Science.gov

Sample records for oxaliplatin-dna adduct formation

  1. Polymorphic acetylation of arylamines and DNA-adduct formation.

    PubMed

    Weber, W W; Levy, G N; Martell, K J

    1990-01-01

    Inbred mouse strains congenic for rapid and slow N-acetyltransferase (NAT) (A.B6, rapid and B6.A, slow) were used to separate the effect of the NAT polymorphism from the influence of other genetically polymorphic enzymes on DNA adduct formation induced by exposure to arylamine carcinogens. Adduct formation was measured by HPLC analysis of 32P-postlabeled nucleotides from DNA of the urinary bladder and liver. Acetylator phenotype was a significant determinant of DNA damage in females as slow acetylators had higher levels of bladder DNA adducts than rapids. This correlation was the reverse of that seen with liver DNA. Older mice (20-23 weeks) formed much higher bladder DNA adduct levels than young mice (7 week). The increase in bladder adduct formation with age was seen in both sexes of all mouse strains. The older male B6 mice showed a 26-fold increase in bladder adducts and the older females showed no more than a 2-fold increase. In addition, the older male B6 mice produced significant amounts of an unidentified, early eluting adduct peak. Biochemical studies of liver NAT and O-acetyltransferase (OAT) activities showed a direct correlation between the levels of liver 2-aminofluorene (AF) NAT activity and levels of liver DNA-adduct formation, but the role of OAT activity in adduct formation in the mouse remains unclear. These results indicate that the NAT phenotype, age and sex are all important determinants of arylamine-DNA adduct formation in mice. PMID:2134671

  2. DNA adduct formation by alachlor metabolites

    SciTech Connect

    Brown, M.A.; Kimmel, E.C.; Casida, J.E.

    1988-01-01

    The extent of DNA adduct formation by alachlor (ArN(CH/sub 2/OCH/sub 3/)C(O)CH/sub 2/Cl wherein Ar is 2,6-diethylphenyl) and its metabolites is used as a guide to deduce the causal agent(s) in the carcinogenicity of this major herbicide. (/sup 14/C-phenyl)Alachlor is compared to its two metabolic cleavage products, (/sup 14/C-phenyl) 2-chloro-N-(2,6-diethylphenyl)acetamide (CDEPA) (ArNHC(O)CH/sub 2/Cl) and (/sup 14/C-phenyl)2,6-diethylaniline (DEA) (ArNH/sub 2/), and to (/sup 14/C-methoxy)alachlor in various in vitro and in vivo systems. Horseradish peroxidase and hydrogen peroxide activate DEA, but not CEDPA or alachlor, for formation of adducts with calf thymus DNA, which probably involves 2,6-diethylnitrosobenzene (ArNO) as an intermediate. Mouse liver microsomes and NADPH are both required to enhance the binding from each labeled preparation to calf thymus DNA; 4-fold higher labeling is observed from (/sup 14/C-methoxy)- than from (/sup 14/C-phenyl)alachlor. This 4-fold preferential DNA labeling from the /sup 14/C-methoxy compound is likewise found in the liver of mice treated intraperitoneally. Mouse liver protein and hemoglobin are also labeled, in vivo, with (/sup 14/C-phenyl)alachlor, -CDEPA and -DEA, and, as with the DNA, the labeling of these proteins is 1.5- to 2-fold higher with (/sup 14/C-methoxy)alachlor.

  3. Diet-related DNA adduct formation in relation to carcinogenesis.

    PubMed

    Hemeryck, Lieselot Y; Vanhaecke, Lynn

    2016-08-01

    The human diet contributes significantly to the initiation and promotion of carcinogenesis. It has become clear that the human diet contains several groups of natural foodborne chemicals that are at least in part responsible for the genotoxic, mutagenic, and carcinogenic potential of certain foodstuffs. Electrophilic chemicals are prone to attack nucleophilic sites in DNA, resulting in the formation of altered nucleobases, also known as DNA adducts. Since DNA adduct formation is believed to signal the onset of chemically induced carcinogenesis, the DNA adduct-inducing potential of certain foodstuffs has been investigated to gain more insight into diet-related pathways of carcinogenesis. Many studies have investigated diet-related DNA adduct formation. This review summarizes work on known or suspected dietary carcinogens and the role of DNA adduct formation in hypothesized carcinogenesis pathways. PMID:27330144

  4. Protein modification by acrolein: Formation and stability of cysteine adducts

    PubMed Central

    Cai, Jian; Bhatnagar, Aruni; Pierce, William M.

    2010-01-01

    The toxicity of the ubiquitous pollutant and endogenous metabolite, acrolein, is due in part to covalent protein modifications. Acrolein reacts readily with protein nucleophiles via Michael addition and Schiff base formation. Potential acrolein targets in protein include the nucleophilic side chains of cysteine, histidine, and lysine residues as well as the free amino terminus of proteins. Although cysteine is the most acrolein-reactive residue, cysteine-acrolein adducts are difficult to identify in vitro and in vivo. In this study, model peptides with cysteine, lysine, and histidine residues were used to examine the reactivity of acrolein. Results from these experiments show that acrolein reacts rapidly with cysteine residues through Michael addition to form M+56 Da adducts. These M+56 adducts are, however, not stable, even though spontaneous dissociation of the adduct is slow. Further studies demonstrated that when acrolein and model peptides are incubated at physiological pH and temperature, the M+56 adducts decreased gradually accompanied by the increase of M+38 adducts, which are formed from intra-molecular Schiff base formation. Adduct formation with the side chains of other amino acid residues (lysine and histidine) was much slower than cysteine and required higher acrolein concentration. When cysteine residues were blocked by reaction with iodoacetamide and higher concentrations of acrolein were used, adducts of the N-terminal amino group or histidyl residues were formed but lysine adducts were not detected. Collectively, these data demonstrate that acrolein reacts avidly with protein cysteine residues and that the apparent loss of protein-acrolein Michael adducts over time may be related to the appearance of a novel (M+38) adduct. These findings may be important in identification of in vivo adducts of acrolein with protein cysteine residues. PMID:19231900

  5. Protein adduct formation as a molecular mechanism in neurotoxicity.

    PubMed

    Lopachin, Richard M; Decaprio, Anthony P

    2005-08-01

    Chemicals that cause nerve injury and neurological deficits are a structurally diverse group. For the majority, the corresponding molecular mechanisms of neurotoxicity are poorly understood. Many toxicants (e.g., hepatotoxicants) of other organ systems and/or their oxidative metabolites have been identified as electrophiles and will react with cellular proteins by covalently binding nucleophilic amino acid residues. Cellular toxicity occurs when adduct formation disrupts protein structure and/or function, which secondarily causes damage to submembrane organelles, metabolic pathways, or cytological processes. Since many neurotoxicants are also electrophiles, the corresponding pathophysiological mechanism might involve protein adduction. In this review, we will summarize the principles of covalent bond formation that govern reactions between xenobiotic electrophiles and biological nucleophiles. Because a neurotoxicant can form adducts with multiple nucleophilic residues on proteins, the challenge is to identify the mechanistically important adduct. In this regard, it is now recognized that despite widespread chemical adduction of tissue proteins, neurotoxicity can be mediated through binding of specific target nucleophiles in key neuronal proteins. Acrylamide and 2,5-hexanedione are prototypical neurotoxicants that presumably act through the formation of protein adducts. To illustrate both the promise and the difficulty of adduct research, these electrophilic chemicals will be discussed with respect to covalent bond formation, suspected protein sites of adduction, and proposed mechanisms of neurotoxicity. The goals of future investigations are to identify and quantify specific protein adducts that play a causal role in the generation of neurotoxicity induced by electrophilic neurotoxicants. This is a challenging but critical objective that will be facilitated by recent advances in proteomic methodologies. PMID:15901921

  6. Paclitaxel Enhances Carboplatin-DNA Adduct Formation and Cytotoxicity

    DOE PAGESBeta

    Jiang, Shuai; Pan, Amy W.; Lin, Tzu-yin; Zhang, Hongyong; Malfatti, Michael; Turteltaub, Kenneth; Henderson, Paul T.; Pan, Chong-xian

    2015-11-06

    This rapid report focuses on the pharmacodynamic mechanism of the carboplatin/paclitaxel combination and correlates it with its cytotoxicity. Consistent with the synergistic to additive antitumor activity (the combination index ranging from 0.53 to 0.94), cells exposed to this combination had significantly increased carboplatin-DNA adduct formation when compared to that of carboplatin alone (450 ± 30 versus 320 ± 120 adducts per 108 nucleotides at 2 h, p = 0.004). Removal of paclitaxel increased the repair of carboplatin-DNA adducts: 39.4 versus 33.1 adducts per 108 nucleotides per hour in carboplatin alone (p = 0.021). In conclusion, this rapid report provides themore » first pharmacodynamics data to support the use of carboplatin/paclitaxel combination in the clinic.« less

  7. Paclitaxel Enhances Carboplatin-DNA Adduct Formation and Cytotoxicity

    SciTech Connect

    Jiang, Shuai; Pan, Amy W.; Lin, Tzu-yin; Zhang, Hongyong; Malfatti, Michael; Turteltaub, Kenneth; Henderson, Paul T.; Pan, Chong-xian

    2015-11-06

    This rapid report focuses on the pharmacodynamic mechanism of the carboplatin/paclitaxel combination and correlates it with its cytotoxicity. Consistent with the synergistic to additive antitumor activity (the combination index ranging from 0.53 to 0.94), cells exposed to this combination had significantly increased carboplatin-DNA adduct formation when compared to that of carboplatin alone (450 ± 30 versus 320 ± 120 adducts per 108 nucleotides at 2 h, p = 0.004). Removal of paclitaxel increased the repair of carboplatin-DNA adducts: 39.4 versus 33.1 adducts per 108 nucleotides per hour in carboplatin alone (p = 0.021). In conclusion, this rapid report provides the first pharmacodynamics data to support the use of carboplatin/paclitaxel combination in the clinic.

  8. Paclitaxel Enhances Carboplatin-DNA Adduct Formation and Cytotoxicity.

    PubMed

    Jiang, Shuai; Pan, Amy W; Lin, Tzu-yin; Zhang, Hongyong; Malfatti, Michael; Turteltaub, Kenneth; Henderson, Paul T; Pan, Chong-xian

    2015-12-21

    This rapid report focuses on the pharmacodynamic mechanism of the carboplatin/paclitaxel combination and correlates it with its cytotoxicity. Consistent with the synergistic to additive antitumor activity (the combination index ranging from 0.53 to 0.94), cells exposed to this combination had significantly increased carboplatin-DNA adduct formation when compared to that of carboplatin alone (450 ± 30 versus 320 ± 120 adducts per 10(8) nucleotides at 2 h, p = 0.004). Removal of paclitaxel increased the repair of carboplatin-DNA adducts: 39.4 versus 33.1 adducts per 10(8) nucleotides per hour in carboplatin alone (p = 0.021). This rapid report provides the first pharmacodynamics data to support the use of carboplatin/paclitaxel combination in the clinic. PMID:26544157

  9. Ion-molecule adduct formation in tandem mass spectrometry.

    PubMed

    Alechaga, Élida; Moyano, Encarnación; Galceran, Maria Teresa

    2016-02-01

    Nowadays most LC-MS methods rely on tandem mass spectrometry not only for quantitation and confirmation of compounds by multiple reaction monitoring (MRM), but also for the identification of unknowns from their product ion spectra. However, gas-phase reactions between charged and neutral species inside the mass analyzer can occur, yielding product ions at m/z values higher than that of the precursor ion, or at m/z values difficult to explain by logical losses, which complicate mass spectral interpretation. In this work, the formation of adduct ions in the mass analyzer was studied using several mass spectrometers with different mass analyzers (ion trap, triple quadrupole, and quadrupole-Orbitrap). Heterocyclic amines (AαC, MeAαC, Trp-P-1, and Trp-P-2), photo-initiators (BP and THBP), and pharmaceuticals (phenacetin and levamisole) were selected as model compounds and infused in LCQ Classic, TSQ Quantum Ultra AM, and Q-Exactive Orbitrap (ThermoFisher Scientific) mass spectrometers using electrospray as ionization method. The generation of ion-molecule adducts depended on the compound and also on the instrument employed. Adducts with neutral organic solvents (methanol and acetonitrile) were only observed in the ion trap instrument (LCQ Classic), because of the ionization source on-axis configuration and the lack of gas-phase barriers, which allowed inertial entrance of the neutrals into the analyzer. Adduct formation (only with water) in the triple quadrupole instruments was less abundant than in the ion trap and quadrupole-Orbitrap mass spectrometers, because of the lower residence time of the reactive product ions in the mass analyzer. The moisture level of the CID and/or damper gas had a great effect in beam-like mass analyzers such as triple quadrupole, but not in trap-like mass analyzers, probably because of the long residence time that allowed adduct formation even with very low concentrations of water inside the mass spectrometer. PMID:26700446

  10. UVR Exposure Sensitizes Keratinocytes to DNA Adduct Formation

    PubMed Central

    Nair, Sudhir; Kekatpure, Vikram D.; Judson, Benjamin L.; Rifkind, Arleen B.; Granstein, Richard D.; Boyle, Jay O.; Subbaramaiah, Kotha; Guttenplan, Joseph B.; Dannenberg, Andrew J.

    2009-01-01

    Ultraviolet radiation (UVR) and exposure to tobacco smoke, a source of polycyclic aromatic hydrocarbons (PAH), have been linked to skin carcinogenesis. UVR-mediated activation of the aryl hydrocarbon receptor (AhR) stimulates the transcription of CYP1A1 and CYP1B1, which encode proteins that convert PAH to genotoxic metabolites. We determined whether UVR exposure sensitized human keratinocytes to PAH-induced DNA adduct formation. UVR exposure induced CYP1A1 and CYP1B1 in HaCaT cells, an effect that was mimicked by photooxidized tryptophan (aTRP) and FICZ, a component of aTRP. UVR exposure or pretreatment with aTRP or FICZ also sensitized cells to benzo[a]pyrene (B[a]P) induced DNA adduct formation. α-Naphthoflavone (αNF), an AhR antagonist, suppressed UVR-, aTRP- and FICZ-mediated induction of CYP1A1 and CYP1B1 and inhibited B[a]P induced DNA adduct formation. Treatment with 17-AAG, a Hsp90 inhibitor, caused a marked decrease in levels of AhR, inhibited UVR-, aTRP- and FICZ-mediated induction of CYP1A1 and CYP1B1 and blocked the sensitization of HaCaT cells to B[a]P induced DNA adduct formation. FICZ has been suggested to be a physiological ligand of the AhR that may have systemic effects. Hence, studies of FICZ were also carried out in MSK-Leuk1 cells, a model of oral leukoplakia. Pretreatment with αNF or 17-AAG blocked FICZ-mediated induction of CYP1A1 and CYP1B1, and suppressed the increased B[a]P-induced DNA adduct formation. Collectively, these results suggest that sunlight may activate AhR signaling and thereby sensitize cells to PAH-mediated DNA adduct formation. Antagonists of AhR signaling may have a role in the chemoprevention of photocarcinogenesis. PMID:19789301

  11. DNA adducts of ethylene dibromide: Aspects of formation and mutagenicity

    SciTech Connect

    Cmarik, J.L.

    1991-01-01

    1,2-Dibromoethane (ethylene dibromide, EDB), a potential human carcinogen, undergoes bioactivation by the pathway of glutathione (GSH) conjugation, which generates a reactive intermediate capable of alkylating DNA. The major DNA adduct formed is S-[2-(N[sup 7]-guanyl)ethyl]GSH. This dissertation examined the bioactivation of EDB and the formation of DNA adducts. The selectivity of purified rat and human GSH S-transferases for EDB was examined in vitro. An assay was developed to measure the formation of S,S[prime]-ethylene-bis(GSH). The [alpha] class of the GSH S-transferases was responsible for the majority of EDB-GSH conjugation with both the rat and human enzymes. Human tissue samples for a victim of EDB poisoning were analyzed for S-[2-(N[sup 7]-guanyl)ethyl]GSH utilizing electrochemical detection. No adducts were detected in samples of brain, heart, or kidney. The pattern of alkylation of guanines in fragments of plasmid pBR322 DNA by S-(2-chloroethyl)GSH and related compounds was determined. Alkylation varied approximately ten-fold in intensity and was strongest in runs of guanines. Few differences were observed in the alkylation patterns generated by the different compounds tested. The spectrum of mutations caused by S-(2-chloroethyl)GSH was determined using an M13 bacteriophage forward mutation assay. The majority of mutations (70%) were G:C to A:T transitions. Participation of the N[sup 7]-guanyl adduct in the mutagenic process is strongly implicated. The sequence selectivity of alkylation in the region of M13 sequenced in the mutation assay was determined. Comparison of the sequence selectivity with the mutation spectrum revealed no obligate relationship between the extent of adduct formation and the number of mutations which resulted at different sites. Sequence context appears to exert a strong influence on the processing of lesions. These studies strongly implicate S-[2-(N[sup 7]-guanyl)-ethyl]GSH as a mutagenic lesion formed by EDB.

  12. Metabolites and DNA adduct formation from flavoenzyme-activated porfiromycin.

    PubMed

    Pan, S S; Iracki, T

    1988-08-01

    Porfiromycin was reductively metabolized by NADPH cytochrome P-450 reductase and xanthine oxidase under anaerobic conditions. The production of metabolites varied with the pH and the contents of the reaction buffer. In Tris buffer, two major metabolites were produced at pH 7.5 and above, whereas one major metabolite was produced at pH 6.5. The three major metabolites were separated and isolated by HPLC. Identification by californium-252 plasma desorption mass spectrometry showed that the two major metabolites from pH 7.5 were (trans) and (cis)-forms of 7-amino-1-hydroxyl-2-methylaminomitosene and the major metabolite from pH 6.5 was 7-amino-2-methylaminomitosene. All three major metabolites showed substitutions at the C-1 position. DNA was alkylated readily by enzyme-activated porfiromycin. Digestion of porfiromycin-alkylated DNA by DNase, snake venom phosphodiesterase, and alkaline phosphatase resulted in an insoluble nuclease-resistant fraction and a soluble fraction. The nuclease-resistant fraction reflected a high content of cross-linked adducts. Upon HPLC analysis, the solubilized fraction contained two monofunctionally linked porfiromycin adducts and a possibly cross-linked dinucleotide. The major adduct was isolated by HPLC and identified by NMR, as N2-(2'-deoxyguanosyl)-7-amino-2-methylaminomitosene. The N2 position of deoxyguanosine appeared as the major monofunctional alkylating site for DNA alkylation by porfiromycin. Thus, mitomycin C and porfiromycin (which differs from mitomycin C only by the addition of a methyl group to the aziridine nitrogen) share the same enzymatic activating mechanism that leads to the formation of the same types of metabolites and the same specificity of DNA alkylation. PMID:3412325

  13. Temporal and spatial features of the formation of DNA adducts in sulfur mustard-exposed skin

    SciTech Connect

    Batal, Mohamed; Boudry, Isabelle; Mouret, Stéphane; Wartelle, Julien; Emorine, Sandy; Bertoni, Marine; Bérard, Izabel; and others

    2013-12-15

    Sulfur mustard (SM) is a chemical warfare agent that targets skin where it induces large blisters. DNA alkylation is a critical step to explain SM-induced cutaneous symptoms. We determined the kinetics of formation of main SM–DNA adducts and compare it with the development of the SM-induced pathogenesis in skin. SKH-1 mice were exposed to 2, 6 and 60 mg/kg of SM and treated skin was biopsied between 6 h and 21 days. Formation of SM DNA adducts was dose-dependent with a maximum immediately after exposure. However, adducts were persistent and still detectable 21 days post-exposure. The time-dependent formation of DNA adducts was also found to be correlated with the appearance of apoptotic cells. This temporal correlation suggests that these two early events are responsible for the severity of the damage to the skin. Besides, SM–DNA adducts were also detected in areas located next to contaminated zone, thus suggesting that SM diffuses in skin. Altogether, this work provides for the first time a clear picture of SM-induced genotoxicity using DNA adducts as a marker. - Highlights: • Sulfur mustard adducts are formed in DNA after skin exposure. • DNA damage formation is an early event in the pathological process of skin burn. • The amount of SM–DNA adducts is maximal at the earliest time point investigated. • Adducts are still detected 3 weeks after exposure. • Sulfur mustard diffuses in skin especially when large doses are applied.

  14. Effect of phytochemical intervention on dibenzo[a,l]pyrene-induced DNA adduct formation.

    PubMed

    Russell, Gilandra K; Gupta, Ramesh C; Vadhanam, Manicka V

    2015-04-01

    Dibenzo[a,l]pyrene (DBP) has been found to be the most potent carcinogen of the polycyclic aromatic hydrocarbons (PAHs). Primary sources for DBP in the environment are combustion of wood and coal burning, gasoline and diesel exhaust, and tires. Given the likelihood of environmental exposure to DBP and strong experimental evidence of its potency, it is likely to contribute to lung cancer development. Intervention with compounds of natural origin ("phytochemicals") is considered an effective means to prevent cancer development and favorably modulate the underlying mechanisms, including DNA adduct formation. In this study, several agents have been identified that inhibit environmental carcinogen-induced DNA adduct formation using a cell-free microsomal system. Of the ten agents tested, resveratrol (648 ± 26 adducts/10(9) nucleotides), oltipraz (1007 ± 348 adducts/10(9) nucleotides), delphinidin (1252 ± 142 adducts/10(9) nucleotides), tanshinone I (1981 ± 213 adducts/10(9) nucleotides), tanshinone IIA (2606 ± 478 adducts/10(9) nucleotides) and diindoylmethane (3643 ± 469 adducts/10(9) nucleotides) were the most effective compared to vehicle treatment (14,062 ± 1097 adducts/10(9) nucleotides). DBP is metabolized by phase I metabolizing enzymes CYP1A1, CYP1A2, and CYP1B1. DBP-induced DNA adducts can be inhibited by several mechanisms. We found that all the test agents inhibited DNA adducts by inhibiting one or more of these enzymes. Oltipraz inhibited DNA adducts entirely by inhibiting the CYP450s, while resveratrol and delphinidin inhibited DNA adducts by also interacting directly with the carcinogenic metabolite, anti-dibenzo(a,l)pyrene-11,12-dihydrodiol-13,14-epoxide. PMID:25794985

  15. Effect of phytochemical intervention on dibenzo[a,l]pyrene-induced DNA adduct formation

    PubMed Central

    Russell, Gilandra K.; Gupta, Ramesh C.; Vadhanam, Manicka V.

    2015-01-01

    Dibenzo[a,l]pyrene (DBP) has been found to be the most potent carcinogen of the polycyclic aromatic hydrocarbons (PAHs). Primary sources for DBP in the environment are combustion of wood and coal burning, gasoline and diesel exhaust, and tires. Given the likelihood of environmental exposure to DBP and strong experimental evidence of its potency, it is likely to contribute to lung cancer development. Intervention with compounds of natural origin (“phytochemicals”) is considered an effective means to prevent cancer development and favorably modulate the underlying mechanisms, including DNA adduct formation. In this study, several agents have been identified that inhibit environmental carcinogen-induced DNA adduct formation using a cell-free microsomal system. Of the ten agents tested, resveratrol (648 ± 26 adducts/109 nucleotides), oltipraz (1007 ± 348 adducts/109 nucleotides), delphinidin (1252 ± 142 adducts/109 nucleotides), tanshinone I (1981 ± 213 adducts/109 nucleotides), tanshinone IIA (2606 ± 478 adducts/109 nucleotides) and diindoylmethane (3643 ± 469 adducts/109 nucleotides) were the most effective compared to vehicle treatment (14,062 ± 1097 adducts/109 nucleotides). DBP is metabolized by phase I metabolizing enzymes CYP1A1, CYP1A2, and CYP1B1. DBP-induced DNA adducts can be inhibited by several mechanisms. We found that all the test agents inhibited DNA adducts by inhibiting one or more of these enzymes. Oltipraz inhibited DNA adducts entirely by inhibiting the CYP450s, while resveratrol and delphinidin inhibited DNA adducts by also interacting directly with the carcinogenic metabolite, anti-dibenzo(a,l)pyrene-11,12-dihydrodiol-13,14-epoxide. PMID:25794985

  16. Methods for synthesizing alane without the formation of adducts and free of halides

    DOEpatents

    Zidan, Ragaiy; Knight, Douglas A; Dinh, Long V

    2013-02-19

    A process is provided to synthesize an alane without the formation of alane adducts as a precursor. The resulting product is a crystallized .alpha.-alane and is a highly stable product and is free of halides.

  17. Preferential Formation of Benzo[a]pyrene Adducts at Lung Cancer Mutational Hotspots in P53

    NASA Astrophysics Data System (ADS)

    Denissenko, Mikhail F.; Pao, Annie; Tang, Moon-Shong; Pfeifer, Gerd P.

    1996-10-01

    Cigarette smoke carcinogens such as benzo[a]pyrene are implicated in the development of lung cancer. The distribution of benzo[a]pyrene diol epoxide (BPDE) adducts along exons of the P53 gene in BPDE-treated HeLa cells and bronchial epithelial cells was mapped at nucleotide resolution. Strong and selective adduct formation occurred at guanine positions in codons 157, 248, and 273. These same positions are the major mutational hotspots in human lung cancers. Thus, targeted adduct formation rather than phenotypic selection appears to shape the P53 mutational spectrum in lung cancer. These results provide a direct etiological link between a defined chemical carcinogen and human cancer.

  18. Metabolism and hemoglobin adduct formation of acrylamide in humans.

    PubMed

    Fennell, Timothy R; Sumner, Susan C J; Snyder, Rodney W; Burgess, Jason; Spicer, Rebecca; Bridson, William E; Friedman, Marvin A

    2005-05-01

    Acrylamide (AM), used in the manufacture of polyacrylamide and grouting agents, is produced during the cooking of foods. Workplace exposure to AM can occur through the dermal and inhalation routes. The objectives of this study were to evaluate the metabolism of AM in humans following oral administration, to compare hemoglobin adduct formation on oral and dermal administration, and to measure hormone levels. The health of the people exposed under controlled conditions was continually monitored. Prior to conducting exposures in humans, a low-dose study was conducted in rats administered 3 mg/kg (1,2,3-13C3) AM by gavage. The study protocol was reviewed and approved by Institute Review Boards both at RTI, which performed the sample analysis, and the clinical research center conducting the study. (1,2,3-13C3) AM was administered in an aqueous solution orally (single dose of 0.5, 1.0, or 3.0 mg/kg) or dermally (three daily doses of 3.0 mg/kg) to sterile male volunteers. Urine samples (3 mg/kg oral dose) were analyzed for AM metabolites using 13C NMR spectroscopy. Approximately 86% of the urinary metabolites were derived from GSH conjugation and excreted as N-acetyl-S-(3-amino-3-oxopropyl)cysteine and its S-oxide. Glycidamide, glyceramide, and low levels of N-acetyl-S-(3-amino-2-hydroxy-3-oxopropyl)cysteine were detected in urine. On oral administration, a linear dose response was observed for N-(2-carbamoylethyl)valine (AAVal) and N-(2-carbamoyl-2-hydroxyethyl)valine (GAVal) in hemoglobin. Dermal administration resulted in lower levels of AAVal and GAVal. This study indicated that humans metabolize AM via glycidamide to a lesser extent than rodents, and dermal uptake was approximately 6.6% of that observed with oral uptake. PMID:15625188

  19. DNA Adduct Formation of 4-Aminobiphenyl and Heterocyclic Aromatic Amines in Human Hepatocytes

    PubMed Central

    Nauwelaers, Gwendoline; Bessette, Erin E.; Gu, Dan; Tang, Yijin; Rageul, Julie; Fessard, Valérie; Yuan, Jian-Min; Yu, Mimi C.; Langouët, Sophie; Turesky, Robert J.

    2011-01-01

    DNA adduct formation of the aromatic amine, 4-aminobiphenyl (4-ABP), a known human carcinogen present in tobacco smoke, and the heterocyclic aromatic amines (HAAs), 2-amino-9H-pyrido[2,3-b]indole (AαC), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), and 2-amino-3,8-dimethylmidazo[4,5-f]quinoxaline (MeIQx), potential human carcinogens, which are also present in tobacco smoke or formed during the high-temperature cooking of meats, was investigated in freshly cultured human hepatocytes. The carcinogens (10 μM) were incubated with hepatocytes derived from eight different donors for time periods up to 24 h. The DNA adducts were quantified by liquid chromatography-electrospray ionization mass spectrometry with a linear quadrupole ion trap mass spectrometer. The principal DNA adducts formed for all of the carcinogens were N-(deoxyguanosin-8-yl) (dG-C8) adducts. The levels of adducts ranged from 3.4 to 140 adducts per 107 DNA bases. The highest level of adduct formation occurred with AαC, followed by 4-ABP, then by PhIP, MeIQx, and IQ. Human hepatocytes formed dG-C8-HAA-adducts at levels that were up to 100-fold greater than the amounts of adducts produced in rat hepatocytes. In contrast to HAA adducts, the levels of dG-C8-4-ABP adduct formation were similar in human and rat hepatocytes. These DNA binding data demonstrate that the rat, an animal model that is used for carcinogenesis bioassays, significantly underestimates the potential hepatic genotoxicity of HAAs in humans. The high level of DNA adducts formed by AαC, a carcinogen produced in tobacco smoke at levels that are up to 100-fold higher than the amounts of 4-ABP, is noteworthy. The possible causal role of AαC in tobacco-associated cancers warrants investigation. PMID:21456541

  20. Formation and Repair of Tobacco Carcinogen-Derived Bulky DNA Adducts

    PubMed Central

    Hang, Bo

    2010-01-01

    DNA adducts play a central role in chemical carcinogenesis. The analysis of formation and repair of smoking-related DNA adducts remains particularly challenging as both smokers and nonsmokers exposed to smoke are repetitively under attack from complex mixtures of carcinogens such as polycyclic aromatic hydrocarbons and N-nitrosamines. The bulky DNA adducts, which usually have complex structure, are particularly important because of their biological relevance. Several known cellular DNA repair pathways have been known to operate in human cells on specific types of bulky DNA adducts, for example, nucleotide excision repair, base excision repair, and direct reversal involving O6-alkylguanine DNA alkyltransferase or AlkB homologs. Understanding the mechanisms of adduct formation and repair processes is critical for the assessment of cancer risk resulting from exposure to cigarette smoke, and ultimately for developing strategies of cancer prevention. This paper highlights the recent progress made in the areas concerning formation and repair of bulky DNA adducts in the context of tobacco carcinogen-associated genotoxic and carcinogenic effects. PMID:21234336

  1. Formation and Repair of Tobacco Carcinogen-Derived Bulky DNA Adducts

    DOE PAGESBeta

    Hang, Bo

    2010-01-01

    DNA adducts play a central role in chemical carcinogenesis. The analysis of formation and repair of smoking-related DNA adducts remains particularly challenging as both smokers and nonsmokers exposed to smoke are repetitively under attack from complex mixtures of carcinogens such as polycyclic aromatic hydrocarbons and N -nitrosamines. The bulky DNA adducts, which usually have complex structure, are particularly important because of their biological relevance. Several known cellular DNA repair pathways have been known to operate in human cells on specific types of bulky DNA adducts, for example, nucleotide excision repair, base excision repair, and direct reversal involving O 6more » -alkylguanine DNA alkyltransferase or AlkB homologs. Understanding the mechanisms of adduct formation and repair processes is critical for the assessment of cancer risk resulting from exposure to cigarette smoke, and ultimately for developing strategies of cancer prevention. This paper highlights the recent progress made in the areas concerning formation and repair of bulky DNA adducts in the context of tobacco carcinogen-associated genotoxic and carcinogenic effects.« less

  2. Detection of mitomycin C-DNA adducts in vivo by 32P-postlabeling: time course for formation and removal of adducts and biochemical modulation.

    PubMed

    Warren, A J; Maccubbin, A E; Hamilton, J W

    1998-02-01

    Mitomycin C (MMC) is a DNA cross-linking agent that has been used in cancer chemotherapy for over 20 years, yet little is known either qualitatively or quantitatively about MMC-induced DNA adduct formation and repair in vivo. As an initial means of investigating this, we used a recently developed 32P-postlabeling assay to examine the formation and loss of MMC-DNA adducts in the tissues of a simple in vivo model test system, the chick embryo, following treatment with a chemotherapeutic dose of MMC. As early as 15 min after MMC treatment, four adducts could be detected in the liver which were tentatively identified as the (CpG) N2G-MMC-N2G interstrand cross-link, the bifunctionally activated MMC-N2G monoadduct, and two isomers (alpha and beta) of the monofunctionally activated MMC-N2G monoadduct. The (GpG) N2G-MMC-N2G intrastrand cross-link appears to be a poor substrate for nuclease P1 and/or T4 kinase and was not evaluable by this assay. Levels of all four detectable adducts increased substantially within the first 2 h after MMC treatment, reached maximal levels by 6 h, and decreased progressively thereafter through 24 h, although low levels of certain adducts persisted beyond 24 h. Lung and kidney had comparable levels of total MMC adducts, which were approximately 60% those of the liver, and there were no significant differences in the proportion of specific adducts among the three tissues. The interstrand cross-link represented approximately 13-14% of the total MMC adducts, which is approximately 5-fold greater than the proportion of CpG sites in the genome. In addition, the interstrand cross-link was selectively decreased after 16 h relative to the three monoadducts, suggesting preferential repair. The effect of modulating different components of the Phase I and Phase II drug metabolism on MMC adduct formation, using either glutethimide, 3,4,3',4'-tetrachlorobiphenyl, dexamethasone, buthionine sulfoximine, ethacrynic acid, or N-acetylcysteine pretreatments, was

  3. Kinetics, mechanism and thermodynamics of bisulfite-aldehyde adduct formation

    SciTech Connect

    Olson, T.M.; Boyce, S.D.; Hoffmann, M.R.

    1986-04-01

    The kinetics and mechanism of bisulfite addition to benzaldehyde were studied at low pH in order to assess the importance of this reaction in stabilizing S(IV) in fog-, cloud-, and rainwater. Previously, the authors established that appreciable concentrations of the formaldehyde-bisulfite adduct (HMSA) are often present in fogwater. Measured HMSA concentrations in fogwater often do not fully account for observed excess S(IV) concentrations, however, so that other S(IV)-aldehyde adducts may be present. Reaction rates were determined by monitoring the disappearance of benzaldehyde by U.V. spectrophotometry under pseudo-first order conditions, (S(IV))/sub T/ >>(phi-CHO)/sub T/, in the pH range 0 - 4.4 at 25/sup 0/C. The equilibrium constant was determined by dissolving the sodium salt of the addition compound in a solution adjusted to pH 3.9, and measuring the absorbance of the equilibrated solution at 250 nm. A literature value of the extinction coefficient for benzaldehyde was used to calculate the concentration of free benzaldehyde. All solutions were prepared under an N/sub 2/ atmosphere using deoxygenated, deionized water and ionic strength was maintained at 1.0 M with sodium chloride.

  4. Neutrophils amplify the formation of DNA adducts by benzo[a]pyrene in lung target cells.

    PubMed

    Borm, P J; Knaapen, A M; Schins, R P; Godschalk, R W; Schooten, F J

    1997-09-01

    Inflammatory cells and their reactive oxygen metabolites can cause mutagenic effects in lung cells. The purpose of this study was to investigate the ability of activated neutrophils to modulate DNA binding of benzo[a]pyrene (B[a]P), a known carcinogen, in lung target cells. Equivalent numbers of rat lung epithelial cells (RLE-6TN cell line) and freshly isolated human blood neutrophils (PMN) were coincubated in vitro for 2 hr after addition of benzo[a]pyrene (0.5 microM) or two of its trans-diol metabolites, with or without stimulation with phorbol myristate acetate (PMA). DNA adducts of B[a]P-metabolites were determined in target cells using 32P-postlabeling; oxidative DNA damage (7-hydro-8-oxo-2'-deoxyguanosine [8-oxodG]) was evaluated by high performance liquid chromatography with electrochemical detection. Increased DNA adducts were observed in lung cells coincubated with polymorphonuclear leukocytes (PMN). Activation of PMN with PMA, or addition of more activated PMN in relation to the number of lung cells, further increased the number of adducts, the latter in a dose-response manner. Incubation with B[a]P-4,5-diol did not result in any adduct formation, while B[a]P-7,8-diol led to a significant number of adducts. Moreover, PMA-activated PMN strongly enhanced adduct formation by B[a]P-7,8-diol, but not 8-oxodG, in lung cells. The addition of antioxidants to the coincubations significantly reduced the number of adducts. Results suggest that an inflammatory response in the lung may increase the biologically effective dose of polycyclic aromatic hydrocarbons (PAHs), and may be relevant to data interpretation and risk assessment of PAH-containing particulates. PMID:9400705

  5. Formation of DNA Adducts by Ellipticine and Its Micellar Form in Rats — A Comparative Study

    PubMed Central

    Stiborova, Marie; Manhartova, Zuzana; Hodek, Petr; Adam, Vojtech; Kizek, Rene; Frei, Eva

    2014-01-01

    The requirements for early diagnostics as well as effective treatment of cancer diseases have increased the pressure on development of efficient methods for targeted drug delivery as well as imaging of the treatment success. One of the most recent approaches covering the drug delivery aspects is benefitting from the unique properties of nanomaterials. Ellipticine and its derivatives are efficient anticancer compounds that function through multiple mechanisms. Formation of covalent DNA adducts after ellipticine enzymatic activation is one of the most important mechanisms of its pharmacological action. In this study, we investigated whether ellipticine might be released from its micellar (encapsulated) form to generate covalent adducts analogous to those formed by free ellipticine. The 32P-postlabeling technique was used as a useful imaging method to detect and quantify covalent ellipticine-derived DNA adducts. We compared the efficiencies of free ellipticine and its micellar form (the poly(ethylene oxide)-block-poly(allyl glycidyl ether) (PAGE-PEO) block copolymer, P 119 nanoparticles) to form ellipticine-DNA adducts in rats in vivo. Here, we demonstrate for the first time that treatment of rats with ellipticine in micelles resulted in formation of ellipticine-derived DNA adducts in vivo and suggest that a gradual release of ellipticine from its micellar form might produce the enhanced permeation and retention effect of this ellipticine-micellar delivery system. PMID:25479328

  6. A new model for multiply charged adduct formation between peptides and anions in electrospray mass spectrometry.

    PubMed

    Liu, Xiaohua; Cole, Richard B

    2011-12-01

    A new model has been developed to account for adduct formation on multiply charged peptides observed in negative ion electrospray mass spectrometry. To obtain a stable adduct, the model necessitates an approximate matching of apparent gas-phase basicity (GB(app)) of a given proton bearing site on the peptide with the gas-phase basicity (GB) of the anion attaching at that site. Evidence supporting the model is derived from the fact that for [Glu] Fibrinopeptide B, higher GB anions dominated in adducts observed at higher negative charge states, whereas lower GB anions appeared predominately in lower charge state adducts. Singly charged adducts were only observed for lower GB anions: HSO(4)(-), I(-), CF(3)COO(-). Ions that have medium GBs (NO(3) (-), Br(-), H(2)PO(4)(-)) only form adducts having -2 charge states, whereas Cl(-) (higher GB) can form adducts having -3 charge states. The model portends that (1) carboxylate groups are much more basic than available amino groups; (2) apparent GBs of the various carboxylate groups on peptides do not vary substantially from one another; and (3) apparent GBs of the individual carboxylate and amino sites do not behave independently. This model was developed for negative ion attachment but an analogous mechanism is also proposed for the positive ion mode wherein (1) binding of a neutral at an amino site polarizes this amino group, but hardly affects apparent GBs of other sites; (2) proton addition (charge state augmentation) at one site can decrease the instrinsic GBs of other potential protonation sites and lower their apparent GBs. PMID:21997579

  7. A New Model for Multiply Charged Adduct Formation Between Peptides and Anions in Electrospray Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Liu, Xiaohua; Cole, Richard B.

    2011-12-01

    A new model has been developed to account for adduct formation on multiply charged peptides observed in negative ion electrospray mass spectrometry. To obtain a stable adduct, the model necessitates an approximate matching of apparent gas-phase basicity (GBapp) of a given proton bearing site on the peptide with the gas-phase basicity (GB) of the anion attaching at that site. Evidence supporting the model is derived from the fact that for [Glu] Fibrinopeptide B, higher GB anions dominated in adducts observed at higher negative charge states, whereas lower GB anions appeared predominately in lower charge state adducts. Singly charged adducts were only observed for lower GB anions: HSO{4/-}, I-, CF3COO-. Ions that have medium GBs (NO{3/-}, Br-, H2PO{4/-}) only form adducts having -2 charge states, whereas Cl- (higher GB) can form adducts having -3 charge states. The model portends that (1) carboxylate groups are much more basic than available amino groups; (2) apparent GBs of the various carboxylate groups on peptides do not vary substantially from one another; and (3) apparent GBs of the individual carboxylate and amino sites do not behave independently. This model was developed for negative ion attachment but an analogous mechanism is also proposed for the positive ion mode wherein (1) binding of a neutral at an amino site polarizes this amino group, but hardly affects apparent GBs of other sites; (2) proton addition (charge state augmentation) at one site can decrease the instrinsic GBs of other potential protonation sites and lower their apparent GBs.

  8. FORMATION OF CIGARETTE SMOKE-INDUCED DNA ADDUCTS IN THE RAT LUNG AND NASAL MUCOSA

    EPA Science Inventory

    The formation of DNA adducts in the nasal, lung, and liver tissues of rats exposed daily to fresh smoke from a University of Kentucky refernece cigarette (2R1) for up to 40 weeks was examined. he amount of smoke total particulate matter (TPM) inhaled and the blood carboxyhemoglob...

  9. IN VITRO METABOLISM AND DNA ADDUCT FORMATION FROM THE MUTAGENIC ENVIRONMENTAL CONTAMINANT 2-NITROFLURORANTHENE

    EPA Science Inventory

    The metabolism and DNA adduct formation by the mutagenic environmental contaminant 2-nitrofluoranthene (2-NFA) was studied. ncubation under aerobic conditions with liver microsomes of rats pretreated with 3-methylcholanthrene yielded 2-NFA tran-7.8-dihydrodiol, 2-NFA tran-9,10-di...

  10. Nitroreduction and formation of hemoglobin adducts in rats with a human intestinal microflora

    SciTech Connect

    Scheepers, P.T.J.; Straetemans, M.M.E.; Koopman, J.P.; Bos, R.P.

    1994-10-01

    In the covalent binding of nitroarenes to macromolecules, nitroreduction is an important step. The intestinal microflora represents an enormous potential of bacterial nitroreductase activity. As a consequence, the in vivo nitroreduction of orally administerednitroarenes is primarily located in the intestine. In this study, we have investigated the nitroreduction of 2-nitrofluorene (2-NF) by a human microflora in female Wistar rats. Germ-free (FG) rats were equipped with a bacterial flora derived from human feces. Nontreated GF rats and GF animals equipped with a conventional rat flora were used as controls. The composition of the human and the conventional microflora isolated from the rats were consistent with the microflora of the administered feces. In the rats receiving only sunflower seed oil, no adducts were detected. The animals equipped with a human or rat microflora that received 2-aminofluorene (2-AF) formed 2-AF hemoglobin (Hb)-adducts at average levels mean {+-} 0.003 and 0.043 {+-} 0.010 {mu}mole/g Hb, respectively. In the FG rats, an adduct level of 0.57 {+-} 0.09 was determined after 2-AF administration and non adducts were detected after 2-NF administration. The results show that nitroreduction by an acquired human intestinal microflora and subsequent adduct formation can be studied in the rate in vivo. 21 refs., 3 tabs.

  11. Isomerism and adduct formation in the hector's base series: A MNDO study of model compounds

    NASA Astrophysics Data System (ADS)

    Cuthbertson, Alastair F.; Glidewell, Christopher

    MNDO calculations on a series of a model compounds show that the observed structures for Hector's base, Dost's base and Dost's keto compound are the thermodynamically most stable tautomers and that the bond-switched structure observed for the 1:1 adduct of Hector's base with carbon disulphide and the non-bond-switched structure observed for the corresponding adducts with isocyanates and isothiocyanates are both the thermodynamically most favoured isomers, so that the occurrence or otherwise of a bond switch in these compounds is determined by thermodynamic rather than by mechanistic factors. Proposed mechanisms for the formation of the carbon disulphide adduct of Hector's base, and for its desulphurisation are supported by MNDO calculations.

  12. Covalent adduct formation between the plasmalogen-derived modification product 2-chlorohexadecanal and phloretin

    PubMed Central

    Üllen, Andreas; Nusshold, Christoph; Glasnov, Toma; Saf, Robert; Cantillo, David; Eibinger, Gerald; Reicher, Helga; Fauler, Günter; Bernhart, Eva; Hallstrom, Seth; Kogelnik, Nora; Zangger, Klaus; Oliver Kappe, C.; Malle, Ernst; Sattler, Wolfgang

    2015-01-01

    Hypochlorous acid added as reagent or generated by the myeloperoxidase (MPO)-H2O2-Cl− system oxidatively modifies brain ether-phospholipids (plasmalogens). This reaction generates a sn2-acyl-lysophospholipid and chlorinated fatty aldehydes. 2-Chlorohexadecanal (2-ClHDA), a prototypic member of chlorinated long-chain fatty aldehydes, has potent neurotoxic potential by inflicting blood–brain barrier (BBB) damage. During earlier studies we could show that the dihydrochalcone-type polyphenol phloretin attenuated 2-ClHDA-induced BBB dysfunction. To clarify the underlying mechanism(s) we now investigated the possibility of covalent adduct formation between 2-ClHDA and phloretin. Coincubation of 2-ClHDA and phloretin in phosphatidylcholine liposomes revealed a half-life of 2-ClHDA of approx. 120 min, decaying at a rate of 5.9 × 10−3 min−1. NMR studies and enthalpy calculations suggested that 2-ClHDA-phloretin adduct formation occurs via electrophilic aromatic substitution followed by hemiacetal formation on the A-ring of phloretin. Adduct characterization by high-resolution mass spectroscopy confirmed these results. In contrast to 2-ClHDA, the covalent 2-ClHDA-phloretin adduct was without adverse effects on MTT reduction (an indicator for metabolic activity), cellular adenine nucleotide content, and barrier function of brain microvascular endothelial cells (BMVEC). Of note, 2-ClHDA-phloretin adduct formation was also observed in BMVEC cultures. Intraperitoneal application and subsequent GC–MS analysis of brain lipid extracts revealed that phloretin is able to penetrate the BBB of C57BL/6J mice. Data of the present study indicate that phloretin scavenges 2-ClHDA, thereby attenuating 2-ClHDA-mediated brain endothelial cell dysfunction. We here identify a detoxification pathway for a prototypic chlorinated fatty aldehyde (generated via the MPO axis) that compromises BBB function in vitro and in vivo. PMID:25576489

  13. Formation of metal-ion adducts and evidence for surface-catalyzed ionization in electrospray analysis of pharmaceuticals and pesticides

    USGS Publications Warehouse

    Thurman, E.M.; Ferrer, I.

