Science.gov

Sample records for p53 tolerates amino

  1. Xenogeneic human p53 DNA vaccination by electroporation breaks immune tolerance to control murine tumors expressing mouse p53.

    PubMed

    Soong, Ruey-Shyang; Trieu, Janson; Lee, Sung Yong; He, Liangmei; Tsai, Ya-Chea; Wu, T-C; Hung, Chien-Fu

    2013-01-01

    The pivotal role of p53 as a tumor suppressor protein is illustrated by the fact that this protein is found mutated in more than 50% of human cancers. In most cases, mutations in p53 greatly increase the otherwise short half-life of this protein in normal tissue and cause it to accumulate in the cytoplasm of tumors. The overexpression of mutated p53 in tumor cells makes p53 a potentially desirable target for the development of cancer immunotherapy. However, p53 protein represents an endogenous tumor-associated antigen (TAA). Immunization against a self-antigen is challenging because an antigen-specific immune response likely generates only low affinity antigen-specific CD8(+) T-cells. This represents a bottleneck of tumor immunotherapy when targeting endogenous TAAs expressed by tumors. The objective of the current study is to develop a safe cancer immunotherapy using a naked DNA vaccine. The vaccine employs a xenogeneic p53 gene to break immune tolerance resulting in a potent therapeutic antitumor effect against tumors expressing mutated p53. Our study assessed the therapeutic antitumor effect after immunization with DNA encoding human p53 (hp53) or mouse p53 (mp53). Mice immunized with xenogeneic full length hp53 DNA plasmid intramuscularly followed by electroporation were protected against challenge with murine colon cancer MC38 while those immunized with mp53 DNA were not. In a therapeutic model, established MC38 tumors were also well controlled by treatment with hp53 DNA therapy in tumor bearing mice compared to mp53 DNA. Mice vaccinated with hp53 DNA plasmid also exhibited an increase in mp53-specific CD8(+) T-cell precursors compared to vaccination with mp53 DNA. Antibody depletion experiments also demonstrated that CD8(+) T-cells play crucial roles in the antitumor effects. This study showed intramuscular vaccination with xenogeneic p53 DNA vaccine followed by electroporation is capable of inducing potent antitumor effects against tumors expressing mutated

  2. Change in oligomerization specificity of the p53 tetramerization domain by hydrophobic amino acid substitutions.

    PubMed Central

    Stavridi, E. S.; Chehab, N. H.; Caruso, L. C.; Halazonetis, T. D.

    1999-01-01

    The tumor suppressor function of the wild-type p53 protein is transdominantly inhibited by tumor-derived mutant p53 proteins. Such transdominant inhibition limits the prospects for gene therapy approaches that aim to introduce wild-type p53 into cancer cells. The molecular mechanism for transdominant inhibition involves sequestration of wild-type p53 subunits into inactive wild-type/mutant hetero-tetramers. Thus, p53 proteins, whose oligomerization specificity is altered so they cannot interact with tumor-derived mutant p53, would escape transdominant inhibition. Aided by the known three-dimensional structure of the p53 tetramerization domain and by trial and error we designed a novel domain with seven amino acid substitutions in the hydrophobic core. A full-length p53 protein bearing this novel domain formed homo-tetramers and had tumor suppressor function, but did not hetero-oligomerize with tumor-derived mutant p53 and resisted transdominant inhibition. Thus, hydrophobic core residues influence the oligomerization specificity of the p53 tetramerization domain. PMID:10493578

  3. The 7-amino-acid site in the proline-rich region of the N-terminal domain of p53 is involved in the interaction with FAK and is critical for p53 functioning.

    PubMed

    Golubovskaya, Vita M; Finch, Richard; Zheng, Min; Kurenova, Elena V; Cance, William G

    2008-04-01

    It is known that p53 alterations are commonly found in tumour cells. Another marker of tumorigenesis is FAK (focal adhesion kinase), a non-receptor kinase that is overexpressed in many types of tumours. Previously we determined that the N-terminal domain of FAK physically interacted with the N-terminal domain of p53. In the present study, using phage display, sitedirected mutagenesis, pulldown and immunoprecipitation assays we localized the site of FAK binding to a 7-amino-acid region(amino acids 65-71) in the N-terminal proline-rich domain of human p53. Mutation of the binding site in p53 reversed the suppressive effect of FAK on p53-mediated transactivation ofp21, BAX (Bcl-2-associated X protein) and Mdm2 (murine double minute 2) promoters. In addition, to functionally test this p53 site, we conjugated p53 peptides [wild-type (containing the wild-type binding site) and mutant (with a mutated 7-aminoacid binding site)] to a TAT peptide sequence to penetrate the cells, and demonstrated that the wild-type p53 peptide disrupted binding of FAK and p53 proteins and significantly inhibited cell viability of HCT116 p53+/+ cells compared with the control mutant peptide and HCT116 p53-/- cells. Furthermore, the TAT-p53 peptide decreased the viability of MCF-7 cells, whereas the mutant peptide did not cause this effect. Normal fibroblast p53+/+ and p53-/- MEF (murine embryonic fibroblast) cells and breast MCF10A cells were not sensitive to p53 peptide. Thus, for the first time, we have identified the binding site of the p53 andFAK interaction and have demonstrated that mutating this site and targeting the site with peptides affects p53 functioning and viability in the cells. PMID:18215142

  4. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation

    PubMed Central

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M.; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-01-01

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  5. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation.

    PubMed

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-08-11

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  6. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression

    PubMed Central

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F.; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-01-01

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker–induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  7. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    PubMed

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  8. Amino-terminal p53 mutations lead to expression of apoptosis proficient p47 and prognosticate better survival, but predispose to tumorigenesis

    PubMed Central

    Phang, Beng Hooi; Othman, Rashidah; Bougeard, Gaelle; Chia, Ren Hui; Frebourg, Thierry; Tang, Choong Leong; Cheah, Peh Yean; Sabapathy, Kanaga

    2015-01-01

    Whereas most mutations in p53 occur in the DNA-binding domain and lead to its functional inactivation, their relevance in the amino-terminal transactivation domain is unclear. We show here that amino-terminal p53 (ATp53) mutations often result in the abrogation of full-length p53 expression, but concomitantly lead to the expression of the amino-terminally truncated p47 isoform. Using genetically modified cancer cells that only express p47, we demonstrate it to be up-regulated in response to various stimuli, and to contribute to cell death, through its ability to selectively activate a group of apoptotic target genes. Target gene selectivity is influenced by K382 acetylation, which depends on the amino terminus, and is required for recruitment of selective cofactors. Consistently, cancers capable of expressing p47 had a better overall survival. Nonetheless, retention of the apoptotic function appears insufficient for tumor suppression, because these mutations are also found in the germ line and lead to Li–Fraumeni syndrome. These data from ATp53 mutations collectively demonstrate that p53’s apoptosis proficiency is dispensable for tumor suppression, but could prognosticate better survival. PMID:26578795

  9. A spermine conjugated stearic acid-g-chitosan oligosaccharide polymer with different types of amino groups for efficient p53 gene therapy.

    PubMed

    Meng, Tingting; Wu, Jie; Yi, Hanxi; Liu, Jingwen; Lu, Binbin; Yuan, Ming; Huang, Xuan; Yuan, Hong; Hu, Fuqiang

    2016-09-01

    The effect of various amino groups on gene vector is different. In order to combine their effect in one vector and finally promote the transfection efficiency, a biogenic tetra-amine spermine was introduced to modify the stearic acid-grafted chitosan oligosaccharide (CSOSA) polymer to build a new gene delivery system. The spermine linked CSOSA (SP-CSOSA) polymer consists two types of amino groups with 73.3%, 19.3% of all nitrogen atoms for primary and secondary amine groups, respectively. The SP modified CSOSA showed strong DNA condensation capability and obviously enhanced proton binding ability especially at about pH 5.0, which significantly promoted the escape of SP-CSOSA/pDNA complexes from endo-lysosoms. Moreover, the transfection efficiency at the N/P ratio of 10 could compete with that of Lipofectamine 2000 and PEI 25K, but with lower cytotoxicities. The therapeutic wild type p53 gene transfected by the SP-CSOSA polymer restored the function of aberrant p53 gene and induced obvious cell apoptosis and G1 phase arrest. We concluded that the new vector SP-CSOSA polymer proved to be a potential delivery system for gene therapy. PMID:27289311

  10. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses.

    PubMed

    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko

    2015-10-01

    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3'-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486-5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  11. Simian virus 40 T antigen can regulate p53-mediated transcription independent of binding p53.

    PubMed Central

    Rushton, J J; Jiang, D; Srinivasan, A; Pipas, J M; Robbins, P D

    1997-01-01

    A simian virus 40 (SV40) T-antigen mutant containing only the N-terminal 136 amino acids, able to bind to Rb and p300 but not p53, partially inhibited p53-mediated transcription without affecting the ability of p53 to bind DNA. These results suggest that SV40 T antigen can regulate p53-mediated transcription either directly through protein-protein association or indirectly through interaction with factors which may function to confer p53-mediated transcription. PMID:9188637

  12. FAK and p53 protein interactions.

    PubMed

    Golubovskaya, Vita M; Cance, William G

    2011-09-01

    Focal Adhesion Kinase plays a major role in cell adhesion, motility, survival, proliferation, metastasis, angiogenesis and lymphangiogenesis. In 2004, we have cloned the promoter sequence of FAK and found that p53 inhibits its activity (BBA, v. 1678, 2004). In 2005, we were the first group to show that FAK and p53 proteins directly interact in the cells (JBC, v. 280, 2005). We have shown that FAK and p53 proteins interact in the cytoplasm and in the nucleus by immunoprecipitation, pull-down and confocal microscopy assays. We have shown that FAK inhibited activity of p53 with the transcriptional targets: p21, Bax and Mdm-2 through protein-protein interactions. We identified the 7 amino-acid site in p53 that is involved in interaction with FAK protein. The present review will discuss the interaction of FAK and p53 proteins and discuss the mechanism of FAK-p53 loop regulation: inhibition of FAK promoter activity by p53 protein and also inhibition of p53 transcriptional activity by FAK protein. PMID:21355845

  13. Metabolic activation of 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine and DNA adduct formation depends on p53: Studies in Trp53(+/+),Trp53(+/-) and Trp53(-/-) mice.

    PubMed

    Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M

    2016-02-15

    The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. PMID:26335255

  14. A/T gap tolerance in the core sequence and flanking sequence requirements of non-canonical p53 response elements.

    PubMed

    Cai, Bi-He; Chao, Chung-Faye; Lin, Hwang-Chi; Huang, Hua-Ying; Kannagi, Reiji; Chen, Jang-Yi

    2016-06-01

    The canonical core sequence of the p53 response element, CATG, has a two-base A/T gap. Previously, we found that p53 can also activate a non-canonical four-base A/T gap CATATG core sequence. In this study, we investigated the possible number of A/T bases used by p53 and showed that a six-base A/T gap CATATATG core sequence was the maximum A/T gap in the p53 response element that could be upregulated by p53 and p63. Canonical and non-canonical p53 response elements also have three-base flanking sequences. A/T bases could be substituted by G/C bases, including CACACG and CGTGTG, but not CGCGCG. We found that the SV40 promoter with functional six- and two-base A/T gap core sequences could be activated by TAp63γ and that TAp63γ could upregulate SV40 small and large T antigens expression in COS7 cells. We also found that the distal region of PUMA promoter with functional two six-base A/T gap core sequences could be activated by TAp63γ in 293T cells. These new findings could provide novel rules for the non-canonical p53 family response element and could extend the entire p53 family regulation network. PMID:26823482

  15. Functional studies of a germ-line polymorphism at codon 47 within the p53 gene

    SciTech Connect

    Felley-Bosco, E.; Weston, A.; Cawley, H.M.; Bennett, W.P.; Harris, C.C.

    1993-09-01

    A rare germ-line polymorphism in codon 47 of the p53 gene replaces the wild-type proline (CCG) with a serine (TCG). Restriction analysis of 101 human samples revealed the frequency of the rare allele to be 0% (n = 69) in Causasians and 4.7% (3/64, n = 32) among African-Americans. To investigate the consequence of this amino acid substitution, a cDNA construct (p53 mut47ser) containing the mutation was introduced into a lung adenocarcinoma cell line (Calu-6) that does not express p53. A growth suppression similar to that obtained after introduction of a wild-type p53 cDNA construct was observed, in contrast to the result obtained by introduction of p53 mut143ala. Furthermore, expression of neither p53 mut47ser nor wild-type p53 was tolerated by growing cells. In transient expression assays, both mut47ser and wild-type p53 activated the expression of a reporter gene linked to a p53 binding sequence (PG13-CAT) and inhibited the expression of the luciferase gene under the control of the Rous sarcoma virus promoter (RSVluc). In the same assay, mut143ala did not activate the expression of PG13-CAT and produced only a slight inhibitory effect on RSVluc. These findings indicate that the p53 variant with a serine at codon 47 should be considered as a rare germ-line polymorphism that does not alter the growth-suppression activity of p53. 30 refs., 3 figs., 3 tabs.

  16. Targeting the p53 pathway.

    PubMed

    Golubovskaya, Vita M; Cance, William G

    2013-10-01

    This article summarizes data on translational studies to target the p53 pathway in cancer. It describes the functions of the p53 and Mdm-2 signaling pathways, and discusses current therapeutic approaches to target p53 pathways, including reactivation of p53. In addition, direct interaction and colocalization of the p53 and focal adhesion kinase proteins in cancer cells have been demonstrated, and different approaches to target this interaction are reviewed. This is a broad review of p53 function as it relates to the diagnosis and treatment of a wide range of cancers. PMID:24012397

  17. p53 and rapamycin are additive

    PubMed Central

    Campisi, Judith; Huang, Jing; Jones, Diane; Dodds, Sherry G.; Williams, Charnae; Hubbard, Gene; Livi, Carolina B.; Gao, Xiaoli; Weintraub, Susan; Curiel, Tyler; Sharp, Z. Dave; Hasty, Paul

    2015-01-01

    Mechanistic target of rapamycin (mTOR) is a kinase found in a complex (mTORC1) that enables macromolecular synthesis and cell growth and is implicated in cancer etiology. The rapamycin-FK506 binding protein 12 (FKBP12) complex allosterically inhibits mTORC1. In response to stress, p53 inhibits mTORC1 through a separate pathway involving cell signaling and amino acid sensing. Thus, these different mechanisms could be additive. Here we show that p53 improved the ability of rapamycin to: 1) extend mouse life span, 2) suppress ionizing radiation (IR)-induced senescence-associated secretory phenotype (SASP) and 3) increase the levels of amino acids and citric acid in mouse embryonic stem (ES) cells. This additive effect could have implications for cancer treatment since rapamycin and p53 are anti-oncogenic. PMID:26158292

  18. The mitochondrial p53 pathway

    PubMed Central

    Vaseva, Angelina V.; Moll, Ute M.

    2010-01-01

    p53 is one of the most mutated tumor suppressors in human cancers and as such has been intensively studied for a long time. p53 is a major orchestrator of the cellular response to a broad array of stress types by regulating apoptosis, cell cycle arrest, senescence, DNA repair and genetic stability. For a long time it was thought that these functions of p53 solely rely on its function as a transcription factor, and numerous p53 target genes have been identified [1]. In the last 8 years however, a novel transcription-independent proapoptotic function mediated by the cytoplasmic pool of p53 has been revealed. p53 participates directly in the intrinsic apoptosis pathway by interacting with the multidomain members of the Bcl-2 family to induce mitochondrial outer membrane permeabilization. Our review will discuss these studies, focusing on recent advances in the field. PMID:19007744

  19. The p53 circuit board

    PubMed Central

    Sullivan, Kelly D.; Gallant-Behm, Corrie L.; Henry, Ryan E.; Fraikin, Jean-Luc; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor is embedded in a large gene network controlling diverse cellular and organismal phenotypes. Multiple signaling pathways converge onto p53 activation, mostly by relieving the inhibitory effects of its repressors, MDM2 and MDM4. In turn, signals originating from increased p53 activity diverge into distinct effector pathways to deliver a specific cellular response to the activating stimuli. Much attention has been devoted to dissecting how the various input pathways trigger p53 activation and how the activity of the p53 protein itself can be modulated by a plethora of co-factors and post-translational modifications. In this review we will focus instead on the multiple configurations of the effector pathways. We will discuss how p53-generated signals are transmitted, amplified, resisted and eventually integrated by downstream gene circuits operating at the transcriptional, post-transcriptional and post-translational level. We will also discuss how context-dependent variations in these gene circuits define the cellular response to p53 activation and how they may impact the clinical efficacy of p53-based targeted therapies. PMID:22333261

  20. Autoantibody recognition mechanisms of p53 epitopes

    NASA Astrophysics Data System (ADS)

    Phillips, J. C.

    2016-06-01

    There is an urgent need for economical blood based, noninvasive molecular biomarkers to assist in the detection and diagnosis of cancers in a cost-effective manner at an early stage, when curative interventions are still possible. Serum autoantibodies are attractive biomarkers for early cancer detection, but their development has been hindered by the punctuated genetic nature of the ten million known cancer mutations. A landmark study of 50,000 patients (Pedersen et al., 2013) showed that a few p53 15-mer epitopes are much more sensitive colon cancer biomarkers than p53, which in turn is a more sensitive cancer biomarker than any other protein. The function of p53 as a nearly universal "tumor suppressor" is well established, because of its strong immunogenicity in terms of not only antibody recruitment, but also stimulation of autoantibodies. Here we examine dimensionally compressed bioinformatic fractal scaling analysis for identifying the few sensitive epitopes from the p53 amino acid sequence, and show how it could be used for early cancer detection (ECD). We trim 15-mers to 7-mers, and identify specific 7-mers from other species that could be more sensitive to aggressive human cancers, such as liver cancer. Our results could provide a roadmap for ECD.

  1. Acidosis Blocks CCAAT/Enhancer-Binding Protein Homologous Protein (CHOP)- and c-Jun-Mediated Induction of p53-Upregulated Mediator of Apoptosis (PUMA) during Amino Acid Starvation

    PubMed Central

    Ryder, Christopher B.; McColl, Karen; Distelhorst, Clark W.

    2012-01-01

    Cancer cells must avoid succumbing to a variety of noxious conditions within their surroundings. Acidosis is one such prominent feature of the tumor microenvironment that surprisingly promotes tumor survival and progression. We recently reported that acidosis prevents apoptosis of starved or stressed lymphoma cells through regulation of several Bcl-2 family members (Ryder et al., JBC, 2012). Mechanistic studies in that work focused on the acid-mediated upregulation of anti-apoptotic Bcl-2 and Bcl-xL, while additionally showing inhibition of glutamine starvation-induced expression of pro-apoptotic PUMA by acidosis. Herein we report that amino acid (AA) starvation elevates PUMA, an effect that is blocked by extracellular acidity. Knockdown studies confirm that PUMA induction during AA starvation requires expression of both CHOP and c-Jun. Interestingly, acidosis strongly attenuates AA starvation-mediated c-Jun expression, which correlates with PUMA repression. As c-Jun exerts a tumor suppressive function in this and other contexts, its inhibition by acidosis has broader implications for survival of cancer cells in the acidic tumor milieu. PMID:23261451

  2. p53: Guardian of Ploidy

    PubMed Central

    Aylon, Yael; Oren, Moshe

    2011-01-01

    Aneuploidy, often preceded by tetraploidy, is one of the hallmarks of solid tumors. Indeed, both aneuploidy and tetraploidy are oncogenic occurrences that are sufficient to drive neoplastic transformation and cancer progression. True to form, the tumor suppressor p53 obstructs propagation of these dangerous chromosomal events by either instigating irreversible cell cycle arrest or apoptosis. The tumor suppressor Lats2, along with other tumor inhibitory proteins such as BRCA1/2 and BubR1, are central to p53-dependent elimination of tetraploid cells. Not surprisingly, these proteins are frequently inactivated or downregulated in tumors, synergizing with p53 inactivation to establish an atmosphere of “tolerance” for a nondiploid state. PMID:21852209

  3. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    PubMed

    2003-01-01

    undergoing phase I trials for the potential treatment of lung, breast, ovarian, bladder, liver and brain cancers. Introgen and Aventis Pharma had signed a Cooperative Research and Development Agreement (CRADA) with the National Cancer Institute (NCI). NCI will sponsor clinical trials to evaluate and develop RPR/INGN 201 as a potential anticancer agent for these cancer indications. The trials conducted under a NCI-sponsored IND will evaluate RPR/INGN 201 alone and in combination with other anticancer agents. This agreement was originally signed by Rhône-Poulenc Rorer's Gencell. Introgen has completed three phase I clinical trials with INGN 201 in patients with bronchioalveolar cell lung carcinoma, ovarian cancer and recurrent glioblastomas, respectively. Intratumoural injection of RPR/INGN 201 in patients with recurrent glioblastomas was well tolerated and resulted in expression of the p53 protein. Direct administration of RPR/INGN 201 to the lower airways of patients with bronchioalveolar cell lung carcinoma resulted in symptomatic improvement and improved lung function in some patients. In February 2003, Introgen announced that the US Patent and Trademark Office has issued to The Board of Regents of The University of Texas System, patent No. 6,511,847 entitled "Recombinant p53 Adenovirus Methods and Compositions". Introgen Therapeutics is the exclusive licensee of this patent. The patent covers any adenoviral DNA molecules that encode the p53 gene positioned under the control of a promoter. Such a DNA molecule forms the genetic core of Introgen's ADVEXIN cancer therapy. Introgen's ADVEXIN therapy is now covered by up to ten separate US patents relevant to the product including compositions, therapeutic methods of administering the product in virtually any form, alone and in conjunction with the most widely used chemotherapeutic and radiation treatments, as well as its production. Introgen has a number of US patents that relate to the clinical use of ADVEXIN in cancer as

  4. p53MVA therapy in patients with refractory gastrointestinal malignancies elevates p53-specific CD8+ T cell responses

    PubMed Central

    Hardwick, Nicola R; Carrol, Mary; Kaltcheva, Teodora; Qian, Dajun; Lim, Dean; Leong, Lucille; Chu, Peiguo; Kim, Joseph; Chao, Joseph; Fakih, Marwan; Yen, Yun; Espenschied, Jonathan; Ellenhorn, Joshua D I; Diamond, Don J; Chung, Vincent

    2014-01-01

    PURPOSE: To conduct a Phase I trial of a Modified Vaccinia Ankara vaccine delivering wild type human p53 (p53MVA) in patients with refractory gastrointestinal cancers. EXPERIMENTAL DESIGN: Three patients were vaccinated with 1.0 × 108 pfu p53MVA followed by nine patients at 5.6 × 108 pfu. Toxicity was classified using the NCI Common Toxicity Criteria and clinical responses were assessed by CT scan. Peripheral blood samples were collected pre- and post-immunization for immunophenotyping, monitoring of p53MVA induced immune response and examination of PD-1 checkpoint inhibition in vitro. RESULTS: p53MVA immunization was well tolerated at both doses, with no adverse events above grade 2. CD4+ and CD8+ T cells showing enhanced recognition of a p53 overlapping peptide library were detectable after the first immunization, particularly in the CD8+ T cell compartment (p=0.03). However in most patients this did not expand further with the second and third immunization. The frequency of PD-1+ T cells detectable in patients PBMC was significantly higher than in healthy controls. Furthermore, the frequency of PD-1+ CD8+ T cells showed an inverse correlation with the peak CD8+ p53 response (p=0.02) and antibody blockade of PD-1 in vitro increased the p53 immune responses detected after the second or third immunizations. Induction of strong T cell and antibody responses to the MVA backbone were also apparent. CONCLUSION: p53MVA was well tolerated and induced robust CD8+ T cell responses. Combination of p53MVA with immune checkpoint inhibition could help sustain immune responses and lead to enhanced clinical benefit. PMID:24987057

  5. SAR405838: An optimized inhibitor of MDM2-p53 interaction that induces complete and durable tumor regression

    PubMed Central

    Wang, Shaomeng; Sun, Wei; Zhao, Yujun; McEachern, Donna; Meaux, Isabelle; Barrière, Cédric; Stuckey, Jeanne; Meagher, Jennifer; Bai, Longchuan; Liu, Liu; Hoffman-Luca, Cassandra Gianna; Lu, Jianfeng; Shangary, Sanjeev; Yu, Shanghai; Bernard, Denzil; Aguilar, Angelo; Dos-Santos, Odette; Besret, Laurent; Guerif, Stéphane; Pannier, Pascal; Gorge-Bernat, Dimitri; Debussche, Laurent

    2014-01-01

    Blocking the MDM2-p53 protein-protein interaction has long been considered to offer a broad cancer therapeutic strategy, despite the potential risks of selecting tumors harboring p53 mutations that escape MDM2 control. In this study, we report a novel small molecule inhibitor of the MDM2-p53 interaction, SAR405838 (MI-77301) that has been advanced into Phase I clinical trials. SAR405838 binds to MDM2 with Ki = 0.88 nM and has high specificity over other proteins. A co-crystal structure of the SAR405838:MDM2 complex shows that in addition to mimicking three key p53 amino acid residues, the inhibitor captures additional interactions not observed in the p53-MDM2 complex and induces refolding of the short, unstructured MDM2 N-terminal region to achieve its high affinity. SAR405838 effectively activates wild-type p53 in vitro and in xenograft tumor tissue of leukemia and solid tumors, leading to p53-dependent cell cycle arrest and/or apoptosis. At well-tolerated dose schedules, SAR405838 achieves either durable tumor regression or complete tumor growth inhibition in mouse xenograft models of SJSA-1 osteosarcoma, RS4;11 acute leukemia, LNCaP prostate cancer and HCT-116 colon cancer. Remarkably, a single oral dose of SAR405838 is sufficient to achieve complete tumor regression in the SJSA-1 model. Mechanistically, robust transcriptional up-regulation of PUMA induced by SAR405838 results in strong apoptosis in tumor tissue, leading to complete tumor regression. Our findings provide a preclinical basis upon which to evaluate SAR405838 as a therapeutic agent in patients whose tumors retain wild-type p53. PMID:25145672

  6. Pathologies Associated with the p53 Response

    PubMed Central

    Gudkov, Andrei V.; Komarova, Elena A.

    2010-01-01

    Although p53 is a major cancer preventive factor, under certain extreme stress conditions it may induce severe pathologies. Analyses of animal models indicate that p53 is largely responsible for the toxicity of ionizing radiation or DNA damaging drugs contributing to hematopoietic component of acute radiation syndrome and largely determining severe adverse effects of cancer treatment. p53-mediated damage is strictly tissue specific and occurs in tissues prone to p53-dependent apoptosis (e.g., hematopoietic system and hair follicles); on the contrary, p53 can serve as a survival factor in tissues that respond to p53 activation by cell cycle arrest (e.g., endothelium of small intestine). There are multiple experimental indications that p53 contributes to pathogenicity of acute ischemic diseases. Temporary reversible suppression of p53 by small molecules can be an effective and safe approach to reduce severity of p53-associated pathologies. PMID:20595398

  7. Regulation of Mutant p53 Protein Expression

    PubMed Central

    Vijayakumaran, Reshma; Tan, Kah Hin; Miranda, Panimaya Jeffreena; Haupt, Sue; Haupt, Ygal

    2015-01-01

    For several decades, p53 has been detected in cancer biopsies by virtue of its high protein expression level which is considered indicative of mutation. Surprisingly, however, mouse genetic studies revealed that mutant p53 is inherently labile, similar to its wild type (wt) counterpart. Consistently, in response to stress conditions, both wt and mutant p53 accumulate in cells. While wt p53 returns to basal level following recovery from stress, mutant p53 remains stable. In part, this can be explained in mutant p53-expressing cells by the lack of an auto-regulatory loop with Mdm2 and other negative regulators, which are pivotal for wt p53 regulation. Further, additional protective mechanisms are acquired by mutant p53, largely mediated by the co-chaperones and their paralogs, the stress-induced heat shock proteins. Consequently, mutant p53 is accumulated in cancer cells in response to chronic stress and this accumulation is critical for its oncogenic gain of functions (GOF). Building on the extensive knowledge regarding wt p53, the regulation of mutant p53 is unraveling. In this review, we describe the current understanding on the major levels at which mutant p53 is regulated. These include the regulation of p53 protein levels by microRNA and by enzymes controlling p53 proteasomal degradation. PMID:26734569

  8. Allele Specific p53 Mutant Reactivation

    PubMed Central

    Yu, Xin; Vazquez, Alexei; Levine, Arnold J.; Carpizo, Darren R.

