miRNA-based drugs or determining miRNA functions have been conducted by inhibiting miRNAs using anti-miRNA oligonucleotides (AMOs), which inhibit the function by hybridizing with miRNA. To increase the binding affinity and specificity to target miRNA, AMOs with various chemical modifications have been developed. Evaluating the potency of these various types of AMOs is an essential step in their development. In this study, we developed a capillary electrophoresis with laser-induced fluorescence (CE-LIF) method to evaluate the potency of AMOs by measuring changes in miRNA levels with fluorescence-labeled ssDNA probes using AMO-miR-23a, which inhibits miR-23a related to lung cancer. In order to eliminate interference by excess AMOs during hybridization of the ssDNA probe with the miR-23a, the concentration of the ssDNA probe was optimized. This newly developed method was used to compare the potency of two different modified AMOs. The data were supported by the results of a luciferase assay. This study demonstrated that CE-LIF analysis could be used to accurately evaluate AMO potency in biological samples. PMID:27178549

  1. Use of phosphorus oxychloride in synthesizing nucleotides and oligonucleotides

    PubMed Central

    Mungall, W.S.; Greene, G.L.; Miller, P.S.; Letsinger, R.L.

    1974-01-01

    Procedures are described for phosphorylating protected nucleotides, oligonucleotides and phosphoramidate oligonucleotide derivatives at the 3′-hydroxyl group. The conditions (phosphorylation with phosphorus oxychloride and pyridine in dioxane followed by hydrolysis with aqueous pyridine) are sufficiently mild that base labile (trifluoroacetylamino; β-cyanoethyl phosphotriester) and acid labile (O-monomethoxytrityl; phosphoramidate) functions are retained intact. Application of the technique is illustrated by the synthesis of dpT, dTp, d(CF3CONH)Tp, dTpNTp, and dTpNTpNTp. In addition, the utilization of phosphorus oxychloride in joining thymidine derivatives and dinucleoside phosphotriester blocks via phosphodiester links is described. PMID:10793743

  2. Spectrophotometric probe

    DOEpatents

    Prather, W.S.; O'Rourke, P.E.

    1994-08-02

    A support structure is described bearing at least one probe for making spectrophotometric measurements of a fluid using a source of light and a spectrophotometer. The probe includes a housing with two optical fibers and a planoconvex lens. A sleeve bearing a mirror surrounds the housing. The lens is separated from the mirror by a fixed distance, defining an interior space for receiving a volume of the fluid sample. A plurality of throughholes extending through the sleeve communicate between the sample volume and the exterior of the probe, all but one hole bearing a screen. A protective jacket surrounds the probe. A hollow conduit bearing a tube is formed in the wall of the probe for venting any air in the interior space when fluid enters. The probe is held at an acute angle so the optic fibers carrying the light to and from the probe are not bent severely on emergence from the probe. 3 figs.

  3. Spectrophotometric probe

    DOEpatents

    Prather, William S.; O'Rourke, Patrick E.

    1994-01-01

    A support structure bearing at least one probe for making spectrophotometric measurements of a fluid using a source of light and a spectrophotometer. The probe includes a housing with two optical fibers and a planoconvex lens. A sleeve bearing a mirror surrounds the housing. The lens is separated from the mirror by a fixed distance, defining an interior space for receiving a volume of the fluid sample. A plurality of throughholes extending through the sleeve communicate between the sample volume and the exterior of the probe, all but one hole bearing a screen. A protective jacket surrounds the probe. A hollow conduit bearing a tube is formed in the wall of the probe for venting any air in the interior space when fluid enters. The probe is held at an acute angle so the optic fibers carrying the light to and from the probe are not bent severely on emergence from the probe.

  4. A Comparative Study of Normalization Methods Used in Statistical Analysis of Oligonucleotide Microarray Data

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Normalization methods used in the statistical analysis of oligonucleotide microarray data were evaluated. The oligonucleotide microarray is considered an efficient analytical tool for analyzing thousands of genes simultaneously in a single experiment. However, systematic variation in microarray, ori...

  5. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  6. GENUS- AND GROUP-SPECIFIC HYBRIDIZATION PROBES FOR DETERMINATIVE AND ENVIRONMENTAL STUDIES OF SULFATE-REDUCING BACTERIA

    EPA Science Inventory

    A set of six oligonucleotides, complementary to conserved tracts of 16S rRNA from phylogenetically-defined groups of sulfate-reducing bacteria, was characterized for use as hybridization probes in determinative and environmental microbiology. our probes were genus specific and id...

  7. Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

    DOEpatents

    Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

    1999-01-19

    The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

  8. Construction and Evaluation of Desulfovibrio vulgaris Whole-Genome Oligonucleotide Microarrays

    SciTech Connect

    Z. He; Q. He; L. Wu; M.E. Clark; J.D. Wall; Jizhong Zhou; Matthew W. Fields

    2004-03-17

    Desulfovibrio vulgaris Hildenborough has been the focus of biochemical and physiological studies in the laboratory, and the metabolic versatility of this organism has been largely recognized, particularly the reduction of sulfate, fumarate, iron, uranium and chromium. In addition, a Desulfovibrio sp. has been shown to utilize uranium as the sole electron acceptor. D. vulgaris is a d-Proteobacterium with a genome size of 3.6 Mb and 3584 ORFs. The whole-genome microarrays of D. vulgaris have been constructed using 70mer oligonucleotides. All ORFs in the genome were represented with 3471 (97.1%) unique probes and 103 (2.9%) non-specific probes that may have cross-hybridization with other ORFs. In preparation for use of the experimental microarrays, artificial probes and targets were designed to assess specificity and sensitivity and identify optimal hybridization conditions for oligonucleotide microarrays. The results indicated that for 50mer and 70mer oligonucleotide arrays, hybridization at 45 C to 50 C, washing at 37 C and a wash time of 2.5 to 5 minutes obtained specific and strong hybridization signals. In order to evaluate the performance of the experimental microarrays, growth conditions were selected that were expected to give significant hybridization differences for different sets of genes. The initial evaluations were performed using D. vulgaris cells grown at logarithmic and stationary phases. Transcriptional analysis of D. vulgaris cells sampled during logarithmic phase growth indicated that 25% of annotated ORFs were up-regulated and 3% of annotated ORFs were downregulated compared to stationary phase cells. The up-regulated genes included ORFs predicted to be involved with acyl chain biosynthesis, amino acid ABC transporter, translational initiation factors, and ribosomal proteins. In the stationary phase growth cells, the two most up-regulated ORFs (70-fold) were annotated as a carboxynorspermidine decarboxylase and a 2C-methyl-D-erythritol-2

  9. Solid-phase-supported synthesis of morpholinoglycine oligonucleotide mimics

    PubMed Central

    Belov, Sergey S; Tarasenko, Yulia V; Silnikov, Vladimir N

    2014-01-01

    Summary An efficient solid-phase-supported peptide synthesis (SPPS) of morpholinoglycine oligonucleotide (MorGly) mimics has been developed. The proposed strategy includes a novel specially designed labile linker group containing the oxalyl residue and the 2-aminomethylmorpholino nucleoside analogues as first subunits. PMID:24991266

  10. Oligonucleotide-directed mutagenesis for precision gene editing.

    PubMed

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed. PMID:26503400

  11. Gene expression profiling in peanut using oligonucleotide microarrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently have a moderately significant number of ESTs been released into the public domain. Utilization of these ESTs for the oligonucleotide microarrays provides a means to investigate l...

  12. Chromosome-specific painting in Cucumis species using bulked oligonucleotides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a sing...

  13. Discovery of Genomic DNA Polymorphisms using oligonucleotide arrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We are applying oligonucleotide microarray technology as a means of rapidly discovering DNA-based markers for genetic mapping in finger millet and rice. A test genome scan was conducted using the full genome sequences of rice varieties 93-11 (indica) and Nipponbare (japonica) compared with the Affy...

  14. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

    PubMed

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

    2016-07-01

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with at least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. PMID:27237093

  15. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  16. Oligonucleotide and polymer functionalized nanoparticles for amplification-free detection of DNA.

    PubMed

    Thomson, David A C; Tee, Ernest H L; Tran, Nguyen T D; Monteiro, Michael J; Cooper, Matthew A

    2012-06-11

    Sensitive and quantitative nucleic acid testing from complex biological samples is now an important component of clinical diagnostics. Whereas nucleic acid amplification represents the gold standard, its utility in resource-limited and point-of-care settings can be problematic due to assay interferants, assay time, engineering constraints, and costs associated with both wetware and hardware. In contrast, amplification-free nucleic acid testing can circumvent these limitations by enabling direct target hybridization within complex sample matrices. In this work, we grew random copolymer brushes from the surface of silica-coated magnetic nanoparticles using azide-modified and hydroxyl oligo ethylene glycol methacrylate (OEGMA) monomers. The azide-functionalized polymer brush was first conjugated, via copper-catalyzed azide/alkyne cycloaddition (CuAAC), with herpes simplex virus (HSV)-specific oligonucleotides and then with alkyne-substituted polyethylene glycol to eliminate all residual azide groups. Our methodology enabled control over brush thickness and probe density and enabled multiple consecutive coupling reactions on the particle grafted brush. Brush- and probe-modified particles were then combined in a 20 min hybridization with fluorescent polystyrene nanoparticles modified with HSV-specific reporter probes. Following magnetic capture and washing, the particles were analyzed with an aggregate fluorescence measurement, which yielded a limit of detection of 6 pM in buffer and 60 pM in 50% fetal bovine serum. Adoption of brush- and probe-modified particles into a particle counting assay will result in the development of diagnostic assays with significant improvements in sensitivity. PMID:22612382

  17. Modeling Formamide Denaturation of Probe-Target Hybrids for Improved Microarray Probe Design in Microbial Diagnostics

    PubMed Central

    Yilmaz, L. Safak; Loy, Alexander; Wright, Erik S.; Wagner, Michael; Noguera, Daniel R.

    2012-01-01

    Application of high-density microarrays to the diagnostic analysis of microbial communities is challenged by the optimization of oligonucleotide probe sensitivity and specificity, as it is generally unfeasible to experimentally test thousands of probes. This study investigated the adjustment of hybridization stringency using formamide with the idea that sensitivity and specificity can be optimized during probe design if the hybridization efficiency of oligonucleotides with target and non-target molecules can be predicted as a function of formamide concentration. Sigmoidal denaturation profiles were obtained using fluorescently labeled and fragmented 16S rRNA gene amplicon of Escherichia coli as the target with increasing concentrations of formamide in the hybridization buffer. A linear free energy model (LFEM) was developed and microarray-specific nearest neighbor rules were derived. The model simulated formamide melting with a denaturant m-value that increased hybridization free energy (ΔG°) by 0.173 kcal/mol per percent of formamide added (v/v). Using the LFEM and specific probe sets, free energy rules were systematically established to predict the stability of single and double mismatches, including bulged and tandem mismatches. The absolute error in predicting the position of experimental denaturation profiles was less than 5% formamide for more than 90 percent of probes, enabling a practical level of accuracy in probe design. The potential of the modeling approach for probe design and optimization is demonstrated using a dataset including the 16S rRNA gene of Rhodobacter sphaeroides as an additional target molecule. The LFEM and thermodynamic databases were incorporated into a computational tool (ProbeMelt) that is freely available at http://DECIPHER.cee.wisc.edu. PMID:22952791

  18. [Preparative isolation of tetra-, penta- and hexapurine oligonucleotides from partial hydrolysates of depyrimidinated herring sperm DNA].

    PubMed

    Schott, H; Schrade, H

    1984-02-01

    Herring sperm DNA is chemically degraded to a complex mixture of purine nucleotides. The oligonucleotides are separated from the partial hydrolysates by column chromatography. The resulting mixture of trimer to hexamer purine oligonucleotides is subsequently fractionated on QAE-Sephadex into different mixtures of sequence-isomeric purine oligonucleotides. In a final separation, which uses reversed-phase (Nucleosil C18) high-performance liquid chromatography, these mixtures are separated under isocratic conditions into 35 pure defined purine oligonucleotides with four to six monomer units, 14 defined mixtures of sequence-isomeric purine oligonucleotides and several unidentified products. Purity and sequence of the isolated oligonucleotides are determined by the "fingerprint" method. The results of the high-performance liquid chromatographic and the "fingerprint" methods of the isolated oligonucleotides are discussed. PMID:6707126

  19. Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple targeted genes

    PubMed Central

    Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille

    2013-01-01

    The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513

  20. Development of the large-scale oligonucleotide chip for the diagnosis of plant viruses and its practical use.

    PubMed

    Nam, Moon; Kim, Jeong-Seon; Lim, Seungmo; Park, Chung Youl; Kim, Jeong-Gyu; Choi, Hong-Soo; Lim, Hyoun-Sub; Moon, Jae Sun; Lee, Su-Heon

    2014-03-01

    A large-scale oligonucleotide (LSON) chip was developed for the detection of the plant viruses with known genetic information. The LSON chip contains two sets of 3,978 probes for 538 species of targets including plant viruses, satellite RNAs and viroids. A hundred forty thousand probes, consisting of isolate-, species- and genus-specific probes respectively, are designed from 20,000 of independent nucleotide sequence of plant viruses. Based on the economic importance, the amount of genome information, and the number of strains and/or isolates, one to fifty-one probes for each target virus are selected and spotted on the chip. The standard and field samples for the analysis of the LSON chip have been prepared and tested by RT-PCR. The probe's specific and/or nonspecific reaction patterns by LSON chip allow us to diagnose the unidentified viruses. Thus, the LSON chip in this study could be highly useful for the detection of unexpected plant viruses, the monitoring of emerging viruses and the fluctuation of the population of major viruses in each plant. PMID:25288985

  1. Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification.

    PubMed

    Guan, Weihua; Chen, Liben; Rane, Tushar D; Wang, Tza-Huei

    2015-01-01

    We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples. PMID:26333806

  2. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  3. Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification

    NASA Astrophysics Data System (ADS)

    Guan, Weihua; Chen, Liben; Rane, Tushar D.; Wang, Tza-Huei

    2015-09-01

    We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples.

  4. Oligonucleotide-stabilized fluorescent silver nanoclusters for the specific and sensitive detection of biotin.

    PubMed

    Xiong, Xiaoli; Tang, Yan; Zhao, Jingjin; Zhao, Shulin

    2016-02-01

    A novel biotin fluorescent probe based on oligonucleotide-stabilized silver nanoclusters (DNA-AgNCs) was synthesized by employing a biotinylated cytosine-rich sequence as a synthesized template. The fluorescence properties of the DNA-AgNCs are related to the modified position of the DNA. When biotin is linked to the middle thymine base of the DNA sequence, the DNA-AgNCs emit the strongest fluorescence. Moreover, the stability of the DNA-AgNCs was affected by avidin through biotin-avidin binding, quenching the fluorescence of the DNA-AgNCs. In contrast, if free biotin is further introduced into this system, the quenching is apparently weakened by competition, leading to the restoration of fluorescence. This phenomenon can be utilized for the detection of biotin. Under the optimal conditions, the fluorescence recovery is linearly proportional to the concentration of biotin in the range of 10 nM-1.0 μM with a detection limit of 6.0 nM. This DNA-AgNCs probe with excellent fluorescent properties is sensitive and selective for the detection of biotin and has been applied for the determination of biotin in wheat flour. PMID:26750716

  5. Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification

    PubMed Central

    Guan, Weihua; Chen, Liben; Rane, Tushar D.; Wang, Tza-Huei

    2015-01-01

    We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples. PMID:26333806

  6. Oligonucleotides, part 5+: synthesis and fluorescence studies of DNA oligomers d(AT)5 containing adenines covalently linked at C-8 with dansyl fluorophore.

    PubMed Central

    Singh, D; Kumar, V; Ganesh, K N

    1990-01-01

    The synthesis of oligodeoxynucleotides d(AT)5 in which specific adenines are linked at C-8 position with dansyl fluorophores via a variable polymethylene spacer chain are reported. This was achieved by a strategy involving prelabelling at the monomeric stage followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled oligonucleotides. Several mono and polydansyl d(AT)5 derivatives in which the fluorophore is linked via ethylene, tetramethylene and hexamethylene spacer arms were synthesised for a systematic study of their fluorescence characteristics. It was observed that (i) enhancements in fluorescence intensity and emission quantum yields are seen due to multiple labelling, (ii) the magnitude of enhancements are related to labelling configuration and (iii) quenching efficiency is minimal with shorter and rigid spacer arms. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids. PMID:2356124

  7. Selective release of multiple DNA oligonucleotides from gold nanorods.

    PubMed

    Wijaya, Andy; Schaffer, Stefan B; Pallares, Ivan G; Hamad-Schifferli, Kimberly

    2009-01-27

    Combination therapy, or the use of multiple drugs, has been proven to be effective for complex diseases, but the differences in chemical properties and pharmacokinetics can be challenging in terms of the loading, delivering, and releasing multiple drugs. Here we demonstrate that we can load and selectively release two different DNA oligonucleotides from two different gold nanorods. DNA was loaded on the nanorods via thiol conjugation. Selective releases were induced by selective melting of gold nanorods via ultrafast laser irradiation at the nanorods' longitudinal surface plasmon resonance peaks. Excitation at one wavelength could selectively melt one type of gold nanorods and selectively release one type of DNA strand. Releases were efficient (50-80%) and externally tunable by laser fluence. Released oligonucleotides were still functional. This proof of concept is potentially a powerful method for multiple-drug delivery strategies. PMID:19206252

  8. Synthesis and properties of oligonucleotides containing aminodeoxythymidine units.

    PubMed Central

    Gryaznov, S M; Letsinger, R L

    1992-01-01

    Procedures are described for synthesis via solid support methodology of oligonucleotide analogues derived in part from 3'-amino-3'-deoxythymidine or 5'-amino-5'-deoxythymidine. Oligothymidylate decamers terminated with a 3'-amino group or containing a 3'-NHP(O)(O-)O-5' internucleoside link are found to form unusually stable complexes with poly(dA), poly(A), and oligo(dA). For related derivatives of 5'-amino-5'-deoxythymidine enhancement is less or absent, and in the case of multiple substitution destabilization of the heteroduplex may be observed. That the effect of the 3'-amino group is general for oligonucleotide derivatives is indicated by enhanced Tm values for heteroduplex complexes of the mixed-base oligomer, d(TATTCAGTCAT(NH2)), and the methyl phosphonate derivatives, TmTmTmTmTmTmTmTmTmT(NH2) and d(TmAmTmTmCmAmGmTmCmAmT(NH2)). PMID:1630911

  9. Oligonucleotide-directed site-specific mutagenesis in Drosophila melanogaster.

    PubMed Central

    Banga, S S; Boyd, J B

    1992-01-01

    An efficient technique has been developed for performing in vivo site-directed mutagenesis in Drosophila melanogaster. This procedure involves directed repair of P-element-induced DNA lesions after injection of a modified DNA sequence into early embryos. An oligonucleotide of 50 base pairs, whose sequence spans the P-element insertion site, mediates base replacement in the endogenous gene. Restriction mapping, DNA sequencing, and polymerase chain reaction analysis demonstrate that base substitutions present in an injected oligonucleotide are incorporated into genomic sequences flanking a P insertion site in the white gene. This analysis suggests that progeny bearing directed mutations are recovered with a frequency of about 0.5 x 10(-3). Because Drosophila remains a premier organism for the analysis of eukaryotic gene regulation, this system should find strong application in that analysis as well as in the analysis of DNA recombination, conversion, repair, and mutagenesis. Images PMID:1311850

  10. Cell-penetrating Peptides as Versatile Vehicles for Oligonucleotide Delivery

    PubMed Central

    Margus, Helerin; Padari, Kärt; Pooga, Margus

    2012-01-01

    Short regulatory oligonucleotides (ONs) have a great therapeutic potential for the modulation of gene expression due to their high specificity and low toxicity. The major obstacles for in vivo clinical applications of ONs are the poor permeability of plasma membrane to nucleic acids and the sensitivity of ONs to enzymatic degradation. Hence, various delivery vehicles have been developed to ensure the transduction of ONs into cells. Among these, the cell-penetrating peptides (CPPs) have gained quickly broadening popularity as promising nonviral transmembrane delivery vectors. For coupling of nucleic acids to CPPs, two distinct strategies may be applied—covalent and noncovalent. The majority of earlier studies have used covalent coupling of CPPs to ONs. However, the number of studies demonstrating very high therapeutic potential of noncovalent complexes of ONs with novel CPP-based delivery vehicles is explosively increasing. In this review, the recent developments in the application of CPP-mediated oligonucleotide delivery by noncovalent strategy will be discussed. PMID:22233581

  11. Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair

    NASA Astrophysics Data System (ADS)

    Marson, D.; Laurini, E.; Posocco, P.; Fermeglia, M.; Pricl, S.

    2015-02-01

    Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction.Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction. Electronic supplementary information (ESI) available: Additional figures and tables. See DOI: 10.1039/c4nr04510f

  12. Functionalization of silicon oxide using supercritical fluid deposition of 3,4-epoxybutyltrimethoxysilane for the immobilization of amino-modified oligonucleotide

    NASA Astrophysics Data System (ADS)

    Rull, Jordi; Nonglaton, Guillaume; Costa, Guillaume; Fontelaye, Caroline; Marchi-Delapierre, Caroline; Ménage, Stéphane; Marchand, Gilles

    2015-11-01

    The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO2) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric contrast optical technique, atomic force microscopy, multiple internal reflection infrared spectroscopy and X-ray photoelectron spectroscopy. The shelf life of the 3,4-epoxybutyltrimethoxysilane coating layer has also been studied. Finally, two different strategies of NH2-oligonucleotide grafting on EBTMOS coating layer have been compared, i.e. reductive amination and nucleophilic substitution, SN2. This EBTMOS based coating layer can be used for a wide range of applications

  13. Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

    PubMed Central

    Moreno, Pedro M. D.; Pêgo, Ana P.

    2014-01-01

    Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

  14. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

    2014-01-01

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  15. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing.

    PubMed

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P; Low, Audrey; Yoshida, Masayuki; Bennett, C Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  16. Recursive construction of perfect DNA molecules from imperfect oligonucleotides

    PubMed Central

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2008-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms. PMID:18463615

  17. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  18. Targeting Several CAG Expansion Diseases by a Single Antisense Oligonucleotide

    PubMed Central

    Evers, Melvin M.; Pepers, Barry A.; van Deutekom, Judith C. T.; Mulders, Susan A. M.; den Dunnen, Johan T.; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.; van Roon-Mom, Willeke M. C.

    2011-01-01

    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2′-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)7, also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  19. Targeting several CAG expansion diseases by a single antisense oligonucleotide.

    PubMed

    Evers, Melvin M; Pepers, Barry A; van Deutekom, Judith C T; Mulders, Susan A M; den Dunnen, Johan T; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B; van Roon-Mom, Willeke M C

    2011-01-01

    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2'-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)(7), also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  20. Sequence-selective metal ion binding to DNA oligonucleotides.

    PubMed

    Frøystein, N A; Davis, J T; Reid, B R; Sletten, E

    1993-07-01

    Metal ion titrations of several DNA oligonucleotides, 10 dodecamers and one decamer have been monitored by 1H NMR spectroscopy in order to elucidate metal ion binding patterns. Also, the effects of paramagnetic impurities on resonance linewidths and NOESY cross-peak intensities have been reversed by EDTA back-titration experiments. 1H 1D NMR spectra were recorded after successive additions of aliquots of different metal salts to oligonucleotide samples. Paramagnetic manganese(II) salts were used in most cases, but a few samples were also titrated with diamagnetic zinc(II). From this study, we conclude that there exists a sequence-selective metal ion binding pattern. The metal ions bind predominantly to 5'-G in the contexts 5'-GC and 5'-GA. The order of preference seems to be GG > or = GA > GT > > GC. No evidence of metal ion binding to 5'-G in 5'-GC steps or to non-G residues was found. The H6 or H8 resonances on preceding (5'-) bases were affected by the adjacent bound paramagnetic metal ion, but no effect was observed on the protons of the succeeding (3'-) base. The metal binding site in the duplexes is most likely at G-N7, as manifested by the pronounced paramagnetic line broadening or diamagnetic shift of the G-H8 signal. This sequence selectivity may be qualitatively explained by a sequence-dependent variation in the molecular electrostatic potentials of guanine residues (MEPs) along the oligonucleotide chain. PMID:8363924

  1. Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.

    PubMed

    Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E

    2005-02-01

    Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. PMID:15614814

  2. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  3. Time-Resolved Sequence Analysis on High Density Fiberoptic DNA Probe

    SciTech Connect

    Walt, D. R.; Lee, K-H

    2002-11-19

    A universal array format has been developed in which all possible n-mers of a particular oligonucleotide sequence can be represented. The ability to determine the sequence of the probes at every position in the array should enable unbiased gene expression as well as arrays for de novo sequencing.

  4. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

    PubMed Central

    Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

    2014-01-01

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design

  5. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids.