    2002-01-01

    The formation of metal ion adducts in liquid chromatography/mass spectrometry positive-ion electrospray analysis of pharmaceuticals and pesticides was investigated. The evidence of surface-catalyzed ionization in the electrospray analysis was also studied. Both positive and negative ion mass spectrometry were used for the analysis of the products. It was found that the sodium adducts formed in the analysis included single, double, and triple sodium adducts. Adduction was found to occur by attachment of the metal ion to carboxyl, carbonyl and aromatic pi electrons of the molecule.

  14. Formation of 1,4-dioxo-2-butene-derived adducts of 2'-deoxyadenosine and 2'-deoxycytidine in oxidized DNA.

    PubMed

    Chen, Bingzi; Vu, Choua C; Byrns, Michael C; Dedon, Peter C; Peterson, Lisa A

    2006-08-01

    Oxidation of deoxyribose in DNA produces a variety of electrophilic residues that are capable of reacting with nucleobases to form adducts such as M(1)dG, the pyrimidopurinone adduct of dG. We now report that deoxyribose oxidation in DNA leads to the formation of oxadiazabicyclo(3.3.0)octaimine adducts of dC and dA. We previously demonstrated that these adducts arise in reactions of nucleosides and DNA with trans-1,4-dioxo-2-butene, the beta-elimination product of the 2-phosphoryl-1,4-dioxobutane residue arising from 5'-oxidation of deoxyribose in DNA, and with cis-1,4-dioxo-2-butene, a metabolite of furan. Treatment of DNA with enediyne antibiotics capable of oxidizing the 5'-position of deoxyribose (calicheamicin and neocarzinostatin) led to a concentration-dependent formation of oxadiazabicyclo(3.3.0)octaimine adducts of dC and dA, while the antibiotic bleomycin, which is capable of performing only 4-oxidation of deoxyribose, did not give rise to the adducts. The nonspecific DNA oxidant, gamma-radiation, also produced the adducts that represented approximately 0.1% of the 2-phosphoryl-1,4-dioxobutane residues formed during the irradiation. These results suggest that the oxadiazabicyclo(3.3.0)octaimine adducts of dC and dA could represent endogenous DNA lesions arising from oxidative stresses that also give rise to other DNA adducts. PMID:16918236

  15. Formation of melamium adducts by pyrolysis of thiourea or melamine/NH4 Cl mixtures.

    PubMed

    Braml, Nicole E; Sattler, Andreas; Schnick, Wolfgang

    2012-02-01

    Pyrolysis of prominent precursor compounds for the synthesis of carbon nitride type materials (e.g., melamine, thiourea) have been studied in detail. Molecular adducts containing monoprotonated melamium C(6)N(11)H(10)(+) and melaminium HC(3)N(3)(NH(2))(3)(+) ions, respectively, have been identified as intermediates. The adduct C(6)N(11)H(10)Cl·0.5NH(4)Cl was obtained by the reaction of melamine C(3)N(3)(NH(2))(3) with NH(4)Cl at 450 °C. During the pyrolysis of thiourea, guanidinium thiocyanate was initially formed and subsequently the melamium thiocyanate melamine adduct C(6)N(11)H(10)SCN·2C(3)N(3)(NH(2))(3) was isolated at 300 °C. A second melaminium thiocyanate melamine adduct with the formula HC(3)N(3)(NH(2))(3)SCN·2C(3)N(3)(NH(2))(3) represents an intermediary reaction product that is best accessible at low pressures. The crystal structures of the compounds were solved by single-crystal XRD. Unequivocal proton localization at the C(6)N(11)H(10)(+) ion was established. A typical intramolecular and interannular hydrogen bridge and other characteristic hydrogen-bonding motifs were identified. Additionally, the adducts were investigated by solid-state NMR spectroscopy. Our study provides detailed insight into the thermal condensation of thiourea by identifying and characterizing key intermediates involved in the condensation process leading to carbon nitride type materials. Furthermore, factors promoting the formation of melamium adduct phases over melem are discussed. PMID:22223531

  16. Monitoring the apple polyphenol oxidase-modulated adduct formation of phenolic and amino compounds.

    PubMed

    Reinkensmeier, Annika; Steinbrenner, Katrin; Homann, Thomas; Bußler, Sara; Rohn, Sascha; Rawel, Hashadrai M

    2016-03-01

    Minimally processed fruit products such as smoothies are increasingly coming into demand. However, they are often combined with dairy ingredients. In this combination, phenolic compounds, polyphenoloxidases, and amino compounds could interact. In this work, a model approach is presented where apple serves as a source for a high polyphenoloxidase activity for modulating the reactions. The polyphenoloxidase activity ranged from 128 to 333nakt/mL in different apple varieties. From these, 'Braeburn' was found to provide the highest enzymatic activity. The formation and stability of resulting chromogenic conjugates was investigated. The results show that such adducts are not stable and possible degradation mechanisms leading to follow-up products formed are proposed. Finally, apple extracts were used to modify proteins and their functional properties characterized. There were retaining antioxidant properties inherent to phenolic compounds after adduct formation. Consequently, such interactions may also be utilized to improve the textural quality of food products. PMID:26471529

  17. Formation of DNA adducts in rat lung following chronic inhalation of diesel emissions, carbon black and titanium dioxide particles.

    PubMed

    Gallagher, J; Heinrich, U; George, M; Hendee, L; Phillips, D H; Lewtas, J

    1994-07-01

    Exposure of rats to diesel emissions results in the development of lung tumors. The objective of this study was to determine whether the polycyclic aromatic hydrocarbons (PAHs), nitro-PAHs or other polycyclic organic matter adsorbed to diesel particles induces the formation of DNA adducts in the lung when compared to particles with little or no adsorbed organic matter. Rats were exposed to diesel emissions containing particles with over 30% solvent-extractable adsorbed organic matter and to particles with < 0.1% adsorbed organic matter (carbon black particles and TiO2). Wistar rats were exposed to diesel emissions (7.5 mg/m3) for 2 months, 6 months and 2 years and for 2 years to carbon black (11.3 mg/m3) and TiO2 particles (10.4 mg/m3) to compare tumorigenic response and DNA adduct formation in the lung. Two versions of the 32P-postlabeling assay for the detection of DNA adducts were used to tentatively identify nitrated-amine or arylamine adducts formed relative to other nitro PAH based on the demonstrated sensitivity of these adducts to nuclease P1 treatment. Total adduct levels were determined for peripheral lung tissue DNA as detected in a diagonal radioactive zone. One major adduct which migrated outside this region (adduct 1) and a nuclease P1-sensitive adduct (adduct 2) were quantitated separately. Adduct 1 increased significantly over time in the filtered air exposed animals but decreased markedly at the 2 year time points regardless of particle type, presumably as a result of adduct dilution through de novo cell synthesis or cell proliferation invoked in response to particle loading and/or effect on the endogenous synthesis or degradation of DNA reactive moieties. The nuclease sensitive adduct (adduct 2), possibly resulting from exposure to nitro-PAHs, was detected in diesel-exposed rats but was not detected in the rats exposed to TiO2 and carbon black. No significant elevation in PAH-derived adducts, relative to the filtered air controls, was observed in

  18. Role of CYP1B1 in PAH-DNA adduct formation and breast cancer risk

    SciTech Connect

    Goth-Goldstein, Regine; Russell, Marion L.; Muller, A.P.; Caleffi, M.; Eschiletti, J.; Graudenz, M.; Sohn, Michael D.

    2010-04-01

    This study investigated the hypothesis that increased exposure to polycyclic aromatic hydrocarbons (PAHs) increases breast cancer risk. PAHs are products of incomplete burning of organic matter and are present in cigarette smoke, ambient air, drinking water, and diet. PAHs require metabolic transformation to bind to DNA, causing DNA adducts, which can lead to mutations and are thought to be an important pre-cancer marker. In breast tissue, PAHs appear to be metabolized to their cancer-causing form primarily by the cytochrome P450 enzyme CYP1B1. Because the genotoxic impact of PAH depends on their metabolism, we hypothesized that high CYP1B1 enzyme levels result in increased formation of PAH-DNA adducts in breast tissue, leading to increased development of breast cancer. We have investigated molecular mechanisms of the relationship between PAH exposure, CYP1B1 expression and breast cancer risk in a clinic-based case-control study. We collected histologically normal breast tissue from 56 women (43 cases and 13 controls) undergoing breast surgery and analyzed these specimens for CYP1B1 genotype, PAH-DNA adducts and CYP1B1 gene expression. We did not detect any difference in aromatic DNA adduct levels of cases and controls, only between smokers and non-smokers. CYP1B1 transcript levels were slightly lower in controls than cases, but the difference was not statistically significant. We found no correlation between the levels of CYP1B1 expression and DNA adducts. If CYP1B1 has any role in breast cancer etiology it might be through its metabolism of estrogen rather than its metabolism of PAHs. However, due to the lack of statistical power these results should be interpreted with caution.

  19. Stereochemical Configuration of 4-Hydroxy-2-nonenal-Cysteine Adducts and Their Stereoselective Formation in a Redox-regulated Protein*

    PubMed Central

    Wakita, Chika; Maeshima, Takuya; Yamazaki, Atsushi; Shibata, Takahiro; Ito, Sohei; Akagawa, Mitsugu; Ojika, Makoto; Yodoi, Junji; Uchida, Koji

    2009-01-01

    4-Hydroxy-2-nonenal (HNE), a major racemic product of lipid peroxidation, preferentially reacts with cysteine residues to form a stable HNE-cysteine Michael addition adduct possessing three chiral centers. Here, to gain more insight into sulfhydryl modification by HNE, we characterized the stereochemical configuration of the HNE-cysteine adducts and investigated their stereoselective formation in redox-regulated proteins. To characterize the HNE-cysteine adducts by NMR, the authentic (R)-HNE- and (S)-HNE-cysteine adducts were prepared by incubating N-acetylcysteine with each HNE enantiomer, both of which provided two peaks in reversed-phase high performance liquid chromatography (HPLC). The NMR analysis revealed that each peak was a mixture of anomeric isomers. In addition, mutarotation at the anomeric center was also observed in the analysis of the nuclear Overhauser effect. To analyze these adducts in proteins, we adapted a pyridylamination-based approach, using 2-aminopyridine in the presence of sodium cyanoborohydride, which enabled analyzing the individual (R)-HNE- and (S)-HNE-cysteine adducts by reversed-phase HPLC following acid hydrolysis. Using the pyridylamination method along with mass spectrometry, we characterized the stereoselective formation of the HNE-cysteine adducts in human thioredoxin and found that HNE preferentially modifies Cys73 and, to the lesser extent, the active site Cys32. More interestingly, the (R)-HNE- and (S)-HNE-cysteine adducts were almost equally formed at Cys73, whereas Cys32 exhibited a remarkable preference for the adduct formation with (R)-HNE. Finally, the utility of the method for the determination of the HNE-cysteine adducts was confirmed by an in vitro study using HeLa cells. The present results not only offer structural insight into sulfhydryl modification by lipid peroxidation products but also provide a platform for the chemical analysis of protein S-associated aldehydes in vitro and in vivo. PMID:19692331

  20. Determinants of formation of aflatoxin-albumin adducts: a seven-township study in Taiwan

    PubMed Central

    Sun, C-A; Wu, D-M; Wang, L-Y; Chen, C-J; You, S-L; Santella, R M

    2002-01-01

    Dietary exposure to aflatoxins is one of the major risk factors for hepatocellular carcinoma. Individual susceptibility to aflatoxin-induced hepatocarcinogenesis may be modulated by both genetic and environmental factors affecting metabolism. A cross-sectional study was performed to evaluate determinants of the formation of aflatoxin covalently bound to albumin (AFB1-albumin adducts). A total of 474 subjects who were free of liver cancer and cirrhosis and were initially selected as controls for previous case–control studies of aflatoxin-induced hepatocarcinogenesis in Taiwan, were employed in this study. Aflatoxin-albumin adducts were determined by competitive enzyme-linked immunosorbent assay, hepatitis B surface antigen and antibodies to hepatitis C virus by enzyme immunoassay, as well as genotypes of glutathione S-transferase M1-1 and T1-1 by polymerase chain reaction. The detection rate of AFB1-albumin adducts was significantly higher in males (42.5%) than in females (21.6%) (multivariate-adjusted odds ratio=2.6, 95% confidence interval=1.4–5.0). The formation of detectable albumin adducts was moderately higher in hepatitis B surface antigen carriers (42.8%) than in non-carriers (36.6%) (multivariate-adjusted odds ratio=1.4, 95% confidence interval=1.0–2.1). In addition, the detection rate of AFB1-albumin adducts tended to increase with the increasing number of null genotypes of glutathione S-transferase M1-1 and glutathione S-transferase T1-1. In conclusion, this cross-sectional study has assessed the relative contributions of environmental exposure and host susceptibility factors in the formation of AFB1-albumin adducts in a well characterised Chinese adult population. This study further emphasises the necessity to reduce aflatoxin exposure in people living in an area endemic for chronic hepatitis B virus infection. British Journal of Cancer (2002) 87, 966–970. doi:10.1038/sj.bjc.6600584 www.bjcancer.com © 2002 Cancer Research UK PMID:12434285

  1. The use of in vitro DNA adduct formation to estimate the genotoxicity of residues at contaminated sites.

    PubMed

    Shaw, G; Connell, D; Barron, W

    1995-05-01

    Genotoxic carcinogens such as polycyclic aromatic hydrocarbons (PAHs) covalently bind to the bases in DNA to form adducts. The formation of DNA adducts is significant with respect to chemical carcinogenesis. Many contaminated sites contain quantities of carcinogens such as PAHs, and the evaluation of the genotoxicity of these soils has important implications for human risk assessment. DNA adducts can be formed using an in vitro system incorporating extracts from contaminated soils. The 32P-postlabelling assay is a sensitive technique for the detection of DNA adducts from complex mixtures of environmental carcinogens. These techniques have been used to form and detect DNA adducts using soils from a number of coal gasworks sites. The results show that the extent of adduct formation depends partially on the petroleum hydrocarbon content of samples, but also on other undetermined factors related to composition. While environmental weathering has been shown to effect the PAH composition of samples, this is not an important factor in controlling the genotoxicity of samples as estimated by DNA adduct formation. PMID:7780722

  2. Novel methods for synthesizing halide-free alane without the formation of adducts

    NASA Astrophysics Data System (ADS)

    Dinh, Long V.; Knight, Douglas A.; Paskevicius, Mark; Buckley, Craig E.; Zidan, Ragaiy

    2012-04-01

    Many of the current synthesis methods for aluminum hydride (alane—AlH3) involve reacting AlCl3 and LiAlH4 in solvents. The reaction requires the formation of an alane adduct such as AlH3ṡ[(C2H5)2O] prior to obtaining crystallized stable α-AlH3. This process requires several hours of pumping in a vacuum system to remove the ether and convert the alane etherate into stable α-alane. This crystallization process is both costly and hazardous because a large amount of highly flammable material (e.g. ether) is removed by vacuum pumps over several hours. Conversely, the work presented herein describes novel methods to synthesize adduct-free alane. It is demonstrated here that AlH3 can form by mixing AlCl3 and LiAlH4 in the solid state and heating to 75∘C; only α-AlH3 was obtained. The α-AlH3 product can be washed with minimal solvents leading to zero formation of alane adducts. In addition, the unwanted LiCl by-product is also removed during the solvent wash, resulting in halide-free α-alane. Although simply mixing and heating the reactants led to a 40% yield of alane, having the reactants compacted and mechanically pressed while heating increases the yield to 60% crystalline α-AlH3.

  3. Adduct formation of 7,12-dimethylbenz(a)anthracene in the embryo of the Japanese medaka (Oryzias latipes)

    SciTech Connect

    Liu, H.; Cooper, K.R.

    1995-12-31

    DNA adduct formation of 7,1 2-dimethylbenz(a)anthracene (DMBA) in vivo in the Japanese medaka embryo were investigated using {sup 32}P-postlabeling analysis. 1-compounds (endogenous adducts) were not observed in the Japanese medaka embryo on days 4 (prior to liver formation), 6 (liver/swim bladder) or 10 (prior to hatch) of development. The level of DMBA:DNA adducts were concentration-dependent over the range of 0.625 ppm (Total Adducts 0.05707 pmol/mg of DNA) to 2.50 ppm (0.43341 pmol/mg of DNA) and decreased at 5.00 ppm (0.25338 pmol/mg of DNA) after medaka embryos were exposed to DMBA for 6 days from the day of fertilization. The decrease in DMBA:DNA adducts at 5.00 ppm was probably due to embryo toxicity (78% death). The level of DMBA:DNA adducts formed from the embryos exposed to DMBA for 24 hr decreased as the stage of development increased: day 4 > day 6 > day 10; 0.0262, 0.0179, 0.0129 pmol/mg of DNA, respectively. The level of DMBA:DNA adducts increased as the length of exposure increased: 4 day < 6 day < 10 day; 0.0233, 0.0614, 0.1502, respectively. There was both a time and dose dependence to the number of adducts detected. The data presented demonstrated the development of DM BA-DNA adducts in the developing Japanese medaka (Oryzias latipes) and the lack of I-compounds.

  4. The formation of lipid hydroperoxide-derived amide-type lysine adducts on proteins: a review of current knowledge.

    PubMed

    Kato, Yoji

    2014-01-01

    Lipid peroxidation is an important biological reaction. In particular, polyunsaturated fatty acid (PUFA) can be oxidized easily. Peroxidized lipids often react with other amines accompanied by the formation of various covalent adducts. Novel amide-type lipid-lysine adducts have been identified from an in vitro reaction mixture of lipid hydroperoxide with a protein, biological tissues exposed to conditions of oxidative stress and human urine from a healthy person. In this chapter, the current knowledge of amide type adducts is reviewed with a focus on the evaluation of functional foods and diseases with a history of discovery of hexanoyl-lysine (HEL). Although there is extensive research on HEL and other amide-type adducts, the mechanism of generation of the amide bond remains unclear. We have found that the decomposed aldehyde plus peroxide combined with a lysine moiety does not fully explain the formation of the amide-type lipid-lysine adduct that is generated by lipid hydroperoxide. Singlet oxygen or an excited state of the ketone generated from the lipid hydroperoxide may also contribute to the formation of the amide linkage. The amide-adducts may prove useful not only for the detection of oxidative stress induced by disease but also for the estimation of damage caused by an excess intake of PUFA. PMID:24374915

  5. Contribution of artifacts to N-methylated piperazine cyanide adduct formation in vitro from N-alkyl piperazine analogs.

    PubMed

    Zhang, Minli; Resuello, Christina M; Guo, Jian; Powell, Mark E; Elmore, Charles S; Hu, Jun; Vishwanathan, Karthick

    2013-05-01

    In the liver microsome cyanide (CN)-trapping assays, piperazine-containing compounds formed significant N-methyl piperazine CN adducts. Two pathways for the N-methyl piperazine CN adduct formation were proposed: 1) The α-carbon in the N-methyl piperazine is oxidized to form a reactive iminium ion that can react with cyanide ion; 2) N-dealkylation occurs followed by condensation with formaldehyde and dehydration to produce N-methylenepiperazine iminium ion, which then reacts with cyanide ion to form the N-methyl CN adduct. The CN adduct from the second pathway was believed to be an artifact or metabonate. In the present study, a group of 4'-N-alkyl piperazines and 4'-N-[¹³C]methyl-labeled piperazines were used to determine which pathway was predominant. Following microsomal incubations in the presence of cyanide ions, a significant percentage of 4'-N-[¹³C]methyl group in the CN adduct was replaced by an unlabeled natural methyl group, suggesting that the second pathway was predominant. For 4'-N-alkyl piperazine, the level of 4'-N-methyl piperazine CN adduct formation was limited by the extent of prior 4'-N-dealkylation. In a separate study, when 4'-NH-piperaziens were incubated with potassium cyanide and [¹³C]-labeled formaldehyde, 4'-N-[¹³C]methyl piperazine CN-adduct was formed without NADPH or liver microsome suggesting a direct Mannich reaction is involved. However, when [¹³C]-labeled methanol or potassium carbonate was used as the one-carbon donor, 4'-N-[¹³C]methyl piperazine CN adduct was not detected without liver microsome or NADPH present. The biologic and toxicological implications of bioactivation via the second pathway necessitate further investigation because these one-carbon donors for the formation of reactive iminium ions could be endogenous and readily available in vivo. PMID:23431111

  6. Aminofluorene-DNA adduct formation in Salmonella typhimurium exposed to the carcinogen N-hydroxy-2-acetylaminofluorene.

    PubMed Central

    Beranek, D T; White, G L; Heflich, R H; Beland, F A

    1982-01-01

    The DNA adducts formed during incubation of the hepatocarcinogen N-hydroxy-2-acetylaminofluorene with Salmonella typhimurium tester strain TA1538 were investigated to determine if the covalently bound products were identical to those adducts found in rat liver DNA and to establish the biological significance of the adducts in a mutational assay. When bacteria were exposed to N-hydroxy-2-acetylaminofluorene in the presence of a 9,000 x g supernatant from a rat liver homogenate (S9), only one adduct was detected. This adduct had chromatographic, pH-dependent partitioning, and UV spectral characteristics identical to those of N-(deoxyguanosin-8-yl)-2-aminofluorene. In the absence of S9 activation the same product was detected, but at a 85-90% lower level, which indicates that S. typhimurium also may be capable of metabolizing N-hydroxy-2-acetylaminofluorene to a reactive electrophile. When incubations were conducted with N-hydroxy-2-aminofluorene in the absence of the activation system, N-(deoxyguanosin-8-yl)-2-aminofluorene again was the major adduct. At equimolar concentrations, the arylhydroxylamine was approximately 10 times more efficient than the arylhydroxamic acid in inducing reversions in the bacteria. Comparison of the mutation rate to the level of binding in bacterial DNA gave a linear relationship with a slope of 0.96 and a correlation coefficient of 0.92. These data support previous suggestions that N-hydroxy-2-acetylaminofluorene is deacetylated by rat liver S9 to the ultimate mutagen, N-hydroxy-2-aminofluorene, and also indicate that S. typhimurium can mediate this reaction. The correlation between mutagenicity and the extent of N-(deoxyguanosin-8-yl)-2-aminofluorene adduct formation, coupled with the observation that this adduct is the major DNA adduct found in rat liver in vivo, suggests that N-(deoxyguanosin-8-yl)-2-aminofluorene may be a critical lesion for the initiation of hepatic tumorigenesis. PMID:6752940

  7. The formation of argpyrimidine, a methylglyoxal-arginine adduct, in the nucleus of neural cells

    SciTech Connect

    Nakadate, Yusuke; Uchida, Koji; Shikata, Keiji; Yoshimura, Saori; Azuma, Masayuki; Hirata, Tatsumi; Konishi, Hiroyuki; Kiyama, Hiroshi; Tachibana, Taro

    2009-01-09

    Methylglyoxal (MG) is an endogenous metabolite in glycolysis and forms stable adducts primarily with arginine residues of intracellular proteins. The biological role of this modification in cell function is not known. In the present study, we found that a MG-detoxification enzyme glyoxalase I (GLO1) is mainly expressed in the ventricular zone (VZ) at embryonic day 16 which neural stem and progenitor cells localize. Moreover, immunohistochemical analysis revealed that argpyrimidine, a major MG-arginine adduct, is predominantly produced in cortical plate neurons not VZ during cerebral cortex development and is exclusively located in the nucleus. Immunoblotting experiment showed that the formation of argpyrimidine occurs on some nuclear proteins of cortical neurons. To our knowledge, this is first report of the argpyrimidine formation in the nucleus of neuron. These findings suggest that GLO1, which is dominantly expressed in the embryonic VZ, reduces the intracellular level of MG and suppresses the formation of argpyrimidine in neural stem and progenitor cells. Argpyrimidine may contribute to the neural differentiation and/or the maintenance of the differentiated state via the modification of nuclear proteins.

  8. Proteinuria in passive Heymann nephritis is associated with lipid peroxidation and formation of adducts on type IV collagen.

    PubMed Central

    Neale, T J; Ojha, P P; Exner, M; Poczewski, H; Rüger, B; Witztum, J L; Davis, P; Kerjaschki, D

    1994-01-01

    Passive Heymann nephritis (PHN) is a model of human membranous nephropathy that is characterized by formation of granular subepithelial immune deposits in the glomerular capillary wall which results in complement activation. This is causally related to damage of the filtration barrier and subsequent proteinuria. The local accumulation of injurious reactive oxygen species (ROS) is a major effector mechanism in PHN. ROS may induce tissue damage by initiating lipid peroxidation (LPO). In turn, this leads to adduct formation between breakdown products of LPO with structural proteins, such as formation of malondialdehyde (MDA) or 4-hydroxynonenal-lysine adducts. To examine the role of LPO in the development of proteinuria we have localized MDA and 4-hydroxynonenal-lysine adducts in glomeruli of PHN rats by immunofluorescence microscopy, using specific monoclonal antibodies. By immunogold electron microscopy, MDA adducts were localized to cytoplasmic vesicles and cell membranes of glomerular epithelial cells, to the glomerular basement membrane (GBM), and also to immune deposits. Type IV collagen was specifically identified as being modified by MDA adducts, using a variety of techniques. Collagenase pretreatment of GBM extracts indicated that the NC-1 domain of type IV collagen was a site of adduct formation. When LPO was inhibited by pretreatment of PHN rats with the antioxidant probucol, proteinuria was reduced by approximately 85%, and glomerular immunostaining for dialdehyde adducts was markedly reduced, even though the formation of immune deposits was not affected. By contrast, lowering of the serum cholesterol levels had no influence on the development of proteinuria. These findings are consistent with the premise that ROS-induced glomerular injury in PHN involves LPO and that this results not only in damage of cell membranes but in modification of type IV collagen in the GBM as well. The close temporal correlation of the occurrence of LPO with proteinuria and the

  9. Effects of water and polymer content on covalent amide-linked adduct formation in peptide-containing amorphous lyophiles.

    PubMed

    DeHart, Michael P; Anderson, Bradley D

    2012-09-01

    Deamidation of asparagine-containing proteins and peptides results in the formation of hydrolysis products via a reactive succinimide intermediate. In amorphous lyophile formulations at low water content, nucleophilic amine groups in neighboring molecules can effectively compete with water for reaction with the succinimide intermediate resulting in the formation of a variety of covalent amide-linked adducts. This study examines the effects of changes in percentage of a polymeric excipient [hypromellose (HPMC)] and water content on the degradants formed from a model asparaginyl peptide (Gly-Phe-L-Asn-Gly) in amorphous solids also containing an excess of Gly-Val and carbonate buffer and stored at 40°C. Degradation of Gly-Phe-L-Asn-Gly and formation of succinimide intermediates, aspartyl peptides, and covalent amide-linked adducts were monitored by high-performance liquid chromatography. In all formulations and storage conditions, the formation kinetics of aspartyl hydrolysis products and covalent adducts could be described by a mechanism-based model that assigned a central role to the succinimide intermediate. Increasing the percentage of HPMC (i.e., reactant dilution) favored the formation of hydrolysis products over covalent amide-linked adducts, consistent with the bimolecular nature of covalent adduct formation. Increases in water content as relative humidity (RH) was varied from 33% to 75% produced orders-of-magnitude increases in the rate constants for succinimide formation and hydrolysis with both becoming nearly constant at high water contents. A bell-shaped profile for the dependence of the rate of covalent adduct formation on water content was observed, a result that may be indicative of phase separation at higher RHs. PMID:22437444

  10. Linking DNA adduct formation and human cancer risk in chemical carcinogenesis.

    PubMed

    Poirier, Miriam C

    2016-08-01

    Over two centuries ago, Sir Percival Pott, a London surgeon, published a pioneering treatise showing that soot exposure was the cause of high incidences of scrotal cancers occurring in young men who worked as chimney sweeps. Practicing at a time when cellular pathology was not yet recognized, Sir Percival nonetheless observed that the high incidence and short latency of the chimney sweep cancers, was fundamentally different from the rare scrotal cancers typically found in elderly men. Furthermore, his diagnosis that the etiology of these cancers was related to chimney soot exposure, was absolutely accurate, conceptually novel, and initiated the field of "occupational cancer epidemiology." After many intervening years of research focused on mechanisms of chemical carcinogenesis, briefly described here, it is clear that DNA damage, or DNA adduct formation, is "necessary but not sufficient" for tumor induction, and that many additional factors contribute to carcinogenesis. This review includes a synopsis of carcinogen-induced DNA adduct formation in experimental models and in the human population, with particular attention paid to molecular dosimetry and molecular cancer epidemiology. Environ. Mol. Mutagen. 57:499-507, 2016. © 2016 Wiley Periodicals, Inc. PMID:27346877

  11. Inhibition of DNA adduct formation of PhIP in female F344 rats by dietary conjugated linoleic acid.

    PubMed

    Josyula, S; He, Y H; Ruch, R J; Schut, H A

    1998-01-01

    The dietary mutagen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) is a mammary carcinogen in the female Fischer (F344) rat and a colon carcinogen in the male F344 rat. To exert its carcinogenicity, it is believed that PhIP needs to form adducts with DNA, a process requiring N-hydroxylation of PhIP by cytochromes P-450 1A1 and/or 1A2 (CYP 1A1 and/or 1A2), as well as further esterification of the hydroxylamine thus formed. Dietary conjugated linoleic acid (CLA) inhibits chemical carcinogenesis in various experimental models. We have examined the effect of dietary CLA on PhIP-DNA adduct formation in female F344 rats. Four-week-old animals were maintained on AIN-76A diet without or with CLA (1%, 0.5%, and 0.1% wt/wt) for 57 days. PhIP was added to the diets (0.04% wt/wt) from Days 14-42. Animals were killed (4/group) on Days 43, 50, and 57. DNA isolated from liver, mammary epithelial cells (MEC), colon, and white blood cells (WBC) was analyzed for PhIP-DNA adducts by 32P-postlabeling assays. On Day 43, CLA inhibited adduct formation in the liver (up to 58%) in a dose-dependent manner. CLA also inhibited hepatic adduct levels (29-39%) on Day 50 (at 1.0% and 0.5% CLA) and on Day 57 (53% at 0.5% CLA). CLA significantly reduced adduct levels in the WBC on Day 50 (63-70%). Adducts in MEC and the colon were not affected by dietary CLA. On Day 57, adduct levels in MEC, liver, colon, and WBC were 0-30.3%, 8.6-41.7%, 21.5-50.7%, and 7.5-11.8%, respectively, of those on Day 43. Northern blot analysis of liver RNA showed that dietary CLA did not affect steady-state levels of CYP 1A1 or 1A2 mRNA. It is concluded that dietary CLA inhibits PhIP-DNA adduct formation in liver and WBC but that those in MEC and the colon are unaffected when a low-level dietary regimen of carcinogen and inhibitor was used. In inhibiting PhIP-DNA adduct formation, CLA does not appear to act by inhibiting CYP 1A1 or 1A2 expression. PMID:10050262

  12. QUANTITATIVE AND TEMPORAL RELATIONSHIPS BETWEEN DNA ADDUCT FORMATION IN TARGET AND SURROGATE TISSUES: IMPLICATIONS FOR BIOMONITORING

    EPA Science Inventory

    DNA-carcinogen adducts offer a potential dosimeter for environmental genotoxicants reaching the exposed individual. ecause the target tissues for many chemical carcinogens are not readily accessible for monitoring adducts in humans, peripheral blood lymphocytes (PBLS) have served...

  13. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )

    1991-01-01

    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  14. N-Acetylcysteine blocks formation of cancer-initiating estrogen-DNA adducts in cells

    PubMed Central

    Zahid, Muhammad; Saeed, Muhammad; Ali, Mohammed F.; Rogan, Eleanor G.; Cavalieri, Ercole L.

    2010-01-01

    Catechol estrogens, especially 4-hydroxylated metabolites of 17β-estradiol (E2), are responsible for estrogen-induced carcinogenesis. 4-Hydroxyestradiol (4-OHE2), a major metabolite of E2 formed preferentially by cytochrome P-450 1B1, is oxidized to E2-3,4-quinone, which can react with DNA to yield the depurinating adducts 4-OHE2-1-N3Ade and 4-OHE2-1-N7Gua. The apurinic sites generated by the loss of these depurinating adducts induce mutations that could lead to cancer initiation. In the present study, we have evaluated the effects of N-acetycysteine (NAcCys) on the metabolism of two cell lines, MCF-10F (a normal human breast epithelial cell line) and E6 (a normal mouse mammary epithelial cell line), treated with 4-OHE2 or its reactive metabolite, E2-3,4-quinone. Extensive HPLC with electrochemical detection and UPLC-MS/MS analyses of the cell media demonstrated that the presence of NAcCys very efficiently shifted the estrogen metabolism towards protective methoxylation and conjugation pathways in multiple ways, while formation of depurinating DNA adducts was inhibited. Protection by NAcCys appears to be similar in both cell lines irrespective of their origin (human or mouse) or the presence of estrogen receptor-alpha. This finding suggests that NAcCys, a common dietary supplement, could be used as a potential chemopreventive agent to block the initial step in the genotoxicity caused by catechol estrogen quinones. PMID:20472053

  15. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  16. Impairment of histone H1 DNA binding by adduct formation with acetaldehyde

    SciTech Connect

    Niemela, O.; Mannermaa, R.; Oikarinen, J. )

    1990-01-01

    Incubation of histone H1 with pharmacologically relevant concentrations of acetaldehyde resulted in the formation of spontaneously stable acetaldehyde-protein linkages. The reaction of acetaldehyde and H1 purified from rat liver either by a DNA recognition site affinity chromatography or by perchloric acid extraction occurred primarily at the lysine residues in the carboxyterminal tail of H1, which is crucial for its function as a eukaryotic repressor. It was further shown using an H1-lacZ fusion protein produced in E. coli and the protein isolated from rat liver that the formation of acetaldehyde adducts with H1 impair its DNA binding properties. They propose that such a reaction may occur in vivo and lead to an inability to repress genes in the liver upon excessive alcohol consumption. This mechanism may play a role in acetaldehyde-induced collagen synthesis in alcoholics.

  17. Efficient CO2 capture by tertiary amine-functionalized ionic liquids through Li+-stabilized zwitterionic adduct formation

    PubMed Central

    Yang, Zhen-Zhen

    2014-01-01

    Summary Highly efficient CO2 absorption was realized through formation of zwitterionic adducts, combining synthetic strategies to ionic liquids (ILs) and coordination. The essence of our strategy is to make use of multidentate cation coordination between Li+ and an organic base. Also PEG-functionalized organic bases were employed to enhance the CO2-philicity. The ILs were reacted with CO2 to form the zwitterionic adduct. Coordination effects between various lithium salts and neutral ligands, as well as the CO2 capacity of the chelated ILs obtained were investigated. For example, the CO2 capacity of PEG150MeBu2N increased steadily from 0.10 to 0.66 (mol CO2 absorbed per mol of base) through the formation of zwitterionic adducts being stabilized by Li+. PMID:25246955

  18. Cysteine amide adduct formation from carboxylic acid drugs via UGT-mediated bioactivation in human liver microsomes.

    PubMed

    Harada, H; Toyoda, Y; Endo, T; Kobayashi, M

    2015-10-01

    Although chemical trapping has been widely used to evaluate cytochrome P450-mediated drug bioactivation, thus far, only a few in vitro-trapping studies have been performed on UDP-glucuronosyltransferase (UGT)-mediated drug bioactivation. In this study, we used cysteine (Cys) as trapping agent to gain new insights into the UGT-mediated bioactivation involving acyl glucuronides of carboxylic acid drugs. Diclofenac, ketoprofen and ibuprofen were incubated in human liver microsomes with UDPGA and Cys, followed by analysis using ultra-performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-QTOF/MS). The N-acyl-Cys amide adduct of diclofenac was characterized by mass analysis and was detectable even in photodiode array analysis. Our data indicated that the formation of such adducts reflects the reactivity of the corresponding acyl glucuronides. In addition, it was suggested that the adduct formation requires an N-terminal Cys moiety with both a free amine and a free thiol group, from the results using various cysteine derivatives. We propose that the S-acyl-Cys thioester adduct can form via transacylation of an acyl glucuronide and can then form to an N-acyl-Cys amide adduct through intramolecular S- to N-acyl rearrangement. This series of the reactions has important implications as a possible bioactivation mechanism for covalent binding of carboxylic acid drugs to macromolecules. PMID:26601426

  19. Formation of cigarette smoke-induced DNA adducts in the rat lung and nasal mucosa

    SciTech Connect

    Gupta, R.C.; Sopori, M.L.; Gairola, C.G.

    1989-01-01

    The formation of DNA adducts in the nasal, lung, and liver tissues of rats exposed daily to fresh smoke from a University of Kentucky reference cigarette (2R1) for up to 40 weeks was examined. The amount of smoke total particulate matter (TPM) inhaled and the blood carboxyhemoglobin (COHb) values averaged 5-5.5 mg smoke TPM/day/rat and 5.5%, respectively. The pulmonary AHH activity measured at the termination of each experiment showed an average increase of about two- to threefold in smoke-exposed groups. These observations suggested that animals effectively inhaled both gaseous and particulate phase constituents of cigarette smoke. DNAs from nasal, lung, and liver tissue were extracted and analyzed by an improved {sup 32}P-postlabeling procedure. The data demonstrate the DNA-damaging potential of long term fresh cigarette smoke exposure and suggest the ability of the tissue to partially recover from such damage following cessation of the exposure.

  20. FORMATION OF DNA ADDUCTS IN RAT LUNG FOLLOWING CHRONIC INHALATION OF DIESEL EMISSIONS, CARBON BLACK, AND TITANIUM DIOXIDE PARTICLES

    EPA Science Inventory

    The objective of this study was to determine whether the polycyclic aromatic hydrocarbons(PAH), nitro-PAH or other polycyclic organic matter adsorbed to diesel particles induces the formation of DNA adducts in the lung when compared to particles with little or no adsorbed organic...

  1. DNA BINDING AND ADDUCT FORMATION OF AFLATOXIN B1 IN CULTURED HUMAN AND ANIMAL TRACHEOBRONCHIAL AND BLADDER TISSUES

    EPA Science Inventory

    DNA binding and adduct formation of aflatoxin B1 (AFB1) was studied in cultured bladder and tracheobronchial explants from human, monkey, dog, hamster and rat. Explants were exposed to (3H)AFB1 (1 micrometer final concentration) in PFHR-4 medium (pH 7.4) without serum for 24 h, a...

  2. SENSITIVITY OF RAT AND MOUSE PERIPHERAL BLOOD LYMPHOCYTES TO B(A)P ADDUCTION AND SCE FORMATION

    EPA Science Inventory

    Both mice and rats were injected i.p. with doses of benzo(a)pyrene [B(a)P] ranging from 10 to 100 mg/kg to compare species sensitivity to SCE induction and DNA adduct formation, as well as the relationship between these endpoints. wenty-four hours after injection, blood was remov...

  3. Coulometric Titrations in Wine Samples: Studies on the Determination of S(IV) and the Formation of Adducts

    NASA Astrophysics Data System (ADS)

    Lowinsohn, Denise; Bertotti, Mauro

    2002-01-01

    In this experiment, the sulfite in white wine samples is quantified by coulometric titration with iodine, using a procedure that minimizes errors due to air oxidation. Some aspects of the distinction of S(IV) forms in such matrices are discussed on the basis of the formation of adducts between sulfite and carbonyl compounds present in the wine. The reactivity of these S(IV)-bound compounds toward the reaction with iodine is addressed and the stability of the adducts as the sample pH is changed is discussed.

    See Letter re: this article.

  4. 2-Aminofluorene metabolism and DNA adduct formation by mononuclear leukocytes from rapid and slow acetylator mouse strains.

    PubMed

    Levy, G N; Chung, J G; Weber, W W

    1994-02-01

    Following exposure of mice to the arylamine carcinogen 2-aminofluorene, DNA-carcinogen adducts can be found in the target tissues liver and bladder, and also in circulating leukocytes. Evidence is presented here that mouse mononuclear leukocytes (MNL) are capable of metabolizing 2-aminofluorene to DNA-binding metabolites which give rise to the adducts found in the MNL. Both lymphocytes and monocytes were able to acetylate arylamines during 18 h of culture. The degree of acetylation was determined by the N-acetyltransferase genotype of the mice as shown through use of acetylator congenic strains which differ only in the Nat-2 gene. Cultured MNL from rapid acetylator mice (C57BL/6J and A.B6-Natr) produced about twice as much N-acetylaminofluorene from 2-aminofluorene and 6- to 8-fold as much N-acetyl-p-aminobenzoic acid from p-aminobenzoic acid as cells from slow acetylator mice (B6.A-Nat(s) and A/J). Other differences in arylamine metabolism by MNL in culture were observed and shown to be due to genetic factors, currently unidentified, other than N-acetyltransferase. DNA adduct formation following incubation of MNL with the arylamine carcinogen 2-aminofluorene was related to both acetylation capacity and to other genetic metabolic factors in the mouse genome. MNL from rapid acetylator mice with the C57BL/6J background (B6) had 3-fold the DNA adduct levels of cells from the corresponding slow acetylator congenic (B6.A-Nat(s)). Similarly, MNL from rapid acetylator mice with the A/J background (A.B6-Natr) had twice the DNA adduct levels of those from their corresponding slow congenic (A). Adduct levels in MNL from C57BL/6J were nearly the same as those of MNL from A/J, again indicating the involvement of loci other than acetylation in DNA adduct formation. The finding of genetically dependent arylamine carcinogen metabolism and DNA adduct formation in cultured MNL suggests the possibility of using cultured MNL for assessing individual susceptibility to arylamine

  5. FORMATION OF HEMOGLOBIN ADDUCTS OF ACRYLAMIDE AND ITS EPOXIDE METABOLITE GLYCIDAMIDE IN THE RAT

    EPA Science Inventory

    A method was developed for the determination of hemoglobin (Hb) adducts form by the neurotoxic agent acrylamide and its mutagenic epoxide metabolite glycidamide. he method was based on simultaneous measurements of the cysteine adducts formed by these two agents by means of gas ch...

  6. vapor pressure of uranyl beta-diketonates. IV. effect of adduct formation on volatility of uranyl pivaloyltrifluoroacetonate

    SciTech Connect

    Sidorenko, G.V.; Suglobov, D.N.

    1986-07-01

    Gas-phase adduct formation of uranyl pivaloyltrifluoroacetonate (I) with donor active materials such as trimethyl phosphate (TMP), pyridine (Py), tetrahydrofuran (THF), and ethanol (EtOH) was demonstrated by IR spectroscopy. Vapor pressure of the I-TMF adduct was measured by the flow method. The volatility of I was studied in a stream of helium saturated with vapors of donor-active materials: Py, THF, diethyl ether (Et/sub 2/O), EtOH, and acetonitrile. The temperature dependence of the pressure of saturated I.TMP and I vapor in a stream of neutral ligand vapor is described by log p (Pa) = -A/T + B. Following are, respectively, neutral ligand, T range (degreeK), and coefficiencts A, B: TMP 383453, 4648 +/- 48, 12.06 +/- 0.18; Py, 383-463, 5277 +/- 87, 13.36 +/- 0.21; THF, 363453, 4662 +/- 69, 12.66 +/- 0.17; Et/sub 2/O, 353-423, 4864 +/- 110, 13.29 +/- 0.28; EtOH, 363-443, 4509 +/- 89, 12.18 +/- 0.22. Adduct formation with these neutral ligands decreases the volatility of I significantly. A tendency to increase of adduct volatility was observed when the donor properties of the neutral ligand decrease.

  7. Inhaled cigarette smoke induces the formation of DNA adducts in lungs of rats

    SciTech Connect

    Bond, J.A.; Chen, B.T.; Griffith, W.C.; Mauderly, J.L.

    1989-06-01

    Cigarette smoking causes a variety of adverse human health effects, including lung cancer. The molecular events associated with smoke-induced carcinogenesis are thought to be related in part to the genotoxic activities of the chemicals associated with smoke. The purpose of this investigation was to determine the molecular dosimetry of compounds in cigarette smoke in lungs of rats exposed by inhalation. These studies investigated the effects of exposure mode, sex, and time (adduct persistence) on the level of DNA adducts. Male and female F344/N rats were exposed 6 hr/day, 5 days/week for 22 days to cigarette smoke by nose-only intermittent (NOI), nose-only continuous (NOC), or whole-body continuous (WBC) exposures. Separate groups of rats were sham-exposed nose-only (NOS) or whole-body (WBS) to filtered air. All smoke exposure modes yielded daily smoke exposure concentration X time products of 600 mg particulate.hr/m3 for the first week and 1200 mg particulate.hour/m3 thereafter. Groups of rats were killed at 18 hr and 3 weeks after the 22-day exposure period and DNA adducts in lung tissues were quantified by the /sup 32/P-postlabeling method. There were significant (p less than 0.05) increases in levels of clearly resolved lung DNA adducts in male and female rats exposed to smoke compared to sham-exposed rats. There were no significant effects of exposure mode or sex on lung DNA adducts. Mean levels (+/- SE) of clearly resolved lung DNA adducts for both sexes combined in NOI, NOC, WBC, NOS, and WBS groups were 50 +/- 4, 52 +/- 6, 52 +/- 7, 21 +/- 6, and 22 +/- 4 adducts per 10(9) bases, respectively. Levels of clearly resolved DNA adducts were significantly less in lungs of rats killed 3 weeks after exposure and had declined to near control levels, suggesting that smoke-induced adducts are repaired by lung DNA repair enzymes.

  8. Formation of 7-hydroxymethyl-12-methylbenz(a)anthracene-DNA adducts from 7,12-dimethylbenz(a)anthracene in mouse epidermis

    SciTech Connect

    DiGiovanni, J.; Nebzydoski, A.P.; Decina, P.C.

    1983-09-01

    The formation of DNA adducts from (/sup 3/H)-7-hydroxymethyl-12-methylbenz(a)anthracene (7-OHM-12-MBA) and (/sup 3/H)-7,12-dimethylbenz(a)anthracene (DMBA) in the epidermis of Sencar mice was analyzed. Comparison of Sephadex LH-20 chromatographic profiles of DNA samples isolated from mice treated with DMBA or 7-OHM-12-MBA suggested that the DMBA-treated animals contained DNA adduct(s) derived from the further metabolism of 7-OHM-12-MBA. Further analysis of DNA samples from DMBA-treated mice by high-pressure liquid chromatography demonstrated the presence of 5 DNA adducts which were chromatographically indistinguishable from the DNA adducts formed in 7-OHM-12-MBA-treated mice. Epidermal homogenates were utilized to catalyze the covalent binding of (/sup 3/H)DMBA and (/sup 3/H)-7-OHM-12-MBA to calf thymus DNA in vitro. Under conditions of limiting concentrations of (/sup 3/H)DMBA, the majority of the DNA adducts formed chromatographed in regions where 7-OHM-12-MBA-DNA adducts eluted. A major DMBA-DNA adduct formed in this in vitro system eluted with the same retention time as did the major 7-OHM-12-MBA-DNA adduct formed in mouse skin in vivo. These results when coupled with the in vivo data suggest that 7-OHM-12-MBA is an intermediate for at least some of the binding of DMBA to epidermal DNA in Sencar mice.