    2012-01-01

    Summary Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Using the NCI anticancer drug screen data, we identified two compounds from the thiosemicarbazone family that manifest increased growth inhibitory activity in mutant p53 cells, particularly for the p53R175 mutant. Mechanistic studies reveal that NSC319726 restores WT structure and function to the p53R175 mutant. This compound kills p53R172H knock-in mice with extensive apoptosis and inhibits xenograft tumor growth in a 175-allele specific mutant p53 dependent manner. This activity depends upon the zinc ion chelating properties of the compound as well as redox changes. These data identify NSC319726 as a p53R175 mutant reactivator and as a lead compound for p53 targeted drug development. PMID:22624712

  9. Prospective therapeutic applications of p53 inhibitors

    SciTech Connect

    Gudkov, Andrei V. . E-mail: gudkov@ccf.org; Komarova, Elena A.

    2005-06-10

    p53, in addition to being a key cancer preventive factor, is also a determinant of cancer treatment side effects causing excessive apoptotic death in several normal tissues during cancer therapy. p53 inhibitory strategy has been suggested to protect normal tissues from chemo- and radiotherapy, and to treat other pathologies associated with stress-mediated activation of p53. This strategy was validated by isolation and testing of small molecule p53 inhibitor pifithrin-{alpha} that demonstrated broad tissue protecting capacity. However, in some normal tissues and tumors p53 plays protective role by inducing growth arrest and preventing cells from premature entrance into mitosis and death from mitotic catastrophe. Inhibition of this function of p53 can sensitize tumor cells to chemo- and radiotherapy, thus opening new potential application of p53 inhibitors and justifying the need in pharmacological agents targeting specifically either pro-apoptotic or growth arrest functions of p53.

  10. Phosphorylation of p53: a Novel Pathway for p53 Inactivation in Human T-Cell Lymphotropic Virus Type 1-Transformed Cells

    PubMed Central

    Pise-Masison, Cynthia A.; Radonovich, Michael; Sakaguchi, Kazuyasu; Appella, Ettore; Brady, John N.

    1998-01-01

    Inhibition of p53 function, through either mutation or interaction with viral or cellular transforming proteins, correlates strongly with the oncogenic potential. Only a small percentage of human T-cell lymphotropic virus type 1 (HTLV-1)-transformed cells carry p53 mutations, and mutated p53 genes have been found in only one-fourth of adult T-cell leukemia cases. In previous studies, we demonstrated that wild-type p53 is stabilized and transcriptionally inactive in HTLV-1-transformed cells. Further, the viral transcriptional activator Tax plays a role in both the stabilization and inactivation of p53 through a mechanism involving the first 52 amino acids of p53. Here we show for the first time that phosphorylation of p53 inactivates p53 by blocking its interaction with basal transcription factors. Using two-dimensional peptide mapping, we demonstrate that peptides corresponding to amino acids 1 to 19 and 387 to 393 are hyperphosphorylated in HTLV-1-transformed cells. Moreover, using antibodies specific for phosphorylated Ser15 and Ser392, we demonstrate increased phosphorylation of these amino acids. Since HTLV-1 p53 binds DNA in a sequence-specific manner but fails to interact with TFIID, we tested whether phosphorylation of the N terminus of p53 affected p53-TFIID interaction. Using biotinylated peptides, we show that phosphorylation of Ser15 alone inhibits p53-TFIID interaction. In contrast, phosphorylation at Ser15 and -37 restores TFIID binding and blocks MDM2 binding. Our studies provide evidence that HTLV-1 utilizes the posttranslational modification of p53 in vivo to inactivate function of the tumor suppressor protein. PMID:9658074

  11. Sodium orthovanadate inhibits p53-mediated apoptosis.

    PubMed

    Morita, Akinori; Yamamoto, Shinichi; Wang, Bing; Tanaka, Kaoru; Suzuki, Norio; Aoki, Shin; Ito, Azusa; Nanao, Tomohisa; Ohya, Soichiro; Yoshino, Minako; Zhu, Jin; Enomoto, Atsushi; Matsumoto, Yoshihisa; Funatsu, Osamu; Hosoi, Yoshio; Ikekita, Masahiko

    2010-01-01

    Sodium orthovanadate (vanadate) inhibits the DNA-binding activity of p53, but its precise effects on p53 function have not been examined. Here, we show that vanadate exerts a potent antiapoptotic activity through both transcription-dependent and transcription-independent mechanisms relative to other p53 inhibitors, including pifithrin (PFT) alpha. We compared the effects of vanadate to PFTalpha and PFTmicro, an inhibitor of transcription-independent apoptosis by p53. Vanadate suppressed p53-associated apoptotic events at the mitochondria, including the loss of mitochondrial membrane potential, the conformational change of Bax and Bak, the mitochondrial translocation of p53, and the interaction of p53 with Bcl-2. Similarly, vanadate suppressed the apoptosis-inducing activity of a mitochondrially targeted temperature-sensitive p53 in stable transfectants of SaOS-2 cells. In radioprotection assays, which rely on p53, vanadate completely protected mice from a sublethal dose of 8 Gy and partially from a lethal dose of 12 Gy. Together, our findings indicated that vanadate effectively suppresses p53-mediated apoptosis by both transcription-dependent and transcription-independent pathways, and suggested that both pathways must be inhibited to completely block p53-mediated apoptosis. PMID:20048077

  12. Identification of a Sequence Element from p53 That Signals for Mdm2-Targeted Degradation

    PubMed Central

    Gu, Jijie; Chen, Dongli; Rosenblum, Jamie; Rubin, Rachel M.; Yuan, Zhi-Min

    2000-01-01

    The binding of Mdm2 to p53 is required for targeting p53 for degradation. p73, however, binds to Mdm2 but is refractory to Mdm2-mediated degradation, indicating that binding to Mdm2 is not sufficient for degradation. By utilizing the structural homology between p53 and p73, we generated p53-p73 chimeras to determine the sequence element unique to p53 essential for regulation of its stability. We found that replacing an element consisting of amino acids 92 to 112 of p53 with the corresponding region of p73 results in a protein that is not degradable by Mdm2. Removal of amino acids 92 to 112 of p53 by deletion also results in a non-Mdm2-degradable protein. Significantly, the finding that swapping this fragment converts p73 from refractory to sensitive to Mdm2-mediated degradation supports the conclusion that the amino acids 92 to 112 of p53 function as a degradation signal. We propose that the presence of an additional protein recognizes the degradation signal and coordinates with Mdm2 to target p53 for degradation. Our finding opens the possibility of searching for the additional protein, which most likely plays a critical role in the regulation of p53 stability and therefore function. PMID:10648610

  13. DNA-mediated oxidation of p53.

    PubMed

    Schaefer, Kathryn N; Barton, Jacqueline K

    2014-06-01

    Transcription factor p53 is the most commonly altered gene in human cancer. As a redox-active protein in direct contact with DNA, p53 can directly sense oxidative stress through DNA-mediated charge transport. Electron hole transport occurs over long distances through the π-stacked bases and leads to the oxidative dissociation of p53. The extent of protein dissociation depends upon the redox potential of the DNA in direct contact with each p53 monomer. The DNA sequence dependence of p53 oxidative dissociation was examined by electrophoretic mobility shift assays using oligonucleotides containing both synthetic and human p53 consensus sequences with an appended photooxidant, anthraquinone. Greater p53 dissociation is observed from sequences containing low-redox potential purine regions, particularly guanine triplets. Using denaturing polyacrylamide gel electrophoresis of irradiated anthraquinone-modified DNA, the DNA damage sites corresponding to sites of preferred electron hole localization were determined. The resulting DNA damage preferentially localizes to guanine doublets and triplets. Oxidative DNA damage is inhibited in the presence of p53, but only at sites in direct contact with p53. From these data, predictions about the sensitivity of human p53-binding sites to oxidative stress as well as possible biological implications have been made. On the basis of our data, the guanine pattern within the purine region of each p53-binding site determines the response of p53 to DNA oxidation, yielding for some sequences the oxidative dissociation of p53 from a distance and thereby providing another potential role for DNA charge transport chemistry within the cell. PMID:24853816

  14. p53 mutation heterogeneity in cancer

    SciTech Connect

    Soussi, T. . E-mail: thierry.soussi@free.fr; Lozano, G.

    2005-06-10

    The p53 gene is inactivated in about 50% of human cancers and the p53 protein is an essential component of the cell response induced by genotoxic stresses such as those generated by radiotherapy or chemotherapy. It is therefore highly likely that these alterations are an important component in tumor resistance to therapy. The particular characteristics of these alterations, 80% of which are missense mutations leading to functionally heterogeneous proteins, make p53 a unique gene in the class of tumor suppressor genes. A considerable number of mutant p53 proteins probably have an oncogenic activity per se and therefore actively participate in cell transformation. The fact that the apoptotic and antiproliferative functions of p53 can be dissociated in certain mutants also suggests another level of complexity in the relationships between p53 inactivation and neoplasia.

  15. Mutant p53: one name, many proteins

    PubMed Central

    Freed-Pastor, William A.; Prives, Carol

    2012-01-01

    There is now strong evidence that mutation not only abrogates p53 tumor-suppressive functions, but in some instances can also endow mutant proteins with novel activities. Such neomorphic p53 proteins are capable of dramatically altering tumor cell behavior, primarily through their interactions with other cellular proteins and regulation of cancer cell transcriptional programs. Different missense mutations in p53 may confer unique activities and thereby offer insight into the mutagenic events that drive tumor progression. Here we review mechanisms by which mutant p53 exerts its cellular effects, with a particular focus on the burgeoning mutant p53 transcriptome, and discuss the biological and clinical consequences of mutant p53 gain of function. PMID:22713868

  16. p53 and ARF: Unexpected players in autophagy

    PubMed Central

    Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.

    2010-01-01

    p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino acids and subsequent survival. The mechanisms whereby p53 and ARF control autophagy are only now becoming elucidated. An emerging question is whether we can develop metabolic poisons that preferentially destroy tumor cells depending on their reliance on autophagy for survival, and on their p53 and ARF status. PMID:20303758

  17. Isolation, characterization and functional analysis of full length p53 cDNA from Bubalus bubalis.

    PubMed

    Singh, Minu; Aggarwal, Suruchi; Mohanty, Ashok K; Mukhopadhyay, Tapas

    2015-09-01

    p53 plays a pivotal role in maintaining the genomic integrity of the cell and has an important role in cellular transformation. We isolated and cloned a full length p53 cDNA (Bp53) from water buffalo in expression vectors designed to generate tagged proteins with FLAG or GFP. Bp53 was found to be 1161 nucleotide long and codes for 386 amino acid residues with 79% homology with human p53 containing 393 amino acids. Although Bp53 has some inherent differences in amino acid composition in different functional domains as compared to human p53 but the total electrostatic charge of amino acids has been maintained. Bp53 cDNA was transiently transfected in a p53 null human NSCLC cell line and as expected, it was predominantly localized in the nucleus. Besides, Bp53 effectively transactivates a number of target genes similar to human p53 and exerts most of its anti-tumorigenic potential in culture as observed in clonogenic and cell viability assays. Like human p53 mutants, core domain mutant version of Bp53 was found to be mis-localized to cytoplasm with diminished tumor suppressor activity. However, Bp53 appeared to be more sensitive to mdm2 mediated degradation and as a result, this protein was less stable as compared to human p53. For the first time we have characterized a functionally efficient wild-type p53 from buffalo having lower stability than human p53 and thus, buffalo p53 could be used as a model system for further insight to the molecular basis of wild-type p53 instability. PMID:26003295

  18. The p53-dependent radioadaptive response

    NASA Astrophysics Data System (ADS)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  19. Mitochondrial death functions of p53

    PubMed Central

    Marchenko, N D; Moll, U M

    2014-01-01

    The p53 tumor suppressor network plays a fundamental surveillance role in both homeostatic and adaptive cell biology. p53 is one of the most important barriers against malignant derailment of normal cells, orchestrating growth arrest, senescence, or cell death by linking many different pathways in response to genotoxic and non-genotoxic insults. p53 is the key broadband sensor for numerous cellular stresses such as DNA damage, hypoxia, oxidative stress, oncogenic signaling, and nucleolar stress. The crucial tumor suppressive and tissue homeostasis activity of p53 is its ability to activate cell death via multiple different pathways. A well-characterized biochemical function of p53 in the regulation of apoptosis is its role as a potent transcriptional regulator. p53 activates a panel of proapoptotic genes from the mitochondrial apoptotic and death receptor programs while repressing antiapoptotic Bcl2 family genes. In addition, over the last 10 y a growing body of evidence has also defined direct extranuclear non-transcriptional p53 activities within mitochondria-mediated cell death pathways that are based on p53 protein accumulation in cytosolic and mitochondrial compartments and protein-protein interactions. To date, transcription-independent p53-mediated cell death regulation has been described for apoptosis, necrosis, and autophagy. Because mitochondrial dysregulation is central to the development of a number of pathologic processes such as cancer and neurodegenerative and age-related diseases, understanding the direct roles of p53 protein in mitochondria has high translational impact and could facilitate the development of novel drug targets to combat these diseases. In this review we will mainly focus on mechanisms of p53-mediated transcription-independent cell death pathways at mitochondria. PMID:27308326

  20. Lysosomal destabilization in p53-induced apoptosis

    PubMed Central

    Yuan, Xi-Ming; Li, Wei; Dalen, Helge; Lotem, Joseph; Kama, Rachel; Sachs, Leo; Brunk, Ulf T.

    2002-01-01

    The tumor suppressor wild-type p53 can induce apoptosis. M1-t-p53 myeloid leukemic cells have a temperature-sensitive p53 protein that changes its conformation to wild-type p53 after transfer from 37°C to 32°C. We have now found that these cells showed an early lysosomal rupture after transfer to 32°C. Mitochondrial damage, including decreased membrane potential and release of cytochrome c, and the appearance of apoptotic cells occurred later. Lysosomal rupture, mitochondrial damage, and apoptosis were all inhibited by the cytokine IL-6. Some other compounds can also inhibit apoptosis induced by p53. The protease inhibitor N-tosyl-l-phenylalanine chloromethyl ketone inhibited the decrease in mitochondrial membrane potential and cytochrome c release, the Ca2+-ATPase inhibitor thapsigargin inhibited only cytochrome c release, and the antioxidant butylated hydroxyanisole inhibited only the decrease in mitochondrial membrane potential. In contrast to IL-6, these other compounds that inhibited some of the later occurring mitochondrial damage did not inhibit the earlier p53-induced lysosomal damage. The results indicate that apoptosis is induced by p53 through a lysosomal-mitochondrial pathway that is initiated by lysosomal destabilization, and that this pathway can be dissected by using different apoptosis inhibitors. These findings on the induction of p53-induced lysosomal destabilization can also help to formulate new therapies for diseases with apoptotic disorders. PMID:11959917

  1. Regulation of P53 stability in p53 mutated human and mouse hepatoma cells.

    PubMed

    Hailfinger, Stephan; Jaworski, Maike; Marx-Stoelting, Philip; Wanke, Ines; Schwarz, Michael

    2007-04-01

    The tumor suppressor p53 is frequently mutated in cancer. We have investigated the regulation of P53 in p53 wild type mouse hepatoma cells (line 55.1c), in p53 heterozygeously mutated cells (56.1b) and in p53 defective cells (lines 56.1d, 70.4 and HUH7) under various experimental settings. The basal levels of P53 were low in 55.1c cells, but nuclear accumulation occurred upon UV-irradiation. Similarly, UV-exposure induced stabilization of P53 in the heterozygeously p53 mutated 56.1b hepatoma cells. By contrast, the 3 hepatoma lines, which lack transcriptionally active P53, demonstrated high basal nuclear concentrations of P53 protein and, unexpectedly, showed loss of P53 upon UV-irradiation. Expression of p53 mRNA was also decreased in p53 defective cells after 24 hr post UV-irradiation, which may be linked to induction of apoptosis of the irradiated cells under these conditions. Other stressors like H2O2 also mediated a decrease in P53 concentration in p53 defective cells. This effect occurred at very low concentrations and was already detectable 1-2 hr after exposure of cells. There were no signs of apoptosis of H2O2-exposed cells at this time point and no significant changes in p53 mRNA or MDM2 level. These unexpected findings indicate a new aspect related to regulation of P53 stability in cells with a defect in the tumor suppressor protein. PMID:17205518

  2. Structure of the Tfb1/p53 complex: Insights into the interaction between the p62/Tfb1 subunit of TFIIH and the activation domain of p53.

    PubMed

    Di Lello, Paola; Jenkins, Lisa M Miller; Jones, Tamara N; Nguyen, Bao D; Hara, Toshiaki; Yamaguchi, Hiroshi; Dikeakos, Jimmy D; Appella, Ettore; Legault, Pascale; Omichinski, James G

    2006-06-23

    The interaction between the amino-terminal transactivation domain (TAD) of p53 and TFIIH is directly correlated with the ability of p53 to activate both transcription initiation and elongation. We have identified a region within the p53 TAD that specifically interacts with the pleckstrin homology (PH) domain of the p62 and Tfb1 subunits of human and yeast TFIIH. We have solved the 3D structure of a complex between the p53 TAD and the PH domain of Tfb1 by NMR spectroscopy. Our structure reveals that p53 forms a nine residue amphipathic alpha helix (residues 47-55) upon binding to Tfb1. In addition, we demonstrate that diphosphorylation of p53 at Ser46 and Thr55 leads to a significant enhancement in p53 binding to p62 and Tfb1. These results indicate that a phosphorylation cascade involving Ser46 and Thr55 of p53 could play an important role in the regulation of select p53 target genes. PMID:16793543

  3. Microbial Regulation of p53 Tumor Suppressor.

    PubMed

    Zaika, Alexander I; Wei, Jinxiong; Noto, Jennifer M; Peek, Richard M

    2015-09-01

    p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40). Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections. PMID:26379246

  4. Microbial Regulation of p53 Tumor Suppressor

    PubMed Central

    Zaika, Alexander I.; Wei, Jinxiong; Noto, Jennifer M.; Peek, Richard M.

    2015-01-01

    p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40). Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host–bacteria interactions and tumorigenesis associated with bacterial infections. PMID:26379246

  5. The heme-p53 interaction: Linking iron metabolism to p53 signaling and tumorigenesis.

    PubMed

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Xie, Dong; Wang, Fudi; Hu, Ronggui

    2016-01-01

    Recently, we reported that heme binds to tumor suppressor p53 protein (TP53, best known as p53) and promotes its nuclear export and cytosolic degradation, whereas iron chelation stabilizes p53 protein and suppresses tumors in a p53-dependent manner. This not only provides mechanistic insights into tumorigenesis associated with iron excess, but also helps guide the administration of chemotherapy based on iron deprivation in the clinic. PMID:27308524

  6. The heme–p53 interaction: Linking iron metabolism to p53 signaling and tumorigenesis

    PubMed Central

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Xie, Dong; Wang, Fudi; Hu, Ronggui

    2016-01-01

    Recently, we reported that heme binds to tumor suppressor p53 protein (TP53, best known as p53) and promotes its nuclear export and cytosolic degradation, whereas iron chelation stabilizes p53 protein and suppresses tumors in a p53-dependent manner. This not only provides mechanistic insights into tumorigenesis associated with iron excess, but also helps guide the administration of chemotherapy based on iron deprivation in the clinic. PMID:27308524

  7. PILOT STUDY FOR ARSENIC CARCINOGENESIS IN P53 HETEROZYGOTE DEFICIENT MICE

    EPA Science Inventory

    40 p53 heterozygous knockout mice and 40 p53 wild-type controls were exposed to 4 arsenicals in drinking water at a single dose, the maximum tolerated dose (MTD), in a chronic lifetime tumor bioassay, and animals were subjected to necropsy and limited pathologic examination of th...

  8. Expression of p53β and Δ133p53 isoforms in different gastric tissues

    PubMed Central

    Ji, Wansheng; Zhang, Na; Zhang, Hongmei; Ma, Jingrong; Zhong, Hua; Jiao, Jianxin; Gao, Zhixing

    2015-01-01

    This study aims to detect the mRNA of p53β and Δ133p53 isoforms in three gastric carcinoma cell lines and tissues of superficial gastritis, atrophic gastritis, gastric carcinoma, or paracancerous area. Nested reverse transcription PCR was used to detect the mRNA of p53β and Δ133p53 isoforms in tissues of superficial gastritis, chronic atrophic gastritis, gastric cancer cell lines (SGC-7901, MKN45, KATO III), gastric adenocarcinoma, and paracancerous lesion. The amplified products were shown by agarose gel electrophoresis. The expression difference among various tissues was analyzed by x2 tests. The positive rates of ∆133p53 mRNA were 73.3% (11/15) in gastric adenocarcinoma and 20% (3/15) in paracancerous tissue, whereas the positive rates of p53β mRNA were 20% (3/15) in gastric adenocarcinoma and 66.7% (10/15) in paracancerous tissue. The difference between adenocarcinoma and paracancerous tissues was significant (P<0.05). The positive rates of ∆133p53 mRNA were 25% (5/20), 50% (15/30), and 75% (15/20), respectively, in superficial gastritis, atrophic gastritis, and gastric adenocarcinoma; the positive rates of p53β mRNA were 65% (13/20), 33.3% (10/30), and 25% (5/20), respectively, in superficial gastritis, atrophic gastritis, and gastric adenocarcinoma. The difference between adenocarcinoma and superficial gastritis samples was significant (P<0.05). Both p53β and ∆133p53 mRNAs were positive in MKN45; only p53β mRNA was detected in SGC7901; neither p53β nor ∆133p53 mRNA was detected in KATO III. ∆133p53 and p53β, which are possible indicators for the diagnosis and biological therapy of gastric carcinoma, were expressed differentially in different gastric tissues. PMID:26617756

  9. p53 and Mitochondrial Function in Neurons

    PubMed Central

    Wang, David B.; Kinoshita, Chizuru; Kinoshita, Yoshito; Morrison, Richard S.

    2014-01-01

    The p53 tumor suppressor plays a central role in dictating cell survival and death as a cellular sensor for a myriad of stresses including DNA damage, oxidative and nutritional stress, ischemia and disruption of nucleolar function. Activation of p53-dependent apoptosis leads to mitochondrial apoptotic changes via the intrinsic and extrinsic pathways triggering cell death execution most notably by release of cytochrome c and activation of the caspase cascade. Although it was previously believed that p53 induces apoptotic mitochondrial changes exclusively through transcription-dependent mechanisms, recent studies suggest that p53 also regulates apoptosis via a transcription-independent action at the mitochondria. Recent evidence further suggests that p53 can regulate necrotic cell death and autophagic activity including mitophagy. An increasing number of cytosolic and mitochondrial proteins involved in mitochondrial metabolism and respiration are regulated by p53, which influences mitochondrial ROS production as well. Cellular redox homeostasis is also directly regulated by p53 through modified expression of pro- and anti-oxidant proteins. Proper regulation of mitochondrial size and shape through fission and fusion assures optimal mitochondrial bioenergetic function while enabling adequate mitochondrial transport to accommodate local energy demands unique to neuronal architecture. Abnormal regulation of mitochondrial dynamics has been increasingly implicated in neurodegeneration, where elevated levels of p53 may have a direct contribution as the expression of some fission/fusion proteins are directly regulated by p53. Thus, p53 may have a much wider influence on mitochondrial integrity and function than one would expect from its well-established ability to transcriptionally induce mitochondrial apoptosis. However, much of the evidence demonstrating that p53 can influence mitochondria through nuclear, cytosolic or intra-mitochondrial sites of action has yet to be

  10. EBNA3C regulates p53 through induction of Aurora kinase B.

    PubMed

    Jha, Hem C; Yang, Karren; El-Naccache, Darine W; Sun, Zhiguo; Robertson, Erle S

    2015-03-20

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  11. EBNA3C regulates p53 through induction of Aurora kinase B

    PubMed Central

    Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

    2015-01-01

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  12. Germ cell tumors of the testis overexpress wild-type p53.

    PubMed Central

    Guillou, L.; Estreicher, A.; Chaubert, P.; Hurlimann, J.; Kurt, A. M.; Metthez, G.; Iggo, R.; Gray, A. C.; Jichlinski, P.; Leisinger, H. J.; Benhattar, J.

    1996-01-01

    Several recent studies have suggested that testicular germ cell tumors express high levels of wild-type p53 protein. To clarify and confirm this unexpected result, we have investigated seminomatous and nonseminomatous germ cell tumors at the genomic, mRNA, and protein levels. Thirty-five tumors were examined for p53 overexpression using antibodies directed against the p53 (PAb1801, PAb240, and CM1), mdm2 (IF2), and p21Waf1/Clp1 (EA10) proteins. Thirty-two tumors were screened for p53 mutations by single-strand conformation polymorphism analysis. Eighteen tumors were screened with a functional assay that tests the transcriptional competence of human p53 protein expressed in yeast. On frozen sections, 100, 65, 35, 73, and 0% of tumors reacted with the CM1, PAb240, PAb1801, IF2, and EA10 antibodies, respectively. No p53 mutations were detected by single-strand conformation polymorphism or by functional assay. The fact that many tumors overexpress wild-type p53 but not mdm2 rules out mdm2 overexpression as a general explanation for the presence of wild-type p53 in these tumors. The absence of p21 overexpression suggests that p53 may be unable to activate transcription of critical target genes, which may explain why the presence of wild-type p53 is tolerated in this tumor type, although the mechanism for this transcriptional inactivity remains to be established. Images Figure 1 Figure 2 PMID:8863671

  13. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  14. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53

    PubMed Central

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Casanova, M. Llanos; Paramio, Jesús M.; Bravo, Ana; Ramirez, Angel

    2016-01-01

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  15. Expression of p53 in endometrial polyps with special reference to the p53 signature.

    PubMed

    Sho, Tomoko; Hachisuga, Toru; Kawagoe, Toshinori; Urabe, Rie; Kurita, Tomoko; Kagami, Seiji; Shimajiri, Shohei; Fujino, Yoshihisa

    2016-07-01

    We herein examined the significance of the p53 expression in endometrial polyps (EMPs). A total of 133 EMPs, including 62 premenopausal and 71 postmenopausal women with EMP, were immunohistochemically studied for the expression of estrogen receptor (ER)-alpha, Ki-67 and p53. Apoptotic cells were identified using a TUNEL assay. A DNA sequence analysis of TP53 exons 5 to 9 was performed. Among the premenopausal EMPs, a multivariate analysis showed the labeling index (LI) for Ki-67 to correlate significantly with that for p53 (P<0.001), but not that for apoptosis. On the contrary, among the postmenopausal EMPs, the LI for Ki-67 correlated significantly with that for apoptosis (P<0.001). The p53 signature (p53S) was defined by endometrial epithelial cells, which are morphologically benign in appearance but display 12 or more consecutive epithelial cell nuclei with strong p53 immunostaining. The p53S was found in nine (12.7%) postmenopausal EMPs (mean age: 70.2 years). The median Ki-67 index for the p53S was 7%, with no significant difference from that of the glands of the postmenopausal EMPs without the p53S (P=0.058). The median apoptotic index for the p53S was 0%, which was significantly lower than that of the postmenopausal EMPs without the p53S (P=0.002). Two of four p53Ss showed TP53 mutations according to the DNA sequence analysis. The presence of the p53S is not rare in postmenopausal EMPs with an advanced age. Among postmenopausal EMPs, the LI of Ki-67 significantly correlates with that of apoptosis. However, such a positive correlation between the LI of Ki-67 and apoptosis is not observed in p53S. PMID:26727623

  16. p53, Stem Cells, and Reprogramming

    PubMed Central

    Spike, Benjamin T.; Wahl, Geoffrey M.

    2011-01-01

    p53 is well recognized as a potent tumor suppressor. In its classic role, p53 responds to genotoxic insults by inducing cell cycle exit or programmed cell death to limit the propagation of cells with corrupted genomes. p53 is also implicated in a variety of other cellular processes in which its involvement is less well understood including self-renewal, differentiation, and reprogramming. These activities represent an emerging area of intense interest for cancer biologists, as they provide potential mechanistic links between p53 loss and the stem cell–like cellular plasticity that has been suggested to contribute to tumor cell heterogeneity and to drive tumor progression. Despite accumulating evidence linking p53 loss to stem-like phenotypes in cancer, it is not yet understood how p53 contributes to acquisition of “stemness” at the molecular level. Whether and how stem-like cells confer survival advantages to propagate the tumor also remain to be resolved. Furthermore, although it seems reasonable that the combination of p53 deficiency and the stem-like state could contribute to the genesis of cancers that are refractory to treatment, direct linkages and mechanistic underpinnings remain under investigation. Here, we discuss recent findings supporting the connection between p53 loss and the emergence of tumor cells bearing functional and molecular similarities to stem cells. We address several potential molecular and cellular mechanisms that may contribute to this link, and we discuss implications of these findings for the way we think about cancer progression. PMID:21779509

  17. Nucleolar stress with and without p53.

    PubMed

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell's energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  18. Nucleolar stress with and without p53

    PubMed Central

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell’s energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  19. Mutation of p53 Tumor Suppressor Gene in Hepatocellular Carcinoma.