    PubMed

    Carpini, Guido; Lucarelli, Fausto; Marrazza, Giovanna; Mascini, Marco

    2004-09-15

    An electrochemical genosensor for the detection of specific sequences of DNA has been developed using disposable screen-printed gold electrodes. Screen-printed gold electrodes were firstly modified with a mixed monolayer of a 25-mer thiol-tethered DNA probe and a spacer thiol, 6-mercapto-1-hexanol (MCH). The DNA probe sequence was internal to the sequence of the 35S promoter, which sequence is inserted in the genome of GMOs regulating the transgene expression. An enzyme-amplified detection scheme, based on the coupling of a streptavidin-alkaline phosphatase conjugate and biotinylated target sequences was then applied. The enzyme catalysed the hydrolysis of the electroinactive alpha-naphthyl phosphate to alpha-naphthol; this product is electroactive and has been detected by means of differential pulse voltammetry. The assay was, firstly, characterised using synthetic oligonucleotides. Relevant parameters, such as the probe concentration and the immobilisation time, the use of the MCH and different enzymatic conjugates, were investigated and optimised. The genosensor response was found to be linearly related to the target concentration between 0 and 25 nmol/L; the detection limit was 0.25 nmol/L. The analytical procedure was then applied for the detection of the 35S promoter sequence, which was amplified from the pBI121 plasmid by polymerase chain reaction (PCR). Hybridisation conditions (i.e., hybridisation buffer and hybridisation time) were further optimised. The selectivity of the assay was confirmed using biotinylated non-complementary amplicons and PCR blanks. The results showed that the genosensor enabled sensitive (detection limit: 1 nmol/L) and specific detection of GMO-related sequences, thus providing a useful tool for the screening analysis of bioengineered food samples. PMID:15308218

  6. MiL-FISH: Multilabeled Oligonucleotides for Fluorescence In Situ Hybridization Improve Visualization of Bacterial Cells

    PubMed Central

    Kleiner, Manuel; Wetzel, Silke; Liebeke, Manuel; Dubilier, Nicole

    2015-01-01

    Fluorescence in situ hybridization (FISH) has become a vital tool for environmental and medical microbiology and is commonly used for the identification, localization, and isolation of defined microbial taxa. However, fluorescence signal strength is often a limiting factor for targeting all members in a microbial community. Here, we present the application of a multilabeled FISH approach (MiL-FISH) that (i) enables the simultaneous targeting of up to seven microbial groups using combinatorial labeling of a single oligonucleotide probe, (ii) is applicable for the isolation of unfixed environmental microorganisms via fluorescence-activated cell sorting (FACS), and (iii) improves signal and imaging quality of tissue sections in acrylic resin for precise localization of individual microbial cells. We show the ability of MiL-FISH to distinguish between seven microbial groups using a mock community of marine organisms and its applicability for the localization of bacteria associated with animal tissue and their isolation from host tissues using FACS. To further increase the number of potential target organisms, a streamlined combinatorial labeling and spectral imaging-FISH (CLASI-FISH) concept with MiL-FISH probes is presented here. Through the combination of increased probe signal, the possibility of targeting hard-to-detect taxa and isolating these from an environmental sample, the identification and precise localization of microbiota in host tissues, and the simultaneous multilabeling of up to seven microbial groups, we show here that MiL-FISH is a multifaceted alternative to standard monolabeled FISH that can be used for a wide range of biological and medical applications. PMID:26475101

  7. Optical probe

    DOEpatents

    Hencken, Kenneth; Flower, William L.

    1999-01-01

    A compact optical probe is disclosed particularly useful for analysis of emissions in industrial environments. The instant invention provides a geometry for optically-based measurements that allows all optical components (source, detector, rely optics, etc.) to be located in proximity to one another. The geometry of the probe disclosed herein provides a means for making optical measurements in environments where it is difficult and/or expensive to gain access to the vicinity of a flow stream to be measured. Significantly, the lens geometry of the optical probe allows the analysis location within a flow stream being monitored to be moved while maintaining optical alignment of all components even when the optical probe is focused on a plurality of different analysis points within the flow stream.

  8. Flexibility of C3h -Symmetrical Linkers in Tris-oligonucleotide-Based Tetrahedral Scaffolds.

    PubMed

    Panagiotidis, Christos; Kath-Schorr, Stephanie; von Kiedrowski, Günter

    2016-02-01

    Flexibility of tris-oligonucleotides is determined by the length of their connecting hydrocarbon chains. Tris-oligonucleotides are branched DNA building blocks with three oligonucleotide arms attached to a C3h -symmetrical linker core at these chains. Four tris-oligonucleotides hybridise into a tetrahedral nanocage by sequence-determined self-assembly. The influence of methylene, ethylene and propylene chains was studied by synthesising sets of tris-oligonucleotides and analysing the relative stability of the hybridisation products against digestion by mung bean nuclease by using gel electrophoresis. Linkers with ethylene chains showed sufficient flexibility, whereas methylene-chain linkers were too rigid. Tris-oligonucleotides based on the latter still formed tetrahedral scaffolds in intermixing experiments with linkers of higher flexibility. Thus, a new generation of versatile isocyanurate-based linkers was established. PMID:26593127

  9. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    NASA Astrophysics Data System (ADS)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  10. Nanoparticle-bridge assay for amplification-free electrical detection of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Teimouri, Manouchehr

    The aim of this research is to investigate a highly sensitive, fast, inexpensive, and field-applicable amplification-free nanoparticle-based oligonucleotide detection method which does not rely on any enzymatic or signal amplification process. In this approach, target oligonucleotide strands are detected through the formation of nanoparticle satellites which make an electrical path between two electrodes. This method enables an extremely sensitive oligonucleotide detection because even a few oligonucleotide strands can form a single nanoparticle satellite which can solely generates an electrical output signal. Results showed that this oligonucleotide detection method can detect oligonucleotide single strands at concentrations as low as 50 femtomolar without any amplification process. This detection method can be implemented in many fields such as biodefense, food safety, clinical research, and forensics.

  11. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore.

    PubMed

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I. PMID:27111839

  12. Systematic studies on the paracellular permeation of model permeants and oligonucleotides in the rat small intestine with chenodeoxycholate as enhancer.

    PubMed

    Tsutsumi, Keiko; Li, S Kevin; Hymas, Richard V; Teng, Ching-Leou; Tillman, Lloyd G; Hardee, Gregory E; Higuchi, William I; Ho, Norman F H

    2008-01-01

    The objective of this study was to mechanistically and quantitatively analyze chenodeoxycholate-enhanced paracellular transport of polar permeants and oligonucleotides in the rat jejunum and ileum. Micellar chenodeoxycholate solutions were used to perturbate the tight junctions. Supporting studies included assessment of the aqueous boundary layer (ABL) with ABL-controlled permeants, measurements of the permeability coefficients and fluxes of the bile acid in dilute and micellar concentrations, and determinations of pore sizes with paracellular probes (urea, mannitol, and raffinose). The paracellular permeability coefficients, P(para), of two model oligonucleotides (ON3 and ON6; 12- and 24-mers with 11 and 23 negative charges, respectively) were determined. The enhanced permeabilities paralleled the increased fluxes of micellar bile salt solutions into mesenteric blood and the opening of the tight junctions as compared to controls. As the pore radius increased from 0.7 nm to a maximum of 2.4 nm in the jejunum and ileum, the absorption of ON3 was enhanced up to sixfold in the jejunum and about 14-fold in the ileum with P(para) values between 0.5 x 10(-6) and 6 x 10(-6) cm/s, whereas ON6 was enhanced up to twofold in the jejunum and fivefold in the ileum with permeabilities between 0.3 x 10(-6) and 2 x 10(-6) cm/s. PMID:17847071

  13. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  14. Direct measurement of oligonucleotide binding stoichiometry of gene V protein by mass spectrometry.

    PubMed Central

    Cheng, X; Harms, A C; Goudreau, P N; Terwilliger, T C; Smith, R D

    1996-01-01

    The binding stoichiometry of gene V protein from bacteriophage f1 to several oligonucleotides was studied using electrospray ionization-mass spectrometry (ESI-MS). Using mild mass spectrometer interface conditions that preserve noncovalent associations in solution, gene V protein was observed as dimer ions from a 10 mM NH4OAc solution. Addition of oligonucleotides resulted in formation of protein-oligonucleotide complexes with stoichiometry of approximately four nucleotides (nt) per protein monomer. A 16-mer oligonucleotide gave predominantly a 4:1 (protein monomer: oligonucleotide) complex while oligonucleotides shorter than 15 nt showed stoichiometries of 2:1. Stoichiometries and relative binding constants for a mixture of oligonucleotides were readily measured using mass spectrometry. The binding stoichiometry of the protein with the 16-mer oligonucleotide was measured independently using size-exclusion chromatography and the results were consistent with the mass spectrometric data. These results demonstrate, for the first time, the observation and stoichiometric measurement of protein-oligonucleotide complexes using ESI-MS. The sensitivity and high resolution of ESI-MS should make it a useful too] in the study of protein-DNA interactions. PMID:8692937

  15. 2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

    SciTech Connect

    Prakash, T.P.; Puschl, A.; Lesnik, E.; Mohan, V.; Tereshko, V.; Egli, M.; Manoharan, M.

    2010-03-08

    Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA ({Delta}T{sub m} 3.2 C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 {angstrom} resolution.

  16. Repair of DNA lesions associated with triplex-forming oligonucleotides.

    PubMed

    Chin, Joanna Y; Glazer, Peter M

    2009-04-01

    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision repair pathway. This review examines the evidence for DNA repair of triplex-associated lesions. PMID:19072762

  17. A convenient and efficient purification method for chemically labeled oligonucleotides.

    PubMed

    Hwang, Jihee; Kang, Junhee; Kim, Seong Keun; Kim, Younggyu

    2013-05-01

    We developed an efficient, cost-effective, and rapid purification method for chemically-labeled oligonucleotides that requires less time than conventional procedures such as ethanol precipitation or size-exclusion chromatography. Based on the hydrophilic and hydrophobic properties of DNA and amine-reactive fluorophores, we show that n-butanol saturated with distilled water may be used to remove unreacted fluorophores by sequestering them in the organic phase, while labeled DNA remains in the aqueous phase. This phase extraction method is simple, fast, and allows for processing multiple samples simultaneously, a necessity for high-throughput labeling strategies. PMID:23662899

  18. On the rapid deprotection of synthetic oligonucleotides and analogs.

    PubMed Central

    Polushin, N N; Morocho, A M; Chen, B C; Cohen, J S

    1994-01-01

    The efficiency of oligodeoxynucleotide deprotection is greatly enhanced using a combination of: (a) ethanolamine, and especially a mixture of hydrazine, ethanolamine and methanol, in place of the usual aqueous ammonia; (b) tert-butylphenoxyacetyl amino protecting groups, and (c) oxalyl link between the first nucleotide and the polymeric support. The extent of base modification, particularly of C, is shown to be extremely low, and the quality of deprotected oligonucleotides is as high as in the case of ammonia deprotection. This method is also shown to be applicable to the preparation of phosphorothioate and methylphosphonate oligodeoxynucleotides and oligoribonucleotides. Images PMID:8127712

  19. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  20. Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides

    DOEpatents

    Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.

    2003-04-15

    A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

  1. Oligonucleotide microarray for subtyping of influenza A viruses

    NASA Astrophysics Data System (ADS)

    Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.

    2012-02-01

    Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

  2. Compact structures of d(CNG)n oligonucleotides in solution and their possible relevance to fragile X and related human genetic diseases.

    PubMed Central

    Mitchell, J E; Newbury, S F; McClellan, J A

    1995-01-01

    We show that oligonucleotides of CNG tracts readily adopt compact DNA structures that move unusually fast on gels. Base composition does not explain this, and non-CNG triplets (including GNC) do not form such structures. Chemical probing and melting experiments suggest that the structures probably are not hairpins. Although both long and short tracts can adopt compact structures, the structure formed by longer tracts is more compact than that formed by shorter ones. We note the possibility that such structures may form in vivo, and be instrumental in normal and/or abnormal function of human genes. Images PMID:7596812

  3. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    NASA Astrophysics Data System (ADS)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Ahmad, Haslina; Heng, Lee Yook; Karim, Nurul Huda Abd; Harun, Siti Norain

    2014-09-01

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy)2(PIP)]2+, (bpy = 2,2'bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy)2(PIP)]2+ was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulse voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy)2(PIP)]2+ with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.

  4. Conductivity Probe

    NASA Technical Reports Server (NTRS)

    2008-01-01

    The Thermal and Electrical Conductivity Probe (TECP) for NASA's Phoenix Mars Lander took measurements in Martian soil and in the air.

    The needles on the end of the instrument were inserted into the Martian soil, allowing TECP to measure the propagation of both thermal and electrical energy. TECP also measured the humidity in the surrounding air.

    The needles on the probe are 15 millimeters (0.6 inch) long.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  5. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides

    PubMed Central

    Kolganova, N. A.; Shchyolkina, A. K.; Chudinov, A. V.; Zasedatelev, A. S.; Florentiev, V. L.; Timofeev, E. N.

    2012-01-01

    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  6. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides.

    PubMed

    Kolganova, N A; Shchyolkina, A K; Chudinov, A V; Zasedatelev, A S; Florentiev, V L; Timofeev, E N

    2012-09-01

    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  7. Development of oligonucleotide microarrays for simultaneous multi-species identification of Phellinus tree-pathogenic fungi.

    PubMed

    Tzean, Yuh; Shu, Po-Yao; Liou, Ruey-Fen; Tzean, Shean-Shong

    2016-03-01

    Polyporoid Phellinus fungi are ubiquitously present in the environment and play an important role in shaping forest ecology. Several species of Phellinus are notorious pathogens that can affect a broad variety of tree species in forest, plantation, orchard and urban habitats; however, current detection methods are overly complex and lack the sensitivity required to identify these pathogens at the species level in a timely fashion for effective infestation control. Here, we describe eight oligonucleotide microarray platforms for the simultaneous and specific detection of 17 important Phellinus species, using probes generated from the internal transcribed spacer regions unique to each species. The sensitivity, robustness and efficiency of this Phellinus microarray system was subsequently confirmed against template DNA from two key Phellinus species, as well as field samples collected from tree roots, trunks and surrounding soil. This system can provide early, specific and convenient detection of Phellinus species for forestry, arboriculture and quarantine inspection, and could potentially help to mitigate the environmental and economic impact of Phellinus-related diseases. PMID:26853539

  8. Electrochemical Investigation of Oligonucleotide-DNA Hybridization on Poly(4-Methoxyphenethylamine)

    PubMed Central

    Silva, Francielle B.; Vieira, Sabrina N.; Goulart Filho, Luiz R.; Boodts, Julien F. C.; Brito-Madurro, Ana G.; Madurro, João M.

    2008-01-01

    This work describes the immobilization of purine and pyrimidine bases and immobilization/hybridization of synthetic oligonucleotides on graphite electrodes modified with poly(4-methoxyphenethylamine) produced in acid medium. The immobilization of adenine, guanine, cytosine and thymine on these modified electrodes was efficient, producing characteristic peaks. Another relevant observation is that, according to the literature, pyrimidine bases, cytosine and thymine are more difficult to detect. However, when immobilized onto the poly(4-methoxyphenethylamine), a significant increase in the magnitude of the current was obtained. The observation of the hybridization between the poly(GA) probe and its complementary, poly(CT) target, was possible by monitoring the guanosine and adenosine peaks or through methylene blue indicator, using differential pulse voltammetry. Hybridization results in a decrease of the peak current of guanosine and adenosine or the signal of methylene blue accumulated on the modified electrode surface. The hybridization with the complementary target was also investigated by electrochemical impedance spectroscopy. The results showed a significant modification in the Nyquist plot, after addition of the complementary target, with increase of the charge transference resistance. PMID:19325797

  9. Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

    SciTech Connect

    Proudnikov, D.; Kirillov, E.; Chumakov, K.; Donion, J.; Rezapkin, G.; Mirzabekov, A.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology; Center for Biologics Evaluation and Research

    2000-01-01

    This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements. Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.

  10. A Versatile Vector for Gene and Oligonucleotide Transfer into Cells in Culture and in vivo: Polyethylenimine

    NASA Astrophysics Data System (ADS)

    Boussif, Otmane; Lezoualc'h, Frank; Zanta, Maria Antonietta; Djavaheri Mergny, Mojgan; Scherman, Daniel; Demeneix, Barbara; Behr, Jean-Paul

    1995-08-01

    Several polycations possessing substantial buffering capacity below physiological pH, such as lipopolyamines and polyamidoamine polymers, are efficient transfection agents per se-i.e., without the addition of cell targeting or membrane-disruption agents. This observation led us to test the cationic polymer polyethylenimine (PEI) for its genedelivery potential. Indeed, every third atom of PEI is a protonable amino nitrogen atom, which makes the polymeric network an effective "proton sponge" at virtually any pH. Luciferase reporter gene transfer with this polycation into a variety of cell lines and primary cells gave results comparable to, or even better than, lipopolyamines. Cytotoxicity was low and seen only at concentrations well above those required for optimal transfection. Delivery of oligonucleotides into embryonic neurons was followed by using a fluorescent probe. Virtually all neurons showed nuclear labeling, with no toxic effects. The optimal PEI cation/anion balance for in vitro transfection is only slightly on the cationic side, which is advantageous for in vivo delivery. Indeed, intracerebral luciferase gene transfer into newborn mice gave results comparable (for a given amount of DNA) to the in vitro transfection of primary rat brain endothelial cells or chicken embryonic neurons. Together, these properties make PEI a promising vector for gene therapy and an outstanding core for the design of more sophisticated devices. Our hypothesis is that its efficiency relies on extensive lysosome buffering that protects DNA from nuclease degradation, and consequent lysosomal swelling and rupture that provide an escape mechanism for the PEI/DNA particles.

  11. Genome-wide expression analysis of Saccharomyces pastorianus orthologous genes using oligonucleotide microarrays.

    PubMed

    Horinouchi, Takaaki; Yoshikawa, Katsunori; Kawaide, Risa; Furusawa, Chikara; Nakao, Yoshihiro; Hirasawa, Takashi; Shimizu, Hiroshi

    2010-11-01

    The lager brewing yeast, Saccharomyces pastorianus, an allopolyploid species hybrid, contains 2 diverged sub-genomes; one derived from Saccharomyces cerevisiae (Sc-type) and the other from Saccharomyces bayanus (Sb-type). We analyzed the functional roles of these orthologous genes in determining the phenotypic features of S. pastorianus. We used a custom-made oligonucleotide microarray containing probes designed for both Sc-type and Sb-type ORFs for a comprehensive expression analysis of S. pastorianus in a pilot-scale fermentation. We showed a high degree of correlation between the expression levels and the expression changes for a majority of orthologous gene sets during the fermentation process. We screened the functional categories and metabolic pathways where Sc- or Sb-type genes have higher expression levels than the corresponding orthologous genes. Our data showed that, for example, pathways for sulfur metabolism, cellular import, and production of branched amino acids are dominated by Sb-type genes. This comprehensive expression analysis of orthologous genes can provide valuable insights on understanding the phenotype of S. pastorianus. PMID:20547377

  12. An oligonucleotide-tagged microarray for routine diagnostics of colon cancer by genotyping KRAS mutations.

    PubMed

    Liu, Yuliang; Gudnason, Haukur; Li, Yi-Ping; Bang, Dang Duong; Wolff, Anders

    2014-10-01

    Colorectal cancer (CRC) is one of the most prevalent types of cancer, causing significant morbidity and mortality worldwide. CRC is curable if diagnosed at an early stage. Mutations in the oncogene KRAS play a critical role in early development of CRC. Detection of activated KRAS is of diagnostic and therapeutic importance. In this study, KRAS gene fragments containing mutations in codon 12 were amplified by multiplex PCR using a 5'-Cy5-labeled reverse primer in combination with 3'-mutation-specific forward primers that were linked with four unique nucleotide-sequence tags at the 5'-end. The Cy5-labeled reverse primer was extended under PCR amplification to the 5'-end of the mutation-specific forward primers and thus included the complimentary sequence of the tag. PCR products were hybridized to tag-probes immobilized on various substrates and detected by a scanner. Our results indicate that all mutations at codon 12 of KRAS derived from cancer cells and clinical samples could be unambiguously detected. KRAS mutations were accurately detected when the mutant DNA was present only in 10% of the starting mixed materials including wild-type genomic DNA, which was isolated from either cancer cells or spiked fecal samples. The immobilized tag-probes were stable under multiple thermal cycling treatments, allowing re-use of the tag-microarray and further optimization to solid PCR. Our results demonstrated that a novel oligonucleotide-tagged microarray system has been developed which would be suitable to be used for detection of KRAS mutations and clinical diagnosis of CRC. PMID:25018048

  13. Germ-line deletion in DICER1 revealed by a novel MLPA assay using synthetic oligonucleotides.

    PubMed

    Sabbaghian, Nelly; Srivastava, Archana; Hamel, Nancy; Plourde, François; Gajtko-Metera, Malgorzata; Niedziela, Marek; Foulkes, William D

    2014-04-01

    DICER1 is an endoribonuclease responsible for the production of mature microRNAs which are small, single-stranded RNA molecules that regulate gene expression post-transcriptionally by binding to mRNA and repressing the expression of target genes. Germ-line mutations in DICER1 are responsible for a rare cancer syndrome, including tumors that can co-occur with multinodular goiter (MNG). Using Sanger sequencing, we screened all DICER1 exons and intron boundaries in 20 suspected mutation carriers: nine with ovarian sex cord-stromal tumors (including Sertoli-Leydig cell tumors (SLCTs)), five with pleuropulmonary blastoma, one with cystic nephroma, one with nasal chondromesenchymal hamartoma and four with more than one manifestation suggestive of a germ-line DICER1 mutation. All were negative for any apparently deleterious variants. We developed a Multiplex Ligation-based Probe Amplification assay for DICER1 to screen for large deletions or duplications. Synthetic oligonucleotides were designed to cover all exons in three probe-mixes. In a child with a SLCT and MNG, and in her mother and brother (both diagnosed with MNG), we identified a heterozygous germ-line deletion of approximately 3 kilobases that eliminates exon 21 of DICER1 and two-thirds of intron 21, accompanied by an insertion of a G nucleotide at the 3' end of the deletion (c.3270-6_4051-1280delinsG). This allele is expressed in the patient's cDNA, creating an out-of-frame deletion predicted to result in a truncated protein (r.3270_4050del; p.Tyr1091Ser*28). Our novel finding of a disease-causing large deletion in DICER1 emphasizes the need to include assays that can detect rearrangements, duplications and deletions in any DICER1 screening protocol. PMID:24065110

  14. Germ-line deletion in DICER1 revealed by a novel MLPA assay using synthetic oligonucleotides

    PubMed Central

    Sabbaghian, Nelly; Srivastava, Archana; Hamel, Nancy; Plourde, François; Gajtko-Metera, Malgorzata; Niedziela, Marek; Foulkes, William D

    2014-01-01

    DICER1 is an endoribonuclease responsible for the production of mature microRNAs which are small, single-stranded RNA molecules that regulate gene expression post-transcriptionally by binding to mRNA and repressing the expression of target genes. Germ-line mutations in DICER1 are responsible for a rare cancer syndrome, including tumors that can co-occur with multinodular goiter (MNG). Using Sanger sequencing, we screened all DICER1 exons and intron boundaries in 20 suspected mutation carriers: nine with ovarian sex cord-stromal tumors (including Sertoli–Leydig cell tumors (SLCTs)), five with pleuropulmonary blastoma, one with cystic nephroma, one with nasal chondromesenchymal hamartoma and four with more than one manifestation suggestive of a germ-line DICER1 mutation. All were negative for any apparently deleterious variants. We developed a Multiplex Ligation-based Probe Amplification assay for DICER1 to screen for large deletions or duplications. Synthetic oligonucleotides were designed to cover all exons in three probe-mixes. In a child with a SLCT and MNG, and in her mother and brother (both diagnosed with MNG), we identified a heterozygous germ-line deletion of approximately 3 kilobases that eliminates exon 21 of DICER1 and two-thirds of intron 21, accompanied by an insertion of a G nucleotide at the 3′ end of the deletion (c.3270-6_4051-1280delinsG). This allele is expressed in the patient's cDNA, creating an out-of-frame deletion predicted to result in a truncated protein (r.3270_4050del; p.Tyr1091Ser*28). Our novel finding of a disease-causing large deletion in DICER1 emphasizes the need to include assays that can detect rearrangements, duplications and deletions in any DICER1 screening protocol. PMID:24065110

  15. SPR Detection and Discrimination of the Oligonucleotides Related to the Normal and the Hybrid bcr-abl Genes by Two Stringency Control Strategies

    NASA Astrophysics Data System (ADS)

    Matsishin, M. J.; Ushenin, Iu. V.; Rachkov, A. E.; Solatkin, A. P.

    2016-01-01

    In this study, we applied two stringency control strategies for surface plasmon resonance (SPR) detection of DNA hybridization and discrimination of completely and partially complementary 24-mer sequences. These sequences are specific to the human normal bcr and the hybrid bcr-abl genes, protein products of which are responsible for some leukemia. SPR sensors based on resonance phenomena in nanoscale gold films are well suited for label-free, real-time investigations of the macromolecule interactions. Thermodynamic parameters obtained using the web server DINAMelt allowed supposing the possibility for realization (a) stringency control based on the ionic strength of the hybridization buffer and (b) stringency control based on the temperature elevation. The first one resulted in that the discrimination index of completely complementary and partially complementary oligonucleotides depending on the target concentration varied from 1.3 to 1.8 in 2 × SSC and from 2.0 to 2.9 in 0.5 × SSC. For implementation of the second stringency control strategy, SPR spectrometer measuring flow cell with built-in high-precision temperature control and regulation as well as corresponding software was created. It is shown that the duplexes formed by the immobilized probes mod-Ph and completely complementary oligonucleotides P1 remained without significant changes until ~50 °C, while the duplexes formed with partially complementary oligonucleotide Bcrex14 almost entirely disrupted at 40 °C. Thus, the absolutely effective thermodiscrimination of this pair of oligonucleotides was achieved in this temperature range (40-50 °C).

  16. SPR Detection and Discrimination of the Oligonucleotides Related to the Normal and the Hybrid bcr-abl Genes by Two Stringency Control Strategies.

    PubMed

    Matsishin, M J; Ushenin, Iu V; Rachkov, A E; Solatkin, A P

    2016-12-01

    In this study, we applied two stringency control strategies for surface plasmon resonance (SPR) detection of DNA hybridization and discrimination of completely and partially complementary 24-mer sequences. These sequences are specific to the human normal bcr and the hybrid bcr-abl genes, protein products of which are responsible for some leukemia. SPR sensors based on resonance phenomena in nanoscale gold films are well suited for label-free, real-time investigations of the macromolecule interactions. Thermodynamic parameters obtained using the web server DINAMelt allowed supposing the possibility for realization (a) stringency control based on the ionic strength of the hybridization buffer and (b) stringency control based on the temperature elevation. The first one resulted in that the discrimination index of completely complementary and partially complementary oligonucleotides depending on the target concentration varied from 1.3 to 1.8 in 2 × SSC and from 2.0 to 2.9 in 0.5 × SSC. For implementation of the second stringency control strategy, SPR spectrometer measuring flow cell with built-in high-precision temperature control and regulation as well as corresponding software was created. It is shown that the duplexes formed by the immobilized probes mod-Ph and completely complementary oligonucleotides P1 remained without significant changes until ~50 °C, while the duplexes formed with partially complementary oligonucleotide Bcrex14 almost entirely disrupted at 40 °C. Thus, the absolutely effective thermodiscrimination of this pair of oligonucleotides was achieved in this temperature range (40-50 °C). PMID:26759355

  17. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  18. DOTAP/UDCA vesicles: novel approach in oligonucleotide delivery.