  9. Facile Formation of a DNA Adduct of Semicarbazide on Reaction with Apurinic/Apyrimidinic Sites in DNA.

    PubMed

    Wang, Yinan; Chan, Ho Wai; Chan, Wan

    2016-05-16

    Mutagenic semicarbazide (SEM) is a hydrazine-containing food contaminant found in a wide variety of foods. Despite decades of research, the toxicity of SEM remains incompletely understood. In this study, we demonstrate for the first time that SEM reacts rapidly with apurinic/apyrimidinic sites in an endogenous DNA lesion to form covalently bonded DNA adducts in vitro and in bacteria. Specifically, we performed high-performance liquid chromatography with high accuracy and tandem mass spectrometry to characterize the DNA adduct formed by reacting SEM with 2'-deoxyribose and single- and double-stranded oligonucleotides containing abasic sites under physiologically relevant conditions. By analyzing the reaction mixture at different time points, the reaction kinetics of SEM with DNA was also elucidated. Moreover, by using a highly sensitive and selective liquid chromatography-tandem mass spectrometry method, we show that SEM induces the dose-dependent formation of DNA adducts in Escherichia coli. The results from our studies provide the first direct evidence suggesting that SEM may exert genotoxicity by forming covalently bonded DNA adducts. PMID:27058397

  10. Malabaricone C-containing mace extract inhibits safrole bioactivation and DNA adduct formation both in vitro and in vivo.

    PubMed

    Martati, Erryana; Boonpawa, Rungnapa; van den Berg, Johannes H J; Paini, Alicia; Spenkelink, Albertus; Punt, Ans; Vervoort, Jacques; van Bladeren, Peter J; Rietjens, Ivonne M C M

    2014-04-01

    Safrole, present in mace and its essential oils, causes liver tumors in rodents at high dose levels due to formation of a DNA reactive 1'-sulfooxysafrole. The present study identifies malabaricone C as a mace constituent able to inhibit safrole DNA adduct formation at the level of sulfotransferase mediated bioactivation. This inhibition was incorporated into physiologically based biokinetic rat and human models. Dosing safrole at 50mg/kg body weight and malabaricone C-containing mace extract at a ratio reflecting the relative presence in mace, and assuming 100% or 1% uptake of malabaricone C-containing mace extract, the model predicted inhibition of 1'-sulfooxysafrole formation for rats and humans by 90% and 100% or 61% and 91%, respectively. To validate the model, mace extract and safrole were co-administered orally to Sprague-Dawley rats. LC-ECI-MS/MS based quantification of DNA adduct levels revealed a significant (p<0.01) 55% reduction of safrole DNA adduct formation by malabaricone C-containing mace extract in the liver of rats exposed to safrole. The data obtained were used to perform a refined risk assessment of safrole. Overall, the results suggest a lower tumor incidence when safrole would be tested within a relevant food matrix containing sulfotransferase inhibitors compared to dosing pure safrole. PMID:24508526

  11. Formation and removal of DNA adducts in rat liver treated with N-hydroxy derivatives of 2-acetylaminofluorene, 4-acetylaminobiphenyl, and 2-acetylaminophenanthrene.

    PubMed

    Gupta, R C; Dighe, N R

    1984-03-01

    Formation and removal of hepatic DNA adducts was studied in male Sprague-Dawley rats following single injections of two hepatocarcinogens, N-hydroxy-2-acetylaminofluorene (N-OH-AAF) and N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP) and a nonhepatocarcinogen, N-hydroxy-2-acetylaminophenanthrene (N-OH-AAP) at 0.5 h, 1.5 h, 4 h, 24 h, 9 d and 29 d. Using a previously described 32P-postlabeling assay, maximal DNA binding of these compounds was observed at approximately 1.5 h, 0.5 h and 24 h, respectively. In addition to the formation of three already known C8- and N2-acetylated and C8-deacetylated guanine derivatives and several minor unknown adducts with N-OH-AAF, a set of four new major adducts was also detected. These comprised approximately 50% of the total adducts during the first 4 h. The three known adducts amounted to 58, 16 and 6% of the 1.5-h value after 24 h, 9 d and 29 d, respectively, while the bulk (greater than 84%) of the new major adducts were removed from the DNA within 24 h and found only in traces after 9 d. N-OH-AABP formed several unknown minor adducts, in addition to the one major C8-deacetylated and two minor C8- and N2-acetylated guanine derivatives; only the C8-deacetylated and N2-acetylated adducts were detected after 29 d. In the case of N-OH-AAP, two major and several minor adducts were detected, most of which were found to be deacetylated, and as much as 60% of the adducts measured at 24 h were still present after 9 d treatment. These data indicate that certain DNA adducts are repaired rapidly, while others persist for long periods. PMID:6705140

  12. Cell toxicity of methacrylate monomers-the role of glutathione adduct formation.

    PubMed

    Ansteinsson, V; Kopperud, H B; Morisbak, E; Samuelsen, J T

    2013-12-01

    Polymer-based dental restorative materials are designed to polymerize in situ. However, the conversion of methacrylate monomer to polymer is never complete, and leakage of the monomer occurs. It has been shown that these monomers are toxic in vitro; hence concerns regarding exposure of patients and dental personnel have been raised. Different monomer methacrylates are thought to cause toxicity through similar mechanisms, and the sequestration of cellular glutathione (GSH) may be a key event. In this study we examined the commonly used monomer methacrylates, 2-hydroxyethylmethacrylate (HEMA), triethylenglycol-dimethacrylate (TEGDMA), bisphenol-A-glycidyl-dimethacrylate (BisGMA), glycerol-dimethacrylate (GDMA) and methyl-methacrylate (MMA). The study aimed to establish monomers' ability to complex with GSH, and relate this to cellular toxicity endpoints. Except for BisGMA, all the monomer methacrylates decreased the GSH levels both in cells and in a cell-free system. The spontaneous formation of methacrylate-GSH adducts were observed for all methacrylate monomers except BisGMA. However, we were not able to correlate GSH depletion and toxic response measured as SDH activity and changes in cell growth pattern. Together, the current study indicates mechanisms other than GSH-binding to be involved in the toxicity of methacrylate monomers. PMID:23613115

  13. Gas-Phase Anionic σ-Adduct (Trans)formations in Heteroaromatic Systems1

    NASA Astrophysics Data System (ADS)

    Zimnicka, Magdalena; Danikiewicz, Witold

    2015-07-01

    Anions of nitroderivatives of thiophene and furan were subjected to the reactions with selected C-H acids in the gas phase. Various structures and reaction pathways were proposed for the observed ionic products. In general, the reactions of heteroaromatic anions with C-H acids may be divided into three groups, depending on the proton affinity difference between C-H acid's conjugate base and heteroaromatic anion (ΔPA). The proton transfer from C-H acid to heteroaromatic anion is a dominant process in the reactions for which ΔPA < 0 kcal mol-1, whereas the reactions with high ΔPA (ΔPA > 16 kcal mol-1) do not lead to any ionic products. The formation of σ-adducts and products of their further transformations according to the VNS, SNAr, cine, and tele substitution mechanisms have been proposed for reactions with moderate ΔPA. The other possible mechanisms as SN2 reaction, nucleophilic addition to the cyano group, ring-opening pathway, and halogenophilic reaction have also been discussed to contribute in the reactions between heteroaromatic anions and C-H acids.

  14. Red meat enhances the colonic formation of the DNA adduct O6-carboxymethyl guanine: implications for colorectal cancer risk.

    PubMed

    Lewin, Michelle H; Bailey, Nina; Bandaletova, Tanya; Bowman, Richard; Cross, Amanda J; Pollock, Jim; Shuker, David E G; Bingham, Sheila A

    2006-02-01

    Red meat is associated with increased risk of colorectal cancer and increases the endogenous formation of N-nitrosocompounds (NOC). To investigate the genotoxic effects of NOC arising from red meat consumption, human volunteers were fed high (420 g) red meat, vegetarian, and high red meat, high-fiber diets for 15 days in a randomized crossover design while living in a volunteer suite, where food was carefully controlled and all specimens were collected. In 21 volunteers, there was a consistent and significant (P < 0.0001) increase in endogenous formation of NOC with the red meat diet compared with the vegetarian diet as measured by apparent total NOC (ATNC) in feces. In colonic exfoliated cells, the percentage staining positive for the NOC-specific DNA adduct, O(6)-carboxymethyl guanine (O(6)CMG) was significantly (P < 0.001) higher on the high red meat diet. In 13 volunteers, levels were intermediate on the high-fiber, high red meat diet. Fecal ATNC were positively correlated with the percentage of cells staining positive for O(6)CMG (r(2) = 0.56, P = 0.011). The presence of O(6)CMG was also shown in intact small intestine from rats treated with the N-nitrosopeptide N-acetyl-N'-prolyl-N'-nitrosoglycine and in HT-29 cells treated with diazoacetate. This study has shown that fecal NOC arising from red meat include direct acting diazopeptides or N-nitrosopeptides able to form alkylating DNA adducts in the colon. As these O(6)CMG adducts are not repaired, and if other related adducts are formed and not repaired, this may explain the association of red meat with colorectal cancer. PMID:16452248

  15. Evaluation of Interindividual Human Variation in Bioactivation and DNA Adduct Formation of Estragole in Liver Predicted by Physiologically Based Kinetic/Dynamic and Monte Carlo Modeling.

    PubMed

    Punt, Ans; Paini, Alicia; Spenkelink, Albertus; Scholz, Gabriele; Schilter, Benoit; van Bladeren, Peter J; Rietjens, Ivonne M C M

    2016-04-18

    Estragole is a known hepatocarcinogen in rodents at high doses following metabolic conversion to the DNA-reactive metabolite 1'-sulfooxyestragole. The aim of the present study was to model possible levels of DNA adduct formation in (individual) humans upon exposure to estragole. This was done by extending a previously defined PBK model for estragole in humans to include (i) new data on interindividual variation in the kinetics for the major PBK model parameters influencing the formation of 1'-sulfooxyestragole, (ii) an equation describing the relationship between 1'-sulfooxyestragole and DNA adduct formation, (iii) Monte Carlo modeling to simulate interindividual human variation in DNA adduct formation in the population, and (iv) a comparison of the predictions made to human data on DNA adduct formation for the related alkenylbenzene methyleugenol. Adequate model predictions could be made, with the predicted DNA adduct levels at the estimated daily intake of estragole of 0.01 mg/kg bw ranging between 1.6 and 8.8 adducts in 10(8) nucleotides (nts) (50th and 99th percentiles, respectively). This is somewhat lower than values reported in the literature for the related alkenylbenzene methyleugenol in surgical human liver samples. The predicted levels seem to be below DNA adduct levels that are linked with tumor formation by alkenylbenzenes in rodents, which were estimated to amount to 188-500 adducts per 10(8) nts at the BMD10 values of estragole and methyleugenol. Although this does not seem to point to a significant health concern for human dietary exposure, drawing firm conclusions may have to await further validation of the model's predictions. PMID:26952143

  16. A physiologically based biodynamic (PBBD) model for estragole DNA binding in rat liver based on in vitro kinetic data and estragole DNA adduct formation in primary hepatocytes

    SciTech Connect

    Paini, Alicia; Punt, Ans; Viton, Florian; Scholz, Gabriele; Delatour, Thierry; Marin-Kuan, Maricel; Schilter, Benoit; Bladeren, Peter J. van; Rietjens, Ivonne M.C.M.

    2010-05-15

    Estragole has been shown to be hepatocarcinogenic in rodent species at high-dose levels. Translation of these results into the likelihood of formation of DNA adducts, mutation, and ultimately cancer upon more realistic low-dose exposures remains a challenge. Recently we have developed physiologically based biokinetic (PBBK) models for rat and human predicting bioactivation of estragole. These PBBK models, however, predict only kinetic characteristics. The present study describes the extension of the PBBK model to a so-called physiologically based biodynamic (PBBD) model predicting in vivo DNA adduct formation of estragole in rat liver. This PBBD model was developed using in vitro data on DNA adduct formation in rat primary hepatocytes exposed to 1'-hydroxyestragole. The model was extended by linking the area under the curve for 1'-hydroxyestragole formation predicted by the PBBK model to the area under the curve for 1'-hydroxyestragole in the in vitro experiments. The outcome of the PBBD model revealed a linear increase in DNA adduct formation with increasing estragole doses up to 100 mg/kg bw. Although DNA adduct formation of genotoxic carcinogens is generally seen as a biomarker of exposure rather than a biomarker of response, the PBBD model now developed is one step closer to the ultimate toxic effect of estragole than the PBBK model described previously. Comparison of the PBBD model outcome to available data showed that the model adequately predicts the dose-dependent level of DNA adduct formation. The PBBD model predicts DNA adduct formation at low levels of exposure up to a dose level showing to cause cancer in rodent bioassays, providing a proof of principle for modeling a toxicodynamic in vivo endpoint on the basis of solely in vitro experimental data.

  17. Isoniazid-resistance conferring mutations in Mycobacterium tuberculosis KatG: Catalase, peroxidase, and INH-NADH adduct formation activities

    PubMed Central

    Cade, Christine E; Dlouhy, Adrienne C; Medzihradszky, Katalin F; Salas-Castillo, Saida Patricia; Ghiladi, Reza A

    2010-01-01

    Mycobacterium tuberculosis catalase-peroxidase (KatG) is a bifunctional hemoprotein that has been shown to activate isoniazid (INH), a pro-drug that is integral to frontline antituberculosis treatments. The activated species, presumed to be an isonicotinoyl radical, couples to NAD+/NADH forming an isoniazid-NADH adduct that ultimately confers anti-tubercular activity. To better understand the mechanisms of isoniazid activation as well as the origins of KatG-derived INH-resistance, we have compared the catalytic properties (including the ability to form the INH-NADH adduct) of the wild-type enzyme to 23 KatG mutants which have been associated with isoniazid resistance in clinical M. tuberculosis isolates. Neither catalase nor peroxidase activities, the two inherent enzymatic functions of KatG, were found to correlate with isoniazid resistance. Furthermore, catalase function was lost in mutants which lacked the Met-Tyr-Trp crosslink, the biogenic cofactor in KatG which has been previously shown to be integral to this activity. The presence or absence of the crosslink itself, however, was also found to not correlate with INH resistance. The KatG resistance-conferring mutants were then assayed for their ability to generate the INH-NADH adduct in the presence of peroxide (t-BuOOH and H2O2), superoxide, and no exogenous oxidant (air-only background control). The results demonstrate that residue location plays a critical role in determining INH-resistance mechanisms associated with INH activation; however, different mutations at the same location can produce vastly different reactivities that are oxidant-specific. Furthermore, the data can be interpreted to suggest the presence of a second mechanism of INH-resistance that is not correlated with the formation of the INH-NADH adduct. PMID:20054829

  18. 1,N(2)-propanodeoxyguanosine adduct formation in aortic DNA following inhalation of acrolein.

    PubMed Central

    Penn, A; Nath, R; Pan, J; Chen, L; Widmer, K; Henk, W; Chung, F L

    2001-01-01

    Recent reports indicate that many of the cytotoxic and health-threatening components of environmental tobacco smoke (ETS) reside in the vapor phase of the smoke. We have reported previously that inhalation of 1,3-butadiene, a prominent vapor phase component of ETS, accelerates arteriosclerotic plaque development in cockerels. In this study we asked whether inhaled acrolein, a reactive aldehyde that is also a prominent vapor-phase component of ETS, damages artery-wall DNA and accelerates plaque development. Cockerels inhaled 0, 1, or 10 ppm acrolein mixed with HEPA-filtered air for 6 hr. Half were killed immediately (day 1 group) for detection of the stable, premutagenic 1,N(2)-propanodeoxyguanosine acrolein adduct (AdG3) in aortic DNA via a (32)P-postlabeling/HPLC method, and half were killed after 10 days (day 10 group) for indirect assessment of adduct repair. In the day 1 group, acrolein-DNA adducts were 5 times higher in the 1 and 10 ppm groups than in HEPA-filtered air controls. However, in the day 10 group, adduct levels in the 1 and 10 ppm acrolein groups were reduced to the control adduct level. For the plaque studies, cockerels inhaled 1 ppm acrolein (6 hr/day, 8 weeks), mixed with the same HEPA-filtered air inhaled by controls. Plaque development was measured blind by computerized morphometry. Unlike butadiene inhalation, acrolein inhalation did not accelerate plaque development. Thus, even though repeated exposure to acrolein alone has no effect on plaque size under the exposure conditions described here, a single, brief inhalation exposure to acrolein elicits repairable DNA damage to the artery wall. These results suggest that frequent exposure to ETS may lead to persistent artery-wall DNA damage and thus provide sites on which other ETS plaque accelerants can act. PMID:11333181

  19. Formation of Hydroxymethyl DNA Adducts in Rats Orally Exposed to Stable Isotope Labeled Methanol

    PubMed Central

    Lu, Kun; Gul, Husamettin; Upton, Patricia B.; Moeller, Benjamin C.; Swenberg, James A.

    2012-01-01

    Methanol is a large volume industrial chemical and widely used solvent and fuel additive. Methanol’s well known toxicity and use in a wide spectrum of applications has raised long-standing environmental issues over its safety, including its carcinogenicity. Methanol has not been listed as a carcinogen by any regulatory agency; however, there are debates about its carcinogenic potential. Formaldehyde, a metabolite of methanol, has been proposed to be responsible for the carcinogenesis of methanol. Formaldehyde is a known carcinogen and actively targets DNA and protein, causing diverse DNA and protein damage. However, formaldehyde-induced DNA adducts arising from the metabolism of methanol have not been reported previously, largely due to the absence of suitable DNA biomarkers and the inability to differentiate what was due to methanol compared with the substantial background of endogenous formaldehyde. Recently, we developed a unique approach combining highly sensitive liquid chromatography-mass spectrometry methods and exposure to stable isotope labeled chemicals to simultaneously quantify formaldehyde-specific endogenous and exogenous DNA adducts. In this study, rats were exposed daily to 500 or 2000 mg/kg [13CD4]-methanol by gavage for 5 days. Our data demonstrate that labeled formaldehyde arising from [13CD4]-methanol induced hydroxymethyl DNA adducts in multiple tissues in a dose-dependent manner. The results also demonstrated that the number of exogenous DNA adducts was lower than the number of endogenous hydroxymethyl DNA adducts in all tissues of rats administered 500 mg/kg per day for 5 days, a lethal dose to humans, even after incorporating an average factor of 4 for reduced metabolism due to isotope effects of deuterium-labeled methanol into account. PMID:22157354

  20. Formation of DNA adducts and induction of mutations in rats treated with tumorigenic doses of 1,6-dinitropyrene

    SciTech Connect

    Beland, F.A.; Fullerton, N.F.; Smith, B.A.; Heflich, R.H.

    1994-10-01

    1,6-Dinitropyrene, a component of diesel exhaust, is a lung carcinogen in male F344 rats following a single intrapulmonary administration. In this study, rats were treated with tumorigenic doses of 1,6-dinitropyrene to establish dose-response relationships for the formation of DNA adducts in target (lung) and nontarget (liver) tissues and for the induction of 6-thioguanine-resistant mutations in spleen T-lymphocytes. One week after treatment with 0.3, 1, 3, 10, 30, 100, or 150 {mu}g of 1,6-dinitropyrene, dose-responsive DNA binding was measured in lung and liver with binding in the being 10-fold higher than in the liver. In the lung, a 2-fold increase in dose resulted in a 1.8-fold increase in DNA binding at treatments up to 30 {mu}g of 1,6-dinitropyrene, while in the liver, a 2-fold increase in 1,6-dinitropyrene produced a 2-fold increase in DNA binding at doses up to the 10 {mu}g treatment. Higher doses of 1,6-dinitropyrene resulted in proportionally smaller increases in adduct formation in the two tissues. When measured 21 weeks after treatment, mutations in T-lymphocytes increased with doses up to 100 {mu}g of 1,6-dinitropyrene, but the response was nonlinear throughout the dose range. These findings indicate that concentrations of 1,6-dinitropyrene that produce a dose-dependent induction of lung tumors also result in a dose-dependent formation of DNA adducts and induction of lymphocyte mutations but that the dose-response curves for DNA binding and mutations are different. 39 refs., 3 figs.

  1. Formation of S-substituted glutathione adducts of styrene catalyzed by protaglandin H synthase: a possible new mechanism for the formation of glutathione conjugates

    SciTech Connect

    Stock, B.H.; Bend, J.R.; Eling, T.E.

    1986-03-01

    The prostaglandin hydroperoxidase (PHP)- and horseradish peroxidase (HRP)-dependent metabolism of styrene was examined. In the presence of arachidonic acid or hydrogen peroxide and glutathione (GSH), microsomes prepared from ram seminal vesicles catalyzed the formation of styrene-GSH adducts. Neither styrene 7,8-oxide nor styrene-GSH adducts were isolated by HPLC and shown by NMR and MS-MS mass spectrometry to be a mixture of (2R)- and (2S)-S-(2-phenyl-2-hydroxyethyl)glutathione. No (1R)- or (1S)-S-(1-phenyl-2-hydroxyethyl)glutathione was formed. The addition of phenol or aminopyrine to incubation mixtures containing the appropriate cofactor and PHP or HRP, which greatly enhances the oxidation of GSH to a thiyl radical by these peroxidases, increased the amount of the two styrene-GSH adducts produced. The authors propose that the formation of (2R)- and (2S)-S-(2-phenyl-2-hydroxyethyl)glutathione is dependent on the initial oxidation of GSH to a thiyl radical by the peroxidases, and on the subsequent reaction of this thiyl radical with the terminal alkene carbon atom of styrene. This is an epoxide-independent mechanism for the formation of GSH conjugates of alkenes that can occur in the absence of cytochrome P-450-dependent monooxygenases.

  2. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne α,β-unsaturated aldehydes

    SciTech Connect

    Kiwamoto, R. Spenkelink, A.; Rietjens, I.M.C.M.; Punt, A.

    2015-01-01

    Acyclic α,β-unsaturated aldehydes present in food raise a concern because the α,β-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present study was to develop physiologically based kinetic/dynamic (PBK/D) models to examine dose-dependent detoxification and DNA adduct formation of a group of 18 food-borne acyclic α,β-unsaturated aldehydes without 2- or 3-alkylation, and with no more than one conjugated double bond. Parameters for the PBK/D models were obtained using quantitative structure–activity relationships (QSARs) defined with a training set of six selected aldehydes. Using the QSARs, PBK/D models for the other 12 aldehydes were defined. Results revealed that DNA adduct formation in the liver increases with decreasing bulkiness of the molecule especially due to less efficient detoxification. 2-Propenal (acrolein) was identified to induce the highest DNA adduct levels. At realistic dietary intake, the predicted DNA adduct levels for all aldehydes were two orders of magnitude lower than endogenous background levels observed in disease free human liver, suggesting that for all 18 aldehydes DNA adduct formation is negligible at the relevant levels of dietary intake. The present study provides a proof of principle for the use of QSAR-based PBK/D modelling to facilitate group evaluations and read-across in risk assessment. - Highlights: • Physiologically based in silico models were made for 18 α,β-unsaturated aldehydes. • Kinetic parameters were determined by in vitro incubations and a QSAR approach. • DNA adduct formation was negligible at levels relevant for dietary intake. • The use of QSAR-based PBK/D modelling facilitates group evaluations and read-across.

  3. Effects of selenium on 7,12-dimethylbenz(a)anthracene-induced mammary carcinogenesis and DNA adduct formation

    SciTech Connect

    Ip, C.; Daniel, F.B.

    1985-01-01

    The purpose of the present investigation was to determine the effects of dietary selenium deficiency or excess on 7,12-dimethylbenz(a)anthracene (DMBA)-induced mammary neoplasia in rats and to delineate whether selenium-mediated modification of mammary carcinogenesis was associated with changes in carcinogen:DNA adduct formation and activities of liver microsomal enzymes that are involved in xenobiotic metabolism. Female Sprague-Dawley rats were divided into three groups from weaning and were maintained on one of three synthetic diets designated as follows: selenium deficient (less than 0.02 ppm); selenium adequate (0.2 ppm); or selenium excess (2.5 ppm). For the DMBA binding and DNA adduct studies, rats were given a dose of (/sup 3/H)DMBA p.o. after 1 month on their respective diets. Results from the liver and the mammary gland indicated that neither selenium deficiency nor excess had any significant effect on the binding levels, which were calculated on the basis of total radioactivity isolated with the purified DNA. Furthermore, it was found that dietary selenium intake did not seem to affect quantitatively or qualitatively the formation of DMBA:DNA adducts in the liver. Similarly, in a parallel group of rats that did not receive DMBA, the activities of aniline hydroxylase, aminopyrine N-demethylase, and cytochrome c reductase were not significantly altered by dietary selenium levels. Concurrent with the above experiments, the effect of dietary selenium intake on carcinogenesis was also monitored. Results of this experiment indicated that selenium deficiency enhanced mammary carcinogenesis only when this nutritional condition was maintained in the postinitiation phase. Likewise, an excess of selenium intake inhibited neoplastic development only when this regimen was continued after DMBA administration.

  4. Kinetics, thermodynamics, and mechanism of the formation of benzaldehyde-S(IV) adducts

    SciTech Connect

    Olson, T.M.; Boyce, S.D.; Hoffmann, M.R.

    1986-05-22

    The kinetics and mechanism of the formation of ..cap alpha..-hydroxyphenylmethanesulfonate (HPMS) by the addition of bisulfite to benzaldehyde were studied at low pH. A three-term rate law was observed as d(HPMS)/dt - (k/sub 1/..cap alpha../sub 2/ + (k/sub 2/ + k/sub 3/K/sub H-/(H/sup +/))..cap alpha../sub 1/)(S(IV))/sub t/(C/sub 6/H/sub 5/CHO) where ..cap alpha../sub 1/ = (HSO/sub 2//sup -/)/(S(IV)), ..cap alpha../sub 3/ = (SO/sub 2//sup 2 -/)/(S(IV)), and K/sub H/ is the proton association constant of benzaldehyde. The rate-limiting steps of each term appeared to be the nucleophilic attack of SO/sub 3//sup 2 -/ on the carbonyl carbon of benzaldehyde, the attack of HSO/sub 3//sup -/ on the carbonyl carbon, and the attack by HSO/sub 3//sup -/ on the protonated carbon of the carbocation, C/sub 6/H/sub 5/C/sup +/H(OH), respectively. Over the pH range of most natural systems, only the k/sub 1/ and k/sub 2/ steps contribute to adduct formation while the k/sub 3/ term becomes important for pH < 1. At 25/sup 0/C and ..mu.. = 1.0 M, the intrinsic rate constants were determined to be k/sub 1/ = (2.15 +- 0.09) x 10/sup 4/ M/sup -1/ s/sup -1/, k/sub 2/ = (0.71 +- 0.03) M/sup -1/ s/sup -1/, k/sub 3/ approx. 2.5 x 10/sup 7/ M/sup -1/ s/sup -1/. Para-substitution on the benzaldehyde ring resulted in a slight increase in reactivity for p-NO/sub 2/- and p-Cl-, and a decrease for p-OH-, p-OCH/sub 3/-, and p-CH/sub 3/-C/sub 6/H/sub 5/CHO. The equilibrium association constant, K = (C/sub 6/H/sub 5/CH(OH)SO/sub 3//sup -/)/(HSO/sub 3//sup -/)(C/sub 6/H/sub 5/CHO), at 25/sup 0/C was determined to be 4.8 (+-0.8) x 10/sup 3/ at ..mu.. = 0.1 M and 0.98 (+- 0.11) x 10/sup 3/ M/sup -1/ at ..mu.. = 1.0 M. ..delta..H/sup 0/ and ..delta..S/sup 0/ was determined to be -64.6 kJ mol/sup -1/ and -146 J mol/sup -1/ deg/sup -1/, respectively.

  5. Uptake, distribution, and formation of hemoglobin and DNA adducts after inhalation of C2-C8 1-alkenes (olefins) in the rat.

    PubMed

    Eide, I; Hagemann, R; Zahlsen, K; Tareke, E; Törnqvist, M; Kumar, R; Vodicka, P; Hemminki, K

    1995-07-01

    Absorption, distribution, elimination and hemoglobin and DNA adduct formation were studied in the rat after inhalation of individual C2-C8 1-alkenes (olefins) at 300 p.p.m., 12 h a day for 3 consecutive days. The concentrations of olefins were measured in blood, lung, brain, liver, kidney and perirenal fat immediately after each exposure and 12 h after the third exposure. DNA adducts were determined by 32P-postlabeling in liver, and lymphocytes sampled immediately after the last exposure. Hemoglobin adducts were determined by GC/MS and GC/MS/MS in erythrocytes sampled immediately after the last exposure. Concentrations of 1-alkenes in blood and organs reached a steady-state level after the first 12 h exposure, and the concentrations 12 h after the last exposure were generally low, except in fat tissue. Concentrations of 1-alkenes in blood and the different tissues increased with increasing number of carbon atoms. In contrast, levels of hemoglobin and DNA adducts decreased with increasing number of carbon atoms. The decrease was most pronounced from C2 to C3. The decrease through the whole homologous series from ethene to 1-octene was most pronounced for hemoglobin adducts followed by the DNA adducts in the lymphocytes. All 1-alkenes caused formation of detectable levels of hemoglobin and DNA adducts, although the levels of hemoglobin adducts after C4-C8 exposure were low. The project illustrates important aspects of the use of biomarkers. The structure-activity approach gives possibilities for extrapolation within the homologous series. PMID:7614695

  6. Effects of dietary conjugated linoleic acid on DNA adduct formation of PhIP and IQ after bolus administration to female F344 rats.

    PubMed

    Josyula, S; Schut, H A

    1998-01-01

    Meats cooked at high temperatures contain mutagenic heterocyclic amines such as 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3-methylimidazo[4,5-f]quinoline (IQ). In female Fischer 344 rats, IQ is a multiorgan carcinogen, whereas PhIP induces mammary adenocarcinomas. For IQ and PhIP, N-hydroxylation, catalyzed by microsomal cytochrome P-450 1A1 and/or 1A2, and then esterification, especially O-acetylation, are the principal steps leading to DNA adduct formation. Conjugated linoleic acid (CLA) is a mixture of conjugated linoleic acid isomers found in various meat and dairy products. We have examined the effect of dietary CLA on DNA adduct formation by PhIP and IQ in female Fischer 344 rats. Four-week-old animals were maintained on AIN-76A diet without or with CLA (4% wt/wt) and treated with IQ or PhIP (50 mg/kg by gavage) after two weeks. Animals were killed (4/group) one, four, and eight days later. DNA isolated from mammary epithelial cells, liver, colon, and white blood cells was analyzed for carcinogen-DNA adducts by 32P-postlabeling assays. On Day 1, dietary CLA significantly inhibited adduct formation (82.0%) in mammary epithelial cells in IQ--but not in PhIP-treated rats. In the colon, dietary CLA significantly inhibited PhIP-DNA adduct formation (18.7%) on Day 8 but increased IQ-DNA adduct formation (30.5%) on Day 8. Dietary CLA had no effect on adduct levels in liver or white blood cells. Calf thymus DNA was incubated with N-hydroxy-PhIP or -IQ in the presence of acetyl-CoA. Enzymatic activation was catalyzed by liver or mammary cytosol. A two-week pretreatment with 2% (wt/wt) dietary CLA had no effect on O-acetyltransferase-catalyzed IQ- or PhIP-DNA adduct formation. It is concluded, under certain conditions, that dietary CLA can lower IQ- and PhIP-DNA adduct formation. Overall, however, the major mode of action of CLA is probably by a mechanism other than the inhibition of the N-hydroxylation and subsequent O-acetylation of PhIP or

  7. DNA adduct formation and induction of detoxification mechanisms in Dreissena polymorpha exposed to nitro-PAHs.

    PubMed

    Châtel, Amélie; Faucet-Marquis, Virginie; Pfohl-Leszkowicz, Annie; Gourlay-Francé, Catherine; Vincent-Hubert, Françoise

    2014-11-01

    Derived polycyclic aromatic hydrocarbons (PAHs) such as nitro-PAHs are present in the environment and are known to be much more toxic than PAHs compounds. However, very few studies have analysed their effects on the aquatic environment and none have investigated the freshwater environment. In the present study, we determined whether 1-nitropyrene (1-NP), a model of nitro-PAHs, can induce DNA adducts in gills and digestive glands of the freshwater mussel Dreissena polymorpha. Two concentrations of 1-NP (50 and 500 μM) were tested. In addition, in order to understand the metabolic pathways involved in 1-NP genotoxicity, mRNA expression of genes implicated in biotransformation mechanisms was assessed by quantitative reverse transcription-PCR. Results showed the presence of DNA adducts in both gills and digestive glands, with highest levels obtained after 5 days of exposure to 500 μM. Metallothionein mRNA levels were enhanced in digestive glands exposed to 50 μM. Surprisingly, at the higher concentration (500 μM), aryl hydrocarbon receptor and HSP70 genes were only up-regulated in digestive glands while PgP mRNA levels were increased in both tissues. Results suggested a cytotoxic and genotoxic effect of 1-NP. Mussels seemed to be able to partially detoxify this compound, in view of the low amount of DNA adducts observed after 5 days exposure to 50 μM. For the first time, 1-NP biotransformation and detoxification systems have been characterised in D. polymorpha. PMID:25209124

  8. Titanium dioxide nanoparticles induce oxidative stress and DNA-adduct formation but not DNA-breakage in human lung cells

    PubMed Central

    Bhattacharya, Kunal; Davoren, Maria; Boertz, Jens; Schins, Roel PF; Hoffmann, Eik; Dopp, Elke

    2009-01-01

    Titanium dioxide (TiO2), also known as titanium (IV) oxide or anatase, is the naturally occurring oxide of titanium. It is also one of the most commercially used form. To date, no parameter has been set for the average ambient air concentration of TiO2 nanoparticles (NP) by any regulatory agency. Previously conducted studies had established these nanoparticles to be mainly non-cyto- and -genotoxic, although they had been found to generate free radicals both acellularly (specially through photocatalytic activity) and intracellularly. The present study determines the role of TiO2-NP (anatase, ∅ < 100 nm) using several parameters such as cyto- and genotoxicity, DNA-adduct formation and generation of free radicals following its uptake by human lung cells in vitro. For comparison, iron containing nanoparticles (hematite, Fe2O3, ∅ < 100 nm) were used. The results of this study showed that both types of NP were located in the cytosol near the nucleus. No particles were found inside the nucleus, in mitochondria or ribosomes. Human lung fibroblasts (IMR-90) were more sensitive regarding cyto- and genotoxic effects caused by the NP than human bronchial epithelial cells (BEAS-2B). In contrast to hematite NP, TiO2-NP did not induce DNA-breakage measured by the Comet-assay in both cell types. Generation of reactive oxygen species (ROS) was measured acellularly (without any photocatalytic activity) as well as intracellularly for both types of particles, however, the iron-containing NP needed special reducing conditions before pronounced radical generation. A high level of DNA adduct formation (8-OHdG) was observed in IMR-90 cells exposed to TiO2-NP, but not in cells exposed to hematite NP. Our study demonstrates different modes of action for TiO2- and Fe2O3-NP. Whereas TiO2-NP were able to generate elevated amounts of free radicals, which induced indirect genotoxicity mainly by DNA-adduct formation, Fe2O3-NP were clastogenic (induction of DNA-breakage) and required reducing

  9. Substituents on Quinone Methides Strongly Modulate Formation and Stability of Their Nucleophilic Adducts

    PubMed Central

    Weinert, Emily E.; Dondi, Ruggero; Colloredo-Melz, Stefano; Frankenfield, Kristen N.; Mitchell, Charles H.; Freccero, Mauro; Rokita, Steven E.

    2008-01-01

    Electronic perturbation of quinone methides (QM) greatly influences their stability and in turn alters the kinetics and product profile of QM reaction with deoxynucleosides. Consistent with the electron deficient nature of this reactive intermediate, electron-donating substituents are stabilizing and electron-withdrawing substituents are destabilizing. For example, a dC N3-QM adduct is made stable over the course of observation (7 days) by the presence of an electron-withdrawing ester group that inhibits QM regeneration. Conversely, a related adduct with an electron donating methyl group is very labile and regenerates its QM with a half-life of approximately 5 hr. The generality of these effects is demonstrated with a series of alternative quinone methide precursors (QMP) containing a variety of substituents attached at different positions with respect to the exocyclic methylene. The rates of nucleophilic addition to substituted QMs measured by laser flash photolysis similarly span five orders of magnitude with electron rich species reacting most slowly and electron deficient species reacting most quickly. The reversibility of QM reaction can now be predictably adjusted for any desired application. PMID:16953635

  10. Reactions of OOH radical with beta-carotene, lycopene, and torulene: hydrogen atom transfer and adduct formation mechanisms.

    PubMed

    Galano, Annia; Francisco-Marquez, Misaela

    2009-08-13

    The relative free radical scavenging activity of beta-carotene, lycopene, and torulene toward OOH radicals has been studied using density functional theory. Hydrogen atom transfer (HAT) and radical adduct formation (RAF) mechanisms have been considered. All the possible reaction sites have been included in the modeling, and detailed branching ratios are reported for the first time. The reactions of hydrocarbon carotenoids (Car) with peroxyl radicals, in both polar and nonpolar environments, are predicted to proceed via RAF mechanism, with contributions higher than 98% to the overall OOH + Car reactions. Lycopene and torulene were found to be more reactive than beta-carotene. In nonpolar environments the reactivity of the studied carotenoids toward peroxyl radical follows the trend LYC > TOR > BC, whereas in aqueous solutions it is TOR > LYC > BC. OOH adducts are predicted to be formed mainly at the terminal sites of the conjugated polyene chains. The main addition sites were found to be C5 for beta-carotene and lycopene and C30 for torulene. The general agreement between the calculated magnitudes and the available experimental data supports the predictions from this work. PMID:19627101

  11. N7-glycidamide-guanine DNA adduct formation by orally ingested acrylamide in rats: a dose-response study encompassing human diet-related exposure levels.

    PubMed

    Watzek, Nico; Böhm, Nadine; Feld, Julia; Scherbl, Denise; Berger, Franz; Merz, Karl Heinz; Lampen, Alfonso; Reemtsma, Thorsten; Tannenbaum, Steven R; Skipper, Paul L; Baum, Matthias; Richling, Elke; Eisenbrand, Gerhard

    2012-02-20

    Acrylamide (AA) is formed during the heating of food and is classified as a genotoxic carcinogen. The margin of exposure (MOE), representing the distance between the bench mark dose associated with 10% tumor incidence in rats and the estimated average human exposure, is considered to be of concern. After ingestion, AA is converted by P450 into the genotoxic epoxide glycidamide (GA). GA forms DNA adducts, primarily at N7 of guanine (N7-GA-Gua). We performed a dose-response study with AA in female Sprague-Dawley (SD) rats. AA was given orally in a single dosage of 0.1-10 000 μg/kg bw. The formation of urinary mercapturic acids and of N7-GA-Gua DNA adducts in liver, kidney, and lung was measured 16 h after application. A mean of 37.0 ± 11.5% of a given AA dose was found as mercapturic acids (MAs) in urine. MA excretion in urine of untreated controls indicated some background exposure from endogenous AA. N7-GA-Gua adduct formation was not detectable in any organ tested at 0.1 μg AA/kg bw. At a dose of 1 μg/kg bw, adducts were found in kidney (around 1 adduct/10(8) nucleotides) and lung (below 1 adduct/10(8) nucleotides) but not in liver. At 10, respectively, 100 μg/kg bw, adducts were found in all three organs, at levels close to those found at 1 μg AA/kg, covering a range of about 1-2 adducts/10(8) nucleotides. As compared to DNA adduct levels from electrophilic genotoxic agents of various origin found in human tissues, N7-GA-Gua adduct levels within the dose range of 0.1-100 μg AA/kg bw were at the low end of this human background. We propose to take the background level of DNA lesions in humans more into consideration when doing risk assessment of food-borne genotoxic carcinogens. PMID:22211389

  12. Protective Role of CYP2E1 Inhibitor Diallyl Disulfide (DADS) on Alcohol Induced Malondialdehyde-Deoxyguanosine (M1dG) Adduct Formation

    PubMed Central

    Sapkota, M.; Hottor, T. K.; DeVasure, J. M.; Wyatt, T. A.; McCaskill, M. L.

    2014-01-01

    Background Alcohol use disorders are often associated with lung disease. Alcohol exposure leads to the production of reactive oxygen species, lipid peroxidation, and formation of malondialdehyde (MDA) as well as induce the expression of cytochrome p450 2E1 (CYP2E1). Likewise, cigarette smoking can lead to lung lipid peroxidation and formation of MDA. MDA can bind to DNA forming MDA deoxyguanosine (M1dG) adducts, which have been implicated in alcohol-related cancers and cardiovascular disease. Because CYP2E1 regulates MDA production, and our previous studies have shown that alcohol and cigarette smoke can lead to MDA formation, we hypothesized that CYP2E1 would modulate M1dG adduct formation and single strand DNA damage in alcohol- and cigarette smoke-exposed lung cells and tissue. Methods Normal human bronchial epithelial cells (HBEC) were pre-treated with 10 μM DADS for 1h, and treated with 80 mM ethanol +/− 5% cigarette smoke extract (CSE) for 3 hrs for comet assay and 6 hrs for CYP2E1, MDA, and M1dG adduct assays. C57BL/6 mice were administered 20% ethanol ad libitum in drinking water for 8 wk and exposed to whole body cigarette smoke for 5 wk. Mice were also fed a CYP2E1 inhibitor, diallyl disulfide (DADS), at 1 μM/g of feed in their daily diet for 7 wk. Whole lung tissue homogenate was used for CYP2E1, MDA, and M1dG adduct assays. Results Ethanol exposure significantly increased HBEC olive tail moment. DADS pretreatment of HBEC attenuated this ethanol effect. Ethanol also induced MDA and M1dG adduct formation, which was also significantly reduced by DADS treatment. CSE +/− ethanol did not enhance these effects. In lung tissue homogenate of 8 wk alcohol-fed mice, MDA and M1dG adduct levels were significantly elevated in comparison to control mice and mice fed DADS while consuming alcohol. No increase in MDA and M1dG adduct formation was observed in 5 wk cigarette smoke-exposed mice. Conclusions These findings suggest that CYP2E1 plays a pivotal role in

  13. 3-Methylcholanthrene elicits DNA adduct formation in the CYP1A1 promoter region and attenuates reporter gene expression in rat H4IIE cells

    SciTech Connect

    Moorthy, Bhagavatula . E-mail: bmoorthy@bcm.tmc.edu; Muthiah, Kathirvel; Fazili, Inayat S.; Kondraganti, Sudha R.; Wang Lihua; Couroucli, Xanthi I.; Jiang Weiwu

    2007-03-23

    Cytochrome CYP1A (CYP1A) enzymes catalyze bioactivation of 3-methylcholanthrene (MC) to genotoxic metabolites. Here, we tested the hypothesis that CYP1A2 catalyzes formation of MC-DNA adducts that are preferentially formed in the promoter region of CYP1A1, resulting in modulation of CYP1A1 gene expression. MC bound covalently to plasmid DNA (50 {mu}g) containing human CYP1A1 promoter (pGL3-1A1), when incubated with wild-type (WT) liver microsomes (2 mg) and NAPPH 37 {sup o}C for 2 h, giving rise to 9 adducts, as determined by {sup 32}P-postlabeling. Eighty percent of adducts was located in the promoter region. Transient transfection of the adducted plasmids into rat hepatoma (H4IIE) cells for 16 h, followed by MC (1 {mu}M) treatment for 24 h inhibited reporter (luciferase) gene expression by 75%, compared to unadducted controls. Our results suggest that CYP1A2 plays a key role in sequence-specific MC-DNA adduct formation in the CYP1A1 promoter region, leading to attenuation of CYP1A1 gene expression.

  14. Influence of TCDD and natural Ah receptor agonists on benzo[a]pyrene-DNA adduct formation in the Caco-2 human colon cell line.

    PubMed

    de Waard, Pim W J; de Kok, Theo M C M; Maas, Lou M; Peijnenburg, Ad A C M; Hoogenboom, Ron L A P; Aarts, Jac M M J G; van Schooten, Frederik-Jan

    2008-01-01

    Several compounds originating from cruciferous vegetables and citrus fruits bind to and activate the aryl hydrocarbon receptor (AhR). This receptor plays an important role in the toxicity of the known tumour promoter and potent AhR-agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). However, vegetables and fruits are generally considered as healthy. Therefore, besides the AhR activation, the natural AhR agonists (NAhRAs) are assumed to show other health-concerning effects. AhR activation induces several cytochrome P450 phase I enzymes involved, e.g. in the bioactivation of carcinogenic polycyclic aromatic hydrocarbons, like benzo[a]pyrene (BaP), and may as such stimulate DNA adduct formation of those compounds. Therefore, the influence of TCDD, indolo[3,2-b]carbazole (ICZ, an NAhRA originating from cruciferous vegetables) and an NAhRA-containing extract of grapefruit juice (GJE) on BaP-DNA adduct formation in the human Caco-2 cell line was studied. Also, we investigated if different effects of TCDD, ICZ and GJE on adduct formation could be related to the modulation of transcription of biotransformation- and DNA-repair enzymes. Co-exposure to high AhR-activating concentrations of both TCDD and ICZ significantly reduced the amount of BaP-DNA adducts at 0.1 microM BaP, while at higher concentrations of BaP no influence was observed. In contrast, exposure to 0.1 microM BaP combined with GJE showed a significant increase in BaP-DNA adducts, and a significant decrease at 0.3 and 1 microM BaP. These differences could not be related to transcription of the phase I and II enzymes CYP1A1, CYP1B1, NQO1, GSTP1 and UGT1A6 or to transcription of the nucleotide excision repair enzymes ERCC1, XPA, XPC, XPF and XPG. We conclude that ICZ showed a similar effect on BaP-DNA adduct formation than TCDD, while GJE influenced the adduct formation in a different way. The difference in the influence on adduct formation may be due to effects at the level of enzyme activity, rather than gene

  15. Characterization of hemoglobin adduct formation in mice and rats after administration of ( sup 14 C)butadiene or ( sup 14 C)isoprene

    SciTech Connect

    Sun, J.D.; Dahl, A.R.; Bond, J.A.; Birnbaum, L.S.; Henderson, R.F. )

    1989-08-01

    Occupational exposures to 1,3-butadiene or isoprene occur through their use in the manufacture of rubber and other related polymer products. The purpose of this study was to determine if butadiene or isoprene administration would result in the formation of adducts with blood hemoglobin (Hb), and if such adducts can be used as a measure of previous exposure(s). Male B6C3F1 mice and male Sprague-Dawley rats were injected intraperitoneally with 1, 10, 100, or 1000 mumol (14C)butadiene or 0.3, 3.0, 300, 1000, or 3000 mumol (14C)isoprene per kilogram body weight. Animals were killed 24 hr later. Globin was isolated from blood samples and was analyzed for 14C by liquid scintillation spectroscopy. Hb adduct formation was linearly related to administered doses up to 100 mumol (14C)butadiene or 500 mumol (14C)isoprene per kilogram body weight for mice and rats, respectively. For (14C)butadiene, the efficiency of Hb adduct formation in mice and rats within the linear response range was 0.177 +/- 0.003 and 0.407 +/- 0.019 (pmol of 14C-adducts/mg globin)/(mumol of retained (14C)butadiene/kg body wt), respectively (mean +/- SE; n = 18). For (14C)isoprene, these values for mice and rats were 0.158 +/- 0.035 and 0.079 +/- 0.016 (pmol of 14C-adducts/mg globin)/(mumol of retained (14C)isoprene/kg body wt), respectively (mean +/- SE; n = 12). Hb adducts also accumulated linearly after repeated daily administration of 100 mumol (14C)butadiene or 500 mumol (14C)isoprene per kilogram body wt to mice and rats, respectively, for 3 days. (14C)Butadiene-derived Hb adducts in blood showed lifetimes of approximately 24 and approximately 65 days for mice and rats, respectively, which correlate with the reported lifetimes for red blood cells in these rodent species. Thus, levels of butadiene- or isoprene-derived adducts on Hb in circulating blood may be a useful measure of prior repeated exposures to these compounds.