    PubMed

    Tullo, A; Sbisà, E

    2000-01-01

    In recent years, the most commonly observed genetic alteration in hepatocellular carcinoma (HCC), as in many other tumors affecting man, has been reported to be the mutation of the p53 coding gene (1,2). This gene has the features of a recessive oncosuppressor in its wild-type form and can be a dominant oncogene in its mutated form. The gene (20 kb) is located in a single copy on the short arm of chromosome 17 and contains 11 exons interrupted by 10 introns. The mRNA (2.8 kb) codes for a protein of 393 amino acids, which is expressed at relatively low levels in all tissues. p53 product is a 53-kDa phosphoprotein involved in the regulation of cell cycle, in DNA synthesis and repair, and in cell differentiation and apoptosis (see refs. 3-6, for reviews). PMID:21341051

  20. p53-directed translational control can shape and expand the universe of p53 target genes

    PubMed Central

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-01-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  1. p53-directed translational control can shape and expand the universe of p53 target genes.

    PubMed

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-10-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  2. Genetic and immunochemical analysis of mutant p53 in human breast cancer cell lines.

    PubMed

    Bartek, J; Iggo, R; Gannon, J; Lane, D P

    1990-06-01

    The expression of the tumour suppressor gene p53 was analysed in 11 human breast cancer cell lines by immunohistochemistry, immunoprecipitation and cDNA sequencing. We used a panel of anti-p53 monoclonal antibodies for cell staining and found abnormalities in every case. Eight of the cell lines produce a form of p53 which can be immunoprecipitated by the monoclonal antibody PAb240 but not by PAb1620. In the murine system PAb240 only immunoprecipitates mutant p53. We sequenced p53 cDNA directly from four of the PAb240 positive cell lines using asymmetric PCR templates. All four contained missense mutations in p53 RNA, with no detectable expression of the wild type sequence. Different residues were affected in each cell line, but all the mutations changed amino acids conserved from man to Xenopus. These results imply that as in the murine system, the PAb240 antibody reliably detects a wide variety of p53 mutations and that these mutations have a common effect on the structure of p53. Immunohistochemical data suggest that p53 mutation is the commonest genetic alteration so far detected in primary breast cancer. PMID:1694291

  3. The role of p53 in ribosomopathies.

    PubMed

    Fumagalli, Stefano; Thomas, George

    2011-04-01

    Impaired ribosome biogenesis is the underlying cause of the pathological conditions collectively known as ribosomopathies. Several hypotheses have been advanced to explain the mechanisms by which deficiencies in ribosome biogenesis interfere with developmental processes leading eventually to the emergence of these diseases. In recent years it has become clear that perturbation of this process triggers a cell-cycle checkpoint that, through activation of the tumor-suppressor p53, leads to cell-cycle arrest and apoptosis. Indeed, evidence is accumulating from studies in animal models that the unscheduled activation of p53 is responsible for perturbations in tissue homeostasis that cause the development of ribosomopathies such as Treacher-Collins syndrome (TCS) and 5q(-) syndrome. These findings imply that inhibition of p53, or better, of mechanisms that specifically lead to p53 activation in response to inhibition of ribosome biogenesis, could be targeted in the treatment of ribosomopathies where activation of p53 is shown to play a pathogenic role. PMID:21435506

  4. p53 mutation, but not p53 overexpression, correlates with survival in head and neck squamous cell carcinoma.

    PubMed Central

    Mineta, H.; Borg, A.; Dictor, M.; Wahlberg, P.; Akervall, J.; Wennerberg, J.

    1998-01-01

    Survival in squamous cell carcinoma of the head and neck (HNSCC) was compared with overexpression and mutation of the p53 gene. Archival tissue from 77 tumours was analysed for protein expression using immunohistochemistry (IHC) with the monoclonal antibody Do-7, and for the presence of mutation in exons 5-8 using single-stranded conformation polymorphism (SSCP), followed by DNA sequencing in SSCP-positive cases. p53 expression was scored as high (>70% nuclei stained) in 25 (32%) tumours, as intermediate (10-70% nuclei stained) in 19 (25%) tumours and as low (<10% nuclei stained) in 33 (43%) tumours. Twelve (18%) tumours exhibited gene mutation (ten missense and two nonsense mutations) and an additional five tumours contained changes that could not result in amino acid substitution or protein truncation. There was no correlation between gene expression and mutation, mutations being equally frequent in tumours with either high (4/25), intermediate (4/19) or low protein expression (4/33). Fifty-eight patients were eligible for survival analysis. There was a strong correlation between p53 mutation and cause-specific survival; median survival among mutated cases was 12.5 months compared with >160 months among non-mutated patients (P < 0.005). There was no correlation between p53 overexpression and survival. The results suggest that p53 mutation status is an important prognostic factor in HNSCC, and that IHC analysis of protein overexpression is an inadequate measure of gene mutation in these tumours. Images Figure 1 PMID:9792155

  5. Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

    PubMed Central

    Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

    2016-01-01

    Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

  6. More targets, more pathways and more clues for mutant p53

    PubMed Central

    Garritano, S; Inga, A; Gemignani, F; Landi, S

    2013-01-01

    Mutations in the transcription factor p53 are among the most common genetic alterations in human cancer, and missense p53 mutations in cancer cells can lead to aggressive phenotypes. So far, only few studies investigated transcriptional reprogramming under mutant p53 expression as a means to identify deregulated targets and pathways. A review of the literature was carried out focusing on mutant p53-dependent transcriptome changes with the aims of (i) verifying whether different p53 mutations can be equivalent for their effects, or whether there is a mutation-specific transcriptional reprogramming of target genes, (ii) understanding what is the main mechanism at the basis of upregulation or downregulation of gene expression under the p53 mutant background, (iii) identifying novel candidate target genes of WT and/or mutant p53 and (iv) defining cellular pathways affected by the mutant p53-dependent gene expression reprogramming. Nearly 600 genes were consistently found upregulated or downregulated upon ectopic expression of mutant p53, regardless of the specific p53 mutation studied. Promoter analysis and the use of ChIP-seq data indicate that, for most genes, the expression changes could be ascribed to a loss both of WT p53 transcriptional activation and repressor functions. Pathway analysis indicated changes in the metabolism/catabolism of amino acids such as aspartate, glutamate, arginine and proline. Novel p53 candidate target genes were also identified, including ARID3B, ARNT2, CLMN, FADS1, FTH1, KPNA2, LPHN2, PARD6B, PDE4C, PIAS2, PRPF40A, PYGL and RHOBTB2, involved in the metabolism, xenobiotic responses and cell differentiation. PMID:23817466

  7. p53 protects against LPS-induced lung endothelial barrier dysfunction

    PubMed Central

    Dimitropoulou, Christiana; Birmpas, Charalampos; Joshi, Atul; Thangjam, Gagan; Catravas, John D.

    2015-01-01

    New therapies toward heart and blood vessel disorders may emerge from the development of Hsp90 inhibitors. Several independent studies suggest potent anti-inflammatory activities of those agents in human tissues. The molecular mechanisms responsible for their protective effects in the vasculature remain unclear. The present study demonstrates that the transcription factor p53, an Hsp90 client protein, is crucial for the maintenance of vascular integrity, protects again LPS-induced endothelial barrier dysfunction, and is involved in the mediation of the anti-inflammatory activity of Hsp90 inhibitors in lung tissues. p53 silencing by siRNA decreased transendothelial resistance (a measure of endothelial barrier function). A similar effect was induced by the p53 inhibitor pifithrin, which also potentiated the LPS-induced hyperpermeability in human lung microvascular endothelial cells (HLMVEC). On the other hand, p53 induction by nutlin suppressed the LPS-induced vascular barrier dysfunction. LPS decreased p53 expression in lung tissues and that effect was blocked by pretreatment with Hsp90 inhibitors both in vivo and in vitro. Furthermore, the Hsp90 inhibitor 17-allyl-amino-demethoxy-geldanamycin suppressed the LPS-induced overexpression of the p53 negative regulator MDMX as well as p53 and MDM2 (another p53 negative regulator) phosphorylation in HLMVEC. Both negative p53 regulators were downregulated by LPS in vivo. Chemically induced p53 overexpression resulted in the suppression of LPS-induced RhoA activation and MLC2 phosphorylation, whereas p53 suppression caused the opposite effects. These observations reveal new mechanisms for the anti-inflammatory actions of Hsp90 inhibitors, i.e., the induction of the transcription factor p53, which in turn can orchestrate robust vascular anti-inflammatory responses both in vivo and in vitro. PMID:25713322

  8. TRIM32 is a novel negative regulator of p53.

    PubMed

    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui

    2015-01-01

    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  9. TRIM32 is a novel negative regulator of p53

    PubMed Central

    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui

    2015-01-01

    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  10. p53 Suppresses Tetraploid Development in Mice

    PubMed Central

    Horii, Takuro; Yamamoto, Masamichi; Morita, Sumiyo; Kimura, Mika; Nagao, Yasumitsu; Hatada, Izuho

    2015-01-01

    Mammalian tetraploid embryos die in early development because of defects in the epiblast. Experiments with diploid/tetraploid chimeric mice, obtained via the aggregation of embryonic stem cells, clarified that while tetraploid cells are excluded from epiblast derivatives, diploid embryos with tetraploid extraembryonic tissues can develop to term. Today, this method, known as tetraploid complementation, is usually used for rescuing extraembryonic defects or for obtaining completely embryonic stem (ES) cell-derived pups. However, it is still unknown why defects occur in the epiblast during mammalian development. Here, we demonstrated that downregulation of p53, a tumour suppressor protein, rescued tetraploid development in the mammalian epiblast. Tetraploidy in differentiating epiblast cells triggered p53-dependent cell-cycle arrest and apoptosis, suggesting the activation of a tetraploidy checkpoint during early development. Finally, we found that p53 downregulation rescued tetraploid embryos later in gestation. PMID:25752699

  11. Δ113p53/Δ133p53 converts P53 from a repressor to a promoter of DNA double-stand break repair

    PubMed Central

    Gong, Lu; Chen, Jun

    2016-01-01

    ABSTRACT In response to DNA damage, p53 (TP53, best known as p53) is quickly activated leading to cell cycle arrest or apoptosis to ensure genomic integrity; however, this represses DNA double-strand break (DSB) repair. Our recent work revealed that Δ113p53/Δ133p53 protein is accumulated at a later stage upon DNA DSB stress to switch p53 signaling from repression to promotion of DNA DSB repair. PMID:27308550

  12. The E3 ubiquitin protein ligase HERC2 modulates the activity of tumor protein p53 by regulating its oligomerization.

    PubMed

    Cubillos-Rojas, Monica; Amair-Pinedo, Fabiola; Peiró-Jordán, Roser; Bartrons, Ramon; Ventura, Francesc; Rosa, Jose Luis

    2014-05-23

    The tumor suppressor p53 is a transcription factor that coordinates the cellular response to several kinds of stress. p53 inactivation is an important step in tumor progression. Oligomerization of p53 is critical for its posttranslational modification and its ability to regulate the transcription of target genes necessary to inhibit tumor growth. Here we report that the HECT E3 ubiquitin ligase HERC2 interacts with p53. This interaction involves the CPH domain of HERC2 (a conserved domain within Cul7, PARC, and HERC2 proteins) and the last 43 amino acid residues of p53. Through this interaction, HERC2 regulates p53 activity. RNA interference experiments showed how HERC2 depletion reduces the transcriptional activity of p53 without affecting its stability. This regulation of p53 activity by HERC2 is independent of proteasome or MDM2 activity. Under these conditions, up-regulation of cell growth and increased focus formation were observed, showing the functional relevance of the HERC2-p53 interaction. This interaction was maintained after DNA damage caused by the chemotherapeutic drug bleomycin. In these stressed cells, p53 phosphorylation was not impaired by HERC2 knockdown. Interestingly, p53 mutations that affect its tetramerization domain disrupted the HERC2-p53 interaction, suggesting a role for HERC2 in p53 oligomerization. This regulatory role was shown using cross-linking assays. Thus, the inhibition of p53 activity after HERC2 depletion can be attributed to a reduction in p53 oligomerization. Ectopic expression of HERC2 (residues 2292-2923) confirmed these observations. Together, these results identify HERC2 as a novel regulator of p53 signaling. PMID:24722987

  13. Frameshift and nonsense p53 mutations in squamous-cell carcinoma of head and neck - non-reactivity with 3 anti-p53 monoclonal-antibodies.

    PubMed

    Chen, Y; Xu, L; Massey, L; Zlotolow, I; Huvos, A; Garinchesa, P; Old, L

    1994-03-01

    p53 mutations in human tumors are often associated with overexpression of p53, and immunohistochemical detection of p53 has frequently been chosen as a simpler method than genetic analysis to access p53 mutations. In this study, we analyzed the p53 gene by single-strand conformational polymorphism (SSCP) and DNA sequencing, and correlated findings to Ab staining results. In a series of 58 squamous cell carcinoma, 15 showed mutations in exons 5, 6, 7, 8 and 9 by SSCP. Of these 15 cases, 11 were positive by antibody staining, and DNA sequencing showed missense mutations but no frameshift or nonsense mutations. In contrast, the antibody-negative cases had frameshift or nonsense mutations, but no missense mutations. SSCP analysis of these 4 cases showed mutations in exon 6 (2 cases), exon 7 (1), and exon 8 (1), respectively. In case 1, sequencing data revealed a single-base addition in exon 6, leading to a truncated gene product of 207 amino acids (aa), in contrast to 393 aa in wild-type p53. Similar frameshift mutations were shown in case 2 and case 3. Case 4, instead of a frameshift mutation, carried a nonsense mutation, and a truncated peptide of 235 aa. All these mutations thus shared the feature of producing truncated p53 products nonreactive with antibodies. We conclude that frameshift mutations as well as nonsense mutations can lead to altered p53 undetectable by available monoclonal antibodies. Our finding indicates that the absence of Ab reactivity does not rule out genetic alterations of the p53 gene in human tumors. PMID:21566966

  14. Mutant p53: Multiple Mechanisms Define Biologic Activity in Cancer

    PubMed Central

    Kim, Michael Paul; Zhang, Yun; Lozano, Guillermina

    2015-01-01

    The functional importance of p53 as a tumor suppressor gene is evident through its pervasiveness in cancer biology. The p53 gene is the most commonly altered gene in human cancer; however, not all genetic alterations are biologically equivalent. The majority of alterations involve p53 missense mutations that result in the production of mutant p53 proteins. Such mutant p53 proteins lack normal p53 function and may concomitantly gain novel functions, often with deleterious effects. Here, we review characterized mechanisms of mutant p53 gain of function in various model systems. In addition, we review mutant p53 addiction as emerging evidence suggests that tumors may depend on sustained mutant p53 activity for continued growth. We also discuss the role of p53 in stromal elements and their contribution to tumor initiation and progression. Lastly, current genetic mouse models of mutant p53 in various organ systems are reviewed and their limitations discussed. PMID:26618142

  15. A novel p53 mutant in human breast cancer revealed by multiple SSCP analysis.

    PubMed

    Nigro, V; Napolitano, M; Abbondanza, C; Medici, N; Puca, A A; Schiavulli, M; Armetta, I; Moncharmont, B; Puca, G A; Molinari, A M

    1994-04-29

    DNA from tumor tissue and peripheral blood lymphocytes of primary breast cancer patients was screened for the presence of p53 mutations. In DNA from one tumor we found that the histidine codon 193 (CAT) was somatically converted to arginine (CGT). This amino acid residue is highly conserved in many species, thus suggesting that such mutation plays an important role in the loss of wt-p53 function. PMID:8187056

  16. Modulation of cellular and viral promoters by mutant human p53 proteins found in tumor cells.

    PubMed Central

    Deb, S; Jackson, C T; Subler, M A; Martin, D W

    1992-01-01

    Wild-type p53 has recently been shown to repress transcription from several cellular and viral promoters. Since p53 mutations are the most frequently reported genetic defects in human cancers, it becomes important to study the effects of mutations of p53 on promoter functions. We, therefore, have studied the effects of wild-type and mutant human p53 on the human proliferating-cell nuclear antigen (PCNA) promoter and on several viral promoters, including the herpes simplex virus type 1 UL9 promoter, the human cytomegalovirus major immediate-early promoter-enhancer, and the long terminal repeat promoters of Rous sarcoma virus and human T-cell lymphotropic virus type I. HeLa cells were cotransfected with a wild-type or mutant p53 expression vector and a plasmid containing a chloramphenicol acetyltransferase reporter gene under viral (or cellular) promoter control. As expected, expression of the wild-type p53 inhibited promoter function. Expression of a p53 with a mutation at any one of the four amino acid positions 175, 248, 273, or 281, however, correlated with a significant increase of the PCNA promoter activity (2- to 11-fold). The viral promoters were also activated, although to a somewhat lesser extent. We also showed that activation by a mutant p53 requires a minimal promoter containing a lone TATA box. A more significant increase (25-fold) in activation occurs when the promoter contains a binding site for the activating transcription factor or cyclic AMP response element-binding protein. Using Saos-2 cells that do not express p53, we showed that activation by a mutant p53 was a direct enhancement. The mutant forms of p53 used in this study are found in various cancer cells. The activation of PCNA by mutant p53s may indicate a way to increase cell proliferation by the mutant p53s. Thus, our data indicate a possible functional role for the mutants of p53 found in cancer cells in activating several important loci, including PCNA. Images PMID:1356162

  17. Ferroptosis: A missing puzzle piece in the p53 blueprint?

    PubMed Central

    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei

    2016-01-01

    ABSTRACT Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  18. Pharmacological Activation of p53 in Cancer Cells

    PubMed Central

    Athar, Mohammad; Elmets, Craig A.; Kopelovich, Levy

    2013-01-01

    Tumor suppressor p53 is a transcription factor that regulates a large number of genes and guards against genomic instability. Under multiple cellular stress conditions, p53 functions to block cell cycle progression transiently unless proper DNA repair occurs. Failure of DNA repair mechanisms leads to p53-mediated induction of cell death programs. p53 also induces permanent cell cycle arrest known as cellular senescence. During neoplastic progression, p53 is often mutated and fails to efficiently perform these functions. It has been observed that cancers carrying a wild-type p53 may also have interrupted downstream p53 regulatory signaling leading to disruption in p53 functions. Therefore, strategies to reactivate p53 provide an attractive approach for blocking tumor pathogenesis and its progression. p53 activation may also lead to regression of existing early neoplastic lesions and therefore may be important in developing cancer chemoprevention protocols. A large number of small molecules capable of reactivating p53 have been developed and some are progressing through clinical trials for prospective human applications. However, several questions remain to be answered at this stage. For example, it is not certain if pharmacological activation of p53 will restore all of its multifaceted biological responses, assuming that the targeted cell is not killed following p53 activation. It remains to be demonstrated whether the distinct biological effects regulated by specific post-transnationally modified p53 can effectively be restored by refolding mutant p53. Mutant p53 can be classified as a loss of function or gain of function protein depending on the type of mutation. It is also unclear whether reactivation of mutant p53 has similar consequences in cells carrying gain-of-function and loss-of-function p53 mutants. This review provides a description of various pharmacological approaches tested to activate p53 (both wild-type and mutant) and to assess the effects of

  19. Ferroptosis: A missing puzzle piece in the p53 blueprint?

    PubMed

    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei

    2016-05-01

    Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  20. The combination of 5-fluorouracil plus p53 pathway restoration is associated with depletion of p53-deficient or mutant p53-expressing putative colon cancer stem cells.

    PubMed

    Huang, Catherine; Zhang, Xiang M; Tavaluc, Raluca T; Hart, Lori S; Dicker, David T; Wang, Wenge; El-Deiry, Wafik S

    2009-11-01

    The cancer stem cell hypothesis suggests that rare populations of tumor-initiating cells may be resistant to therapy, lead to tumor relapse and contribute to poor prognosis for cancer patients. We previously demonstrated the feasibility of p53 pathway restoration in p53-deficient tumor cell populations using small molecules including ellipticine or its derivatives. We now establish a single cell p53-regulated green fluorescent protein (EGFP)-reporter system in human DLD1 colon tumor cells expressing mutant p53 protein. We use these p53-EGFP reporter DLD1 cells to investigate the status of p53 transcriptional activity in putative colon cancer stem cell populations following exposure to p53 pathway-restoring drugs and/or classical chemotherapy. We demonstrate induction of p53-specific EGFP reporter fluorescence following overexpression of p53 family member p73 by an Adenovirus vector. We further show that p53-reporter activity is induced in DLD1 putative cancer stem cell side-populations analyzed by their Hoechst dye efflux properties following treatment with the p53 pathway restoring drug ellipticine. Combination of ellipticine with the cytotoxic agent 5-fluorouracil resulted in increased cytotoxicity as compared to either agent alone and this was associated with depletion of putative cancer stem cell populations as compared with 5-FU alone treatment. Our results support the feasibility of therapeutic targeting of mutant p53 in putative cancer stem cells as well as the potential to enhance cytotoxic chemotherapy. PMID:19923910

  1. Targeting Oncogenic Mutant p53 for Cancer Therapy

    PubMed Central

    Parrales, Alejandro; Iwakuma, Tomoo

    2015-01-01

    Among genetic alterations in human cancers, mutations in the tumor suppressor p53 gene are the most common, occurring in over 50% of human cancers. The majority of p53 mutations are missense mutations and result in the accumulation of dysfunctional p53 protein in tumors. These mutants frequently have oncogenic gain-of-function activities and exacerbate malignant properties of cancer cells, such as metastasis and drug resistance. Increasing evidence reveals that stabilization of mutant p53 in tumors is crucial for its oncogenic activities, while depletion of mutant p53 attenuates malignant properties of cancer cells. Thus, mutant p53 is an attractive druggable target for cancer therapy. Different approaches have been taken to develop small-molecule compounds that specifically target mutant p53. These include compounds that restore wild-type conformation and transcriptional activity of mutant p53, induce depletion of mutant p53, inhibit downstream pathways of oncogenic mutant p53, and induce synthetic lethality to mutant p53. In this review article, we comprehensively discuss the current strategies targeting oncogenic mutant p53 in cancers, with special focus on compounds that restore wild-type p53 transcriptional activity of mutant p53 and those reducing mutant p53 levels. PMID:26732534

  2. The p53 target Wig-1 regulates p53 mRNA stability through an AU-rich element

    PubMed Central

    Vilborg, Anna; Glahder, Jacob A.; Wilhelm, Margareta T.; Bersani, Cinzia; Corcoran, Martin; Mahmoudi, Salah; Rosenstierne, Maiken; Grandér, Dan; Farnebo, Marianne; Norrild, Bodil; Wiman, Klas G.

    2009-01-01

    The p53 target gene Wig-1 encodes a double-stranded-RNA-binding zinc finger protein. We show here that Wig-1 binds to p53 mRNA and stabilizes it through an AU-rich element (ARE) in the 3′ UTR of the p53 mRNA. This effect is mirrored by enhanced p53 protein levels in both unstressed cells and cells exposed to p53-activating stress agents. Thus, the p53 target Wig-1 is a previously undescribed ARE-regulating protein that acts as a positive feedback regulator of p53, with implications both for the steady-state levels of p53 and for the p53 stress response. Our data reveal a previously undescribed link between the tumor suppressor p53 and posttranscriptional gene regulation via AREs in mRNA. PMID:19805223

  3. Iron Metabolism Regulates p53 Signaling through Direct Heme-p53 Interaction and Modulation of p53 Localization, Stability, and Function

    PubMed Central

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Wang, Sheng; Xuan, Zongliang; Li, Dan; Wu, Yalan; Shang, Yongjia; Kong, Xiangtao; Yu, Long; Li, Lin; Ruan, Kangchen; Hu, Hongyu; Huang, Ying; Hui, Lijian; Xie, Dong; Wang, Fudi; Hu, Ronggui

    2014-01-01

    SUMMARY Iron excess is closely associated with tumorigenesis in multiple types of human cancers, with underlying mechanisms yet unclear. Recently, iron deprivation has emerged as a major strategy for chemotherapy, but it exerts tumor suppression only on select human malignancies. Here, we report that the tumor suppressor protein p53 is downregulated during iron excess. Strikingly, the iron polyporphyrin heme binds to p53 protein, interferes with p53-DNA interactions, and triggers both nuclear export and cytosolic degradation of p53. Moreover, in a tumorigenicity assay, iron deprivation suppressed wild-type p53-dependent tumor growth, suggesting that upregulation of wild-type p53 signaling underlies the selective efficacy of iron deprivation. Our findings thus identify a direct link between iron/heme homeostasis and the regulation of p53 signaling, which not only provides mechanistic insights into iron-excess-associated tumorigenesis but may also help predict and improve outcomes in iron-deprivation-based chemotherapy. PMID:24685134

  4. The dichotomy of p53 regulation by noncoding RNAs.

    PubMed

    Deng, Qipan; Becker, Lindsey; Ma, Xiaodong; Zhong, Xiaoming; Young, Ken; Ramos, Kenneth; Li, Yong

    2014-06-01

    The p53 tumor suppressor gene is the most frequently mutated gene in cancer. Significant progress has been made to discern the importance of p53 in coordinating cellular responses to DNA damage, oncogene activation, and other stresses. Noncoding RNAs are RNA molecules functioning without being translated into proteins. In this work, we discuss the dichotomy of p53 regulation by noncoding RNAs with four unconventional questions. First, is overexpression of microRNAs responsible for p53 inactivation in the absence of p53 mutation? Second, are there somatic mutations in the noncoding regions of the p53 gene? Third, is there a germline mutant in the noncoding regions of the p53 gene that predisposes carriers to cancer? Fourth, can p53 activation mediated by a noncoding RNA mutation cause cancer? This work highlights the prominence of noncoding RNAs in p53 dysregulation and tumorigenesis. PMID:24706938

  5. P53 licensed to kill? Operating the assassin.

    PubMed

    Haupt, Susan; Louria-Hayon, Igal; Haupt, Ygal

    2003-01-01

    The p53 protein is a key player in the cellular response to stress. Proper regulation of p53 is imperative for the suppression of tumor development. This regulation is largely governed by its master inhibitor, Mdm2, which both blocks p53 activities and promotes its destabilization. This tight regulation of p53 by Mdm2 must be interrupted under stress conditions in order for p53 to be stabilized in an active form. A combined action of partner proteins and modifying enzymes is essential for the relief of p53 from Mdm2. The recent revelation of p53 association with the PML-nuclear bodies provides one explanation of how this regulatory network is coordinated within the nucleus in response to certain stress conditions. Thus, it is not only the nature of the p53 regulatory complex but also the spatial and temporal context of this association that governs the output inhibitory signals mediated by p53. PMID:12461776

  6. Assessment of sensitivity and specificity of immunohistochemical staining of p53 in lung and head and neck cancers.

    PubMed Central

    Melhem, M. F.; Law, J. C.; el-Ashmawy, L.; Johnson, J. T.; Landreneau, R. J.; Srivastava, S.; Whiteside, T. L.

    1995-01-01

    Thirty-two primary carcinomas of the lung and 17 carcinomas of the head and neck (HN) were systematically analyzed for p53 mutations in the highly conserved regions of the gene (exons 5-8). Frozen sections of the same tumors were stained immunohistochemically to assess the sensitivity and specificity of p53 expression as determined by the presence or absence of the protein. On the basis of histology, the lung tumors studied were divided into adenocarcinomas (AC; n = 15), squamous-cell carcinomas (SCC; n = 12), and large-cell carcinomas (LCC; n = 5). All the HN cancers were SCC. Mutations in the p53 gene were detected by direct sequencing of amplified polymerase chain reaction products in six AC of the lungs (40%), three SCC of the lungs (25%), and one LCC (20%), with an overall mutation frequency of 31%. Nine AC (60%) of the lungs, five SCC (42%), and four LCC (80%) were p53-positive by immunohistochemistry. Among HN cancers, p53 mutations were detected in seven tumors (41%). Nine HN tumors (53%) were positive for p53. Negative staining, despite the presence of p53 mutations, was confined to nonsense mutations with truncated p53 and to single-base mutations not causing any change in the amino acid. Although immunohistochemical staining for mutated p53 is sensitive and simple to perform as a screening method, it is not as specific for evaluation of p53 mutations in lung and HN cancers. Images Figure 1 PMID:7747811

  7. mTORC1 and p53

    PubMed Central

    Hasty, Paul; Sharp, Zelton Dave; Curiel, Tyler J.; Campisi, Judith

    2013-01-01

    A balance must be struck between cell growth and stress responses to ensure that cells proliferate without accumulating damaged DNA. This balance means that optimal cell proliferation requires the integration of pro-growth and stress-response pathways. mTOR (mechanistic target of rapamycin) is a pleiotropic kinase found in complex 1 (mTORC1). The mTORC1 pathway governs a response to mitogenic signals with high energy levels to promote protein synthesis and cell growth. In contrast, the p53 DNA damage response pathway is the arbiter of cell proliferation, restraining mTORC1 under conditions of genotoxic stress. Recent studies suggest a complicated integration of these pathways to ensure successful cell growth and proliferation without compromising genome maintenance. Deciphering this integration could be key to understanding the potential clinical usefulness of mTORC1 inhibitors like rapamycin. Here we discuss how these p53-mTORC1 interactions might play a role in the suppression of cancer and perhaps the development of cellular senescence and organismal aging. PMID:23255104

  8. High levels of p53 protein expression do not correlate with p53 gene mutations in anaplastic large cell lymphoma.

    PubMed Central

    Cesarman, E.; Inghirami, G.; Chadburn, A.; Knowles, D. M.