    PubMed

    Ruozi, Barbara; Battini, Renata; Montanari, Monica; Mucci, Adele; Tosi, Giovanni; Forni, Flavio; Vandelli, Maria Angela

    2007-03-01

    The relatively hydrophilic bile acid, ursodeoxycholic acid (UDCA), was used as an additive to DOTAP cationic liposomes to evaluate the effect on the cellular uptake of an oligonucleotide. Nuclear magnetic resonance studies were applied to estimate the relative amount of incorporated UDCA into the lipidic bilayers. DOTAP or DOTAP-UDCA vesicles (MixVes; DOTAP/UDCA molar ratios 1:0.25, 1:0.5, 1:1, and 1:2) formed complexes with 5'-fluorescein conjugated 29-mer phosphorothioate oligonucleotides (PS-ODNs) and studied using gel electrophoresis. In addition, the complexes were tested after transfection to assess the cellular uptake and the localization of the oligo in a HaCaT cell line by the use of cytofluorimetric and confocal microscopic analysis. DOTAP lipid formulated in the presence of a defined amount of UDCA forms more stable, flexible, and active MixVes. In particular, the MixVes at 1:0.25 and 1:0.5 molar ratios increase and modify the cellular uptake of PS-ODNs if compared with DOTAP liposomes 3 hours after the transfection studies. Moreover, the in vitro data suggest that these new formulations are not toxic. PMID:17379164

  19. Multiplex pairwise assembly of array-derived DNA oligonucleotides

    PubMed Central

    Klein, Jason C.; Lajoie, Marc J.; Schwartz, Jerrod J.; Strauch, Eva-Maria; Nelson, Jorgen; Baker, David; Shendure, Jay

    2016-01-01

    While the cost of DNA sequencing has dropped by five orders of magnitude in the past decade, DNA synthesis remains expensive for many applications. Although DNA microarrays have decreased the cost of oligonucleotide synthesis, the use of array-synthesized oligos in practice is limited by short synthesis lengths, high synthesis error rates, low yield and the challenges of assembling long constructs from complex pools. Toward addressing these issues, we developed a protocol for multiplex pairwise assembly of oligos from array-synthesized oligonucleotide pools. To evaluate the method, we attempted to assemble up to 2271 targets ranging in length from 192–252 bases using pairs of array-synthesized oligos. Within sets of complexity ranging from 131–250 targets, we observed error-free assemblies for 90.5% of all targets. When all 2271 targets were assembled in one reaction, we observed error-free constructs for 70.6%. While the assembly method intrinsically increased accuracy to a small degree, we further increased accuracy by using a high throughput ‘Dial-Out PCR’ protocol, which combines Illumina sequencing with an in-house set of unique PCR tags to selectively amplify perfect assemblies from complex synthetic pools. This approach has broad applicability to DNA assembly and high-throughput functional screens. PMID:26553805

  20. Dendritic nanoconjugates for intracellular delivery of neutral oligonucleotides

    NASA Astrophysics Data System (ADS)

    Ming, Xin; Wu, Lin; Carver, Kyle; Yuan, Ahu; Min, Yuanzeng

    2015-07-01

    Dendrimer-based gene delivery has been constrained by intrinsic toxicity and suboptimal nanostructure. Conjugation of neutral morpholino oligonucleotides (ONs) with PAMAM dendrimers resulted in neutral, uniform, and ultra-small (~10 nm) nanoconjugates. The nanoconjugates dramatically enhanced cellular delivery of the ONs in cancer cells. After release from the dendrimer in the cytosol, the ONs produced potent functional activity without causing significant cytotoxicity. When carrying an apoptosis-promoting ON, the nanoconjugates produced cancer cell killing directly. Thus, the dendritic nanoconjugates may provide an effective tool for delivering ONs to tumors and other diseased tissues.Dendrimer-based gene delivery has been constrained by intrinsic toxicity and suboptimal nanostructure. Conjugation of neutral morpholino oligonucleotides (ONs) with PAMAM dendrimers resulted in neutral, uniform, and ultra-small (~10 nm) nanoconjugates. The nanoconjugates dramatically enhanced cellular delivery of the ONs in cancer cells. After release from the dendrimer in the cytosol, the ONs produced potent functional activity without causing significant cytotoxicity. When carrying an apoptosis-promoting ON, the nanoconjugates produced cancer cell killing directly. Thus, the dendritic nanoconjugates may provide an effective tool for delivering ONs to tumors and other diseased tissues. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01665g

  1. In vivo delivery of transcription factors with multifunctional oligonucleotides

    NASA Astrophysics Data System (ADS)

    Lee, Kunwoo; Rafi, Mohammad; Wang, Xiaojian; Aran, Kiana; Feng, Xuli; Lo Sterzo, Carlo; Tang, Richard; Lingampalli, Nithya; Kim, Hyun Jin; Murthy, Niren

    2015-07-01

    Therapeutics based on transcription factors have the potential to revolutionize medicine but have had limited clinical success as a consequence of delivery problems. The delivery of transcription factors is challenging because it requires the development of a delivery vehicle that can complex transcription factors, target cells and stimulate endosomal disruption, with minimal toxicity. Here, we present a multifunctional oligonucleotide, termed DARTs (DNA assembled recombinant transcription factors), which can deliver transcription factors with high efficiency in vivo. DARTs are composed of an oligonucleotide that contains a transcription-factor-binding sequence and hydrophobic membrane-disruptive chains that are masked by acid-cleavable galactose residues. DARTs have a unique molecular architecture, which allows them to bind transcription factors, trigger endocytosis in hepatocytes, and stimulate endosomal disruption. The DARTs have enhanced uptake in hepatocytes as a result of their galactose residues and can disrupt endosomes efficiently with minimal toxicity, because unmasking of their hydrophobic domains selectively occurs in the acidic environment of the endosome. We show that DARTs can deliver the transcription factor nuclear erythroid 2-related factor 2 (Nrf2) to the liver, catalyse the transcription of Nrf2 downstream genes, and rescue mice from acetaminophen-induced liver injury.

  2. Multiplex pairwise assembly of array-derived DNA oligonucleotides.

    PubMed

    Klein, Jason C; Lajoie, Marc J; Schwartz, Jerrod J; Strauch, Eva-Maria; Nelson, Jorgen; Baker, David; Shendure, Jay

    2016-03-18

    While the cost of DNA sequencing has dropped by five orders of magnitude in the past decade, DNA synthesis remains expensive for many applications. Although DNA microarrays have decreased the cost of oligonucleotide synthesis, the use of array-synthesized oligos in practice is limited by short synthesis lengths, high synthesis error rates, low yield and the challenges of assembling long constructs from complex pools. Toward addressing these issues, we developed a protocol for multiplex pairwise assembly of oligos from array-synthesized oligonucleotide pools. To evaluate the method, we attempted to assemble up to 2271 targets ranging in length from 192-252 bases using pairs of array-synthesized oligos. Within sets of complexity ranging from 131-250 targets, we observed error-free assemblies for 90.5% of all targets. When all 2271 targets were assembled in one reaction, we observed error-free constructs for 70.6%. While the assembly method intrinsically increased accuracy to a small degree, we further increased accuracy by using a high throughput 'Dial-Out PCR' protocol, which combines Illumina sequencing with an in-house set of unique PCR tags to selectively amplify perfect assemblies from complex synthetic pools. This approach has broad applicability to DNA assembly and high-throughput functional screens. PMID:26553805

  3. Pollution Probe.

    ERIC Educational Resources Information Center

    Chant, Donald A.

    This book is written as a statement of concern about pollution by members of Pollution Probe, a citizens' anti-pollution group in Canada. Its purpose is to create public awareness and pressure for the eventual solution to pollution problems. The need for effective government policies to control the population explosion, conserve natural resources,…

  4. G-quadruplex formation between G-rich PNA and homologous sequences in oligonucleotides and supercoiled plasmid DNA.

    PubMed

    Gaynutdinov, Timur I; Englund, Ethan A; Appella, Daniel H; Onyshchenko, Mykola I; Neumann, Ronald D; Panyutin, Igor G

    2015-04-01

    Guanine (G)-rich DNA sequences can adopt four-stranded quadruplex conformations that may play a role in the regulation of genetic processes. To explore the possibility of targeted molecular recognition of DNA sequences with short G-rich peptide nucleic acids (PNA) and to assess the strand arrangement in such complexes, we used PNA and DNA with the Oxytricha nova telomeric sequence d(G4T4G4) as a model. PNA probes were complexed with DNA targets in the following forms: single-stranded oligonucleotides, a loop of DNA in a hairpin conformation, and as supercoiled plasmid with the (G4T4G4)/(C4A4C4) insert. Gel-shift mobility assays demonstrated formation of stable hybrid complexes between the homologous G4T4G4 PNA and DNA with multiple modes of binding. Chemical and enzymatic probing revealed sequence-specific and G-quadruplex dependent binding of G4T4G4 PNA to dsDNA. Spectroscopic and electrophoretic analysis of the complex formed between PNA and the synthetic DNA hairpin containing the G4T4G4 loop showed that the stoichiometry of a prevailing complex is three PNA strands per one DNA strand. We speculate how this new PNA-DNA complex architecture can help to design more selective, quadruplex-specific PNA probes. PMID:25650982

  5. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  6. HELP (high efficiency liquid phase) new oligonucleotide synthesis on soluble polymeric support.

    PubMed

    Bonora, G M; Scremin, C L; Colonna, F P; Garbesi, A

    1990-06-11

    A simple, rapid and high-yielding method for the synthesis of oligonucleotides by the phosphotriesters approach is described. The use of polyethylene glycol (PEG) as soluble polymeric support preserves some convenient features of the solid-phase synthesis with new interesting advantages. Short oligonucleotides in hundred milligrams scale can be obtained from few grams of functionalized PEG. PMID:2356115

  7. HELP (high efficiency liquid phase) new oligonucleotide synthesis on soluble polymeric support.

    PubMed Central

    Bonora, G M; Scremin, C L; Colonna, F P; Garbesi, A

    1990-01-01

    A simple, rapid and high-yielding method for the synthesis of oligonucleotides by the phosphotriesters approach is described. The use of polyethylene glycol (PEG) as soluble polymeric support preserves some convenient features of the solid-phase synthesis with new interesting advantages. Short oligonucleotides in hundred milligrams scale can be obtained from few grams of functionalized PEG. PMID:2356115

  8. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. II - Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1992-01-01

    Hairpin oligonucleotides were prepared with 5-prime-terminal single-stranded sequments containing cytidylate (C) and guanylate (G) residues. It was found that incubation of these hairpin oligonucleotides with a mixutre of cytidine and guanosine 5-prime-phosphoro (2-methyl)imidazolides results in sequence-specific addition of C and G residues to the 3-prime terminus of the hairpin.

  9. Controlling microarray DNA hybridization efficiency by probe-surface distance and external surface electrostatics

    NASA Astrophysics Data System (ADS)

    Qamhieh, K.; Pettitt, B. Montgomery

    2015-03-01

    DNA microarrays are analytical devices designed to determine the composition of multicomponent solutions of nucleic acids, DNA or RNA. These devices are promising technology for diverse applications, including sensing, diagnostics, and drug/gene delivery. Here, we modify a hybridization adsorption isotherm to study the effects of probe-surface distance and the external electrostatic fields, on the oligonucleotide hybridization in microarray and how these effects are varies depending on surface probe density and target concentration. This study helps in our understanding on-surface hybridization mechanisms, and from it we can observe a significant effect of the probe-surface distance, and the external electrostatic fields, on the hybridization yield. In addition we present a simple new criteria to control the oligonucleotide hybridization efficiency by providing a chart illustrating the effects of all factors on the DNA-hybridization efficiency.

  10. Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports.

    PubMed Central

    Guo, Z; Guilfoyle, R A; Thiel, A J; Wang, R; Smith, L M

    1994-01-01

    A simple and rapid method for the analysis of genetic polymorphisms has been developed using allele-specific oligonucleotide arrays bound to glass supports. Allele-specific oligonucleotides are covalently immobilized on glass slides in arrays of 3 mm spots. Genomic DNA is amplified by PCR using one fluorescently tagged primer oligonucleotide and one biotinylated primer oligonucleotide. The two complementary DNA strands are separated, the fluorescently tagged strand is hybridized to the support-bound oligonucleotide array, and the hybridization pattern is detected by fluorescence scanning. Multiple polymorphisms present in the PCR product may be detected in parallel. The effect of spacer length, surface density and hybridization conditions were evaluated, as was the relative efficacy of hybridization with single or double-stranded PCR products. The utility of the method was demonstrated in the parallel analysis of 5 point mutations from exon 4 of the human tyrosinase gene. Images PMID:7816638

  11. Stable dye-labelled oligonucleotide-nanoparticle conjugates for nucleic acid detection

    NASA Astrophysics Data System (ADS)

    Barrett, Lee; Dougan, Jennifer A.; Faulds, Karen; Graham, Duncan

    2011-08-01

    Metallic nanoparticles functionalized with oligonucleotides are used for a number of nucleic acid detection strategies. However, oligonucleotide-nanoparticle conjugates suffer from a lack of stability when exposed to certain conditions associated with DNA detection assays. In this study, we report the synthesis of thiol and thioctic acid-modified oligonucleotide gold nanoparticle (OGNs) conjugates functionalized with a dye label and varying spacer groups. The thioctic acid-modified conjugates exhibit increased stability when treated with dithiothreitol (DTT) compared to the more commonly used thiol modification. When the dye labelled oligonucleotide nanoparticle conjugates are exposed to the same conditions there is a pronounced increase in the stability for both thioctic acid and thiol modified sequences. These results open up the possibility of simply using a dye label to enhance the stability of oligonucleotide-nanoparticle conjugates in DNA detection assays where the enhanced stability of the conjugate system can be advantageous in more complex biological environments.

  12. Recommendations for safety pharmacology evaluations of oligonucleotide-based therapeutics.

    PubMed

    Berman, Cindy L; Cannon, Keri; Cui, Yi; Kornbrust, Douglas J; Lagrutta, Armando; Sun, Sunny Z; Tepper, Jeff; Waldron, Gareth; Younis, Husam S

    2014-08-01

    This document was prepared by the Safety Pharmacology Subcommittee of the Oligonucleotide Safety Working Group (OSWG), a group of industry and regulatory scientists involved in the development and regulation of therapeutic oligonucleotides. The mission of the Subcommittee was to develop scientific recommendations for the industry regarding the appropriate scope and strategies for safety pharmacology evaluations of oligonucleotides (ONs). These recommendations are the consensus opinion of the Subcommittee and do not necessarily reflect the current expectations of regulatory authorities. 1) Safety pharmacology testing, as described in the International Conference on Harmonisation (ICH) S7 guidance, is as applicable to ONs as it is to small molecule drugs and biotherapeutics. 2) Study design considerations for ONs are similar to those for other classes of drugs. In general, as with other therapeutics, studies should evaluate the drug product administered via the clinical route. Species selection should ideally consider relevance of the model with regard to the endpoints of interest, pharmacological responsiveness, and continuity with the nonclinical development program. 3) Evaluation of potential effects in the core battery (cardiovascular, central nervous, and respiratory systems) is recommended. In general: a. In vitro human ether-a-go-go-related gene (hERG) testing does not provide any specific value and is not warranted. b. Emphasis should be placed on in vivo evaluation of cardiovascular function, typically in nonhuman primates (NHPs). c. Due to the low level of concern, neurologic and respiratory function can be assessed concurrently with cardiovascular safety pharmacology evaluation in NHPs, within repeat-dose toxicity studies, or as stand-alone studies. In the latter case, rodents are most commonly used. 4) Other dedicated safety pharmacology studies, beyond the core battery, may have limited value for ONs. Although ONs can accumulate in the kidney and liver

  13. Frequent oligonucleotides and peptides of the Haemophilus influenzae genome.

    PubMed Central

    Karlin, S; Mrázek, J; Campbell, A M

    1996-01-01

    The complete Haemophilus influenzae genome (1.83 Mb, Rd strain) provides opportunities for characterizing global genomic inhomogeneities and for detecting important sequence signals. Along these lines, new methods for identifying frequent words (oligonucleotides and/or peptides) and their distributions are applied to the H.influenzae genome with some comparisons and contrasts made with frequent words of other bacterial genomes. Three major classes of frequent oligonucleotides stand out: (i) oligos related to the familiar uptake signal sequences (USSs), AAGTGCGGT (USS+) and its inverted complement (USS-), (ii) multiple tetranucleotide iterations and (iii) intergenic dyad sequences (ISDs) found as AAGCCCACCCTAC and its dyad form. The USS+ and USS- occur in almost equal counts, are remarkably evenly spaced around the genome, and appear predominantly in the same reading frame of protein coding domains (USS+ translated to Ser-Ala-Val, USS- translated to Thr-Ala-Leu). These observations suggest that USSs contribute to global genomic functions, for example, in replication and/or repair processes, or as membrane attachment sites, or as sequences helping to pack DNA. The long tetranucleotide iterations, virtually unique to H.influenzae (i.e., unknown in other prokaryotes), through polymerase slippage during replication and/or homologous recombination may produce subpopulations expressing alternative proteins. The 13 bp frequent IDS words, invariably intergenic, occur mostly in clusters and provide potential for complex secondary structures suggesting that these sequences may be important signals for regulating the activity of their flanking genes. The frequent oligopeptides of H.influenzae are principally of two kinds--those induced by oligonucleotide frequent words (USSs, tetranucleotide iterations), and those associated with ATP or GTP binding sites that are generally composed of three motifs: the A-box which contributes to delineating the binding pocket; the B-box which

  14. Development and application of small-subunit rRNA probes for assessment of selected Thiobacillus species and members of the genus Acidiphilium.

    PubMed

    Peccia, J; Marchand, E A; Silverstein, J; Hernandez, M

    2000-07-01

    Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using (32)P radiolabels, probe specificity was characterized by hybridization dissociation temperature (T(d)) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined T(d)s. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris. PMID:10877807

  15. Application of rRNA-based probes for observing marine nanoplanktonic protists.

    PubMed Central

    Lim, E L; Amaral, L A; Caron, D A; DeLong, E F

    1993-01-01

    The use of small-subunit rRNA-based oligonucleotides as probes for detecting marine nanoplanktonic protists was examined with a ciliate (an Uronema sp.), a flagellate (a Cafeteria sp.), and mixed assemblages of protists from enrichment cultures and natural seawater samples. Flow cytometry and epifluorescence microscopy analyses demonstrated that hybridizations employing fluorescein-labeled, eukaryote-specific probes intensely stained logarithmically growing protists, whereas these same protist strains in late stationary growth were barely detectable. The fluorescence intensity due to probe binding was significantly enhanced by the use of probes end labeled with biotin, which were detected by fluorescein-labeled avidin. The degree of signal amplification ranged from two- to fivefold for cultured protists in both logarithmic and stationary growth phases. Mixed assemblages of heterotrophic protists from enrichment cultures were also intensely labeled by rRNA-targeted oligonucleotide probes by the biotin-avidin detection system. Protists in late stationary growth phase and natural assemblages of protists that were otherwise undetectable when hybridized with fluorescein-labeled probes were easily visualized by this approach. In the latter samples, hybridization with multiple, biotin-labeled probes was necessary for detection of naturally occurring marine protists by epifluorescence microscopy. The signal amplification obtained with the biotin-avidin system should increase the utility of rRNA-targeted probes for identifying protists and facilitate characterization of the population structure and distribution of protists in aquatic environments. Images PMID:8517756

  16. L-DNAs as potential antimessenger oligonucleotides: a reassessment.

    PubMed

    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J

    1993-09-11

    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. PMID:8414968

  17. L-DNAs as potential antimessenger oligonucleotides: a reassessment.

    PubMed Central

    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J

    1993-01-01

    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. Images PMID:8414968

  18. Synthesis of oligonucleotides on cellulose by a phosphotriester method.

    PubMed Central

    Crea, R; Horn, T

    1980-01-01

    The synthesis of oligothymidilic acids, (dT)m (where m = 4, 7, 10, 13, 16, 19, 22, and 25), was carried out using a solid phase approach in combination with the modified phosphotriester methodology developed in solution. Cellulose was used as the solid support after its functionalization with a specially featured dinucleoside diphosphate, 5'-0-p-chlorophenylphospho-2'(3')-0-acetyluridilyl-[2'(3')-3']-5'-0-dimethoxytritylthymidine p-chlorophenylester. The fully protected trideoxynucleoside triphosphate containing only thymidine was repeatedly used to elongate the oligonucleotide chain in the 3'-5' direction. Individual coupling yields ranged from 45% to 75%. The total time needed to prepare (dT)25 was four days. Similarly, the tridecanucleotide d(AGAAGGTACTTTT) was synthesized in good yield. The results show that this approach can be used for a fast and economic way to synthesize oligodeoxynucleotides. Images PMID:7433092

  19. Efficient site-directed saturation mutagenesis using degenerate oligonucleotides.

    PubMed

    Steffens, David L; Williams, John G K

    2007-07-01

    We describe a reliable protocol for constructing single-site saturation mutagenesis libraries consisting of all 20 naturally occurring amino acids at a specific site within a protein. Such libraries are useful for structure-function studies and directed evolution. This protocol extends the utility of Stratagene's QuikChange Site-Directed Mutagenesis Kit, which is primarily recommended for single amino acid substitutions. Two complementary primers are synthesized, containing a degenerate mixture of the four bases at the three positions of the selected codon. These primers are added to starting plasmid template and thermal cycled to produce mutant DNA molecules, which are subsequently transformed into competent bacteria. The protocol does not require purification of mutagenic oligonucleotides or PCR products. This reduces both the cost and turnaround time in high-throughput directed evolution applications. We have utilized this protocol to generate over 200 site-saturation libraries in a DNA polymerase, with a success rate of greater than 95%. PMID:17595310

  20. Oligonucleotide synthesis catalyzed by the Zn/2+/ ion

    NASA Technical Reports Server (NTRS)

    Sawai, H.; Orgel, L. E.

    1975-01-01

    Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.

  1. Computer simulation in template-directed oligonucleotide synthesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia; Benasconi, Claude F.

    1990-01-01

    It is commonly assumed that template-directed polymerizations have played a key role in prebiotic evolution. A computer simulation that models up to 33 competing reactions was used to investigate the product distribution in a template-directed oligonucleotide synthesis as a function of time and concentration of the reactants. The study focuses on the poly(C)-directed elongation reaction of oligoguanylates, and how it is affected by the competing processes of hydrolysis and dimerization of the activated monomer, which have the potential of severely curtailing the elongation and reducing the size and yield of the synthesized polymers. The simulations show that realistic and probably prebiotically plausible conditions can be found where hydrolysis and dimerization are either negligible or where a high degree of polymerization can be attained even in the face of substantial hydrolysis and/or dimerization.

  2. Insights to primitive replication derived from structures of small oligonucleotides

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Fox, G. E.

    1995-01-01

    Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

  3. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  4. New reagents for the introduction of reactive functional groups into chemically synthesized DNA probes.

    PubMed

    Skrzypczynski, Zbigniew; Wayland, Sarah

    2003-01-01

    An efficient and versatile preparative approach is described, allowing for the preparation of DNA probes modified with an aldehyde group at the 3'- or 5'-end. The developed synthetic strategy allows for the preparation of a new family of phosphoramidites and solid supports compatible with the automated synthesis of modified oligonucleotide probes. These new reagents were prepared from intermediates 3 and 3a, obtained from the commercially available aleuritic acid 1. It was demonstrated that the new phosphoramidite reagents also could be used as new types of cleavable linkers. A new and efficient method for the production of 5' aldehyde-labeled DNA probes was developed. PMID:12757390

  5. NANOSTRUCTURED PROBES FOR IN VIVO GENE DETECTION

    PubMed Central

    Bao, Gang; Santangelo, Phillip; Nitin, Nitin; Rhee, Won Jong

    2010-01-01

    The ability to visualize in real-time the expression dynamics and localization of specific RNAs in vivo offers tremendous opportunities for biological and disease studies including cancer detection. However, quantitative methods such as real-time PCR and DNA microarrays rely on the use of cell lysates thus not able to obtain important spatial and temporal information. Fluorescence proteins and other reporter systems cannot image endogenous RNA in living cells. Fluorescence in situ hybridization (FISH) assays require washing to achieve specificity, therefore can only be used with fixed cells. Here we review the recent development of nanostructured probes for living cell RNA detection, and discuss the biological and engineering issues and challenges of quantifying gene expression in vivo. In particular, we describe methods that use oligonucleotide probes, combined with novel delivery strategies, to image the relative level, localization and dynamics of RNA in live cells. Examples of detecting endogenous mRNAs, as well as imaging their subcellular localization are given to illustrate the biological applications, and issues in probe design, delivery and target accessibility are discussed. The nanostructured probes promise to open new and exciting opportunities in sensitive gene detection for a wide range of biological and medical applications. PMID:22138717

  6. Stereospecificity of Oligonucleotide Interactions Revisited: No Evidence for Heterochiral Hybridization and Ribozyme/DNAzyme Activity

    PubMed Central

    Hoehlig, Kai; Bethge, Lucas; Klussmann, Sven

    2015-01-01

    A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-)oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be) stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa) prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications. PMID:25679211

  7. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    PubMed

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  8. Oligonucleotides Designed to Inhibit TLR9 Block Herpes Simplex Virus type 1 Infection at Multiple Steps

    PubMed Central

    Sauter, Monica M.; Gauger, Joshua J. L.; Brandt, Curtis R.

    2014-01-01

    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor–kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLR) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2 hours prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10 to 20 micromolar. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution. PMID:24995383

  9. 2′-Fluoro-modified phosphorothioate oligonucleotide can cause rapid degradation of P54nrb and PSF

    PubMed Central

    Shen, Wen; Liang, Xue-hai; Sun, Hong; Crooke, Stanley T.