  16. Glutathione transferase activity and formation of macromolecular adducts in two cases of acute methyl bromide poisoning.

    PubMed Central

    Garnier, R; Rambourg-Schepens, M O; Müller, A; Hallier, E

    1996-01-01

    OBJECTIVES: To determine the activity of glutathione transferase and to measure the S-methylcysteine adducts in blood proteins, after acute inhalation exposure to methyl bromide. To examine the influence of the polymorphism of glutathione-S-transferase theta (GSTT1) on the neurotoxicity of methyl bromide. METHODS: Two workers acutely exposed to methyl bromide with inadequate respiratory protective devices were poisoned. Seven weeks after the accident, blood samples were drawn from both patients, for measurement of glutathione transferase activity in erythrocytes (conjugator status--that is, GSTT1 phenotype) and measurement of binding products of methyl bromide with blood proteins. Conjugator status was determined by a standard procedure. The binding product of methyl bromide, S-methylcysteine, was measured in globin and albumin. RESULTS: Duration and intensity of exposure were identical for both patients as they worked together with the same protective devices and with similar physical effort. However, one patient had very severe poisoning, whereas the other only developed mild neurotoxic symptoms. The first patient was a "conjugator" with normal glutathone transferase activity, whereas this activity was undetectable in the erythrocytes of the second patient, who consequently had higher concentrations of S-methylcysteine adduct in albumin (149 v 91 nmol/g protein) and in globin (77 v 30 nmol/g protein). CONCLUSIONS: Methyl bromide is genotoxic and neurotoxic. Its genotoxicity seems to be the consequence of the alkylating activity of the parent compound, and conjugation to glutathione has a protective effect. The data presented here suggest a different mechanism for methyl bromide neurotoxicity which could be related to the transformation of methylglutathione into toxic metabolites such as methanethiol and formaldehyde. If such metabolites are the ultimate toxic species, N-acetylcysteine treatment could have a toxifying rather than a detoxifying effect. PMID:8704864

  17. Acetylator genotype-dependent formation of 2-aminofluorene-hemoglobin adducts in rapid and slow acetylator Syrian hamsters congenic at the NAT2 locus.

    PubMed

    Feng, Y; Rustan, T D; Ferguson, R J; Doll, M A; Hein, D W

    1994-01-01

    Arylamine-hemoglobin adducts are a valuable dosimeter for assessing arylamine exposures and carcinogenic risk. The effects of age, sex, time-course, dose, and acetylator genotype on levels of 2-aminofluorene-hemoglobin adducts were investigated in homozygous rapid (Bio. 82.73/H-Patr) and slow (Bio. 82.73/H-Pats) acetylator hamsters congenic at the polymorphic (NAT2) acetylator locus. Following administration of a single ip dose of [3H]2-aminofluorene, peak 2-aminofluorene-hemoglobin adduct levels were achieved at 12-18 hr and retained a plateau up to 72 hr postinjection in both rapid and slow acetylator congenic hamsters. 2-Aminofluorene-hemoglobin adduct levels did not differ significantly between young (5-6 weeks) and old (32-49 weeks) hamsters or between male and female hamsters within either acetylator genotype. 2-Aminofluorene-hemoglobin adduct levels increased in a dose-dependent manner (r = 0.95, p = 0.0001) and were consistently higher in slow versus rapid acetylator congenic hamsters in studies of both time-course and dose-effect. The magnitude of the acetylator genotype-dependent difference was a function of dose; 2-aminofluorene-hemoglobin adduct levels were 1.5-fold higher in slow acetylator congenic hamsters following a 60 mg/kg 2-aminofluorene dose (p = 0.0013) but 2-fold higher following a 100 mg/kg 2-aminofluorene dose (p < 0.0001). These results show a specific and significant role for NAT2 acetylator genotype in formation of arylamine-hemoglobin adducts, which may reflect the relationship between acetylator genotype and the incidence of different cancers from arylamine exposures. PMID:8291051

  18. Exposure to the chlorofluorocarbon substitute 2,2-dichloro-1,1,1- trifluoroethane and the anesthetic agent halothane is associated with transient protein adduct formation in the heart

    SciTech Connect

    Huwyler, J.; Gut, J. )

    1992-05-15

    Hydrochlorofluorocarbons (HCFCs) that are structural analogues of the anesthetic agent halothane may follow a common pathway of bioactivation and formation of adducts to cellular targets of distinct tissues. Exposure of rats to a single dose of HCFC 123 (2,2-dichloro- 1,1,1-trifluoroethane) or its structural analogue halothane (2-bromo-2-chloro-1,1,1-trifluoroethane) in vivo resulted in the formation of one prominent trifluoroacetylated protein adduct (TFA-protein adduct) in the heart. In contrast, a variety of distinct TFA-protein adducts were formed in the liver and the kidney of the same animals. The TFA-protein adduct in the heart was processed rapidly; t1/2 of the intact TFA-protein adduct was less than 12 h.

  19. Metabolism of methyleugenol in liver microsomes and primary hepatocytes: pattern of metabolites, cytotoxicity, and DNA-adduct formation.

    PubMed

    Cartus, Alexander T; Herrmann, Kristin; Weishaupt, Lucas W; Merz, Karl-Heinz; Engst, Wolfram; Glatt, Hansruedi; Schrenk, Dieter

    2012-09-01

    Methyleugenol (1) is a constituent of many foods, in particular of herbal spices, and is used as flavoring agent in foodstuffs and as fragrance in cosmetics. 1 has been found to be carcinogenic in rodents, its metabolite, 1-hydroxymethyleugenol (2) acting as proximate DNA-binding carcinogen. We incubated 1 with liver microsomes of rat, bovine, and human origin. We found 2, 3-hydroxymethylisoeugenol (3), and 6-hydroxymethyleugenol (4) as major metabolites, and 1-oxomethyleugenol (5), 3-oxomethylisoeugenol (6), eugenol (9), chavibetol (11), and (RS)-2,3-dihydroxy-2,3-dihydromethyleugenol (7) as minor metabolites. Methyleugenol-2,3-epoxide (8), probably the precursor of 7, could not be detected. Incubations with synthetic metabolites were applied in order to uncover metabolic pathways. Incubations with primary rat hepatocytes revealed mainly nonconjugated 2 and conjugated 4, and minor amounts of partly conjugated 7 and conjugated 9 + 11. The "reactive metabolites" 3, 5, 6, and 8 were not detectable, possibly due to rapid reaction with cellular macromolecules. The highest cytotoxicity (resazurin reduction assay and lactate dehydrogenase leakage assay) was observed for the main metabolite 2 and its secondary metabolite 5 with EC(50) values of 50 and 10 µM, respectively. Deoxyadenosine or deoxyguanosine adducts were formed by incubating 1 or metabolites with rat hepatocytes. The rank order of adduct formation was 2 > 1 > 3 > 6, whereas 4, 5, and 8 were inactive. In conclusion, we present a virtually complete pattern of microsomal (rat, bovine, and human) and hepatocellular (rat) metabolites of 1 suggesting the formation of several reactive metabolites possibly involved in carcinogenicity, organ toxicity, and immune reactions. PMID:22610610

  20. Prediction of treatment outcome by cisplatin-DNA adduct formation in patients with stage III/IV head and neck squamous cell carcinoma, treated by concurrent cisplatin-radiation (RADPLAT).

    PubMed

    Hoebers, Frank J P; Pluim, Dick; Verheij, Marcel; Balm, Alfons J M; Bartelink, Harry; Schellens, Jan H M; Begg, Adrian C

    2006-08-15

    The purpose of our study was to test the predictive value of cisplatin-DNA adduct levels in head and neck squamous cell carcinoma (HNSCC) patients treated with cisplatin-radiation. Patients with advanced-stage HNSCC were treated within a randomized trial, investigating the optimal route of cisplatin administration, concurrently with radiation. Cisplatin was administered intra-arterially (IA, 150 mg/m2, with systemic rescue by sodium thiosulfate) or intravenously (IV, 100 mg/m2). In a subgroup, adducts were quantified in normal tissue and tumor. 32P-postlabeling was used to quantify intrastrand guanosine-guanosine adducts (GG-adducts) and adenosine-guanosine adducts (AG-adducts). Adduct levels were correlated with treatment outcome. Thirty-five patients were included (21 IV and 14 IA). At median follow-up of 27 months, locoregional (LR) control was 75% at 1 and 70% at 2 years. Adduct levels in tumor were 4-5-fold higher than in white blood cells (WBC) for both IA and IV treatment (p = 0.01). Adduct formation in WBC and buccal cells was higher in IV treated patients compared with IA infusion (p = 0.049 and 0.005 for GG-adducts in WBC and buccal cells, respectively). Adducts in tumors after IA infusion were not statistically different from those after IV. A strong correlation was observed between GG- and AG-adduct formation (r = 0.86, p < 0.001). Patients with higher GG adduct levels (>median) in primary tumor had significantly better disease free survival (DFS) than patients with lower (< or = median) adduct levels (p = 0.02). For overall survival (OS), a nonsignificant trend was observed, again in favor of patients with higher adduct levels (p = 0.06). In conclusion, cisplatin-DNA adduct formation in primary tumor appears to be predictive for DFS in HNSCC. No differences were observed in intratumoral adduct levels between IA and IV treatments, despite selective infusion of high-dose cisplatin with the IA procedure. However, systemic adduct levels (WBC and buccal

  1. STUDIES ON THE METABOLISM OF 6-NITROCHRYSENE AND THE FORMATION OF DNA ADDUCTS IN THE LIVER, LUNG AND BLADDER OF A/J MICE

    EPA Science Inventory

    /
    Studies On The Metabolism of 6-Nitrochrysene and The Formation of DNA Adducts in the Liver, Lung and Bladder ofAJJ Mice
    Moses McDaniel*, Linda Adamst, Joycelyn Allisont, Michael George"l", Dhimant Desai+, 5hantu Amin+, Guy Lambertt, William Padgettt, Stephen Nesnowt and...

  2. AN EVALUATION OF THE MUTAGENICITY, METABOLISM AND DNA ADDUCT FORMATION OF 5-NITROBENZO[B]NAPHTHO[2,1-D]THIOPHENE

    EPA Science Inventory

    An Evaluation of the Mutagenicity, Metabolism and DNA Adduct Formation of 5-Nitrobenzo[b ]naphtho[2, I-d]thiophene

    Thioarenes, sulfur containing polycyclic aromatic compounds, are environmental contaminants suspected of posing human health risks. In this study, 5-nitroben...

  3. Application of Thio-Ugi Adducts for the Preparation of Benzo[b]thiophene and S-Heterocycle Library via Copper Catalyzed Intramolecular C-S Bond Formation.

    PubMed

    Kim, Yong-Sang; Kwak, Se Hun; Gong, Young-Dae

    2015-06-01

    Fused heterocycles, such as benzo[b]thiophene, thiochroman, benzo[b][1,4]thiazine, and 1,4-benzothiazepine were generated from thio-Ugi adducts containing a thioamide group through copper-catalyzed intramolecular C-S bond formation under microwave irradiation. PMID:25961783

  4. INTERSPECIES COMPARISONS OF BENZO(A)PYRENE METABOLISM AND DNA-ADDUCT FORMATION IN CULTURED HUMAN AND ANIMAL BLADDER AND TRACHEOBRONCHIAL TISSUES

    EPA Science Inventory

    Cultured bladder and tracheobronchial explants from human, monkey, dog, hamster, and rat were used to study the metabolism, covalent binding to DNA, and DNA:adduct formation of (3H0benzo(a)pyrene (BP). Both organs from all species formed large amounts (40 to 70% of total 3H in th...

  5. Evidence for adduct formation at the semiconductor-solution interface. Photoluminescent properties of cadmium selenide in the presence of lanthanide. beta. -diketonate complexes

    SciTech Connect

    Murphy, C.J.; Ellis, A.B. )

    1990-04-05

    Photoluminescence (PL) measurements of etched, single-crystal n-CdSe demonstrate that the semiconductor surface engages in adduct formation with a family of lanthanide {beta}-diketonate complexes, Ln(fod){sub 3} (Ln = lanthanide; fod = 6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedionato anion), in isooctane ambient.

  6. 2-Methoxyethanol metabolism, embryonic distribution, and macromolecular adduct formation in the rat: the effect of radiofrequency radiation-induced hyperthermia.

    PubMed

    Cheever, K L; Swearengin, T F; Edwards, R M; Nelson, B K; Werren, D W; Conover, D L; DeBord, D G

    2001-05-31

    Exposure of pregnant rats to the solvent 2-methoxyethanol (2ME) and radiofrequency (RF) radiation results in greater than additive fetal malformations (Nelson, B.K., Conover, D.L., Brightwell, W.S., Shaw, P.B., Werren, D.W., Edwards, R.M., Lary, J.M., 1991. Marked increase in the teratogenicity of the combined administration of the industrial solvent 2-methoxyethanol and radiofrequency radiation in rats. Teratology 43, 621-34; Nelson, B.K., Conover, D.L., Shaw, P.B., Werren, D.W., Edwards, R.M., Hoberman, A.M., 1994. Interactive developmental toxicity of radiofrequency radiation and 2-methoxyethanol in rats. Teratology 50, 275-93). The current study evaluated the metabolism of 14C-labeled 2ME and the distribution of methoxyacetic acid (MAA) in maternal and embryonic tissues of pregnant Sprague-Dawley rats either exposed to 10 MHz RF radiation or sham conditions. Additionally, adduct formation for both plasma and embryonic protein was tested as a possible biomarker for the observed 2ME/RF teratogenicity. Rats were administered [ethanol-1,2-(14)C]-2ME (150 mg/kg, 161 microCi/rat average) by gavage on gestation day 13 immediately before RF radiation sufficient to elevate body temperature to 42 degrees C for 30 min. Concurrent sham- and RF-exposed rats were sacrificed at 3, 6, 24 or 48 h for harvest of maternal blood, urine, embryos and extra-embryonic fluid. Tissues were either digested for determination of radioactivity or deproteinized with TCA and analyzed by HPLC for quantification of 2ME metabolites. Results show the presence of 2ME and seven metabolites, with the major metabolite, MAA, peaking at 6 h in the tissues tested. MAA, the proximal teratogen, was detectable in maternal serum, urine, embryo and extraembryonic fluid 48 h after dosing. Clearance of total body 14C was significantly reduced for the RF-exposed animals (P<0.05) for the 24-48 h period, but MAA values for serum, embryos and extraembryonic fluid were similar for both sham- and RF-exposed rats

  7. Induction of cytochromes P450 1A1 and 1A2 suppresses formation of DNA adducts by carcinogenic aristolochic acid I in rats in vivo

    PubMed Central

    Dračínská, Helena; Bárta, František; Levová, Kateřina; Hudecová, Alena; Moserová, Michaela; Schmeiser, Heinz H.; Kopka, Klaus; Frei, Eva; Arlt, Volker M.; Stiborová, Marie

    2016-01-01

    Aristolochic acid I (AAI) is a natural plant alkaloid causing aristolochic acid nephropathy, Balkan endemic nephropathy and their associated urothelial malignancies. One of the most efficient enzymes reductively activating AAI to species forming AAI-DNA adducts is cytosolic NAD(P)H:quinone oxidoreductase 1. AAI is also either reductively activated or oxidatively detoxified to 8-hydroxyaristolochic acid (AAIa) by microsomal cytochrome P450 (CYP) 1A1 and 1A2. Here, we investigated which of these two opposing CYP1A1/2-catalyzed reactions prevails in AAI metabolism in vivo. The formation of AAI-DNA adducts was analyzed in liver, kidney and lung of rats treated with AAI, Sudan I, a potent inducer of CYP1A1/2, or AAI after pretreatment with Sudan I. Compared to rats treated with AAI alone, levels of AAI-DNA adducts determined by the 32P-postlabeling method were lower in liver, kidney and lung of rats treated with AAI after Sudan I. The induction of CYP1A1/2 by Sudan I increased AAI detoxification to its O-demethylated metabolite AAIa, thereby reducing the actual amount of AAI available for reductive activation. This subsequently resulted in lower AAI-DNA adduct levels in the rat in vivo. Our results demonstrate that CYP1A1/2-mediated oxidative detoxification of AAI is the predominant role of these enzymes in rats in vivo, thereby suppressing levels of AAI-DNA adducts. PMID:26845733

  8. Absence of formation of benzo[a]pyrene/DNA adducts in the cuttlefish (Sepia officinalis, Mollusca: Cephalopoda)

    SciTech Connect

    Lee, P.G.; Lu, L.J.W.; Salazar, J.J.; Holoubek, V. )

    1994-01-01

    Benzo[a]pyrene (B[a]P) injected intramuscularly into the base of the arms of cuttlefish was released continuously from the injection site and removed from the organism. Only a portion of the compound accumulated in the body. Twenty-four hr after its injection, 75% of B[a]P applied in olive oil was removed from the cuttlefish, and 1.2% was found in the body outside the head, in site of injection. If the carcinogen was dissolved in dimethylformamide, the removal of B[a]P was slower, so that only 18% of the injected B[a]P was removed from the organism and 0.36% accumulated in the body outside the head 24 hr after injection. The high level of B[a]P in gills and hemolymph 4 hr after injection and the kinetics of the decrease of its concentration with time indicate that these two organs could be involved in the excretion of B[a]P from the body. The B[a]P/DNA adducts characteristic for vertebrates could not be demonstrated in gills, skin, brain, hepatopancreas, and lymphocytes of the cuttlefish 24 hr after injection. The dose of the carcinogene injected into the cuttlefish was 2-4 times higher than the dose resulting in the formation of a high level of B[a]P/DNA adducts in vertebrates. A different metabolism of B[a]P in the tissue of cephalopods, compared to vertebrates, could be less favorable to the process leading to malignant transformation and could explain the absence from the literature of reports of tumors in cephalopods. 15 refs., 1 fig., 2 tabs.

  9. Chemical-Biological Properties of Zinc Sensors TSQ and Zinquin: Formation of Sensor-Zn-Protein Adducts versus Zn(Sensor)2 Complexes.

    PubMed

    Nowakowski, Andrew B; Meeusen, Jeffrey W; Menden, Heather; Tomasiewicz, Henry; Petering, David H

    2015-12-21

    Fluorescent zinc sensors are the most commonly used tool to study the intracellular mobile zinc status within cellular systems. Previously, we have shown that the quinoline-based sensors Zinquin and 6-methoxy-8-p-toluenesulfonamido-quinoline (TSQ) predominantly form ternary adducts with members of the Zn-proteome. Here, the chemistries of these sensors are further characterized, including how Zn(sensor)2 complexes may react in an intracellular environment. We demonstrate that these sensors are typically used in higher concentrations than needed to obtain maximum signal. Exposing cells to either Zn(Zinquin)2 or Zn(TSQ)2 resulted in efficient cellular uptake and the formation of sensor-Zn-protein adducts as evidenced by both a fluorescence spectral shift toward that of ternary adducts and the localization of the fluorescence signal within the proteome after gel filtration of cellular lysates. Likewise, reacting Zn(sensor)2 with the Zn-proteome from LLC-PK1 cells resulted in the formation of sensor-Zn-protein ternary adducts that could be inhibited by first saturating the Zn- proteome with excess sensor. Further, a native SDS-PAGE analysis of the Zn-proteome reacted with either the sensor or the Zn(sensor)2 complex revealed that both reactions result in the formation of a similar set of sensor-Zn-protein fluorescent products. The results of this experiment also demonstrated that TSQ and Zinquin react with different members of the Zn-proteome. Reactions with the model apo-Zn-protein bovine serum albumin showed that both Zn(TSQ)2 and Zn(Zinquin)2 reacted to form ternary adducts with its apo-Zn-binding site. Moreover, incubating Zn(sensor)2 complexes with non-zinc binding proteins failed to elicit a spectral shift in the fluorescence spectrum, supporting the premise that blue-shifted emission spectra are due to sensor-Zn-protein ternary adducts. It was concluded that Zn(sensors)2 species do not play a significant role in the overall reaction between these sensors and

  10. Chromium (VI) potentiates the DNA adducts (O(6)-methylguanine) formation of N-nitrosodimethylamine in rat: implication on carcinogenic risk.

    PubMed

    Ma, Fujun; Zhang, Zhaobin; Jiang, Jieqiong; Hu, Jianying

    2015-11-01

    Chromium (VI) [Cr(VI)] and nitrosamines such as N-nitrosodimethylamine (NDMA) exist commonly in the environment. To evaluate the potential influence of Cr(VI) co-exposure on the carcinogenic risk of NDMA, Female Wistar rats were treated with various concentrations of Cr(VI) and/or NDMA via drinking water for 15days and the DNA adducts (O(6)-methylguanine, O(6)-MeG) of NDMA in liver tissue was used as a bioindicator. The results showed that Cr(VI) synergistically enhanced the O(6)-MeG formation, which could lead to an increase in DNA damage and carcinogenic potential. Although Cr(VI) did not alter the CYP 2E1 enzyme activity, it decreased GSH content, which would be an potential mechanism for the potentiated O(6)-MeG formation by Cr(VI) co-exposure. These results would contribute to the development of quantitative risk assessment of NDMA or even for a group of nitrosamines under environmental mixture exposure. PMID:26143543

  11. Alcohol, Aldehydes, Adducts and Airways

    PubMed Central

    Sapkota, Muna; Wyatt, Todd A.

    2015-01-01

    Drinking alcohol and smoking cigarettes results in the formation of reactive aldehydes in the lung, which are capable of forming adducts with several proteins and DNA. Acetaldehyde and malondialdehyde are the major aldehydes generated in high levels in the lung of subjects with alcohol use disorder who smoke cigarettes. In addition to the above aldehydes, several other aldehydes like 4-hydroxynonenal, formaldehyde and acrolein are also detected in the lung due to exposure to toxic gases, vapors and chemicals. These aldehydes react with nucleophilic targets in cells such as DNA, lipids and proteins to form both stable and unstable adducts. This adduction may disturb cellular functions as well as damage proteins, nucleic acids and lipids. Among several adducts formed in the lung, malondialdehyde DNA (MDA-DNA) adduct and hybrid malondialdehyde-acetaldehyde (MAA) protein adducts have been shown to initiate several pathological conditions in the lung. MDA-DNA adducts are pre-mutagenic in mammalian cells and induce frame shift and base-pair substitution mutations, whereas MAA protein adducts have been shown to induce inflammation and inhibit wound healing. This review provides an insight into different reactive aldehyde adducts and their role in the pathogenesis of lung disease. PMID:26556381

  12. Alcohol, Aldehydes, Adducts and Airways.

    PubMed

    Sapkota, Muna; Wyatt, Todd A

    2015-01-01

    Drinking alcohol and smoking cigarettes results in the formation of reactive aldehydes in the lung, which are capable of forming adducts with several proteins and DNA. Acetaldehyde and malondialdehyde are the major aldehydes generated in high levels in the lung of subjects with alcohol use disorder who smoke cigarettes. In addition to the above aldehydes, several other aldehydes like 4-hydroxynonenal, formaldehyde and acrolein are also detected in the lung due to exposure to toxic gases, vapors and chemicals. These aldehydes react with nucleophilic targets in cells such as DNA, lipids and proteins to form both stable and unstable adducts. This adduction may disturb cellular functions as well as damage proteins, nucleic acids and lipids. Among several adducts formed in the lung, malondialdehyde DNA (MDA-DNA) adduct and hybrid malondialdehyde-acetaldehyde (MAA) protein adducts have been shown to initiate several pathological conditions in the lung. MDA-DNA adducts are pre-mutagenic in mammalian cells and induce frame shift and base-pair substitution mutations, whereas MAA protein adducts have been shown to induce inflammation and inhibit wound healing. This review provides an insight into different reactive aldehyde adducts and their role in the pathogenesis of lung disease. PMID:26556381

  13. DNA binding and adduct formation of 7,12-dimethylbenz(a)-anthracene by rat mammary epithelial cell aggregates in vitro

    SciTech Connect

    Singletary, K.W.; Milner, J.A.

    1986-01-01

    Freshly isolated mammary epithelial cell aggregates from female Sprague-Dawley rats metabolized 7,12-dimethylbenz-(a)anthracene (DMBA) to bay-region anti- and syn-dihydrodiolepoxides that bound to deoxyguanosine and deoxyadenosine residues in cellular DNA. After 24 h of incubation 68% of the DMBA (0.4 micrograms/ml) was metabolized and 58% of the extracellular metabolites were water-soluble. DMBA-DNA binding increased rapidly during the initial 24 h of incubation. Formation of the bay-region syn-dihydrodiolepoxide:deoxyadenosine adduct increased linearly throughout the 24 h, whereas formation of deoxyadenosine and deoxyguanosine adducts with the bay-region anti-dihydrodiolepoxide increased rapidly following a delay of 12 h.

  14. DNA Adduct Formation from Metabolic 5'-Hydroxylation of the Tobacco-Specific Carcinogen N'-Nitrosonornicotine in Human Enzyme Systems and in Rats.

    PubMed

    Zarth, Adam T; Upadhyaya, Pramod; Yang, Jing; Hecht, Stephen S

    2016-03-21

    N'-Nitrosonornicotine (NNN) is carcinogenic in multiple animal models and has been evaluated as a human carcinogen. NNN can be metabolized by cytochrome P450s through two activation pathways: 2'-hydroxylation and 5'-hydroxylation. While most previous studies have focused on 2'-hydroxylation in target tissues of rats, available evidence suggests that 5'-hydroxylation is a major activation pathway in human enzyme systems, in nonhuman primates, and in target tissues of some other rodent carcinogenicity models. In the study reported here, we investigated DNA damage resulting from NNN 5'-hydroxylation by quantifying the adduct 2-(2-(3-pyridyl)-N-pyrrolidinyl)-2'-deoxyinosine (py-py-dI). In rats treated with NNN in the drinking water (7-500 ppm), py-py-dI was the major DNA adduct resulting from 5'-hydroxylation of NNN in vivo. Levels of py-py-dI in the lung and nasal cavity were the highest, consistent with the tissue distribution of CYP2A3. In rats treated with (S)-NNN or (R)-NNN, the ratios of formation of (R)-py-py-dI to (S)-py-py-dI were not the expected mirror image, suggesting that there may be a carrier for one of the unstable intermediates formed upon 5'-hydroxylation of NNN. Rat hepatocytes treated with (S)- or (R)-NNN or (2'S)- or (2'R)-5'-acetoxyNNN exhibited a pattern of adduct formation similar to that of live rats. In vitro studies with human liver S9 fraction or human hepatocytes incubated with NNN (2-500 μM) demonstrated that py-py-dI formation was greater than the formation of pyridyloxobutyl-DNA adducts resulting from 2'-hydroxylation of NNN. (S)-NNN formed more total py-py-dI adducts than (R)-NNN in human liver enzyme systems, which is consistent with the critical role of CYP2A6 in the 5'-hydroxylation of NNN in human liver. The results of this study demonstrate that the major DNA adduct resulting from NNN metabolism by human enzymes is py-py-dI and provide potentially important new insights into the metabolic activation of NNN in rodents and humans

  15. FORMATION OF HEMOGLOBIN AND ALBUMIN ADDUCTS OF BENZENE OXIDE IN MOUSE, RAT, AND HUMAN BLOOD

    EPA Science Inventory

    Little is known about the formation and disposition of benzene oxide (BO), the initial metabolite arising from oxidation of benzene by cytochrome P450. In this study, reactions of BO with hemoglobin (Hb) and albumin (Alb) were investigated in blood from B6C3F1 mice, F344 rats, ...

  16. Formation of cyclic 1,N2-propanodeoxyguanosine and thymidine adducts in the reaction of the mutagen 2-bromoacrolein with calf thymus DNA

    SciTech Connect

    Meerman, J.H.; Smith, T.R.; Pearson, P.G.; Meier, G.P.; Nelson, S.D. )

    1989-11-15

    The interaction of the mutagen 2-bromoacrolein (2BA) with DNA and thymidine was studied in vitro by reaction of (3-3H)2BA with thymidine, RNA, single-stranded DNA, and double-stranded DNA in phosphate buffer (pH 7.4). After purification of the nucleic acids, they were incubated at alkaline pH to convert any (hydroxybromo)propano(deoxy)-guanosine adducts to their dihydroxy analogues. After acid or enzymatic hydrolysis, the hydrolysates were analyzed by reversed-phase high-performance liquid chromatography. At a concentration of 1.6 mM, the fraction of 2BA that became covalently bound to DNA was 2.3% of the amount added. Only 3% of the radioactivity bound to DNA after extensive purification could be accounted for as cyclic 1,N2-(6,7-dihydroxy)-propanoguanine adducts. More 2BA became covalently bound to single-stranded DNA and RNA as compared with double-stranded DNA. However, high-performance liquid chromatographic analyses showed that formation of cyclic 1,N2-(6,7-dihydroxy)propanoguanine adducts was also a minor reaction with these macromolecules. Because these data showed that other type(s) of reaction(s) are more important in the reaction of 2BA with nucleic acids, we have investigated the reaction of 2BA with other nucleosides. It was found that 2BA reacted well with thymidine in vitro, and the major product was identified by 500 MHz 1H and 75.43 MHz 13C nuclear magnetic resonance and thermospray mass spectrometry as 3-(2-bromo-3-oxopropyl)thymidine. This adduct was unstable and decomposed upon storage. After enzymatic hydrolysis of (3H)2BA-modified double-stranded DNA and subsequent analysis of the hydrolysate by high-performance liquid chromatography, 22% of the covalently bound radioactivity to DNA coeluted with decomposition products of the 3-(bromooxypropyl)thymidine adduct.

  17. Inhibition of aryl hydrocarbon receptor transactivation and DNA adduct formation by CYP1 isoform-selective metabolic deactivation of benzo[a]pyrene

    SciTech Connect

    Endo, Kaori; Uno, Shigeyuki; Seki, Taiichiro; Ariga, Toyohiko; Kusumi, Yoshiaki; Mitsumata, Masako; Yamada, Sachiko; Makishima, Makoto

    2008-07-15

    Benzo[a]pyrene (BaP), a polyaromatic hydrocarbon produced by the combustion of cigarettes and coke ovens, is a known procarcinogen. BaP activates the aryl hydrocarbon receptor (AhR) and induces the expression of a battery of genes, including CYP1A1, which metabolize BaP to toxic compounds. The possible role of CYP1 enzymes in mediating BaP detoxification or metabolic activation remains to be elucidated. In this study, we assessed the effects of CYP1 enzymes (CYP1A1, CYP1A2 and CYP1B1) on BaP-induced AhR transactivation and DNA adduct formation in HEK293 cells and HepG2 cells. Transfection of CYP1A1 and CYP1B1, but not CYP1A2, suppressed BaP-induced activation of AhR. Expression of CYP1A1 and CYP1A2, but not CYP1B1, inhibited DNA adduct formation in BaP-treated HepG2 cells. These results indicate that CYP1A1 and CYP1B1 play a role in deactivation of BaP on AhR and that CYP1A1 and CYP1A2 are involved in BaP detoxification by suppressing DNA adduct formation. BaP treatment did not induce DNA adduct formation in HEK293 cells, even after transfection of CYP1 enzymes, suggesting that expression of CYP1 enzymes is not sufficient for DNA adduct formation. Lower expression of epoxide hydrolase and higher expression of glutathione S-transferase P1 (GSTP1) and GSTM1/M2 were observed in HEK293 cells compared with HepG2 cells. Dynamic expression of CYP1A1, CYP1A2 and CYP1B1 along with expression of other enzymes such as epoxide hydrolase and phase II enzymes may determine the detoxification or metabolic activation of BaP.

  18. Inhibition of the formation of benzo[a]pyrene adducts to DNA in A549 lung cells exposed to mixtures of polycyclic aromatic hydrocarbons.

    PubMed

    Genies, Camille; Jullien, Amandine; Lefebvre, Emmanuel; Revol, Morgane; Maitre, Anne; Douki, Thierry

    2016-09-01

    Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous pollutants, which exhibit carcinogenic properties especially in lungs. In the present work, we studied the effect of mixtures of 12 PAHs on the A549 alveolar cells. We first assess the ability of each PAH at inducing gene expression of phase I metabolization enzymes and at generating DNA adducts. A good correlation was found between these two endpoints. We then exposed cells to either binary mixtures of the highly genotoxic benzo[a]pyrene (B[a]P) with each PAH or complex mixtures of all studied PAHs mimicking by real emissions including combustion of wood, cigarette smoke, and atmospheres of garage, silicon factory and urban environments. Compared to pure B[a]P, both types of mixtures led to reduced CYP450 activity measured by the EROD test. A similar trend was observed for the formation of DNA adducts. Surprisingly, the complex mixtures were more potent than B[a]P used at the same concentration for the induction of genes coding for CYP. Our results stress the lack of additivity of the genotoxic properties of PAH in mixtures. Interestingly, an opposite synergy in the formation of B[a]P adducts were observed previously in hepatocytes. Our data also show that measurement of the metabolic activity rather than quantification of gene expression reflects the actual bioactivation of PAHs into DNA damaging species. PMID:27196671

  19. Cytochrome P4501A induction and DNA adduct formation in glaucous gulls (Larus hyperboreus), fed with environmentally contaminated gull eggs.

    PubMed

    Østby, Lene; Gabrielsen, Geir Wing; Krøkje, Ase

    2005-11-01

    This study indicates that complex mixtures of pollutants found in the Arctic marine environment have genotoxic effects in glaucous gulls (Larus hyperboreus). DNA adducts were quantified, by the (32)P-postlabeling technique, in liver samples from gulls fed with hen eggs (controls) and from gulls fed with environmentally contaminated gull eggs (exposed). All birds were grown and fed under laboratory conditions. Hepatic homologues to mammalian cytochrome P4501A (CYP1A) proteins were also determined by Western blotting. DNA adducts were detected in all but one liver sample, but the exposed birds had a significantly increased level of DNA adducts relative to that of the controls. There was no clear significant correlation between the DNA adduct level and the level of organochlorine compounds (OCs) in blood. The level of CYP1A protein was significantly higher in the liver of exposed male gulls than in the liver of control males and positively correlated, with significance, to the level of OC compounds measured in blood. There was no significant correlation between the level of DNA adducts and the CYP1A protein content. PMID:16216630

  20. Improvement in the diagnostic potential of (32)P-postlabeling analysis demonstrated by the selective formation and comparative analysis of nitrated-PAH-derived adducts arising from diesel-particle extracts

    SciTech Connect

    Gallagher, J.E.; Kohan, M.J.; George, M.H.; Lewtas, J.

    1991-01-01

    Studies suggest that DNA adducts derived from N-substituted aryl-compounds are poorly recovered in the nuclease P1 version of the (32)P-postlabeling assay but not the butanol extraction version. Both versions were employed to ascertain whether the differences in sensitivity could be used to select for nitroaromatic-DNA adducts derived by treating calf thymus DNA with organic extracts from four diesel and one gasoline vehicle emission particles. The authors' enhanced the formation of nitrated-PAH-derived adducts through xanthine oxidase-catalyzed nitroreduction of nitrated-polycyclic aromatic hydrocarbons; constituents previously detected in the diesel emissions. All four diesel organic extracts treated with xanthine oxidase resulted in the formation of one major DNA adduct chromatographically distinct from the multiple DNA adducts detected in the rat liver S9-treated incubations. The adduct was detectable with the butanol extraction but not the nuclease P1 version of the (32)P-postlabeling assay and was chromatographically similar to DNA adducts formed following xanthine oxidase nitroreduction of 1-nitropyrene or ascorbic acid treatment of 1-nitro-8-nitrosopyrene and 1-nitro-6-nitrosopyrene.

  1. Effects of epigallocatechin gallate, L-ascorbic acid, alpha-tocopherol, and dihydrolipoic acid on the formation of deoxyguanosine adducts derived from lipid peroxidation.

    PubMed

    Nath, Raghu G; Wu, Mona Y; Emami, Armaghan; Chung, Fung-Lung

    2010-01-01

    Oxidation of polyunsaturated fatty acids (PUFAs) releases alpha,beta-unsaturated aldehydes that modify deoxyguanosine (dG) to form cyclic 1,N(2)-propanodeoxyguanosine adducts. One of the major adducts detected in vivo is acrolein (Acr)-derived 1,N(2)-propanodeoxyguanosine (Acr-dG). We used a chemical model system to examine the effects of 4 antioxidants known to inhibit fatty acid oxidation on the formation of Acr-dG and 8-oxodeoxyguaonsine (8-oxodG) from the PUFA docosahexaenoic acid (DHA) under oxidative conditions. We found that epigallocatechin gallate (EGCG) and dihydrolipoic acid (DHLA) inhibit both Acr-dG and 8-oxodG formation. In contrast, ascorbic acid and alpha-tocopherol actually increase Acr-dG at high concentrations and do not show a concentration-dependant inhibition of 8-oxodG. We also studied their effects on blocking Acr-dG formation directly from Acr. EGCG and DHLA can both effectively block Acr-dG formation, but ascorbic acid and alpha-tocopherol show weak or little effect. These results highlight the complexity of antioxidant mechanisms and also reveal that EGCG and DHLA are effective at suppressing lipid peroxidation-induced Acr-dG and 8-oxodG formation as well as blocking the reaction of dG with Acr. PMID:20574923

  2. Carbanion reactivity, kinetic and equilibrium studies of sigma-adduct formation and elimination in the reactions of 4-nitrobenzofurazan derivatives with nitroalkane anions.

    PubMed

    Asghar, Basim H M; Crampton, Michael R

    2007-05-21

    1H NMR studies are reported of the reactions in [2H(6)]-DMSO of 4-nitrobenzofurazan, 2a, and its 7-chloro- and 7-methoxy-derivatives, 2b and 2c respectively, with anions derived from nitromethane, 3, nitroethane, 4, and 2-nitropropane, 5. The initial reactions result in sigma-adduct formation by carbanion attack at the 5-position of 2a-c and in the case of reaction of 2a with 5 the adduct at the 7-position is also observed. These reactions may be followed by base catalysed elimination of nitrous acid to yield anionic alkene derivatives. Kinetic and equilibrium measurements of these reactions were made spectrophotometrically in methanol. The carbon nucleophilicities of the carbanions decrease in the order 3> 4> 5, as also found in their reactions with benzhydrylium cations, and are much lower than the nucleophilicities of some cyano-substituted carbanions. Comparison with corresponding sigma-adduct forming reactions of 1,3,5-trinitrobenzene, TNB, show that here 2 and TNB have similar electrophilicity, although the value of the intrinsic rate coefficient k(o) = 0.05, for reaction of 2 is rather lower than that, k(o) = 0.20, for the TNB reactions. Literature data suggest that for reaction with a variety of nucleophiles 2 and TNB show similar electrophilicities. Measurements of the rates of elimination of nitrous acid from some 5-adducts in methanol catalysed by methoxide ions are reported. Values of rate constants may be influenced both by steric requirements at the reaction centre and by the electronic effects of the 7-substituent. PMID:17571196

  3. Cytochrome P450 system expression and DNA adduct formation in the liver of Zacco platypus following waterborne benzo(a)pyrene exposure: implications for biomarker determination.

    PubMed

    Lee, Jin Wuk; Kim, Yong Hwa; Yoon, Seokjoo; Lee, Sung Kyu

    2014-09-01

    Benzo(a)pyrene (BaP) is a polycyclic aromatic hydrocarbon that causes mutations and tumor formation. Zacco platypus is a sentinel species that is suitable for monitoring aquatic environments. We studied cytochrome P450 system (CYP system) expression and DNA adduct formation in the liver of Z. platypus following waterborne exposure to BaP. The results showed both dose and time dependency. The significant induction levels of CYP system mRNA and protein reached maximums at 2 days and 14 days, respectively, and hepatosomatic index was maximally induced at 4 days during 14 days BaP exposure. DNA adduct formation was significantly induced compared to corresponding controls (t-test, p < 0.01) after 4 days of exposure in 100 μg/L BaP. These results indicate that the only use of mRNA expression level of CYP system as a biomarker make us underestimate prolonged toxicity (4-14 days) of BaP and the only use of protein expression level of CYP system make us underestimate acute toxicity (1-2 days) of BaP. Therefore, we suggests that a combinational use of the mRNA expression level and protein expression level of CYP system, hepatosomatic index is a useful biomarker in risk assessment of waterborne BaP exposure. In addition, DNA adduct formation was a useful biomarker in risk assessment of waterborne BaP exposure at 4 days. CYP1A was a more sensitive biomarker than CYP reductase for BaP exposure when considering both the mRNA and protein level. Furthermore, our results show that Z. platypus is a useful species for assessing the risk of waterborne BaP exposure. PMID:23192953

  4. Metabolism of isoniazid by neutrophil myeloperoxidase leads to isoniazid-NAD(+) adduct formation: A comparison of the reactivity of isoniazid with its known human metabolites.

    PubMed

    Khan, Saifur R; Morgan, Andrew G M; Michail, Karim; Srivastava, Nutan; Whittal, Randy M; Aljuhani, Naif; Siraki, Arno G

    2016-04-15

    The formation of isonicotinyl-nicotinamide adenine dinucleotide (INH-NAD(+)) via the mycobacterial catalase-peroxidase enzyme, KatG, has been described as the major component of the mode of action of isoniazid (INH). However, there are numerous human peroxidases that may catalyze this reaction. The role of neutrophil myeloperoxidase (MPO) in INH-NAD(+) adduct formation has never been explored; this is important, as neutrophils are recruited at the site of tuberculosis infection (granuloma) through infected macrophages' cell death signals. In our studies, we showed that neutrophil MPO is capable of INH metabolism using electron paramagnetic resonance (EPR) spin-trapping and UV-Vis spectroscopy. MPO or activated human neutrophils (by phorbol myristate acetate) catalyzed the oxidation of INH and formed several free radical intermediates; the inclusion of superoxide dismutase revealed a carbon-centered radical which is considered to be the reactive metabolite that binds with NAD(+). Other human metabolites, including N-acetyl-INH, N-acetylhydrazine, and hydrazine did not show formation of carbon-centered radicals, and either produced no detectable free radicals, N-centered free radicals, or superoxide, respectively. A comparison of these free radical products indicated that only the carbon-centered radical from INH is reducing in nature, based on UV-Vis measurement of nitroblue tetrazolium reduction. Furthermore, only INH oxidation by MPO led to a new product (λmax=326nm) in the presence of NAD(+). This adduct was confirmed to be isonicotinyl-NAD(+) using LC-MS analysis where the intact adduct was detected (m/z=769). The findings of this study suggest that neutrophil MPO may also play a role in INH pharmacological activity. PMID:26867495

  5. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P

    1998-01-01

    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  6. DNA adduct formation in mice following dermal application of smoke condensates from cigarettes that burn or heat tobacco

    SciTech Connect

    Lee, C.K.; Brown, B.G.; Reed, E.A.; Mosberg, A.T.; Doolittle, D.J.; Hayes, A.W. ); Hejtmancik, M. )

    1992-01-01

    A prototype cigarette that heats tobacco (test cigarette), developed by R.J. Reynolds Tobacco Company, has yielded consistently negative results in several in vivo and in vitro genetic toxicology tests. The objective of the present study was to evaluate the potential of cigarette smoke condensate (CSC) from the test cigarette to induce DNA adducts in mouse tissues and compare the results with those obtained with CSC from a reference tobacco-burning cigarette (1R4F). CD-1 mice were skin-painted with CSF from reference and test cigarettes three times a week for 4 weeks. The highest mass of CSC applied was 180 mg tar per week per animal for both reference and test cigarette. DNA adducts were analyzed in skin and lung tissues using the [sup 32]P-postlabeling method with the P[sub 1] nuclease modification. Distinct diagonal radioactive zones (DRZ) were observed in the DNA from both skin and lung tissues of animals dosed with reference CSC, whereas no corresponding DRZ were observed from the DNA of animals dosed with either test CSC or acetone (solvent control). The relative adduct labeling (RAL) values of skin and lung DNA from reference CSC-treated animals were significantly greater than those of the test CSC-treated animals. The RAL values of the test CSC-treated animals were no greater than those of solvent controls. The negative results in DNA adduct assays with test CSC are consistent with all previous results of in vivo and in vitro genetic toxicology testing on this cigarette and provide additional evidence that smoke condensate from the test cigarette is not genotoxic. 31 refs., 4 figs., 2 tabs.

  7. Covalent Adduct Formation between the Antihypertensive Drug Hydralazine and Abasic Sites in Double- and Single-Stranded DNA

    PubMed Central

    2015-01-01

    Hydralazine (4) is an antihypertensive agent that displays both mutagenic and epigenetic properties. Here, gel electrophoretic, mass spectroscopic, and chemical kinetics methods were used to provide evidence that medicinally relevant concentrations of 4 rapidly form covalent adducts with abasic sites in double- and single-stranded DNA under physiological conditions. These findings raise the intriguing possibility that the genotoxic properties of this clinically used drug arise via reactions with an endogenous DNA lesion rather than with the canonical structure of DNA. PMID:25405892

  8. Competitive Deprotonation and Superoxide [O₂⁻•)] Radical-Anion Adduct Formation Reactions of Carboxamides under Negative-Ion Atmospheric-Pressure Helium-Plasma Ionization (HePI) Conditions.