    1993-01-01

    Strong immunohistochemical reactivity for p53 tumor suppressor gene product has been reported in a variety of different human malignancies including CD30- (Ki-1) positive anaplastic large cell lymphoma (ALCL). Although high levels of p53 protein have been interpreted as abnormal, rapidly proliferating benign and neoplastic lymphoid cells may have increased p53 expression in the absence of structural alterations. On the other hand, mutations in the p53 gene can lead to a lack of p53 protein production. Structural alterations of the p53 gene have not been documented in cases of ALCL and the mechanism for an abnormal pattern of p53 expression in these lymphomas has not been elucidated. Therefore, to determine whether an altered pattern of p53 expression correlates with mutations in the p53 locus in ALCL, we analyzed the expression of p53 protein immunohistochemically, compared it with the proliferation index using monoclonal antibody Ki-67, and assessed the presence of mutations in exons 5 though 9 of the p53 gene using a single-strand conformation polymorphism assay in a panel of 17 ALCLs. Furthermore, we studied the presence of allelic deletions of chromosome 17p by restriction fragment length polymorphism analysis. We found significant levels of p53 protein expression in 12 of the 15 cases studied, but identified mutations in only one of 17 cases. An allelic deletion in chromosome 17p was identified only in the one case containing a mutated p53 gene. Whereas the case containing structural alterations in the p53 gene did have strong p53 immunoreactivity, 11 cases that lacked p53 mutations in the regions examined also had significant levels of p53. Thus, our studies indicate that strong immunohistochemical reactivity for p53 is not a reliable indicator of the presence of structural alterations of p53 gene exons 5 through 9 in ALCL. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8103295

  9. Heterogeneous Hydration of p53/MDM2 Complex

    PubMed Central

    2015-01-01

    Water-mediated interactions play critical roles in biomolecular recognition processes. Explicit solvent molecular dynamics (MD) simulations and the variational implicit-solvent model (VISM) are used to study those hydration properties during binding for the biologically important p53/MDM2 complex. Unlike simple model solutes, in such a realistic and heterogeneous solute–solvent system with both geometrical and chemical complexity, the local water distribution sensitively depends on nearby amino acid properties and the geometric shape of the protein. We show that the VISM can accurately describe the locations of high and low density solvation shells identified by the MD simulations and can explain them by a local coupling balance of solvent–solute interaction potentials and curvature. In particular, capillary transitions between local dry and wet hydration states in the binding pocket are captured for interdomain distance between 4 to 6 Å, right at the onset of binding. The underlying physical connection between geometry and polarity is illustrated and quantified. Our study offers a microscopic and physical insight into the heterogeneous hydration behavior of the biologically highly relevant p53/MDM2 system and demonstrates the fundamental importance of hydrophobic effects for biological binding processes. We hope our study can help to establish new design rules for drugs and medical substances. PMID:24803860

  10. Mutant p53 and ETS2, a Tale of Reciprocity

    PubMed Central

    Martinez, Luis Alfonso

    2016-01-01

    TP53 is one of the most frequently inactivated tumor suppressor genes in human cancer. However, unlike other tumor suppressor genes whose expression is lost, TP53 is usually inactivated as a result of a single nucleotide change within the coding region. Typically, these single nucleotide mutations result in a codon change that creates an amino acid substitution. Thus, unlike other tumor suppressor genes whose expression is lost due to genetic or epigenetic changes, the p53 gene primarily suffers missense mutations, and therefore, the cells retain and express a mutant form of the p53 protein (mtp53). It is now well established that mtp53 contributes to tumor development through its gain-of-function (GOF) activities. These GOF activities can arise from novel protein–protein interactions that can either disable other tumor suppressors (e.g., p63 and p73) or enable oncogenes such as ETS2, an ETS family member. In this review, I will focus on the identification of the mtp53/ETS2 complex and outline the diverse activities that this transcriptional regulatory complex controls to promote cancer. PMID:26925389

  11. Mutant p53 and ETS2, a Tale of Reciprocity.

    PubMed

    Martinez, Luis Alfonso

    2016-01-01

    TP53 is one of the most frequently inactivated tumor suppressor genes in human cancer. However, unlike other tumor suppressor genes whose expression is lost, TP53 is usually inactivated as a result of a single nucleotide change within the coding region. Typically, these single nucleotide mutations result in a codon change that creates an amino acid substitution. Thus, unlike other tumor suppressor genes whose expression is lost due to genetic or epigenetic changes, the p53 gene primarily suffers missense mutations, and therefore, the cells retain and express a mutant form of the p53 protein (mtp53). It is now well established that mtp53 contributes to tumor development through its gain-of-function (GOF) activities. These GOF activities can arise from novel protein-protein interactions that can either disable other tumor suppressors (e.g., p63 and p73) or enable oncogenes such as ETS2, an ETS family member. In this review, I will focus on the identification of the mtp53/ETS2 complex and outline the diverse activities that this transcriptional regulatory complex controls to promote cancer. PMID:26925389

  12. Identification of TRIML2, a Novel p53 Target, that Enhances p53-SUMOylation and Regulates the Transactivation of Pro-apoptotic Genes

    PubMed Central

    Kung, Che-Pei; Khaku, Sakina; Jennis, Matthew; Zhou, Yan; Murphy, Maureen E.

    2014-01-01

    The tumor suppressor protein p53, encoded by TP53, inhibits tumorigenesis by inducing cell cycle arrest, senescence and apoptosis. Several genetic polymorphisms exist in TP53, including a proline to arginine variant at amino acid 72 (P72 and R72, respectively); this polymorphism alters p53 function. In general, the P72 variant shows increased ability to induce cell cycle arrest, while the R72 variant possesses increased ability to induce apoptosis, relative to P72. At present, the underlying mechanisms for these functional differences are not fully understood. Toward elucidating the molecular basis for these differences a gene expression microarray analysis was conducted on normal human fibroblast cells that are homozygous for P72 and R72 variants, along with subclones of these lines that express a p53 short hairpin (shp53). Approximately three dozen genes were identified whose transactivation is affected by the codon 72 polymorphism. One of these is the tripartite motif family-like 2 (TRIML2) gene, which is preferentially induced by the R72 variant. Importantly, the accumulated data indicate that TRIML2 interacts with p53, and facilitates the modification of p53 with SUMO2. TRIML2 also enhances the ability of p53 to transactivate a subset of pro-apoptotic target genes associated with prolonged oxidative stress, including PIDD, PIG3 (TP53I3) and PIG6 (PRODH). These data indicate that TRIML2 is part of a feed-forward loop that activates p53 in cells expressing the R72 variant, particularly after prolonged stress. PMID:25256710

  13. Expression of TP53 Isoforms p53β or p53γ Enhances Chemosensitivity in TP53null Cell Lines

    PubMed Central

    Silden, Elisabeth; Hjelle, Sigrun M.; Wergeland, Line; Sulen, André; Andresen, Vibeke; Bourdon, Jean-Christophe; Micklem, David R.; McCormack, Emmet; Gjertsen, Bjørn Tore

    2013-01-01

    The carboxy-terminal truncated p53 alternative spliced isoforms, p53β and p53γ, are expressed at disparate levels in cancer and are suggested to influence treatment response and therapy outcome. However, their functional role in cancer remains to be elucidated. We investigated their individual functionality in the p53null background of cell lines H1299 and SAOS-2 by stable retroviral transduction or transient transfection. Expression status of p53β and p53γ protein was found to correlate with increased response to camptothecin and doxorubicin chemotherapy. Decreased DNA synthesis and clonogenicity in p53β and p53γ congenic H1299 was accompanied by increased p21(CIP1/WAF1), Bax and Mdm2 proteins. Chemotherapy induced p53 isoform degradation, most prominent for p53γ. The proteasome inhibitor bortezomib substantially increased basal p53γ protein level, while the level of p53β protein was unaffected. Treatment with dicoumarol, a putative blocker of the proteasome-related NAD(P)H quinone oxidoreductase NQO1, effectively attenuated basal p53γ protein level in spite of bortezomib treatment. Although in vitro proliferation and clonogenicity assays indicated a weak suppressive effect by p53β and p53γ expression, studies of in vivo subcutaneous H1299 tumor growth demonstrated a significantly increased growth by expression of either p53 isoforms. This study suggests that p53β and p53γ share functionality in chemosensitizing and tumor growth enhancement but comprise distinct regulation at the protein level. PMID:23409163

  14. Expression of TP53 isoforms p53β or p53γ enhances chemosensitivity in TP53(null) cell lines.

    PubMed

    Silden, Elisabeth; Hjelle, Sigrun M; Wergeland, Line; Sulen, André; Andresen, Vibeke; Bourdon, Jean-Christophe; Micklem, David R; McCormack, Emmet; Gjertsen, Bjørn Tore

    2013-01-01

    The carboxy-terminal truncated p53 alternative spliced isoforms, p53β and p53γ, are expressed at disparate levels in cancer and are suggested to influence treatment response and therapy outcome. However, their functional role in cancer remains to be elucidated. We investigated their individual functionality in the p53(null) background of cell lines H1299 and SAOS-2 by stable retroviral transduction or transient transfection. Expression status of p53β and p53γ protein was found to correlate with increased response to camptothecin and doxorubicin chemotherapy. Decreased DNA synthesis and clonogenicity in p53β and p53γ congenic H1299 was accompanied by increased p21((CIP1/WAF1)), Bax and Mdm2 proteins. Chemotherapy induced p53 isoform degradation, most prominent for p53γ. The proteasome inhibitor bortezomib substantially increased basal p53γ protein level, while the level of p53β protein was unaffected. Treatment with dicoumarol, a putative blocker of the proteasome-related NAD(P)H quinone oxidoreductase NQO1, effectively attenuated basal p53γ protein level in spite of bortezomib treatment. Although in vitro proliferation and clonogenicity assays indicated a weak suppressive effect by p53β and p53γ expression, studies of in vivo subcutaneous H1299 tumor growth demonstrated a significantly increased growth by expression of either p53 isoforms. This study suggests that p53β and p53γ share functionality in chemosensitizing and tumor growth enhancement but comprise distinct regulation at the protein level. PMID:23409163

  15. Glycogen Synthase Kinase-3β (GSK3β) Binds to and Promotes the Actions of p53*

    PubMed Central

    Watcharasit, Piyajit; Bijur, Gautam N.; Song, Ling; Zhu, Jianhui; Chen, Xinbin; Jope, Richard S.

    2006-01-01

    The recent discovery of direct interactions between two important regulators of cell fate, the tumor suppressor p53 and glycogen synthase kinase-3β (GSK3β), led us to examine the mechanism and outcomes of this interaction. Two regions of p53 were identified that regulate its binding to GSK3β. Deletion of the p53 activation domain-1 (AD1), but not mutations that prevent MDM2 binding through the AD1 domain, enhanced GSK3β binding to p53, indicating that the AD1 domain interferes with p53 binding to GSK3β. Deletion of the p53 basic domain (BD) abrogated GSK3β binding, and a ten amino acid region within the C-terminal BD domain was identified as necessary for binding to GSK3β. GSK3β activity was not required for p53 binding, but inhibition of GSK3β stabilized the association, suggesting a transient interaction during which active GSK3β promotes actions of p53. This regulatory role of GSK3β was demonstrated by large reductions of p53-induced increases in the levels of MDM2, p21, and Bax when GSK3β was inhibited. Besides promoting p53-mediated transcription, GSK3β also contributed to mitochondrial p53 apoptotic signaling. After DNA damage, mitochondrial GSK3β co-immunoprecipitated with p53 and was activated, and inhibition of GSK3β blocked cytochrome c release and caspase-3 activation. Thus, GSK3β interacts with p53 in both the nucleus and mitochondria and promotes its actions at both sites. PMID:14523002

  16. Activation and activities of the p53 tumour suppressor protein

    PubMed Central

    Bálint, É; Vousden, K H

    2001-01-01

    The p53 tumour suppressor protein inhibits malignant progression by mediating cell cycle arrest, apoptosis or repair following cellular stress. One of the major regulators of p53 function is the MDM2 protein, and multiple forms of cellular stress activate p53 by inhibiting the MDM2-mediated degradation of p53. Mutations in p53, or disruption of the pathways that allow activation of p53, seem to be a general feature of all cancers. Here we review recent advances in our understanding of the pathways that regulate p53 and the pathways that are induced by p53, as well as their implications for cancer therapy. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11747320

  17. Watching the watcher: regulation of p53 by mitochondria

    PubMed Central

    Holley, Aaron K; St Clair, Daret K

    2009-01-01

    p53 has been referred to as the ‘guardian of the genome’ because of its role in protecting the cell from DNA damage. p53 performs its duties by regulating cell-cycle progression and DNA repair and, in cases of irreparable DNA damage, by executing programmed cell death. Mitochondria are an important target of transcription-dependent and -independent actions of p53 to carry out the apoptotic function. However, increasing evidence suggests that p53 activity is regulated by mitochondria. Cellular insults that alter mitochondrial function can have important consequences on p53 activity. In light of these new findings, the following review focuses on p53/mitochondria connections, in particular how reactive oxygen species generated at mitochondria regulate p53 activity. A better understanding of the mechanisms by which mitochondria regulate p53 may have an impact on our understanding of the development and progression of many diseases, especially cancer. PMID:19243304

  18. Mutant p53: One, No One, and One Hundred Thousand

    PubMed Central

    Walerych, Dawid; Lisek, Kamil; Del Sal, Giannino

    2015-01-01

    Encoded by the mutated variants of the TP53 tumor suppressor gene, mutant p53 proteins are getting an increased experimental support as active oncoproteins promoting tumor growth and metastasis. p53 missense mutant proteins are losing their wild-type tumor suppressor activity and acquire oncogenic potential, possessing diverse transforming abilities in cell and mouse models. Whether various mutant p53s differ in their oncogenic potential has been a matter of debate. Recent discoveries are starting to uncover the existence of mutant p53 downstream programs that are common to different mutant p53 variants. In this review, we discuss a number of studies on mutant p53, underlining the advantages and disadvantages of alternative experimental approaches that have been used to describe the numerous mutant p53 gain-of-function activities. Therapeutic possibilities are also discussed, taking into account targeting either individual or multiple mutant p53 proteins in human cancer. PMID:26734571

  19. Wild type p53 reactivation: from lab bench to clinic.

    PubMed

    Selivanova, Galina

    2014-08-19

    The p53 tumor suppressor is the most frequently inactivated gene in cancer. Several mouse models have demonstrated that the reconstitution of the p53 function suppresses the growth of established tumors. These facts, taken together, promote the idea of p53 reactivation as a strategy to combat cancer. This review will focus on recent advances in the development of small molecules which restore the function of wild type p53 by blocking its inhibitors Mdm2 and MdmX or their upstream regulators and discuss the impact of different p53 functions for tumor prevention and tumor eradication. Finally, the recent progress in p53 research will be analyzed concerning the role of p53 cofactors and cellular environment in the biological response upon p53 reactivation and how this can be applied in clinic. PMID:24726725

  20. In vitro expression of human p53 cDNA clones and characterization of the cloned human p53 gene.

    PubMed

    Wolf, D; Laver-Rudich, Z; Rotter, V

    1985-08-01

    The human p53 gene was cloned and characterized by using a battery of p53 DNA clones. A series of human cDNA clones of various sizes and relative localizations to the mRNA molecule were isolated by using the human p53-H14 (2.35-kilobase) cDNA probe which we previously cloned. One such isolate, clone p53-H7 (2.65 kilobases), spans the entire human mature p53 mRNA molecule. Construction of the human cDNA clones in the pSP65 RNA transcription vector facilitated the generation of p53 transcripts by the SP6 bacteriophage RNA polymerase. The p53-specific RNA transcripts obtained without further processing were translated into p53 proteins in a cell-free system. By using this rapid in vitro transcription-translation assay, we found that whereas clone p53-H7 (2.65 kilobases) coded for a mature-sized p53 protein, a shorter cDNA clone, p53-H13 (1.8 kilobases), dictated the synthesis of a smaller-sized p53 protein (45 kilodaltons). The p53 proteins synthesized in vitro immunoprecipitated efficiently with human-specific anti-p53 antibodies. Genomic analysis of human DNA revealed the presence of a single p53 gene residing within two EcoRI fragments. Heteroduplex analysis between the full-length cDNA clone p53-H7 and the cloned p53 gene indicated the presence of seven major exons. PMID:3018534

  1. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53

    PubMed Central

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar

    2016-01-01

    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1–393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using “hot-spot” p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  2. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53.

    PubMed

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar

    2016-01-01

    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1-393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using "hot-spot" p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  3. Identification of p53-target genes in Danio rerio

    PubMed Central

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M. Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  4. Identification of p53-target genes in Danio rerio.

    PubMed

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  5. Cellular adaptation to hypoxia and p53 transcription regulation.

    PubMed

    Zhao, Yang; Chen, Xue-qun; Du, Ji-zeng

    2009-05-01

    Tumor suppressor p53 is the most frequently mutated gene in human tumors. Meanwhile, under stress conditions, p53 also acts as a transcription factor, regulating the expression of a series of target genes to maintain the integrity of genome. The target genes of p53 can be classified into genes regulating cell cycle arrest, genes involved in apoptosis, and genes inhibiting angiogenesis. p53 protein contains a transactivation domain, a sequence-specific DNA binding domain, a tetramerization domain, a non-specific DNA binding domain that recognizes damaged DNA, and a later identified proline-rich domain. Under stress, p53 proteins accumulate and are activated through two mechanisms. One, involving ataxia telangiectasia-mutated protein (ATM), is that the interaction between p53 and its down-regulation factor murine double minute 2 (MDM2) decreases, leading to p53 phosphorylation on Ser15, as determined by the post-translational mechanism; the other holds that p53 increases and is activated through the binding of ribosomal protein L26 (RPL26) or nucleolin to p53 mRNA 5( untranslated region (UTR), regulating p53 translation. Under hypoxia, p53 decreases transactivation and increases transrepression. The mutations outside the DNA binding domain of p53 also contribute to tumor progress, so further studies on p53 should also be focused on this direction. The subterranean blind mole rat Spalax in Israel is a good model for hypoxia-adaptation. The p53 of Spalax mutated in residue 172 and residue 207 from arginine to lysine, conferring it the ability to survive hypoxic conditions. This model indicates that p53 acts as a master gene of diversity formation during evolution. PMID:19434769

  6. Nuclear Localization Signal and p53 Binding Site in MAP/ERK Kinase Kinase 1 (MEKK1).

    PubMed

    Chipps, Elizabeth; Protzman, April; Muhi, M Zubayed; Ando, Shoko; Calvet, James P; Islam, M Rafiq

    2015-12-01

    Previously, we showed that Mekk1 translocates to the nucleus, interacts with tumor suppressor protein p53, and co-represses PKD1 transcription via an atypical p53 binding site on the minimal PKD1 promoter (JBC 285:38,818-38,831, 2010). In this study, we report the mechanisms of Mekk1 nuclear transport and p53 binding. Using GFP-linked constitutively active-Mekk1 (CA-Mekk1) and a deletion strategy, we identified a nuclear localization signal (HRDVK) located at amino acid (aa) residues 1,349-1,353 in the C-terminal Mekk1 catalytic domain. Deletion of this sequence in CA-Mekk1 and full-length Mekk1 significantly reduced their nuclear translocation in both HEK293T and COS-1 cells. Using co-immunoprecipitation, we identified an adjacent sequence (GANLID, aa 1,354-1,360) in Mekk1 responsible for p53 binding. Deletion of this sequence markedly reduced the interaction of Mekk1 with p53. Mekk1 does not appear to affect phosphorylation of Ser15, located in the Mdm2 interaction site, or other Ser residues in p53. However, Mekk1 mediates p53 protein stability in the presence of Mdm2 and reduces p53 ubiquitination, suggesting an interference with Mdm2-mediated degradation of p53 by the ubiquitin-proteasome pathway. PMID:26018553

  7. Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

    SciTech Connect

    Tommaso, Anne di; Hagen, Jussara; Tompkins, Van; Muniz, Viviane; Dudakovic, Amel; Kitzis, Alain; Ladeveze, Veronique; Quelle, Dawn E.

    2009-04-15

    The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala{sup 14} and Thr{sup 31}) were found to destabilize the protein while two others (Val{sup 24} and Ala{sup 41}) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significant biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val{sup 24} was required for p53-independent growth suppression whereas multiple residues (Val{sup 24}, Thr{sup 31}, Ala{sup 41} and His{sup 60}) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.

  8. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  9. A p53-bound enhancer region controls a long intergenic noncoding RNA required for p53 stress response.

    PubMed

    Melo, C A; Léveillé, N; Rooijers, K; Wijchers, P J; Geeven, G; Tal, A; Melo, S A; de Laat, W; Agami, R

    2016-08-18

    Genome-wide chromatin studies identified the tumor suppressor p53 as both a promoter and an enhancer-binding transcription factor. As an enhancer factor, p53 can induce local production of enhancer RNAs, as well as transcriptional activation of distal neighboring genes. Beyond the regulation of protein-coding genes, p53 has the capacity to regulate long intergenic noncoding RNA molecules (lincRNAs); however, their importance to the p53 tumor suppressive function remains poorly characterized. Here, we identified and characterized a novel p53-bound intronic enhancer that controls the expression of its host, the lincRNA00475 (linc-475). We demonstrate the requirement of linc-475 for the proper induction of a p53-dependent cell cycle inhibitory response. We further confirm the functional importance of linc-475 in the maintenance of CDKN1A/p21 levels, a cell cycle inhibitor and a major p53 target gene, following p53 activation. Interestingly, loss of linc-475 reduced the binding of both p53 and RNA polymerase II (RNAPII) to the promoter of p21, attenuating its transcription rate following p53 activation. Altogether, our data suggest a direct role of p53-bound enhancer domains in the activation of lincRNAs required for an efficient p53 transcriptional response. PMID:26776159

  10. [Bcl-2 inhibits p53-induced apoptosis after genotoxic damage by inhibitors of nuclear import of p53].

    PubMed

    Beham, A; Schumacher, G; McDonnell, T J; Marin, M C; Jauch, K W

    1998-01-01

    The tumor suppressor gene p53 in overexpressed in 50% of colorectal carcinomas and is an interesting target for gene therapeutic approaches. Furthermore the protooncogen bcl-2 is known to inhibit p53 induced apoptosis and is expressed in some colorectal carcinomas. In this study mechanism of bcl-2 cell death inhibition after p53 induction were evaluated. The human colon carcinoma cell line RKO posses wild-type p53 and also expresses bcl-2 protein. RKO cells were treated with liposomal bcl-2 antisense oligonucleotides (AS), control oligonucleotides (CO) and empty liposomes (EL) resulting in decreased bcl-2 expression. After induction of p53 with gamma-irradiation p53 protein expression was induced in AS, CO and EL pretreated cells. Microscopy and immunoblotting was used to characterize subcellular localization of p53 protein. Further p53 subcellular localisation was examined after p53 transfer of wt p53 cDNA in three bcl-2 expressing cell lines. Most of the p53 protein remained localized in the cytosol and apoptosis was decreased in bcl-2 expressing cells assessed by flow cytometric analysis (Ao). Our data suggests that bcl-2 is able to modulate transmembrane trafficking of p53. This resulted in inhibition of cell death implicating that bcl-2 function is involved in regulation of transmembrane gradients. PMID:14518224

  11. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  12. p53 genes function to restrain mobile elements.

    PubMed

    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  13. A novel p53-binding domain in CUL7.

    PubMed

    Kasper, Jocelyn S; Arai, Takehiro; DeCaprio, James A

    2006-09-15

    CUL7 is a member of the cullin RING ligase family and forms an SCF-like complex with SKP1 and FBXW8. CUL7 is required for normal mouse embryonic development and cellular proliferation, and is highly homologous to PARC, a p53-associated, parkin-like cytoplasmic protein. We determined that CUL7, in a manner similar to PARC, can bind directly to p53 but does not affect p53 expression. We identified a discrete, co-linear domain in CUL7 that is conserved in PARC and HERC2, and is necessary and sufficient for p53-binding. The presence of p53 stabilized expression of this domain and we demonstrate that this p53-binding domain of CUL7 contributes to the cytoplasmic localization of CUL7. The results support the model that p53 plays a role in regulation of CUL7 activity. PMID:16875676

  14. Chemical Variations on the p53 Reactivation Theme

    PubMed Central

    Ribeiro, Carlos J. A.; Rodrigues, Cecília M. P.; Moreira, Rui; Santos, Maria M. M.

    2016-01-01

    Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX). Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented. PMID:27187415

  15. A novel p53-binding domain in CUL7

    SciTech Connect

    Kasper, Jocelyn S.; Arai, Takehiro; De Caprio, James A. . E-mail: james_decaprio@dfci.harvard.edu

    2006-09-15

    CUL7 is a member of the cullin RING ligase family and forms an SCF-like complex with SKP1 and FBXW8. CUL7 is required for normal mouse embryonic development and cellular proliferation, and is highly homologous to PARC, a p53-associated, parkin-like cytoplasmic protein. We determined that CUL7, in a manner similar to PARC, can bind directly to p53 but does not affect p53 expression. We identified a discrete, co-linear domain in CUL7 that is conserved in PARC and HERC2, and is necessary and sufficient for p53-binding. The presence of p53 stabilized expression of this domain and we demonstrate that this p53-binding domain of CUL7 contributes to the cytoplasmic localization of CUL7. The results support the model that p53 plays a role in regulation of CUL7 activity.

  16. Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

    PubMed Central

    el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

    1997-01-01

    We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

  17. Regulation of p53 during senescence in normal human keratinocytes

    PubMed Central

    Kim, Reuben H; Kang, Mo K; Kim, Terresa; Yang, Paul; Bae, Susan; Williams, Drake W; Phung, Samantha; Shin, Ki-Hyuk; Hong, Christine; Park, No-Hee

    2015-01-01

    p53, the guardian of the genome, is a tumor suppressor protein and critical for the genomic integrity of the cells. Many studies have shown that intracellular level of p53 is enhanced during replicative senescence in normal fibroblasts, and the enhanced level of p53 is viewed as the cause of senescence. Here, we report that, unlike in normal fibroblasts, the level of intracellular p53 reduces during replicative senescence and oncogene-induced senescence (OIS) in normal human keratinocytes (NHKs). We found that the intracellular p53 level was also decreased in age-dependent manner in normal human epithelial tissues. Senescent NHKs exhibited an enhanced level of p16INK4A, induced G2 cell cycle arrest, and lowered the p53 expression and transactivation activity. We found that low level of p53 in senescent NHKs was due to reduced transcription of p53. The methylation status at the p53 promoter was not altered during senescence, but senescent NHKs exhibited notably lower level of acetylated histone 3 (H3) at the p53 promoter in comparison with rapidly proliferating cells. Moreover, p53 knockdown in rapidly proliferating NHKs resulted in the disruption of fidelity in repaired DNA. Taken together, our study demonstrates that p53 level is diminished during replicative senescence and OIS and that such diminution is associated with H3 deacetylation at the p53 promoter. The reduced intracellular p53 level in keratinocytes of the elderly could be a contributing factor for more frequent development of epithelial cancer in the elderly because of the loss of genomic integrity of cells. PMID:26138448

  18. p53 Loss Increases the Osteogenic Differentiation of BMSCs

    PubMed Central

    He, Yunlong; de Castro, Luis F; Shin, Min Hwa; Dubois, Wendy; Yang, Howard H.; Jiang, Shunlin; Mishra, Pravin J.; Ren, Ling; Gou, Hongfeng; Lal, Ashish; Khanna, Chand; Merlino, Glenn; Lee, Maxwell; Robey, Pamela G.; Huang, Jing

    2014-01-01

    The tumor suppressor, p53, plays a critical role in suppressing osteosarcoma. Bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) have been suggested to give rise to osteosarcomas. However, the role of p53 in BMSCs has not been extensively explored. Here, we report that p53 regulates the lineage choice of mouse BMSCs (mBMSCs). Compared to mBMSCs with wild type p53, mBMSCs deficient in p53 have enhanced osteogenic differentiation, but with similar adipogenic and chondrogenic differentiation. The role of p53 in inhibiting osteogenic lineage differentiation is mainly through the action of Runx2, a master transcription factor required for the osteogenic differentiation of mBMSCs. We find that p53 indirectly represses the expression of Runx2 by activating the microRNA-34 family, which suppresses the translation of Runx2. Since osteosarcoma may derive from BMSCs, we examined whether p53 has a role in the osteogenic differentiation of osteosarcoma cells and found that osteosarcoma cells with p53 deletion have higher levels of Runx2 and faster osteogenic differentiation than those with wild type p53. A systems biology approach reveals that p53-deficient mBMSCs are more closely related to human osteosarcoma while mBMSCs with wild type p53 are similar to normal human BMSCs. In summary, our results indicate that p53 activity can influence cell fate specification of mBMSCs, and provide molecular and cellular insights into the observation that p53 loss is associated with increased osteosarcoma incidence. PMID:25524638

  19. Loss of p53-regulatory protein IFI16 induces NBS1 leading to activation of p53-mediated checkpoint by phosphorylation of p53 SER37.