    2015-01-01

    Synthetic oligonucleotides are used to regulate gene expression through different mechanisms. Chemical modifications of the backbone of the nucleic acid and/or of the 2′ moiety of the ribose can increase nuclease stability and/or binding affinity of oligonucleotides to target molecules. Here we report that transfection of 2′-F-modified phosphorothioate oligonucleotides into cells can reduce the levels of P54nrb and PSF proteins through proteasome-mediated degradation. Such deleterious effects of 2′-F-modified oligonucleotides were observed in different cell types from different species, and were independent of oligonucleotide sequence, positions of the 2′-F-modified nucleotides in the oligonucleotides, method of delivery or mechanism of action of the oligonucleotides. Four 2′-F-modified nucleotides were sufficient to cause the protein reduction. P54nrb and PSF belong to Drosophila behavior/human splicing (DBHS) family. The third member of the family, PSPC1, was also reduced by the 2′-F-modified oligonucleotides. Preferential association of 2′-F-modified oligonucleotides with P54nrb was observed, which is partially responsible for the protein reduction. Consistent with the role of DBHS proteins in double-strand DNA break (DSB) repair, elevated DSBs were observed in cells treated with 2′-F-modified oligonucleotides, which contributed to severe impairment in cell proliferation. These results suggest that oligonucleotides with 2′-F modifications can cause non-specific loss of cellular protein(s). PMID:25855809

  10. Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.

    PubMed

    Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro

    2016-02-19

    A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS. PMID:26845521

  11. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Zieboll, Gerhard; Orgel, Leslie E.

    1994-01-01

    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  12. Antisense c-myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo

    NASA Astrophysics Data System (ADS)

    Simons, Michael; Edelman, Elazer R.; Dekeyser, Jean-Luc; Langer, Robert; Rosenberg, Robert D.

    1992-09-01

    SYNTHETIC antisense oligonucleotides have been used to dissect gene function in vitro. Technical difficulties prevented the use of this approach for investigating the effect of gene products in vivo. Here we report the use of local delivery of antisense c-myb oligonu-cleotide to suppress intimal accumulation of rat carotid arterial smooth muscle cells. Our results suggest that antisense oligonucleotides can be used to define the in vivo biological role of specific macromolecules in the blood vessel wall and could potentially serve as a new class of therapeutic agents for cardiovascular disorders.

  13. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  14. Preparation of Complex DNA Probe Sets for 3D FISH with up to Six Different Fluorochromes.

    PubMed

    Müller, Stefan; Neusser, Michaela; Köhler, Daniela; Cremer, Marion

    2007-01-01

    INTRODUCTIONDNA probes for fluorescence in situ hybridization (FISH) can be generated and labeled by various methods. This protocol describes the conjugation of dUTPs with haptens or fluorochromes, as well as the generation and labeling of DNA probes using those modified dUTPs. Sources of probe DNA include genomic DNA, DNA from flow-sorted chromosomes, bacterial artificial chromosomes (BACs), and cosmids. DNA amplification and labeling procedures involving degenerate oligonucleotide-primed PCR (DOP-PCR) and multiple displacement amplification (MDA) are provided. Advice is given for setting up complex probe pools, such as those containing large pools of BAC probes. Also included is a method for probe precipitation and preparation of a hybridization mix ready to be used for 3D fluorescence in situ hybridization (FISH) experiments. PMID:21357075

  15. Minimum probe length for unique identification of all open reading frames in a microbial genome

    SciTech Connect

    Sokhansanj, B A; Ng, J; Fitch, J P

    2000-03-05

    In this paper, we determine the minimum hybridization probe length to uniquely identify at least 95% of the open reading frame (ORF) in an organism. We analyze the whole genome sequences of 17 species, 11 bacteria, 4 archaea, and 2 eukaryotes. We also present a mathematical model for minimum probe length based on assuming that all ORFs are random, of constant length, and contain an equal distribution of bases. The model accurately predicts the minimum probe length for all species, but it incorrectly predicts that all ORFs may be uniquely identified. However, a probe length of just 9 bases is adequate to identify over 95% of the ORFs for all 15 prokaryotic species we studied. Using a minimum probe length, while accepting that some ORFs may not be identified and that data will be lost due to hybridization error, may result in significant savings in microarray and oligonucleotide probe design.

  16. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens.

    PubMed

    Lee, Dae-Young; Lauder, Heather; Cruwys, Heather; Falletta, Patricia; Beaudette, Lee A

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10(3)A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater. PMID:18423816

  17. Luminescent Probes for Ultrasensitive Detection of Nucleic Acids

    PubMed Central

    Krasnoperov, Lev N.; Marras, Salvatore A.E.; Kozlov, Maxim; Wirpsza, Laura; Mustaev, Arkady

    2010-01-01

    Novel amino-reactive derivatives of lanthanide-based luminescent labels of enhanced brightness and metal retention were synthesized and used for the detection of complementary DNA oligonucleotides by molecular beacons. Time-resolved acquisition of the luminescent signal that occurs upon hybridization of the probe to the target enabled the avoidance of short-lived background fluorescence, markedly enhancing the sensitivity of detection, which was less than 1 pM. This value is about 50 to 100 times more sensitive than the level achieved with conventional fluorescence-based molecular beacons, and is 10 to 60 times more sensitive than previously reported for other lanthanide-based hybridization probes. These novel luminescent labels should significantly enhance the sensitivity of all type of nucleic acid hybridization probes, and could dramatically improve the detection limit of other biopolymers and small compounds that are used in a variety of biological applications. PMID:20085336

  18. Characterization of Chromosomal Inversions Using Anti-Parallel Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2015-01-01

    A method for the characterization of chromosomal inversions using anti-parallel probes is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. Further, one or more reporter species are replaced with anti-parallel probes that hybridize at known locations along the second sister chromatid such that the position and size of the inversion may be identified/estimated.

  19. Multi-Gene Detection and Identification of Mosquito-Borne RNA Viruses Using an Oligonucleotide Microarray

    PubMed Central

    Grubaugh, Nathan D.; McMenamy, Scott S.; Turell, Michael J.; Lee, John S.

    2013-01-01

    Background Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae), Alphavirus (Togaviridae), Orthobunyavirus (Bunyaviridae), and Phlebovirus (Bunyaviridae). Methodology/Principal Findings The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. Conclusions/Significance We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish public health

  20. Development of Polymer-Coated Glass Slides as Optical Oligonucleotide Microarrays

    PubMed Central

    Pourjahed, Atefeh; Rabiee, Mohammad; Tahriri, Mohammadreza

    2013-01-01

    Background The microarray technology is in needed of cost-effective, low background noise and stable substrates for successful hybridization and analysis. Methods In this research, we developed a three-dimentional stable and mechanically reliable microarray substrates by coating of two polymeric layers on standard microscope glass slides. For fabrication of these substrates, a thin film of oxidized agarose was prepared on the Poly-L-Lysine (PLL) coated glass slides. Unmodified oligonucleotide probes were spotted and immobilized on these double layered thin films by adsorption on the porous structure of the agarose film. Some of the aldehyde groups of the activated agarose linked covalently to PLL amine groups; on the other side, they bound to amino groups of adsorbed tail of biomolecules. These linkages were fixed by UV irradiation at 254 nm using a CL-1000 UV. These prepared substrates were compared to only agarose-coated and PLL-coated slides Results Atomic Force Microscope (AFM) results demonstrated that agarose provided three-dimensional surface which had higher loading and bindig capacity for biomolecules than PLL-coated surface which had two-dimensional surface. The nano-indentation tests demonstrated the prepared double coating was more reliable and flexible for mechanical robotic spotting. In addition, the repeated indentation on different substrates showed uniformity of coatings. The stability of novel coating was sufficient for hybridization process. The signal-to-noise ratio in hybridization reactions performed on the agarose-PLL coated substrates increased two fold and four fold compared to agarose and PLL coated substrates, respectively. Conclusion Finally, the agarose-PLL microarrays had the highest signal (2920) and lowest background signal (205) in hybridization, suggesting that the prepared slides are suitable in analyzing wide concentration range of analytes. PMID:24285999

  1. Carboranyl Nucleosides & Oligonucleotides for Neutron Capture Therapy Final Report

    SciTech Connect

    Schinazi, Raymond F.

    2004-12-01

    This proposal enabled us to synthesize and develop boron-rich nucleosides and oligonucleotide analogues for boron neutron capture therapy (BNCT) and the treatment of various malignancies. First, we determined the relationship between structure, cellular accumulation and tissue distribution of 5-o-carboranyl-2'-deoxyuridine (D-CDU) and its derivatives D-ribo-CU and 5-o-carboranyluracil (CU), to potentially target brain and other solid tumors for neutron capture therapy. Synthesized carborane containing nucleoside derivatives of CDU, D- and L-enantiomers of CDU, D-ribo-CU and CU were used. We measured tissue disposition in xenografted mice bearing 9479 human prostate tumors xenografts and in rats bearing 9L gliosarcoma isografts in their flanks and intracranially. The accumulation of D-CDU, 1-({beta}-L-arabinosyl)-5-o-carboranyluracil, D-ribo-CU, and CU were also studied in LnCap human prostate tumor cells and their retention was measured in male nude mice bearing LnCap and 9479 human prostate tumor xenografts. D-CDU, D-ribo-CU and CU levels were measured after administration in mice bearing 9479 human prostate tumors in their flanks. D-CDU achieved high cellular concentrations in LnCap cells and up to 2.5% of the total cellular compound was recovered in the 5'-monophosphorylated form. D-CDU cellular concentrations were similar in LnCap and 9479 tumor xenografts. Studies in tumor bearing animals indicated that increasing the number of hydroxyl moieties in the sugar constituent of the carboranyl nucleosides lead to increased rate and extent of renal elimination, a decrease in serum half-lives and an increased tissue specificity. Tumor/brain ratios were greatest for CDU and D-ribo-CU, while tumor/prostate ratios were greatest with CU. CDU and D-ribo-CU have potential for BNCT of brain malignancies, while CU may be further developed for prostate cancer. A method was developed for the solid phase synthesis of oligonucleotides containing (ocarboran-1-yl

  2. The Fidelity of Template-Directed Oligonucleotide Ligation and the Inevitability of Polymerase Function

    NASA Astrophysics Data System (ADS)

    James, Kenneth D.; Ellington, Andrew D.

    1999-08-01

    The first living systems may have employed template-directed oligonucleotide ligation for replication. The utility of oligonucleotide ligation as a mechanism for the origin and evolution of life is in part dependent on its fidelity. We have devised a method for evaluating ligation fidelity in which ligation substrates are selected from random sequence libraries. The fidelities of chemical and enzymatic ligation are compared under a variety of conditions. While reaction conditions can be found that promote high fidelity copying, departure from these conditions leads to error-prone copying. In particular, ligation reactions with shorter oligonucleotide substrates are less efficient but more faithful. These results support a model for origins in which there was selective pressure for template-directed oligonucleotide ligation to be gradually supplanted by mononucleotide polymerization.

  3. On-line coupling of capillary gel electrophoresis with electrospray mass spectrometry for oligonucleotide analysis.

    PubMed

    Freudemann, T; von Brocke, A; Bayer, E

    2001-06-01

    Homooligodeoxyribonucleotides differing one nucleotide in length from 12- to 15-mer and from 17- to 20-mer were separated by size with capillary gel electrophoresis (CGE) using an entangled polymer solution in coated capillaries. The resolved components were analyzed by on-line coupling of CGE with electrospray mass spectrometry (ES-MS), denoted as CGE/ES-MS, in the full-scan negative ion detection mode. Baseline separation was achieved for the 12-15-mer oligonucleotide mixtures. Both synthetic phosphodiester oligonucleotide mixtures as well as their phosphorothioate analogues, serving as model compounds for antisense oligonucleotides, could be analyzed by on-line CGE/ES-MS coupling. Terminally phosphorylated and nonphosphorylated synthetic failure sequences could be electrophoretically separated and mass spectrometically characterized as well. This methodology might be a useful tool for synthesis control of phosphodiester oligonucleotides as well as for analysis of phosphorothioate analogues as they are used in antisense drug development. PMID:11403304

  4. Synthesis and thermodynamics of oligonucleotides containing chirally pure R(P) methylphosphonate linkages.

    PubMed Central

    Reynolds, M A; Hogrefe, R I; Jaeger, J A; Schwartz, D A; Riley, T A; Marvin, W B; Daily, W J; Vaghefi, M M; Beck, T A; Knowles, S K; Klem, R E; Arnold, L J

    1996-01-01

    Methylphosphonate (MP) oligodeoxynucleotides (MPOs) are metabolically stable analogs of conventional DNA containing a methyl group in place of one of the non-bonding phosphoryl oxygens. All 16 possible chiral R(P) MP dinucleotides were synthesized and derivatized for automated oligonucleotide synthesis. These dimer synthons can be used to prepare (i) all-MP linked oligonucleotides having defined R(P) chirality at every other position (R(P) chirally enriched MPOs) or (ii) alternating R(P) MP/phosphodiester backbone oligonucleotides, depending on the composition of the 3'-coupling group. Chirally pure dimer synthons were also prepared with 2'-O-methyl sugar modifications. Oligonucleotides prepared with these R(P) chiral methylphosphonate linkage synthons bind RNA with significantly higher affinity than racemic MPOs. PMID:8948653

  5. Use of synthetic oligonucleotides for genomic DNA dot hybridization to split the DQw3 haplotype.

    PubMed Central

    Martell, M; Le Gall, I; Millasseau, P; Dausset, J; Cohen, D

    1988-01-01

    Comparison of two different HLA-DQ beta gene sequences from two DR4 individuals, probably corresponding to DQw3.2 (DQR4) and DQw3.1 (DQR5) specificities, has shown several nucleotide variations. Eight oligonucleotides (24 bases long), derived from these polymorphic areas, have been synthesized. Each oligonucleotide was hybridized to BamHI-digested DNA samples from eight families with HLA-DR4 individuals. Four polymorphic BamHI fragments were detected. Two of eight oligonucleotides gave a single signal (8.9 kilobases) on DQw3.2-positive haplotypes. We used one of these oligonucleotides in a genomic DNA dot hybridization and detected a hybridization signal only in DQw3.2-positive individuals. A very simple test like this allows the screening of a large population sample within a very short period. Images PMID:2895927

  6. Sequence identity of the n-1 product of a synthetic oligonucleotide.

    PubMed Central

    Temsamani, J; Kubert, M; Agrawal, S

    1995-01-01

    After synthesis and purification of an oligonucleotide, the final product usually contains a low level of n-1 congeneric species. We have sequenced the n-1 population of a 25mer phosphodiester oligonucleotide. The n-1 band was cut from the gel and eluted. Oligonucleotides were tailed with dA and annealed to a dT-tailed plasmid. The recombinant plasmid was ligated and used to transform competent bacteria. Our results show that the n-1 population was heterogeneous. The frequency of truncated nucleotides at the 3'-end was much higher than at the 5'-end of the oligomer. No truncated nucleotides were found in the last four nucleotides at the 5'-end. Our results also show that the chain of oligonucleotides can grow on unreacted sites of a controlled-pore glass support. Images PMID:7596808

  7. Complexes of carbon nanotubes with oligonucleotides in thin Langmuir-Blodgett films to detect electrochemically hybridization

    NASA Astrophysics Data System (ADS)

    Egorov, A. S.; Egorova, V. P.; Krylova, H. V.; Lipnevich, I. V.; Orekhovskaya, T. I.; Veligura, A. A.; Govorov, M. I.; Shulitsky, B. G.

    2014-10-01

    Self-assembled complexes consisting of thin multi-walled carbon nanotubes (MWCNTs) and DNA-oligonucleotides which are able to a cooperative binding to complementary oligonucleotides have been investigated. It was establised a high-performance charge transport in nanostructured Langmuir-Blodgett complexes thin MWCNTs/DNA. A method to electrochemically detect DNA hybridization on the self-organized structures has been proposed.

  8. DNA hybridization in nanostructural molecular assemblies enables detection of gene mutations without a fluorescent probe.

    PubMed

    Maruyama, Tatsuo; Park, Lian-Chun; Shinohara, Toshimitsu; Goto, Masahiro

    2004-01-01

    We have developed a simple single nucleotide polymorphisms (SNPs) analysis utilizing DNA hybridization in nanostructural molecular assemblies. The novel technique enables the detection of a single-base mismatch in a DNA sequence without a fluorescent probe. This report describes for the first time that DNA hybridization occurs in the nanostructural molecular assemblies (termed reverse micelles) formed in an organic medium. The restricted nanospace in the reverse micelles amplifies the differences in the hybridization rate between mismatched and perfectly matched DNA probes. For a model system, we hybridized a 20-mer based on the p53 gene sequence to 20-mer complementary oligonucleotides with various types of mismatches. Without any DNA labeling or electrochemical apparatus, we successfully detected the various oligonucleotide mismatches by simply measuring the UV absorbance at 260 nm. PMID:14715007

  9. A Locked Nucleic Acid Probe Based on Selective Salt-Induced Effect Detects Single Nucleotide Polymorphisms

    PubMed Central

    Zhang, Jing; Wu, Huizhe; Chen, Qiuchen; Zhao, Pengfei; Zhao, Haishan; Yao, Weifan; Wei, Minjie

    2015-01-01

    Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A) from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature. PMID:26347880

  10. Directly incorporating fluorochromes into DNA probes by PCR increases the efficience of fluorescence in situ hybridization

    SciTech Connect

    Dittmer, Joy

    1996-05-01

    The object of this study was to produce a directly labeled whole chromosome probe in a Degenerative Oligonucleotide Primed-Polymerase Chain Reaction (DOP-PCR) that will identify chromosome breaks, deletions, inversions and translocations caused by radiation damage. In this study we amplified flow sorted chromosome 19 using DOP-PCR. The product was then subjected to a secondary DOP PCR amplification, After the secondary amplification the DOP-PCR product was directly labeled in a tertiary PCR reaction with rhodamine conjugated with dUTP (FluoroRed) to produce a DNA fluorescent probe. The probe was then hybridized to human metaphase lymphocytes on slides, washed and counterstained with 4{prime},6-diamino-2-phenylindole (DAPI). The signal of the FluoroRed probe was then compared to a signal of a probe labeled with biotin and stained with avidin fluorescein isothio cynate (FITC) and anti-avidin FITC. The results show that the probe labeled with FluoroRed gave signals as bright as the probe with biotin labeling. The FluoroRed probe had less noise than the biotin labeled probe. Therefore, a directly labeled probe has been successfully produced in a DOP-PCR reaction. In future a probe labeled with FluoroRed will be produced instead of a probe labeled with biotin to increase efficiency.

  11. Cationic nanoemulsion as a delivery system for oligonucleotides targeting malarial topoisomerase II.

    PubMed

    Bruxel, F; Cojean, S; Bochot, A; Teixeira, H; Bories, C; Loiseau, P-M; Fattal, E

    2011-09-20

    A promising strategy based on the antisense oligonucleotides against the Plasmodium falciparum topoisomerase II has been considered using cationic nanoemulsion as oligonucleotide delivery system. Phosphodiester and chemically modified phosphorothioate oligonucleotides bearing negative charges were adsorbed on positively charged emulsion composed of medium chain triglycerides, egg lecithin, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), and water, at different +/- charge ratios (positive charges from cationic lipid/negative charges from oligonucleotide): +0.5/-, +2/-, +4/- and +6/-. The physicochemical properties of the complexes were determined, as well as their stability in culture medium. Their interaction with erythrocytes through hemolysis, binding experiments and confocal microscopy were also evaluated. Finally, the in vitro evaluation of parasite growth and reinfection capacity was performed. The overall results showed that antisense oligonucleotides against P. falciparum topoisomerase II gene can be efficiently adsorbed onto a cationic nanoemulsion forming complexes. Whereas unloaded nanoemulsion displayed an hemolytic effect due to the presence of the cationic lipid, this was not the case of loaded nanoemulsion at low +/- ratios. Oligonucleotide-loaded nanoemulsions were found to be located inside the infected erythrocytes, inhibiting efficiently parasite growth (until 80%) and causing a delay in P. falciparum life cycle. PMID:21291974

  12. Fragment-based solid-phase assembly of oligonucleotide conjugates with peptide and polyethylene glycol ligands.

    PubMed

    Dirin, Mehrdad; Urban, Ernst; Noe, Christian R; Winkler, Johannes

    2016-10-01

    Ligand conjugation to oligonucleotides is an attractive strategy for enhancing the therapeutic potential of antisense and siRNA agents by inferring properties such as improved cellular uptake or better pharmacokinetic properties. Disulfide linkages enable dissociation of ligands and oligonucleotides in reducing environments found in endosomal compartments after cellular uptake. Solution-phase fragment coupling procedures for producing oligonucleotide conjugates are often tedious, produce moderate yields and reaction byproducts are frequently difficult to remove. We have developed an improved method for solid-phase coupling of ligands to oligonucleotides via disulfides directly after solid-phase synthesis. A 2'-thiol introduced using a modified nucleotide building block was orthogonally deprotected on the controlled pore glass solid support with N-butylphosphine. Oligolysine peptides and a short monodisperse ethylene glycol chain were successfully coupled to the deprotected thiol. Cleavage from the resin and full removal of oligonucleotide protection groups were achieved using methanolic ammonia. After standard desalting, and without further purification, homogenous conjugates were obtained as demonstrated by HPLC, gel electrophoresis, and mass spectrometry. The attachment of both amphiphilic and cationic ligands proves the versatility of the conjugation procedure. An antisense oligonucleotide conjugate with hexalysine showed pronounced gene silencing in a cell culture tumor model in the absence of a transfection reagent and the corresponding ethylene glycol conjugate resulted in down regulation of the target gene to nearly 50% after naked application. PMID:27236069

  13. In vitro characterization of two novel biodegradable vectors for the delivery of radiolabeled antisense oligonucleotides.

    PubMed

    von Guggenberg, Elisabeth; Shahhosseini, Soraya; Koslowsky, Ingrid; Lavasanifar, Afsaneh; Murray, David; Mercer, John

    2010-12-01

    The development of antisense oligonucleotides suitable for tumor targeting applications is hindered by low stability and bioavailability of oligonucleotides in vivo and by the absence of efficient and safe vectors for oligonucleotide delivery. Stabilization in vivo has been achieved through chemical modification of oligonucleotides by various means, but effective approaches to enhance their intracellular delivery are lacking. This study reports on the characterization in vitro of a fully phosphorothioated 20-mer oligonucleotide, complementary to p21 mRNA, radiolabeled with fluorine-18 using a thiol reactive prosthetic group. The potential of two novel synthetic block copolymers containing grafted polyamines on their hydrophobic blocks for vector-assisted cell delivery was studied in vitro. Extensive cellular uptake studies were performed in human colon carcinoma cell lines with enhanced or deficient p21 expression to evaluate and compare the uptake mechanism of naked and vectorized radiolabeled formulations. Uptake studies with the two novel biodegradable vectors showed a moderate increase in cell uptake of the radiofluorinated antisense oligonucleotide. The two vectors show, however, promising advantages over conventional lipidic vectors regarding their biocompatibility and subcellular distribution. PMID:21204767

  14. Peptide nanoparticle delivery of charge-neutral splice-switching morpholino oligonucleotides.

    PubMed

    Järver, Peter; Zaghloul, Eman M; Arzumanov, Andrey A; Saleh, Amer F; McClorey, Graham; Hammond, Suzan M; Hällbrink, Mattias; Langel, Ülo; Smith, C I Edvard; Wood, Matthew J A; Gait, Michael J; El Andaloussi, Samir

    2015-04-01

    Oligonucleotide analogs have provided novel therapeutics targeting various disorders. However, their poor cellular uptake remains a major obstacle for their clinical development. Negatively charged oligonucleotides, such as 2'-O-Methyl RNA and locked nucleic acids have in recent years been delivered successfully into cells through complex formation with cationic polymers, peptides, liposomes, or similar nanoparticle delivery systems. However, due to the lack of electrostatic interactions, this promising delivery method has been unsuccessful to date using charge-neutral oligonucleotide analogs. We show here that lipid-functionalized cell-penetrating peptides can be efficiently exploited for cellular transfection of the charge-neutral oligonucleotide analog phosphorodiamidate morpholino. The lipopeptides form complexes with splice-switching phosphorodiamidate morpholino oligonucleotide and can be delivered into clinically relevant cell lines that are otherwise difficult to transfect while retaining biological activity. To our knowledge, this is the first study to show delivery through complex formation of biologically active charge-neutral oligonucleotides by cationic peptides. PMID:25594433

  15. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.

    PubMed

    Beaucage, S L

    2001-08-01

    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips. PMID:11472237

  16. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells.

    PubMed

    Kotula, Jonathan W; Pratico, Elizabeth D; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L; Sullenger, Bruce A

    2012-06-01

    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  17. Improved DNA microarray detection sensitivity through immobilization of preformed in solution streptavidin/biotinylated oligonucleotide conjugates.

    PubMed

    Mavrogiannopoulou, E; Petrou, P S; Koukouvinos, G; Yannoukakos, D; Siafaka-Kapadai, A; Fornal, K; Awsiuk, K; Budkowski, A; Kakabakos, S E

    2015-04-01

    A novel immobilization approach involving binding of preformed streptavidin/biotinylated oligonucleotide conjugates onto surfaces coated with biotinylated bovine serum albumin is presented. Microarrays prepared according to the proposed method were compared, in terms of detection sensitivity and specificity, with other immobilization schemes employing coupling of biotinylated oligonucleotides onto directly adsorbed surface streptavidin, or sequential coupling of streptavidin and biotinylated oligonucleotides onto a layer of adsorbed biotinylated bovine serum albumin. A comparison was performed employing biotinylated oligonucleotides corresponding to wild- and mutant-type sequences of seven single point mutations of the BRCA1 gene. With respect to the other immobilization protocols, the proposed oligonucleotide immobilization approach offered the highest hybridization signals (at least 5 times higher) and permitted more elaborative washings, thus providing considerably higher discrimination between complimentary and non-complementary DNA sequences for all mutations tested. In addition, the hybridization kinetics were significantly enhanced compared to two other immobilization protocols, permitting PCR sample analysis in less than 40 min. Thus, the proposed oligonucleotide immobilization approach offered improved detection sensitivity and discrimination ability along with considerably reduced analysis time, and it is expected to find wide application in DNA mutation detection. PMID:25805150

  18. Aptamer-Mediated Delivery of Splice-Switching Oligonucleotides to the Nuclei of Cancer Cells

    PubMed Central

    Kotula, Jonathan W.; Pratico, Elizabeth D.; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L.

    2012-01-01

    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  19. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Quintela, Irwin A.; de Los Reyes, Benildo G.; Lin, Chih-Sheng; Wu, Vivian C. H.

    2015-01-01

    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g-1, requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains.A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide

  20. Reactive Microcontact Printing of DNA Probes on (DMA-NAS-MAPS) Copolymer-Coated Substrates for Efficient Hybridization Platforms.