    PubMed

    Hassan, Isra; Pinto, Spencer; Weisbecker, Carl; Attygalle, Athula B

    2016-03-01

    Carboxamides bearing an N-H functionality are known to undergo deprotonation under negative-ion-generating mass spectrometric conditions. Herein, we report that N-H bearing carboxamides with acidities lower than that of the hydroperoxyl radical (HO-O(•)) preferentially form superoxide radical-anion (O2(-•)) adducts, rather than deprotonate, when they are exposed to the glow discharge of a helium-plasma ionization source. For example, the spectra of N-alkylacetamides show peaks for superoxide radical-anion (O2(-•)) adducts. Conversely, more acidic amides, such as N-alkyltrifluoroacetamides, preferentially undergo deprotonation under similar experimental conditions. Upon collisional activation, the O2(-•) adducts of N-alkylacetamides either lose the neutral amide or the hydroperoxyl radical (HO-O(•)) to generate the superoxide radical-anion (m/z 32) or the deprotonated amide [m/z (M - H)(-)], respectively. For somewhat acidic carboxamides, the association between the two entities is weak. Thus, upon mildest collisional activation, the adduct dissociates to eject the superoxide anion. Superoxide-adduct formation results are useful for structure determination purposes because carboxamides devoid of a N-H functionality undergo neither deprotonation nor adduct formation under HePI conditions. PMID:26545766

  9. Competitive Deprotonation and Superoxide [O2 -•] Radical-Anion Adduct Formation Reactions of Carboxamides under Negative-Ion Atmospheric-Pressure Helium-Plasma Ionization (HePI) Conditions

    NASA Astrophysics Data System (ADS)

    Hassan, Isra; Pinto, Spencer; Weisbecker, Carl; Attygalle, Athula B.

    2016-03-01

    Carboxamides bearing an N-H functionality are known to undergo deprotonation under negative-ion-generating mass spectrometric conditions. Herein, we report that N-H bearing carboxamides with acidities lower than that of the hydroperoxyl radical (HO-O•) preferentially form superoxide radical-anion (O2 -•) adducts, rather than deprotonate, when they are exposed to the glow discharge of a helium-plasma ionization source. For example, the spectra of N-alkylacetamides show peaks for superoxide radical-anion (O2 -•) adducts. Conversely, more acidic amides, such as N-alkyltrifluoroacetamides, preferentially undergo deprotonation under similar experimental conditions. Upon collisional activation, the O2 -• adducts of N-alkylacetamides either lose the neutral amide or the hydroperoxyl radical (HO-O•) to generate the superoxide radical-anion ( m/z 32) or the deprotonated amide [ m/z (M - H)-], respectively. For somewhat acidic carboxamides, the association between the two entities is weak. Thus, upon mildest collisional activation, the adduct dissociates to eject the superoxide anion. Superoxide-adduct formation results are useful for structure determination purposes because carboxamides devoid of a N-H functionality undergo neither deprotonation nor adduct formation under HePI conditions.

  10. Isolevuglandin Adducts in Disease

    PubMed Central

    Bi, Wenzhao

    2015-01-01

    Abstract Significance: A diverse family of lipid-derived levulinaldehydes, isolevuglandins (isoLGs), is produced by rearrangement of endoperoxide intermediates generated through both cyclooxygenase (COX) and free radical-induced cyclooxygenation of polyunsaturated fatty acids and their phospholipid esters. The formation and reactions of isoLGs with other biomolecules has been linked to alcoholic liver disease, Alzheimer's disease, age-related macular degeneration, atherosclerosis, cardiac arythmias, cancer, end-stage renal disease, glaucoma, inflammation of allergies and infection, mitochondrial dysfunction, multiple sclerosis, and thrombosis. This review chronicles progress in understanding the chemistry of isoLGs, detecting their production in vivo and understanding their biological consequences. Critical Issues: IsoLGs have never been isolated from biological sources, because they form adducts with primary amino groups of other biomolecules within seconds. Chemical synthesis enabled investigation of isoLG chemistry and detection of isoLG adducts present in vivo. Recent Advances: The first peptide mapping and sequencing of an isoLG-modified protein present in human retina identified the modification of a specific lysyl residue of the sterol C27-hydroxylase Cyp27A1. This residue is preferentially modified by iso[4]LGE2 in vitro, causing loss of function. Adduction of less than one equivalent of isoLG can induce COX-associated oligomerization of the amyloid peptide Aβ1-42. Adduction of isoLGE2 to phosphatidylethanolamines causes gain of function, converting them into proinflammatory isoLGE2-PE agonists that foster monocyte adhesion to endothelial cells. Future Directions: Among the remaining questions on the biochemistry of isoLGs are the dependence of biological activity on isoLG isomer structure, the structures and mechanism of isoLG-derived protein–protein and DNA–protein cross-link formation, and its biological consequences. Antioxid. Redox Signal. 22

  11. Formation of S-Cl phosphorothioate adduct radicals in dsDNA-S-oligomers: Hole transfer to guanine vs. disulfide anion radical formation

    PubMed Central

    Adhikary, Amitava; Kumar, Anil; Palmer, Brian J.; Todd, Andrew D.; Sevilla, Michael D.

    2013-01-01

    In phosphorothioate containing dsDNA-oligomers (S-oligomers), one of the two non-bridging oxygen atoms in the phosphate moiety of sugar-phosphate backbone is replaced by sulphur. In this work, electron spin resonance (ESR) studies of one-electron oxidation of several S-oligos by Cl2•− at low temperatures are investigated. Electrophilic addition of Cl2•− to phosphorothioate with elimination of Cl− leads to the formation of a 2-center three-electron σ2σ*1 bonded adduct radical (-P-S∸Cl). In AT S-oligomers with mutiple phosphorothioates, i.e., d[ATATAsTsAsT]2, -P-S∸Cl reacts with a neighboring phosphorothioate to form the σ2σ*1 bonded disulphide anion radical ([-P-S∸S-P-]−). With AT S-oligomers with a single phosphorothioate, i.e., d[ATTTAsAAT]2, reduced levels of conversion of -P-S∸Cl dsDNA [-P-S∸S-P-]− are found. For guanine containing S-oligomers containing one phosphorothioate, -P-S∸Cl results in one-electron oxidation of guanine base but not of A, C, or T thereby leading to selective hole transfer to G. The redox potential of -P-S∸Cl is thus higher than that of G but is lower than those of A, C, and T. Spectral assignments to -P-S∸Cl and [-P-S∸S-P-]− are based on reaction of Cl2•− with the model compound diisopropyl phosphorothioate. The results found for d[TGCGsCsGCGCA]2 suggest that [-P-S∸S-P-]− undergoes electron transfer to the one-electron oxidized G healing the base but producing a cyclic disulfide bonded backbone with a substantial bond strength (50 kcal/mol). Formation of -P-S∸Cl and its conversion to [-P-S∸S-P-]− is found to be unaffected by O2 and this is supported by the theoretically calculated electron affinities and reduction potentials of [-P-S-S-P-] and O2. PMID:23885974

  12. DNA ADDUCTS OF THE ANTITUMOR AGENT DIAZIQUONE

    EPA Science Inventory

    We have studied adduct formation of the antineoplastic agent diaziquone with DNA and nucleotides in vitro. he aziridine moieties of AZQ can be expected to interact covalently with DNA which in turn presumably elicit the antitumor activity. e analyzed AZQ-DNA adducts by a modified...

  13. Formation of DNA adducts in wild-type and transgenic mice expressing human sulfotransferases 1A1 and 1A2 after oral exposure to furfuryl alcohol

    PubMed Central

    Høie, Anja Hortemo; Monien, Bernhard Hans; Sakhi, Amrit Kaur; Glatt, Hansruedi; Hjertholm, Hege; Husøy, Trine

    2015-01-01

    Furfuryl alcohol (FFA) is present in many heat-treated foods as a result of its formation via dehydration of pentoses. It is also used legally as a flavouring agent. In an inhalation study conducted in the National Toxicology Program, FFA showed some evidence of carcinogenic activity in rats and mice. FFA was generally negative in conventional genotoxicity assays, which suggests that it may be a non-genotoxic carcinogen. However, it was recently found that FFA is mutagenic in Salmonella strains expressing appropriate sulfotransferases (SULTs), such as human or mouse SULT1A1. The same DNA adducts that were formed by FFA in these strains, mainly N 2-((furan-2-yl)methyl)-2′-deoxyguanosine (N 2-MF-dG), were also detected in tissues of FFA-exposed mice and even in human lung specimens. In the present study, a single oral dose of FFA (250mg/kg body weight) or saline was administered to FVB/N mice and transgenic mice expressing human SULT1A1/1A2 on the FVB/N background. The transgenic mice were used, since human and mouse SULT1A1 substantially differ in substrate specificity and tissue distribution. DNA adducts were studied in liver, kidney, proximal and distal small intestine as well as colon, using isotope-dilution ultra performance liquid chromatography (UPLC–MS/MS). Surprisingly, low levels of adducts that may represent N 2-MF-dG were detected even in tissues of untreated mice. FFA exposure enhanced the adduct levels in colon and liver, but not in the remaining investigated tissues of wild-type (wt) mice. The situation was similar in transgenic mice, except that N 2-MF-dG levels were also strongly enhanced in the proximal small intestine. These different results between wt and transgenic mice may be attributed to the fact that human SULT1A1, but not the orthologous mouse enzyme, is strongly expressed in the small intestine. PMID:25904584

  14. Formation of Metal-Adducted Analyte Ions by Flame-Induced Atmospheric Pressure Chemical Ionization Mass Spectrometry.

    PubMed

    Cheng, Sy-Chyi; Wang, Chin-Hsiung; Shiea, Jentaie

    2016-05-17

    A flame-induced atmospheric pressure chemical ionization (FAPCI) source, consisting of a miniflame, nebulizer, and heated tube, was developed to ionize analytes. The ionization was performed by reacting analytes with a charged species generated in a flame. A stainless steel needle deposited with saturated alkali chloride solution was introduced into the mini oxyacetylene flame to generate alkali ions, which were reacted with analytes (M) generated in a heated nebulizer. The alkali-adducted 18-crown-6 ether ions, including (M + Li)(+), (M + Na)(+), (M + K)(+), (M + Rb)(+), and (M + Cs)(+), were successfully detected on the FAPCI mass spectra when the corresponding alkali chloride solutions were separately introduced to the flame. When an alkali chloride mixture was introduced, all alkali-adducted analyte ions were simultaneously detected. Their intensity order was as follows: (M + Cs)(+) > (M + Rb)(+) > (M + K)(+) > (M + Na)(+) > (M + Li)(+), and this trend agreed with the lattice energies of alkali chlorides. Besides alkali ions, other transition metal ions such as Ni(+), Cu(+), and Ag(+) were generated in a flame for analyte ionization. Other than metal ions, the reactive species generated in the fossil fuel flame could also be used to ionize analytes, which formed protonated analyte ions (M + H)(+) in positive ion mode and deprotonated analyte ions (M - H)(-) in negative ion mode. PMID:27093572

  15. Formation and collision-induced dissociation of adduct ions [matrix + C]+ (C = Li, Na, Cs and NH4) produced under fast atom bombardment conditions

    NASA Astrophysics Data System (ADS)

    Takayama, Mitsuo

    1994-09-01

    The formation of adduct ions of matrices B with organic/metallic cations C+, [B + C]+ (C = Li, Na, Cs and NH4), under fast atom bombardment (FAB) conditions has been examined. The cation affinity (CA) for various matrix materials, glycerol, thioglycerol, dithiothreitol, m-nitrobenzylalcohol and diethanolamine, was evaluated from the positive-ion FAB mass spectra obtained for the salts LiCl, NaCl, CsCl or NH4Cl added to matrix B. The order of the CA of matrices for relatively small cations Li+ and Na+ was in accordance with that of the proton affinity (PA) of the matrices used. The collision-induced dissociation (CID) spectra of [B + H]+ and [B + C]+ ions have been obtained. The PA differences between matrix B and ammonia (NH3) molecules were roughly estimated from the CID spectra of [B + NH4]+ ions. The CID spectra of [B + C]+ ions, which have different dissociation windows from [B + H]+ ions, were analyzed by proposing multidentate-binding structures of the adduct ions. Some dissociations of [B + C]+ ions could be explained by charge-remote fragmentations. The results obtained suggest that the binding energy for the coordination complex (B...C+) can be evaluated from the CID patterns.

  16. Carcinogenicity and DNA adduct formation of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone and enantiomers of its metabolite 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol in F-344 rats.

    PubMed

    Balbo, Silvia; Johnson, Charles S; Kovi, Ramesh C; James-Yi, Sandra A; O'Sullivan, M Gerard; Wang, Mingyao; Le, Chap T; Khariwala, Samir S; Upadhyaya, Pramod; Hecht, Stephen S

    2014-12-01

    4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is metabolized to enantiomers of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL), found in the urine of virtually all people exposed to tobacco products. We assessed the carcinogenicity in male F-344 rats of (R)-NNAL (5 ppm in drinking water), (S)-NNAL (5 ppm), NNK (5 ppm) and racemic NNAL (10 ppm) and analyzed DNA adduct formation in lung and pancreas of these rats after 10, 30, 50 and 70 weeks of treatment. All test compounds induced a high incidence of lung tumors, both adenomas and carcinomas. NNK and racemic NNAL were most potent; (R)-NNAL and (S)-NNAL had equivalent activity. Metastasis was observed from primary pulmonary carcinomas to the pancreas, particularly in the racemic NNAL group. DNA adducts analyzed were O (2)-[4-(3-pyridyl)-4-oxobut-1-yl]thymidine (O (2)-POB-dThd), 7-[4-(3-pyridyl)-4-oxobut-1-yl]guanine(7-POB-Gua),O (6)-[4-(3-pyridyl)-4-oxobut-1-yl]deoxyguanosine(O (6)-POB-dGuo),the 4-(3-pyridyl)-4-hydroxybut-1-yl(PHB)adductsO (2)-PHB-dThd and 7-PHB-Gua, O (6)-methylguanine (O (6)-Me-Gua) and 4-hydroxy-1-(3-pyridyl)-1-butanone (HPB)-releasing adducts. Adduct levels significantly decreased with time in the lungs of rats treated with NNK. Pulmonary POB-DNA adducts and O (6)-Me-Gua were similar in rats treated with NNK and (S)-NNAL; both were significantly greater than in the (R)-NNAL rats. In contrast, pulmonary PHB-DNA adduct levels were greatest in the rats treated with (R)-NNAL. Total pulmonary DNA adduct levels were similar in (S)-NNAL and (R)-NNAL rats. Similar trends were observed for DNA adducts in the pancreas, but adduct levels were significantly lower than in the lung. The results of this study clearly demonstrate the potent pulmonary carcinogenicity of both enantiomers of NNAL in rats and provide important new information regarding DNA damage by these compounds in lung and pancreas. PMID:25269804

  17. 3,2'-Dimethyl-4-aminobiphenyl-DNA adduct formation in tumor target and nontarget organs of rapid and slow acetylator Syrian hamsters cogenic at the NAT2 locus.

    PubMed

    Feng, Y; Jiang, W; Deitz, A C; Hein, D W

    1996-10-01

    DNA adduct formation is an important step in initiation of the carcinogenic process. 3,2'-Dimethyl-4-aminobiphenyl (DMABP) is a well-documented multiorgan carcinogenic aromatic amine in rodents. In the present study, DMABP-DNA adduct levels were measured in rapid (Bio. 82.73/H-Pat(r)) and slow (Bio. 82.73/H-Pat(s)) acetylator Syrian hamsters congenic at the NAT2 locus following a single injection of 33 or 100 mg/kg body wt DMABP. Two DNA adducts, N-(deoxyguanosin-8-yl)-DMABP and 5-(deoxyguanosin-N2-yl)-DMABP, were identified and quantitated by 32P-postlabeling assay. After injection of 33 mg/kg, DMABP-DNA adducts were detected in urinary bladder at 6, 18, 24, and 48 hr with adduct levels increasing up to 48 hr postinjection. DMABP-DNA adducts were not detected in liver, colon, and heart. After injection of 100 mg/kg, DMABP-DNA adducts were detected in urinary bladder, liver, prostate, colon, and heart at 48 hr postinjection. DMABP-DNA adduct levels were significantly higher in urinary bladder (primary tumor target organ) than in the other organs of both rapid and slow acetylator congenic hamsters. N-(deoxyguanosin-8-yl)-DMABP levels were significantly higher in liver and prostate than in colon and heart of rapid and slow acetylator congenic hamsters, whereas 5-(deoxyguanosin-N2-yl)-DMABP levels were significantly higher in prostate than in colon and heart of rapid and slow acetylator congenic hamsters. DMABP-DNA adduct levels in each tissue examined did not differ significantly between rapid and slow acetylator hamsters following either 33 or 100 mg/kg injection. The tissue-dependent differences in DMABP-DNA adduct levels observed in the Syrian hamster differ from those reported in the rat and are consistent with previous studies that show DMABP induces primarily urinary bladder tumors in the Syrian hamster. PMID:8887447

  18. Multidrug resistance protein (MRP) 4 attenuates benzo[a]pyrene-mediated DNA-adduct formation in human bronchoalveolar H358 cells.

    PubMed

    Gelhaus, Stacy L; Gilad, Oren; Hwang, Wei-Ting; Penning, Trevor M; Blair, Ian A

    2012-02-25

    Multi-drug resistance protein (MRP) 4, an ATP-binding cassette (ABC) transporter, has broad substrate specificity. It facilitates the transport of bile salt conjugates, conjugated steroids, nucleoside analogs, eicosanoids, and cardiovascular drugs. Recent studies in liver carcinoma cells and hepatocytes showed that MRP4 expression is regulated by the aryl hydrocarbon receptor (AhR) and nuclear factor E2-related factor 2 (Nrf2). The AhR has particular importance in the lung and is most commonly associated with the up-regulation of cytochrome P-450 (CYP)-mediated metabolism of benzo[a]pyrene (B[a]P) to reactive intermediates. Treatment of H358, human bronchoalveolar, cells with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or (-)-benzo[a]pyrene-7,8-dihydro-7,8-diol (B[a]P-7,8-dihydrodiol), the proximate carcinogen of B[a]P, revealed that MRP4 expression was increased compared to control. This suggested that MRP4 expression might contribute to the paradoxical decrease in (+)-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene-2'-deoxyguanosine ((+)-anti-trans-B[a]PDE-dGuo) DNA-adducts observed in TCDD-treated H358 cells. We have now found that decreased MRP4 expression induced by a short hairpin RNA (shRNA), or chemical inhibition with probenecid, increased (+)-anti-trans-B[a]PDE-dGuo formation in cells treated with (-)-B[a]P-7,8-dihydrodiol, but not the ultimate carcinogen (+)-anti-trans-B[a]PDE. Thus, up-regulation of MRP4 increased cellular efflux of (-)-B[a]P-7,8-dihydrodiol, which attenuated DNA-adduct formation. This is the first report identifying a specific MRP efflux transporter that decreases DNA damage arising from an environmental carcinogen. PMID:22155354

  19. THE K-REGION DIHYDRODIOL OF BENZO[A]PYRENE INDUCES DNA DAMAGE AND MORPHOLOGICAL CELL TRANSFORMATION IN C3H10T1/2CL8 MOUSE EMBRYO CELLS WITHOUT THE FORMATION OF DETECTABLE STABLE COVALENT DNA ADDUCTS

    EPA Science Inventory

    The K -region dihydrodiol ofbenzo[ a ]pyrene induces DNA damage and morphological cell transformation in C3HlOTY2CL8 mouse embryo cells without the formation of detectable stable covalent DNA adducts

    Benzo[ a ]pyrene (B[ a ]P) is the most thoroughly studied polycyclic aro...

  20. DNA adducts in biomonitoring.

    PubMed

    Hemminki, K

    1995-05-01

    The types of occupational groups studied by postlabelling include foundry, coke oven and aluminium workers, roofers, garage and terminal workers, car mechanics and chimney sweeps. There does not seem to be a direct relationship between the exposure and adduct levels. However, the postlabelling assay is sensitive enough to show adducts in apparently unexposed individuals. The origin of such adducts is unknown; in the case of aromatic adducts, the origin is likely to be environmental and/or dietary. PMID:7618142

  1. Food borne bacterial models for detection of benzo[a]pyrene-DNA adducts formation using RAPD-PCR.

    PubMed

    Lanzone, Valentina; Tofalo, Rosanna; Fasoli, Giuseppe; Perpetuini, Giorgia; Suzzi, Giovanna; Sergi, Manuel; Corrado, Federica; Compagnone, Dario

    2016-05-01

    Random amplified polymorphic DNA (RAPD) PCR is a feasible method to evaluate genotoxin-induced DNA damage and mutations. In this study, Lactobacillus plantarum ATCC 14917T, Enterococcus faecium DSMZ 20477T, Escherichia coli PQ37 and Saccharomyces cerevisiae S441 were screened for DNA genetic alterations by DNA fingerprinting using M13 and LA1 primers after treatment with three compounds forming covalent adducts with DNA [benzo[a]pyrenediol epoxide (BPDE), methyl methanesulfonate and 1,2,3,4-diepoxybutane (DEB)]. M13 RAPD fingerprinting revealed that the total number of bands decreased in all treated DNA compared to control samples and generally the lost bands were characterized by high molecular weight. Some extra bands were detected for L. plantarum and E. faecium, while in E. coli and S. cerevisiae DNAs BPDE and DEB treatments did not result in new extra bands. Besides qualitatively analysis, cluster analysis based on Unweighted Pair-Group Method with Average algorithm was performed to compare DNA fingerprints before and after treatments. This analysis confirmed the absence of significant differences between negative controls and treated DNA in S. cerevisiae and E. coli however the disappearance of some bands can be detected. The data indicate that this approach can be used for DNA damage detection and mutations induced by genotoxic compounds and highlighted the possible use of L. plantarum and E. faecium M13 based fingerprinting as reference for hazard identification in risk assessment. PMID:26991971

  2. On-line cation exchange for suppression of adduct formation in negative-ion electrospray mass spectrometry of nucleic acids.

    PubMed

    Huber, C G; Buchmeiser, M R

    1998-12-15

    One major difficulty in the analysis of nucleic acids by electrospray mass spectrometry is represented by the affinity of the polyanionic sugar-phosphate backbone for nonvolatile cations, especially ubiquitous sodium and potassium ions. A simple on-line sample preparation system comprising a microflow pumping system and 45 x 0.8-mm-i.d. microcolumns packed with weak or strong cation-exchange resins is described for the efficient removal of cations from nucleic acid samples. Samples were analyzed by flow injection analysis at a 3-5 microL/min flow of 10 mM triethylamine in 50% water-50% acetonitrile. After on-line desalting, mass spectra of oligonucleotides revealed no significant sodium adduct peaks. Moreover, signal-to-noise ratios were greatly enhanced compared to direct injection of the samples. Electrospray mass spectrometry with on-line sample preparation allowed accurate molecular mass determinations of picomole amounts of crude oligonucleotide preparations ranging in size from 8 to 80 nucleotides within a few minutes. The good linearity of the calibration plot (R2 = 0.9988) over at least 2 orders of magnitude and a relative standard deviation in peak areas of less than 9% permitted the sensitive quantitative measurement of oligonucleotides in a concentration range of 0.2-20 microM with selected-ion monitoring. Finally, the on-line sample preparation system was evaluated for the mass spectrometric analysis of complex oligonucleotide mixtures. PMID:9868919

  3. Measurement artifacts identified in the UV-vis spectroscopic study of adduct formation within the context of molecular imprinting of naproxen

    NASA Astrophysics Data System (ADS)

    Perez, Martin; Concu, Riccardo; Ornelas, Mariana; Cordeiro, M. Natália D. S.; Azenha, Manuel; Fernando Silva, A.

    2016-01-01

    The ultraviolet-visible spectroscopy has been assessed as a technique for the evaluation of the strength of template-precursor adduct in the development of molecular imprints of the non-steroidal anti-inflammatory drug naproxen (NAP). The commonly employed approach relies on the collection of UV spectra of drug + precursor mixtures at different proportions, the spectra being recorded against blanks containing the same concentration of the precursor. The observation of either blue or red band-shifts and abatement of a major band are routinely attributed to template-precursor adduct formation. Following the described methodology, the precursors 1-(triethoxysilylpropyl)-3-(trimethoxysilylpropyl)-4,5-dihydroimidazolium iodide (AO-DHI+) and 4-(2-(trimethoxysilyl)ethyl)pyridine (PETMOS) provoked a blue-shift and band abatement effect on the NAP spectrum. Molecular dynamics simulations indicated a reasonable affinity between NAP and these precursors (coordination numbers 0.33 for AO-DHI+ and 0.18 for PETMOS), hence showing that NAP-precursor complexation is in fact effective. However, time dependent density functional theory (TD-DFT) calculations of the spectra of both free and precursor-complexed NAP were identical, thus providing no theoretical basis for the complexation-induced effects observed. We realized that the intense spectral bands of AO-DHI+ and PETMOS (at around 265 nm) superimpose partially with the NAP bands, and the apparent "blue-shifting" in the NAP spectra when mixed with AO-DHI + and PETMOS was in this case a spurious effect of the intense background subtraction. Therefore, extreme care must be taken when interpreting other spectroscopic results obtained in a similar fashion.

  4. Measurement artifacts identified in the UV-vis spectroscopic study of adduct formation within the context of molecular imprinting of naproxen.

    PubMed

    Perez, Martin; Concu, Riccardo; Ornelas, Mariana; Cordeiro, M Natália D S; Azenha, Manuel; Silva, A Fernando

    2016-01-15

    The ultraviolet-visible spectroscopy has been assessed as a technique for the evaluation of the strength of template-precursor adduct in the development of molecular imprints of the non-steroidal anti-inflammatory drug naproxen (NAP). The commonly employed approach relies on the collection of UV spectra of drug+precursor mixtures at different proportions, the spectra being recorded against blanks containing the same concentration of the precursor. The observation of either blue or red band-shifts and abatement of a major band are routinely attributed to template-precursor adduct formation. Following the described methodology, the precursors 1-(triethoxysilylpropyl)-3-(trimethoxysilylpropyl)-4,5-dihydroimidazolium iodide (AO-DHI(+)) and 4-(2-(trimethoxysilyl)ethyl)pyridine (PETMOS) provoked a blue-shift and band abatement effect on the NAP spectrum. Molecular dynamics simulations indicated a reasonable affinity between NAP and these precursors (coordination numbers 0.33 for AO-DHI(+) and 0.18 for PETMOS), hence showing that NAP-precursor complexation is in fact effective. However, time dependent density functional theory (TD-DFT) calculations of the spectra of both free and precursor-complexed NAP were identical, thus providing no theoretical basis for the complexation-induced effects observed. We realized that the intense spectral bands of AO-DHI(+) and PETMOS (at around 265 nm) superimpose partially with the NAP bands, and the apparent "blue-shifting" in the NAP spectra when mixed with AO-DHI+ and PETMOS was in this case a spurious effect of the intense background subtraction. Therefore, extreme care must be taken when interpreting other spectroscopic results obtained in a similar fashion. PMID:26458249

  5. Flight restriction prevents associative learning deficits but not changes in brain protein-adduct formation during honeybee ageing.

    PubMed

    Tolfsen, Christina C; Baker, Nicholas; Kreibich, Claus; Amdam, Gro V

    2011-04-15

    Honeybees (Apis mellifera) senesce within 2 weeks after they discontinue nest tasks in favour of foraging. Foraging involves metabolically demanding flight, which in houseflies (Musca domestica) and fruit flies (Drosophila melanogaster) is associated with markers of ageing such as increased mortality and accumulation of oxidative damage. The role of flight in honeybee ageing is incompletely understood. We assessed relationships between honeybee flight activity and ageing by simulating rain that confined foragers to their colonies most of the day. After 15 days on average, flight-restricted foragers were compared with bees with normal (free) flight: one group that foraged for ∼15 days and two additional control groups, for flight duration and chronological age, that foraged for ∼5 days. Free flight over 15 days on average resulted in impaired associative learning ability. In contrast, flight-restricted foragers did as well in learning as bees that foraged for 5 days on average. This negative effect of flight activity was not influenced by chronological age or gustatory responsiveness, a measure of the bees' motivation to learn. Contrasting their intact learning ability, flight-restricted bees accrued the most oxidative brain damage as indicated by malondialdehyde protein adduct levels in crude cytosolic fractions. Concentrations of mono- and poly-ubiquitinated brain proteins were equal between the groups, whereas differences in total protein amounts suggested changes in brain protein metabolism connected to forager age, but not flight. We propose that intense flight is causal to brain deficits in aged bees, and that oxidative protein damage is unlikely to be the underlying mechanism. PMID:21430210

  6. Kinetics and Thermochemistry of Reversible Adduct Formation in the Reaction of Cl((sup 2)P(sub J)) with CS2

    NASA Technical Reports Server (NTRS)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

    1997-01-01

    Reversible adduct formation in the reaction of Cl((sup 2)P(sub J)) with CS2 has been observed over the temperature range 193-258 K by use of time-resolved resonance fluorescence spectroscopy to follow the decay of pulsed-laser-generated Cl((sup 2)P(sub J)) into equilbrium with CS2Cl. Rate coefficients for CS2Cl formation and decomposition have been determined as a function of temperature and pressure; hence, the equilbrium constant has been determined as a function of temperature. A second-law analysis of the temperature dependence of Kp and heat capacity corrections calculated with use of an assumed CS2Cl structure yields the following thermodynamic parameters for the association reaction: Delta-H(sub 298) = -10.5 +/- 0.5 kcal/mol, Delta-H(sub 0) = -9.5 +/- 0.7 kcal/mol, Delta-S(sub 298) = -26.8 +/- 2.4 cal/mol.deg., and Delta-H(sub f,298)(CS2Cl) = 46.4 +/- 0.6 kcal/mol. The resonance fluorescence detection scheme has been adapted to allow detection of Cl((sup 2)P(sub J)) in the presence of large concentrations of O2, thus allowing the CS2Cl + Cl + O2 reaction to be investigated. We find that the rate coefficient for CS2Cl + O2 reaction via all channels that do not generate Cl((sup 2)P(sub J)) is less than 2.5 x 10(exp-16) cu cm/(molecule.s) at 293 K and 300-Torr total pressure and that the total rate coefficient is less than 2 x 10 (exp -15) cu cm/(molecule.s) at 230 K and 30-Torr total pressure. Evidence for reversible adduct formation in the reaction of Cl((sup 2)P(sub J)) with COS was sought but not observed, even at temperatures as low as 194 K.

  7. Influence of selenium, age and dosage of 7,12-dimethylbenz(a)anthracene (DMBA) on the in vivo formation of DNA adducts in mammary tissue

    SciTech Connect

    Jinzhou Liu; Milner, J.A. )

    1991-03-15

    Diets formulated to contain selenium, as sodium selenite, 0.1 or 2 {mu}g/g were fed for 2 weeks prior to DMBA treatment. Food intake and weight gain were not influenced by Se intake. Anti- and syn-dihydrodiol epoxide adducts reached maximum binding by 24 h. Se supplementation inhibited by about 50% the appearance of both anti-and syn- DMBA-DNA adducts. Dietary selenium increased the rate of removal of the anti-dihydrodiol epoxide adduct bound to guanine, but delayed the removal of the other adducts. The occurrence of DMBA-DNA adducts correlated positively with the dosage of DMBA administered. Binding increased about 40% as the rat's age increased from 36 to 125 d. Se supplementation inhibited binding in 36, 54 and 125 d old rats. These data confirmed that dietary selenium is effective in inhibiting in vivo metabolism of DMBA.

  8. Influence of the uvr-dependent nucleotide excision repair on DNA adducts formation and mutagenic spectrum of a potent genotoxic agent: 7-methoxy-2-nitronaphtho[2,1-b]furan (R7000).

    PubMed

    Quillardet, P; Touati, E; Hofnung, M

    1996-10-28

    The influence of the uvr-dependent excision repair system on the lethal action, mutagenic specificity, SOS induction and DNA adducts formation of 7-methoxy-2-nitronaphtho[2,1-b]furan (R7000), a potent genotoxic nitrofuran, were examined in Escherichia coli. Binding measurements of 3H-labelled R7000 to DNA indicated that R7000-DNA adducts can be removed by excision repair soon after the action of the chemical: 50% of the DNA adducts were removed within 10 min of treatment. After 1 h of incubation the level of excision reached 70%. This result was confirmed using the postlabelling technique. We found that R7000 yielded at least 10 different DNA adducts. Each of the adducts detected could be removed by excision repair. The rates of excision appeared different from one to the other. In addition, using a lacZ reversion system that is able to detect each type of base substitution mutations [1], we found that in uvrA bacteria deficient in excision repair, R7000 can induce 5 out of the 6 possible mutational events: GC-->TA, AT-->TA, GC-->CG, AT-->CG and GC-->AT. The transition AT-->GC was not observed. Only 3 transversions: GC-->TA, AT-->TA and GC-->CG could be detected in repair proficient uvr+ bacteria. The differences between the mutagenic spectra obtained in either uvr+ bacteria or uvrA mutants indicate that some potentially mutagenic DNA adducts induced by R7000 can be removed by excision repair, thus lowering the mutagenic potency of the chemical and modifying the mutagenic spectrum detected. PMID:8921981

  9. Modulation of 3-methylcholanthrene toxicity in cultured neoplastic keratinocytes by glucocorticoids and retinoids is not accounted for by macromolecular adduct formation

    SciTech Connect

    Rubin, A.L.; Rice, R.H. )

    1989-04-01

    3-Methylcholanthrene (3-MC) greatly inhibits the growth of two lines of human squamous carcinoma cells, SCC-9 and SCC-12B{sub 2}. The degree of 3-MC-mediated inhibition, however, was markedly alleviated by inclusion of retinoic acid and hydrocortisone or dexamethasone in the culture medium. These physiological effectors, which are known to have opposing actions on keratinocyte character in SCC cells, did not significantly alter either aryl hydrocarbon hydroxylase activity or macromolecular adduct formation. Further analysis of the cellular responses indicated that hydrocortisone and, in some experiments, retinoids increased the growth rate in 3-MC-exposed cultures, while 3-MC increased the saturation density in retinoic acid-exposed cultures, an example of interference with a physiological response of the cells. These results indicate that alteration of the differentiated state, regardless of the direction of the change, can alter the sensitivity of these cells to toxic stimuli. Further investigation of the bases of such toxic responses and their modulation by the microenvironment may enhance our understanding of the target cell specificity of polycyclic aromatic hydrocarbons.

  10. 32P-postlabelling methods for cyclic DNA adducts.

    PubMed

    Watson, W P; Crane, A E; Steiner, S

    1993-01-01

    32P-Postlabelling procedures coupled with HPLC have been developed to detect and measure a range of cyclic DNA adducts formed by bifunctional genotoxic agents. The methods are based on reverse-phase HPLC, particularly column-switching HPLC, to enrich adduct 3'-monophosphates before labelling. Following 3'-dephosphorylation of the 3'5'-[5'-32P]bisphosphates with nuclease P1, the resulting 5'-[32P]monophosphate adducts are resolved, identified and characterized by co-chromatography with synthetic reference standards. The procedures have been applied to a number of cyclic adducts including those formed by chloroacetaldehyde, glycidaldehyde and malonaldehyde. In general, labelling efficiencies measured as chromatographed 5'-[32P]monophosphates were in the range 30-40%. However, the values for the malonaldehyde deoxyguanosine adduct were much lower. The techniques have been applied to studies on the formation of DNA adducts in the skin of male C3H mice treated cutaneously with glycidaldehyde. The HPLC-32P-postlabelling analysis of epidermal DNA hydrolysates indicated that a single major cyclic adduct was formed by reaction with deoxyadenosine residues in mouse skin DNA. The adduct was identified as a hydroxymethyl ethenodeoxyadenosine adduct by comparison with a synthetic standard. This adduct was highly fluorescent and it was possible to make quantitative comparisons of the amounts of adduct determined by either HPLC-32P-postlabelling or HPLC-fluorescence detection. PMID:8225493

  11. Human DNA adduct measurements: state of the art.

    PubMed Central

    Poirier, M C; Weston, A

    1996-01-01

    Human DNA adduct formation (covalent modification of DNA with chemical carcinogens) is a promising biomarker for elucidating the molecular epidemiology of cancer. Classes of compounds for which human DNA adducts have been observed include polycyclic aromatic hydrocarbons (PAHs), nitrosamines, mycotoxins, aromatic amines, heterocyclic amines, ultraviolet light, and alkylating cancer chemotherapeutic agents. Most human DNA adduct exposure monitoring has been performed with either 32P-postlabeling or immunoassays, neither of which is able to chemically characterize specific DNA adducts. Recently developed combinations of methods with chemical and physical end points have allowed identification of specific adducts in human tissues. Studies are presented that demonstrate that high ambient levels of benzo[a]pyrene are associated with high levels of DNA adducts in human blood cell DNA and that the same DNA adduct levels drop when the ambient PAH levels decrease significantly. DNA adduct dosimetry, which has been achieved with some dietary carcinogens and cancer chemotherapeutic agents, is described, as well as studies correlating DNA adducts with other biomarkers. It is likely that some toxic, noncarcinogenic compounds may have genotoxic effects, including oxidative damage, and that adverse health outcomes other than cancer may be correlated with DNA adduct formation. The studies presented here may serve as useful prototypes for exploration of other toxicological end points. PMID:8933030

  12. Covalent adduction of nitrogen mustards to model protein nucleophiles.

    PubMed

    Thompson, Vanessa R; DeCaprio, Anthony P

    2013-08-19

    Protein adducts have the potential to serve as unique biomarkers of exposure to compounds of interest. Many xenobiotics (or their metabolites) are electrophilic and therefore reactive with nucleophilic amino acid residues on proteins. Nitrogen mustards are reactive xenobiotics with potential use as chemical warfare agents (CWA) or agents of terrorist attack, in addition to being employed as chemotherapeutic agents. The present study utilized cysteine-, lysine-, and histidine-containing model peptides to characterize in vitro adduction of the nitrogen mustards mechloroethamine (HN-2) and tris-(2-chlorethyl)amine (HN-3) to these nucleophilic amino acid residues by means of liquid chromatography-tandem mass spectrometry. The study assessed the structure of adducts formed, the time course of adduct formation, concentration-response relationships, and temporal stability of adducts. Adduction was hypothesized to occur on all three model peptides via initial formation of a reactive aziridinium intermediate for both mechloroethamine and tris-(2-chlorethyl)amine, followed by covalent adduction to nucleophilic residues. While adduction was found to occur most readily with cysteine, it was also observed at lysine and histidine, demonstrating that adduction by mechloroethamine and tris-(2-chlorethyl)amine is possible at multiple nucleophilic sites. Following solid phase extraction cleanup, adducts formed with mechloroethamine were stable for up to three weeks. Adducts formed with tris-(2-chlorethyl)amine were less stable; however, hydrolyzed secondary adducts were observed throughout the three week period. This study demonstrates that the nitrogen mustards mechloroethamine and tris-(2-chlorethyl)amine form stable adducts with reactive protein nucleophiles other than cysteine. PMID:23859065

  13. Investigating the adduct formation of organic mercury species with carbonic anhydrase and hemoglobin from human red blood cell hemolysate by means of LC/ESI-TOF-MS and LC/ICP-MS.

    PubMed

    Hogeback, Jens; Schwarzer, Miriam; Wehe, Christoph A; Sperling, Michael; Karst, Uwe

    2016-01-01

    The interaction of mercury species with human erythrocytes is studied to investigate possible high molecular binding partners for mercury species. Human blood hemolysate was spiked with methylmercury and investigated by means of liquid chromatography (LC) coupled to electrospray ionization time of flight mass spectrometry (ESI-ToF-MS) and inductively coupled plasma mass spectrometry (ICP-MS). Beside adduct formation of mercury species with hemoglobin, the main compound of the erythrocytes, mercury binding to the enzyme carbonic anhydrase was revealed. Due to an enzymatic digest of the protein-mercury adduct, the binding site at the free thiol group of the protein was identified. These results indicate that carbonic anhydrase might play a role in mercury toxicity. PMID:26442983

  14. Regio- and stereochemically controlled formation of hydroxamic acids from indium triflate-mediated nucleophilic ring-opening reactions with acylnitroso-Diels–Alder adducts

    PubMed Central

    Yang, Baiyuan; Miller, Marvin J.

    2010-01-01

    Treatment of acylnitroso-Diels–Alder [2.2.1] bicyclic adducts 2a–b with indium triflate in an alcohol solvent induces ring opening reactions to afford monocyclic anti-1,2-, anti-1,4- and syn-1,4-hydroxamic acids with good to excellent regio- and stereoselectivity (up to 7:86:7). Treatment of [2.2.2] bicyclic nitroso adducts 2c–d under similar reaction conditions generates only anti-1,2- and anti-1,4-hydroxamic acids with anti-1,4-product predominant (up to 17:83). PMID:20209116

  15. Stereospecific Formation of Interstrand Carbinolamine DNA Crosslinks by Crotonaldehyde- and Acetaldehyde-Derived α-CH3-γ-OH-1,N2-Propano-2’-deoxyguanosine Adducts in the 5′-CpG-3′ Sequence

    PubMed Central

    Cho, Young-Jin; Wang, Hao; Kozekov, Ivan D.; Kurtz, Andrew J.; Jacob, Jaison; Voehler, Markus; Smith, Jarrod; Harris, Thomas M.; Lloyd, R. Stephen; Rizzo, Carmelo J.; Stone, Michael P.

    2008-01-01

    The crotonaldehyde- and acetaldehyde-derived R- and S-α-CH3-γ-OH-1,N2-propanodeoxyguanosine adducts were monitored in single-stranded and duplex oligodeoxynucleotides using NMR spectroscopy. In both instances the cis and trans diastereomers of the α-CH3 and γ-OH groups underwent slow exchange, with the trans diastereomers being favored. In single-stranded oligodeoxynucleotides, the aldehyde intermediates were not detected spectroscopically, but their presence was revealed through the formation of N-terminal conjugates with the tetrapeptide KWKK. When annealed into 5′-d(GCTAGCXAGTCC)-3′•5′-d(GGACTCYCTAGC)-3′ containing the 5′-CpG-3′ sequence context (X=R- or S-α-CH3-γ-13C-OH-PdG; Y=15N2-dG), at pH 7, partial opening of the R- or S-α-CH3-γ-13C-OH-PdG adducts to the corresponding N2-(3-oxo-1-methyl-propyl)-dG aldehydes was observed at temperatures below the Tm of the duplexes. These aldehydes equilibrated with their geminal diol hydrates; higher temperatures favored the aldehydes. When annealed opposite to T, the S-α-CH3-γ-13C-OH-PdG adduct was stable. At 37 °C, an interstrand DNA crosslink was observed spectroscopically only for the R-α-CH3-γ-OH-PdG adduct. Molecular modeling predicted that the interstrand crosslink formed by the R-α-CH3-γ-OH-PdG adduct introduced less disruption into the duplex structure than did the crosslink arising from the S-α-CH3-γ-OH-PdG adduct, due to differing orientations of the R- and S-CH3 groups. Modeling also predicted that the α-methyl group of the aldehyde arising from the R-α-CH3-γ-OH-PdG adduct oriented in the 3′ direction in the minor groove, facilitating crosslinking. In contrast, the α-methyl group of the aldehyde arising from the S-α-CH3-γ-OH-PdG adduct oriented in the 5′ direction within the minor groove potentially hindering crosslinking. NMR revealed that for the R-α-CH3-γ-OH-PdG adduct, the carbinolamine form of the crosslink was favored in duplex DNA, in situ, with the imine or

  16. MUTAGENICITY AND DNA ADDUCT FORMATION OF PAH, NITRO-PAH, AND OXY-PAH FRACTIONS OF ATMOSPHERIC PARTICULATE MATTER FROM SAO PAULO, BRAZIL

    EPA Science Inventory

    Summary
    What is the study?
    Near roadway and immediate roadway exposures to transportation emissions gave very similar results in the Salmonella mutagenicity assay and in an assay for DNA adducts indicating that near roadway genotoxicity is not altered significantly over...

  17. Self-assembling of C60-imidazole and C60-pyridine adducts in the Langmuir and Langmuir-Blodgett films via complex formation with water-soluble zinc porphyrins

    NASA Astrophysics Data System (ADS)

    Marczak, Renata; Noworyta, Krzysztof; Kutner, Wlodzimierz; Gadde, Suresh; D'Souza, Francis

    2003-10-01

    The C60-pyridine, C60py, and C60-imidazole, C60im, adducts were found to self-assemble in films floating onto aqueous solutions of zinc tetrakis (N-methylpyridinium)porphyrin cation, Zn(TMPyP), or zinc tetrakis (4-sulfonatophenyl)porphyrin anion, Zn(TPPS). This self assembling was due to axial ligation of the C60 adducts (acceptors) by Zn porphyrins (donors), which lead to the formation of relatively stable donor-acceptor dyads in the water-air interfaces. The films were compressed in a Langmuir trough and characterized by isotherms of surface pressure vs. area per molecule as well as by the Brewster angle microscopy imaging. All systems formed stable aggregated Langmuir films of the "expanded liquid" type. Extensive compression of the films resulted in two-dimensional phase transitions. The area per molecule at infinite dilution of the adducts in films increased in the order: water<0.1 mM Zn(TPPS)<0.1 mM Zn(TPMyP). Comparison of the determined and calculated values of area per molecule indicated that orientation of porphyrins in the complexes was parallel with respect to the interface plane. The Langmuir films were transferred, by using the Langmuir-Blodgett technique, onto quartz slides. The UV-vis spectroscopic study of these films revealed that Zn porphyrins were transferred together with the C60 adducts and that the transfer efficiency increased in the order: C60py-Zn(TPPS)

  18. Modulation of carcinogen metabolism by nitric oxide-aspirin 2 is associated with suppression of DNA damage and DNA adduct formation.