    PubMed

    Tawara, Hideyuki; Fujiuchi, Nobuko; Sironi, Juan; Martin, Sarah; Aglipay, Jason; Ouchi, Mutsuko; Taga, Makoto; Chen, Phang-Lang; Ouchi, Toru

    2008-01-01

    Our previous results that IFI16 is involved in p53 transcription activity under conditions of ionizing radiation (IR), and that the protein is frequently lost in human breast cancer cell lines and breast adenocarcinoma tissues suggesting that IFI16 plays a crucial role in controlling cell growth. Here, we show that loss of IFI16 by RNA interference in cell culture causes elevated phosphorylation of p53 Ser37 and accumulated NBS1 (nibrin) and p21WAF1, leading to growth retardation. Consistent with these observations, doxycyclin-induced NBS1 caused accumulation of p21WAF1 and increased phosphorylation of p53 Ser37, leading to cell cycle arrest in G1 phase. Wortmannin treatment was found to decrease p53 Ser37 phosphorylation in NBS-induced cells. These results suggest that loss of IFI16 activates p53 checkpoint through NBS1-DNA-PKcs pathway. PMID:17981542

  20. NAT10 regulates p53 activation through acetylating p53 at K120 and ubiquitinating Mdm2.

    PubMed

    Liu, Xiaofeng; Tan, Yuqin; Zhang, Chunfeng; Zhang, Ying; Zhang, Liangliang; Ren, Pengwei; Deng, Hongkui; Luo, Jianyuan; Ke, Yang; Du, Xiaojuan

    2016-03-01

    As a genome guardian, p53 maintains genome stability by arresting cells for damage repair or inducing cell apoptosis to eliminate the damaged cells in stress response. Several nucleolar proteins stabilize p53 by interfering Mdm2-p53 interaction upon cellular stress, while other mechanisms by which nucleolar proteins activate p53 remain to be determined. Here, we identify NAT10 as a novel regulator for p53 activation. NAT10 acetylates p53 at K120 and stabilizes p53 by counteracting Mdm2 action. In addition, NAT10 promotes Mdm2 degradation with its intrinsic E3 ligase activity. After DNA damage, NAT10 translocates to nucleoplasm and activates p53-mediated cell cycle control and apoptosis. Finally, NAT10 inhibits cell proliferation and expression of NAT10 decreases in human colorectal carcinomas. Thus, our data demonstrate that NAT10 plays a critical role in p53 activation via acetylating p53 and counteracting Mdm2 action, providing a novel pathway by which nucleolar protein activates p53 as a cellular stress sensor. PMID:26882543

  1. C-Abl as a modulator of p53

    SciTech Connect

    Levav-Cohen, Yaara; Goldberg, Zehavit; Zuckerman, Valentina; Grossman, Tamar; Haupt, Sue; Haupt, Ygal . E-mail: haupt@md.huji.ac.il

    2005-06-10

    P53 is renowned as a cellular tumor suppressor poised to instigate remedial responses to various stress insults that threaten DNA integrity. P53 levels and activities are kept under tight regulation involving a complex network of activators and inhibitors, which determine the type and extent of p53 growth inhibitory signaling. Within this complexity, the p53-Mdm2 negative auto-regulatory loop serves as a major route through which intra- and extra-cellular stress signals are channeled to appropriate p53 responses. Mdm2 inhibits p53 transcriptional activities and through its E3 ligase activity promotes p53 proteasomal degradation either within the nucleus or following nuclear export. Upon exposure to stress signals these actions of Mdm2 have to be moderated, or even interrupted, in order to allow sufficient p53 to accumulate in an active form. Multiple mechanisms involving a variety of factors have been demonstrated to mediate this interruption. C-Abl is a critical factor that under physiological conditions is required for the maximal and efficient accumulation of active p53 in response to DNA damage. C-Abl protects p53 by antagonizing the inhibitory effect of Mdm2, an action that requires a direct interplay between c-Abl and Mdm2. In addition, c-Abl protects p53 from other inhibitors of p53, such as the HPV-E6/E6AP complex, that inhibits and degrades p53 in HPV-infected cells. Surprisingly, the oncogenic form of c-Abl, the Bcr-Abl fusion protein in CML cells, also promotes the accumulation of wt p53. However, in contrast to the activation of p53 by c-Abl, its oncogenic form, Bcr-Abl, counteracts the growth inhibitory activities of p53 by modulating the p53-Mdm2 loop. Thus, it appears that by modulating the p53-Mdm2 loop, c-Abl and its oncogenic forms critically determine the type and extent of the cellular response to DNA damage.

  2. Role of p53 isoforms and aggregations in cancer.

    PubMed

    Kim, SeJin; An, Seong Soo A

    2016-06-01

    p53 is a master regulatory protein that is involved in diverse cellular metabolic processes such as apoptosis, DNA repair, and cell cycle arrest. The protective function of p53 (in its homotetrameric form) as a tumor suppressor is lost in more than 50% of human cancers.Despite considerable experimental evidence suggesting the presence of multiple p53 states, it has been difficult to correlate the status of p53 with cancer response to treatments and clinical outcomes, which suggest the importance of complex but essential p53 regulatory pathways.Recent studies have indicated that the expression pattern of p53 isoforms may play a crucial role in regulating normal and cancer cell fates in response to diverse stresses. The human TP53 gene encodes at least 12 p53 isoforms, which are produced in normal tissue through alternative initiation of translation, usage of alternative promoters, and alternative splicing. Furthermore, some researchers have suggested that the formation of mutant p53 aggregates may be associated with cancer pathogenesis due to loss-of function (LoF), dominant-negative (DN), and gain-of function (GoF) effects.As different isoforms or the aggregation state of p53 may influence tumorigenesis, this review aims to examine the correlation of p53 isoforms and aggregation with cancer. PMID:27368003

  3. [Punish or cherish: p53, metabolism and tumor suppression].

    PubMed

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. PMID:26481026

  4. Role of p53 isoforms and aggregations in cancer

    PubMed Central

    Kim, SeJin; An, Seong Soo A.

    2016-01-01

    Abstract p53 is a master regulatory protein that is involved in diverse cellular metabolic processes such as apoptosis, DNA repair, and cell cycle arrest. The protective function of p53 (in its homotetrameric form) as a tumor suppressor is lost in more than 50% of human cancers. Despite considerable experimental evidence suggesting the presence of multiple p53 states, it has been difficult to correlate the status of p53 with cancer response to treatments and clinical outcomes, which suggest the importance of complex but essential p53 regulatory pathways. Recent studies have indicated that the expression pattern of p53 isoforms may play a crucial role in regulating normal and cancer cell fates in response to diverse stresses. The human TP53 gene encodes at least 12 p53 isoforms, which are produced in normal tissue through alternative initiation of translation, usage of alternative promoters, and alternative splicing. Furthermore, some researchers have suggested that the formation of mutant p53 aggregates may be associated with cancer pathogenesis due to loss-of function (LoF), dominant-negative (DN), and gain-of function (GoF) effects. As different isoforms or the aggregation state of p53 may influence tumorigenesis, this review aims to examine the correlation of p53 isoforms and aggregation with cancer. PMID:27368003

  5. p53: a molecular marker for the detection of cancer

    PubMed Central

    Boyd, Mark T; Vlatkovic, Nikolina

    2013-01-01

    Background The p53 gene is the most frequently mutated gene in cancer and accordingly has been the subject of intensive investigation for almost 30 years. Loss of p53 function due to mutations has been unequivocally demonstrated to promote cancer in both humans and in model systems. As a consequence, there exists an enormous body of information regarding the function of normal p53 in biology and the pathobiological consequences of p53 mutation. It has long been recognised that analysis of p53 has considerable potential as a tool for use in both diagnostic and, to a greater extent, prognostic settings and some significant progress has been made in both of these arenas. Objective To provide an overview of the biology of p53, particularly in the context of uses of p53 as a diagnostic tool. Methods A literature review focused upon the methods and uses of p53 analysis in the diagnosis of sporadic cancers, rare genetic disorders and in detection of residual disease. Conclusion p53 is currently an essential diagnostic for the rare inherited cancer prone syndrome (Li-Fraumeni) and is an important diagnostic in only a limited number of settings in sporadic disease. Research in specific cancers indicates that the uses of increasingly well informed p53 mutational analysis are likely to expand to other cancers. PMID:23495923

  6. p53 isoform profiling in glioblastoma and injured brain

    PubMed Central

    Takahashi, Rie; Giannini, Caterina; Sarkaria, Jann N.; Schroeder, Mark; Rogers, Joseph; Mastroeni, Diego; Scrable, Heidi

    2014-01-01

    The tumor suppressor p53 has been found to be the most commonly mutated gene in human cancers; however, the frequency of p53 mutations varies from 10–70% across different cancer types. This variability can partly be explained by inactivating mechanisms aside from direct genomic polymorphisms. The p53 gene encodes 12 isoforms, which have been shown to modulate full-length p53 activity in cancer. In this study, we characterized p53 isoform expression patterns in glioblastoma, gliosis, non-tumor brain, and neural progenitor cells by SDS-PAGE, immunoblot, mass spectrometry, and RT-PCR. At the protein level, we found that the most consistently expressed isoform in glioblastoma, Δ40p53, was uniquely expressed in regenerative processes, such as those involving neural progenitor cells and gliosis compared to tumor samples. Isoform profiling of glioblastoma tissues revealed the presence of both Δ40p53 and full-length p53, neither of which were detected in non-tumor cerebral cortex. Upon xenograft propagation of tumors, p53 levels increased. The variability of overall p53 expression and relative levels of isoforms suggest fluctuations in subpopulations of cells with greater or lesser capacity for proliferation, which can change as the tumor evolves under different growth conditions. PMID:22824800

  7. p53 regulation upon genotoxic stress: intricacies and complexities

    PubMed Central

    Kumari, Rajni; Kohli, Saishruti; Das, Sanjeev

    2014-01-01

    p53, the revered savior of genomic integrity, receives signals from diverse stress sensors and strategizes to maintain cellular homeostasis. However, the predominance of p53 overshadows the fact that this herculean task is no one-man show; rather, there is a huge army of regulators that reign over p53 at various levels to avoid an unnecessary surge in its levels and sculpt it dynamically to favor one cellular outcome over another. This governance starts right at the time of p53 translation, which is gated by proteins that bind to p53 mRNA and keep a stringent check on p53 protein levels. The same effect is also achieved by ubiquitylases and deubiquitylases that fine-tune p53 turnover and miRNAs that modulate p53 levels, adding precision to this entire scheme. In addition, extensive covalent modifications and differential protein interactions allow p53 to trigger a tailor-made response for a given circumstance. To magnify the marvel, these various tiers of regulation operate simultaneously and in various combinations. In this review, we have tried to provide a glimpse into this bewildering labyrinth. We believe that further studies will result in a better understanding of p53 regulation and that new insights will help unravel many aspects of cancer biology. PMID:27308356

  8. Senescence Regulation by the p53 Protein Family

    PubMed Central

    Qian, Yingjuan; Chen, Xinbin

    2013-01-01

    p53, a guardian of the genome, exerts its tumor suppression activity by regulating a large number of downstream targets involved in cell cycle arrest, DNA repair, apoptosis, and cellular senescence. Although p53-mediated apoptosis is able to kill cancer cells, a role for cellular senescence in p53-dependent tumor suppression is becoming clear. Mouse studies showed that activation of p53-induced premature senescence promotes tumor regression in vivo. However, p53-mediated cellular senescence also leads to aging-related phenotypes, such as tissue atrophy, stem cell depletion, and impaired wound healing. In addition, several p53 isoforms and two p53 homologs, p63 and p73, have been shown to play a role in cellular senescence and/or aging. Importantly, p53, p63, and p73 are necessary for the maintenance of adult stem cells. Therefore, understanding the dual role the p53 protein family in cancer and aging is critical to solve cancer and longevity in the future. In this chapter, we provide an overview on how p53, p63, p73, and their isoforms regulate cellular senescence and aging. PMID:23296650

  9. TRIM65 negatively regulates p53 through ubiquitination.

    PubMed

    Li, Yang; Ma, Chengyuan; Zhou, Tong; Liu, Ying; Sun, Luyao; Yu, Zhenxiang

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. PMID:27012201

  10. Mitofusin-2 is a novel direct target of p53

    SciTech Connect

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-10-01

    Research highlights: {yields} Mfn2 is a novel target gene of p53. {yields} Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. {yields} Mfn2 promoter activity can be elevated by the p53 protein. {yields} P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  11. Targeting the p53 Pathway in Ewing Sarcoma

    PubMed Central

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  12. Immunohistochemical Determination of p53 Protein Overexpression for Predicting p53 Gene Mutations in Hepatocellular Carcinoma: A Meta-Analysis

    PubMed Central

    Deng, Miao; Liu, Dechun; Ma, Qingyong; Feng, Xiaoshan

    2016-01-01

    Background Whether increased expression of the tumor suppressor protein p53 indicates a p53 gene mutation in hepatocellular carcinoma (HCC) remains unclear. We conducted a meta-analysis to determine whether p53 protein overexpression detected by immunohistochemistry (IHC) offers a diagnostic prediction for p53 gene mutations in HCC patients. Methods Systematic literature searches were conducted with an end date of December 2015. A meta-analysis was performed to estimate the diagnostic accuracy of IHC-determined p53 protein overexpression in the prediction of p53 gene mutations in HCC. Sensitivity, subgroup, and publication bias analyses were also conducted. Results Thirty-six studies were included in the meta-analysis. The results showed that the overall sensitivity and specificity for IHC-determined p53 overexpression in the diagnostic prediction of p53 mutations in HCC were 0.83 (95% CI: 0.80–0.86) and 0.74 (95% CI: 0.71–0.76), respectively. The summary positive likelihood ratio (PLR) and negative likelihood ratio (NLR) were 2.65 (95% CI: 2.21–3.18) and 0.36 (95% CI: 0.26–0.50), respectively. The diagnostic odds ratio (DOR) of IHC-determined p53 overexpression in predicting p53 mutations ranged from 0.56 to 105.00 (pooled, 9.77; 95% CI: 6.35–15.02), with significant heterogeneity between the included studies (I2 = 40.7%, P = 0.0067). Moreover, subgroup and sensitivity analyses did not alter the results of the meta-analysis. However, potential publication bias was present in the current meta-analysis. Conclusion The upregulation of the tumor suppressor protein p53 was indeed linked to p53 gene mutations. IHC determination of p53 overexpression can predict p53 gene mutations in HCC patients. PMID:27428001

  13. P53 protein expression in human leukemia and lymphoma cells.

    PubMed

    Koníková, E; Kusenda, J

    2001-01-01

    The purpose of this study was to determine the value of p53 protein overexpression in human leukemia and lymphoma cells. We examined PB and/or BM samples on a series of 111 patients with immunophenotypically defined hematological malignancies at diagnosis, in remission and in relapsed disease comparing to 20 control samples of healthy individuals. p53 protein has been studied by flow cytometry using three monoclonal antibodies specific for epitopes on N-terminus (Bp53-12, DO-1) and central region (DO-11) of p53 protein. Our findigs showed, that p53 expression may contribute to phenotype of leukemic cells and that overexpression of this protein is often associated with progression of disease. All samples of early B-ALL patients and samples of patients with immunophenotypically defined T- cell disorders examined at diagnosis of disease were p53 positive. Eleven of 19 patient samples from AML at diagnosis showed also increased expression of p53 protein. The cells of all patients who responded to therapy with complete immunophenotypically defined remission were p53 negative. Relapsed T-, B- ALL and AML develop p53 alteration. We reported positive p53 expression in cells of patients with advanced stages of CLL in comparison to them with initial stage of disease at examination. As well as in the group of B- cell lymphomas only samples of patients with generalized FCC lymphoma at diagnosis were p53 positive. We detected p53 positive cells in immunologically defined myeloid blast crisis of CML opposite to p53 negativity in chronic phase of disease. The finding of p53 positive BM cells without immunophenotypic blast markers in two of followed cases documented the contributing value of p53 detection in their characterization. On the basis of above findings we conclude, that cytofluorometric determination of p53 expression may contribute to the better definition of leukemic phenotype. Loss of the normal p53 function may be important in the genesis of some leukemias

  14. MDM2 small-molecule antagonist RG7112 activates p53 signaling and regresses human tumors in preclinical cancer models.

    PubMed

    Tovar, Christian; Graves, Bradford; Packman, Kathryn; Filipovic, Zoran; Higgins, Brian; Xia, Mingxuan; Tardell, Christine; Garrido, Rosario; Lee, Edmund; Kolinsky, Kenneth; To, Kwong-Him; Linn, Michael; Podlaski, Frank; Wovkulich, Peter; Vu, Binh; Vassilev, Lyubomir T

    2013-04-15

    MDM2 negatively regulates p53 stability and many human tumors overproduce MDM2 as a mechanism to restrict p53 function. Thus, inhibitors of p53-MDM2 binding that can reactivate p53 in cancer cells may offer an effective approach for cancer therapy. RG7112 is a potent and selective member of the nutlin family of MDM2 antagonists currently in phase I clinical studies. RG7112 binds MDM2 with high affinity (K(D) ~ 11 nmol/L), blocking its interactions with p53 in vitro. A crystal structure of the RG7112-MDM2 complex revealed that the small molecule binds in the p53 pocket of MDM2, mimicking the interactions of critical p53 amino acid residues. Treatment of cancer cells expressing wild-type p53 with RG7112 activated the p53 pathway, leading to cell-cycle arrest and apoptosis. RG7112 showed potent antitumor activity against a panel of solid tumor cell lines. However, its apoptotic activity varied widely with the best response observed in osteosarcoma cells with MDM2 gene amplification. Interestingly, inhibition of caspase activity did not change the kinetics of p53-induced cell death. Oral administration of RG7112 to human xenograft-bearing mice at nontoxic concentrations caused dose-dependent changes in proliferation/apoptosis biomarkers as well as tumor inhibition and regression. Notably, RG7112 was highly synergistic with androgen deprivation in LNCaP xenograft tumors. Our findings offer a preclinical proof-of-concept that RG7112 is effective in treatment of solid tumors expressing wild-type p53. PMID:23400593

  15. The conformationally flexible S9-S10 linker region in the core domain of p53 contains a novel MDM2 binding site whose mutation increases ubiquitination of p53 in vivo.

    PubMed

    Shimizu, Harumi; Burch, Lindsay R; Smith, Amanda J; Dornan, David; Wallace, Maura; Ball, Kathryn L; Hupp, Ted R

    2002-08-01

    Although the N-terminal BOX-I domain of the tumor suppressor protein p53 contains the primary docking site for MDM2, previous studies demonstrated that RNA stabilizes the MDM2.p53 complex using a p53 mutant lacking the BOX-I motif. In vitro assays measuring the specific activity of MDM2 in the ligand-free and RNA-bound state identified a novel MDM2 interaction site in the core domain of p53. As defined using phage-peptide display, the RNA.MDM2 isoform exhibited a notable switch in peptide binding specificity, with enhanced affinity for novel peptide sequences in either p53 or small nuclear ribonucleoprotein-U (snRNP-U) and substantially reduced affinity for the primary p53 binding site in the BOX-I domain. The consensus binding site for the RNA.MDM2 complex within p53 is SGXLLGESXF, which links the S9-S10 beta-sheets flanking the BOX-IV and BOX-V motifs in the core domain and which is a site of reversible conformational flexibility in p53. Mutation of conserved amino acids in the linker at Ser(261) and Leu(264), which bridges the S9-S10 beta-sheets, stimulated p53 activity from reporter templates and increased MDM2-dependent ubiquitination of p53. Furthermore, mutation of the conserved Phe(270) within the S10 beta-sheet resulted in a mutant p53, which binds more stably to RNA.MDM2 complexes in vitro and which is strikingly hyper-ubiquitinated in vivo. Introducing an Ala(19) mutation into the p53(F270A) protein abolished both RNA.MDM2 complex binding and hyper-ubiquitination in vivo, thus indicating that p53(F270A) protein hyper-ubiquitination depends upon MDM2 binding to its primary site in the BOX-I domain. Together, these data identify a novel MDM2 binding interface within the S9-S10 beta-sheet region of p53 that plays a regulatory role in modulating the rate of MDM2-dependent ubiquitination of p53 in cells. PMID:11925449

  16. p53 attenuates AKT signaling by modulating membrane phospholipid composition

    PubMed Central

    Rueda-Rincon, Natalia; Bloch, Katarzyna; Derua, Rita; Vyas, Rajesh; Harms, Amy; Hankemeier, Thomas; Khan, Niamat Ali; Dehairs, Jonas; Bagadi, Muralidhararao; Binda, Maria Mercedes; Waelkens, Etienne; Marine, Jean-Christophe; Swinnen, Johannes V.

    2015-01-01

    The p53 tumor suppressor is the central component of a complex network of signaling pathways that protect organisms against the propagation of cells carrying oncogenic mutations. Here we report a previously unrecognized role of p53 in membrane phospholipids composition. By repressing the expression of stearoyl-CoA desaturase 1, SCD, the enzyme that converts saturated to mono-unsaturated fatty acids, p53 causes a shift in the content of phospholipids with mono-unsaturated acyl chains towards more saturated phospholipid species, particularly of the phosphatidylinositol headgroup class. This shift affects levels of phosphatidylinositol phosphates, attenuates the oncogenic AKT pathway, and contributes to the p53-mediated control of cell survival. These findings expand the p53 network to phospholipid metabolism and uncover a new molecular pathway connecting p53 to AKT signaling. PMID:26061814

  17. Mutant p53 in cell adhesion and motility.

    PubMed

    Yeudall, W Andrew; Wrighton, Katharine H; Deb, Sumitra

    2013-01-01

    Pro-oncogenic properties of mutant p53 were investigated with the aid of migration assays, adhesion assays, and soft agar growth assays using cells stably expressing gain-of-function p53 mutants. To determine cell migration, "wound-healing" (scratch) assays and haptotactic (chamber) assays were used. H1299 cells expressing mutant p53 were found to migrate more rapidly than cells transfected with empty vector alone. Results from both types of migration assay were broadly similar. Migratory ability differed for different p53 mutants, suggesting allele-specific effects. Cells expressing p53 mutants also showed enhanced adhesion to extracellular matrix compare to controls. Furthermore, stable transfection of mutant p53-H179L into NIH3T3 fibroblasts was sufficient to allow anchorage-independent growth in soft agar. PMID:23150443

  18. The transduction of His-TAT-p53 fusion protein into the human osteogenic sarcoma cell line (Saos-2) and its influence on cell cycle arrest and apoptosis.

    PubMed

    Jiang, Lei; Ma, Yushu; Wang, Jinzhi; Tao, Xinyi; Wei, Dongzhi

    2008-03-01

    The p53 gene is a tumor suppressor gene. It encodes a nuclear phosphoprotein p53 involved in the regulation of cell cycle arrest and apoptosis to maintain the genomic integrity of the cell. As mutations of p53 gene are found in most human cancers, p53 protein becomes a hot target in the research of anticancer therapy. In the present study, an 11-amino acid domain of TAT protein which has been demonstrated to be able to transduce across cell membranes was fused with p53. The result revealed that the fusion protein His-TAT-p53 accumulated in the nucleus and inhibited the growth of the Saos-2 cells. Besides apoptosis, an increased percentage of G2 phase suggested that the transduction of His-TAT-p53 into cells might be associated with a G2 arrest of cell cycle. PMID:17206471

  19. Transcriptional Activation of p53 during Cold Induced Torpor in the 13-Lined Ground Squirrel Ictidomys tridecemlineatus

    PubMed Central

    Hefler, Joshua; Wu, Cheng-Wei; Storey, Kenneth B.

    2015-01-01

    The transcription factor p53 is located at the centre of multiple pathways relating the cellular response to stress. Commonly known as a tumor suppressor, it is responsible for initiating diverse actions to protect the integrity of the genome, ranging from cell cycle arrest to apoptosis. This study investigated the regulation of p53 protein in hibernating 13-lined ground squirrel Ictidomys tridecemlineatus during multiple stages of the torpor-arousal cycle. Transcript and protein levels of p53 were both elevated in the skeletal muscle during early and late torpor stages of the hibernation cycle. Nuclear localization of p53 was also increased during late torpor, and this is associated with an increase in its DNA binding activity and expression of p53 transcriptional targets p21CIP, gadd45α, and 14-3-3σ. The increase in p53 transcriptional activity appears to be independent of its phosphorylation at Ser-15, Ser-46, and Ser-392, consistent with an absence of checkpoint kinase activation during torpor. Sequence analysis revealed unique amino acid substitutions in the ground squirrel p53 protein, which may contribute to an increase in protein stability compared to nonhibernators. Overall, the study results provided evidences for a potential role of p53 in the protection of the skeletal muscle during torpor. PMID:26843984

  20. Transcriptional Activation of p53 during Cold Induced Torpor in the 13-Lined Ground Squirrel Ictidomys tridecemlineatus.

    PubMed

    Hefler, Joshua; Wu, Cheng-Wei; Storey, Kenneth B

    2015-01-01

    The transcription factor p53 is located at the centre of multiple pathways relating the cellular response to stress. Commonly known as a tumor suppressor, it is responsible for initiating diverse actions to protect the integrity of the genome, ranging from cell cycle arrest to apoptosis. This study investigated the regulation of p53 protein in hibernating 13-lined ground squirrel Ictidomys tridecemlineatus during multiple stages of the torpor-arousal cycle. Transcript and protein levels of p53 were both elevated in the skeletal muscle during early and late torpor stages of the hibernation cycle. Nuclear localization of p53 was also increased during late torpor, and this is associated with an increase in its DNA binding activity and expression of p53 transcriptional targets p21CIP, gadd45α, and 14-3-3σ. The increase in p53 transcriptional activity appears to be independent of its phosphorylation at Ser-15, Ser-46, and Ser-392, consistent with an absence of checkpoint kinase activation during torpor. Sequence analysis revealed unique amino acid substitutions in the ground squirrel p53 protein, which may contribute to an increase in protein stability compared to nonhibernators. Overall, the study results provided evidences for a potential role of p53 in the protection of the skeletal muscle during torpor. PMID:26843984

  1. p53 isoforms regulate astrocyte-mediated neuroprotection and neurodegeneration.