    PubMed

    Castagna, Rossella; Bertucci, Alessandro; Prasetyanto, Eko Adi; Monticelli, Marco; Conca, Dario Valter; Massetti, Matteo; Sharma, Parikshit Pratim; Damin, Francesco; Chiari, Marcella; De Cola, Luisa; Bertacco, Riccardo

    2016-04-01

    High-performing hybridization platforms fabricated by reactive microcontact printing of DNA probes are presented. Multishaped PDMS molds are used to covalently bind oligonucleotides over a functional copolymer (DMA-NAS-MAPS) surface. Printed structures with minimum width of about 1.5 μm, spaced by 10 μm, are demonstrated, with edge corrugation lower than 300 nm. The quantification of the immobilized surface probes via fluorescence imaging gives a remarkable concentration of 3.3 × 10(3) oligonucleotides/μm(2), almost totally active when used as probes in DNA-DNA hybridization assays. Indeed, fluorescence and atomic force microscopy show a 95% efficiency in target binding and uniform DNA hybridization over printed areas. PMID:26972953

  1. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation.

    PubMed

    Kim, Jinho; Olsen, Timothy R; Zhu, Jing; Hilton, John P; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  2. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  3. Annexin A2 facilitates endocytic trafficking of antisense oligonucleotides

    PubMed Central

    Wang, Shiyu; Sun, Hong; Tanowitz, Michael; Liang, Xue-hai; Crooke, Stanley T.

    2016-01-01

    Chemically modified antisense oligonucleotides (ASOs) designed to mediate site-specific cleavage of RNA by RNase H1 are used as research tools and as therapeutics. ASOs modified with phosphorothioate (PS) linkages enter cells via endocytotic pathways. The mechanisms by which PS-ASOs are released from membrane-enclosed endocytotic organelles to reach target RNAs remain largely unknown. We recently found that annexin A2 (ANXA2) co-localizes with PS-ASOs in late endosomes (LEs) and enhances ASO activity. Here, we show that co-localization of ANXA2 with PS-ASO is not dependent on their direct interactions or mediated by ANXA2 partner protein S100A10. Instead, ANXA2 accompanies the transport of PS-ASOs to LEs, as ANXA2/PS-ASO co-localization was observed inside LEs. Although ANXA2 appears not to affect levels of PS-ASO internalization, ANXA2 reduction caused significant accumulation of ASOs in early endosomes (EEs) and reduced localization in LEs and decreased PS-ASO activity. Importantly, the kinetics of PS-ASO activity upon free uptake show that target mRNA reduction occurs at least 4 hrs after PS-ASOs exit from EEs and is coincident with release from LEs. Taken together, our results indicate that ANXA2 facilitates PS-ASO trafficking from early to late endosomes where it may also contribute to PS-ASO release. PMID:27378781

  4. Template-directed synthesis of oligonucleotides under eutectic conditions

    NASA Technical Reports Server (NTRS)

    Stribling, R.; Miller, S. L.

    1991-01-01

    One of the most important sets of model prebiotic experiments consists of reactions that synthesize complementary oligonucleotides from preformed templates under nonenzymatic conditions. Most of these experiments are conducted at 4 degrees C using 0.01-0.1 M concentrations of activated nucleotide monomer and template (monomer equivalent). In an attempt to extend the conditions under which this type of reaction can occur, we have concentrated the reactants by freezing at -18 degrees C, which is close to the NaCl-H2O eutectic at -21 degrees C. The results from this set of experiments suggest that successful syntheses can occur with poly(C) concentrations as low at 5 x 10(-4) M and 2MeImpG concentrations at 10(-3) M. It was also anticipated that this mechanism might allow the previously unsuccessful poly(A)-directed synthesis of oligo(U)s to occur. However, no template effect was seen with the poly(A) and ImpU system. The failure of these conditions to allow template-directed synthesis of oligo(U)s supports the previously proposed idea that pyrimidines may not have been part of the earliest genetic material. Because of the low concentrations of monomer and template that would be expected from prebiotic syntheses, this lower temperature could be considered a more plausible geologic setting for template-directed synthesis than the standard reaction conditions.

  5. Dicationic Surfactants with Glycine Counter Ions for Oligonucleotide Transportation.

    PubMed

    Pietralik, Zuzanna; Skrzypczak, Andrzej; Kozak, Maciej

    2016-08-01

    Gemini surfactants are good candidates to bind, protect, and deliver nucleic acids. Herein, the concept of amino acids (namely glycine) as counter ions of gemini surfactants for gene therapy application was explored. This study was conducted on DNA and RNA oligomers and two quaternary bis-imidazolium salts, having 2,5-dioxahexane and 2,8-dioxanonane spacer groups. The toxicity level of surfactants was assessed by an MTT assay, and their ability to bind nucleic acids was tested through electrophoresis. The nucleic acid conformation was established based on circular dichroism and infrared spectroscopic analyses. The structures of the formed complexes were characterized by small-angle scattering of synchrotron radiation. Both studied surfactants appear to be suitable for gene therapy; however, although they vary by only three methylene groups in the spacer, they differ in binding ability and toxicity. The tested oligonucleotides maintained their native conformations upon surfactant addition and the studied lipoplexes formed a variety of structures. In systems based on a 2,5-dioxahexane spacer, a hexagonal phase was observed for DNA-surfactant complexes and a micellar phase was dominant with RNA. For the surfactant with a 2,8-dioxanonane spacer group, the primitive cubic phase prevailed. PMID:27214208

  6. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  7. Triplex formation on DNA targets: how to choose the oligonucleotide.

    PubMed

    Vekhoff, Pierre; Ceccaldi, Alexandre; Polverari, David; Pylouster, Jean; Pisano, Claudio; Arimondo, Paola B

    2008-11-25

    Triplex-forming oligonucleotides (TFOs) are sequence-specific DNA binders. TFOs provide a tool for controlling gene expression or, when attached to an appropriate chemical reagent, for directing DNA damage. Here, we report a set of rules for predicting the best out of five different triple-helical binding motifs (TM, UM, GA, GT, and GU, where M is 5-methyldeoxycytidine and U is deoxyuridine) by taking into consideration the sequence composition of the underlying duplex target. We tested 11 different triplex targets present in genes having an oncogenic role. The rules have predictive power and are very useful in the design of TFOs for antigene applications. Briefly, we retained motifs GU and TM, and when they do form a triplex, TFOs containing G and U are preferred over those containing T and M. In the case of the G-rich TFOs, triplex formation is principally dependent on the percentage of G and the length of the TFO. In the case of the pyrimidine motif, replacement of T with U is destabilizing; triplex formation is dependent on the percentage of T and destabilized by the presence of several contiguous M residues. An equation to choose between a GU and TM motif is given. PMID:18954091

  8. Mechanism for radical cation transport in duplex DNA oligonucleotides.

    PubMed

    Liu, Chu-Sheng; Hernandez, Rigoberto; Schuster, Gary B

    2004-03-10

    We investigated the photoinduced one-electron oxidation of a series of DNA oligomers having a covalently linked anthraquinone group (AQ) and containing [(A)(n)GG](m) or [(T)(n)GG](m) segments. These oligomers have m GG steps, where m = 4 or 6, separated by (A)(n) or (T)(n) segments, where n = 1-7 for the (A)(n) set and 1-5 for the (T)(n) set. Irradiation with UV light that is absorbed by the AQ causes injection of a radical cation into the DNA. The radical cation migrates through the DNA, causing chemical reaction, primarily at GG steps, that leads to strand cleavage after piperidine treatment. The uniform, systematic structure of the DNA oligonucleotides investigated permits the numerical solution of a kinetic scheme that models these reactions. This analysis yields two rate constants, k(hop), for hopping of the radical cation from one site to adjacent sites, and k(trap), for irreversible reaction of the radical cation with H(2)O or O(2). Analysis of these findings indicates that radical cation hopping in these duplex DNA oligomers is a process that occurs on a microsecond time scale. The value of k(hop) depends on the number of base pairs in the (A)(n) and (T)(n) segments in a systematic way. We interpret these results in terms of a thermally activated adiabatic mechanism for radical cation hopping that we identify as phonon-assisted polaron hopping. PMID:14995205

  9. Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol

    PubMed Central

    Nishina, Tomoko; Numata, Junna; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Nitta, Keiko; Piao, Wenying; Iwata, Rintaro; Ito, Shingo; Kuwahara, Hiroya; Wada, Takeshi; Mizusawa, Hidehiro; Yokota, Takanori

    2015-01-01

    We developed an efficient system for delivering short interfering RNA (siRNA) to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid)-DNA gapmer antisense oligonucleotide (ASO) was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA) as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS) molecules are bound to ASO with UNA sequences. PMID:25584900

  10. Phosphorothioate Antisense Oligonucleotides Induce the Formation of Nuclear Bodies

    PubMed Central

    Lorenz, Peter; Baker, Brenda F.; Bennett, C. Frank; Spector, David L.

    1998-01-01

    Antisense oligonucleotides are powerful tools for the in vivo regulation of gene expression. We have characterized the intracellular distribution of fluorescently tagged phosphorothioate oligodeoxynucleotides (PS-ONs) at high resolution under conditions in which PS-ONs have the potential to display antisense activity. Under these conditions PS-ONs predominantly localized to the cell nucleus where they accumulated in 20–30 bright spherical foci designated phosphorothioate bodies (PS bodies), which were set against a diffuse nucleoplasmic population excluding nucleoli. PS bodies are nuclear structures that formed in cells after PS-ON delivery by transfection agents or microinjection but were observed irrespectively of antisense activity or sequence. Ultrastructurally, PS bodies corresponded to electron-dense structures of 150–300 nm diameter and resembled nuclear bodies that were found with lower frequency in cells lacking PS-ONs. The environment of a living cell was required for the de novo formation of PS bodies, which occurred within minutes after the introduction of PS-ONs. PS bodies were stable entities that underwent noticeable reorganization only during mitosis. Upon exit from mitosis, PS bodies were assembled de novo from diffuse PS-ON pools in the daughter nuclei. In situ fractionation demonstrated an association of PS-ONs with the nuclear matrix. Taken together, our data provide evidence for the formation of a nuclear body in cells after introduction of phosphorothioate oligodeoxynucleotides. PMID:9571236

  11. Evolutionary sequence comparisons using high-density oligonucleotide arrays.

    PubMed

    Hacia, J G; Makalowski, W; Edgemon, K; Erdos, M R; Robbins, C M; Fodor, S P; Brody, L C; Collins, F S

    1998-02-01

    We explored the utility of high-density oligonucleotide arrays (DNA chips) for obtaining sequence information from homologous genes in closely related species. Orthologues of the human BRCA1 exon 11, all approximately 3.4 kb in length and ranging from 98.2% to 83.5% nucleotide identity, were subjected to hybridization-based and conventional dideoxysequencing analysis. Retrospective guidelines for identifying high-fidelity hybridization-based sequence calls were formulated based upon dideoxysequencing results. Prospective application of these rules yielded base-calling with at least 98.8% accuracy over orthologous sequence tracts shown to have approximately 99% identity. For higher primate sequences with greater than 97% nucleotide identity, base-calling was made with at least 99.91% accuracy covering a minimum of 97% of the sequence. Using a second-tier confirmatory hybridization chip strategy, shown in several cases to confirm the identity of predicted sequence changes, the complete sequence of the chimpanzee, gorilla and orangutan orthologues should be deducible solely through hybridization-based methodologies. Analysis of less highly conserved orthologues can still identify conserved nucleotide tracts of at least 15 nucleotides and can provide useful information for designing primers. DNA-chip based assays can be a valuable new technology for obtaining high-throughput cost-effective sequence information from related genomes. PMID:9462745

  12. Antineoplastic Effect of Decoy Oligonucleotide Derived from MGMT Enhancer

    PubMed Central

    Refael, Miri; Zrihan, Daniel; Siegal, Tali; Lavon, Iris

    2014-01-01

    Silencing of O(6)-methylguanine-DNA-methyltransferase (MGMT) in tumors, mainly through promoter methylation, correlates with a better therapeutic response and with increased survival. Therefore, it is conceivable to consider MGMT as a potential therapeutic target for the treatment of cancers. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through p65/NF-kappaB homodimers. Here we show that the non-canonical NF-KappaB motif (MGMT-kappaB1) within MGMT enhancer is probably the major inducer of MGMT expression following NF-kappaB activation. Thus, in an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA) modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN). Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to the NF-KappaB motif within MGMT enhancer, the efficacy of the decoy was studied in-vitro and in-vivo. The results of these experiments show that the decoy MGMT-kB1-LODN have a substantial antineoplastic effect when used either in combination with temozolomide or as monotherapy. Our results suggest that MGMT-kB1-LODN may provide a novel strategy for cancer therapy. PMID:25460932

  13. Splice-switching antisense oligonucleotides as therapeutic drugs.

    PubMed

    Havens, Mallory A; Hastings, Michelle L

    2016-08-19

    Splice-switching oligonucleotides (SSOs) are short, synthetic, antisense, modified nucleic acids that base-pair with a pre-mRNA and disrupt the normal splicing repertoire of the transcript by blocking the RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. Splicing of pre-mRNA is required for the proper expression of the vast majority of protein-coding genes, and thus, targeting the process offers a means to manipulate protein production from a gene. Splicing modulation is particularly valuable in cases of disease caused by mutations that lead to disruption of normal splicing or when interfering with the normal splicing process of a gene transcript may be therapeutic. SSOs offer an effective and specific way to target and alter splicing in a therapeutic manner. Here, we discuss the different approaches used to target and alter pre-mRNA splicing with SSOs. We detail the modifications to the nucleic acids that make them promising therapeutics and discuss the challenges to creating effective SSO drugs. We highlight the development of SSOs designed to treat Duchenne muscular dystrophy and spinal muscular atrophy, which are currently being tested in clinical trials. PMID:27288447

  14. Crystallization and crystal packing analysis of DNA oligonucleotides

    NASA Astrophysics Data System (ADS)

    Wang, Andrew H.-J.; Teng, M.-K.

    1988-07-01

    There are now over 30 DNA oligonucleotides that have been crystallized and their structure determined by X-ray diffraction analysis. From these studies there is a new wealth of information available to us concerning the fine details of the conformation of DNA molecules and their interactions with other ligands such as antitumor drugs and ions. In addition, the intensive efforts in attempting to crystallize many DNA fragments from several laboratories have resulted in a considerable amount of data related to the crystallization conditions for DNA molecules. Various factors such as the types of metal ion, precipitant, buffer and pH all play important roles in obtaining suitable crystals. We have also analyzed the packings of DNA molecules in the crystal lattice and found that they can be arranged into four different general categories. Those four types of packing interactions are: (1) base-base stacking plus intermolecular hydrogen bonds such as in the crystals of Z-DNA, daunomycin/DNA complex, triostin A/DNA complex, etc.; (2) base pair/A-DNA minor groove stacking, as in several DNA oligomer crystals in the A-DNA conformation; (3) guanine-guanine pairing in the minor groove of B-DNA dodecamers; (4) miscellaneous hydrogen bonding and stacking interactions. Many of those intermolecular interactions are examined in details and their possible biological relevance is discussed.

  15. [The use of oligonucleotide aptamers in cancer therapy].

    PubMed

    Odrzywolski, Adrian; Waśko, Adam

    2016-01-01

    Aptamers are a new class of molecules which originated in the 1990s. They are usually RNA or DNA oligonucleotides, the length of which ranges between 20 and 80 nt. They are produced using the SELEX method that allows one to obtain aptamers that bind to virtually any molecule of interest, providing a high specificity. Aptamers are an alternative to antibodies because on the one hand, their sensitivity is at a similar or sometimes even higher level, while on the other hand they do not show immunogenicity, and may be synthesized in vitro. To date, a broad range of different applications of aptamers has been described: as components of biosensors, or use in various laboratory techniques, such as microarrays or chromatography. One of the most important is the use of aptamers in medicine, especially in the fight against cancer. They can be used both for diagnosis and for the eradication of cancers - particularly through the delivery of drugs. Currently, most transport-related research is devoted to the delivery of chemotherapeutic drugs, such as doxorubicin. This was used in research on liver cancer cells, prostate, and acute lymphoblastic leukemia blast cells. Another possibility is to use aptamers to deliver siRNAs. In this way inhibition of the quality control process of the mRNA in tumor cells is possible. An aptamer complex with the drug allows for direct delivery of the active substance in a particular cell type, substantially eliminating the non-specific effect of the drug. PMID:27180958

  16. Automated design of probes for rRNA-targeted fluorescence in situ hybridization reveals the advantages of using dual probes for accurate identification.

    PubMed

    Wright, Erik S; Yilmaz, L Safak; Corcoran, Andrew M; Ökten, Hatice E; Noguera, Daniel R

    2014-08-01

    Fluorescence in situ hybridization (FISH) is a common technique for identifying cells in their natural environment and is often used to complement next-generation sequencing approaches as an integral part of the full-cycle rRNA approach. A major challenge in FISH is the design of oligonucleotide probes with high sensitivity and specificity to their target group. The rapidly expanding number of rRNA sequences has increased awareness of the number of potential nontargets for every FISH probe, making the design of new FISH probes challenging using traditional methods. In this study, we conducted a systematic analysis of published probes that revealed that many have insufficient coverage or specificity for their intended target group. Therefore, we developed an improved thermodynamic model of FISH that can be applied at any taxonomic level, used the model to systematically design probes for all recognized genera of bacteria and archaea, and identified potential cross-hybridizations for the selected probes. This analysis resulted in high-specificity probes for 35.6% of the genera when a single probe was used in the absence of competitor probes and for 60.9% when up to two competitor probes were used. Requiring the hybridization of two independent probes for positive identification further increased specificity. In this case, we could design highly specific probe sets for up to 68.5% of the genera without the use of competitor probes and 87.7% when up to two competitor probes were used. The probes designed in this study, as well as tools for designing new probes, are available online (http://DECIPHER.cee.wisc.edu). PMID:24928876

  17. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles.

    PubMed

    Quintela, Irwin A; de los Reyes, Benildo G; Lin, Chih-Sheng; Wu, Vivian C H

    2015-02-14

    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; "Big Six" - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g(-1), requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains. PMID:25563863

  18. 2-O-[2-(Methylthio)ethyl]-Modified Oligonucleotide: An Analog of 2-O-[2-(Methoxy)ethyl]-Modified Oligonucleotide with Improved Protein Binding Properties and High Binding Affinity to Target RNA

    SciTech Connect

    Prakash, T.P.; Manoharan, M.; Fraser, A.S.; Kawasaki, A.M.; Lesnik, E.; Sioufi, N.; Leeds, J.M.; Teplova, M.; Egli, M.

    2010-03-08

    A novel 2'-modification, 2'-O-[2-(methylthio)ethyl] or 2'-O-MTE, has been incorporated into oligonucleotides and evaluated for properties relevant to antisense activity. The results were compared with the previously characterized 2'-O-[2-(methoxy)ethyl] 2'-O-MOE modification. As expected, the 2'-O-MTE modified oligonucleotides exhibited improved binding to human serum albumin compared to the 2'-O-MOE modified oligonucleotides. The 2'-O-MTE oligonucleotides maintained high binding affinity to target RNA. Nuclease digestion of 2'-O-MTE oligonucleotides showed that they have limited resistance to exonuclease degradation. We analyzed the crystal structure of a decamer DNA duplex containing the 2'-O-MTE modifcation. Analysis of the crystal structure provides insight into the improved RNA binding affinity, protein binding affinity and limited resistance of 2'-O-MTE modified oligonucleotides to exonuclease degradation.

  19. SNP Detection in mRNA in Living Cells Using Allele Specific FRET Probes

    PubMed Central

    Dahan, Liya; Huang, Lingyan; Kedmi, Ranit; Behlke, Mark A.; Peer, Dan

    2013-01-01

    Live mRNA detection allows real time monitoring of specific transcripts and genetic alterations. The main challenge of live genetic detection is overcoming the high background generated by unbound probes and reaching high level of specificity with minimal off target effects. The use of Fluorescence Resonance Energy Transfer (FRET) probes allows differentiation between bound and unbound probes thus decreasing background. Probe specificity can be optimized by adjusting the length and through use of chemical modifications that alter binding affinity. Herein, we report the use of two oligonucleotide FRET probe system to detect a single nucleotide polymorphism (SNP) in murine Hras mRNA, which is associated with malignant transformations. The FRET oligonucleotides were modified with phosphorothioate (PS) bonds, 2′OMe RNA and LNA residues to enhance nuclease stability and improve SNP discrimination. Our results show that a point mutation in Hras can be detected in endogenous RNA of living cells. As determined by an Acceptor Photobleaching method, FRET levels were higher in cells transfected with perfect match FRET probes whereas a single mismatch showed decreased FRET signal. This approach promotes in vivo molecular imaging methods and could further be applied in cancer diagnosis and theranostic strategies. PMID:24039756

  20. DNA Stains as Surrogate Nucleobases in Fluorogenic Hybridization Probes.

    PubMed

    Hövelmann, Felix; Seitz, Oliver

    2016-04-19

    The increasing importance assigned to RNA dynamics in cells and tissues calls for probe molecules that enable fluorescence microscopy imaging in live cells. To achieve this goal, fluorescence dyes are conjugated with oligonucleotides so as to provide strong emission upon hybridization with the target molecule. The impressive 10(3)-fold fluorescence intensification observed when DNA stains such as thiazole orange (TO) interact with double-stranded DNA is intriguing and prompted the exploration of oligonucleotide conjugates. However, nonspecific interactions of DNA stains with polynucleotides tend to increase background, which would affect the contrast achievable in live-cell imaging. This Account describes the development of DNA-stain-labeled hybridization probes that provide high signal-to-background. We focus on our contributions in context with related advances from other laboratories. The emphasis will be on the requirements of RNA imaging in live cells. To reduce background, intercalator dyes such as TO were appended to peptide nucleic acid (PNA), which is less avidly recognized by DNA stains than DNA/RNA. Constraining the TO dye as a nucleobase surrogate in "forced intercalation (FIT) probes" improved the target specificity, presumably by helping to prevent unspecific interactions. The enforcement of TO intercalation between predetermined base pairs upon formation of the probe-target duplex provided for high brightness and enabled match/mismatch selectivity beyond stringency of hybridization. We show examples that highlight the use of PNA FIT probes in the imaging of mRNA, miRNA, and lncRNA in living cells. The "FIT approach" was recently extended to DNA probes. Signal brightness can become limiting when low-abundance targets ought to be visualized over cellular autofluorescence. We discuss strategies that further the brightness of signaling by FIT probes. Multilabeling with identical dyes does not solve the brightness issue. To avoid self-quenching, we

  1. Conditionally fluorescent molecular probes for detecting single base changes in double-stranded DNA

    NASA Astrophysics Data System (ADS)

    Chen, Sherry Xi; Zhang, David Yu; Seelig, Georg

    2013-09-01

    Small variations in nucleic acid sequences can have far-reaching phenotypic consequences. Reliably distinguishing closely related sequences is therefore important for research and clinical applications. Here, we demonstrate that conditionally fluorescent DNA probes are capable of distinguishing variations of a single base in a stretch of target DNA. These probes use a novel programmable mechanism in which each single nucleotide polymorphism generates two thermodynamically destabilizing mismatch bubbles rather than the single mismatch formed during typical hybridization-based assays. Up to a 12,000-fold excess of a target that contains a single nucleotide polymorphism is required to generate the same fluorescence as one equivalent of the intended target, and detection works reliably over a wide range of conditions. Using these probes we detected point mutations in a 198 base-pair subsequence of the Escherichia coli rpoB gene. That our probes are constructed from multiple oligonucleotides circumvents synthesis limitations and enables long continuous DNA sequences to be probed.

  2. Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays

    SciTech Connect

    Kingsley, Mark T.; Straub, Tim M.; Call, Douglas R.; Daly, Don S.; Wunschel, Sharon C.; Chandler, Darrell P.

    2002-12-01

    Current bacterial DNA typing methods are typically based upon gel-based fingerprinting methods. As such, they access a limited complement of genetic information and many independent restriction enzymes or probes is required to achieve statistical rigor and confidence in the resulting pattern of DNA fragments.

  3. Concepts and software for a rational design of polynucleotide probes.

    PubMed

    Moraru, Cristina; Moraru, Gabriel; Fuchs, Bernhard M; Amann, Rudolf

    2011-02-01

    Fluorescence in situ hybridization (FISH) of genes and mRNA is most often based on polynucleotide probes. However, so far there was no published framework for the rational design of polynucleotide probes. The well-established concepts for oligonucleotide probe design cannot be transferred to polynucleotides. Due to the high allele diversity of genes, a single probe is not sufficient to detect all alleles of a gene. Therefore, the main objective of this study was to develop a concept and software (PolyPro) for rational design of polynucleotide probe mixes to target particular genes. PolyPro consists of three modules: a GenBank Taxonomy Extractor (GTE), a Polynucleotide Probe Designer (PPD) and a Hybridization Parameters Calculator (HPC). The new concept proposes the construction of defined polynucleotide mixes to target the habitat specific sequence diversity of a particular gene. The concept and the software are intended as a first step towards a more frequent application of polynucleotides for in situ identification of mRNA and genes in environmental microbiology. PMID:23761233

  4. Detection of toxoplasma gondii with a DNA molecular beacon probe

    NASA Astrophysics Data System (ADS)

    Xu, Shichao; Yao, Cuicui; Wei, Shuoming; Zhang, Jimei; Sun, Bo; Zheng, Guo; Han, Qing; Hu, Fei; Zhou, Hongming

    2008-12-01

    Toxoplasma gondii is a microscopic parasite that may infect humans, so there is an increasing concern on the early detection of latent Toxoplasma gondii infection in recent years. We currently report a rapid and sensitive method for Toxoplasma gondii based on molecular beacon (MB) probe. The probe based on fluorescence resonance energy transfer (FRET) with a stem-loop DNA oligonucleotide was labeled with CdTe/ZnS quantum dots (energy donor) at 5' end and BHQ-2 (energy acceptor) at 3' end, respectively. The probe was synthesized in PBS buffer at pH 8.2, room temperature for 24 h. Then target DNA was injected under the condition of 37°C, hybridization for 2 h, in Tris-HCl buffer. The data from fluorescence spectrum (FS) showed that ca 65% of emitted fluorescence was quenched, and about 50% recovery of fluorescence intensity was observed after adding target DNA, which indicated that the target DNA was successfully detected by MB probe. The detecting limitation was determined as ca 5 nM. Moreover, specificity of the probe was investigated by adding target DNA with one-base-pair mismatch, the low fluorescence recovery indicated the high specificity. The results showed that the current sensing probe will be a useful and convenient tool in Toxoplasma gondii early detection.