    PubMed

    MacDonald, Christopher J; Cheng, Robert Y S; Roberts, David D; Wink, David A; Yeh, Grace Chao

    2009-08-14

    Nitric oxide (NO)-donating non-steroidal anti-inflammatory drugs (NSAIDs) represent a promising new class of drugs developed to provide a safer alternative than their conventional NSAID counterparts in chemoprevention. We tested the effects of NO-aspirin 2 on Phase I and Phase II carcinogen-metabolizing enzymes. In HepG2 human hepatoma cells and in LS180 colonic adenocarcinoma cells, NO-aspirin 2 inhibited 2,3,7,8-tetrachlordibenzo-p-dioxin (TCDD)-induced cytochrome P450 (CYP) enzyme activity and CYP1A1 and CYP1A2 mRNA expression. These effects were further characterized as being mediated through transcriptional regulation: NO-aspirin 2 inhibited binding of ligand (TCDD)-activated aryl hydrocarbon receptor to the CYP1A1 enhancer sequence; additionally, NO-aspirin 2 suppressed carcinogen-induced expression of CYP1A heterogeneous nuclear RNA. The fate of carcinogen metabolites depends not only on activation by CYP enzymes but also detoxification by Phase II enzymes. Both HepG2 and LS180 cells treated with NO-aspirin 2 showed an increase in glutathione S-transferase-P1 (GST-P1), glutamate-cysteine ligase (GCL), and NAD(P)H:quinone oxidoreductase-1 (NQO1) expression. Compared with two other NO-releasing compounds, diethylenetriamine-NO and the organic nitrate, isosorbide dinitrate, the inhibitory effects of NO-aspirin 2 on TCDD-induced CYP activity and mRNA expression were considerably more potent. Furthermore, aspirin alone had no inhibitory effect on TCDD-induced CYP activity, nor did aspirin up-regulate GCL, GST-P1, or NQO1 expression. Consequent to the effects on carcinogen-metabolizing enzymes, NO-aspirin 2 inhibited [3H]benzo[a]pyrene-DNA adduct formation and DNA damage elicited by TCDD or benzo[a]pyrene. Our results demonstrate that NO-aspirin 2 may be an effective chemopreventive agent by favorably affecting the inhibitory and enhancing effects of Phase I and Phase II carcinogen metabolism, thereby protecting DNA from carcinogenic insult. PMID:19542225

  19. Chicken Fetal Liver DNA Damage and Adduct Formation by Activation-Dependent DNA-Reactive Carcinogens and Related Compounds of Several Structural Classes

    PubMed Central

    Williams, Gary M.; Duan, Jian-Dong; Brunnemann, Klaus D.; Iatropoulos, Michael J.; Vock, Esther; Deschl, Ulrich

    2014-01-01

    The chicken egg genotoxicity assay (CEGA), which utilizes the liver of an intact and aseptic embryo-fetal test organism, was evaluated using four activation-dependent DNA-reactive carcinogens and four structurally related less potent carcinogens or non-carcinogens. In the assay, three daily doses of test substances were administered to eggs containing 9–11-day-old fetuses and the fetal livers were assessed for two endpoints, DNA breaks using the alkaline single cell gel electrophoresis (comet) assay and DNA adducts using the 32P-nucleotide postlabeling (NPL) assay. The effects of four carcinogens of different structures requiring distinct pathways of bioactivation, i.e., 2-acetylaminofluorene (AAF), aflatoxin B1 (AFB1), benzo[a]pyrene (B[a]P), and diethylnitrosamine (DEN), were compared with structurally related non-carcinogens fluorene (FLU) and benzo[e]pyrene (B[e]P) or weak carcinogens, aflatoxin B2 (AFB2) and N-nitrosodiethanolamine (NDELA). The four carcinogens all produced DNA breaks at microgram or low milligram total doses, whereas less potent carcinogens and non-carcinogens yielded borderline or negative results, respectively, at higher doses. AAF and B[a]P produced DNA adducts, whereas none was found with the related comparators FLU or B[e]P, consistent with comet results. DEN and NDELA were also negative for adducts, as expected in the case of DEN for an alkylating agent in the standard NPL assay. Also, AFB1 and AFB2 were negative in NPL, as expected, due to the nature of ring opened aflatoxin adducts, which are resistant to enzymatic digestion. Thus, the CEGA, using comet and NPL, is capable of detection of the genotoxicity of diverse DNA-reactive carcinogens, while not yielding false positives for non-carcinogens. PMID:24973097

  20. Fluorescence and mass spectral evidence for the formation of benzo[a]pyrene anti-diol-epoxide-DNA and -hemoglobin adducts in humans.

    PubMed

    Weston, A; Rowe, M L; Manchester, D K; Farmer, P B; Mann, D L; Harris, C C

    1989-02-01

    Highly specific methods are required to detect and quantitate carcinogen-macromolecular adducts in humans who are exposed to complex mixtures of chemical carcinogens. High performance liquid chromatography and fluorescence spectroscopy have been used successfully to detect and identify residues of benzo[a]pyrene-7,10/8,9-tetrahydrotetrol (BP-7,10/8,9-tetrol) that were released upon mild acid hydrolysis of human DNA or hemoglobin. Synchronous fluorescence spectroscopy data indicate that levels of benzo[a]pyrene-diol-epoxide-DNA (BPDE-DNA) adducts as high as 1.54 fmol BPDE/micrograms DNA are formed (1 adduct in 5 million nucleotides) in peripheral blood lymphocytes of coke-oven workers; these data were subsequently corroborated by gas chromatography/mass spectroscopy single ion monitoring analysis (m/z 404+). Additionally, among lung cancer patients, 5 samples of tumor DNA were found to be negative and 1 of 4 samples of corresponding lung tissue was found to be positive. Extraction and purification of BP-7,10/8,9-tetrol from the hemoglobin of smokers suggested levels of bound carcinogen in excess of 1 ng BPDE/gm of hemoglobin. High performance liquid chromatography combined with synchronous fluorescence spectroscopy provides a highly specific method for the detection of covalently bound BP residues in both human hemoglobin and DNA. PMID:2912575

  1. Metformin inhibits 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis and adduct formation in human breast cells by inhibiting the cytochrome P4501A1/aryl hydrocarbon receptor signaling pathway

    SciTech Connect

    Maayah, Zaid H.; Ghebeh, Hazem; Alhaider, Abdulqader A.; El-Kadi, Ayman O.S.; Soshilov, Anatoly A.; Denison, Michael S.; Ansari, Mushtaq Ahmad; Korashy, Hesham M.

    2015-04-15

    Recent studies have established that metformin (MET), an oral anti-diabetic drug, possesses antioxidant activity and is effective against different types of cancer in several carcinogen-induced animal models and cell lines. However, whether MET can protect against breast cancer has not been reported before. Therefore, the overall objectives of the present study are to elucidate the potential chemopreventive effect of MET in non-cancerous human breast MCF10A cells and explore the underlying mechanism involved, specifically the role of cytochrome P4501A1 (CYP1A1)/aryl hydrocarbon receptor (AhR) pathway. Transformation of the MCF10A cells into initiated breast cancer cells with DNA adduct formation was conducted using 7,12-dimethylbenz[a]anthracene (DMBA), an AhR ligand. The chemopreventive effect of MET against DMBA-induced breast carcinogenesis was evidenced by the capability of MET to restore the induction of the mRNA levels of basic excision repair genes, 8-oxoguanine DNA glycosylase (OGG1) and apurinic/apyrimidinic endonuclease1 (APE1), and the level of 8-hydroxy-2-deoxyguanosine (8-OHdG). Interestingly, the inhibition of DMBA-induced DNA adduct formation was associated with proportional decrease in CYP1A1 and in NAD(P)H:quinone oxidoreductase 1 (NQO1) gene expression. Mechanistically, the involvements of AhR and nuclear factor erythroid 2-related factor-2 (Nrf2) in the MET-mediated inhibition of DMBA-induced CYP1A1 and NQO1 gene expression were evidenced by the ability of MET to inhibit DMBA-induced xenobiotic responsive element and antioxidant responsive element luciferase reporter gene expression which suggests an AhR- and Nrf2-dependent transcriptional control. However, the inability of MET to bind to AhR suggests that MET is not an AhR ligand. In conclusion, the present work shows a strong evidence that MET inhibits the DMBA-mediated carcinogenicity and adduct formation by inhibiting the expression of CYP1A1 through an AhR ligand-independent mechanism

  2. Metabolic activation of 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine and DNA adduct formation depends on p53: Studies in Trp53(+/+),Trp53(+/-) and Trp53(-/-) mice.

    PubMed

    Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M

    2016-02-15

    The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. PMID:26335255

  3. Formation of Fused-Ring 2′-Deoxycytidine Adducts from 1-Chloro-3-buten-2-one, an in Vitro 1,3-Butadiene Metabolite, under in Vitro Physiological Conditions

    PubMed Central

    Sun, Liang; Pelah, Avishay; Zhang, Dong-Ping; Zhong, Yu-Fang; An, Jing; Yu, Ying-Xin; Zhang, Xin-Yu; Elfarra, Adnan A.

    2013-01-01

    1-Chloro-3-buten-2-one (CBO) is a potential metabolite of 1,3-butadiene (BD), a carcinogenic air pollutant. CBO is a bifunctional alkylating agent that readily reacts with glutathione (GSH) to form mono-GSH and di-GSH adducts. Recently, CBO and its precursor 1-chloro-2-hydroxy-3-butene (CHB) were found to be cytotoxic and genotoxic in human liver cells in culture with CBO being approximately 100-fold more potent than CHB. In the present study, CBO was shown to react readily with 2′-deoxycytidine (dC) under in vitro physiological conditions (pH 7.4, 37 °C) to form four dC adducts with the CBO moieties forming fused rings with the N3 and N4 atoms of dC. The four products were structurally characterized as 2-hydroxy-2-hydroxymethyl-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahy dro-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-1 and dC-2, a pair of diastereomers), 4-chloromethyl-4-hydroxy-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahydr o-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-3), and 2-chloromethyl-2-hydroxy-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahydr o-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-4). Interestingly, dC-1 and dC-2 were stable under our experimental conditions (pH 7.4, 37 °C, 6 h) and existed in equilibrium as indicated by HPLC analysis, whereas dC-3 and dC-4 were labile with the half-lives being 3.0 ± 0.36 and 1.7 ± 0.06 h, respectively. Decomposition of dC-4 produced both dC-1 and dC-2, whereas acid hydrolysis of dC-1/dC-2 and dC-4 in 1 M HCl at 100 °C for 30 min yielded the deribosylated adducts dC-1H/dC-2H and dC-4H, respectively. Because fused-ring dC adducts of other chemicals are mutagenic, the characterized CBO-dC adducts could be mutagenic and play a role in the cytotoxicity and genotoxicity of CBO and its precursors, CHB and BD. The CBO-dC adducts may also be used as standards to characterize CBO-DNA adducts and to develop potential biomarkers for CBO formation in vivo. PMID:24020501

  4. General method for quantifying base adducts in specific mammalian genes

    SciTech Connect

    Thomas, D.C.; Morton, A.G.; Bohr, V.A.; Sancar, A.

    1988-06-01

    A general method has been developed to measure the formation and removal of DNA adducts in defined sequences of mammalian genomes. Adducted genomic DNA is digested with an appropriate restriction enzyme, treated with Escherichia coli UvrABC excision nuclease (ABC excinuclease), subjected to alkaline gel electrophoresis, and probed for specific sequences by Southern hybridization. The ABC excinuclease incises DNA containing bulky adducts and thus reduces the intensity of the full-length fragments in Southern hybridization in proportion to the number of adducts present in the probed sequence. This method is similar to that developed by Bohr et al. for quantifying pyrimidine dimers by using T4 endonuclease V. Because of the wide substrate range of ABC exinuclease, however, our method can be used to quantify a large variety of DNA adducts in specific genomic sequences.

  5. DNA adduct formation and DNA strand breaks in green-lipped mussels (Perna viridis) exposed to benzo[a]pyrene: dose- and time-dependent relationships.

    PubMed

    Ching, E W; Siu, W H; Lam, P K; Xu, L; Zhang, Y; Richardson, B J; Wu, R S

    2001-07-01

    Green-lipped mussels, Perna viridis, were exposed to 0, 0.3, 3 and 30 micrograms l-1 (nominal concentrations) B[a]P under laboratory conditions over a period of 24 days. Mussels were collected on day 0, 1, 3, 6, 12, 18 and 24, and the levels of DNA adducts and DNA strand breaks in their hepatopancreas tissues monitored. Mussels exposed to 0.3 and 3 micrograms l-1 B[a]P showed marked increases in strand breaks after 1 day of exposure. DNA strand break levels in these mussels remained high and significantly different from the control values until day 3 for the 0.3 microgram l-1 treatment group, and day 6 for the 3 micrograms l-1 treatment group. This was followed by a gradual reduction in strand breaks. After 12 days, the levels of both groups had returned to the same level as that of the control. No increase in DNA strand breaks was observable in mussels exposed to 30 micrograms l-1 B[a]P in the first 12 days of exposure, but a significant increase was observed from day 12 to day 24. Increasing B[a]P concentrations resulted in elevated DNA adduct levels after 3-6 days of exposure, but this pattern of dose-related increase disappeared after 12 days. These results indicate that a better understanding of the complex interactions between exposure levels and durations is crucially important before DNA adduct levels and DNA strand breaks in P. viridis can be used as effective biomarkers for monitoring genotoxicants in marine waters. PMID:11488241

  6. MeIQx-induced DNA adduct formation and mutagenesis in DNA repair deficient CHO cells expressing human CYP1A1 and rapid or slow acetylator NAT2

    PubMed Central

    Bendaly, Jean; Zhao, Shuang; Neale, Jason R.; Metry, Kristin J.; Doll, Mark A.; States, J. Christopher; Pierce, William M.; Hein, David W.

    2007-01-01

    2-Amino-3,8-dimethylimidazo-[4,5-f]quinoxaline (MeIQx) is one of the most potent and abundant mutagens in the western diet. Bioactivation includes N-hydroxylation catalyzed by cytochrome P450s followed by O-acetylation catalyzed by N-acetyltransferase 2 (NAT2). Nucleotide excision repair-deficient chinese hamster ovary (CHO) cells were constructed by stable transfection of human cytochrome P4501A1 (CYP1A1) and a single copy of either NAT2*4 (rapid acetylator) or NAT2*5B (slow acetylator) alleles. CYP1A1 and NAT2 catalytic activities were undetectable in untransfected CHO cell lines. CYP1A1 activity did not differ significantly (p > 0.05) among the CYP1A1-transfected cell lines. Cells transfected with NAT2*4 had significantly higher levels of sulfamethazine N-acetyltransferase (p = 0.0001) and N-hydroxy-MeIQx O-acetyltransferase (p = 0.0093) catalytic activity than cells transfected with NAT2*5B. Only cells transfected with both CYP1A1 and NAT2*4 showed concentration-dependent cytotoxicity and hypoxanthine phosphoribosyl transferase (hprt) mutagenesis following MeIQx treatment. dG-C8-MeIQx was the primary DNA adduct formed and levels were dose-dependent in each cell line and in the order: untransfected < transfected with CYP1A1 < transfected with CYP1A1 & NAT2*5B < transfected with CYP1A1 & NAT2*4. MeIQx DNA adduct levels were significantly higher (p < 0.001) in CYP1A1/NAT2*4 than CYP1A1/NAT2*5B cells at all concentrations of MeIQx tested. MeIQx-induced DNA adduct levels correlated very highly (r2 = 0.88) with MeIQx-induced mutants. These results strongly support extrahepatic activation of MeIQx by CYP1A1 and a robust effect of human NAT2 genetic polymorphism on MeIQx –induced DNA adducts and mutagenesis. The results provide laboratory-based support for epidemiological studies reporting higher frequency of heterocyclic amine-related cancers in rapid NAT2 acetylators. PMID:17627018

  7. Sperm DNA oxidative damage and DNA adducts.

    PubMed

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-12-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps=0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps=0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps=0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm

  8. Ethanol and 4-methylpyrazole increase DNA adduct formation of furfuryl alcohol in FVB/N wild-type mice and in mice expressing human sulfotransferases 1A1/1A2.

    PubMed

    Sachse, Benjamin; Meinl, Walter; Glatt, Hansruedi; Monien, Bernhard H

    2016-03-01

    Furfuryl alcohol (FFA) is a carcinogenic food contaminant, which is formed by acid- and heat-catalyzed degradation of fructose and glucose. The activation by sulfotransferases (SULTs) yields a DNA reactive and mutagenic sulfate ester. The most prominent DNA adduct, N(2)-((furan-2-yl)methyl)-2'-deoxyguanosine (N(2)-MF-dG), was detected in FFA-treated mice and also in human tissue samples. The dominant pathway of FFA detoxification is the oxidation via alcohol dehydrogenases (ADHs) and aldehyde dehydrogenases (ALDHs). The activity of these enzymes may be greatly altered in the presence of inhibitors or competitive substrates. Here, we investigated the impact of ethanol and the ADH inhibitor 4-methylpyrazole (4MP) on the DNA adduct formation by FFA in wild-type and in humanized mice that were transgenic for human SULT1A1/1A2 and deficient in the mouse (m) Sult1a1 and Sult1d1 genes (h1A1/1A2/1a1(-)/1d1(-)). The administration of FFA alone led to hepatic adduct levels of 4.5 N(2)-MF-dG/10(8) nucleosides and 33.6 N(2)-MF-dG/10(8) nucleosides in male and female wild-type mice, respectively, and of 19.6 N(2)-MF-dG/10(8) nucleosides and 95.4 N(2)-MF-dG/10(8) nucleosides in male and female h1A1/1A2/1a1(-)/1d1(-) mice. The coadministration of 1.6g ethanol/kg body weight increased N(2)-MF-dG levels by 2.3-fold in male and by 1.7-fold in female wild-type mice and by 2.5-fold in male and by 1.5-fold in female h1A1/1A2/1a1(-)/1d1(-) mice. The coadministration of 100mg 4MP/kg body weight had a similar effect on the adduct levels. These findings indicate that modulators of the oxidative metabolism, e.g. the drug 4MP or consumption of alcoholic beverages, may increase the genotoxic effects of FFA also in humans. PMID:26775039

  9. Induction of Cyp1a1 and Cyp1b1 and formation of DNA adducts in C57BL/6, Balb/c, and F1 mice following in utero exposure to 3-methylcholanthrene

    SciTech Connect

    Xu Mian; Nelson, Garret B.; Moore, Joseph E.; McCoy, Thomas P.; Dai, Jian; Manderville, Richard A.; Ross, Jeffrey A.; Miller, Mark Steven . E-mail: msmiller@wfubmc.edu

    2005-11-15

    Fetal mice are more sensitive to chemical carcinogens than are adults. Previous studies from our laboratory demonstrated differences in the mutational spectrum induced in the Ki-ras gene from lung tumors isolated from [D2 x B6D2F1]F2 mice and Balb/c mice treated in utero with 3-methylcholanthrene (MC). We thus determined if differences in metabolism, adduct formation, or adduct repair influence strain-specific responses to transplacental MC exposure in C57BL/6 (B6), Balb/c (BC), and reciprocal F1 crosses between these two strains of mice. The induction of Cyp1a1 and Cyp1b1 in fetal lung and liver tissue was determined by quantitative fluorescent real-time PCR. MC treatment caused maximal induction of Cyp1a1 and Cyp1b1 RNA 2-8 h after injection in both organs. RNA levels for both genes then declined in both fetal organs, but a small biphasic, secondary increase in Cyp1a1 was observed specifically in the fetal lung 24-48 h after MC exposure in all four strains. Cyp1a1 induction by MC at 4 h was 2-5 times greater in fetal liver (7000- to 16,000-fold) than fetal lung (2000- to 6000-fold). Cyp1b1 induction in both fetal lung and liver was similar and much lower than that observed for Cyp1a1, with induction ratios of 8- to 18-fold in fetal lung and 10- to 20-fold in fetal liver. The overall kinetics and patterns of induction were thus very similar across the four strains of mice. The only significant strain-specific effect appeared to be the relatively poor induction of Cyp1b1 in the parental strain of B6 mice, especially in fetal lung tissue. We also measured the levels of MC adducts and their disappearance from lung tissue by the P{sup 32} post-labeling assay on gestation days 18 and 19 and postnatal days 1, 4, 11, and 18. Few differences were seen between the different strains of mice; the parental strain of B6 mice had nominally higher levels of DNA adducts 2 (gestation day 19) and 4 (postnatal day 1) days after injection, although this was not statistically

  10. High performance addition-type thermoplastics (ATTs) - Evidence for the formation of a Diels-Alder adduct in the reaction of an acetylene-terminated material and a bismaleimide

    NASA Technical Reports Server (NTRS)

    Pater, R. H.; Soucek, M. D.; Chang, A. C.; Partos, R. D.

    1991-01-01

    Recently, the concept and demonstration of a new versatile synthetic reaction for making a large number of high-performance addition-type thermoplastics (ATTs) were reported. The synthesis shows promise for providing polymers having an attractive combination of easy processability, good toughness, respectable high temperature mechanical performance, and excellent thermo-oxidative stability. The new chemistry involves the reaction of an acetylene-terminated material with a bismaleimide or benzoquinone. In order to clarify the reaction mechanism, model compound studies were undertaken in solutions as well as in the solid state. The reaction products were purified by flash chromatography and characterized by conventional analytical techniques including NMR, FT-IR, UV-visible, mass spectroscopy, and high pressure liquid chromatography. The results are presented of the model compound studies which strongly support the formation of a Diels-Alder adduct in the reaction of an acetylene-terminated compound and a bismaleimide or benzoquinone.

  11. Comparative DNA adduct formation and induction of colonic aberrant crypt foci in mice exposed to 2-amino-9H-pyrido[2,3-b]indole, 2-amino-3,4-dimethylimidazo[4,5-f]quinoline, and azoxymethane.

    PubMed

    Kim, Sangyub; Guo, Jingshu; O'Sullivan, M Gerald; Gallaher, Daniel D; Turesky, Robert J

    2016-03-01

    Considerable evidence suggests that environmental factors, including diet and cigarette smoke, are involved in the pathogenesis of colon cancer. Carcinogenic nitroso compounds (NOC), such as N-nitrosodimethylamine (NDMA), are present in tobacco and processed red meat, and NOC have been implicated in colon cancer. Azoxymethane (AOM), commonly used for experimental colon carcinogenesis, is an isomer of NDMA, and it produces the same DNA adducts as does NDMA. Heterocyclic aromatic amines (HAAs) formed during the combustion of tobacco and high-temperature cooking of meats are also associated with an elevated risk of colon cancer. The most abundant carcinogenic HAA formed in tobacco smoke is 2-amino-9H-pyrido[2,3-b]indole (AαC), whereas 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ) is the most potent carcinogenic HAA formed during the cooking of meat and fish. However, the comparative tumor-initiating potential of AαC, MeIQ, and AOM is unknown. In this report, we evaluate the formation of DNA adducts as a measure of genotoxicity, and the induction of colonic aberrant crypt foci (ACF) and dysplastic ACF, as an early measure of carcinogenic potency of these compounds in the colon of male A/J mice. Both AαC and AOM induced a greater number of DNA adducts than MeIQ in the liver and colon. AOM induced a greater number of ACF and dysplastic ACF than either AαC or MeIQ. Conversely, based on adduct levels, MeIQ-DNA adducts were more potent than AαC- and AOM-DNA adducts at inducing ACF. Long-term feeding studies are required to relate levels of DNA adducts, induction of ACF, and colon cancer by these colon genotoxicants. PMID:26734915

  12. Quantitation of DNA adducts by stable isotope dilution mass spectrometry

    PubMed Central

    Tretyakova, Natalia; Goggin, Melissa; Janis, Gregory

    2012-01-01

    Exposure to endogenous and exogenous chemicals can lead to the formation of structurally modified DNA bases (DNA adducts). If not repaired, these nucleobase lesions can cause polymerase errors during DNA replication, leading to heritable mutations potentially contributing to the development of cancer. Due to their critical role in cancer initiation, DNA adducts represent mechanism-based biomarkers of carcinogen exposure, and their quantitation is particularly useful for cancer risk assessment. DNA adducts are also valuable in mechanistic studies linking tumorigenic effects of environmental and industrial carcinogens to specific electrophilic species generated from their metabolism. While multiple experimental methodologies have been developed for DNA adduct analysis in biological samples – including immunoassay, HPLC, and 32P-postlabeling – isotope dilution high performance liquid chromatography-electrospray ionization-tandem mass spectrometry (HPLC-ESI-MS/MS) generally has superior selectivity, sensitivity, accuracy, and reproducibility. As typical DNA adducts concentrations in biological samples are between 0.01 – 10 adducts per 108 normal nucleotides, ultrasensitive HPLC-ESI-MS/MS methodologies are required for their analysis. Recent developments in analytical separations and biological mass spectrometry – especially nanoflow HPLC, nanospray ionization MS, chip-MS, and high resolution MS – have pushed the limits of analytical HPLC-ESI-MS/MS methodologies for DNA adducts, allowing researchers to accurately measure their concentrations in biological samples from patients treated with DNA alkylating drugs and in populations exposed to carcinogens from urban air, drinking water, cooked food, alcohol, and cigarette smoke. PMID:22827593

  13. Reactions of Ph3Sb═S with copper(I) complexes supported by N-donor ligands: formation of stable adducts and S-transfer reactivity.

    PubMed

    Yang, Lei; Tehranchi, Jacqui; Tolman, William B

    2011-03-21

    In the exploration of sulfur-delivery reagents useful for synthesizing models of the tetracopper-sulfide cluster of nitrous oxide reductase, reactions of Ph(3)Sb═S with Cu(I) complexes of N,N,N',N'-tetramethyl-2R,3R-cyclohexanediamine (TMCHD) and 1,4,7-trialkyltriazacyclononanes (R(3)tacn; R = Me, Et, iPr) were studied. Treatment of [(R(3)tacn)Cu(NCCH(3))]SbF(6) (R = Me, Et, or iPr) with 1 equiv of S═SbPh(3) in CH(2)Cl(2) yielded adducts [(R(3)tacn)Cu(S═SbPh(3))]SbF(6) (1-3), which were fully characterized, including by X-ray crystallography. The adducts slowly decayed to [(R(3)tacn)(2)Cu(2)(μ-η(2):η(2)-S(2))](2+) species (4-6) and SbPh(3), or more quickly in the presence of additional [(R(3)tacn)Cu(NCCH(3))]SbF(6) to 4-6 and [(R(3)tacn)Cu(SbPh(3))]SbF(6) (7-9). The results of mechanistic studies of the latter process were consistent with rapid intermolecular exchange of S═SbPh(3) between 1-3 and added [(R(3)tacn)Cu(NCCH(3))]SbF(6), followed by conversion to product via a dicopper intermediate formed in a rapid pre-equilibrium step. Key evidence supporting this step came from the observation of saturation behavior in a plot of the initial rate of loss of 1 versus the initial concentration of [(Me(3)tacn)Cu(NCCH(3))]SbF(6). Also, treatment of [(TMCHD)Cu(CH(3)CN)]PF(6) with S═SbPh(3) led to the known tricopper cluster [(TMCHD)(3)Cu(3)(μ(3)-S)(2)](PF(6))(3) in good yield (79%), a synthetic procedure superior to that previously reported (Brown, E. C.; York, J. T.; Antholine, W. E.; Ruiz, E.; Alvarez, S.; Tolman, W. B. J. Am. Chem. Soc. 2005, 127, 13752-13753). PMID:21338053

  14. Sustained induction of cytochrome P4501A1 in human hepatoma cells by co-exposure to benzo[a]pyrene and 7H-dibenzo[c,g]carbazole underlies the synergistic effects on DNA adduct formation

    SciTech Connect

    Gábelová, Alena; Poláková, Veronika; Prochazka, Gabriela; Kretová, Miroslava; Poloncová, Katarína; Regendová, Eva; Luciaková, Katarína; Segerbäck, Dan

    2013-08-15

    To gain a deeper insight into the potential interactions between individual aromatic hydrocarbons in a mixture, several benzo[a]pyrene (B[a]P) and 7H-dibenzo[c,g]carbazole (DBC) binary mixtures were studied. The biological activity of the binary mixtures was investigated in the HepG2 and WB-F344 liver cell lines and the Chinese hamster V79 cell line that stably expresses the human cytochrome P4501A1 (hCYP1A1). In the V79 cells, binary mixtures, in contrast to individual carcinogens, caused a significant decrease in the levels of micronuclei, DNA adducts and gene mutations, but not in cell survival. Similarly, a lower frequency of micronuclei and levels of DNA adducts were found in rat liver WB-F344 cells treated with a binary mixture, regardless of the exposure time. The observed antagonism between B[a]P and DBC may be due to an inhibition of Cyp1a1 expression because cells exposed to B[a]P:DBC showed a decrease in Cyp1a1 mRNA levels. In human liver HepG2 cells exposed to binary mixtures for 2 h, a reduction in micronuclei frequency was also found. However, after a 24 h treatment, synergism between B[a]P and DBC was determined based on DNA adduct formation. Accordingly, the up-regulation of CYP1A1 expression was detected in HepG2 cells exposed to B[a]P:DBC. Our results show significant differences in the response of human and rat cells to B[a]P:DBC mixtures and stress the need to use multiple experimental systems when evaluating the potential risk of environmental pollutants. Our data also indicate that an increased expression of CYP1A1 results in a synergistic effect of B[a]P and DBC in human cells. As humans are exposed to a plethora of noxious chemicals, our results have important implications for human carcinogenesis. - Highlights: • B[a]P:DBC mixtures were less genotoxic in V79MZh1A1 cells than B[a]P and DBC alone. • An antagonism between B[a]P and DBC was determined in rat liver WB-F344 cells. • The inhibition of CYP1a1 expression by B[a]P:DBC mixture

  15. Epoxidation of the methamphetamine pyrolysis product, trans-phenylpropene, to trans-phenylpropylene oxide by CYP enzymes and stereoselective glutathione adduct formation

    SciTech Connect

    Sanga, Madhu; Younis, Islam R.; Tirumalai, Padma S.; Bland, Tina M.; Banaszewska, Monica; Konat, Gregory W.; Tracy, Timothy S.; Gannett, Peter M.; Callery, Patrick S. . E-mail: pcallery@hsc.wvu.edu

    2006-03-01

    Pyrolytic products of smoked methamphetamine hydrochloride are well established. Among the various degradation products formed, trans-phenylpropene (trans-{beta}-methylstyrene) is structurally similar to styrene analogues known to be bioactivated by CYP enzymes. In human liver microsomes, trans-phenylpropene was converted to the epoxide trans-phenylpropylene oxide (trans-2-methyl-3-phenyloxirane) and cinnamyl alcohol. Incubation of trans-phenylpropene with microsomes in the presence of enzyme-specific P450 enzyme inhibitors indicated the involvement of CYP2E1, CYP1A2, and CYP3A4 enzymes. Both (R,R)-phenylpropylene oxide and (S,S)-phenylpropylene oxide were formed in human liver microsomal preparations. Enantiomers of trans-phenylpropylene oxide were stereoselectively and regioselectively conjugated in a Phase II drug metabolism reaction catalyzed by human liver cytosolic enzymes consisting of conjugation with glutathione. The structure of the phenylpropylene oxide-glutathione adduct is consistent with nucleophilic ring-opening by attack at the benzylic carbon. Exposure of cultured C6 glial cells to (S,S)-phenylpropylene oxide produced a cytotoxic response in a concentration-dependent manner based on cell degeneration and death.

  16. Structure of adducts of isoindolo[2,1-a]benzimidazole derivatives with maleimides

    NASA Astrophysics Data System (ADS)

    Korolev, Oleksandr; Yegorova, Tatyana; Levkov, Igor; Malytskyy, Volodymyr; Shishkin, Oleg; Zubatyuk, Roman; Palamarchuk, Genadiy; Vedrenne, Marc; Baltas, Michel; Voitenko, Zoia

    2015-03-01

    The selectivity of formation and some mechanistic insights during the synthesis of substituted isoindolo[2,1-a]benzimidazoles are discussed. Furthermore, the reactions of the obtained products with maleimides were carried out. Two types rearrangement adducts together with intermediate Michael type adducts were isolated. The influence of the reaction conditions and reagents ratio is discussed. Specific spectral criteria for the identification of the Michael type adducts are indicated.

  17. 32P-postlabeling DNA adduct assay: cigarette smoke-induced dna adducts in the respiratory and nonrespiratory rat tissues. Book chapter

    SciTech Connect

    Gupta, R.C.; Gairola, C.G.

    1990-01-01

    An analysis of the tissue DNA adducts in rats by the sensitive (32)p-postlabeling assay showed one to eight detectable DNA adducts in lung, trachea, larynx, heart and bladder of the sham controls. Chronic exposure of animals to mainstream cigarette smoke showed a remarkable enhancement of most adducts in the lung and heart DNA. Since cigarette smoke contains several thousand chemicals and a few dozen of them are known or potential carcinogens, the difference between the DNA adducts of nasal and the other tissues may reflect the diversity of reactive constituents and their differential absorption in different tissues. In comparison to the lung DNA adducts, the adducts in nasal DNA were less hydrophobic. Identity of the predominant adducts was further investigated by comparison with several reference DNA adducts from 10 PAH and aromatic amines. Since some of these chemicals are present in cigarette smoke, the results suggest that these constituents of cigarette smoke may not be directly responsible for formation of DNA adducts in the lung and heart of the smoke-exposed animals.

  18. Formation of Metal Clusters or Nitrogen-Bridged Adducts by Reaction of a Bis(amino)stannylene with Halides of Two-Valent Transition Metals.

    PubMed

    Veith, Michael; Müller, Alice; Stahl, Lothar; Nötzel, Martin; Jarczyk, Maria; Huch, Volker

    1996-06-19

    When the cyclic bis(amino)stannylene Me(2)Si(NtBu)(2)Sn is allowed to react with metal halides MX(2) (M = Cr, Fe, Co, Zn; X = Cl, Br [Zn]) adducts of the general formula [Me(2)Si(NtBu)(2)Sn.MX(2)](n) are obtained. The compounds are generally dimeric (n = 2) except the ZnBr(2) adduct, which is monomeric in benzene. The crystal structures of [Me(2)Si(NtBu)(2)Sn.CoCl(2)](2) (triclinic, space group &Pmacr;1; a = 8.620(9) Å, b = 9.160(9) Å, c = 12.280(9) Å, alpha = 101.2(1) degrees, beta = 97.6(1) degrees, gamma = 105.9(1) degrees, Z = 1) and of [Me(2)Si(NtBu)(2)Sn.ZnCl(2)](2) (monoclinic, space group P2(1)/c; a = 8.156(9) Å, b = 16.835(12) Å, c = 13.206(9) Å, beta = 94.27(6) degrees, Z = 2) were determined by X-ray diffraction techniques. The two compounds form similar polycyclic, centrosymmetrical assemblies of metal atoms bridged by chlorine or nitrogen atoms. While in the case of the cobalt compound Co is pentacoordinated by three chlorine and two nitrogen atoms, in the zinc derivative Zn is almost tetrahedrally coordinated by three chlorine atoms and one nitrogen atom. The iron derivative [Me(2)Si(NtBu)(2)Sn.FeCl(2)](2) seems to be isostructural with the cobalt compound as can be deduced from the crystal data (triclinic, a = 8.622(7) Å, b = 9.158(8) Å, c = 12.353(8) Å, alpha = 101.8(1) degrees, beta = 96.9(1) degrees, gamma = 105.9(1) degrees, Z = 1). If NiBr(2), PdCl(2), or PtCl(2) is combined with the stannylene, the reaction product is totally different: 4 equiv of the stannylene are coordinating per metal halide, forming the molecular compound [Me(2)Si(NtBu)(2)Sn](4)MX(2), which crystallizes with half a mole of benzene per molecular formula. The crystal structures of [Me(2)Si(NtBu)(2)Sn](4).NiBr(2).(1)/(2)C(6)H(6) (tetragonal, space group I4(1)/a, a = b = 43.86(4) Å, c = 14.32(2) Å, Z = 16) and [Me(2)Si(NtBu)(2)Sn](4).PdCl(2).(1)/(2)C(6)H(6) (tetragonal, space group I4(1)/a, a = b = 43.99(4) Å, c = 14.318(14) Å, Z = 16) reveal the two compounds to

  19. Covalent thiol adducts arising from reactive intermediates of cocaine biotransformation.

    PubMed

    Schneider, Kevin J; DeCaprio, Anthony P

    2013-11-18

    Exposure to cocaine results in the depletion of hepatocellular glutathione and macromolecular protein binding in humans. Such cocaine-induced responses have generally been attributed to oxidative stress and reactive metabolites resulting from oxidative activation of the cocaine tropane nitrogen. However, little conclusive data exists on the mechanistic pathways leading to protein modification or the structure and specificity of cocaine-derived adduction products. We now report a previously uncharacterized route of cocaine bioactivation leading to the covalent adduction of biological thiols, including cysteine and glutathione. Incubation of cocaine with biological nucleophiles in an in vitro biotransformation system containing human liver microsomes identified a monooxygenase-mediated event leading to the oxidation of, and subsequent sulfhydryl addition to, the cocaine aryl moiety. Adduct structures were confirmed using ultra-high performance liquid chromatography coupled to high resolution, high mass accuracy mass spectrometry. Examination of assays containing transgenic bactosomes expressing single human cytochrome P450 isoforms determined the role of P450s 1A2, 2C19, and 2D6 in the oxidation process resulting in adduct formation. P450-catalyzed aryl epoxide formation and subsequent attack by free nucleophilic moieties is consistent with the resulting adduct structures, mechanisms of formation, and the empirical observation of multiple structural and stereo isomers. Analogous adduction mechanisms were maintained across all sulfhydryl-containing nucleophile models examined; N-acetylcysteine, glutathione, and a synthetic cysteine-containing hexapeptide. Predictive in silico calculations of molecular reactivity and electrophilicity/nucleophilicity were compared to the results of in vitro assay incubations in order to better understand the adduction process using the principles of hard and soft acid and base (HSAB) theory. This study elucidated a novel metabolic

  20. Zinc acetylacetonate hydrate adducted with nitrogen donor ligands: Synthesis, spectroscopic characterization, and thermal analysis

    NASA Astrophysics Data System (ADS)

    Brahma, Sanjaya; Shivashankar, S. A.

    2015-12-01

    We report synthesis, spectroscopic characterization, and thermal analysis of zinc acetylacetonate complex adducted by nitrogen donor ligands, such as pyridine, bipyridine, and phenanthroline. The pyridine adducted complex crystallizes to monoclinic crystal structure, whereas other two adducted complexes have orthorhombic structure. Addition of nitrogen donor ligands enhances the thermal property of these complexes as that with parent metal-organic complex. Zinc acetylacetonate adducted with pyridine shows much higher volatility (106 °C), decomposition temperature (202 °C) as that with zinc acetylacetonate (136 °C, 220 °C), and other adducted complexes. All the adducted complexes are thermally stable, highly volatile and are considered to be suitable precursors for metal organic chemical vapor deposition. The formation of these complexes is confirmed by powder X-ray diffraction, Fourier transform infrared spectroscopy, mass spectroscopy, and elemental analysis. The complexes are widely used as starting precursor materials for the synthesis of ZnO nanostructures by microwave irradiation assisted coating process.

  1. CIGARETTE SMOKE-INDUCED DNA ADDUCTS IN THE RESPIRATORY AND NONRESPIRATORY TISSUE OF RATS

    EPA Science Inventory

    Formation of DNA adducts is regarded a- an essential initial step in the process of chemical carcinogenesis. To determine how chronic exposure to cigarette smoke affects the distribution of DNA adducts In selected respiratory and nonrespiratory tissues, we exposed male Sprague-Da...

  2. Benzo(a)pyrene (B(a)P) metabolism and in vitro formation of B(a)P-DNA adducts by hepatic microsomes from rats fed diets containing corn and menhaden oils

    SciTech Connect

    Dharwadkar, S.; Bellow, J.; Ramanathan, R.; Wade, A.

    1986-03-01

    Dietary unsaturated fat is required for maximum induction of hepatic mixed function oxidases responsible for activating carcinogens which may bind covalently to DNA. The aim of this study was to assess the influence of dietary fat type on in vitro B(a)P metabolism and B(a)P-DNA adduct formation. Male rats were starved 2 days and refed diet devoid of fat, or containing 20% corn oil (CO) or 20% menhaden oil (MO) for 4 days. Both dietary fats increased Vmax for B(a)P hydroxylation without affecting Km. Phenobarbital (PB) administration increased Vmax in all animals but Km was increased only in rats fed the fat diets. PB resulted in decreased B(a)P metabolism when conducted at 15 =M only in rats fed the two fat diets even in the presence of increased cytochrome P-450 (P-450). This effect was due to a decrease in B(a)P metabolism at low substrate concentrations in PB treated fat-fed animals. Binding of B(a)P to calf-thymus DNA was increased in animals fed both fats which was enhanced further by PB only in rats fed the CO and MO diets. When the data are calculated as B(a)P metabolized per unit of P-450, PB seems to induce a P-450 in fat-fed animals having lower affinity and capacity for B(a)P metabolism and activation.

  3. Cigarette smoke-induced DNA-damage: role of hydroquinone and catechol in the formation of the oxidative DNA-adduct, 8-hydroxydeoxyguanosine.

    PubMed

    Leanderson, P; Tagesson, C

    1990-01-01

    This study demonstrates the ability of cigarette smoke condensate to generate hydrogen peroxide and to hydroxylate deoxyguanosine (dG) residues in isolated DNA to 8-hydroxydeoxyguanosine (8-OHdG). Both the formation of hydrogen peroxide and that of 8-OHdG in DNA was significantly decreased when catalase or tyrosinase was added to the smoke condensates, and this also occurred when pure hydroquinone or catechol, two major constitutes in cigarette smoke, was used instead of smoke condensate. Moreover, pure hydroquinone and catechol both caused dose-dependent formation of hydrogen peroxide and 8-OHdG, and there was good correlation between the amounts of hydrogen peroxide and 8-OHdG formed. These findings suggest that (i) hydroquinone and catechol may be responsible for the ability of cigarette smoke to cause 8-OHdG formation in DNA, (ii) this oxidative DNA-damage is due to the action of hydroxyl radicals formed during dissociation of hydrogen peroxide and (iii) the hydrogen peroxide in cigarette smoke is generated via autooxidation of hydroquinone and catechol. PMID:2114224

  4. Urinary biomarkers suggest that estrogen-DNA adducts may play a role in the aetiology of non-Hodgkin lymphoma

    PubMed Central

    Gaikwad, Nilesh W.; Yang, Li; Weisenburger, Dennis D.; Vose, Julie; Beseler, Cheryl; Rogan, Eleanor G.; Cavalieri, Ercole L.

    2015-01-01

    A variety of evidence suggests that estrogens may induce non-Hodgkin lymphoma (NHL). The reaction of catechol estrogen quinones with DNA to form depurinating estrogen-DNA adducts is hypothesized to initiate this process. These adducts are released from DNA, shed from cells into the bloodstream and excreted in urine. The aim of this study was to determine whether or not the depurinating estrogen-DNA adducts might be involved in the aetiology of human NHL. Estrogen metabolites, conjugates and depurinating DNA adducts were identified and quantified in spot urine samples from 15 men with NHL and 30 healthy control men by using ultraperformance liquid chromatography/tandem mass spectrometry. The levels of estrogen-DNA adducts were significantly higher in the men with NHL than in the healthy control men. Thus, formation of estrogen-DNA adducts may play a critical role in the aetiology of NHL, and these adducts could be potential biomarkers of NHL risk. PMID:19863189

  5. Glutathione transferase A4-4 resists adduction by 4-hydroxynonenal☆

    PubMed Central

    Shireman, Laura M.; Kripps, Kimberly A.; Balogh, Larissa M.; Conner, Kip P.; Whittington, Dale; Atkins, William M.

    2010-01-01

    4-Hydroxy-2-trans-nonenal (HNE) is a lipid peroxidation product that contributes to the pathophysiology of several diseases with components of oxidative stress. The electrophilic nature of HNE results in covalent adduct formation with proteins, fatty acids and DNA. However, it remains unclear whether enzymes that metabolize HNE avoid inactivation by it. Glutathione transferase A4-4 (GST A4-4) plays a significant role in the elimination of HNE by conjugating it with glutathione (GSH), with catalytic activity toward HNE that is dramatically higher than the homologous GST A1-1 or distantly related GSTs. To determine whether enzymes that metabolize HNE resist its covalent adduction, the rates of adduction of these GST isoforms were compared and the functional effects of adduction on catalytic properties were determined. Although GST A4-4 and GST A1-1 have striking structural similarity, GST A4-4 was insensitive to adduction by HNE under conditions that yield modest adduction of GST A1-1 and extensive adduction of GST P1-1. Furthermore, adduction of GST P1-1 by HNE eliminated its activity toward the substrates 1-chloro- 2,4-dinitrobenzene (CDNB) and toward HNE itself. HNE effects on GST A4-4 and A1-1 were less significant. The results indicate that enzymes that metabolize HNE may have evolved structurally to resist covalent adduction by it. PMID:20836986

  6. Glutathione transferase A4-4 resists adduction by 4-hydroxynonenal.

    PubMed

    Shireman, Laura M; Kripps, Kimberly A; Balogh, Larissa M; Conner, Kip P; Whittington, Dale; Atkins, William M

    2010-12-15

    4-Hydroxy-2-trans-nonenal (HNE) is a lipid peroxidation product that contributes to the pathophysiology of several diseases with components of oxidative stress. The electrophilic nature of HNE results in covalent adduct formation with proteins, fatty acids and DNA. However, it remains unclear whether enzymes that metabolize HNE avoid inactivation by it. Glutathione transferase A4-4 (GST A4-4) plays a significant role in the elimination of HNE by conjugating it with glutathione (GSH), with catalytic activity toward HNE that is dramatically higher than the homologous GST A1-1 or distantly related GSTs. To determine whether enzymes that metabolize HNE resist its covalent adduction, the rates of adduction of these GST isoforms were compared and the functional effects of adduction on catalytic properties were determined. Although GST A4-4 and GST A1-1 have striking structural similarity, GST A4-4 was insensitive to adduction by HNE under conditions that yield modest adduction of GST A1-1 and extensive adduction of GST P1-1. Furthermore, adduction of GST P1-1 by HNE eliminated its activity toward the substrates 1-chloro-2,4-dinitrobenzene (CDNB) and toward HNE itself. HNE effects on GST A4-4 and A1-1 were less significant. The results indicate that enzymes that metabolize HNE may have evolved structurally to resist covalent adduction by it. PMID:20836986

  7. Detection and comparison of DNA adducts after in vitro and in vivo diesel emission exposures

    SciTech Connect

    Gallagher, J.; George, M.; Kohan, M.; Thompson, C.; Shank, T.

    1993-01-01

    Development of methodologies to evaluate certain classes of polycyclic aromatic compounds (PAC) detected in complex mixtures to which humans are exposed would greatly improve the diagnostic potential of (32)P-postlabeling analysis. Identification of DNA adduct patterns of specific exposure-related marker adducts would strengthen associations between observed DNA adducts and exposures to different environmental pollutants (e.g., kerosene, cigarette smoke, coke oven, and diesel). Diesel-modified DNA adduct patterns were compared in various in vitro and in vivo rodent model systems and then compared to DNA reactive oxidative and reductive metabolites of 1-nitropyrene. The formation of nitrated-polycyclic aromatic hydrocarbon (nitrated-PAH) DNA adducts, derived from the metabolism of diesel extract constituents, was enhanced relative to other PAH-derived DNA adducts via xanthine oxidase-catalyzed nitroreduction. These adducts were detectable only by the butanol extraction version of the postlabeling analysis. Marker adducts detected in the various test systems presented here will assist in characterizing nuclease-P1-sensitive nitrated PAH adducts in humans.

  8. Proton-coupled electron transfer and adduct configuration are important for C4a-hydroperoxyflavin formation and stabilization in a flavoenzyme.