    PubMed

    Turnquist, C; Horikawa, I; Foran, E; Major, E O; Vojtesek, B; Lane, D P; Lu, X; Harris, B T; Harris, C C

    2016-09-01

    Bidirectional interactions between astrocytes and neurons have physiological roles in the central nervous system and an altered state or dysfunction of such interactions may be associated with neurodegenerative diseases, such as Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS). Astrocytes exert structural, metabolic and functional effects on neurons, which can be either neurotoxic or neuroprotective. Their neurotoxic effect is mediated via the senescence-associated secretory phenotype (SASP) involving pro-inflammatory cytokines (e.g., IL-6), while their neuroprotective effect is attributed to neurotrophic growth factors (e.g., NGF). We here demonstrate that the p53 isoforms Δ133p53 and p53β are expressed in astrocytes and regulate their toxic and protective effects on neurons. Primary human astrocytes undergoing cellular senescence upon serial passaging in vitro showed diminished expression of Δ133p53 and increased p53β, which were attributed to the autophagic degradation and the SRSF3-mediated alternative RNA splicing, respectively. Early-passage astrocytes with Δ133p53 knockdown or p53β overexpression were induced to show SASP and to exert neurotoxicity in co-culture with neurons. Restored expression of Δ133p53 in near-senescent, otherwise neurotoxic astrocytes conferred them with neuroprotective activity through repression of SASP and induction of neurotrophic growth factors. Brain tissues from AD and ALS patients possessed increased numbers of senescent astrocytes and, like senescent astrocytes in vitro, showed decreased Δ133p53 and increased p53β expression, supporting that our in vitro findings recapitulate in vivo pathology of these neurodegenerative diseases. Our finding that Δ133p53 enhances the neuroprotective function of aged and senescent astrocytes suggests that the p53 isoforms and their regulatory mechanisms are potential targets for therapeutic intervention in neurodegenerative diseases. PMID:27104929

  2. Cytoplasmic Functions of the Tumor Suppressor p53

    PubMed Central

    Green, Douglas R.; Kroemer, Guido

    2010-01-01

    The principal tumor suppressor protein, p53, accumulates in cells in response to DNA damage, oncogene activation, and other stresses. It acts as a nuclear transcription factor that transactivates genes involved in apoptosis, cell cycle regulation, and numerous other processes. An emerging area of research unravels additional activities of p53 in the cytoplasm, where it triggers apoptosis and inhibits autophagy. These novel functions contribute to p53’s mission as a tumor suppressor. PMID:19407794

  3. Transcription factors that interact with p53 and Mdm2.

    PubMed

    Inoue, Kazushi; Fry, Elizabeth A; Frazier, Donna P

    2016-04-01

    The tumor suppressor p53 is activated upon cellular stresses such as DNA damage, oncogene activation, hypoxia, which transactivates sets of genes that induce DNA repair, cell cycle arrest, apoptosis, or autophagy, playing crucial roles in the prevention of tumor formation. The central regulator of the p53 pathway is Mdm2 which inhibits transcriptional activity, nuclear localization and protein stability. More than 30 cellular p53-binding proteins have been isolated and characterized including Mdm2, Mdm4, p300, BRCA1/2, ATM, ABL and 53BP-1/2. Most of them are nuclear proteins; however, not much is known about p53-binding transcription factors. In this review, we focus on transcription factors that directly interact with p53/Mdm2 through direct binding including Dmp1, E2F1, YB-1 and YY1. Dmp1 and YB-1 bind only to p53 while E2F1 and YY1 bind to both p53 and Mdm2. Dmp1 has been shown to bind to p53 and block all the known functions for Mdm2 on p53 inhibition, providing a secondary mechanism for tumor suppression in Arf-null cells. Although E2F1-p53 binding provides a checkpoint mechanism to silence hyperactive E2F1, YB-1 or YY1 interaction with p53 subverts the activity of p53, contributing to cell cycle progression and tumorigenesis. Thus, the modes and consequences for each protein-protein interaction vary from the viewpoint of tumor development and suppression. PMID:26132471

  4. Regulation of iron homeostasis by the p53-ISCU pathway

    PubMed Central

    Funauchi, Yuki; Tanikawa, Chizu; Yi Lo, Paulisally Hau; Mori, Jinichi; Daigo, Yataro; Takano, Atsushi; Miyagi, Yohei; Okawa, Atsushi; Nakamura, Yusuke; Matsuda, Koichi

    2015-01-01

    Accumulation of iron in tissues increases the risk of cancer, but iron regulatory mechanisms in cancer tissues are largely unknown. Here, we report that p53 regulates iron metabolism through the transcriptional regulation of ISCU (iron-sulfur cluster assembly enzyme), which encodes a scaffold protein that plays a critical role in Fe-S cluster biogenesis. p53 activation induced ISCU expression through binding to an intronic p53-binding site. Knockdown of ISCU enhanced the binding of iron regulatory protein 1 (IRP1), a cytosolic Fe-S protein, to an iron-responsive element in the 5′ UTR of ferritin heavy polypeptide 1 (FTH1) mRNA and subsequently reduced the translation of FTH1, a major iron storage protein. In addition, in response to DNA damage, p53 induced FTH1 and suppressed transferrin receptor, which regulates iron entry into cells. HCT116 p53+/+ cells were resistant to iron accumulation, but HCT116 p53−/− cells accumulated intracellular iron after DNA damage. Moreover, excess dietary iron caused significant elevation of serum iron levels in p53−/− mice. ISCU expression was decreased in the majority of human liver cancer tissues, and its reduced expression was significantly associated with p53 mutation. Our finding revealed a novel role of the p53-ISCU pathway in the maintenance of iron homeostasis in hepatocellular carcinogenesis. PMID:26560363

  5. GATA-1 associates with and inhibits p53

    PubMed Central

    Mas, Caroline; Archambault, Patrick; Di Lello, Paola

    2009-01-01

    In addition to orchestrating the expression of all erythroid-specific genes, GATA-1 controls the growth, differentiation, and survival of the erythroid lineage through the regulation of genes that manipulate the cell cycle and apoptosis. The stages of mammalian erythropoiesis include global gene inactivation, nuclear condensation, and enucleation to yield circulating erythrocytes, and some of the genes whose expression are altered by GATA-1 during this process are members of the p53 pathway. In this study, we demonstrate a specific in vitro interaction between the transactivation domain of p53 (p53TAD) and a segment of the GATA-1 DNA-binding domain that includes the carboxyl-terminal zinc-finger domain. We also show by immunoprecipitation that the native GATA-1 and p53 interact in erythroid cells and that activation of p53-responsive promoters in an erythroid cell line can be inhibited by the overexpression of GATA-1. Mutational analysis reveals that GATA-1 inhibition of p53 minimally requires the segment of the GATA-1 DNA-binding domain that interacts with p53TAD. This inhibition is reciprocal, as the activation of a GATA-1–responsive promoter can be inhibited by p53. Based on these findings, we conclude that inhibition of the p53 pathway by GATA-1 may be essential for erythroid cell development and survival. PMID:19411634

  6. GATA-1 associates with and inhibits p53.

    PubMed

    Trainor, Cecelia D; Mas, Caroline; Archambault, Patrick; Di Lello, Paola; Omichinski, James G

    2009-07-01

    In addition to orchestrating the expression of all erythroid-specific genes, GATA-1 controls the growth, differentiation, and survival of the erythroid lineage through the regulation of genes that manipulate the cell cycle and apoptosis. The stages of mammalian erythropoiesis include global gene inactivation, nuclear condensation, and enucleation to yield circulating erythrocytes, and some of the genes whose expression are altered by GATA-1 during this process are members of the p53 pathway. In this study, we demonstrate a specific in vitro interaction between the transactivation domain of p53 (p53TAD) and a segment of the GATA-1 DNA-binding domain that includes the carboxyl-terminal zinc-finger domain. We also show by immunoprecipitation that the native GATA-1 and p53 interact in erythroid cells and that activation of p53-responsive promoters in an erythroid cell line can be inhibited by the overexpression of GATA-1. Mutational analysis reveals that GATA-1 inhibition of p53 minimally requires the segment of the GATA-1 DNA-binding domain that interacts with p53TAD. This inhibition is reciprocal, as the activation of a GATA-1-responsive promoter can be inhibited by p53. Based on these findings, we conclude that inhibition of the p53 pathway by GATA-1 may be essential for erythroid cell development and survival. PMID:19411634

  7. FHL2 mediates p53-induced transcriptional activation through a direct association with HIPK2

    SciTech Connect

    Lee, Sang-Wang . E-mail: umsj@sejong.ac.kr

    2006-01-27

    To understand the molecular mechanism underlying HIPK2 regulation of the transcriptional activation by p53, we sought to identify the protein that interacts with HIPK2. From our yeast two-hybrid screen, we found that four and a half LIM domains 2 (FHL2) could bind to the C-terminal half of HIPK2. Further assays in yeast mapped the minimal interaction domain to amino acids 812-907 in HIPK2. The interaction was confirmed using a GST pull-down assay in vitro, and an immunoprecipitation (IP) assay and fluorescence microscopy in vivo. FHL2 alone spread throughout both the cytoplasm and nucleus but was redistributed to dot-like structures in the nucleus when HIPK2 was coexpressed in HEK293 cells. When tethered to the Gal4-responsive promoter through the Gal4 DBD fusion, FHL2 showed autonomous transcriptional activity that was enhanced by wild-type HIPK2, but not by the kinase-defective mutant. In addition, FHL2 increased the p53-dependent transcriptional activation and had an additive effect on the activation when coexpressed with HIPK2, which was again not observed with the kinase-defective mutant of HIPK2. Finally, we found a ternary complex of p53, HIPK2, and FHL2 using IP, and their recruitment to the p53-responsive p21Waf1 promoter in chromatin IP assays. Overall, our findings indicate that FHL2 can also regulate p53 via a direct association with HIPK2.

  8. PKR, a p53 target gene, plays a crucial role in the tumor-suppressor function of p53

    PubMed Central

    Yoon, Cheol-Hee; Lee, Eun-Soo; Lim, Dae-Seog; Bae, Yong-Soo

    2009-01-01

    Type I IFN-induced expression of dsRNA-activated protein kinase (PKR) during viral infection is a well-established antiviral mechanism. However, little is known about the expression of PKR in the context of p53 and about PKR involvement in p53-mediated tumor suppression. Here, we report that PKR is a p53 target gene and plays an important role in the tumor-suppressor function of p53. Activation of p53 by genotoxic stress induces a significant level of PKR expression by acting on the newly identified cis-acting element (ISRE), which is separated from the IFN-stimulated responsive element on the PKR promoter, resulting in translational inhibition and cell apoptosis. The genotoxin-mediated inhibition of translation is associated with the p53/PKR/elF2a (eukaryotic initiation factor-2α) pathway. To some extent, p53 activation induced by DNA damage facilitates cell apoptosis by activating PKR. PKR-knockdown human colon cancer cells grew rapidly in nude mice and proved resistant to anti-cancer drugs. These data indicate that p53-mediated tumor suppression can be attributed at least in part to the biological functions of PKR induced by p53 in genotoxic conditions. PMID:19416861

  9. Long Noncoding RNA MEG3 Interacts with p53 Protein and Regulates Partial p53 Target Genes in Hepatoma Cells

    PubMed Central

    Zhu, Juanjuan; Liu, Shanshan; Ye, Fuqiang; Shen, Yuan; Tie, Yi; Zhu, Jie; Wei, Lixin; Jin, Yinghua; Fu, Hanjiang; Wu, Yongge; Zheng, Xiaofei

    2015-01-01

    Maternally Expressed Gene 3 (MEG3) encodes a lncRNA which is suggested to function as a tumor suppressor. Previous studies suggested that MEG3 functioned through activation of p53, however, the functional properties of MEG3 remain obscure and their relevance to human diseases is under continuous investigation. Here, we try to illuminate the relationship of MEG3 and p53, and the consequence in hepatoma cells. We find that transfection of expression construct of MEG3 enhances stability and transcriptional activity of p53. Deletion analysis of MEG3 confirms that full length and intact structure of MEG3 are critical for it to activate p53-mediated transactivation. Interestingly, our results demonstrate for the first time that MEG3 can interact with p53 DNA binding domain and various p53 target genes are deregulated after overexpression of MEG3 in hepatoma cells. Furthermore, results of qRT-PCR have shown that MEG3 RNA is lost or reduced in the majority of HCC samples compared with adjacent non-tumorous samples. Ectopic expression of MEG3 in hepatoma cells significantly inhibits proliferation and induces apoptosis. In conclusion, our data demonstrates that MEG3 functions as a tumor suppressor in hepatoma cells through interacting with p53 protein to activate p53-mediated transcriptional activity and influence the expression of partial p53 target genes. PMID:26444285

  10. Post-thymic T cell lymphomas frequently overexpress p53 protein but infrequently exhibit p53 gene mutations.

    PubMed Central

    Matsushima, A. Y.; Cesarman, E.; Chadburn, A.; Knowles, D. M.

    1994-01-01

    We recently demonstrated that only one of 36 T-cell neoplasms contained p53 gene mutations. Although p53 gene mutations are known to result in overexpression of the p53 gene product, we also recently discovered that p53 protein overexpression does not correlate with p53 gene mutations, but does correlate with proliferation (r = 0.92), in anaplastic large cell lymphoma. In view of these findings, we investigated 34 non-human T-cell lymphotropic virus type I (HTLV-I) related postthymic T-cell lymphomas immunohistochemically for p53 protein, using monoclonal antibody 1801, and for proliferation, using monoclonal antibody Ki-67, and quantitated the results with the CAS-200 computerized image analysis system. We evaluated the presence of mutations in conserved exons 5 to 9 of the p53 gene using single-strand conformation polymorphism analysis and DNA sequencing. p53 mutations were detected in three of 34 cases, including two that contained deletions. p53 protein overexpression was detected in 17 of 34 cases, including the three mutated cases, with reactivities ranging from 10% to 48%. However, many cases in which a structural alteration could not be detected demonstrated levels of p53 protein expression comparable to those cases that were mutated. Correlation of p53 protein expression and proliferation, as assessed by Ki-67 expression, in this group of lymphomas was poor (r = 0.34). Whether alternative mechanisms of p53 protein inactivation are causing phenotypic overexpression of the p53 protein in these malignant lymphomas is unknown, although preliminary studies do not support a major role for such mechanisms. Therefore, the etiology and the significance of p53 protein overexpression in the cases that lack a demonstrable mutation is unclear. Nevertheless, as in anaplastic large cell lymphoma, overexpression of the p53 gene product is not a reliable predictor of the presence of mutations in conserved portions of the p53 gene in non-HTLV-I associated post-thymic T

  11. p53 Isoforms: Key Regulators of the Cell Fate Decision.

    PubMed

    Joruiz, Sebastien M; Bourdon, Jean-Christophe

    2016-01-01

    It is poorly understood how a single protein, p53, can be responsive to so many stress signals and orchestrates very diverse cell responses to maintain/restore cell/tissue functions. The uncovering that TP53 gene physiologically expresses, in a tissue-dependent manner, several p53 splice variants (isoforms) provides an explanation to its pleiotropic biological activities. Here, we summarize a decade of research on p53 isoforms. The clinical studies and the diverse cellular and animal models of p53 isoforms (zebrafish, Drosophila, and mouse) lead us to realize that a p53-mediated cell response is, in fact, the sum of the intrinsic activities of the coexpressed p53 isoforms and that unbalancing expression of different p53 isoforms leads to cancer, premature aging, (neuro)degenerative diseases, inflammation, embryo malformations, or defects in tissue regeneration. Cracking the p53 isoforms' code is, thus, a necessary step to improve cancer treatment. It also opens new exciting perspectives in tissue regeneration. PMID:26801896

  12. A role for Numb in p53 stabilization

    PubMed Central

    Carter, Stephanie; Vousden, Karen H

    2008-01-01

    The cell-fate determinant Numb has recently been shown to help activate the tumor suppressor protein p53. Loss of Numb in breast cancers would result, therefore, in both the activation of the potential oncogene Notch and the diminution of tumor suppression by p53. PMID:18492217

  13. Guilty as CHARGED: p53's expanding role in disease

    PubMed Central

    Van Nostrand, Jeanine L; Attardi, Laura D

    2014-01-01

    Unrestrained p53 activity during development, as occurs upon loss of the p53 negative regulators Mdm2 or Mdmx, causes early embryonic lethality. Surprisingly, co-expression of wild-type p53 and a transcriptionally-dead variant of p53, with mutations in both transactivation domains (p53L25Q,W26S,F53Q,F54S), also causes lethality, but later in gestation and in association with a host of very specific phenotypes reminiscent of a syndrome known as CHARGE. Molecular analyses revealed that wild-type p53 is inappropriately activated in p535,26,53,54/+ embryos, triggering cell-cycle arrest or apoptosis during development to cause CHARGE phenotypes. In addition, CHARGE syndrome is typically caused by mutations in the CHD7 chromatin remodeler, and we have shown that activated p53 contributes to phenotypes caused by CHD7-deficiency. Together, these studies provide new insight into CHARGE syndrome and expand our understanding of the role of p53 in diseases other than cancer. PMID:25483057

  14. Targeting p53 by small molecules in hematological malignancies.

    PubMed

    Saha, Manujendra N; Qiu, Lugui; Chang, Hong

    2013-01-01

    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their anti-tumor effects in different types of hematological malignancies. Importantly, nutlin and PRIMA-1 have successfully reached the stage of phase I/II clinical trials in at least one type of hematological cancer. Thus, the pharmacological activation of p53 by these small molecules has a major clinical impact on prognostic use and targeted drug design. In the current review, we present the recent achievements in p53 research using small molecules in hematological malignancies. Anticancer activity of different classes of compounds targeting the p53 signaling pathway and their mechanism of action are discussed. In addition, we discuss how p53 tumor suppressor protein holds promise as a drug target for recent and future novel therapies in these diseases. PMID:23531342

  15. p53 Regulates Period2 Expression and the Circadian Clock

    PubMed Central

    Miki, Takao; Matsumoto, Tomoko; Zhao, Zhaoyang; Lee, Cheng Chi

    2013-01-01

    The mechanistic interconnectivity between circadian regulation and the genotoxic stress response remains poorly understood. Here we show that the expression of Period 2 (Per2), a circadian regulator, is directly regulated by p53 binding to a response element in the Per2 promoter. This p53 response element is evolutionarily conserved and overlaps with the E-Box element critical for BMAL1/CLOCK binding and its transcriptional activation of Per2 expression. Our studies reveal that p53 blocks BMAL1/CLOCK binding to the Per2 promoter leading to repression of Per2 expression. In the suprachiasmatic nucleus (SCN), p53 expression and its binding to the Per2 promoter are under circadian control. Per2 expression in the SCN is altered by p53 deficiency or stabilization of p53 by Nutlin-3. Behaviorally, p53−/− mice have a shorter period length that lacks stability and they exhibit impaired photo-entrainment to a light pulse under a free-running state. Our studies demonstrate that p53 modulates mouse circadian behavior. PMID:24051492

  16. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-01-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  17. Functional Analysis of p53 Binding under Differential Stresses†

    PubMed Central

    Krieg, Adam J.; Hammond, Ester M.; Giaccia, Amato J.

    2006-01-01

    Hypoxia and DNA damage stabilize the p53 protein, but the subsequent effect that each stress has on transcriptional regulation of known p53 target genes is variable. We have used chromatin immunoprecipitation followed by CpG island (CGI) microarray hybridization to identify promoters bound by p53 under both DNA-damaging and non-DNA-damaging conditions in HCT116 cells. Using gene-specific PCR analysis, we have verified an association with CGIs of the highest enrichment (>2.5-fold) (REV3L, XPMC2H, HNRPUL1, TOR1AIP1, glutathione peroxidase 1, and SCFD2), with CGIs of intermediate enrichment (>2.2-fold) (COX7A2L, SYVN1, and JAG2), and with CGIs of low enrichment (>2.0-fold) (MYC and PCNA). We found little difference in promoter binding when p53 is stabilized by these two distinctly different stresses. However, expression of these genes varies a great deal: while a few genes exhibit classical induction with adriamycin, the majority of the genes are unchanged or are mildly repressed by either hypoxia or adriamycin. Further analysis using p53 mutated in the core DNA binding domain revealed that the interaction of p53 with CGIs may be occurring through both sequence-dependent and -independent mechanisms. Taken together, these experiments describe the identification of novel p53 target genes and the subsequent discovery of distinctly different expression phenomena for p53 target genes under different stress scenarios. PMID:16980608

  18. p53 as an intervention target for cancer and aging

    PubMed Central

    Hasty, Paul; Christy, Barbara A.

    2013-01-01

    p53 is well known for suppressing tumors but could also affect other aging processes not associated with tumor suppression. As a transcription factor, p53 responds to a variety of stresses to either induce apoptosis (cell death) or cell cycle arrest (cell preservation) to suppress tumor development. Yet, the effect p53 has on the non-cancer aspects of aging is complicated and not well understood. On one side, p53 could induce cellular senescence or apoptosis to suppress cancer but as an unintended consequence enhance the aging process especially if these responses diminish stem and progenitor cell populations. But on the flip side, p53 could reduce growth and growth-related stress to enable cell survival and ultimately delay the aging process. A better understanding of diverse functions of p53 is essential to elucidate its influences on the aging process and the possibility of targeting p53 or p53 transcriptional targets to treat cancer and ameliorate general aging. PMID:24124625

  19. p53 in the DNA-Damage-Repair Process.

    PubMed

    Williams, Ashley B; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA-damage-response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA-repair systems. It thus appears as if p53 is multitasking in providing protection from cancer development by maintaining genome stability. PMID:27048304

  20. Low Levels of p53 Protein and Chromatin Silencing of p53 Target Genes Repress Apoptosis in Drosophila Endocycling Cells

    PubMed Central

    Zhang, Bingqing; Mehrotra, Sonam; Ng, Wei Lun; Calvi, Brian R.

    2014-01-01

    Apoptotic cell death is an important response to genotoxic stress that prevents oncogenesis. It is known that tissues can differ in their apoptotic response, but molecular mechanisms are little understood. Here, we show that Drosophila polyploid endocycling cells (G/S cycle) repress the apoptotic response to DNA damage through at least two mechanisms. First, the expression of all the Drosophila p53 protein isoforms is strongly repressed at a post-transcriptional step. Second, p53-regulated pro-apoptotic genes are epigenetically silenced in endocycling cells, preventing activation of a paused RNA Pol II by p53-dependent or p53-independent pathways. Over-expression of the p53A isoform did not activate this paused RNA Pol II complex in endocycling cells, but over-expression of the p53B isoform with a longer transactivation domain did, suggesting that dampened p53B protein levels are crucial for apoptotic repression. We also find that the p53A protein isoform is ubiquitinated and degraded by the proteasome in endocycling cells. In mitotic cycling cells, p53A was the only isoform expressed to detectable levels, and its mRNA and protein levels increased after irradiation, but there was no evidence for an increase in protein stability. However, our data suggest that p53A protein stability is regulated in unirradiated cells, which likely ensures that apoptosis does not occur in the absence of stress. Without irradiation, both p53A protein and a paused RNA pol II were pre-bound to the promoters of pro-apoptotic genes, preparing mitotic cycling cells for a rapid apoptotic response to genotoxic stress. Together, our results define molecular mechanisms by which different cells in development modulate their apoptotic response, with broader significance for the survival of normal and cancer polyploid cells in mammals. PMID:25211335

  1. Amino acids implicated in plant defense are higher in Candidatus Liberibacter asiaticus-tolerant citrus varieties.

    PubMed

    Killiny, Nabil; Hijaz, Faraj

    2016-04-01

    Citrus Huanglongbing (HLB), also known as citrus greening, has been threatening the citrus industry since the early 1900's and up to this date there are no effective cures for this disease. Field observations and greenhouse controlled studies demonstrated that some citrus genotypes are more tolerant to Candidatus Liberibacter asiaticus (CLas) pathogen than others. However, the mechanisms underpinning tolerance has not been determined yet. The phloem sap composition of CLas-tolerant and sensitive citrus varieties was studied to identify metabolites that could be responsible for their tolerance to CLas. The citrus phloem sap was collected by centrifugation and was analyzed with gas chromatography-mass spectrometry after methyl chloroformate derivatization. Thirty-three metabolites were detected in the phloem sap of the studied varieties: twenty 20 amino acids, eight 8 organic acids, and five 5 fatty acids. Interestingly, the levels of most amino acids, especially those implicated in plantdefense to pathogens such as phenylalanine, tyrosine, tryptophan, lysine, and asparagine were higher in tolerant varieties. Although the level of organic acids varied between cultivars, this variation was not correlated with citrus resistance to CLas and could be cultivar specific. The fatty acids were found in trace amounts and in most cases their levels were not significantly different among varieties. Better understanding of the mechanisms underpinning citrus tolerance to CLas will help in developing economically tolerant varieties. PMID:27057814

  2. Mitochondrial dysfunction impairs tumor suppressor p53 expression/function.

    PubMed

    Compton, Shannon; Kim, Chul; Griner, Nicholas B; Potluri, Prasanth; Scheffler, Immo E; Sen, Sabyasachi; Jerry, D Joseph; Schneider, Sallie; Yadava, Nagendra

    2011-06-10

    Recently, mitochondria have been suggested to act in tumor suppression. However, the underlying mechanisms by which mitochondria suppress tumorigenesis are far from being clear. In this study, we have investigated the link between mitochondrial dysfunction and the tumor suppressor protein p53 using a set of respiration-deficient (Res(-)) mammalian cell mutants with impaired assembly of the oxidative phosphorylation machinery. Our data suggest that normal mitochondrial function is required for γ-irradiation (γIR)-induced cell death, which is mainly a p53-dependent process. The Res(-) cells are protected against γIR-induced cell death due to impaired p53 expression/function. We find that the loss of complex I biogenesis in the absence of the MWFE subunit reduces the steady-state level of the p53 protein, although there is no effect on the p53 protein level in the absence of the ESSS subunit that is also essential for complex I assembly. The p53 protein level was also reduced to undetectable levels in Res(-) cells with severely impaired mitochondrial protein synthesis. This suggests that p53 protein expression is differentially regulated depending upon the type of electron transport chain/respiratory chain deficiency. Moreover, irrespective of the differences in the p53 protein expression profile, γIR-induced p53 activity is compromised in all Res(-) cells. Using two different conditional systems for complex I assembly, we also show that the effect of mitochondrial dysfunction on p53 expression/function is a reversible phenomenon. We believe that these findings will have major implications in the understanding of cancer development and therapy. PMID:21502317

  3. p53 regulates the transcription of its Delta133p53 isoform through specific response elements contained within the TP53 P2 internal promoter.

    PubMed

    Marcel, V; Vijayakumar, V; Fernández-Cuesta, L; Hafsi, H; Sagne, C; Hautefeuille, A; Olivier, M; Hainaut, P

    2010-05-01

    The tumor suppressor p53 protein is activated by genotoxic stress and regulates genes involved in senescence, apoptosis and cell-cycle arrest. Nine p53 isoforms have been described that may modulate suppressive functions of the canonical p53 protein. Among them, Delta133p53 lacks the 132 proximal residues and has been shown to modulate p53-induced apoptosis and cell-cycle arrest. Delta133p53 is expressed from a specific mRNA, p53I4, driven by an alternative promoter P2 located between intron 1 and exon 5 of TP53 gene. Here, we report that the P2 promoter is regulated in a p53-dependent manner. Delta133p53 expression is increased in response to DNA damage by doxorubicin in p53 wild-type cell lines, but not in p53-mutated cells. Chromatin immunoprecipitation and luciferase assays using P2 promoter deletion constructs indicate that p53 binds functional response elements located within the P2 promoter. We also show that Delta133p53 does not bind specifically to p53 consensus DNA sequence in vitro, but competes with wild-type p53 in specific DNA-binding assays. Finally, we report that Delta133p53 counteracts p53-dependent growth suppression in clonogenic assays. These observations indicate that Delta133p53 is a novel target of p53 that may participate in a negative feedback loop controlling p53 function. PMID:20190805

  4. The regulation of p53 by phosphorylation: a model for how distinct signals integrate into the p53 pathway.

    PubMed

    Maclaine, Nicola J; Hupp, Ted R

    2009-05-01

    The tumour suppressor p53 is a transcription factor that has evolved the ability to integrate distinct environmental signals including DNA damage, virus infection, and cytokine signaling into a common biological outcome that maintains normal cellular control. Mutations in p53 switch the cellular transcription program resulting in deregulation of the stress responses that normally maintain cell and tissue integrity. Transgenic studies in mice have indicated that changes in the specific activity of p53 can have profound effects not only on cancer development, but also on organism aging. As the specific activity of p53 is regulated at a post-translational level by sets of enzymes that mediate phosphorylation, acetylation, methylation, and ubiquitin-like modifications, it is likely that physiological modifiers of the aging function of p53 would be enzymes that catalyze such covalent modifications. We demonstrate that distinct stress-activated kinases, including ataxia telangiectasia mutated (ATM), casein kinase 1 (CK1) and AMP-activated protein kinase (AMPK), mediate phosphorylation of a key phospho-acceptor site in the p53 transactivation domain in response to diverse stresses including ionizing radiation, DNA virus infection, and elevation in the intracellular AMP/ATP ratio. As diseases linked to aging can involve activation of p53-dependent changes in cellular protective pathways, the development of specific physiological models might further shed light on the role of p53 kinases in modifying age-related diseases. PMID:20157532

  5. p53 mRNA and p53 Protein Structures Have Evolved Independently to Interact with MDM2.