  5. Inhibition of transcription by platinated triplex-forming oligonucleotides.

    PubMed

    Graham, Mindy K; Miller, Paul S

    2012-12-01

    Platinated triplex-forming oligonucleotides (TFOs) consisting of 2'-methoxythymidine and 2'-methoxy-5-methylcytidine and an N-7 platinated deoxyguanosine ((Pt)G) at the 5'-((Pt)G-TFO), 3'-(TFO-G(Pt)), or 3'- and 5'-((Pt)G-TFO-G(Pt)) ends of the TFO form mono-((Pt)G-TFO and TFO-G(Pt)) and interstrand ((Pt)G-TFO-G(Pt)) cross-links with target DNA as a result of reaction of the (Pt)G with guanines adjacent to the homopurine TFO binding site in the target. The extent of cross-linking is greatest when the (Pt)G is located on the 3' end of the TFO and the target guanine is on the same strand as the TFO binding site. Multiple, contiguous deoxyguanosines in the TFO binding site or a cytosine adjacent to the G(Pt) of the TFO significantly reduce cross-linking. DNA reporter plasmids in which platinated TFOs were cross-linked at a site in the transcribed region between a CMV promoter and a luciferase reporter gene were transfected into Chinese hamster ovary cells, and luciferase expression was compared with that for the corresponding non-cross-linked plasmid. Luciferase expression was inhibited 95 % when TFO-G(Pt) was bound and cross-linked to the transcribed strand, demonstrating that the cross-linked TFO was able to block transcription elongation. Further inhibition (99 %) was observed in nucleotide excision repair (NER) deficient cells, suggesting that NER may repair this lesion. The 3'-G(Pt) group of TFO-G(Pt) protects the TFO from degradation by exonucleases found in mammalian serum. Taken together, these results suggest that platinated TFOs of the type TFO-G(Pt) may find applications as agents for suppressing DNA transcription and consequently inhibiting gene expression in mammalian cells. PMID:22965663

  6. Application of heteronuclear couplings to conformational analysis of oligonucleotides

    SciTech Connect

    Zhu, G.; Live, D.; Bax, A.

    1994-12-01

    The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1{prime} and C1{prime} atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3{prime}-endo and C2{prime}-endo conformations of the sugars and syn and anti bases arrangements.

  7. Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

    PubMed

    Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

    2016-02-01

    Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing. PMID:26553470

  8. Oligonucleotide facilitators may inhibit or activate a hammerhead ribozyme.

    PubMed Central

    Jankowsky, E; Schwenzer, B

    1996-01-01

    Facilitators are oligonucleotides capable of affecting hammerhead ribozyme activity by interacting with the substrate at the termini of the ribozyme. Facilitator effects were determined in vitro using a system consisting of a ribozyme with 7 nucleotides in every stem sequence and two substrates with inverted facilitator binding sequences. The effects of 9mer and 12mer RNA as well as DNA facilitators which bind either adjacent to the 3'- or 5'-end of the ribozyme were investigated. A kinetic model was developed which allows determination of the apparent dissociation constant of the ribozyme-substrate complex from single turnover reactions. We observed a decreased dissociation constant of the ribozyme-substrate complex due to facilitator addition corresponding to an additional stabilization energy of delta delta G=-1.7 kcal/mol with 3'-end facilitators. The cleavage rate constant was increased by 3'-end facilitators and decreased by 5'-end facilitators. Values for Km were slightly lowered by all facilitators and kcat was increased by 3'-end facilitators and decreased by 5'-end facilitators in our system. Generally the facilitator effects increased with the length of the facilitators and RNA provided greater effects than DNA of the same sequence. Results suggest facilitator influences on several steps of the hammerhead reaction, substrate association, cleavage and dissociation of products. Moreover, these effects are dependent in different manners on ribozyme and substrate concentration. This leads to the conclusion that there is a concentration dependence whether activation or inhibition is caused by facilitators. Conclusions are drawn with regard to the design of hammerhead ribozyme facilitator systems. PMID:8602353

  9. A novel dysferlin mutant pseudoexon bypassed with antisense oligonucleotides

    PubMed Central

    Dominov, Janice A; Uyan, Özgün; Sapp, Peter C; McKenna-Yasek, Diane; Nallamilli, Babi R R; Hegde, Madhuri; Brown, Robert H

    2014-01-01

    Objective Mutations in dysferlin (DYSF), a Ca2+-sensitive ferlin family protein important for membrane repair, vesicle trafficking, and T-tubule function, cause Miyoshi myopathy, limb-girdle muscular dystrophy type 2B, and distal myopathy. More than 330 pathogenic DYSF mutations have been identified within exons or near exon–intron junctions. In ~17% of patients who lack normal DYSF, only a single disease-causing mutation has been identified. We studied one family with one known mutant allele to identify both the second underlying genetic defect and potential therapeutic approaches. Methods We sequenced the full DYSF cDNA and investigated antisense oligonucleotides (AONs) as a tool to modify splicing of the mRNA transcripts in order to process out mutant sequences. Results We identified a novel pseudoexon between exons 44 and 45, (pseudoexon 44.1, PE44.1), which inserts an additional 177 nucleotides into the mRNA and 59 amino acids within the conserved C2F domain of the DYSF protein. Two unrelated dysferlinopathy patients were also found to carry this mutation. Using AONs targeting PE44.1, we blocked the abnormal splicing event, yielding normal, full-length DYSF mRNA, and increased DYSF protein expression. Interpretation This is the first report of a deep intronic mutation in DYSF that alters mRNA splicing to include a mutant peptide fragment within a key DYSF domain. We report that AON-mediated exon-skipping restores production of normal, full-length DYSF in patients’ cells in vitro, offering hope that this approach will be therapeutic in this genetic context, and providing a foundation for AON therapeutics targeting other pathogenic DYSF alleles. PMID:25493284

  10. Effect of non-specific species competition from total RNA on the static mode hybridization response of nanomechanical assays of oligonucleotides.

    PubMed

    Mishra, Rohit; Hegner, Martin

    2014-06-01

    We investigate here the nanomechanical response of microcantilever sensors in real-time for detecting a range of ultra-low concentrations of oligonucleotides in a complex background of total cellular RNA extracts from cell lines without labeling or amplification. Cantilever sensor arrays were functionalized with probe single stranded DNA (ssDNA) and reference ssDNA to obtain a differential signal. They were then exposed to complementary target ssDNA strands that were spiked in a fragmented total cellular RNA background in biologically relevant concentrations so as to provide clinically significant analysis. We present a model for prediction of the sensor behavior in competitive backgrounds with parameters that are indicators of the change in nanomechanical response with variation in the target and background concentration. For nanomechanical assays to compete with current technologies it is essential to comprehend such responses with eventual impact on areas like understanding non-coding RNA pharmacokinetics, nucleic acid biomarker assays and miRNA quantification for disease monitoring and diagnosis to mention a few. Additionally, we also achieved a femtomolar sensitivity limit for online oligonucleotide detection in a non-competitive environment with these sensors. PMID:24807191

  11. Effect of non-specific species competition from total RNA on the static mode hybridization response of nanomechanical assays of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Mishra, Rohit; Hegner, Martin

    2014-06-01

    We investigate here the nanomechanical response of microcantilever sensors in real-time for detecting a range of ultra-low concentrations of oligonucleotides in a complex background of total cellular RNA extracts from cell lines without labeling or amplification. Cantilever sensor arrays were functionalized with probe single stranded DNA (ssDNA) and reference ssDNA to obtain a differential signal. They were then exposed to complementary target ssDNA strands that were spiked in a fragmented total cellular RNA background in biologically relevant concentrations so as to provide clinically significant analysis. We present a model for prediction of the sensor behavior in competitive backgrounds with parameters that are indicators of the change in nanomechanical response with variation in the target and background concentration. For nanomechanical assays to compete with current technologies it is essential to comprehend such responses with eventual impact on areas like understanding non-coding RNA pharmacokinetics, nucleic acid biomarker assays and miRNA quantification for disease monitoring and diagnosis to mention a few. Additionally, we also achieved a femtomolar sensitivity limit for online oligonucleotide detection in a non-competitive environment with these sensors.

  12. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry.

    PubMed

    Jafari, Safiye; Faridbod, Farnoush; Norouzi, Parviz; Dezfuli, Amin Shiralizadeh; Ajloo, Davood; Mohammadipanah, Fatemeh; Ganjali, Mohammad Reza

    2015-10-01

    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO2NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy)3](2+/3+) redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy)3](2+/3+) FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10(-15) to 1 × 10(-8) mol L(-1). The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL(-1) with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy)3](2+/3+) interaction with ssDNA before and after hybridization. PMID:26454462

  13. Using probe secondary structure information to enhance Affymetrix GeneChip background estimates

    PubMed Central

    Gharaibeh, Raad Z.; Fodor, Anthony A.; Gibas, Cynthia J.

    2007-01-01

    High-density short oligonucleotide microarrays are a primary research tool for assessing global gene expression. Background noise on microarrays comprises a significant portion of the measured raw data. A number of statistical techniques have been developed to correct for this background noise. Here, we demonstrate that probe minimum folding energy and structure can be used to enhance a previously existing model for background noise correction. We estimate that probe secondary structure accounts for up to 3% of all variation on Affymetrix microarrays. PMID:17387043

  14. Oligonucleotide delivery with cell surface binding and cell penetrating Peptide amphiphile nanospheres.

    PubMed

    Mumcuoglu, Didem; Sardan, Melis; Tekinay, Turgay; Guler, Mustafa O; Tekinay, Ayse B

    2015-05-01

    A drug delivery system designed specifically for oligonucleotide therapeutics can ameliorate the problems associated with the in vivo delivery of these molecules. The internalization of free oligonucleotides is challenging, and cytotoxicity is the main obstacle for current transfection vehicles. To develop nontoxic delivery vehicles for efficient transfection of oligonucleotides, we designed a self-assembling peptide amphiphile (PA) nanosphere delivery system decorated with cell penetrating peptides (CPPs) containing multiple arginine residues (R4 and R8), and a cell surface binding peptide (KRSR), and report the efficiency of this system in delivering G-3129, a Bcl-2 antisense oligonucleotide (AON). PA/AON (peptide amphiphile/antisense oligonucleotide) complexes were characterized with regards to their size and secondary structure, and their cellular internalization efficiencies were evaluated. The effect of the number of arginine residues on the cellular internalization was investigated by both flow cytometry and confocal imaging, and the results revealed that uptake efficiency improved as the number of arginines in the sequence increased. The combined effect of cell penetration and surface binding property on the cellular internalization and its uptake mechanism was also evaluated by mixing R8-PA and KRSR-PA. R8 and R8/KRSR decorated PAs were found to drastically increase the internalization of AONs compared to nonbioactive PA control. Overall, the KRSR-decorated self-assembled PA nanospheres were demonstrated to be noncytotoxic delivery vectors with high transfection rates and may serve as a promising delivery system for AONs. PMID:25828697

  15. Oligonucleotide-induced alternative splicing of serotonin 2C receptor reduces food intake.

    PubMed

    Zhang, Zhaiyi; Shen, Manli; Gresch, Paul J; Ghamari-Langroudi, Masoud; Rabchevsky, Alexander G; Emeson, Ronald B; Stamm, Stefan

    2016-01-01

    The serotonin 2C receptor regulates food uptake, and its activity is regulated by alternative pre-mRNA splicing. Alternative exon skipping is predicted to generate a truncated receptor protein isoform, whose existence was confirmed with a new antiserum. The truncated receptor sequesters the full-length receptor in intracellular membranes. We developed an oligonucleotide that promotes exon inclusion, which increases the ratio of the full-length to truncated receptor protein. Decreasing the amount of truncated receptor results in the accumulation of full-length, constitutively active receptor at the cell surface. After injection into the third ventricle of mice, the oligonucleotide accumulates in the arcuate nucleus, where it changes alternative splicing of the serotonin 2C receptor and increases pro-opiomelanocortin expression. Oligonucleotide injection reduced food intake in both wild-type and ob/ob mice. Unexpectedly, the oligonucleotide crossed the blood-brain barrier and its systemic delivery reduced food intake in wild-type mice. The physiological effect of the oligonucleotide suggests that a truncated splice variant regulates the activity of the serotonin 2C receptor, indicating that therapies aimed to change pre-mRNA processing could be useful to treat hyperphagia, characteristic for disorders like Prader-Willi syndrome. PMID:27406820

  16. Sequence specific inhibition of human type II phospholipase A2 enzyme activity by phosphorothioate oligonucleotides.

    PubMed Central

    Bennett, C F; Chiang, M Y; Wilson-Lingardo, L; Wyatt, J R

    1994-01-01

    Phosphorothioate oligonucleotides were identified which directly inhibited human type II phospholipase A2 (PLA2) enzyme activity in a sequence specific manner. The minimum pharmacophore common to all oligonucleotides which inhibited PLA2 enzyme activity consisted of two sets of three or more consecutive guanosine residues in a row. These oligonucleotides appear to form G quartets resulting in the formation of oligonucleotide aggregates. Additionally, a phosphorothioate backbone was required to be effective inhibitors of type II PLA2. The activity of one oligodeoxynucleotide, IP 3196 (5'-GGGTGGGTATAGAAGGGCTCC-3') has been characterized in more detail. IP 3196 inhibited PLA2 enzyme activity when the substrate was presented in the form of a phospholipid bilayer but not when presented in the form of a mixed micelle with anionic detergents. Human type II PLA2 was 50-fold more sensitive to inhibition by IP 3196 than venom and pancreatic type I enzymes. These data demonstrate that phosphorothioate oligonucleotides can specifically inhibit human type II PLA2 enzyme activity in a sequence specific manner. PMID:8065936

  17. Liposome-encapsulated polyethylenimine/oligonucleotide polyplexes prepared by reverse-phase evaporation technique.

    PubMed

    Ko, Young Tag; Bickel, Ulrich

    2012-06-01

    Liposome-encapsulated polyplex system represents a promising delivery system for oligonucleotide-based therapeutics such as siRNA and asODN. Here, we report a novel method to prepare liposome-encapsulated cationic polymer/oligonucleotide polyplexes based on the reverse-phase evaporation following organic extraction of the polyplexes. The polyplexes of polyethylenimine and oligonucleotide were first formed in aqueous buffer at an N/P ratio of 6. The overall positively charged polyplexes were then mixed with the anionic phospholipids in overall organic media. The overall organic environment and electrostatic interaction between anionic phospholipids and positively charged polyplexes resulted in inverted micelle-like particles with the polyplexes in the core. After phase separation, the hydrophobic particles were recovered in organic phase. Reverse-phase evaporation of the organic solvent in the presence of hydrophilic polymer-grafted lipids resulted in a stable aqueous dispersion of hydrophilic lipid-coated particles with the polyplex in the core. Transmission electron microscopy visualization revealed spherical structures with heavily stained polyplex cores surrounded by lightly stained lipid coats. The lipid-coated polyplex particles showed colloidal stability, complete protection of the loaded oligonucleotide molecules from enzymatic degradation, and high loading efficiency of more than 80%. Thus, this technique represents an alternative method to prepare lipid-coated polyplex particles as a delivery system of oligonucleotide therapeutics. PMID:22328240

  18. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.

    PubMed

    Choi, Y C; Busch, H

    1978-06-27

    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  19. Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating.

    PubMed

    Abel, Biebele; Aslan, Kadir

    2012-11-01

    This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization), where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. PMID:23645933

  20. Oligonucleotide directed misfolding of RNA inhibits Candida albicans group I intron splicing

    PubMed Central

    Childs, Jessica L.; Disney, Matthew D.; Turner, Douglas H.

    2002-01-01

    RNA is becoming an important therapeutic target. Many potential RNA targets require secondary or tertiary structure for function. Examples include ribosomal RNAs, RNase P RNAs, mRNAs with untranslated regions that regulate translation, and group I and group II introns. Here, a method is described to inhibit RNA function by exploiting the propensity of RNA to adopt multiple folded states that are of similar free energy. This method, called oligonucleotide directed misfolding of RNA (ODMiR), uses short oligonucleotides to stabilize inactive structures. The ODMiR method is demonstrated with the group I intron from Candida albicans, a human pathogen. The oligonucleotides, L(TACCTTTC) and TLCTLACLGALCGLGCLC, with L denoting a locked nucleic acid residue, inhibit 50% of group I intron splicing in a transcription mixture at about 150 and 30 nM oligonucleotide concentration, respectively. Both oligonucleotides induce misfolds as determined by native gel electrophoresis and diethyl pyrocarbonate modification. The ODMiR approach provides a potential therapeutic strategy applicable to RNAs with secondary or tertiary structures required for function. PMID:12169671

  1. Delivery of oligonucleotides into mammalian cells by anionic peptides: comparison between monomeric and dimeric peptides.

    PubMed Central

    Freulon, I; Roche, A C; Monsigny, M; Mayer, R

    2001-01-01

    The use of antisense oligonucleotides as putative therapeutic agents is limited by their poor delivery into the cytosol and/or the nucleus because they are not able to efficiently cross lipid bilayers. To circumvent this pitfall, anionic amphipathic peptides derived from the influenza virus fusogenic peptide have been used to destabilize membranes in an acidic environment. In this paper, we compare the ability of a monomeric and a dimeric peptide to introduce oligonucleotides into the cytosol and nuclei of several types of cultured cells. Cells incubated at pH 6.2 or at a slightly lower pH in the presence of the monomeric peptide but not the dimeric peptide were efficiently permeabilized. The location of fluorescent derivatives of peptides and of oligonucleotides was assessed by confocal microscopy. Both the peptides and oligonucleotides remained entrapped in vesicular compartments at neutral pH; at acidic pH, oligonucleotides in the presence of the monomeric peptide were mainly in the nucleus, while in the presence of the dimeric peptide they co-localized with the peptide into vesicles. The data are interpreted on the basis of the spectroscopic behaviour of monomeric and dimeric peptides in relation to the environmental pH. PMID:11237872

  2. Novel Efficient Cell-Penetrating, Peptide-Mediated Strategy for Enhancing Telomerase Inhibitor Oligonucleotides.

    PubMed

    Muñoz-Alarcón, Andrés; Eriksson, Jonas; Langel, Ülo

    2015-12-01

    At present, there are several therapeutic approaches for targeting telomerase in tumors. One in particular, currently undergoing clinical trials, is based on synthetic lipid-modified oligonucleotide antagonists aimed at inhibiting the ribonucleoprotein subunit of human telomerase. However, while enabling efficient uptake, the lipid modifications reduce the potency of the therapeutic oligonucleotides compared to nonmodified oligonucleotides. Moreover, lipid modification may increase oligonucleotide accumulation in the liver causing undesirable hepatotoxicity. Noncovalent complexation strategies for cell-penetrating peptide (CPP)-mediated delivery present an option to circumvent the need for potency-reducing modifications, while allowing for a highly efficient uptake, and could significantly improve the efficiency of telomerase-targeting cancer therapeutics. Delivery of a nonlipidated locked nucleic acid/2'-O-methyl mixmer significantly inhibits the telomerase activity in treated HeLa cells. The inhibitory effect was further improved through addition of a CPP. Furthermore, calculated IC50-values for the oligonucleotide delivered by CPPs into HeLa cells are more than 20 times lower than telomerase inhibitor Imetelstat, currently undergoing clinical trials. These results emphasize the potential of CPP-mediated delivery of future pharmaceuticals and provide means by which to enhance an already promising therapeutic strategy for cancer treatment. PMID:26479411

  3. Achieving successful delivery of oligonucleotides--From physico-chemical characterization to in vivo evaluation.

    PubMed

    Scomparin, Anna; Polyak, Dina; Krivitsky, Adva; Satchi-Fainaro, Ronit

    2015-11-01

    RNA interference is one of the most promising fields in modern medicine to treat several diseases, ranging from cancer to cardiac diseases, passing through viral infections and metabolic pathologies. Since the discovery of the potential therapeutic properties of non-self oligonucleotides, it was clear that it is important to develop delivery systems that are able to increase plasma stability and bestow membrane-crossing abilities to the oligonucleotides in order to reach their cytoplasmic targets. Polymer therapeutics, among other systems, are widely investigated as delivery systems for therapeutic agents, such as oligonucleotides. Physico-chemical characterization of the supramolecular polyplexes obtained upon charge interaction or covalent conjugation between the polymeric carrier and the oligonucleotides is critical. Appropriate characterization is fundamental in order to predict and understand the in vivo silencing efficacy and to avoid undesired side effects and toxicity profile. Shedding light on the physico-chemical and in vitro requirements of a polyplex leads to an efficient in vivo delivery system for RNAi therapeutics. In this review, we will present the most common techniques for characterization of obtained polymer/oligonucleotide polyplexes and an up-to-date state of the art in vivo preclinical and clinical studies. This is the first review to deal with the difficulties in appropriate characterization of small interfering RNA (siRNA) or microRNA (miRNA) polyplexes and conjugates which limit the clinical translation of this promising technology. PMID:25916823

  4. High-quality gene assembly directly from unpurified mixtures of microarray-synthesized oligonucleotides

    PubMed Central

    Borovkov, Alex Y.; Loskutov, Andrey V.; Robida, Mark D.; Day, Kristen M.; Cano, Jose A.; Le Olson, Tien; Patel, Hetal; Brown, Kevin; Hunter, Preston D.; Sykes, Kathryn F.

    2010-01-01

    To meet the growing demand for synthetic genes more robust, scalable and inexpensive gene assembly technologies must be developed. Here, we present a protocol for high-quality gene assembly directly from low-cost marginal-quality microarray-synthesized oligonucleotides. Significantly, we eliminated the time- and money-consuming oligonucleotide purification steps through the use of hybridization-based selection embedded in the assembly process. The protocol was tested on mixtures of up to 2000 oligonucleotides eluted directly from microarrays obtained from three different chip manufacturers. These mixtures containing <5% perfect oligos, and were used directly for assembly of 27 test genes of different sizes. Gene quality was assessed by sequencing, and their activity was tested in coupled in vitro transcription/translation reactions. Genes assembled from the microarray-eluted material using the new protocol matched the quality of the genes assembled from >95% pure column-synthesized oligonucleotides by the standard protocol. Both averaged only 2.7 errors/kb, and genes assembled from microarray-eluted material without clonal selection produced only 30% less protein than sequence-confirmed clones. This report represents the first demonstration of cost-efficient gene assembly from microarray-synthesized oligonucleotides. The overall cost of assembly by this method approaches 5¢ per base, making gene synthesis more affordable than traditional cloning. PMID:20693531

  5. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    PubMed Central

    Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

    2006-01-01

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  6. Design and Application of an Easy to Use Oligonucleotide Mass Calculation Program

    NASA Astrophysics Data System (ADS)

    Yang, Jiong; Leopold, Peter; Helmy, Roy; Parish, Craig; Arvary, Becky; Mao, Bing; Meng, Fanyu

    2013-08-01

    With the development of new synthesis procedures, an ever increasing number of chemical modifications can now be incorporated into synthetic oligonucleotides, representing new challenges for analytical chemists to efficiently identify and characterize such molecules. While conventional mass spectrometry (MS) has proven to be a powerful tool to study nucleic acids, new and improved methods and software are now needed to address this emerging challenge. In this report, we describe a simple yet powerful program that affords great flexibility in the calculation of theoretical masses for conventional as well as modified oligonucleotide molecules. This easy to use program can accept input oligonucleotide sequences and then calculate the theoretical mass values for full length products, process impurities, potential metabolites, and gas phase fragments. We intentionally designed this software so that modified nucleotide residues can be incorporated into oligonucleotide sequences, and corresponding mass values can be rapidly calculated. To test the utility of this program, two oligonucleotides that contain a large number of chemical modifications were synthesized. We have analyzed these samples using a Q-TOF mass spectrometer and compared the calculated masses to the observed ones. We found that all of the data matched very well with less than 30 ppm mass errors, well within the expectation for our instrument operated in its current mode. These data confirmed the validity of calculations performed with this new software.

  7. Hydrodynamic ultrasonic probe

    DOEpatents

    Day, Robert A.; Conti, Armond E.

    1980-01-01

    An improved probe for in-service ultrasonic inspection of long lengths of a workpiece, such as small diameter tubing from the interior. The improved probe utilizes a conventional transducer or transducers configured to inspect the tubing for flaws and/or wall thickness variations. The probe utilizes a hydraulic technique, in place of the conventional mechanical guides or bushings, which allows the probe to move rectilinearly or rotationally while preventing cocking thereof in the tube and provides damping vibration of the probe. The probe thus has lower friction and higher inspection speed than presently known probes.

  8. Guidelines for Optimisation of a Multiplex Oligonucleotide Ligation-PCR for Characterisation of Microbial Pathogens in a Microsphere Suspension Array

    PubMed Central

    Wuyts, Véronique; Roosens, Nancy H. C.; Marchal, Kathleen; De Keersmaecker, Sigrid C. J.

    2015-01-01

    With multiplex oligonucleotide ligation-PCR (MOL-PCR) different molecular markers can be simultaneously analysed in a single assay and high levels of multiplexing can be achieved in high-throughput format. As such, MOL-PCR is a convenient solution for microbial detection and identification assays where many markers should be analysed, including for routine further characterisation of an identified microbial pathogenic isolate. For an assay aimed at routine use, optimisation in terms of differentiation between positive and negative results and of cost and effort is indispensable. As MOL-PCR includes a multiplex ligation step, followed by a singleplex PCR and analysis with microspheres on a Luminex device, several parameters are accessible for optimisation. Although MOL-PCR performance may be influenced by the markers used in the assay and the targeted bacterial species, evaluation of the method of DNA isolation, the probe concentration, the amount of microspheres, and the concentration of reporter dye is advisable in the development of any MOL-PCR assay. Therefore, we here describe our observations made during the optimisation of a 20-plex MOL-PCR assay for subtyping of Salmonella Typhimurium with the aim to provide a possible workflow as guidance for the development and optimisation of a MOL-PCR assay for the characterisation of other microbial pathogens. PMID:25705689

  9. Development of bis-locked nucleic acid (bisLNA) oligonucleotides for efficient invasion of supercoiled duplex DNA

    PubMed Central

    Moreno, Pedro M. D.; Geny, Sylvain; Pabon, Y. Vladimir; Bergquist, Helen; Zaghloul, Eman M.; Rocha, Cristina S. J.; Oprea, Iulian I.; Bestas, Burcu; Andaloussi, Samir EL; Jørgensen, Per T.; Pedersen, Erik B.; Lundin, Karin E.; Zain, Rula; Wengel, Jesper; Smith, C. I. Edvard

    2013-01-01

    In spite of the many developments in synthetic oligonucleotide (ON) chemistry and design, invasion into double-stranded DNA (DSI) under physiological salt and pH conditions remains a challenge. In this work, we provide a new ON tool based on locked nucleic acids (LNAs), designed for strand invasion into duplex DNA (DSI). We thus report on the development of a clamp type of LNA ON—bisLNA—with capacity to bind and invade into supercoiled double-stranded DNA. The bisLNA links a triplex-forming, Hoogsteen-binding, targeting arm with a strand-invading Watson–Crick binding arm. Optimization was carried out by varying the number and location of LNA nucleotides and the length of the triplex-forming versus strand-invading arms. Single-strand regions in target duplex DNA were mapped using chemical probing. By combining design and increase in LNA content, it was possible to achieve a 100-fold increase in potency with 30% DSI at 450 nM using a bisLNA to plasmid ratio of only 21:1. Although this first conceptual report does not address the utility of bisLNA for the targeting of DNA in a chromosomal context, it shows bisLNA as a promising candidate for interfering also with cellular genes. PMID:23345620

  10. Validation of the Agilent 244K oligonucleotide array-based comparative genomic hybridization platform for clinical cytogenetic diagnosis.