    PubMed

    Wongnate, Thanyaporn; Surawatanawong, Panida; Visitsatthawong, Surawit; Sucharitakul, Jeerus; Scrutton, Nigel S; Chaiyen, Pimchai

    2014-01-01

    Determination of the mechanism of dioxygen activation by flavoenzymes remains one of the most challenging problems in flavoenzymology for which the underlying theoretical basis is not well understood. Here, the reaction of reduced flavin and dioxygen catalyzed by pyranose 2-oxidase (P2O), a flavoenzyme oxidase that is unique in its formation of C4a-hydroperoxyflavin, was investigated by density functional calculations, transient kinetics, and site-directed mutagenesis. Based on work from the 1970s-1980s, the current understanding of the dioxygen activation process in flavoenzymes is believed to involve electron transfer from flavin to dioxygen and subsequent proton transfer to form C4a-hydroperoxyflavin. Our findings suggest that the first step of the P2O reaction is a single electron transfer coupled with a proton transfer from the conserved residue, His548. In fact, proton transfer enhances the electron acceptor ability of dioxygen. The resulting ·OOH of the open-shell diradical pair is placed in an optimal position for the formation of C4a-hydroperoxyflavin. Furthermore, the C4a-hydroperoxyflavin is stabilized by the side chains of Thr169, His548, and Asn593 in a "face-on" configuration where it can undergo a unimolecular reaction to generate H2O2 and oxidized flavin. The computational results are consistent with kinetic studies of variant forms of P2O altered at residues Thr169, His548, and Asn593, and kinetic isotope effects and pH-dependence studies of the wild-type enzyme. In addition, the calculated energy barrier is in agreement with the experimental enthalpy barrier obtained from Eyring plots. This work revealed new insights into the reaction of reduced flavin with dioxygen, demonstrating that the positively charged residue (His548) plays a significant role in catalysis by providing a proton for a proton-coupled electron transfer in dioxygen activation. The interaction around the N5-position of the C4a-hydroperoxyflavin is important for dictating the

  9. MS/MS and LC-MS/MS analysis of choline/ethanolamine plasmalogens via promotion of alkali metal adduct formation.

    PubMed

    Otoki, Yurika; Nakagawa, Kiyotaka; Kato, Shunji; Miyazawa, Teruo

    2015-11-01

    Tandem mass spectrometry (MS/MS) has been used for the analysis of plasmalogen (Pls), a physiologically important class of vinyl ether-linked phospholipid. However, MS/MS generally causes little fragmentation of Pls, especially choline Pls (PC-Pls). Previous MS/MS studies reported an increased formation of product ions of PC-Pls (and also ethanolamine Pls (PE-Pls)) in the presence of 'alkali metals.' Therefore, use of alkali metals considerably leads to the development of a method for analysis of both PC- and PE-Pls. In this study, this notion was evaluated using quadrupole-time-of-flight MS/MS and liquid chromatography (LC) coupled with MS/MS. Results from MS/MS confirmed that alkali metals (e.g., sodium) produced significant fragmentation of PC-Pls and PE-Pls. A number of structure-diagnostic product ions exhibiting high intensities were observed under optimized MS/MS conditions using alkali metals. Moreover, the ability to selectively and sensitively identify PC-Pls and PE-Pls at the molecular species level in biological samples (rat brain and heart) was demonstrated using LC-MS/MS. Therefore, the herein developed method appears to be a powerful tool for analyzing Pls and may provide a better understanding of their physiological roles in vivo. PMID:26447938

  10. Cytochrome P4501A induction, benzo[a]pyrene metabolism, and nucleotide adduct formation in fish hepatoma cells: Effect of preexposure to 3,3',4,4',5-pentachlorobiphenyl

    USGS Publications Warehouse

    Smeets, J.M.W.; Voormolen, A.; Tillitt, D.E.; Everaarts, J.M.; Seinen, W.; Vanden Berg, M.D.

    1999-01-01

    In PLHC-1 hepatoma cells, benzo[a]pyrene (B[a]P) caused a maximum induction of cytochrome P4501A (CYP1A) activity, measured as ethoxyresorufin O-deethylation (EROD), after 4 to 8 h of exposure, depending on the B[a]P concentration. The decline of EROD activity at longer exposure times was probably caused by the rapid metabolism of B[a]P in this system (57% metabolism within 4 h incubation). In subsequent experiments, PLHC-1 cells were preinduced with PCB 126 for 24 h and then received a dose of 10, 100, or 1,000 nM 3H-B[a]P. A 1-nM concentration of PCB 126 caused an 80-fold induction of CYP1A activity, resulting in an increase in B[a]P metabolism of less than 10%, except at the highest concentration of B[a]P (1,000 nM), where a 50% increase was observed. In another experiment, an 80-fold induction of CYP1A activity caused a 20% increase in the metabolism of B[a]P (100 nM), and RNA adduct formation was increased approximately twofold. These results indicate that, at exposure concentrations up to 100 nM B[a]P, CYP1A activity is not rate limiting for B[a]P metabolism. Furthermore, CYP1A seems to also he specifically involved in B[a]P activation in PLHC-1 cells. However, CYP1A induction causes only a relatively small increase in activation, probably because of the action of other enzymes involved in B[a]P activation and deactivation.

  11. Depurinating estrogen-DNA adducts, generators of cancer initiation: their minimization leads to cancer prevention.

    PubMed

    Cavalieri, Ercole L; Rogan, Eleanor G

    2016-03-01

    Estrogens can initiate cancer by reacting with DNA. Specific metabolites of endogenous estrogens, the catechol estrogen-3,4-quinones, react with DNA to form depurinating estrogen-DNA adducts. Loss of these adducts leaves apurinic sites in the DNA, generating mutations that can lead to the initiation of cancer. A variety of endogenous and exogenous factors can disrupt estrogen homeostasis, which is the normal balance between estrogen activating and protective enzymes. In fact, if estrogen metabolism becomes unbalanced and generates excessive catechol estrogen 3,4-quinones, formation of depurinating estrogen-DNA adducts increases and the risk of initiating cancer is greater. The levels of depurinating estrogen-DNA adducts are high in women diagnosed with breast cancer and those at high risk for the disease. High levels of depurinating estrogen-DNA adducts before the presence of breast cancer indicates that adduct formation is a critical factor in breast cancer initiation. Women with thyroid or ovarian cancer also have high levels of estrogen-DNA adducts, as do men with prostate cancer or non-Hodgkin lymphoma. Depurinating estrogen-DNA adducts are initiators of many prevalent types of human cancer. These findings and other discoveries led to the recognition that reducing the levels of estrogen-DNA adducts could prevent the initiation of human cancer. The dietary supplements N-acetylcysteine and resveratrol inhibit formation of estrogen-DNA adducts in cultured human breast cells and in women. These results suggest that the two supplements offer an approach to reducing the risk of developing various prevalent types of human cancer. Graphical abstract Major metabolic pathway in cancer initiation by estrogens. PMID:26979321

  12. NADH:Cytochrome b5 Reductase and Cytochrome b5 Can Act as Sole Electron Donors to Human Cytochrome P450 1A1-Mediated Oxidation and DNA Adduct Formation by Benzo[a]pyrene

    PubMed Central

    2016-01-01

    Benzo[a]pyrene (BaP) is a human carcinogen that covalently binds to DNA after activation by cytochrome P450 (P450). Here, we investigated whether NADH:cytochrome b5 reductase (CBR) in the presence of cytochrome b5 can act as sole electron donor to human P450 1A1 during BaP oxidation and replace the canonical NADPH:cytochrome P450 reductase (POR) system. We also studied the efficiencies of the coenzymes of these reductases, NADPH as a coenzyme of POR, and NADH as a coenzyme of CBR, to mediate BaP oxidation. Two systems containing human P450 1A1 were utilized: human recombinant P450 1A1 expressed with POR, CBR, epoxide hydrolase, and cytochrome b5 in Supersomes and human recombinant P450 1A1 reconstituted with POR and/or with CBR and cytochrome b5 in liposomes. BaP-9,10-dihydrodiol, BaP-7,8-dihydrodiol, BaP-1,6-dione, BaP-3,6-dione, BaP-9-ol, BaP-3-ol, a metabolite of unknown structure, and two BaP-DNA adducts were generated by the P450 1A1-Supersomes system, both in the presence of NADPH and in the presence of NADH. The major BaP-DNA adduct detected by 32P-postlabeling was characterized as 10-(deoxyguanosin-N2-yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydro-BaP (assigned adduct 1), while the minor adduct is probably a guanine adduct derived from 9-hydroxy-BaP-4,5-epoxide (assigned adduct 2). BaP-3-ol as the major metabolite, BaP-9-ol, BaP-1,6-dione, BaP-3,6-dione, an unknown metabolite, and adduct 2 were observed in the system using P450 1A1 reconstituted with POR plus NADPH. When P450 1A1 was reconstituted with CBR and cytochrome b5 plus NADH, BaP-3-ol was the predominant metabolite too, and an adduct 2 was also generated. Our results demonstrate that the NADH/cytochrome b5/CBR system can act as the sole electron donor both for the first and second reduction of P450 1A1 during the oxidation of BaP in vitro. They suggest that NADH-dependent CBR can replace NADPH-dependent POR in the P450 1A1-catalyzed metabolism of BaP. PMID:27404282

  13. Lack of Involvement of CEP Adducts in TLR Activation and in Angiogenesis

    PubMed Central

    Gounarides, John; Cobb, Jennifer S.; Zhou, Jing; Cook, Frank; Yang, Xuemei; Yin, Hong; Meredith, Erik; Rao, Chang; Huang, Qian; Xu, YongYao; Anderson, Karen; De Erkenez, Andrea; Liao, Sha-Mei; Crowley, Maura; Buchanan, Natasha; Poor, Stephen; Qiu, Yubin; Fassbender, Elizabeth; Shen, Siyuan; Woolfenden, Amber; Jensen, Amy; Cepeda, Rosemarie; Etemad-Gilbertson, Bijan; Giza, Shelby; Mogi, Muneto; Jaffee, Bruce; Azarian, Sassan

    2014-01-01

    Proteins that are post-translationally adducted with 2-(ω-carboxyethyl)pyrrole (CEP) have been proposed to play a pathogenic role in age-related macular degeneration, by inducing angiogenesis in a Toll Like Receptor 2 (TLR2)-dependent manner. We have investigated the involvement of CEP adducts in angiogenesis and TLR activation, to assess the therapeutic potential of inhibiting CEP adducts and TLR2 for ocular angiogenesis. As tool reagents, several CEP-adducted proteins and peptides were synthetically generated by published methodology and adduction was confirmed by NMR and LC-MS/MS analyses. Structural studies showed significant changes in secondary structure in CEP-adducted proteins but not the untreated proteins. Similar structural changes were also observed in the treated unadducted proteins, which were treated by the same adduction method except for one critical step required to form the CEP group. Thus some structural changes were unrelated to CEP groups and were artificially induced by the synthesis method. In biological studies, the CEP-adducted proteins and peptides failed to activate TLR2 in cell-based assays and in an in vivo TLR2-mediated retinal leukocyte infiltration model. Neither CEP adducts nor TLR agonists were able to induce angiogenesis in a tube formation assay. In vivo, treatment of animals with CEP-adducted protein had no effect on laser-induced choroidal neovascularization. Furthermore, in vivo inactivation of TLR2 by deficiency in Myeloid Differentiation factor 88 (Myd88) had no effect on abrasion-induced corneal neovascularization. Thus the CEP-TLR2 axis, which is implicated in other wound angiogenesis models, does not appear to play a pathological role in a corneal wound angiogenesis model. Collectively, our data do not support the mechanism of action of CEP adducts in TLR2-mediated angiogenesis proposed by others. PMID:25343517

  14. Significance of DNA adduct studies in animal models for cancer molecular dosimetry and risk assessment.

    PubMed Central

    Beland, F A; Poirier, M C

    1993-01-01

    To elucidate the relationship between DNA adduct formation and tumorigenesis, a number of experiments have been conducted to measure DNA adducts in target tissues from experimental animals during continuous exposure to carcinogens. With aflatoxins, aromatic amines, and polycyclic aromatic hydrocarbons, tumor induction appears to be associated with the major DNA adduct detected, whereas with N-nitrosamines the response is normally correlated with minor forms of DNA damage. During continuous carcinogen administration, steady-state adduct concentrations are generally obtained in the target tissues, and there is often a linear correlation between the carcinogen concentration and the steady-state DNA adduct level. Exceptions exist when the mechanism of activation changes or with the onset of significant toxicity. Steady-state DNA adduct levels are often linearly related to the tumorigenic response. Carcinogen-induced cell proliferation occurs when significant deviations from linearity are observed. Because DNA adducts detected in humans are chemically identical to those found in experimental animals, DNA adduct data in animals may contribute to our understanding of human cancer risk. PMID:8319658

  15. Benzo(a)pyrene-albumin adducts in humans exposed to polycyclic aromatic hydrocarbons in an industrial area of Poland.

    PubMed Central

    Kure, E H; Andreassen, A; Ovrebø, S; Grzybowska, E; Fiala, Z; Strózyk, M; Chorazy, M; Haugen, A

    1997-01-01

    OBJECTIVES: The interaction of benzo(a)pyrene with serum albumin was measured in an attempt to identify the actual exposure and to evaluate albumin adduct measurements as biomarkers for exposure monitoring. METHODS: Benzo(a)pyrene-diol-epoxide (BPDE)-albumin adducts were measured by competitive enzyme linked immunosorbent assay (ELISA) in plasma of coke oven plant workers from three plants and from people living in a highly industrialised area of Silesia in Poland. Due to the high air concentrations of polycyclic aromatic hydrocarbons (PAHs) in this area, a control group was selected from a rural non-industrialised area in Poland. Breathing zone air measurements of PAHs were collected from some of the participants. RESULTS: Coke oven plant workers and non-occupationally exposed people had similar concentrations of albumin adducts whereas the rural controls were significantly lower (2.74 fmol adducts/microgram albumin (SEM 0.124)). The mean concentration of BPDE-albumin adduct in plasma of both the occupational and the environmental groups were significantly higher in the summer samples (4.34 fmol adducts/microgram albumin (SEM 0.335) and 4.55 fmol adducts/microgram albumin (SEM 0.296), respectively) than in the winter samples (3.06 fmol adducts/microgram albumin (SEM 0.187) and 3.04 fmol adducts/microgram albumin (SEM 0.184), respectively) even though the air measurements showed higher concentrations of PAHs in the winter. The statistical analysis did not show any effects of air exposures on concentrations of BPDE-albumin adduct. CONCLUSIONS: A multiple regression analysis of the measured concentrations of BPDE-albumin adducts for all the groups, during both seasons, indicates that occupational exposures do not contribute significantly to the formation of adducts. In general, the concentrations of albumin adducts found vary within relatively small limits for the two seasons and between the various groups of participants. No extreme differences were found. PMID

  16. DNA adducts-chemical addons

    PubMed Central

    Rajalakshmi, T. R.; AravindhaBabu, N.; Shanmugam, K. T.; Masthan, K. M. K.

    2015-01-01

    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers. PMID:26015708

  17. DNA adducts-chemical addons.

    PubMed

    Rajalakshmi, T R; AravindhaBabu, N; Shanmugam, K T; Masthan, K M K

    2015-04-01

    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers. PMID:26015708

  18. DNA adducts as a measure of lung cancer risk in humans exposed to polycyclic aromatic hydrocarbons.

    PubMed Central

    Kriek, E; Van Schooten, F J; Hillebrand, M J; Van Leeuwen, F E; Den Engelse, L; De Looff, A J; Dijkmans, A P

    1993-01-01

    Workers in the coking, foundry, and aluminum industry can be exposed to high concentrations of polycyclic aromatic hydrocarbons (PAHs) and are at increased risk for lung cancer, as are cigarette smokers. In recent years several studies on workers in the foundry and coking industries have been reported. In these studies, white blood cell(WBC) DNA was used for analysis of PAH-DNA adducts. Theoretically, DNA adduct formation is a more relevant biological parameter for assessing exposure risk than PAH in the work atmosphere, or the amount of a metabolite in the urine, because adduct levels reflect that part of the dose that escapes detoxification and binds to DNA. We analyzed WBC DNA from coke-oven workers and from workers in an aluminum production plant and demonstrated the presence of PAH-DNA adducts. Forty-seven percent of the coke-oven workers had detectable levels of PAH-DNA adducts in their WBC compared with 27% of the controls (p < 0.05), measured with ELISA. In both groups, smokers had significantly higher levels of PAH-DNA adducts than did nonsmokers. In the aluminum workers, no PAH-DNA adducts were detected by ELISA, although the benzo[a]pyrene concentrations in the work atmosphere were comparable to those of the coke-oven workers. The more sensitive 32P-postlabeling assay showed the presence of PAH-DNA adducts in 91% of the aluminum workers. There was no correlation of WBC adduct levels with the concentration of PAH in the work atmosphere. Recently we showed that total PAH-DNA adduct levels in WBC from lung cancer patients were much higher than those generally found in healthy smokers.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8319662

  19. Line narrowing spectroscopic studies of DNA-carcinogen adducts and DNA-dye complexes

    SciTech Connect

    Suh, Myungkoo

    1995-12-06

    Laser-induced fluorescence line narrowing and non-line narrowing spectroscopic methods were applied to conformational studies of stable DNA adducts of the 7{beta}, 8{alpha}-dihydoxy-9{alpha}, l0{alpha}-epoxy-7,8,9, 10-tetrahydrobenzo[{alpha}]pyrene (anti-BPDE). Stereochemically distinct (+)-trans-, ({minus})-trans-, (+)-cis- and ({minus})-cis adducts of anti-BPDE bound to exocyclic amino group of the central guanine in an 11-mer oligonucleotide, exist in a mixture of conformations in frozen aqueous buffer matrices. The (+)-trans adduct adopts primarily an external conformation with a smaller fraction ( {approximately} 25 %) exists in a partially base-stacked conformation. Both cis adducts were found to be intercalated with significant {pi}-{pi} stacking interactions between the pyrenyl residues and the bases. Conformations of the trans-adduct of (+)-anti -BPDE in 11-mer oligonucleotides were studied as a function of flanking bases. In single stranded form the adduct at G{sub 2} or G{sub 3} (5 ft-flanking, base guanine) adopts a conformation with strong, interaction with the bases. In contrast, the adduct with a 5ft-flanking, thymine exists in a primarily helixexternal conformation. Similar differences were observed in the double stranded oligonucleotides. The nature of the 3ft-flanking base has little influence on the conformational equilibrium of the (+)-trans-anti BPDE-dG adduct. The formation and repair of BPDE-N{sup 2}-dG in DNA isolated from the skin of mice treated topically with benzo[{alpha}]pyrene (BP) was studied. Low-temperature fluorescence spectroscopy of the intact DNA identified the major adduct as (+)-trans-anti-BPDE-N-dG, and the minor adduct fraction consisted mainly of (+)-cis-anti-BPDE-N{sup 2}-dG.

  20. The boron trifluoride nitromethane adduct

    NASA Astrophysics Data System (ADS)

    Ownby, P. Darrell

    2004-02-01

    The separation of the boron isotopes using boron trifluoride·organic-donor, Lewis acid·base adducts is an essential first step in preparing 10B enriched and depleted crystalline solids so vital to nuclear studies and reactor applications such as enriched MgB 2, boron carbide, ZrB 2, HfB 2, aluminum boron alloys, and depleted silicon circuits for radiation hardening and neutron diffraction crystal structure studies. The appearance of this new adduct with such superior properties demands attention in the continuing search for more effective and efficient means of separation. An evaluation of the boron trifluoride nitromethane adduct, its thermodynamic and physical properties related to large-scale isotopic separation is presented. Its remarkably high separation factor was confirmed to be higher than the expected theoretical value. However, the reportedly high acid/donor ratio was proven to be an order of magnitude lower. On-going research is determining the crystal structure of deuterated and 11B enriched 11BF 3·CD 3NO 2 by X-ray and neutron diffraction.

  1. Transplatin-conjugated triplex-forming oligonucleotides form adducts with both strands of DNA.

    PubMed

    Campbell, Meghan A; Miller, Paul S

    2009-12-01

    Triplex-forming oligonucleotides (TFOs) can bind to polypurine x polypyrimidine tracts in DNA and, as a consequence, perturb the normal functioning of a targeted gene. The effectiveness of such antigene TFOs can potentially be enhanced by covalent attachment of the TFO to its DNA target. Here, we report that attachment of N-7-platinated guanine nucleosides to the 3'- and/or 5'-ends of oligopyrimidine TFOs enables these TFOs to form highly stable adducts with target DNA deoxyguanosines or deoxyadenosines that are adjacent to the TFO binding site. Such adduct formation stably anchors the TFO to its target. Depending on the sequences adjacent to the TFO binding site, adduct formation can occur on either strand of the DNA. Adduct formation by 3',5'-bis-platinated TFOs can result in the formation of an interstrand cross-link between both strands of the DNA duplex. Formation of the adducts, which could be reversed by treatment with sodium cyanide, was dependent upon the ability of the TFO to bind to DNA and appeared to occur at a rate slower than that at which the TFO bound to the DNA duplex. The extent of adduct formation at 37 degrees C by platinated deoxyribo-TFOs diminished as the pH was increased from 6.5 to 7.4. In contrast, high levels (approximately 86%) of adduct formation by platinated 2'-O-methylribo-TFOs were observed at both pH 6.5 and pH 7.4. Platinated 2'-O-methylribo-TFOs were also shown to bind to plasmid DNA and inhibit transcription in vitro, and to inhibit plasmid replication in E. coli cells. These results suggest that platinum-conjugated TFOs may be good candidates for use as antigene agents. PMID:19950917

  2. Polycyclic aromatic hydrocarbon-DNA adducts and the CYP1A1 restriction fragment length polymorphism

    SciTech Connect

    Shields, P.G.; Bowman, E.D.; Weston, A.; Harris, C.C.; Sugimura, H.; Caporaso, N.E.; Petruzzelli, S.F. ); Trump, B.F. )

    1992-11-01

    Human cancer risk assessment at a genetic level involves the investigation of carcinogen metabolism and DNA adduct formation. Wide interindividual differences in metabolism result in different DNA adduct levels. For this and other reasons, many laboratories have considered DNA adducts to be a measure of the biologically effective dose of a carcinogen. Techniques for studying DNA adducts using chemically specific assays are becoming available. A modification of the [sup 32]P-postlabeling assay for polycyclic aromatic hydrocarbon DNA adducts described here provides potential improvements in quantification. DNA adducts, however, reflect only recent exposure to carcinogens; in contrast, genetic testing for metabolic capacity indicates the extent to which carcinogens can be activated and exert genotoxic effects. Such studies may reflect both separate and integrated risk factors together with DNA adduct levels. A recently described restriction fragment length polymorphism for the CYP1A1, which codes for the cytochrome P450 enzyme primarily responsible for the metabolic activation of carcinogenic polycyclic aromatic hydrocarbons, has been found to be associated with lung cancer risk in a Japanese population. In a subset of individuals enrolled in a US lung cancer case-control study, no association with lung cancer was found. 17 refs., 3 figs.

  3. The Frequency of 1,4-Benzoquinone-Lysine Adducts in Cytochrome c Correlate with Defects in Apoptosome Activation

    PubMed Central

    Fisher, Ashley A.; Labenski, Matthew T.; Chapman, John D.; Bratton, Shawn B.; Monks, Terrence J.; Lau, Serrine S.

    2011-01-01

    Electrophile-mediated post-translational modifications (PTMs) are known to cause tissue toxicities and disease progression. These effects are mediated via site-specific modifications and structural disruptions associated with such modifications. 1,4-Benzoquinone (BQ) and its quinone-thioether metabolites are electrophiles that elicit their toxicity via protein arylation and the generation of reactive oxygen species. Site-specific BQ-lysine adducts are found on residues in cytochrome c that are necessary for protein-protein interactions, and these adducts contribute to interferences in its ability to facilitate apoptosome formation. To further characterize the structural and functional impact of these BQ-mediated PTMs, the original mixture of BQ-adducted cytochrome c was fractionated by liquid isoelectric focusing to provide various fractions of BQ-adducted cytochrome c species devoid of the native protein. The fractionation process separates samples based on their isoelectric point (pI), and because BQ adducts form predominantly on lysine residues, increased numbers of BQ adducts on cytochrome c correlate with a lower protein pI. Each fraction was analyzed for structural changes, and each was also assayed for the ability to support apoptosome-mediated activation of caspase-3. Circular dichroism revealed that several of the BQ-adducted cytochrome c species maintained a slightly more rigid structure in comparison to native cytochrome c. BQ-adducted cytochrome c also failed to activate caspase-3, with increasing numbers of BQ-lysine adducts corresponding to a greater inability to activate the apoptosome. In summary, the specific site of the BQ-lysine adducts, and the nature of the adduct, are important determinants of the subsequent structural changes to cytochrome c. In particular, adducts at sites necessary for protein-protein interactions interfere with the proapoptotic function of cytochrome c. PMID:21527774

  4. 7-Alkylguanine adduct levels in urine, lungs and liver of mice exposed to styrene by inhalation

    SciTech Connect

    Vodicka, Pavel Erik . E-mail: pvodicka@biomed.cas.cz; Linhart, Igor; Novak, Jan; Koskinen, Mikko; Vodickova, Ludmila; Hemminki, Kari

    2006-01-15

    This study describes urinary excretion of two nucleobase adducts derived from styrene 7,8-oxide (SO), i.e., 7-(2-hydroxy-1-phenylethyl)guanine (N7{alpha}G) and 7-(2-hydroxy-2-phenylethyl)guanine (N7{beta}G), as well as a formation of N7-SO-guanine adducts in lungs and liver of two month old male NMRI mice exposed to styrene by inhalation in a 3-week subacute study. Strikingly higher excretion of both isomeric nucleobase adducts in the first day of exposure was recorded, while the daily excretion of nucleobase adducts in following time intervals reached the steady-state level at 4.32 + 1.14 and 6.91 + 1.17 pmol/animal for lower and higher styrene exposure, respectively. {beta}-SO-guanine DNA adducts in lungs increased with exposure in a linear way (F = 13.7 for linearity and 0.17 for non-linearity, respectively), reaching at the 21st day the level of 23.0 adducts/10{sup 8} normal nucleotides, i.e., 0.74 fmol/{mu}g DNA of 7-alkylguanine DNA adducts for the concentration of 1500 mg/m{sup 3}, while no 7-SO-guanine DNA adducts were detected in the liver after 21 days of inhalation exposure to both of styrene concentrations. A comparison of 7-alkylguanines excreted in urine with 7-SO-guanines in lungs (after correction for depurination and for missing {alpha}-isomers) revealed that persisting 7-SO-guanine DNA adducts in lungs account for about 0.5% of the total alkylation at N7 of guanine. The total styrene-specific 7-guanine alkylation accounts for about 1.0 x 10{sup -5}% of the total styrene uptake, while N1-adenine alkylation contributes to this percentage only negligibly.

  5. The effect of knockout of sulfotransferases 1a1 and 1d1 and of transgenic human sulfotransferases 1A1/1A2 on the formation of DNA adducts from furfuryl alcohol in mouse models.

    PubMed

    Sachse, Benjamin; Meinl, Walter; Glatt, Hansruedi; Monien, Bernhard H

    2014-10-01

    Furfuryl alcohol is a rodent carcinogen present in numerous foodstuffs. Sulfotransferases (SULTs) convert furfuryl alcohol into the DNA reactive and mutagenic 2-sulfoxymethylfuran. Sensitive techniques for the isotope-dilution ultra performance liquid chromatography-tandem mass spectrometry quantification of resulting DNA adducts, e.g. N (2)-((furan-2-yl)methyl)-2'-deoxyguanosine (N (2)-MF-dG), were developed. To better understand the contribution of specific SULT forms to the genotoxicity of furfuryl alcohol in vivo, we studied the tissue distribution of N (2)-MF-dG in different mouse models. Earlier mutagenicity studies with Salmonella typhimurium strains expressing different human and murine SULT forms indicated that human SULT1A1 and murine Sult1a1 and 1d1 catalyze furfuryl alcohol sulfo conjugation most effectively. Here, we used three mouse lines to study the bioactivation of furfuryl alcohol by murine SULTs, FVB/N wild-type (wt) mice and two genetically modified models lacking either murine Sult1a1 or Sult1d1. The animals received a single dose of furfuryl alcohol, and the levels of the DNA adducts were determined in liver, kidney, lung, colon and small intestine. The effect of Sult1d1 gene disruption on the genotoxicity of furfuryl alcohol was moderate and limited to kidney and small intestine. In contrast, the absence of functional Sult1a1 had a massive influence on the adduct levels, which were lowered by 33-73% in all tissues of the female Sult1a1 null mice compared with the wt animals. The detection of high N (2)-MF-dG levels in a humanized mouse line expressing hSULT1A1/1A2 instead of endogeneous Sult1a1 and Sult1d1 supports the hypothesis that furfuryl alcohol is converted to the mutagenic 2-sulfoxymethylfuran also in humans. PMID:25053625

  6. Metabolism of the Antibacterial Triclocarban by Human Epidermal Keratinocytes to Yield Protein Adducts

    PubMed Central

    Schebb, Nils Helge; Buchholz, Bruce A.; Hammock, Bruce D.; Rice, Robert H.

    2012-01-01

    Previous studies of triclocarban suggest that its biotransformation could yield reactive metabolites that form protein adducts. Since the skin is the major route of triclocarban exposure, present work examined this possibility in cultured human keratinocytes. The results provide evidence for considerable biotransformation and protein adduct formation when cytochrome P450 activity is induced in the cells by TCDD, a model Ah receptor ligand. Since detecting low adduct levels in cells and tissues is difficult, we utilized the novel approach of accelerator mass spectrometry for this purpose. Exploiting the sensitivity of the method, we demonstrated that a substantial portion of triclocarban forms adducts with keratinocyte protein under the P450 inducing conditions employed. PMID:22711420

  7. Cigarette smoke-induced DNA adducts in the respiratory and nonrespiratory tissues of rats

    SciTech Connect

    Gairola, C.G.; Gupta, R.C. )

    1991-01-01

    Formation of DNA adducts is regarded as an essential initial step in the process of chemical carcinogenesis. To determine how chronic exposure to cigarette smoke affects the distribution of DNA adducts in selected respiratory and nonrespiratory tissues. The authors exposed male Sprague-Dawley rats daily to fresh mainstream smoke from the Univ. of Kentucky reference cigarettes (2R1) in a nose-only exposure system for 32 weeks. Blood carboxyhemoglobin, total particulate matter (TPM) intake, and pulmonary aryl hydrocarbon hydroxylase values indicated effective exposure of animals to cigarette smoke. DNA was extracted from three respiratory (larynx, trachea, and lung) and three nonrespiratory (liver, heart, and bladder) tissues and analyzed for DNA adducts by the {sup 32}P-postlabeling assay under conditions capable of detecting low levels of diverse aromatic/hydrophobic adducts. Data showed that the total DNA adducts in the lung, heart, and trachea, and larynx were increased by 10- to 20-fold in the smoke-exposed group. These data suggest selective formation of DNA adducts in the tissues.

  8. Abacavir forms novel cross-linking abacavir protein adducts in patients.

    PubMed

    Meng, Xiaoli; Lawrenson, Alexandre S; Berry, Neil G; Maggs, James L; French, Neil S; Back, David J; Khoo, Saye H; Naisbitt, Dean J; Park, B Kevin

    2014-04-21

    Abacavir (ABC), a nucleoside-analogue reverse transcriptase inhibitor, is associated with severe hypersensitivity reactions that are thought to involve the activation of CD8+ T cells in a HLA-B*57:01-restricted manner. Recent studies have claimed that noncovalent interactions of ABC with HLA-B*57:01 are responsible for the immunological reactions associated with ABC. However, the formation of hemoglobin-ABC aldehyde (ABCA) adducts in patients exposed to ABC suggests that protein conjugation might represent a pathway for antigen formation. To further characterize protein conjugation reactions, we used mass spectrometric methods to define ABCA modifications in patients receiving ABC therapy. ABCA formed a novel intramolecular cross-linking adduct on human serum albumin (HSA) in patients and in vitro via Michael addition, followed by nucleophilic adduction of the aldehyde with a neighboring protein nucleophile. Adducts were detected on Lys159, Lys190, His146, and Cys34 residues in the subdomain IB of HSA. Only a cysteine adduct and a putative cross-linking adduct were detected on glutathione S-transferase Pi (GSTP). These findings reveal that ABC forms novel types of antigens in all patients taking the drug. It is therefore vital that the immunological consequences of such pathways of haptenation are explored in the in vitro models that have been used by various groups to define new mechanisms of drug hypersensitivity exemplified by ABC. PMID:24571427

  9. Recognition of cisplatin adducts by cellular proteins.

    PubMed

    Kartalou, M; Essigmann, J M

    2001-07-01

    Cisplatin is a widely used chemotherapeutic agent. It reacts with nucleophilic bases in DNA and forms 1,2-d(ApG), 1,2-d(GpG) and 1,3-d(GpTpG) intrastrand crosslinks, interstrand crosslinks and monofunctional adducts. The presence of these adducts in DNA is through to be responsible for the therapeutic efficacy of cisplatin. The exact signal transduction pathway that leads to cell cycle arrest and cell death following treatment with the drug is not known but cell death is believed to be mediated by the recognition of the adducts by cellular proteins. Here we describe the structural information available for cisplatin and related platinum adducts, the interactions of the adducts with cellular proteins and the implications of these interactions for cell survival. PMID:11406166

  10. Thermal stability of DNA adducts induced by cyanomorpholinoadriamycin in vitro.

    PubMed Central

    Cullinane, C; Phillips, D R

    1993-01-01

    The Adriamycin derivative, cyanomorpholinoadriamycin (CMA) was reacted with DNA in vitro to form apparent interstrand crosslinks. The extent of interstrand crosslink formation was monitored by a gel electrophoresis assay and maximal crosslinking of DNA was observed within 1 hr with 5 microM of drug. The interstrand crosslinks were heat labile, with a midpoint melting temperature of 70 degrees C (10 min exposure to heat) in 45% formamide. When CMA-induced adducts were detected as blockages of lambda-exonuclease, 12 blockage sites were observed with 8 being prior to 5'-GG sequences, one prior to 5'-CC, one prior to 5'-GC and 2 at unresolved combinations of these sequences. These exonuclease-detected blockages reveal the same sites of CMA-induced crosslinking as detected by in vitro transcription footprinting and primer-extension blockages on single strand DNA, where the blockages at 5'-GG and 5'-CC were identified as sites of intrastrand crosslinking and the 5'-GC blockage as a probable site of interstrand crosslinking. The thermal stability of both types of crosslink (10 min exposure to heat) ranged from 63-70 degrees C at individual sites. High levels of adduct were detected with poly (dG-dC) but not with poly (dI-dC). These results suggest adduct formation involving an aminal linkage between the 3 position of the morpholino moiety and N2 of guanine. Images PMID:8493102

  11. Structural Characterization of Hydroxyl Radical Adducts in Aqueous Media

    NASA Astrophysics Data System (ADS)

    Janik, Ireneusz; Tripathi, G. N. R.

    2015-06-01

    The oxidation by the hydroxyl (OH) radical is one of the most widely studied reactions because of its central role in chemistry, biology, organic synthesis, and photocatalysis in aqueous environments, wastewater treatment, and numerous other chemical processes. Although the redox potential of OH is very high, direct electron transfer (ET) is rarely observed. If it happens, it mostly proceeds through the formation of elusive OH adduct intermediate which facilitates ET and formation of hydroxide anion. Using time resolved resonance Raman technique we structurally characterized variety of OH adducts to sulfur containing organic compounds, halide ions as well as some metal cations. The bond between oxygen of OH radical and the atom of oxidized molecule differs depending on the nature of solute that OH radical reacts with. For most of sulfur containing organics, as well as halide and pseudo-halide ions, our observation suggested that this bond has two-center three-electron character. For several metal aqua ions studied, the nature of the bond depends on type of the cation being oxidized. Discussion on spectral parameters of all studied hydroxyl radical adducts as well as the role solvent plays in their stabilization will be presented.

  12. The formation of cyclo-addition adducts in the reaction of an acetylene-terminated material with a bismaleimide: A model compound study for addition-type thermoplastics (ATTs) using metal catalysts

    SciTech Connect

    Soucek, M.D., Pater, R.H.; Ritenour, S.L.

    1993-12-31

    A model compound study using an acetylene-terminated material and a bismaleimide has provided evidence that a diruthenium complex Ru{sub 2}(CO){sub 6}[1,2-({mu}-PPh){sub 2}C{sub 6}H{sub 4}] and a rhodium complex Rh(PPh{sub 3}){sub 3}Cl can catalyze a Diels-Alder type cycloaddition in which acetylene-terminated material acts as a diene and the bismaleimide is a dieneophile. The molten state reaction of N-(3-ethynylphenyl) phthalimide and N-(4-phenoxyphenyl) maleimide with Ru{sub 2}(CO){sub 6}[{mu}-(PhP){sub 2}C{sub 6}H{sub 4}] or Rh(PPh{sub 3}){sub 3}Cl heated to 170{degrees}C led to two major products. The spectral data for the first major product is consistent with a 2:1 Diels-Alder adduct formed from two molecules of the acetylene compound and one molecule of the maleimide. The spectral data for the second major product is consistent with a 2:2 Diels-Alder adduct formed from two molecules of each reactant.

  13. Crystal structure of the 1,3,6,8-tetra-aza-tri-cyclo[4.3.1.1(3,8)]undecane (TATU)-4-nitro-phenol (1/2) adduct: the role of anomeric effect in the formation of a second hydrogen-bond inter-action.

    PubMed

    Rivera, Augusto; Osorio, Héctor Jairo; Uribe, Juan Manuel; Ríos-Motta, Jaime; Bolte, Michael

    2015-11-01

    In the title ternary co-crystalline adduct, C7H14N4·2C6H5NO3, mol-ecules are linked by two inter-molecular O-H⋯N hydrogen bonds, forming a tricomponent aggregates in the asymmetric unit. The hydrogen-bond formation to one of the N atoms is enough to induce structural stereoelectronic effects in the normal donor→acceptor direction. In the title adduct, the two independent nitro-phenol mol-ecules are essentially planar, with maximum deviations of 0.0157 (13) and 0.0039 (13) Å. The dihedral angles between the planes of the nitro group and the attached benzene rings are 4.04 (17) and 5.79 (17)°. In the crystal, aggregates are connected by C-H⋯O hydrogen bonds, forming a supra-molecular dimer enclosing an R 6 (6)(32) ring motif. Additional C-H⋯O inter-molecular hydrogen-bonding inter-actions form a second supra-molecular inversion dimer with an R 2 (2)(10) motif. These units are linked via C-H⋯O and C-H⋯N hydrogen bonds, forming a three-dimensional network. PMID:26594510

  14. Crystal structure of the 1,3,6,8-tetra­aza­tri­cyclo[4.3.1.13,8]undecane (TATU)–4-nitro­phenol (1/2) adduct: the role of anomeric effect in the formation of a second hydrogen-bond inter­action

    PubMed Central

    Rivera, Augusto; Osorio, Héctor Jairo; Uribe, Juan Manuel; Ríos-Motta, Jaime; Bolte, Michael

    2015-01-01

    In the title ternary co-crystalline adduct, C7H14N4·2C6H5NO3, mol­ecules are linked by two inter­molecular O—H⋯N hydrogen bonds, forming a tricomponent aggregates in the asymmetric unit. The hydrogen-bond formation to one of the N atoms is enough to induce structural stereoelectronic effects in the normal donor→acceptor direction. In the title adduct, the two independent nitro­phenol mol­ecules are essentially planar, with maximum deviations of 0.0157 (13) and 0.0039 (13) Å. The dihedral angles between the planes of the nitro group and the attached benzene rings are 4.04 (17) and 5.79 (17)°. In the crystal, aggregates are connected by C—H⋯O hydrogen bonds, forming a supra­molecular dimer enclosing an R 6 6(32) ring motif. Additional C—H⋯O inter­molecular hydrogen-bonding inter­actions form a second supra­molecular inversion dimer with an R 2 2(10) motif. These units are linked via C—H⋯O and C—H⋯N hydrogen bonds, forming a three-dimensional network. PMID:26594510

  15. Studies of two-center three-electron S...S bonds in [n-Pr{sub 2}S...Sn-Pr{sub 2}]{sup +} and [i-Pr{sub 2}S...Si-Pr{sub 2}]{sup +}: Thermochemistry of adduct formation and MS/MS metastable and collision-induced dissociation spectra of the adducts

    SciTech Connect

    James, M.A.; Illies, A.J.

    1996-09-26

    Gas-phase ion-molecule association reactions of n-propyl sulfide radical cation ([n-Pr{sub 2}S]{sup +}) with n-propyl sulfide (n-Pr{sub 2}S) were studied by equilibrium methods in CO{sub 2} bath gas to investigate the bond energy of the 2c-3e bond. The 2c-3e S...S bond enthalpy in [n-Pr{sub 2}S...Sn-Pr{sub 2}]{sup +} was determined to be 119 kJ/mol at 507 K. This results in a scaled S...S bond energy of 123 kJ/mol. The S...S bond enthalpy in the i-propyl sulfide dimer cation ([i-Pr{sub 2}S...Si-Pr{sub 2}]{sup +}) could not be determined due to a fragmentation reaction, the loss of an i-propyl group. MS/MS metastable and collision-induced dissociation experiments were carried out to determine metastable fragmentation pathways and to aid in structure analysis. The results are consistent with association products containing 2c-3e bonds; statistical unimolecular metastable fragmentation of the association adduct, [i-Pr{sub 2}S...Si-Pr{sub 2}]{sup +}, confirms the loss of the i-propyl group, which prevented the equilibrium experiments. 21 refs., 11 figs., 1 tab.

  16. DNA adducts of 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) in fetal tissues of patas monkeys after transplacental exposure.

    PubMed

    Josyula, S; Lu, L J; Salazar, J J; Nerurkar, P V; Jones, A B; Grady, J J; Snyderwine, E G; Anderson, L M

    2000-08-01

    Transplacental genotoxicity of the heterocyclic amine food-derived mutagen/carcinogen 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) has been investigated by (32)P-postlabeling assay for IQ-DNA adducts in maternal liver, placenta, and several fetal tissues of patas monkeys, after exposure to 15, 35, or 50 mg/kg IQ near the end of gestation or to the highest dose in the first or second trimester. Dose-dependent adduct formation occurred in all tissues, with the highest levels occurring in maternal liver. Adduct amounts were similar among fetal tissues and placenta, except for lower levels in fetal brain and slightly more adducts in fetal liver. Adducts in placenta, fetal liver, lung, kidney, skin, and adrenal gland, but not in maternal liver or fetal brain, increased significantly as gestation progressed. Pretreatment with phenobarbital, which induces CYP enzymes that detoxify IQ, decreased adducts in maternal liver and possibly placenta, but not in fetal tissues. The CYP inducer beta-naphthoflavone caused a significant increase in IQ-DNA adducts in fetal lungs. Regression analysis suggested that IQ activation in maternal and fetal liver and possibly placenta contributed to adduct formation in fetal tissues; adducts in placenta and/or fetal liver were strong predictors for those in most fetal tissues. The results indicate that exposure of pregnant primates to IQ results in DNA adduct formation in most fetal tissues, especially late in gestation; that upregulation of maternal detoxification does not provide fetal protection; and that adducts in placenta indicate adduct levels in fetal tissues. PMID:10906279

  17. [DNA adducts in human female genital organs].

    PubMed

    Postawski, Krzysztof; Przadka-Rabaniuk, Dorota; Monist, Marta; Baranowski, Włodzimierz

    2007-12-01

    DNA adducts, one of genetic damages markers, precede and finally can lead to oncogenic mutations. They appear in genome as a result of DNA bases damages caused by various and numerous environmental factors eg. ultraviolet light, ionic radiation, toxins and also endogenic substances, for example estrogens. It is believed that the creation of DNA adducts is a necessary but insufficient process for the neoplastic transformation of the cell. The following review presents concise knowledge about the DNA adducts creation and their sequels served in healthy and cancerous tissues of the female genital organs, on the base of the available data. PMID:18411923

  18. Malondialdehyde–Deoxyguanosine Adducts among Workers of a Thai Industrial Estate and Nearby Residents

    PubMed Central

    Peluso, Marco; Srivatanakul, Petcharin; Munnia, Armelle; Jedpiyawongse, Adisorn; Ceppi, Marcello; Sangrajrang, Suleeporn; Piro, Sara; Boffetta, Paolo

    2010-01-01

    Background Humans living near industrial point emissions can experience high levels of exposures to air pollutants. Map Ta Phut Industrial Estate in Thailand is the location of the largest steel, oil refinery, and petrochemical factory complexes in Southeast Asia. Air pollution is an important source of oxidative stress and reactive oxygen species, which interact with DNA and lipids, leading to oxidative damage and lipid peroxidation, respectively. Objective We measured the levels of malondialdehyde–deoxyguanosine (dG) adducts, a biomarker of oxidative stress and lipid peroxidation, in petrochemical workers, nearby residents, and subjects living in a control district without proximity to industrial sources. Design We conducted a cross-sectional study to compare the prevalence of malondialdehyde-dG adducts in groups of subjects experiencing various degrees of air pollution. Results The multivariate regression analysis shows that the adduct levels were associated with occupational and environmental exposures to air pollution. The highest adduct level was observed in the steel factory workers. In addition, the formation of DNA damage tended to be associated with tobacco smoking, but without reaching statistical significance. A nonsignificant increase in DNA adducts was observed after 4–6 years of employment among the petrochemical complexes. Conclusions Air pollution emitted from the Map Ta Phut Industrial Estate complexes was associated with increased adduct levels in petrochemical workers and nearby residents. Considering the mutagenic potential of DNA lesions in the carcinogenic process, we recommend measures aimed at reducing the levels of air pollution. PMID:20056580

  19. In situ detection of acetylaminofluorene-DNA adducts in human cells using monoclonal antibodies.

    PubMed

    Iwamoto, Taka-aki; Kobayashi, Nobuhiko; Imoto, Kyoko; Yamamoto, Aya; Nakamura, Yu; Yamauchi, Yukika; Okumura, Hiromi; Tanaka, Akiko; Hanaoka, Fumio; Shibutani, Shinya; Miyagawa, Sachiko; Mori, Toshio

    2004-11-01

    The present study was performed to generate monoclonal antibodies capable of detecting N-acetoxy-2-acetylaminofluorene (NA-AAF)-derived DNA adducts in human cells in situ. As an immunogen, we employed NA-AAF-modified single-stranded DNA coupled electrostatically to methylated protein and we produced five different monoclonal antibodies. All of them showed strong binding to NA-AAF-modified DNA, but had undetectable or minimal binding to undamaged DNA. Competitive inhibition experiments revealed that the epitope recognized by these antibodies is N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-C8-AAF) in DNA, although deacetylated N-(deoxyguanosin-8-yl)-2-aminofluorene in DNA is also recognized with slightly less efficiency. In contrast, these antibodies did not bind to 3-(deoxyguanosin-N(2)-yl)-2-acetylaminofluorene in DNA or to UV-induced lesions in DNA. Interestingly, they showed only minimal binding to small AAF-nucleoside adducts (dG-C8-AAF), indicating that DNA regions flanking a DNA-bound adduct, in addition to the adduct itself, are essential for the stable binding of the antibodies. Using an enzyme-linked immunosorbent assay with the most promising antibody (AAF-1), we detected the concentration-dependent induction of NA-AAF-modified adducts in DNA from repair deficient xeroderma pigmentosum (XP) cells treated with physiological concentrations of NA-AAF. Moreover, the assay enabled to confirm that normal human cells efficiently repaired NA-AAF-induced DNA adducts but not XP-A cells. Most importantly, the formation of NA-AAF-induced DNA adducts in individual nuclei of XP cells could be clearly visualized using indirect immunofluorescence. Thus, we succeeded in establishing novel monoclonal antibodies capable of the in situ detection of NA-AAF-induced DNA adducts in human cells. PMID:15380103

  20. DNA adducts in human carcinogenesis: etiological relevance and structure-activity relationship.

    PubMed

    Bartsch, H

    1996-06-01

    '-monophosphates. Liver DNA from unexposed rats, mice and from human samples contained background levels of epsilon dA and epsilon dC (Bartsch et al. (1994) Drug. Metab. Rev., 26, 349-371). As formation of epsilon dA and epsilon dC adducts by lipid peroxidation products was demonstrated (El Ghissassi et al. (1995) Chem. Res. Toxicol., 8, 278-283), they may serve as markers for oxidative stress. Results from testing this hypothesis are presented. PMID:8692183

  1. Metabolic activation of 2‐amino‐1‐methyl‐6‐phenylimidazo [4,5‐b]pyridine and DNA adduct formation depends on p53: Studies in T rp53(+/+),T rp53(+/−) and T rp53(−/−) mice

    PubMed Central

    Krais, Annette M.; Speksnijder, Ewoud N.; Melis, Joost P.M.; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H.