    PubMed

    Karakostis, Konstantinos; Ponnuswamy, Anand; Fusée, Leïla T S; Bailly, Xavier; Laguerre, Laurent; Worall, Erin; Vojtesek, Borek; Nylander, Karin; Fåhraeus, Robin

    2016-05-01

    The p53 tumor suppressor and its key regulator MDM2 play essential roles in development, ageing, cancer, and cellular stress responses in mammals. Following DNA damage, MDM2 interacts with p53 mRNA in an ATM kinase-dependent fashion and stimulates p53 synthesis, whereas under normal conditions, MDM2 targets the p53 protein for degradation. The peptide- and RNA motifs that interact with MDM2 are encoded by the same conserved BOX-I sequence, but how these interactions have evolved is unknown. Here, we show that a temperature-sensitive structure in the invertebrate Ciona intestinalis (Ci) p53 mRNA controls its interaction with MDM2. We also show that a nonconserved flanking region of Ci-BOX-I domain prevents the p53-MDM2 protein-protein interaction. These results indicate that the temperature-regulated p53 mRNA-MDM2 interaction evolved to become kinase regulated in the mammalian DNA damage response. The data also suggest that the negative regulation of p53 by MDM2 via protein-protein interaction evolved in vertebrates following changes in the BOX-I flanking sequence. PMID:26823446

  6. Energetic Landscape of MDM2-p53 Interactions by Computational Mutagenesis of the MDM2-p53 Interaction

    PubMed Central

    Thayer, Kelly M.; Beyer, George A.

    2016-01-01

    The ubiquitin ligase MDM2, a principle regulator of the tumor suppressor p53, plays an integral role in regulating cellular levels of p53 and thus a prominent role in current cancer research. Computational analysis used MUMBO to rotamerize the MDM2-p53 crystal structure 1YCR to obtain an exhaustive search of point mutations, resulting in the calculation of the ΔΔG comprehensive energy landscape for the p53-bound regulator. The results herein have revealed a set of residues R65-E69 on MDM2 proximal to the p53 hydrophobic binding pocket that exhibited an energetic profile deviating significantly from similar residues elsewhere in the protein. In light of the continued search for novel competitive inhibitors for MDM2, we discuss possible implications of our findings on the drug discovery field. PMID:26992014

  7. Energetic Landscape of MDM2-p53 Interactions by Computational Mutagenesis of the MDM2-p53 Interaction.

    PubMed

    Thayer, Kelly M; Beyer, George A

    2016-01-01

    The ubiquitin ligase MDM2, a principle regulator of the tumor suppressor p53, plays an integral role in regulating cellular levels of p53 and thus a prominent role in current cancer research. Computational analysis used MUMBO to rotamerize the MDM2-p53 crystal structure 1YCR to obtain an exhaustive search of point mutations, resulting in the calculation of the ΔΔG comprehensive energy landscape for the p53-bound regulator. The results herein have revealed a set of residues R65-E69 on MDM2 proximal to the p53 hydrophobic binding pocket that exhibited an energetic profile deviating significantly from similar residues elsewhere in the protein. In light of the continued search for novel competitive inhibitors for MDM2, we discuss possible implications of our findings on the drug discovery field. PMID:26992014

  8. Pancreatic adenocarcinomas frequently show p53 gene mutations.

    PubMed Central

    Scarpa, A.; Capelli, P.; Mukai, K.; Zamboni, G.; Oda, T.; Iacono, C.; Hirohashi, S.

    1993-01-01

    Thirty-four pancreatic adenocarcinomas were studied for the presence of p53 gene mutations by the single-strand conformation polymorphism method and by direct sequencing of PCR-amplified fragments. p53 protein expression was immunohistochemically evaluated using monoclonal PAb1801 and polyclonal CM1 antibodies. Mutations were detected in 14 cases. The transitions were six G to A and two A to G; the transversions were one C to G and two A to C; the remaining three were frameshift mutations. Immunostaining results were identical with both antibodies. Nuclear immunohistochemical p53-positive cells were found in nine p53 mutated cases and in 12 cases in which no mutation was detected. In most of these latter cases only a minority of cancer cells showed immunohistochemical positivity. Twenty-nine cases, including all p53 mutated cancers, were known to contain codon 12 Ki-ras gene mutations. Also in the light of the demonstrated cooperation of ras and p53 gene alterations in the transformation of cultured cells, our data suggest that p53 mutation is one of the genetic defects that may have a role in the pathogenesis of a proportion of pancreatic cancers. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8494051

  9. Caught in the cross fire: p53 in inflammation.

    PubMed

    Cooks, Tomer; Harris, Curtis C; Oren, Moshe

    2014-08-01

    The p53 transcription factor is a major tumor suppressor, whose diverse activities serve to ensure genome stability and inhibit neoplastic processes. In recent years, it is becoming increasingly clear that p53 also plays a broader role in maintaining cellular homeostasis, as well as contributing to tissue homeostasis in a non-cell-autonomous fashion. Chronic inflammation is a potential cancer-promoting condition, and as such is also within the radar of p53, which mounts a multifaceted attempt to prevent the escalation of chronic tissue imbalance into neoplasia. Recent understanding of the p53 pathway and other family members reveals a broad interaction with inflammatory elements such as reactive oxygen and nitrogen species, cytokines, infectious agents and major immune-regulatory pathways like nuclear factor-kappaB. This complex cross talk is highly dependent on p53 status, as different p53 isoforms and p53 mutants can mediate different responses and even promote chronic inflammation and associated cancer, acting in the tumor cells as well as in the stromal and immune compartments. PMID:24942866

  10. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

    2015-01-01

    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  11. The p53 family and programmed cell death

    PubMed Central

    Pietsch, E. Christine; Sykes, Stephen M.; McMahon, Steven B.; Murphy, Maureen E.

    2008-01-01

    The p53 tumor suppressor continues to hold distinction as the most frequently mutated gene in human cancer. The ability of p53 to induce programmed cell death, or apoptosis, of cells exposed to environmental or oncogenic stress constitutes a major pathway whereby p53 exerts its tumor suppressor function. In the past decade we have discovered that p53 is not alone in its mission to destroy damaged or aberrantly proliferating cells: it has two homologues, p63 and p73, that in various cellular contexts and stresses contribute to this process. In this review, the mechanisms whereby p53, and in some cases p63 and p73, induce apoptosis are discussed. Whereas other reviews have focused more extensively on the contribution of individual p53-regulated genes to apoptosis induction by this protein, in this review we focus more on those factors that mediate the decision between growth arrest and apoptosis by p53, p63 and p73, and on the post-translational modifications and protein-protein interactions that influence this decision. PMID:18955976

  12. MDM2-p53 Pathway in Hepatocellular Carcinoma

    PubMed Central

    Meng, Xuan; Franklin, Derek A; Dong, Jiahong; Zhang, Yanping

    2015-01-01

    Abnormalities in the TP53 gene and overexpression of MDM2, a transcriptional target and negative regulator of p53, are commonly observed in cancers. The MDM2-p53 feedback loop plays an important role in tumor progression and thus, increased understanding of the pathway has the potential to improve clinical outcomes for cancer patients. Hepatocellular carcinoma (HCC) has emerged as one of the most commonly diagnosed forms of human cancer; yet, the current treatment for HCC is less effective than those used against other cancers. We review the current studies of the MDM2-p53 pathway in cancer with a focus on HCC, and specifically discuss the impact of p53 mutations along with other alterations of the MDM2-p53 feedback loop in HCC. We also discuss the potential diagnostic and prognostic applications of p53 and MDM2 in malignant tumors as well as therapeutic avenues that are being developed to target the MDM2-p53 pathway. PMID:25477334

  13. p53 and the pathogenesis of skin cancer

    SciTech Connect

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-11-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients.

  14. Long story short: p53 mediates innate immunity.

    PubMed

    Miciak, Jessica; Bunz, Fred

    2016-04-01

    The story of p53 and how we came to understand it is punctuated by fundamental insights into the essence of cancer. In the decades since its discovery, p53 has been shown to be centrally involved in most, if not all, of the cellular processes that maintain tissue homeostasis. Extensive functional analyses of p53 and its tumor-associated mutants have illuminated many of the common defects shared by most cancer cells. As the central character in a tale that continues to unfold, p53 has become increasingly familiar and yet remains surprisingly inscrutable. New relationships periodically come to light, and surprising, novel activities continue to emerge, thereby revealing new dimensions and aspects of its function. What lies at the very core of this complex protagonist? What is its prime motivation? As every avid reader knows, the elements of character are profoundly shaped by adversity--originating from within and without. And so it is with p53. This review will briefly recap the coordinated responses of p53 to viral infection, and outline a hypothetical model that would explain how an abundance of seemingly unrelated phenotypic attributes may in the end reflect a singular function. All stories eventually draw to a conclusion. This epic tale may eventually leave us with the realization that p53, most simply described, is a protein that evolved to mediate immune surveillance. PMID:26951863

  15. The p53 status of cultured human premalignant oral keratinocytes.

    PubMed Central

    Burns, J. E.; Clark, L. J.; Yeudall, W. A.; Mitchell, R.; Mackenzie, K.; Chang, S. E.; Parkinson, E. K.

    1994-01-01

    Around 60% of oral squamous cell carcinomas (SCCs) have been shown to harbour p53 mutations, and other studies have demonstrated mutant p53 genes in normal and dysplastic squamous epithelium adjacent to these SCCs. In line with these earlier studies we show here that DOK, a keratinocyte cell line derived from a dysplasia, displays elevated levels of p53 protein and harbours a 12 bp in-frame deletion of the p53 gene spanning codons 188-191. In contrast, the coding region of the p53 gene was normal in a series of six benign recurrent laryngeal papillomas and a series of four premalignant oral erythroplakia biopsies and their cell cultures. All but one of these lesions were free of malignancy at the time of biopsy, in contrast to the premalignant lesions studied by previous investigators, but keratinocytes cultured from these lesions all displayed a partially transformed phenotype that was less pronounced than that of DOK. Since three out of four of the erythroplakia patients developed SCC within 1 year of biopsy, these lesions were by definition premalignant. The availability of strains of partially transformed keratinocytes from premalignant erythroplakias which possess normal p53 genes should enable us to test the role of mutant p53 in the progression of erythroplakia to SCC. The premalignant tissues and cultures were also tested for the presence of human papillomavirus (HPV), which is known to inactivate p53 function in some cases. Only the benign papillomas were shown to contain high levels of either HPV 6 or HPV 11 E6 DNA, but not both, and none of the samples contained detectable levels of HPV 16, HPV 18 or HPV 33 E6 DNA or L1 DNA of several other HPV types. There was therefore no evidence to suggest that p53 was being inactivated by a highly oncogenic HPV in these samples. Images Figure 1 Figure 2 Figure 3 PMID:7917902

  16. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    SciTech Connect

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  17. Role of cysteine residues in regulation of p53 function.

    PubMed

    Rainwater, R; Parks, D; Anderson, M E; Tegtmeyer, P; Mann, K

    1995-07-01

    Previous studies of p53 have implicated cysteine residues in site-specific DNA binding via zinc coordination and redox regulation (P. Hainaut and J. Milner, Cancer Res. 53:4469-4473, 1993; T. R. Hupp, D. W. Meek, C. A. Midgley, and D. P. Lane, Nucleic Acids Res. 21:3167-3174, 1993). We show here that zinc binding and redox regulation are, at least in part, distinct determinants of the binding of p53 to DNA. Moreover, by substituting serine for each cysteine in murine p53, we have investigated the roles of individual cysteines in the regulation of p53 function. Substitution of serine for cysteine at position 40, 179, 274, 293, or 308 had little or no effect on p53 function. In contrast, replacement of cysteine at position 173, 235, or 239 markedly reduced in vitro DNA binding, completely blocked transcriptional activation, and led to a striking enhancement rather than a suppression of transformation by p53. These three cysteines have been implicated in zinc binding by X-ray diffraction studies (Y. Cho, S. Gorina, P.D. Jeffrey, and N.P. Pavletich, Science 265:346-355, 1994); our studies demonstrate the functional consequences of the inability of the central DNA-binding domain of p53 to studies demonstrate the functional consequences of the inability of the central DNA-binding domain of p53 to bind zinc. Lastly, substitutions for cysteines at position 121, 132, 138, or 272 partially blocked both transactivation and the suppression of transformation by p53. These four cysteines are located in the loop-sheet-helix region of the site-specific DNA-binding domain of p53. Like the cysteines in the zinc-binding region, therefore, these cysteines may cooperate to modulate the structure of the DNA-binding domain. Our findings argue that p53 is subject to more than one level of conformational modulation through oxidation-reduction of cysteines at or near the p53-DNA interface. PMID:7791795

  18. Robustness of the p53 network and biological hackers.

    PubMed

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-01

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses. PMID:15896791

  19. The emerging role of p53 in exercise metabolism.

    PubMed

    Bartlett, Jonathan D; Close, Graeme L; Drust, Barry; Morton, James P

    2014-03-01

    The major tumour suppressor protein, p53, is one of the most well-studied proteins in cell biology. Often referred to as the Guardian of the Genome, the list of known functions of p53 include regulatory roles in cell cycle arrest, apoptosis, angiogenesis, DNA repair and cell senescence. More recently, p53 has been implicated as a key molecular player regulating substrate metabolism and exercise-induced mitochondrial biogenesis in skeletal muscle. In this context, the study of p53 therefore has obvious implications for both human health and performance, given that impaired mitochondrial content and function is associated with the pathology of many metabolic disorders such as ageing, type 2 diabetes, obesity and cancer, as well as reduced exercise performance. Studies on p53 knockout (KO) mice collectively demonstrate that ablation of p53 content reduces intermyofibrillar (IMF) and subsarcolemmal (SS) mitochondrial yield, reduces cytochrome c oxidase (COX) activity and peroxisome proliferator-activated receptor gamma co-activator 1-α protein content whilst also reducing mitochondrial respiration and increasing reactive oxygen species production during state 3 respiration in IMF mitochondria. Additionally, p53 KO mice exhibit marked reductions in exercise capacity (in the magnitude of 50 %) during fatiguing swimming, treadmill running and electrical stimulation protocols. p53 may regulate contractile-induced increases in mitochondrial content via modulating mitochondrial transcription factor A (Tfam) content and/or activity, given that p53 KO mice display reduced skeletal muscle mitochondrial DNA, Tfam messenger RNA and protein levels. Furthermore, upon muscle contraction, p53 is phosphorylated on serine 15 and subsequently translocates to the mitochondria where it forms a complex with Tfam to modulate expression of mitochondrial-encoded subunits of the COX complex. In human skeletal muscle, the exercise-induced phosphorylation of p53(Ser15) is enhanced in conditions

  20. MEK2 regulates ribonucleotide reductase activity through functional interaction with ribonucleotide reductase small subunit p53R2.

    PubMed

    Piao, Chunmei; Youn, Cha-Kyung; Jin, Min; Yoon, Sang Pil; Chang, In-Youb; Lee, Jung Hee; You, Ho Jin

    2012-09-01

    The p53R2 protein, a newly identified member of the ribonucleotide reductase family that provides nucleotides for DNA damage repair, is directly regulated by p53. We show that p53R2 is also regulated by a MEK2 (ERK kinase 2/MAP kinase kinase 2)-dependent pathway. Increased MEK1/2 phosphorylation by serum stimulation coincided with an increase in the RNR activity in U2OS and H1299 cells. The inhibition of MEK2 activity, either by treatment with a MEK inhibitor or by transfection with MEK2 siRNA, dramatically decreased the serum-stimulated RNR activity. Moreover, p53R2 siRNA, but not R2 siRNA, significantly inhibits serum-stimulated RNR activity, indicating that p53R2 is specifically regulated by a MEK2-dependent pathway. Co-immunoprecipitation analyses revealed that the MEK2 segment comprising amino acids 65-171 is critical for p53R2-MEK2 interaction, and the binding domain of MEK2 is required for MEK2-mediated increased RNR activity. Phosphorylation of MEK1/2 was greatly augmented by ionizing radiation, and RNR activity was concurrently increased. Ionizing radiation-induced RNR activity was markedly attenuated by transfection of MEK2 or p53R2 siRNA, but not R2 siRNA. These data show that MEK2 is an endogenous regulator of p53R2 and suggest that MEK2 may associate with p53R2 and upregulate its activity. PMID:22895183

  1. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  2. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis.

    PubMed

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  3. Structure-based design of a potent artificial transactivation domain based on p53.

    PubMed

    Langlois, Chantal; Del Gatto, Annarita; Arseneault, Geneviève; Lafrance-Vanasse, Julien; De Simone, Mariarosaria; Morse, Thomas; de Paola, Ivan; Lussier-Price, Mathieu; Legault, Pascale; Pedone, Carlo; Zaccaro, Laura; Omichinski, James G

    2012-01-25

    Malfunctions in transcriptional regulation are associated with a number of critical human diseases. As a result, there is considerable interest in designing artificial transcription activators (ATAs) that specifically control genes linked to human diseases. Like native transcriptional activator proteins, an ATA must minimally contain a DNA-binding domain (DBD) and a transactivation domain (TAD) and, although there are several reliable methods for designing artificial DBDs, designing artificial TADs has proven difficult. In this manuscript, we present a structure-based strategy for designing short peptides containing natural amino acids that function as artificial TADs. Using a segment of the TAD of p53 as the scaffolding, modifications are introduced to increase the helical propensity of the peptides. The most active artificial TAD, termed E-Cap-(LL), is a 13-mer peptide that contains four key residues from p53, an N-capping motif and a dileucine hydrophobic bridge. In vitro analysis demonstrates that E-Cap-(LL) interacts with several known p53 target proteins, while in vivo studies in a yeast model system show that it is a 20-fold more potent transcriptional activator than the native p53-13 peptide. These results demonstrate that structure-based design represents a promising approach for developing artificial TADs that can be combined with artificial DBDs to create potent and specific ATAs. PMID:22191432

  4. Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

    SciTech Connect

    Okazaki, Ryuji; Ootsuyama, Akira; Kakihara, Hiroyo; Mabuchi, Yo; Matsuzaki, Yumi; Michikawa, Yuichi; Imai, Takashi; Norimura, Toshiyuki

    2011-01-01

    Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situ hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.

  5. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.

    1989-05-01

    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  6. Nitric oxide evoked p53-accumulation and apoptosis.

    PubMed

    Brüne, Bernhard; Schneiderhan, Nicole

    2003-04-01

    The tumor suppressor p53 accumulates under conditions of cellular stress and affects cell cycle progression and/or apoptosis. This has been exemplified for endogenously produced or exogenously supplied nitric oxide (NO) and thus accounts at least in part for cell destructive signaling qualities of this bioactive molecule and/or derived reactive nitrogen species. However, detailed mechanisms of toxicity and pathways of cell demise remain to be elucidated. Establishing that NO-treatment left the ubiquitination and the p53-Mdm2 interaction intact may point to an impaired nuclear-cytoplasmic shuttling to account for p53 stabilization. This was verified by heterokaryon analysis. We conclude that attenuated nuclear export contributes to stabilization and activation of p53 under the influence of NO. PMID:12628747

  7. Cerebellum Development and Tumorigenesis: A p53-Centric Perspective.

    PubMed

    Barthelery, Nicolas J; Manfredi, James J

    2016-05-01

    The p53 protein has been extensively studied for its role in suppressing tumorigenesis, in part through surveillance and maintenance of genomic stability. p53 has been associated with the induction of a variety of cellular outcomes including cell cycle arrest, senescence, and apoptosis. This occurs primarily, but not exclusively, through transcriptional activation of specific target genes. By contrast, the participation of p53 in normal developmental processes has been largely understudied. This review focuses on possible functions of p53 in cerebellar development. It can be argued that a better understanding of such mechanisms will provide needed insight into the genesis of certain embryonic cancers including medulloblastomas, and thus lead to more effective therapies. PMID:27085812

  8. p53 AND MDM2 PROTEIN EXPRESSION IN ACTINIC CHEILITIS

    PubMed Central

    de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida

    2008-01-01

    Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia. PMID:19082401

  9. A p53 growth arrest protects fibroblasts from anticancer agents.

    PubMed

    McCormack, E S; Bruskin, A M; Borzillo, G V

    1997-01-01

    Reversible inhibitors of the cell cycle such as the TGF-betas have been exploited to protect dividing cells from exposure to anticancer drugs and radiation. Here, rat embryo fibroblast (REF) lines expressing different p53 mutations were used to test whether the p53 growth arrest could also chemoprotect cells from high doses of anticancer drugs. Whereas the doubling times of the different REF lines at 37 degrees C were similar, cells bearing temperature-sensitive mutations (mouse 135V or human 143A) were growth arrested at 31 degrees C. Temperature-dependent p53 activity was associated with increased levels of MDM2 and p21/WAF1, and the induction of an integrated p53-responsive luciferase gene. The REF lines exhibited similar sensitivities to common anticancer drugs when grown at 37 degrees C. However, when exposed to the same agents following transient incubation at 31 degrees C, the p53-arrested cells exhibited a marked survival advantage as shown by colony-forming assays. Chemoprotection was not universal, in that colony formation was not enhanced significantly after treatment with cisplatin or 5-fluorouracil, two drugs which can cause cellular damage throughout the cell cycle. Like other negative growth regulators, an activated p53 checkpoint may mediate the survival of cells exposed to drugs that target DNA synthesis or mitosis. PMID:9351895

  10. UHRF2, another E3 ubiquitin ligase for p53

    SciTech Connect

    Bai, Lu; Wang, Xiaohui; Jin, Fangmin; Yang, Yan; Qian, Guanhua; Duan, Changzhu

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer UHRF2 associates with p53 in vivo and in vitro. Black-Right-Pointing-Pointer UHRF2 interacts with p53 through its SRA/YDG domain. Black-Right-Pointing-Pointer UHRF2 ubiquitinates p53 in vivo and in vitro. -- Abstract: UHRF2, ubiquitin-like with PHD and ring finger domains 2, is a nuclear E3 ubiquitin ligase, which is involved in cell cycle and epigenetic regulation. UHRF2 interacts with multiple cell cycle proteins, including cyclins (A2, B1, D1, and E1), CDK2, and pRb; moreover, UHRF2 could ubiquitinate cyclin D1 and cyclin E1. Also, UHRF2 has been shown to be implicated in epigenetic regulation by associating with DNMTs, G9a, HDAC1, H3K9me2/3 and hemi-methylated DNA. We found that UHRF2 associates with tumor suppressor protein p53, and p53 is ubiquitinated by UHRF2 in vivo and in vitro. Given that both UHRF2 and p53 are involved in cell cycle regulation, this study may suggest a novel signaling pathway on cell proliferation.

  11. Estradiol induces functional inactivation of p53 by intracellular redistribution.

    PubMed

    Molinari, A M; Bontempo, P; Schiavone, E M; Tortora, V; Verdicchio, M A; Napolitano, M; Nola, E; Moncharmont, B; Medici, N; Nigro, V; Armetta, I; Abbondanza, C; Puca, G A

    2000-05-15

    Estrogen treatment of MCF-7 cells grown in serum-free medium induced a modification of the intracellular distribution of p53 protein. Western blot analysis and immunofluorescence staining showed that p53 was localized in the nucleus of untreated cell and that after 48 h of hormone treatment, it was mostly localized in the cytoplasm. This effect was blocked by the antiestrogen ICI182,780. Intracellular redistribution of p53 was correlated to a reduced expression of the WAF1/CIP1 gene product and to the presence of degradation fragments of p53 in the cytosol. Estradiol treatment prevented the growth inhibition induced by oligonucleotide transfection, simulating DNA damage. This observation indicated that the wild-type p53 gene product present in the MCF-7 cell could be inactivated by estradiol through nuclear exclusion to permit the cyclin-dependent phosphorylation events leading to the G1-S transition. In addition, the estradiol-induced inactivation of p53 could be involved in the tumorigenesis of estrogen-dependent neoplasm. PMID:10825127

  12. Regulation of rheumatoid synoviocyte proliferation by endogenous p53 induction

    PubMed Central

    Migita, K; Tanaka, F; Yamasaki, S; Shibatomi, K; Ida, H; Kawakami, A; Aoyagi, T; Kawabe, Y; Eguchi, K

    2001-01-01

    The p53 tumour suppressor protein protects cells from tumorigenic alterations by inducing either cell growth arrest or apoptosis. In the present study, we investigated the role of endogenous p53 expressed in rheumatoid arthritis synovial fibroblasts which show transformed-appearing phenotypes. Type B synovial cells (fibroblast-like synovial cells) were exposed to a proteasome inhibitor, carbobenzoxyl-leucinyl-leucinyl-leucinal (MG-132). During this process, the expressions of p53 and p21 were examined by Western blot. Cell cycle analysis of the synovial cells was determined by DNA staining using propidium iodide (PI). Inhibition of proteasome resulted in the accumulation of p53 which was followed by an increase in the amount of a cyclin-dependent kinase (CDK)-inhibitor, p21. As a consequence, the retinoblastoma gene product, Rb, remained in the hypophosphorylated state, thus preventing PDGF-stimulated synovial cells from progressing into S-phase. This study shows that endogenous p53, which is inducible in rheumatoid synovial cells, is functionally active based on the findings that its expression blocks the G1/S transition by inhibiting the CDK-mediated phosphorylation of Rb via p21 induction. Thus the induction of p53 using proteasome inhibitor may provide a new approach in the treatment of RA. PMID:11703379

  13. Characterization of p53 expression in rainbow trout.

    PubMed

    Liu, Michelle; Tee, Catherine; Zeng, Fanxing; Sherry, James P; Dixon, Brian; Bols, Niels C; Duncker, Bernard P

    2011-11-01

    The tumour suppressor protein p53 is a critical component of cell cycle checkpoint responses. It upregulates the expression of cyclin-dependent kinase inhibitors in response to DNA damage and other cellular perturbations, and promotes apoptosis when DNA repair pathways are overwhelmed. Given the high incidence of p53 mutations in human cancers, it has been extensively studied, though only a small fraction of these investigations have been in non-mammalian systems. For the present study, an anti-rainbow trout p53 polyclonal antibody was generated. A variety of rainbow trout (Oncorhynchus mykiss) tissues and cell lines were examined through western blot analysis of cellular protein extracts, which revealed relatively high p53 levels in brain and gills. To evaluate the checkpoint response of rainbow trout p53, RTbrain-W1 and RTgill-W1 cell lines were exposed to varying concentrations of the DNA damaging agent bleomycin and ribonucleotide reductase inhibitor hydroxyurea. In contrast to mammals, these checkpoint-inducing agents provoked no apparent increase in rainbow trout p53 levels. These results infer the presence of alternate DNA damage checkpoint mechanisms in rainbow trout cells. PMID:21767662

  14. Herbicidal inhibitors of amino acid biosynthesis and herbicide-tolerant crops.

    PubMed

    Tan, S; Evans, R; Singh, B

    2006-03-01

    Acetohydroxyacid synthase (AHAS) inhibitors interfere with branched-chain amino acid biosynthesis by inhibiting AHAS. Glyphosate affects aromatic amino acid biosynthesis by inhibiting 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Glufosinate inhibits glutamine synthetase and blocks biosynthesis of glutamine. AHAS gene variants that confer tolerance to AHAS inhibitors have been discovered in plants through selection or mutagenesis. Imidazolinone-tolerant crops have been commercialized based on these AHAS gene variants. A modified maize EPSPS gene and CP4-EPSPS gene from Agrobacterium sp. have been used to transform plants for target-based tolerance to glyphosate. A gox gene isolated from Ochrobactrum anthropi has also been employed to encode glyphosate oxidoreductase to detoxify glyphosate in plants. Glyphosate-tolerant crops with EPSPS transgene alone or both EPSPS and gox transgenes have been commercialized. Similarly, bar and pat genes isolated from Streptomyces hygroscopicus and S. viridochromogenes, respectively, have been inserted into plants to encode phosphinothricin N-acetyltransferase to detoxify glufosinate. Glufosinate-tolerant crops have been commercialized using one of these two transgenes. PMID:16547651

  15. Combination of Recombinant Adenovirus-p53 with Radiochemotherapy in Unresectable Pancreatic Carcinoma

    PubMed Central

    Li, Jin-luan; Cai, Yong; Zhang, Shan-wen; Xiao, Shao-wen; Li, Xiao-fan; Duan, You-jia; Li, Yong-heng; Xu, Bo; Yan, Kun

    2011-01-01

    Objective To assess the safety and efficacy of the combination of recombinant adenovirus-p53 (rAd-p53) with radiochemotherapy for treating unresectable pancreatic carcinoma. Methods The eligible patients received concurrent rAd-p53 intratumoral injection and radiochemotherapy. Intratumoral injection of rAd-p53 was guided by B ultrasound. Radiochemotherapy consisted of intensity-modulated radiotherapy (IMRT) at two dose levels and intravenous gemcitabine (Gem). For radiotherapy, gross target volume (GTV) and clinical target volume (CTV) were 55-60 Gy and 45-55 Gy in 25-30 fractions, respectively. Concurrent intravenous gemcitabine was administered at 350 mg/m2, weekly, for 6 weeks. The primary end points included toxicity, clinical benefit response (CBR) and disease control rate (DCR). The secondary end points included progression-free survival (PFS) and overall survival (OS). Results Fifteen eligible patients were enrolled. Eight patients (53.3%) were evaluated as CBR and 12 (80%) achieved DCR. The median PFS and OS were 6.7 and 13.8 months, respectively. One-year PFS and OS were 40.0% and 51.1%, respectively. There were 8 (53.3%) patients reported grade 3 toxicities including neutropenia (6 patients, 40%), fever (1 patient, 6.7%) and fatigue (1 patient, 6.7%). There was no grade 4 toxicity reported. Conclusion Combination of rAd-p53 in unresectable pancreatic carcinoma showed encouraging efficacious benefit and was well tolerated. Long-term follow-up is needed to confirm the improvement of PFS and OS. PMID:23467436

  16. R248Q mutation--Beyond p53-DNA binding.

    PubMed

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. PMID:26442703

  17. Cancer-associated p53 tetramerization domain mutants: quantitative analysis reveals a low threshold for tumor suppressor inactivation

    SciTech Connect

    Kamada, R.; Anderson, C.; Nomura, T.; Sakaguchi, K.