    PubMed

    Yu, Shihui; Bittel, Douglas C; Kibiryeva, Nataliya; Zwick, David L; Cooley, Linda D

    2009-09-01

    High-resolution microarray comparative genomic hybridization (aCGH) is being adopted for diagnostic evaluation of genomic disorders, but validation for clinical diagnosis has not yet been reported. We present validation data for the Agilent Human Genome Microarray Kit 244K for clinical application. The platform contains approximately 240,000 distinct 60-mer oligonucleotide probes spanning the entire human genome. We studied 45 previously characterized samples (43 abnormal, 2 normal), 32 with knowledge of prior results and 13 in a blinded manner with 11 performed in a reference laboratory providing microarray testing. Array analysis confirmed known aberrations in 43 samples and a normal result in 2. The array analysis corrected 1 karyotype and clarified 2 additional cases. Array data from 6 patients with 22q11.2 deletion found an average of 2.56 megabases (Mb; range, 2.49-2.62 Mb) with a common 2.43-Mb deleted region. Approximately 7 copy number variants from 400 base pairs to 1.6 Mb were identified per sample. Results demonstrate the usefulness of the aCGH-244K platform as a powerful diagnostic tool. PMID:19687311

  11. Cassava (Manihot esculenta) transcriptome analysis in response to infection by the fungus Colletotrichum gloeosporioides using an oligonucleotide-DNA microarray.

    PubMed

    Utsumi, Yoshinori; Tanaka, Maho; Kurotani, Atsushi; Yoshida, Takuhiro; Mochida, Keiichi; Matsui, Akihiro; Ishitani, Manabu; Sraphet, Supajit; Whankaew, Sukhuman; Asvarak, Thipa; Narangajavana, Jarunya; Triwitayakorn, Kanokporn; Sakurai, Tetsuya; Seki, Motoaki

    2016-07-01

    Cassava anthracnose disease (CAD), caused by the fungus Colletotrichum gloeosporioides f. sp. Manihotis, is a serious disease of cassava (Manihot esculenta) worldwide. In this study, we established a cassava oligonucleotide-DNA microarray representing 59,079 probes corresponding to approximately 30,000 genes based on original expressed sequence tags and RNA-seq information from cassava, and applied it to investigate the molecular mechanisms of resistance to fungal infection using two cassava cultivars, Huay Bong 60 (HB60, resistant to CAD) and Hanatee (HN, sensitive to CAD). Based on quantitative real-time reverse transcription PCR and expression profiling by the microarray, we showed that the expressions of various plant defense-related genes, such as pathogenesis-related (PR) genes, cell wall-related genes, detoxification enzyme, genes related to the response to bacterium, mitogen-activated protein kinase (MAPK), genes related to salicylic acid, jasmonic acid and ethylene pathways were higher in HB60 compared with HN. Our results indicated that the induction of PR genes in HB60 by fungal infection and the higher expressions of defense response-related genes in HB60 compared with HN are likely responsible for the fungal resistance in HB60. We also showed that the use of our cassava oligo microarray could improve our understanding of cassava molecular mechanisms related to environmental responses and development, and advance the molecular breeding of useful cassava plants. PMID:27138000

  12. Oligonucleotide fingerprinting of free-ranging and captive rhesus macaques from Cayo Santiago: paternity assignment and comparison of heterozygosity.

    PubMed

    Nürnberg, P; Berard, J D; Bercovitch, F; Epplen, J T; Schmidtke, J; Krawczak, M

    1993-01-01

    Multilocus DNA fingerprinting with oligonucleotide probes (GTG)5, (GATA)4, and (CA)8 was applied in order to determine paternity in one birth cohort (15 infants) of social group (S) from the free-ranging colony of rhesus macaques (Macaca mulatta) on Cayo Santiago. While sires could be identified in 11 cases, all males tested (N = 19) could be excluded from paternity for the remaining four infants. Data revealed marked discrepancies between actual paternity and paternity as inferred from the observation of copulation behavior. Thus, a dominant social rank does not appear to be strongly associated with reproductive success. Furthermore, alternative reproductive strategies were found to yield comparable net benefits in reproduction. A second group of animals (M) was translocated from Cayo Santiago to the Sabana Seca Field Station in 1984. They have continuously resided together in a large outdoor enclosure since then. Here paternity assessment was seriously impeded by a reduced number of discriminating bands, i.e. offspring bands which were unequivocally derived from the sires. This was initially held to be indicative of a smaller degree of heterozygosity in Group M, and was attributed to inbreeding due to a lack of male immigration or extra-group fertilizations. However, a comparison of the DNA fingerprint patterns obtained in Group S and Group M lends only partial support to this idea. PMID:8400713

  13. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    SciTech Connect

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook; Karim, Nurul Huda Abd; Ahmad, Haslina; Harun, Siti Norain

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulse voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.

  14. Oligodeoxynucleotide probes for Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequences.

    PubMed Central

    Wesley, I V; Wesley, R D; Cardella, M; Dewhirst, F E; Paster, B J

    1991-01-01

    Deoxyoligonucleotide probes were constructed for the identification of Campylobacter fetus and Campylobacter hyointestinalis based on 16S rRNA sequence data. Probes were targeted to hypervariable regions of 16S rRNA. Specificity of oligonucleotide probes was tested in a colony blot assay with type strains of 15 Campylobacter and Arcobacter species as well as in a slot blot format using genomic DNA extracted from field strains of C. fetus and C. hyointestinalis. Two oligonucleotides were constructed for C. fetus that hybridized with equal specificity with each of 57 biochemically confirmed isolates of C. fetus but not with any other Campylobacter species. The C. hyointestinalis probe reacted with 47 of 48 biochemically confirmed field isolates of C. hyointestinalis. In Southern blot hybridization of BglII digests of genomic DNA, the respective probes reacted within three restriction fragments of either C. hyointestinalis (7.2, 8.2, and 10.1 kb) or C. fetus (7.0, 7.7, and 9.0 kb). This suggests multiple copies of genes encoding 16S rRNA. Images PMID:1723076

  15. Detection of Rifampicin Resistance in Mycobacterium tuberculosis by Padlock Probes and Magnetic Nanobead-Based Readout

    PubMed Central

    Engström, Anna; Zardán Gómez de la Torre, Teresa; Strømme, Maria

    2013-01-01

    Control of the global epidemic tuberculosis is severely hampered by the emergence of drug-resistant Mycobacterium tuberculosis strains. Molecular methods offer a more rapid means of characterizing resistant strains than phenotypic drug susceptibility testing. We have developed a molecular method for detection of rifampicin-resistant M. tuberculosis based on padlock probes and magnetic nanobeads. Padlock probes were designed to target the most common mutations associated with rifampicin resistance in M. tuberculosis, i.e. at codons 516, 526 and 531 in the gene rpoB. For detection of the wild type sequence at all three codons simultaneously, a padlock probe and two gap-fill oligonucleotides were used in a novel assay configuration, requiring three ligation events for circularization. The assay also includes a probe for identification of the M. tuberculosis complex. Circularized probes were amplified by rolling circle amplification. Amplification products were coupled to oligonucleotide-conjugated magnetic nanobeads and detected by measuring the frequency-dependent magnetic response of the beads using a portable AC susceptometer. PMID:23630621

  16. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    SciTech Connect

    Sebastiani, F.; Comez, L.; Sacchetti, F.; Orecchini, A.; Petrillo, C.; Paciaroni, A.; De Francesco, A.; Teixeira, S. C. M.

    2015-07-07

    The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  17. Potent triple helix stabilization by 5',3'-modified triplex-forming oligonucleotides.

    PubMed

    Ben Gaied, Nouha; Zhao, Zhengyun; Gerrard, Simon R; Fox, Keith R; Brown, Tom

    2009-07-20

    Anthraquinone and pyrene analogues attached to the 3' and/or 5' termini of triplex-forming oligonucleotides (TFOs) by various linkers increased the stability of parallel triple helices. The modifications are simple to synthesize and can be introduced during standard solid-phase oligonucleotide synthesis. Potent triplex stability was achieved by using doubly modified TFOs, which in the most favourable cases gave an increase in melting temperature of 30 degrees C over the unmodified counterparts and maintained their selectivity for the correct target duplex. Such TFOs can produce triplexes with melting temperatures of 40 degrees C at pH 7 even though they do not contain any triplex-stabilizing base analogues. These studies have implications for the design of triplex-forming oligonucleotides for use in biology and nanotechnology. PMID:19554592

  18. Dipentafluorophenyl carbonate--a reagent for the synthesis of oligonucleotides and their conjugates.

    PubMed Central

    Efimov, V A; Kalinkina, A L; Chakhmakhcheva, O G

    1993-01-01

    Dipentafluorophenyl carbonate has been successfully used as condensing agent for the internucleotide bond formation in the synthesis of oligonucleotides via H-phosphonate approach. The mechanism of a nucleotide component activation with this reagent has been investigated with the help of 31P NMR spectroscopy. It was shown that preactivation of deoxynucleoside H-phosphonate with dipentafluorophenyl carbonate has no influence on the efficiency of the synthesis. This reagent is highly reactive, nonhygroscopic and stable on storage at room temperature. The effectiveness of dipentafluorophenyl carbonate in the oligonucleotide chemistry has been demonstrated in the solid-phase synthesis of 10-50-mers on 0.2, 1 and 10 mumol scales. The use of this reagent for the derivatisation of polymer supports as well as for the synthesis of oligonucleotide conjugates with polyethylene glycol and a lipid is described. Images PMID:8265346

  19. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  20. Pinpointing RNA-Protein Cross-Links with Site-Specific Stable Isotope-Labeled Oligonucleotides

    PubMed Central

    2015-01-01

    High affinity RNA-protein interactions are critical to cellular function, but directly identifying the determinants of binding within these complexes is often difficult. Here, we introduce a stable isotope mass labeling technique to assign specific interacting nucleotides in an oligonucleotide-protein complex by photo-cross-linking. The method relies on generating site-specific oxygen-18-labeled phosphodiester linkages in oligonucleotides, such that covalent peptide-oligonucleotide cross-link sites arising from ultraviolet irradiation can be assigned to specific sequence positions in both RNA and protein simultaneously by mass spectrometry. Using Lin28A and a let-7 pre-element RNA, we demonstrate that mass labeling permits unambiguous identification of the cross-linked sequence positions in the RNA-protein complex. PMID:26583201

  1. Smart polymeric micelles as nanocarriers for oligonucleotides and siRNA delivery.

    PubMed

    Kataoka, Kazunori; Itaka, Keiji; Nishiyama, Nobuhiro; Yamasaki, Yuichi; Oishi, Motoi; Nagasaki, Yukio

    2005-01-01

    The development of in vivo delivery systems for oligonucleotides and siRNA is strongly desired to achieve their clinical applications. Recently, polyplex micelles, which are formed through an electrostatic interaction between nucleic acid compounds (DNA and RNA) and poly(ethylene glycol) (PEG)-polycation block copolymers, have received much attention due to their nanometric-scaled size and excellent biocompatibility. Here, three types of newly engineered block copolymers were developed to construct polyplex micelles useful for oligonucleotides and siRNA delivery: (1) PEG-polycation diblock copolymers possessing diamine side-chain with distinctive pKa for siRNA encapsulation into polyplex micelles with high endosomal escaping ability, (2) Lactosylated PEG-(oligonucleotide or siRNA) conjugate through acid-labile beta-thiopropionate linkage to construct pH-sensitive PIC micelles, and (3) PEG-poly(methacrylic acid) block copolymer for the construction of organic/inorganic hybrid nanoparticles encapsulating siRNA. PMID:17150611

  2. In situ detection of freshwater fungi in an alpine stream by new taxon-specific fluorescence in situ hybridization probes.

    PubMed

    Baschien, Christiane; Manz, Werner; Neu, Thomas R; Marvanová, Ludmila; Szewzyk, Ulrich

    2008-10-01

    New rRNA-targeting oligonucleotide probes permitted the fluorescence in situ hybridization (FISH) identification of freshwater fungi in an Austrian second-order alpine stream. Based on computer-assisted comparative sequence analysis, nine taxon-specific probes were designed and evaluated by whole-fungus hybridizations. Oligonucleotide probe MY1574, specific for a wide range of Eumycota, and the genus (Tetracladium)-specific probe TCLAD1395, as well as the species-specific probes ALacumi1698 (Alatospora acuminata), TRIang322 (Tricladium angulatum), and Alongi340 (Anguillospora longissima), are targeted against 18S rRNA, whereas probes TmarchB10, TmarchC1_1, TmarchC1_2, and AlongiB16 are targeted against the 28S rRNA of Tetracladium marchalianum and Anguillospora longissima, respectively. After 2 weeks and 3 months of exposure of polyethylene slides in the stream, attached germinating conidia and growing hyphae of freshwater fungi were accessible for FISH. Growing hyphae and germinating conidia on leaves and in membrane cages were also visualized by the new FISH probes. PMID:18776035

  3. High transfection efficiency of quantum dot-antisense oligonucleotide nanoparticles in cancer cells through dual-receptor synergistic targeting.

    PubMed

    Zhang, Ming-Zhen; Li, Cheng; Fang, Bi-Yun; Yao, Ming-Hao; Ren, Qiong-Qiong; Zhang, Lin; Zhao, Yuan-Di

    2014-06-27

    Incorporating ligands with nanoparticle-based carriers for specific delivery of therapeutic nucleic acids (such as antisense oligonucleotides and siRNA) to tumor sites is a promising approach in anti-cancer strategies. However, nanoparticle-based carriers remain insufficient in terms of the selectivity and transfection efficiency. In this paper, we designed a dual receptor-targeted QDs gene carrier QD-(AS-ODN+GE11+c(RGDfK)) which could increase the cellular uptake efficiency and further enhance the transfection efficiency. Here, the targeting ligands used were peptides GE11 and c(RGDfK) which could recognize epidermal growth factor receptors (EGFR) and integrin ανβ3 receptors, respectively. Quantitative flow cytometry and ICP/MS showed that the synergistic effect between EGFR and integrin ανβ3 increased the cellular uptake of QDs carriers. The effects of inhibition agents showed the endocytosis pathway of QD-(AS-ODN+GE11+c(RGDfK)) probe was mainly clathrin-mediated. Western blot confirmed that QD-(AS-ODN+GE11+c(RGDfK)) could further enhance gene silencing efficiency compared to QD-(AS-ODN+GE11) and QD-(AS-ODN+c(RGDfK)), suggesting this dual receptor-targeted gene carrier achieved desired transfection efficiency. In this gene delivery system, QDs could not only be used as a gene vehicle but also as fluorescence probe, allowing for localization and tracking during the delivery process. This transport model is very well referenced for non-viral gene carriers to enhance the targeting ability and transfection efficiency. PMID:24896735

  4. Toll-like receptor 9 mediates CpG oligonucleotide-induced cellular invasion.

    PubMed

    Ilvesaro, Joanna M; Merrell, Melinda A; Li, Li; Wakchoure, Savita; Graves, David; Brooks, Sonja; Rahko, Eeva; Jukkola-Vuorinen, Arja; Vuopala, Katri S; Harris, Kevin W; Selander, Katri S

    2008-10-01

    Toll-like receptor 9 (TLR9) belongs to the innate immune system and recognizes microbial and vertebrate DNA. We showed previously that treatment with the TLR9-agonistic ODN M362 (a CpG sequence containing oligonucleotide) induces matrix metalloproteinase-13-mediated invasion in TLR9-expressing human cancer cell lines. Here, we further characterized the role of the TLR9 pathway in this process. We show that CpG oligonucleotides induce invasion in macrophages from wild-type C57/B6 and MyD88 knockout mice and in human MDA-MB-231 breast cancer cells lacking MyD88 expression. This effect was significantly inhibited in macrophages from TLR9 knockout mice and in human MDA-MB-231 breast cancer cells stably expressing TLR9 small interfering RNA or dominant-negative tumor necrosis factor receptor-associated factor 6 (TRAF6). Sequence modifications to the CpG oligonucleotides that targeted the stem loop and other secondary structures were shown to influence the invasion-inducing effect in MDA-MB-231 cells. In contrast, methylation of the cytosine residues of the parent CpG oligonucleotide did not affect the TLR9-mediated invasion compared with the unmethylated parent CpG oligonucleotide. Finally, expression of TLR9 was studied in clinical breast cancer samples and normal breast epithelium with immunohistochemistry. TLR9 staining localized in epithelial cells in both cancer and normal samples. The mean TLR9 staining intensity was significantly increased in the breast cancer cells compared with normal breast epithelial cells. In conclusion, our results suggest that TLR9 expression is increased in breast cancer and CpG oligonucleotide-induced cellular invasion is mediated via TLR9 and TRAF6, independent of MyD88. Further, our findings suggest that the structure and/or stability of DNA may influence the induction of TLR9-mediated invasion in breast cancer. PMID:18922969

  5. Oxalyl-CPG: a labile support for synthesis of sensitive oligonucleotide derivatives.

    PubMed Central

    Alul, R H; Singman, C N; Zhang, G R; Letsinger, R L

    1991-01-01

    A procedure is described for linking nucleosides covalently to controlled pore glass or cross-linked polystyrene supports by means of an oxalyl anchor. Though stable to triethylamine and diisopropylamine, the nucleoside-oxalyl link can be cleaved within a few minutes at room temperature with ammonium hydroxide in methanol. This new anchor can be used in automated synthesis of conventional oligonucleotides. The primary value, however, is that it enables one to employ solid support methodology to synthesize a variety of base-sensitive oligonucleotide derivatives, as illustrated here by synthesis of oligomers with base protecting groups intact and with methyl phosphotriester groups at the internucleoside links. PMID:2027761

  6. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    PubMed

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye. PMID:26774580

  7. Immobilization of DNA via oligonucleotides containing an aldehyde or carboxylic acid group at the 5' terminus.

    PubMed Central

    Kremsky, J N; Wooters, J L; Dougherty, J P; Meyers, R E; Collins, M; Brown, E L

    1987-01-01

    A general method for the immobilization of DNA through its 5'-end has been developed. A synthetic oligonucleotide, modified at its 5'-end with an aldehyde or carboxylic acid, was attached to latex microspheres containing hydrazide residues. Using T4 polynucleotide ligase and an oligonucleotide splint, a single stranded 98mer was efficiently joined to the immobilized synthetic fragment. After impregnation of the latex microspheres with the fluorescent dye, Nile Red and attachment of an aldehyde 16mer, 5 X 10(5) bead-DNA conjugates could be detected with a conventional fluorimeter. Images PMID:3562241

  8. Large scale, liquid phase synthesis of oligonucleotides by the phosphoramidite approach.

    PubMed Central

    Bonora, G M; Biancotto, G; Maffini, M; Scremin, C L

    1993-01-01

    A new method for the liquid phase synthesis of oligonucleotides is described which makes use of polyethylene glycol (PEG) as soluble support and phosphoramidite derivatives as synthons. The new synthetic protocol was applied to a quite large scale production (about 100 mumoles) of such compounds up to the 20mer level. This solution method, called HELP High Efficiency Liquid Phase) Plus, appears effective in terms of speed and coupling yield and can be evaluated for the production of large amount of oligonucleotides. PMID:8464706

  9. Oligonucleotide-based label-free detection with optical microresonators: strategies and challenges.

    PubMed

    Toren, Pelin; Ozgur, Erol; Bayindir, Mehmet

    2016-07-01

    This review targets diversified oligonucleotide-based biodetection techniques, focusing on the use of microresonators of whispering gallery mode (WGM) type as optical biosensors mostly integrated with lab-on-a-chip systems. On-chip and microfluidics combined devices along with optical microresonators provide rapid, robust, reproducible and multiplexed biodetection abilities in considerably small volumes. We present a detailed overview of the studies conducted so far, including biodetection of various oligonucleotide biomarkers as well as deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs) and proteins. We particularly advert to chemical surface modifications for specific and selective biosensing. PMID:27306702

  10. Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

    DOEpatents

    Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

    2002-01-01

    This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

  11. Approach to the synthesis of natural and modified oligonucleotides by the phosphotriester method using O-nucleophilic intramolecular catalysis.

    PubMed

    Efimov, Vladimir A; Molchanova, Natalia S; Chakhmakhcheva, Oksana G

    2007-01-01

    An approach to the solid phase synthesis of natural and modified oligonucleotides using phosphotriester technique has been developed. Particularly, this method allows the synthesis of ribo- and deoxyribo-oligonucleotides containing various 2'-modified mononucleotides as well as stereodefined nucleotide phosphorothioate analogues. PMID:18058542

  12. Tracking the down-regulation of folate receptor-α in cancer cells through target specific delivery of quantum dots coupled with antisense oligonucleotide and targeted peptide.

    PubMed

    Zhang, Ming-Zhen; Yu, Yong; Yu, Rong-Na; Wan, Min; Zhang, Rong-Ying; Zhao, Yuan-Di

    2013-12-20

    Based on the multivalent binding capability of streptavidin (SA) to biotin, a multifunctional quantum dot probe (QD-(AS-ODN+p160)) coupled with antisense oligonucleotide (AS-ODN) and peptide p160 is designed for real-time tracking of targeted delivery of AS-ODN and regulation of folate receptor-α (hFR-α) in MCF-7 breast cancer cells. Fluorescence spectra, capillary electrophoresis (CE) and dynamic light scattering (DLS) are used to characterize the conjugation of AS-ODN and p160 with quantum dots (QDs), DLS results confirm the well stability of the probe in aqueous media. Confocal imaging and quantitative flow cytometry show that QD-(AS-ODN+p160) is able to specifically target human breast cancer MCF-7 cells. Low temperature and ATP depletion treatments reveal the cellular uptake of QD-(AS-ODN+p160) is energy-dependent, and the effects of inhibition agents and co-localization imaging further confirm the endocytic pathway is mainly receptor-mediated. Transmission electron microscopy (TEM) shows the intracellular delivery and endosomal escape of QD probe along with incubation time extended. Two transfection concentrations of QD probe (10 nM and 50 nM) below half inhibitory concentration (IC50 ) value are chosen according to MTT assay. Real-time PCR shows at these two concentration cases the relative mRNA expression levels of hFR-α reduce to 72.5 ± 3.9% and 17.6 ± 1.0%, respectively. However, western blot and quantitative ELISA analysis show the expression level of hFR-α protein has a significant decrease only at 50 nM, indicating that gene silence is concentration-dependent. These results demonstrate that the QD-(AS-ODN+p160) probe not only achieves gene silence in a cell-specific manner but also achieves real-time tracking during AS-ODN intracellular delivery. PMID:23828664

  13. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  14. A competitive enzyme hybridization assay for plasma determination of phosphodiester and phosphorothioate antisense oligonucleotides.

    PubMed Central

    Deverre, J R; Boutet, V; Boquet, D; Ezan, E; Grassi, J; Grognet, J M

    1997-01-01

    An enzyme competitive hybridization assay was developed and validated for determination of mouse plasma concentrations of a 15mer antisense phosphodiester oligodeoxyribonucleotide and of two phosphorothioate analogs. Assays were performed in 96-well microtiter plates. The phosphodiester sense sequence was covalently bound to the microwells. The 5'-biotinylated antisense sequence was used as tracer. The principle of the assay involves competitive hybridization of tracer and antisense nucleotide to the solid phase-immobilized sense oligonucleotide. Solid phase- bound tracer oligonucleotide was assayed after reaction with a streptavidin-acetylcholinesterase conjugate, using the colorimetric method of Ellman. As in competitive enzyme immunoassays, coloration was inversely related to the amount of analyte initially present in the sample. The limit of quantification was 900 pM for phosphodiester antisense oligonucleotide using a 100 microl volume of plasma without extraction. Cross-reactivity was negligible after a four base deletion in either the 3'or 5'position. The assay was simple and sensitive, suitable for in vitro screening of oligonucleotide hybridization potency in biological fluids and for measuring the plasma pharmacokinetics of phosphorothioate and phosphodiester sequences. PMID:9278477

  15. Understanding oligonucleotide-mediated inhibition of gene expression in Xenopus laevis oocytes

    PubMed Central

    Bailey, Cheryl; Weeks, Daniel L.