    2015-01-01

    The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)‐mediated biotransformation. The carcinogen 2‐amino‐1‐methyl‐6‐phenylimidazo[4,5‐b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/−) and Trp53(−/−) mice with a single oral dose of 50 mg/kg body weight PhIP. N‐(Deoxyguanosin‐8‐yl)‐2‐amino‐1‐methyl‐6‐phenylimidazo[4,5‐b]pyridine (PhIP‐C8‐dG) levels in DNA, measured by liquid chromatography‐tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(−/−) mice compared to Trp53(+/+) mice. Lower PhIP‐DNA adduct levels in the livers of Trp53(−/−) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin‐O‐demethylase activity) in these animals. Interestingly, PhIP‐DNA adduct levels were significantly higher in kidney and bladder of Trp53(−/−) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2‐naphthylsulfate formation from 2‐naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue‐dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP‐DNA adduct formation. PMID:26335255

  2. Adenine-DNA adducts derived from the highly tumorigenic dibenzo[a,l]pyrene are resistant to nucleotide excision repair while guanine adducts are not

    PubMed Central

    Kropachev, Konstantin; Kolbanovskiy, Marina; Liu, Zhi; Cai, Yuqin; Zhang, Lu; Schwaid, Adam G.; Kolbanovskiy, Alexander; Ding, Shuang; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2013-01-01

    The structural origins of differences in susceptibilities of various DNA lesions to nucleotide excision repair (NER) are poorly understood. Here we compared, in the same sequence context, the relative NER dual incision efficiencies elicited by two stereochemically distinct pairs of guanine (N2-dG) and adenine (N6-dA) DNA lesions, derived from enantiomeric genotoxic diol epoxides of the highly tumorigenic fjord region polycyclic aromatic hydrocarbon dibenzo[a,l]pyrene (DB[a,l]P). Remarkably, in cell-free HeLa cell extracts, the guanine adduct with R absolute chemistry at the N2-dG linkage site is ~ 35 times more susceptible to NER dual incisions than the stereochemically identical N6-dA adduct. For the guanine and adenine adducts with S stereochemistry, a similar, but somewhat smaller effect (factor of ~15) is observed. The striking resistance of the bulky N6-dA in contrast to the modest to good susceptibilities of the N2-dG adducts to NER are interpreted in terms of the balance between lesion-induced DNA-distorting and DNA-stabilizing van der Waals interactions in their structures, that are partly reflected in the overall thermal stabilities of the modified duplexes. Our results are consistent with the hypothesis that the high genotoxic activity of DB[a,l]P is related to the formation of NER-resistant and persistent DB[a,l]P-derived adenine adducts in cellular DNA. PMID:23570232

  3. Characterization of the lysyl adducts of prostaglandin H-synthases that are derived from oxygenation of arachidonic acid.

    PubMed

    Boutaud, O; Brame, C J; Chaurand, P; Li, J; Rowlinson, S W; Crews, B C; Ji, C; Marnett, L J; Caprioli, R M; Roberts, L J; Oates, J A

    2001-06-12

    These investigations characterize the covalent binding of reactive products of prostaglandin H-synthases (PGHSs) to the enzyme and to other molecules. The intermediate product of oxygenation of arachidonic acid by the PGHSs, prostaglandin (PG) H2, undergoes rearrangement to the highly reactive gamma-keto aldehydes, levuglandin (LG) E2 and D2. We previously have demonstrated that LGE2 reacts with the epsilon-amine of lysine to form both the lysyl-levuglandin Shiff base and the pyrrole-derived lysyl-levuglandin lactam adducts. We now demonstrate that these lysyl-levuglandin adducts are formed on the PGHSs following the oxygenation of arachidonic acid; after reduction of the putative Schiff base, proteolytic digestion of the enzyme, and isolation of the adducted amino acid residues, these adducts were identified by liquid chromatography-tandem mass spectrometry. The reactivity of the LGs is reflected by the finding that virtually all of the LG predicted to be formed from PGH2 can be accounted for as adducts of the PGH-synthase and that oxygenation of arachidonic acid by PGH-synthases also leads to the formation of adducts of other proteins present in the reaction solution. The reactivity of the PGH-synthase adducts themselves is demonstrated by the formation of intermolecular cross-links. PMID:11389610

  4. Fruit and vegetable and fried food consumption and 3-(2-deoxy-β-D-erythro-pentafuranosyl)pyrimido[1,2-α]purin-10(3H)-one deoxyguanosine adduct formation

    PubMed Central

    PELUSO, MARCO; MUNNIA, ARMELLE; PIRO, SARA; JEDPIYAWONGSE, ADISORN; SANGRAJRANG, SULEEPORN; GIESE, ROGER W.; CEPPI, MARCELLO; BOFFETTA, PAOLO; SRIVATANAKUL, PETCHARIN

    2012-01-01

    Diet has been shown to modulate M1dG adduct, a biomarker of oxidative stress and lipid peroxidation. Thus, we analysed the association between diet and M1dG in 120 controls and 67 Map Ta Phut industrial estate workers, Rayong, Thailand to evaluate the influence of fruit and vegetables, and fried and charcoal-grilled/barbecued food consumption on M1dG. M1dG was decreased in controls reporting to consume 14–17 servings/week of fruit and vegetables [Mean Ratio (MR)=0.35, C.I. 0.18–0.69, p<0.05]. Conversely, a non-statistically significant M1dG increment was detected in controls consuming 9–18 servings/week of fried food (MR=1.33, C.I. 0.88–2.00, p=0.168). No effect of charcoal-grilled/barbecued food was found. No effect of diet was observed in workers. An association with smoking was observed in controls (MR=1.88, C.I. 1.14–3.10, p<0.05), but not in workers. M1dG can induce mutations and/or methylation changes within the promoter regions of cancer-related genes, thus promotion of healthy eating practices should be recommended. PMID:22081860

  5. DNA adducts and carcinogenicity of nitro-polycyclic aromatic hydrocarbons

    SciTech Connect

    Fu, P.P.; Herreno-Saenz, D.; Von Tungeln, L.S.

    1994-10-01

    We have been interested in the structure-activity relationships of nitro-polycyclic aromatic hydrocarbons (nitro-PAHs), and have focused on the correlation of structural and electronic features with biological activities, including mutagenicity and tumorigenicity. In our studies, we have emphasized 1-, 2-, 3-, and 6-nitrobenzo[a]pyrenes (nitro-B[a]Ps) and related compounds, all of which are derived from the potent carcinogen benzo[a]pyrene. While 1-, 2-, and 3-nitro-B[a]P are potent mutagens in Salmonella, 6-nitro-B[a]P is a weak mutagen. In vitro metabolism of 1- and 3-nitro-B[a]P has been found to generate multiple pathways for mutagenic activation. The formation of the corresponding trans-7,8-dihydrodiols and 7,8,9,10-tetrahydrotetrols suggests that 1- and 3-nitro-B[a]P trans-7,8-diol-anti-9, 10--epoxides are ultimate metabolites of the parent nitro-B[a]Ps. We have isolated a DNA adduct from the reaction between 3-nitro-B[a]P trans-7,8-diol-anti-9, 10-epoxide and calf thymus DNA, and identified it as 10-(deoxyguanosin-N{sup 2}-yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydro-3-nitro-B[a]P. The same adduct was identified from in vitro metabolism of [{sup 3}H]3-nitro-B[a]P by rat liver microsomes in the presence of calf thymus DNA. A DNA adduct of 3-nitro-B[a]P formed from reaction of N-hydroxy-3-amino-B[a]P, prepared in situ with calf thymus DNA was also isolated. This adduct was identified as 6-(deoxyguanosin-N{sup 2}-yl)-3-amino-B[a]P. The same adduct was obtained from incubating DNA with 3-nitro-B[a]P in the presence of the mammalian nitroreductase, xanthine oxidase, and hypoxanthine. 48 refs., 6 figs., 1 tab.

  6. p53 controls global nucleotide excision repair of low levels of structurally diverse benzo(g)chrysene-DNA adducts in human fibroblasts.

    PubMed

    Lloyd, Daniel R; Hanawalt, Philip C

    2002-09-15

    Benzo(g)chrysene is a widespread environmental contaminant and potent carcinogen. We have measured the formation and nucleotide excision repair of covalent DNA adducts formed by the DNA-reactive metabolite of this compound in human fibroblasts, in which expression of the p53 tumor suppressor gene could be controlled by a tetracycline-inducible promoter. Cells were exposed for 1 h to 0.01, 0.1, or 1.2 microM (+/-)-anti-benzo(g)chrysene diol-epoxide, and DNA adducts were assessed at various post-treatment times by subjecting isolated DNA to (32)P-postlabeling analysis. Four major DNA adducts were detected, corresponding to the reaction of either the (+)- or (-)-anti-benzo(g)chrysene diol-epoxide stereoisomer with adenine or guanine. Treatment with 1.2 microM resulted in a level of 1100 total adducts/10(8) nucleotides for both p53-proficient and -deficient cells; removal of adducts was not observed in either case. In cells treated with 0.1 microM, the maximum level of total adducts at 24 h was 150/10(8) nucleotides in p53-proficient cells and 210 adducts/10(8) nucleotides in p53-deficient cells. A concentration of 0.01 microM resulted in a maximum of 20 adducts/10(8) nucleotides in p53-proficient cells at 4 h, but 40 adducts/10(8) nucleotides persisted in p53-deficient cells at 24 h. Whereas there were clear differences in the time course of adduct levels in p53-proficient compared with p53-deficient cells treated with 0.1 microM or 0.01 microM, these levels did not decrease extensively over 3 days. This is likely because of the stabilization of the diol-epoxide in cells, and consequent exposure and formation of adducts for many hours after the initial treatment. Furthermore, despite minor quantitative differences, all 4 of the adducts behaved similarly with respect to the effect of p53 expression on their removal. p53 appears to minimize the appearance of benzo(g)chrysene adducts in human cells by up-regulating global nucleotide excision repair and reducing the

  7. Characterization of DNA adducts of the carcinogen N-methyl-4-aminoazobenzene in vitro and in vivo.

    PubMed

    Beland, F A; Tullis, D L; Kadlubar, F F; Straub, K M; Evans, F E

    1980-07-01

    Since the susceptibility of specific tissues to tumor formation has been correlated with the persistence of DNA-carcinogen adducts, the identity and persistence of DNA adducts formed from the hepatocarcinogen N-methyl-4-aminoazobenzene (MAB) has been determined. The synthetic ultimate carcinogen N-benzoyloxy-N-methyl-4-aminoazobenzene (N-BxO-MAB) was reacted in vitro with either calf thymus or rat liver DNA to yield approx. 1 bound residue per 1000 nucleotides. After enzymatic hydrolysis of the DNA and high pressure liquid chromatographic analysis, at least six MAB adducts were detected. Two of the products cochromatographed with MAB-DNA adducts formed in rat liver in vivo following oral administration of the precarcinogen MAB. These two adducts were identified by mass, UV and nuclear magnetic resonance (NMR) spectroscopy as N-(deoxyguanosin-8-yl)- and 3-(deoxyguanosin-N2-yl)-MAB. The former adduct was initially the predominant product in vivo, but it could not be detected 7 days following treatment. The latter adduct remained at a constant level for 14 days and therefore appears to be a persistent lesion. PMID:7389004

  8. The analysis of DNA adducts: the transition from (32)P-postlabeling to mass spectrometry.

    PubMed

    Klaene, Joshua J; Sharma, Vaneet K; Glick, James; Vouros, Paul

    2013-06-28

    The technique of (32)P-postlabeling, which was introduced in 1982 for the analysis of DNA adducts, has long been the method of choice for in vivo studies because of its high sensitivity as it requires only <10μg DNA to achieve the detection of 1 adduct in 10(10) normal bases. (32)P-postlabeling has therefore been utilized in numerous human and animal studies of DNA adduct formation. Like all techniques (32)P-postlabeling does have several disadvantages including the use of radioactive phosphorus, lack of internal standards, and perhaps most significantly does not provide any structural information for positive identification of unknown adducts, a shortcoming that could significantly hamper progress in the field. Structural methods have since been developed to allow for positive identification of DNA adducts, but to this day, the same level of sensitivity and low sample requirements provided by (32)P-postlabeling have not been matched. In this mini review we will discuss the (32)P-postlabeling method and chronicle the transition to mass spectrometry via the hyphenation of gas chromatography, capillary electrophoresis, and ultimately liquid chromatography which, some 30years later, is only just starting to approach the sensitivity and low sample requirements of (32)P-postlabeling. This paper focuses on the detection of bulky carcinogen-DNA adducts, with no mention of oxidative damage or small alkylating agents. This is because the (32)P-postlabeling assay is most compatible with bulky DNA adducts. This will also allow a more comprehensive focus on a subject that has been our particular interest since 1990. PMID:22960573

  9. The modulation of topoisomerase I-mediated DNA cleavage and the induction of DNA–topoisomerase I crosslinks by crotonaldehyde-derived DNA adducts

    PubMed Central

    Dexheimer, Thomas S.; Kozekova, Albena; Rizzo, Carmelo J.; Stone, Michael P.; Pommier, Yves

    2008-01-01

    Crotonaldehyde is a representative α,β-unsaturated aldehyde endowed of mutagenic and carcinogenic properties related to its propensity to react with DNA. Cyclic crotonaldehyde-derived deoxyguanosine (CrA-PdG) adducts can undergo ring opening in duplex DNA to yield a highly reactive aldehydic moiety. Here, we demonstrate that site-specifically modified DNA oligonucleotides containing a single CrA-PdG adduct can form crosslinks with topoisomerase I (Top1), both directly and indirectly. Direct covalent complex formation between the CrA-PdG adduct and Top1 is detectable after reduction with sodium cyanoborohydride, which is consistent with the formation of a Schiff base between Top1 and the ring open aldehyde form of the adduct. In addition, we show that the CrA-PdG adduct alters the cleavage and religation activities of Top1. It suppresses Top1 cleavage complexes at the adduct site and induces both reversible and irreversible cleavage complexes adjacent to the CrA-PdG adduct. The formation of stable DNA–Top1 crosslinks and the induction of Top1 cleavage complexes by CrA-PdG are mutually exclusive. Lastly, we found that crotonaldehyde induces the formation of DNA–Top1 complexes in mammalian cells, which suggests a potential relationship between formation of DNA–Top1 crosslinks and the mutagenic and carcinogenic properties of crotonaldehyde. PMID:18550580

  10. Enzyme-DNA biocolloids for DNA adduct and reactive metabolite detection by chromatography-mass spectrometry.

    PubMed

    Bajrami, Besnik; Hvastkovs, Eli G; Jensen, Gary C; Schenkman, John B; Rusling, James F

    2008-02-15

    Silica microbead bioreactors (0.5 microm diameter) coated with DNA and enzymes were fabricated to measure reactive metabolite and DNA-adduct formation rates relevant to genotoxicity screening. Cytochrome (cyt) P450 2E1, cyt P450(cam), and myoglobin (Mb) were incorporated into thin films with DNA using the electrostatic layer-by-layer (LbL) method. The utility of these biocolloids was demonstrated by oxidation of guaiacol, styrene, and (4-methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK). Enzyme turnover rates for formation of reactive metabolites were monitored using gas chromatography/mass spectrometry (GC/MS) and liquid chromatography-mass spectrometry (LC-MS). Capillary LC-MS/MS was employed to determine DNA nucleobase adducts after catalyzing the reactive metabolite formation with DNA-enzyme biocolloids and then using neutral thermal hydrolysis on the biocolloids. Dramatic improvements in surface area to volume ratio over similar films on macroscopic surfaces opens new avenues for genotoxicity screening and enabled the first use of pure cyt P450 enzymes in enzyme-DNA films to produce DNA adducts. The method makes possible identification and formation rate measurements of major and minor DNA adducts as well as the metabolites themselves in <5 min of reaction time using relevant human liver enzymes. PMID:18217727

  11. Conformational, IR spectroscopic and electronic properties of conium alkaloids and their adducts with C60 fullerene

    NASA Astrophysics Data System (ADS)

    Zabolotnyi, M. A.; Prylutskyy, Yu I.; Poluyan, N. A.; Evstigneev, M. P.; Dovbeshko, G. I.

    2016-08-01

    Conformational, IR spectroscopic and electronic properties of the components of Conium alkaloids (Conium maculatum) in aqueous environment were determined by model calculations and experiment. With the help of FT-IR spectroscopy the possibility of formation of an adduct between γ-coniceine alkaloid and C60 fullerene was demonstrated, which is important for further application of conium analogues in biomedical purposes.

  12. DNA adducts induced by in vitro activation of extracts of diesel and biodiesel exhaust particles

    EPA Science Inventory

    AbstractContext: Biodiesel and biodiesel-blend fuels offer a renewable alternative to petroleum diesel, but few data are available concerning the carcinogenic potential of biodiesel exhausts. Objectives: We compared the formation of covalent DNA adducts by the in vitro metabol...

  13. DNA adduct measurements in zebra mussels, Dreissena polymorpha, Pallas. Potential use for genotoxicant biomonitoring of fresh water ecosystems.

    PubMed

    Le Goff, J; Gallois, J; Pelhuet, L; Devier, M H; Budzinski, H; Pottier, D; André, V; Cachot, J

    2006-08-12

    The purpose of this study was to examine PAH accumulation and bulky DNA adduct formation in the digestive gland of zebra mussels exposed in their habitat or in controlled laboratory conditions to complex mixture of PAH. DNA adducts were measured using a 32P-postlabelling protocol with nuclease P1 enrichment adapted from Reddy and Randerath [Reddy, M.V., Randerath, K., 1986. Nuclease P1-mediated enhancement of sensitivity of 32P-postlabelling test for structurally diverse DNA adducts. Carcinogenesis 7, 1543-1551]. Specimens collected in the upper part of the Seine estuary were shown to accumulate higher levels of PAH (up to 1.6 microg g(-1) dry weight) in comparison to individuals from the reference site (0.053 microg g(-1) dry weight). The former exhibited elevated levels of DNA adducts (up to 4.0/10(8) nucleotides) and higher diversity of individual adducts with five distinct spots being specifically detected in individuals originating from the Seine estuary. Zebra mussels exposed for 5 days to 0.01% (v/v) of organic extract of sediment from the Seine estuary were shown to accumulate high amounts of PAH (up to 138 microg g(-1) dry weight) but exhibited relatively low levels of DNA adducts. Exposure to benzo[a]pyrene led to a dose-dependent accumulation of B[a]P (up to 7063 microg g(-1) dry weight) and a clear induction of DNA adduct formation in the digestive gland of mussels (up to 1.13/10(8) nucleotides). Comparisons with other bivalves exposed to the same model PAH, revealed similar levels of adducts and comparable adduct profiles with a main adduct spot and a second faint one. This study clearly demonstrated that zebra mussels are able to biotransform B[a]P and probably other PAH into reactive metabolites with DNA-binding activity. This work also demonstrated the applicability of the nuclease P1 enhanced 32P-postlabelling method for bulky adduct detection in the digestive gland of zebra mussels. DNA adduct measurement in zebra mussels could be a suitable

  14. Insights into the Mechanism of Protein Electrospray Ionization From Salt Adduction Measurements

    NASA Astrophysics Data System (ADS)

    Yue, Xuanfeng; Vahidi, Siavash; Konermann, Lars

    2014-08-01

    The mechanisms whereby protein ions are liberated from charged droplets during electrospray ionization (ESI) remain under investigation. Compact conformers electrosprayed from aqueous solution in positive ion mode likely follow the charged residue model (CRM), which envisions analyte release after solvent evaporation to dryness. The concentration of nonvolatile salts such as NaCl increases sharply within vanishing CRM droplets, promoting nonspecific pairing of Cl- and Na+ with charged groups on the protein surface. For unfolded proteins, it has been proposed that ion formation occurs via the chain ejection model (CEM). During the CEM proteins are expelled from the droplet long before complete solvent evaporation has taken place. Here we examine whether salt adduction levels support the view that folded and unfolded proteins follow different ESI mechanisms. Solvent evaporation during the CEM is expected to be less extensive and, hence, the salt concentration at the point of protein release should be substantially lower than for the CRM. CEM ions should therefore exhibit lower adduction levels than CRM species. We explore the adduction behavior of several proteins that were chosen to allow comparative studies on folded and unfolded structures in the same solution. In-source activation eliminates chloride adducts via HCl release, generating protein ions that are heterogeneously charged because of sodiation and protonation. Sodiation levels measured under such conditions provide estimates of the salt adduction behavior experienced by the "nascent" analyte ions. Sodiation levels are significantly reduced for unfolded proteins, supporting the view that these species are indeed formed via the CEM.

  15. New fluorescence methodology for detecting DNA adducts

    SciTech Connect

    Giese, R.W.

    1993-05-21

    A new reagent, BO-IMI, has been developed that achieves, single step, phosphate specific fluorescence labeling under aqueous conditions. Both 3 in. and 5 in. mononucleotides, including representative DNA adducts can be labeled. Included in this technique is a convenient procedure for postlabeling sample cleanup, leading to a practical detection of the products by capillary electrophoresis with laser fluorescencedetection. We consider that this new method will have a significant impact on the measurement of DNA adducts in human samples. This work was largely accomplished in the second half of our project. In the first half, we set up a new way to isolate DNA nucleotides from blood, worked with an initial, less specific technique for labeling DNA adducts, compared ionizing radiation vs oxidative damage to fluorescein labeled deoxyadenylic acid, and set up a capillary electrophoresis laser fluorescence detection system.

  16. Selection of adduct-forming chemicals for human-monitoring studies

    SciTech Connect

    Not Available

    1991-07-01

    The U.S. EPA, through its Environmental Monitoring Systems Laboratory-Las Vegas (EMSL-LV) and its Health Effects Research Laboratory-Research Triangle Park (HERL-RTP) has been exploring the feasibility of using biological markers to monitor exposure to environmental chemicals. The participants began by compiling a list of chemicals of known or suspected health hazards and for which the potential for human exposure exists. The chemicals on the master list were then systematically evaluated for: (1) the potential for adduct-formation in vivo, (2) the availability of supportive adduct research data, (3) the identifiability of exposed population(s), and (4) the level of genetic activity. After considering all the relevant data, the participants selected and prioritized for further study a small group of chemicals considered to have the greatest potential for use in pilot, adduct-based, biological monitoring studies in human populations.

  17. Reduced variational space analysis of methane adducts

    SciTech Connect

    Cundari, T.R.; Klinckman, T.R.

    1998-10-05

    Methane is the major component of natural gas, and hence its catalytic conversion to functionalized products (e.g., methanol) is of great interest. A variety of transition metal complexes have been investigated experimentally for the selective activation of methane. Recent experiments and computations suggest that weakly bound methane adducts play a pivotal role in metal-mediated methane activation. Calculation of the intrinsic reaction coordinates for methane activation by d{sup 0} imidos indicates that the adduct lies along the pathway for methane activation. Isolation of a stable methane adduct, suitable for experimental characterization, would be aided by a greater understanding of their chemistry. Given the short-lived nature of these adducts and the limited direct experimental information, computational chemistry is a useful tool for understanding the bonding and structure of these catalytic intermediates. This research investigated the bonding forces in methane adducts of transition metal (TM) complexes. The calculations reported here employed effective core potential (ECP) methods within the Hartree-Fock approximation using the GAMESS quantum chemistry program. The reduced variational space self-consistent field (RVS-SCF) method developed by Stevens and Fink was employed. This technique was used to analyze the Coulomb and exchange energy (CEX), polarization energy (POL), and charge transfer energy (CT) contributions to the binding energy ({Delta}E{sub add}) of methane to a TM complex. Adducts of high-valent (d{sup 0}) transition metal complexes were studied. The role of metal, ligand, and charge on the different contributions to the binding energy were analyzed.

  18. Detection of DNA methylation adducts in Hodgkin's disease patients treated with procarbazine.

    PubMed

    Bianchini, F; Weiderpass, E; Kyrtopoulos, S; Souliotis, V L; Henry-Amar, M; Wild, C P; Boffetta, P

    1996-01-01

    Abstract The aim of the present study was to assess the relationship between dose of the methylating agent procarbazine (PCZ), DNA methylation adduct formation andresponse to chemotherapy treatment in 23 Hodgkin's disease patients receiving MOPP/ABV combination therapy. The DNA adducts, 7-methyldeoxyguanosine (7-medG) and0(6)-methyldeoxyguanosine (0(6)-medG), were measured in leucocytes at the end of the first cycle of PCZ treatment (77-100 mg m(Z) per day). 7-medG was detected in only two patients prior to treatment and0(6)-medG was below the detection limit (0.08 pole per mole dG) in all subjects prior to treatment. The mean levels after PCZ treatment were 12.55 pmole 7-medG per mole dG and0.254 μmole 0(6)-medG per mole dG with a 2-3 fold variation between individuals. No correlation was observed between the levels of the two adducts suggesting inter-individual differences in formation andremoval of the two adducts. Failure of treatment was observed in five patients andthis was not correlated with higher or lower levels of 7-medG or 0(6)-medG. Other adducts formed as a consequence of treatment with PCZ or other MOPP/ABV components could have more relevance in this respect. The ability to measure DNA methylation adducts at the individual level following exposure to PCZ or other methylating chemotherapeutic drugs (e.g. dacarbazine) could be useful in prospective studies of secondary cancer in Hodgkin's disease patients. PMID:23888989

  19. Synthesis of Mitomycin C and Decarbamoylmitomycin C N(2) deoxyguanosine-adducts.

    PubMed

    Champeil, Elise; Cheng, Shu-Yuan; Huang, Bik Tzu; Conchero-Guisan, Marta; Martinez, Thibaut; Paz, Manuel M; Sapse, Anne-Marie

    2016-04-01

    Mitomycin C (MC) and Decarbamoylmitomycin C (DMC) - a derivative of MC lacking the carbamate on C10 - are DNA alkylating agents. Their cytotoxicity is attributed to their ability to generate DNA monoadducts as well as intrastrand and interstrand cross-links (ICLs). The major monoadducts generated by MC and DMC in tumor cells have opposite stereochemistry at carbon one of the guanine-mitosene bond: trans (or alpha) for MC and cis (or beta) for DMC. We hypothesize that local disruptions of DNA structure from trans or cis adducts are responsible for the different biochemical responses produced by MC and DMC. Access to DNA substrates bearing cis and trans MC/DMC lesions is essential to verify this hypothesis. Synthetic oligonucleotides bearing trans lesions can be obtained by bio-mimetic methods. However, this approach does not yield cis adducts. This report presents the first chemical synthesis of a cis mitosene DNA adduct. We also examined the stereopreference exhibited by the two drugs at the mononucleotide level by analyzing the formation of cis and trans adducts in the reaction of deoxyguanosine with MC or DMC using a variety of activation conditions. In addition, we performed Density Functional Theory calculations to evaluate the energies of these reactions. Direct alkylation under autocatalytic or bifunctional conditions yielded preferentially alpha adducts with both MC and DMC. DFT calculations showed that under bifunctional activation, the thermodynamically favored adducts are alpha, trans, for MC and beta, cis, for DMC. This suggests that the duplex DNA structure may stabilize/oriente the activated pro-drugs so that, with DMC, formation of the thermodynamically favored beta products are possible in a cellular environment. PMID:26894558

  20. Molecular characterization of the boron adducts of the proteasome inhibitor bortezomib with epigallocatechin-3-gallate and related polyphenols.

    PubMed

    Glynn, Stephen J; Gaffney, Kevin J; Sainz, Marcos A; Louie, Stan G; Petasis, Nicos A

    2015-04-01

    The green tea polyphenol epigallocatechin-3-gallate (EGCG) was reported to effectively antagonize the ability of Bortezomib (BZM) to induce apoptosis in cancer cells. This interaction was attributed to the formation of a covalent adduct between a phenolic moiety of EGCG with the boronic acid group of Bortezomib. However, the structural details of this boron adduct and the molecular factors that contribute to its formation and its ability to inhibit Bortezomib's activity remain unclear. This paper describes the use of NMR spectroscopy and cell assays to characterize the structures and properties of the boron adducts of EGCG and related polyphenols. The observed boron adducts included both boronate and borate derivatives, and their structural characteristics were correlated with cell-based evaluation of the ability of EGCG and other phenols to antagonize the anticancer activity of Bortezomib. The enhanced stability of the BZM/EGCG adduct was attributed to electronic and steric reasons, and a newly identified intramolecular interaction of the boron atom of BZM with the adjacent amide bond. The reported approach provides a useful method for determining the potential ability of polyphenols to form undesired adducts with boron-based drugs and interfere with their actions. PMID:25669488

  1. Molecular characterization of the boron adducts of the proteasome inhibitor Bortezomib with epigallocatechin-3-gallate and related polyphenols

    PubMed Central

    Glynn, Stephen J.; Gaffney, Kevin J.; Sainz, Marcos A.; Louie, Stan G.

    2015-01-01

    The green tea polyphenol epigallocatechin-3-gallate (EGCG) was reported to effectively antagonize the ability of Bortezomib to induce apoptosis in cancer cells. This interaction was attributed to the formation of a covalent adduct between a phenolic moiety of EGCG with the boronic acid group of Bortezomib. However, the structural details of this boron adduct and the molecular factors that contribute to its formation and its ability to inhibit Bortezomib's activity remain unclear. This paper describes the use of NMR spectroscopy and cell assays to characterize the structures and properties of the boron adducts of EGCG and related polyphenols. The observed boron adducts included both boronate and borate derivatives, and their structural characteristics were correlated with cell-based evaluation of the ability of EGCG and other phenols to antagonize the anticancer activity of Bortezomib. The enhanced stability of the BZM/EGCG adduct was attributed to electronic and steric reasons, and a newly identified intramolecular interaction of the boron atom of BZM with the adjacent amide bond. The reported approach provides a useful method for determining the potential ability of polyphenols to form undesired adducts with boron-based drugs and interfere with their actions. PMID:25669488

  2. DETERMINATION OF HEMOGLOBIN ADDUCTS FOLLOWING ACRYLAMIDE EXPOSURE

    EPA Science Inventory

    The present project was undertaken to develop new methodologies for biological monitoring of exposure to the toxicant acrylamide in laboratory animals as well as humans. ethods were developed to measure the adducts of acrylamide and its epoxide metabolite glycinamide to cysteine ...

  3. 32P-post-labelling analysis of DNA adducts formed in the upper gastrointestinal tissue of mice fed bracken extract or bracken spores.

    PubMed

    Povey, A C; Potter, D; O'Connor, P J

    1996-11-01

    Bracken toxicity to both domestic and laboratory animals is well established and tumours are formed when rodents are treated with either bracken extracts or bracken spores. In this study we have administered bracken spores and extract to mice in order to investigate whether such exposure leads to the formation of DNA adducts. DNA, isolated from the upper gastrointestinal tract and liver, was digested to 3'-nucleotides. Adducts were extracted with butanol, 32P-post-labelled, separated by thin layer chromatography (TLC) and visualised and quantified using storage-phosphor technology. A cluster of adducts was clearly seen in the DNA of the upper gastrointestinal tract, but not liver, 5 and 24 h after treatment with bracken extract or bracken spores. These adducts were not observed in DNA extracted from vehicle-treated animals. Whereas, after 5 h adduct levels in extract and spore-treated animals were similar, after 24 h adduct levels in the extract-treated animals had diminished by > 75%, but levels in spore-treated animals remained similar to those found after 5 h. This suggests that the DNA-reactive compounds were being released slowly from the spores, even though the spores had been sonicated before administration. Adducts were also quantified after the addition of an internal standard (deoxyinosine 3'-monophosphate) by comparing the amount of label incorporated into the adducts with that found in a known amount of the internal standard. Adduct levels using this internal standard approach were similar to those found by direct measurement of radioactivity incorporated into the adduct, indicating that the labelling of adducts was quantitative. We have tried, unsuccessfully, to synthesise ptaquiloside, the principal carcinogenic component present within bracken. However, similar patterns of adducts were observed when two other compounds, (1-(4-chlorophenyl sulphonyl)-l-cyclopropane carbonitrile and 3-cyclopropylindeno [1,2-c] pyrazol-4-(O-methyl)oxime), which both

  4. 32P-post-labelling analysis of DNA adducts formed in the upper gastrointestinal tissue of mice fed bracken extract or bracken spores.

    PubMed Central

    Povey, A. C.; Potter, D.; O'Connor, P. J.

    1996-01-01

    Bracken toxicity to both domestic and laboratory animals is well established and tumours are formed when rodents are treated with either bracken extracts or bracken spores. In this study we have administered bracken spores and extract to mice in order to investigate whether such exposure leads to the formation of DNA adducts. DNA, isolated from the upper gastrointestinal tract and liver, was digested to 3'-nucleotides. Adducts were extracted with butanol, 32P-post-labelled, separated by thin layer chromatography (TLC) and visualised and quantified using storage-phosphor technology. A cluster of adducts was clearly seen in the DNA of the upper gastrointestinal tract, but not liver, 5 and 24 h after treatment with bracken extract or bracken spores. These adducts were not observed in DNA extracted from vehicle-treated animals. Whereas, after 5 h adduct levels in extract and spore-treated animals were similar, after 24 h adduct levels in the extract-treated animals had diminished by > 75%, but levels in spore-treated animals remained similar to those found after 5 h. This suggests that the DNA-reactive compounds were being released slowly from the spores, even though the spores had been sonicated before administration. Adducts were also quantified after the addition of an internal standard (deoxyinosine 3'-monophosphate) by comparing the amount of label incorporated into the adducts with that found in a known amount of the internal standard. Adduct levels using this internal standard approach were similar to those found by direct measurement of radioactivity incorporated into the adduct, indicating that the labelling of adducts was quantitative. We have tried, unsuccessfully, to synthesise ptaquiloside, the principal carcinogenic component present within bracken. However, similar patterns of adducts were observed when two other compounds, (1-(4-chlorophenyl sulphonyl)-l-cyclopropane carbonitrile and 3-cyclopropylindeno [1,2-c] pyrazol-4-(O-methyl)oxime), which both

  5. Environmental toxins and breast cancer on Long Island. I. Polycyclic aromatic hydrocarbon DNA adducts.

    PubMed

    Gammon, Marilie D; Santella, Regina M; Neugut, Alfred I; Eng, Sybil M; Teitelbaum, Susan L; Paykin, Andrea; Levin, Bruce; Terry, Mary Beth; Young, Tie Lan; Wang, Lian Wen; Wang, Qiao; Britton, Julie A; Wolff, Mary S; Stellman, Steven D; Hatch, Maureen; Kabat, Geoffrey C; Senie, Ruby; Garbowski, Gail; Maffeo, Carla; Montalvan, Pat; Berkowitz, Gertrud; Kemeny, Margaret; Citron, Marc; Schnabel, Freya; Schuss, Allan; Hajdu, Steven; Vinceguerra, Vincent

    2002-08-01

    Polycyclic aromatic hydrocarbons (PAH) are potent mammary carcinogens in rodents, but their effect on breast cancer development in women is not clear. To examine whether currently measurable PAH damage to DNA increases breast cancer risk, a population-based case-control study was undertaken on Long Island, NY. Cases were women newly diagnosed with in situ and invasive breast cancer; controls were randomly selected women frequency matched to the age distribution of cases. Blood samples were donated by 1102 (73.0%) and 1141 (73.3%) of case and control respondents, respectively. Samples from 576 cases and 427 controls were assayed for PAH-DNA adducts using an ELISA. The geometric mean (and geometric SD) of the log-transformed levels of PAH-DNA adducts on a natural scale was slightly, but nonsignificantly, higher among cases [7.36 (7.29)] than among controls [6.21 (4.17); P = 0.51]. The age-adjusted odds ratio (OR) for breast cancer in relation to the highest quintile of adduct levels compared with the lowest was 1.51 [95% confidence interval (CI), 1.04-2.20], with little or no evidence of substantial confounding (corresponding multivariate-adjusted OR, 1.49; 95% CI, 1.00-2.21). There was no consistent elevation in risk with increasing adduct levels, nor was there a consistent association between adduct levels and two of the main sources of PAH, active or passive cigarette smoking or consumption of grilled and smoked foods. These data indicate that PAH-DNA adduct formation may influence breast cancer development, although the association does not appear to be dose dependent and may have a threshold effect. PMID:12163319

  6. Identification of adducts derived from reactions of (1-chloroethenyl)oxirane with nucleosides and calf thymus DNA.

    PubMed

    Munter, Tony; Cottrell, Lisa; Hill, Stuart; Kronberg, Leif; Watson, William P; Golding, Bernard T

    2002-12-01

    (1-Chloroethenyl)oxirane is a major mutagenic metabolite of chloroprene, an important large-scale petrochemical used in the manufacture of synthetic rubbers. The reactions of (1-chloroethenyl)oxirane with 2'-deoxyguanosine, 2'-deoxyadenosine, 2'-deoxycytidine, thymidine, and calf thymus DNA have been studied in aqueous buffered solutions. The adducts from the nucleosides were isolated by reversed-phase HPLC, and characterized by their UV absorbance and (1)H and (13)C NMR spectroscopic and mass spectrometric features. The reaction with 2'-deoxyguanosine gave one major adduct, N7-(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGI), and eight minor adducts which were identified as diastereoisomeric pairs of N1-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyguanosine (dGII, dGIII), N3,N7-bis(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGIV, dGV), N7,N9-bis(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGVI, dGVII), and N1,N7-bis(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGVIII, dGIX). The reaction of 2'-deoxyadenosine with (1-chloroethenyl)oxirane gave two adducts: N1-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyadenosine (dAI) and N(6)-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyadenosine (dAII). The adduct dAII was shown to arise via a Dimroth rearrangement of adduct dAI. The HPLC analyses of the reaction mixtures of (1-chloroethenyl)oxirane with 2'-deoxycytidine and thymidine showed the formation of one major product in each reaction. The adduct from 2'-deoxycytidine was identified as N3-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyuridine (dCI) derived by alkylation at N-3 followed by deamination. The adduct from thymidine was identified as N3-(3-chloro-2-hydroxy-3-buten-1-yl)-thymidine (TI). Reaction of (1-chloroethenyl)oxirane with calf thymus DNA gave all of the adducts observed from the individual nucleosides except dGII and dGIII. However, there was selectivity for the formation of dGI and dCI. The adduct levels in DNA were 9,630 (dGI), 240 (dCI), 83 (dAI), 6 (dAII), and 28 (TI

  7. White blood cell DNA adducts and fruit and vegetable consumption in bladder cancer.

    PubMed

    Peluso, M; Airoldi, L; Magagnotti, C; Fiorini, L; Munnia, A; Hautefeuille, A; Malaveille, C; Vineis, P

    2000-02-01

    The 'Mediterranean diet', a diet rich in cereals, fruit and vegetables, has been associated with lowering the risk of a variety of cancers of the digestive tract and the bladder. In a previous study, we showed that the high phenolic content these dietary components produce in the urine could be associated with higher antimutagenic properties of the urine and lower arylamine-DNA adducts in exfoliated bladder cells. We have conducted a case-control study on 162 bladder cancer patients and 104 hospital controls. Total aromatic DNA adducts were measured in white blood cells (WBC) of all subjects by (32)P-post-labelling. Genetically based metabolic polymorphisms were analysed by PCR-RFLP (NAT2, GSTM1, GSTT1, GSTP1, COMT and NQO1). All subjects were interviewed about their tobacco use, dietary habits and other risk factors. The odds ratio (OR) for the risk of bladder cancer according to the presence/absence of WBC DNA adducts (detection limit 0.1 RALx10(8)) was 3.7 [95% confidence interval (CI) 2.2-6.3] and a dose-response relationship with levels of adducts was apparent. The association between case/control status and the presence of WBC DNA adducts was significantly stronger in the subjects who consumed fewer portions of fruit or vegetables per day (OR 7.80, 95% CI 3.0-20.30 for 0-1 portions of vegetables) than in the heavy consumers (OR 4.98 for consumers of 2 portions daily, OR 1.97 for consumers of > or =3 portions; similar but lower estimates were found for the intake of fruit). No association was noticed between tobacco smoking and WBC DNA adducts. Only NAT-2, among the several genotypes considered, was associated in a statistically significant way with the risk of bladder cancer (OR 1.72, 95% CI 1.03-2.87) and with the levels of WBC DNA adducts. Our report suggests that fruit and vegetables could protect against bladder cancer by inhibiting the formation of DNA adducts. PMID:10657956

  8. Synthesis and structural studies of flavin and alloxazine adducts with O-nucleophiles

    NASA Astrophysics Data System (ADS)

    Ménová, Petra; Eigner, Václav; Čejka, Jan; Dvořáková, Hana; Šanda, Miloslav; Cibulka, Radek

    2011-10-01

    Five flavin (isoalloxazine) and alloxazine adducts with O-nucleophiles, 5-ethyl-4a-hydroxy-3,7,8,10-tetramethyl-4a,5-dihydroisoalloxazine ( 1a-OH), 5-ethyl-4a-hydroxy-3,10-dimethyl-4a,5-dihydroisoalloxazine ( 1b-OH), 5-ethyl-4a-methoxy-3,10-dimethyl-4a,5-dihydroisoalloxazine ( 1b-OMe), 5-ethyl-4a-hydroxy-1,3-dimethyl-4a,5-dihydroalloxazine ( 2a-OH) and 5-ethyl-4a-methoxy-1,3-dimethyl-4a,5-dihydroalloxazine ( 2a-OMe) were prepared from the corresponding salts, 5-ethyl-3,7,8,10-tetramethylisoalloxazinium ( 1a), 5-ethyl-3,10-dimethylisoalloxazinium ( 1b) and 5-ethyl-1,3-dimethylalloxazinium ( 2a) perchlorates by the addition of a nucleophile (water or methanol) and triethylamine as a base. The prepared adducts represent artificial analogs of flavin cofactor derivatives which are essential for the functioning of flavoenzymes. They were characterized by 1H and 13C NMR, HR-MS and UV-VIS spectra. In the cases of 1a-OH, 1b-OH, and 2a-OMe, the crystal structures were determined by X-ray diffraction. Flavinium and alloxazinium salts are in rapid equilibria with their adducts in water or methanolic solutions without the presence of a base. It was found that the equilibrium constants for flavin adduct formation is higher by six orders of magnitude than those for alloxazine derivatives. The presence of the sp 3 hybridized C4a atom in the molecule of the adducts causes deviation from planarity. The interplanar angles between benzene and the pyrimidine ring were found to be 31.5°, 23.64° and 15.62° for 1a-OH, 1b-OH and 2a-OMe, respectively, which are much higher than those of previously published adducts of C-nucleophiles. In isoalloxazine adducts, delocalization of π electrons between the N10-C10a and C10a-N1 bonds was detected while the length of the N10-C10a and C10a-N1 bonds in the alloxazine adducts corresponds to a double and single bond, respectively.

  9. Detection of mitomycin C-DNA adducts in human breast cancer cells grown in culture, as xenografted tumors in nude mice, and in biopsies of human breast cancer patient tumors as determined by (32)P-postlabeling.

    PubMed

    Warren, A J; Mustra, D J; Hamilton, J W

    2001-04-01

    Mitomycin C (MMC) is a DNA cross-linking agent that has been used in cancer chemotherapy for >20 years. However, little is known either qualitatively or quantitatively about the relationship between formation and repair of specific MMC-DNA adducts and specific biological outcomes. The goal of this study was to examine formation and removal of specific MMC-DNA adducts in breast cancer cells using a (32)P-postlabeling assay in relation to cytotoxicity and other biological end points. MMC-DNA adducts were measured in cultured human metastatic MDA-MB-435 cells, in the same cells xenografted as a mammary tumor in nude mice, and in metastatic tumor biopsies obtained from human breast cancer patients undergoing MMC-based therapy. MMC adducts corresponding to the CpG interstrand cross-link, the MMC-G bifunctional monoadduct, and two isomers of the MMC-G monofunctional monoadduct were detected in most samples. Despite similarities in the overall patterns of adduct formation, there were substantial differences between the cultured cells and the in vivo tumors in their adduct distribution profile, kinetics of adduct formation and removal, and relationship of specific adduct levels to cytotoxicity, suggesting that the in vivo microenvironment (e.g., degree of oxygenation, pH, activity of oxidoreductases, and other factors) of breast cancer cells may significantly modulate these parameters. PMID:11309355

  10. Prenatal Exposure to Polycyclic Aromatic Hydrocarbons, Benzo[a]pyrene–DNA Adducts, and Genomic DNA Methylation in Cord Blood

    PubMed Central

    Tang, Deliang; Zhu, Deguang; Qu, Lirong; Sjödin, Andreas; Li, Zheng; Camann, David; Perera, Frederica P.

    2012-01-01

    Background: Polycyclic aromatic hydrocarbons (PAHs) are carcinogenic environmental pollutants generated during incomplete combustion. After exposure and during metabolism, PAHs can form reactive epoxides that can covalently bind to DNA. These PAH–DNA adducts are established markers of cancer risk. PAH exposure has been associated with epigenetic alterations, including genomic cytosine methylation. Both global hypomethylation and hypermethylation of specific genes have been associated with cancer and other diseases in humans. Experimental evidence suggests that PAH–DNA adduct formation may preferentially target methylated genomic regions. Early embryonic development may be a particularly susceptible period for PAH exposure, resulting in both increased PAH–DNA adducts and altered DNA methylation. Objective: We explored whether prenatal exposure to PAHs is associated with genomic DNA methylation in cord blood and whether methylation levels are associated with the presence of detectable PAH–DNA adducts. Methods: In a longitudinal cohort study of nonsmoking women in New York City, we measured PAH exposure during pregnancy using personal air monitors, assessed PAH internal dose using prenatal urinary metabolites (in a subset), and quantified benzo[a]pyrene–DNA adducts and genomic DNA methylation in cord blood DNA among 164 participants. Results: Prenatal PAH exposure was associated with lower global methylation in umbilical cord white blood cells (p = 0.05), but global methylation levels were positively associated with the presence of detectable adducts in cord blood (p = 0.01). Conclusions: These observations suggest that PAH exposure was adequate to alter global methylation in our study population. Additional epidemiologic studies that can measure site-specific cytosine methylation and adduct formation will improve our ability to understand this complex molecular pathway in vivo. PMID:22256332