    2000-01-01

    Triplex-forming oligonucleotides (TFOs) modified with N,N-diethylethylenediamine can inhibit the expression of a reporter plasmid in Xenopus oocytes if the triplex is preformed prior to injection while unmodified oligonucleotides cannot. Here we show that merely forming a triplex in a reporter plasmid does not disrupt transcription, but when TFOs are targeted to sites within the transcribed region of a reporter gene then gene activity is inhibited. TFO-based inhibition did not lead to large scale degradation or mutation of the reporter plasmid, but dramatically lowered mRNA levels. Finally, we investigated the accessibility of a triplex target site on a reporter plasmid after injection into nuclei. We found that the site used for our previous studies was inaccessible to restriction endonuclease after injection into nuclei. This observation may explain why inhibition was dependent on forming the triplex before injection into oocytes. Based on the assumption that oligonucleotide association, like restriction enzyme access, was excluded by nucleosome formation, additional target sites were inserted so that all sites could not simultaneously be associated with the octamer core of a nucleosome. With multiple target sites prior association of the plasmid with nuclear proteins does not prevent oligonucleotide-mediated inhibition of gene activity. PMID:10666457

  16. Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

    PubMed Central

    Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

    1994-01-01

    We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites. Images PMID:8058724

  17. A triple-helix forming oligonucleotide targeting genomic DNA fails to induce mutation.

    PubMed

    Reshat, Reshat; Priestley, Catherine C; Gooderham, Nigel J

    2012-11-01

    Purine tracts in duplex DNA can bind oligonucleotide strands in a sequence specific manner to form triple-helix structures. Triple-helix forming oligonucleotides (TFOs) targeting supFG1 constructs have previously been shown to be mutagenic raising safety concerns for oligonucleotide-based pharmaceuticals. We have engineered a TFO, TFO27, to target the genomic Hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus to define the mutagenic potential of such structures at genomic DNA. We report that TFO27 was resistant to nuclease degradation and readily binds to its target motif in a cell free system. Contrary to previous studies using the supFG1 reporter construct, TFO27 failed to induce mutation within the genomic HPRT locus. We suggest that it is possible that previous reports of triplex-mediated mutation using the supFG1 reporter construct could be confounded by DNA quadruplex formation. Although the present study indicates that a TFO targeting a genomic locus lacks mutagenic activity, it is unclear if this finding can be generalised to all TFOs and their targets. For the present, we suggest that it is prudent to avoid large purine stretches in oligonucleotide pharmaceutical design to minimise concern regarding off-target genotoxicity. PMID:22914677

  18. Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

    PubMed

    Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

    2016-05-11

    Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane. PMID:27097153

  19. Oligonucleotide microarray expression profiling of contrasting invasive phenotypes in colorectal cancer.

    PubMed

    Thorn, Christopher C; Williams, Deborah; Freeman, Thomas C

    2011-01-01

    This chapter refers to the application of laser-capture microdissection with oligonucleotide microarray analysis. The protocol described has been successfully used to identify differential transcript expression between contrasting colorectal cancer invasive phenotypes. Tissue processing, RNA extraction, quality control, amplification, fluorescent labelling, purification, hybridisation, and elements of data analysis are covered. PMID:21761306

  20. Poly(propylacrylic acid) enhances cationic lipid mediated delivery of antisense oligonucleotides

    PubMed Central

    Lee, Li Kim; Williams, Charity L.; Devore, David; Roth, Charles M.

    2008-01-01

    The use of antisense oligodeoxynucleotides (ODNs) to inhibit the expression of specific mRNA targets represents a powerful technology for control of gene expression. Cationic lipids and polymers are frequently used to improve the delivery of ODNs to cells, but the resulting complexes often aggregate, bind to serum components, and are trafficked poorly within cells. We show that the addition of a synthetic, pH-sensitive, membrane-disrupting polyanion, poly(propylacrylic acid) (PPAA), improves the in vitro efficiency of the cationic lipid, DOTAP, with regard to oligonucleotide delivery and antisense activity. In characterization studies, ODN complexation with DOTAP/ODN was maintained even when substantial amounts of PPAA were added. The formulation also exhibited partial protection of phosphodiester oligonucleotides against enzymatic digestion. In Chinese hamster ovary (CHO) cells, incorporation of PPAA in DOTAP/ODN complexes improved two- to threefold the cellular uptake of fluorescently tagged oligonucleotides. DOTAP/ODN complexes containing PPAA also maintained high levels of uptake into cells upon exposure to serum. Addition of PPAA to DOTAP/ODN complexes enhanced the antisense activity (using GFP as the target) over a range of PPAA concentrations in both serum-free, and to a lesser extent, serum-containing media. Thus, PPAA is a useful adjunct that improves the lipid-mediated delivery of oligonucleotides. PMID:16677032

  1. TmPrime: fast, flexible oligonucleotide design software for gene synthesis

    PubMed Central

    Bode, Marcus; Khor, Samuel; Ye, Hongye; Li, Mo-Huang; Ying, Jackie Y.

    2009-01-01

    Herein we present TmPrime, a computer program to design oligonucleotide sets for gene assembly by both ligase chain reaction (LCR) and polymerase chain reaction (PCR). TmPrime offers much flexibility with no constraints on the gene and oligonucleotide lengths. The program divides the long input DNA sequence based on the input desired melting temperature, and dynamically optimizes the length of oligonucleotides to achieve homologous melting temperatures. The output reports the melting temperatures, oligonucleotide sequences and potential formation of secondary structures. Our program also provides functions on sequence pooling to separate long genes into smaller pieces for multi-pool assembly and codon optimization for expression. The software has been successfully used in the design and synthesis of green fluorescent protein fragment (GFPuv) (760 bp), human protein kinase B-2 (PKB2) (1446 bp) and the promoter of human calcium-binding protein A4 (S100A4) (752 bp) using real-time PCR assembly with LCGreen I, which offers a novel approach to compare the efficiency of gene synthesis. The purity of assembled products is successfully estimated with the use of melting curve analysis, which would potentially eliminate the necessity for agarose gel electrophoresis. This program is freely available at http://prime.ibn.a-star.edu.sg. PMID:19515937

  2. The prebiotic synthesis of deoxythymidine oligonucleotides. II - Comparison of condensing agents

    NASA Technical Reports Server (NTRS)

    Odom, D. G.; Brady, J. T.

    1975-01-01

    A reaction which oligomerizes nucleotides under possible prebiotic conditions has been characterized. Nucleoside monophosphate in the presence of cyanamide at acid pH condenses to form dithymidine pyrophosphate and phosphodiester bonded compounds. Imidazole compounds and activated precursors such as nucleoside triphosphate are not necessary for this oligomerization reaction which produces primarily cyclic oligonucleotides.

  3. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide

    PubMed Central

    Roh, Changhyun

    2012-01-01

    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (−)-catechin gallate and (−)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (−)-catechin gallate and (−)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL−1, (−)-catechin gallate and (−)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system. PMID:22619553

  4. Cell penetrating peptide delivery of splice directing oligonucleotides as a treatment for Duchenne muscular dystrophy.

    PubMed

    Betts, Corinne A; Wood, Matthew J A

    2013-01-01

    Duchenne muscular dystrophy is a severe, X-linked muscle wasting disorder caused by the absence of an integral structural protein called dystrophin. This is caused by mutations or deletions in the dystrophin gene which disrupt the reading frame, thereby halting the production of a functional protein. A number of potential therapies have been investigated for the treatment of this disease including utrophin upregulation, 'stop-codon read through' aminoglycosides and adeno-associated virus gene replacement as well as stem cell therapy. However, the most promising treatment to date is the use of antisense oligonucleotides which cause exon skipping by binding to a specific mRNA sequence, skipping the desired exon, thereby restoring the reading frame and producing a truncated yet functional protein. The results from recent 2'OMePS and morpholino clinical trials have renewed hope for Duchenne patients; however in vivo studies in a mouse model, mdx, have revealed low systemic distribution and poor delivery of oligonucleotides to affected tissues such as the brain and heart. However a variety of cell penetrating peptides directly conjugated to antisense oligonucleotides have been shown to enhance delivery in Duchenne model systems with improved systemic distribution and greater efficacy compared to 'naked' antisense oligonucleotides. These cell penetrating peptides, combined with an optimised dose and dosing regimen, as well as thorough toxicity profile have the potential to be developed into a promising treatment which may be progressed to clinical trial. PMID:23140454

  5. Efficient large-scale preparation and purification of short single-stranded RNA oligonucleotides.

    PubMed

    Zlobina, Maria; Sedo, Ondrej; Chou, Ming-Yuan; Slepankova, Lucia; Lukavsky, Peter J

    2016-02-01

    Sequence-specific RNA recognition by RNA-binding proteins plays a crucial role in the post-translational regulation of gene expression. Biophysical and biochemical studies help to unravel the principles of sequence-specific RNA recognition, but the methods used require large amounts of single-stranded RNA (ssRNA). Here we present a fast and robust method for large-scale preparation and purification of short ssRNA oligonucleotides for biochemical, biophysical, and structural studies. We designed an efficiently folding, self-cleaving hammerhead (HH) ribozyme to prepare ssRNA oligonucleotides. Hammerhead ribozyme RNAs self-cleave with over 95% efficiency during in vitro transcription as a function of magnesium concentration to produce high yields of the desired ssRNA products. The resulting ssRNAs can be purified from crude transcription reactions by denaturing anion-exchange chromatography and then desalted by weak anion-exchange chromatography using volatile ammonium bicarbonate buffer solutions. The ssRNA oligonucleotides produced this way are homogenous, as judged by mass spectrometry (MS), and are suitable for biochemical and biophysical studies. Moreover, for high-resolution NMR structure determination of RNA-protein complexes, our protocol enables efficient preparation of ssRNA oligonucleotides with various isotope-labeling schemes which are not commercially available. PMID:26842352

  6. Oligonucleotide and amplification fingerprinting of wild species and cultivars of banana (Musa spp.).

    PubMed

    Kaemmer, D; Afza, R; Weising, K; Kahl, G; Novak, F J

    1992-09-01

    DNA oligonucleotide and amplification fingerprinting have been successfully used to detect genetic polymorphisms in 15 representative species and cultivars of the genus Musa, comprising AA, AAA, AAAA, AAB, ABB, and BB genotypes. In-gel-hybridization of Hinf I-digested genomic banana DNA to the 32P-labeled synthetic oligonucleotides (GATA)4, (GTG)5, and (CA)8 revealed considerable polymorphisms between Musa species and cultivars. The fingerprint patterns proved to be somatically stable and did not show differences between individual plants of 'Grand Nain' (AAA genotype). Dendrograms based on oligonucleotide fingerprint band sharing data proved to be consistent with most of the known features of the history of banana and plantain cultivation and evolution, respectively. DNA samples from the same banana species and cultivars were also amplified by PCR using single or pairwise combinations of short oligonucleotide primers. Amplification products were separated on agarose or polyacrylamide gels and visualized by ethidium bromide or silver staining, respectively. Polymorphic patterns were obtained with some but not all primers. By using the CCCTCTGCGG primer in simplex and/or duplex PCR, the induced mutant 'GN60A' was clearly recognized from its original variety 'Grand Nain'. Both fingerprint techniques allowed the detection of bands characteristic for the A and B genome. This DNA fingerprinting technology has potential application in several areas of Musa improvement. PMID:1369000

  7. Investigating Synthetic Oligonucleotide Targeting of Mir31 in Duchenne Muscular Dystrophy.

    PubMed

    Hildyard, John Cw; Wells, Dominic J

    2016-01-01

    Exon-skipping via synthetic antisense oligonucleotides represents one of the most promising potential therapies for Duchenne muscular dystrophy (DMD), yet this approach is highly sequence-specific and thus each oligonucleotide is of benefit to only a subset of patients. The discovery that dystrophin mRNA is subject to translational suppression by the microRNA miR31, and that miR31 is elevated in the muscle of DMD patients, raises the possibility that the same oligonucleotide chemistries employed for exon skipping could be directed toward relieving this translational block. This approach would act synergistically with exon skipping where possible, but by targeting the 3'UTR it would further be of benefit to the many DMD patients who express low levels of in-frame transcript. We here present investigations into the feasibility of combining exon skipping with several different strategies for miR31-modulation, using both in vitro models and the mdx mouse (the classical animal model of DMD), and monitoring effects on dystrophin at the transcriptional and translational level. We show that despite promising results from our cell culture model, our in vivo data failed to demonstrate similarly reproducible enhancement of dystrophin translation, suggesting that miR31-modulation may not be practical under current oligonucleotide approaches. Possible explanations for this disappointing outcome are discussed, along with suggestions for future investigations. PMID:27525173

  8. Generation and screening of an oligonucleotide-encoded synthetic peptide library.

    PubMed Central

    Needels, M C; Jones, D G; Tate, E H; Heinkel, G L; Kochersperger, L M; Dower, W J; Barrett, R W; Gallop, M A

    1993-01-01

    We have prepared a library of approximately 10(6) different peptide sequences on small, spherical (10-microns diameter) beads by the combinatorial chemical coupling of both L- and D-amino acid building blocks. To each bead is covalently attached many copies of a single peptide sequence and, additionally, copies of a unique single-stranded oligonucleotide that codes for that peptide sequence. The oligonucleotide tags are synthesized through a parallel combinatorial procedure that effectively records the process by which the encoded peptide sequence is assembled. The collection of beads was screened for binding to a fluorescently labeled anti-peptide antibody using a fluorescence-activated cell sorting instrument. Those beads to which the antibody bound tightly were isolated by fluorescence-activated sorting, and the oligonucleotide identifiers attached to individual sorted beads were amplified by the PCR. Sequences of the amplified DNAs were determined to reveal the identity of peptide sequences that bound to the antibody with high affinity. By combining the capacity for information storage in an oligonucleotide code with the tremendous level of amplification possible through the PCR, we have devised a means for specifying the identity of each member of a vast library of molecules synthesized from both natural and unnatural chemical building blocks. In addition, we have shown that the use of flow cytometry instrumentation permits facile isolation of individual beads that bear high-affinity ligands for biological receptors. Images Fig. 2 PMID:7504279

  9. Tumor cell-targeted delivery of nanoconjugated oligonucleotides in composite spheroids.

    PubMed

    Carver, Kyle; Ming, Xin; Juliano, Rudy L

    2014-12-01

    Standard tissue culture has often been a poor model for predicting the efficacy of anti-cancer agents including oligonucleotides. In contrast to the simplicity of monolayer tissue cultures, a tumor mass includes tightly packed tumor cells, tortuous blood vessels, high levels of extracellular matrix, and stromal cells that support the tumor. These complexities pose a challenge for delivering therapeutic agents throughout the tumor, with many drugs limited to cells proximal to the vasculature. Multicellular tumor spheroids are superior to traditional monolayer cell culture for the assessment of cancer drug delivery, since they possess many of the characteristics of metastatic tumor foci. However, homogeneous spheroids comprised solely of tumor cells do not account for some of the key aspects of metastatic tumors, particularly the interaction with host cells such as fibroblasts. Further, homogeneous culture does not allow for the assessment of targeted delivery to tumor versus host cells. Here we have evaluated delivery of targeted and untargeted oligonucleotide nanoconjugates and of oligonucleotide polyplexes in both homogeneous and composite tumor spheroids. We find that inclusion of fibroblasts in the spheroids reduces delivery efficacy of the polyplexes. In contrast, targeted multivalent RGD-oligonucleotide nanoconjugates were able to effectively discriminate between melanoma cells and fibroblasts, thus providing tumor-selective uptake and pharmacological effects. PMID:25238564

  10. Investigating Synthetic Oligonucleotide Targeting of Mir31 in Duchenne Muscular Dystrophy

    PubMed Central

    Hildyard, John CW; Wells, Dominic J

    2016-01-01

    Exon-skipping via synthetic antisense oligonucleotides represents one of the most promising potential therapies for Duchenne muscular dystrophy (DMD), yet this approach is highly sequence-specific and thus each oligonucleotide is of benefit to only a subset of patients. The discovery that dystrophin mRNA is subject to translational suppression by the microRNA miR31, and that miR31 is elevated in the muscle of DMD patients, raises the possibility that the same oligonucleotide chemistries employed for exon skipping could be directed toward relieving this translational block. This approach would act synergistically with exon skipping where possible, but by targeting the 3’UTR it would further be of benefit to the many DMD patients who express low levels of in-frame transcript. We here present investigations into the feasibility of combining exon skipping with several different strategies for miR31-modulation, using both in vitro models and the mdx mouse (the classical animal model of DMD), and monitoring effects on dystrophin at the transcriptional and translational level. We show that despite promising results from our cell culture model, our in vivo data failed to demonstrate similarly reproducible enhancement of dystrophin translation, suggesting that miR31-modulation may not be practical under current oligonucleotide approaches. Possible explanations for this disappointing outcome are discussed, along with suggestions for future investigations. PMID:27525173

  11. Quantitative Oligonucleotide Microarray Fingerprinting of Salmonella enterica isolates

    SciTech Connect

    Willse, Alan R.; Straub, Tim M.; Wunschel, Sharon C.; Small, Jack A.; Call, Douglas R.; Daly, Don S.; Chandler, Darrell P.

    2004-03-22

    We report on a genome-independent microbial fingerprinting method using nucleic acid microarrays for microbial forensics and epidemiology applications. We demonstrate that the microarray method provides high-resolution differentiation between closely related microorganisms using Salmonella enterica strains. In replicate trials we used a simple 192-probe nonamer array to construct a fingerprint library of 25 closely related Salmonella isolates. Controlling false discovery rate for multiple testing at alpha =.05, at least 295 of 300 pairs of S. enterica isolate fingerprints were found to be statistically distinct using a modified Hotelling Tsquared test. Although we find most pairs of Salmonella fingerprints to be distinct, forensic applications will also require a protocol for library construction and reliable microbial classification against a fingerprint library. We outline additional steps required to produce a protocol for library construction and reliable classification of unknown organisms.

  12. Monitoring of microbial communities by flow cytometry and rRNA-targeted hybridization probes

    NASA Astrophysics Data System (ADS)

    Wallner, Guenter; Amann, Rudolf

    1995-10-01

    Flow cytometry in combination with ribosomal RNA (rRNA) based fluorescence in situ hybridization is a new technique for the analysis of microbial communities. Oligonucleotide probes directed against ribosomal RNA allow the identification of species or groups of micro- organisms. Combined with flow cytometry, up to several thousand cells per second can be classified. In addition to the identification and specific enumeration of micro-organisms, further information on the distribution of cell size, DNA and ribosome content -- and therefore an assessment of activity -- within the entire community or subpopulations can be obtained. This technique is much more accurate, informative, and rapid than classical culture-dependent methods. Data of activated sludge samples hybridized with fluorescein labeled oligonucleotides and counterstained with the DNA-specific dye Hoechst 33342 are presented as examples for its applicability to complex microbial communities.

  13. Quantitative approaches to monitor protein–nucleic acid interactions using fluorescent probes

    PubMed Central

    Pagano, John M.; Clingman, Carina C.; Ryder, Sean P.

    2011-01-01

    Sequence-specific recognition of nucleic acids by proteins is required for nearly every aspect of gene expression. Quantitative binding experiments are a useful tool to measure the ability of a protein to distinguish between multiple sequences. Here, we describe the use of fluorophore-labeled oligonucleotide probes to quantitatively monitor protein/nucleic acid interactions. We review two complementary experimental methods, fluorescence polarization and fluorescence electrophoretic mobility shift assays, that enable the quantitative measurement of binding affinity. We also present two strategies for post-synthetic end-labeling of DNA or RNA oligonucleotides with fluorescent dyes. The approaches discussed here are efficient and sensitive, providing a safe and accessible alternative to the more commonly used radio-isotopic methods. PMID:21098142

  14. FLUORESCENT IN SITU DETECTION OF ENCEPHALITOZOON HELLEM SPORES WITH A 6-CARBOXYFLUORESCEIN-LABELED RIBOSOMAL RNA-TARGETED OLIGONUCLEOTIDE PROBE

    EPA Science Inventory

    A fluroescent in situ hybridization assay has been developed for the detection of the human-pathogenic microsporidian, Encephalitozoon hellem in water samples using epifluorescence microscopy. The assay employs a 19-nucleotide species-specific 6-carboxyfluorescein-labeled oligonu...

  15. FLUORESCENT IN SITU DETECTION OF ENCEPHALITOZOON HELLEM SPORES WITH A 6-CARBOXYFLUORESCEIN-LABELED RNA-TARGETED OLIGONUCLEOTIDE PROBE

    EPA Science Inventory

    A fluorescent in situ hybridization assay has been developed for the detection of the human-pathogenic microsporidian, Encephalitozoon hellem, in water samples using epifluorescence microscopy. The assay employs a 19-nucleotide species-specific 6-carboxyfluorescein-labeled oligo...

  16. Galileo Probe Battery System

    NASA Technical Reports Server (NTRS)

    Dagarin, B. P.; Taenaka, R. K.; Stofel, E. J.

    1997-01-01

    The conclusions of the Galileo probe battery system are: the battery performance met mission requirements with margin; extensive ground-based and flight tests of batteries prior to probe separation from orbiter provided good prediction of actual entry performance at Jupiter; and the Li-SO2 battery was an important choice for the probe's main power.

  17. Identification of planctomycetes with order-, genus-, and strain-specific 16S rRNA-targeted probes.

    PubMed

    Gade, D; Schlesner, H; Glöckner, F O; Amann, R; Pfeiffer, S; Thomm, M

    2004-04-01

    A specific 16S rRNA-targeted oligonucleotide probe (PIR1223) for the genus Pirellula and a species-specific probe (RB454) for Pirellula sp. strain SH1 have been designed and optimized. Together with the already existing order-specific probe PLA886, the two newly designed probes were used to detect and identify planctomycetes, pirellulae, and close relatives of Pirellula sp. strain SH1 in different habitats. With the help of these probes for detection and identification, bacteria of the genus Pirellula were detected and cultivated from tissue of the Mediterranean sponge Aplysina aerophoba and from the water column of the Kiel Fjord. An unexpected result was the close phylogenetic relationship of the isolate from the sponge and the brackish water habitat Kiel Fjord as revealed by DNA/DNA hybridization. PMID:14994173

  18. Sugar radicals formed by photo-excitation of guanine cation radical in oligonucleotides

    PubMed Central

    Adhikary, Amitava; Collins, Sean; Khanduri, Deepti; Sevilla, Michael D.

    2008-01-01

    This work presents evidence that photo-excitation of guanine cation radical (G•+) in dGpdG and DNA-oligonucleotides: TGT, TGGT, TGGGT, TTGTT, TTGGTT, TTGGTTGGTT, AGA and AGGGA in frozen glassy aqueous solutions at low temperatures leads to hole transfer to the sugar phosphate backbone and results in high yields of deoxyribose radicals. In this series of oligonucleotides we find that, G•+ on photo-excitation, at 143 K leads to the formation of predominantly C5′• and C1′• with small amounts of C3′•. Photo-conversion yields of G•+ to sugar radicals in oligonucleotides decreased as the overall chain length increased. However, for high molecular weight dsDNA (salmon testes) in frozen aqueous solutions substantial conversion of G•+ to C1′• (only) sugar radical is still found (ca. 50%). Within the cohort of sugar radicals formed we find a relative increase in the formation of C1′• with length of the oligonucleotide along with decreases in C3′• and C5′• For dsDNA in frozen solutions, only the formation of C1′• is found via photo-excitation of G•+ without a significant temperature dependence (77 K to 180 K). Long wavelength visible light (>540 nm) is observed to be about as effective as light under 540 nm for photoconversion of G•+ to sugar radicals for short oligonucleotides but gradually loses effectiveness with chain length. This wavelength dependence is attributed to base-to-base hole transfer for wavelengths >540 nm. Base-to-sugar hole transfer is suggested to dominate under 540 nm. These results may have implications for a number of investigations of hole transfer through DNA in which DNA-holes are subjected to continuous visible illumination. PMID:17547448

  19. Coupling Strategies for the Synthesis of Peptide-Oligonucleotide Conjugates for Patterned Synthetic Biomineralization

    PubMed Central

    Carter, Joshua D.; LaBean, Thomas H.

    2011-01-01

    This work describes preparation strategies for peptide-oligonucleotide conjugates that combine the self-assembling behavior of DNA oligonucleotides with the molecular recognition capabilities of peptides. The syntheses include a solution-phase fragment coupling reaction and a solid-phase fragment coupling strategy where the oligonucleotide has been immobilized on DEAE Sepharose. The yield of four coupling reagents is evaluated, two reagents in water, EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) and DMTMM (4-(4,6-dimethoxy[1,3,5]triazin-2-yl)-4-methyl-morpholinium chloride), and two in dimethylformamide (DMF), PyBOP ((Benzotriazol-1-yloxy) tripyrrolidinophosphonium hexafluorophosphate) and HBTU (O-benzotriazole-N,N,N′,N′-tetramethyluronium hexafluorophosphate), while the oligonucleotide fragment is either in solution or immobilized on DEAE. These coupling strategies rely on an unprotected 5′ amino linker on the oligonucleotide reacting with the peptide C-terminus. The peptide, selected from a combinatorial library for its gold-binding behavior, was 12 amino acids long with an N-terminus acetyl cap. Formation of the conjugates was confirmed by gel electrophoresis and mass spectrometry while molecular recognition functionality of the peptide portion was verified using atomic force microscopy. Solution-phase yields were superior to their solid-phase counterparts. EDC resulted in the highest yield for both solution-phase (95%) and solid-phase strategies (24%), while the DMF-based reagents, PyBOP and HBTU, resulted in low yields with reduced recovery. All recoverable conjugates demonstrated gold nanoparticle templating capability. PMID:22007290

  20. Coupling strategies for the synthesis of Peptide-oligonucleotide conjugates for patterned synthetic biomineralization.

    PubMed

    Carter, Joshua D; Labean, Thomas H

    2011-01-01

    This work describes preparation strategies for peptide-oligonucleotide conjugates that combine the self-assembling behavior of DNA oligonucleotides with the molecular recognition capabilities of peptides. The syntheses include a solution-phase fragment coupling reaction and a solid-phase fragment coupling strategy where the oligonucleotide has been immobilized on DEAE Sepharose. The yield of four coupling reagents is evaluated, two reagents in water, EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) and DMTMM (4-(4,6-dimethoxy[1,3,5]triazin-2-yl)-4-methyl-morpholinium chloride), and two in dimethylformamide (DMF), PyBOP ((Benzotriazol-1-yloxy) tripyrrolidinophosphonium hexafluorophosphate) and HBTU (O-benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate), while the oligonucleotide fragment is either in solution or immobilized on DEAE. These coupling strategies rely on an unprotected 5' amino linker on the oligonucleotide reacting with the peptide C-terminus. The peptide, selected from a combinatorial library for its gold-binding behavior, was 12 amino acids long with an N-terminus acetyl cap. Formation of the conjugates was confirmed by gel electrophoresis and mass spectrometry while molecular recognition functionality of the peptide portion was verified using atomic force microscopy. Solution-phase yields were superior to their solid-phase counterparts. EDC resulted in the highest yield for both solution-phase (95%) and solid-phase strategies (24%), while the DMF-based reagents, PyBOP and HBTU, resulted in low yields with reduced recovery. All recoverable conjugates demonstrated gold nanoparticle templating capability. PMID:22007290