    2011-01-07

    The tumor suppressor p53, a 393-amino acid transcription factor, induces cell cycle arrest and apoptosis in response to genotoxic stress. Its inactivation via the mutation of its gene is a key step in tumor progression, and tetramer formation is critical for p53 post-translational modification and its ability to activate or repress the transcription of target genes vital in inhibiting tumor growth. About 50% of human tumors have TP53 gene mutations; most are missense ones that presumably lower the tumor suppressor activity of p53. In this study, we explored the effects of known tumor-derived missense mutations on the stability and oligomeric structure of p53; our comprehensive, quantitative analyses encompassed the tetramerization domain peptides representing 49 such substitutions in humans. Their effects on tetrameric structure were broad, and the stability of the mutant peptides varied widely ({Delta}T{sub m} = 4.8 {approx} -46.8 C). Because formation of a tetrameric structure is critical for protein-protein interactions, DNA binding, and the post-translational modification of p53, a small destabilization of the tetrameric structure could result in dysfunction of tumor suppressor activity. We suggest that the threshold for loss of tumor suppressor activity in terms of the disruption of the tetrameric structure of p53 could be extremely low. However, other properties of the tetramerization domain, such as electrostatic surface potential and its ability to bind partner proteins, also may be important.

  18. The 9aaTAD Transactivation Domains: From Gal4 to p53.

    PubMed

    Piskacek, Martin; Havelka, Marek; Rezacova, Martina; Knight, Andrea

    2016-01-01

    The family of the Nine amino acid Transactivation Domain, 9aaTAD family, comprises currently over 40 members. The 9aaTAD domains are universally recognized by the transcriptional machinery from yeast to man. We had identified the 9aaTAD domains in the p53, Msn2, Pdr1 and B42 activators by our prediction algorithm. In this study, their competence to activate transcription as small peptides was proven. Not surprisingly, we elicited immense 9aaTAD divergence in hundreds of identified orthologs and numerous examples of the 9aaTAD species' convergence. We found unforeseen similarity of the mammalian p53 with yeast Gal4 9aaTAD domains. Furthermore, we identified artificial 9aaTAD domains generated accidentally by others. From an evolutionary perspective, the observed easiness to generate 9aaTAD transactivation domains indicates the natural advantage for spontaneous generation of transcription factors from DNA binding precursors. PMID:27618436

  19. Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response.

    PubMed

    Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

    2014-09-01

    In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

  20. FAK and p53 Synergistically Decrease Neuroblastoma Cell Survival

    PubMed Central

    Gillory, Lauren A.; Stewart, Jerry E.; Megison, Michael L.; Waters, Alicia M.; Beierle, Elizabeth A.

    2015-01-01

    Neuroblastoma is the most common extracranial solid tumor of childhood and is responsible for over 15% of pediatric cancer deaths. Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase that is important in many facets of neuroblastoma tumor development and progression. The p53 oncogene, although wild type in most neuroblastomas, lacks significant function as a tumor suppressor in these tumors. Recent reports have found that FAK and p53 interact in some tumor types. We have hypothesized FAK and p53 coordinately control each other’s expression and also interact in neuroblastoma. In the current study, we showed that not only do FAK and p53 interact but each one controls the expression of the other. In addition, we also examined the effects of FAK inhibition combined with p53 activation in neuroblastoma and showed that these two, in combination, had a synergistic effect upon neuroblastoma cell survival. The findings from this current study help to further our understanding of the regulation of neuroblastoma tumorigenesis, and may provide novel therapeutic strategies and targets for neuroblastoma and other pediatric solid tumors. PMID:25862488

  1. The evolution of thymic lymphomas in p53 knockout mice.

    PubMed

    Dudgeon, Crissy; Chan, Chang; Kang, Wenfeng; Sun, Yvonne; Emerson, Ryan; Robins, Harlan; Levine, Arnold J

    2014-12-01

    Germline deletion of the p53 gene in mice gives rise to spontaneous thymic (T-cell) lymphomas. In this study, the p53 knockout mouse was employed as a model to study the mutational evolution of tumorigenesis. The clonality of the T-cell repertoire from p53 knockout and wild-type thymic cells was analyzed at various ages employing TCRβ sequencing. These data demonstrate that p53 knockout thymic lymphomas arose in an oligoclonal fashion, with tumors evolving dominant clones over time. Exon sequencing of tumor DNA revealed that all of the independently derived oligoclonal mouse tumors had a deletion in the Pten gene prior to the formation of the TCRβ rearrangement, produced early in development. This was followed in each independent clone of the thymic lymphoma by the amplification or overexpression of cyclin Ds and Cdk6. Alterations in the expression of Ikaros were common and blocked further development of CD-4/CD-8 T cells. While the frequency of point mutations in the genome of these lymphomas was one per megabase, there were a tremendous number of copy number variations producing the tumors' driver mutations. The initial inherited loss of p53 functions appeared to delineate an order of genetic alterations selected for during the evolution of these thymic lymphomas. PMID:25452272

  2. p53 Prevents Entry into Mitosis with Uncapped Telomeres

    PubMed Central

    Thanasoula, Maria; Escandell, Jose Miguel; Martinez, Paula; Badie, Sophie; Muñoz, Purificacion; Blasco, María A.; Tarsounas, Madalena

    2016-01-01

    Summary Telomeres are protected by capping structures consisting of core protein complexes that bind with sequence specificity to telomeric DNA (reviewed in [1]). In their absence, telomeres trigger a DNA damage response, materialized in accumulation at the telomere of damage response proteins, e.g., phosphorylated histone H2AX (γH2AX), into telomere-dysfunction-induced foci [2, 3]. Telomere uncapping occurs transiently in every cell cycle in G2 [4], following DNA replication, but little is known about how protective structures are reassembled or whether this process is controlled by the cell-cycle surveillance machinery. Here, we report that telomere capping is monitored at the G2/M transition by the p53/p21 damage response pathway. Unlike their wild-type counterparts, human and mouse cells lacking p53 or p21 progress into mitosis prematurely with persisting uncapped telomeres. Furthermore, artificially uncapped telomeres delay mitotic entry in a p53- and p21-dependent manner. Uncapped telomeres that persist in mitotic p53-deficient cells are shorter than average and religate to generate end-to-end fusions. These results suggest that a p53-dependent pathway monitors telomere capping after DNA replication and delays G2/M progression in the presence of unprotected telomeres. This mechanism maintains a cell-cycle stage conducive for capping reactions and prevents progression into stages during which uncapped telomeres are prone to deleterious end fusions. PMID:20226664

  3. The expanding regulatory universe of p53 in gastrointestinal cancer

    PubMed Central

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  4. The impact of p53 loss on murine plasmacytoma development.

    PubMed

    Mai, Sabine; Wiener, Francis

    2002-01-01

    Mouse plasmacytomas (PCTs) are characterized by c-myc-activating translocations that juxtapose c-myc on chromosome 15 onto one of the immunoglobulin loci (IgH on chromosome 12, IgK on chromosome 6, or IgA on chromosome 16). To assess the impact of p53 loss on PCT genesis, we induced PCTs in p53-deficient BALB/cRb6.15 mouse strains. We show that p53 loss accelerates tumor development and causes a shift in the typical translocation patterns. PCTs that carry variant T(6;15) translocations become as frequent as those with typical T(12;15) translocations (41.66%). In addition, in the absence of p53, the number of translocation-negative PCTs increases from less than 1% to 16.66%. It is noteworthy that neither the shortened latency periods nor the shift in translocation patterns had an impact on the incidence of PCT development. The 42.2% incidence in N3p53-/- mice is similar to the percentages recorded in groups of conventional BALB/cAn mice. The possible mechanisms underlying the accelerated tumorigenesis and the shift in translocation patterns are discussed. PMID:12067213

  5. Chk'ing p53-deficient breast cancers.

    PubMed

    Schoppy, David W; Brown, Eric J

    2012-04-01

    Loss or functional impairment of p53 occurs in many human cancers, and its absence is often associated with a poor response to conventional chemotherapy. Hence, much effort is currently devoted to developing novel treatments for p53-deficient malignancies. One approach is to target pathways that are selectively required for the survival of p53-deficient cancer cells, thus exploiting a synthetic lethal interaction. Previous studies have demonstrated that inhibition of the ataxia telangiectasia and Rad3-related (ATR) and checkpoint kinase 1 (Chk1) pathway in p53-deficient cells can induce such a synthetic lethal outcome. In this issue of the JCI, Ma et al. take these findings a step closer to the clinic by demonstrating that highly specific inhibitors of Chk1 synergize with chemotherapy to stem progression of p53-deficient triple-negative breast cancers in a xenotransplant model of this disease. Together with other recent studies, this report highlights the promise of ATR and Chk1 inhibitors in targeted cancer treatment. PMID:22446183

  6. Sequence-dependent sliding kinetics of p53

    NASA Astrophysics Data System (ADS)

    Leith, Jason; Tafvizi, Anahita; Huang, Fang; Uspal, William; Doyle, Patrick; Fersht, Alan; Mirny, Leonid; van Oijen, Antoine

    2012-02-01

    Theoretical work has long proposed that one-dimensional sliding along DNA while simultaneously reading its sequence can accelerate transcription factors' (TFs) search for their target sites. More recently, functional sliding has been shown to require TFs to possess at least two DNA-binding modes. The tumor suppressor p53 has been directly observed to slide on DNA, and structural and single-molecule studies have provided evidence for a two-mode model for the protein. If the model is in fact applicable to p53, then the requirement that TFs read while they slide implies that p53's mobility on DNA should be affected by non-cognate sites and thus that its diffusivity should be generally sequence-dependent. Here we confirm this prediction with single-molecule microscopy measurements of p53's local diffusivity on non-cognate DNA. We show how a two-mode model accurately predicts the variation in local diffusivity while a single-mode model does not. Our work provides evidence that p53's sliding is indeed functional and suggests that the timing and efficiency of its activating and repressing transcription can depend on its non-cognate binding properties and its ability to change between multiple modes of binding, in addition to the much better-studied effects of cognate-site binding.

  7. Enhanced radiosensitization of p53 mutant cells by oleamide

    SciTech Connect

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil . E-mail: yslee@kcch.re.kr

    2006-04-01

    Purpose: Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. Methods and Materials: NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Results: Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Conclusions: Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  8. Amino acid mixture acutely improves the glucose tolerance of healthy overweight adults.

    PubMed

    Wang, Bei; Kammer, Lynne M; Ding, Zhenping; Lassiter, David G; Hwang, Jungyun; Nelson, Jeffrey L; Ivy, John L

    2012-01-01

    Certain amino acids have been reported to influence carbohydrate metabolism and blood glucose clearance, as well as improve the glucose tolerance in animal models. We hypothesized that an amino acid mixture consisting of isoleucine and 4 additional amino acids would improve the glucose response of healthy overweight men and women to an oral glucose tolerance test (OGTT). Twenty-two overweight healthy subjects completed 2 OGTTs after consuming 2 different test beverages. The amino acid mixture beverage (CHO/AA) consisted of 0.088 g cystine 2HCl, 0.043 g methionine, 0.086 g valine, 12.094 g isoleucine, 0.084 g leucine, and 100 g dextrose. The control beverage (CHO) consisted of 100 g dextrose only. Venous blood samples were drawn 10 minutes before the start of ingesting the drinks and 15, 30, 60, 120, and 180 minutes after the completion of the drinks. During the OGTT, the plasma glucose response for the CHO/AA treatment was significantly lower than that of the CHO treatment (P < .01), as was the plasma glucose area under the curve (CHO/AA 806 ± 31 mmol/L·3 hours vs CHO 942 ± 40 mmol/L·3 hours). Differences in plasma glucose between treatments occurred at 30, 60, 120, and 180 minutes after supplement ingestion. Plasma glucagon during the CHO/AA treatment was significantly higher than during the CHO treatment. However, there were no significant differences in plasma insulin or C-peptide responses between treatments. These results suggest that the amino acid mixture lowers the glucose response to an OGTT in healthy overweight subjects in an insulin-independent manner. PMID:22260861

  9. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    SciTech Connect

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  10. NRF2 and p53: Januses in cancer?

    PubMed Central

    Rotblat, Barak; Melino, Gerry; Knight, Richard A.

    2012-01-01

    The transcription factor nuclear factor (erythroid-derived 2)-like 2, also known as NFE2L2 or NRF2, is a master regulator of the anti-oxidative stress response and positively controls the expression of a battery of anti-oxidative stress response proteins and enzymes implicated in detoxification and glutathione generation. Although its detoxifying activity is important in cancer prevention, it has recently been shown that cancer cells also exploit its protective functions to thrive and resist chemotherapy. NRF2 was also shown to the pentose phosphate pathway and glutaminolysis, which promotes purine synthesis for supporting rapid proliferation and glutathione for providing anti-oxidative stress protection. Evidence obtained from cancer patients and cell lines suggest that NRF2 is highly active in a variety of human cancers and is associated with aggressiveness. p53 is a tumor suppressor that also promotes an anti-oxidative stress metabolic program and glutaminolysis. Here we will discuss the similarities between NRF2 and p53 and review evidence that p53 might be exploited by cancer cells to gain protection against oxidative stress, as is the case for NRF2. We discuss findings of co-regulation between these transcription factors and propose possible therapeutic strategies that can be used for treatment of cancers that harbor WT p53 and express high levels of NRF2. PMID:23174755

  11. p53 at the crossroads between cancer and neurodegeneration.

    PubMed

    Lanni, Cristina; Racchi, Marco; Memo, Maurizio; Govoni, Stefano; Uberti, Daniela

    2012-05-01

    Aging, dementia, and cancer share a critical set of altered cellular functions in response to DNA damage, genotoxic stress, and other insults. Recent data suggest that the molecular machinery involved in maintaining neural function in neurodegenerative disease may be shared with oncogenic pathways. Cancer and neurodegenerative diseases may be influenced by common signaling pathways regulating the balance of cell survival versus death, a decision often governed by checkpoint proteins. This paper focuses on one such protein, p53, which represents one of the most extensively studied proteins because of its role in cancer prevention and which, furthermore, has been recently shown to be involved in aging and Alzheimer disease (AD). The contribution of a conformational change in p53 to aging and neurodegenerative processes has yet to be elucidated. In this review we discuss the multiple functions of p53 and how these correlate between cancer and neurodegeneration, focusing on various factors that may have a role in regulating p53 activity. The observation that aging and AD interfere with proteins controlling duplication and cell cycle may lead to the speculation that, in senescent neurons, aberrations in proteins generally dealing with cell cycle control and apoptosis could affect neuronal plasticity and functioning rather than cell duplication. PMID:22387179

  12. P53 expression in invasive pancreatic adenocarcinoma and precursor lesions.

    PubMed

    Norfadzilah, M Y; Pailoor, Jayalakshmi; Retneswari, M; Chinna, K; Noor, Laili M M

    2011-12-01

    Patients with pancreatic adenocarcinoma are known to have a high mortality rate. The 5-year survival rate still remains low even now compared to that of the 1960's despite new advances in management including surgery, chemotherapy, pathological classification and molecular diagnostic technologies. Precursors to invasive pancreatic adenocarcinoma have been identified in the last ten years that include mucinous cystic neoplasm, intraductal papillary mucinous neoplasm and pancreatic intraepithelial neoplasia. p53 protein accumulation in the nuclei is a common molecular event in most human neoplasms. Our objective is to investigate p53 expression in pancreatic adenocarcinoma and precursor lesions and their significance. The selected study material encompassed 31 invasive ductal adenocarcinoma, 15 mucinous cystic neoplasm and papillary mucinous neoplasm, and 27 cases of pancreatic intraepithelial neoplasia including grade 1, 2 and 3. Immunoscore was given for each case based on intensity of staining and percentage of cells positive and compared between precursor lesions and invasive adenocarcinoma. A score of 50 and above was considered significant. The results showed that p53 expression increased progressively and significantly with the grade of pancreatic intraepithelial neoplasia and adenocarcinoma (p-value < 0.001). These findings support the concept of multistep carcinogenesis in pancreatic adenocarcinoma and suggest that p53 inactivation occurs in the progression of precursors to pancreatic adenocarcinoma. PMID:22299208

  13. Immunohistochemical detection of P53 and Mdm2 in vitiligo

    PubMed Central

    Bakry, Ola A.; Hammam, Mostafa A.; Wahed, Moshira M. Abdel

    2012-01-01

    Background: Vitiligo is a common depigmented skin disorder that is caused by selective destruction of melanocytes. It is generally accepted that the main function of melanin resides in the protection of skin cells against the deleterious effect of ultraviolet rays (UVRs). Association of vitiligo and skin cancer has been a subject of controversy. Occurrence of skin cancer in long-lasting vitiligo is rare despite multiple evidences of DNA damage in vitiliginous skin. Aim: To detect the expression of P53 and Mdm2 proteins in both depigmented and normally pigmented skin of vitiligo patients and to compare it to control subjects suffering from nonmelanoma skin cancer (NMSC). Materials and Methods: Thirty-four patients with vitiligo and 30 age and sex-matched patients with nodulo-ulcerative basal cell carcinoma (BCC) as a control group were selected. Both patients and control subjects had outdoor occupations. Skin biopsies were taken from each case and control subjects. Histopathological examination of Hematoxylin and eosin-stained sections was done. Expression of P53 and Mdm2 proteins were examined immunohistochemically. Results: Both P53 and Mdm2 were strongly expressed in depigmented as well as normally pigmented skin of vitiligo patients. This expression involved the epidermis, skin adnexa and blood vessels with significant differences between cases and controls. Conclusions: The overexpression of P53 and Mdm2 proteins in both normally pigmented and depigmented skin of patients with vitiligo could contribute to the decreased occurrence of actinic damage and NMSC in these patients. PMID:23189248

  14. A role for p53 in selenium-induced senescence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The tumor suppressor p53 and the ataxia-telangiectasia mutated (ATM) kinase play important roles in the senescence response to oncogene activation and DNA damage. We have previously shown that selenium-containing compounds can activate an ATM-dependent senescence response in MRC-5 normal fibroblasts...

  15. From Sea Anemone to Homo Sapiens: The Evolution of the p53 Family of Genes

    SciTech Connect

    Levine, Arnold

    2009-09-14

    The human genome contains three transcription factors termed p53, p63 and p73 which are related orthologues. The function of the p53 protein is to respond to a wide variety of stresses which can disrupt the fidelity of DNA replication and cell division in somatic cells of the body. These stress signals, such as DNA damage, increase the mutation rate during DNA duplication and so an active p53 protein responds by eliminating clones of cells with mutations employing apoptosis, senescence or cell cycle arrest. In this way the p53 protein acts as a tumor suppressor preventing the mutations that can lead to cancers. The p63 and p73 proteins act in a similar fashion to protect the germ line cells in females (eggs). In addition the p63 protein plays a central role in the formation of epithelial cell layers and p73 plays a critical role in the formation of several structures in the central nervous system. Based upon their amino acid sequences and structural considerations the oldest organisms that contain an ancestor of the p53/p63/p73 gene are the sea anemone or hydra. The present day representatives of these animals contain a p63/p73 like ancestor gene and the protein functions in germ cells of this animal to enforce the fidelity of DNA replication after exposure to ultraviolet light. Thus the structure and functions of this gene family have been preserved for over one billion years of evolution. Other invertebrates such as the worm, the fly and the clam contain a very similar ancestor gene with a similar set of functions. The withdrawal of a food source from a worm results in the p63/p73 mediated apoptosis of the eggs so that new organisms will not be hatched into a poor environment. A similar response is thought to occur in humans. Thus this ancestor gene ensures the fidelity of the next generation of organisms. The first time a clearly distinct new p53 gene arises is in the cartilaginous fish and in the bony fish a separation of the p

  16. From Sea Anemone to Homo sapiens: The Evolution of the p53 Family of Genes

    SciTech Connect

    Levine, Arnold

    2009-09-14

    The human genome contains three transcription factors termed p53, p63 and p73 which are related orthologues. The function of the p53 protein is to respond to a wide variety of stresses which can disrupt the fidelity of DNA replication and cell division in somatic cells of the body. These stress signals, such as DNA damage, increase the mutation rate during DNA duplication and so an active p53 protein responds by eliminating clones of cells with mutations employing apoptosis, senescence or cell cycle arrest. In this way the p53 protein acts as a tumor suppressor preventing the mutations that can lead to cancers. The p63 and p73 proteins act in a similar fashion to protect the germ line cells in females (eggs). In addition the p63 protein plays a central role in the formation of epithelial cell layers and p73 plays a critical role in the formation of several structures in the central nervous system. Based upon their amino acid sequences and structural considerations the oldest organisms that contain an ancestor of the p53/p63/p73 gene are the sea anemone or hydra. The present day representatives of these animals contain a p63/p73 like ancestor gene and the protein functions in germ cells of this animal to enforce the fidelity of DNA replication after exposure to ultraviolet light. Thus the structure and functions of this gene family have been preserved for over one billion years of evolution. Other invertebrates such as the worm, the fly and the clam contain a very similar ancestor gene with a similar set of functions. The withdrawal of a food source from a worm results in the p63/p73 mediated apoptosis of the eggs so that new organisms will not be hatched into a poor environment. A similar response is thought to occur in humans. Thus this ancestor gene ensures the fidelity of the next generation of organisms. The first time a clearly distinct new p53 gene arises is in the cartilaginous fish and in the bony fish a separation of the p

  17. p53 and Translation Attenuation Regulate Distinct Cell Cycle Checkpoints during Endoplasmic Reticulum (ER) Stress*

    PubMed Central

    Thomas, Sally E.; Malzer, Elke; Ordóñez, Adriana; Dalton, Lucy E.; van ′t Wout, Emily F. A.; Liniker, Elizabeth; Crowther, Damian C.; Lomas, David A.; Marciniak, Stefan J.

    2013-01-01

    Cell cycle checkpoints ensure that proliferation occurs only under permissive conditions, but their role in linking nutrient availability to cell division is incompletely understood. Protein folding within the endoplasmic reticulum (ER) is exquisitely sensitive to energy supply and amino acid sources because deficiencies impair luminal protein folding and consequently trigger ER stress signaling. Following ER stress, many cell types arrest within the G1 phase, although recent studies have identified a novel ER stress G2 checkpoint. Here, we report that ER stress affects cell cycle progression via two classes of signal: an early inhibition of protein synthesis leading to G2 delay involving CHK1 and a later induction of G1 arrest associated both with the induction of p53 target genes and loss of cyclin D1. We show that substitution of p53/47 for p53 impairs the ER stress G1 checkpoint, attenuates the recovery of protein translation, and impairs induction of NOXA, a mediator of cell death. We propose that cell cycle regulation in response to ER stress comprises redundant pathways invoked sequentially first to impair G2 progression prior to ultimate G1 arrest. PMID:23341460

  18. p53 mutations and overexpression in locally advanced breast cancers.

    PubMed Central

    Faille, A.; De Cremoux, P.; Extra, J. M.; Linares, G.; Espie, M.; Bourstyn, E.; De Rocquancourt, A.; Giacchetti, S.; Marty, M.; Calvo, F.

    1994-01-01

    Alterations in the p53 gene were analysed in 39 patients with locally advanced breast cancers (LABCs) (stage III-IV) with inflammatory signs in most cases (UICC stage T4d = 32 patients) by molecular and immunohistochemical (IHC) approaches. All patients were included in the same therapy protocol. Using polymerase chain reaction (PCR) and a single-strand conformational polymorphism migration technique (SSCP), the presence of mutations in exons 2-11, covering the entire coding sequence of the p53 gene, was evaluated. Using the mouse specific anti-human p53 monoclonal antibody (PAb 1801), we also looked for overexpression of the p53 protein in tissue sections. In 16 cases shifted bands were reproducibly identified by PCR-SSCP, and all but one (localised to exon 10) were in exons 5-8, the usual mutational hotspots. Fifteen of these 16 samples were sequenced and 14 of the suspected mutations (36%) were confirmed. Most of them (12) were single nucleotide substitutions, and transitions were more frequent (eight cases) than transversions (four cases). Fourteen of the tumour samples were positively stained with the monoclonal antibody PAb 1801, 11 with nuclear staining only, two with mixed cytoplasmic and nuclear staining and one with cytoplasmic staining only. Staining patterns were very heterogeneous in terms of the percentage of positive cells (10-75%) and their distribution in the tissue section (isolated foci or dispersed cells). In 11 of the 14 mutated cases a positive immunostaining was observed. The presence of a p53 mutation was significantly associated with larger tumour diameter (chi 2 = 7.490, P = 0.0062) and the presence of clinical metastases (stage IV) (chi 2 = 10.113, P = 0.0015). A non-statistically significant trend of association was observed between p53 mutation, negative oestrogen receptors and lower response rate to therapy. Our results in this group of patients and the heterogeneity of the staining of tumour cells in tissue sections suggest that p53

  19. p53 and TFIIEα share a common binding site on the Tfb1/p62 subunit of TFIIH

    PubMed Central

    Di Lello, Paola; Miller Jenkins, Lisa M.; Mas, Caroline; Langlois, Chantal; Malitskaya, Elena; Fradet-Turcotte, Amélie; Archambault, Jacques; Legault, Pascale; Omichinski, James G.

    2008-01-01

    The general transcription factor IIH is recruited to the transcription preinitiation complex through an interaction between its p62/Tfb1 subunit and the α-subunit of the general transcription factor IIE (TFIIEα). We have determined that the acidic carboxyl terminus of TFIIEα (TFIIEα336–439) directly binds the amino-terminal PH domain of p62/Tfb1 with nanomolar affinity. NMR mapping and mutagenesis studies demonstrate that the TFIIEα binding site on p62/Tfb1 is identical to the binding site for the second transactivation domain of p53 (p53 TAD2). In addition, we demonstrate that TFIIEα336–439 is capable of competing with p53 for a common binding site on p62/Tfb1 and that TFIIEα336–439 and the diphosphorylated form (pS46/pT55) of p53 TAD2 have similar binding constants. NMR structural studies reveal that TFIIEα336–439 contains a small domain (residues 395–433) folded in a novel ββααα topology. NMR mapping studies demonstrate that two unstructured regions (residues 377–393 and residues 433–439) located on either side of the folded domain appear to be required for TFIIEα336–439 binding to p62/Tfb1 and that these two unstructured regions are held close to each other in three-dimensional space by the novel structured domain. We also demonstrate that, like p53, TFIIEα336–439 can activate transcription in vivo. These results point to an important interplay between the general transcription factor TFIIEα and the tumor suppressor protein p53 in regulating transcriptional activation that may be modulated by the phosphorylation status of p53. PMID:18160537

  20. p53 and TFIIEalpha share a common binding site on the Tfb1/p62 subunit of TFIIH.

    PubMed

    Di Lello, Paola; Miller Jenkins, Lisa M; Mas, Caroline; Langlois, Chantal; Malitskaya, Elena; Fradet-Turcotte, Amélie; Archambault, Jacques; Legault, Pascale; Omichinski, James G

    2008-01-01

    The general transcription factor IIH is recruited to the transcription preinitiation complex through an interaction between its p62/Tfb1 subunit and the alpha-subunit of the general transcription factor IIE (TFIIEalpha). We have determined that the acidic carboxyl terminus of TFIIEalpha (TFIIEalpha(336-439)) directly binds the amino-terminal PH domain of p62/Tfb1 with nanomolar affinity. NMR mapping and mutagenesis studies demonstrate that the TFIIEalpha binding site on p62/Tfb1 is identical to the binding site for the second transactivation domain of p53 (p53 TAD2). In addition, we demonstrate that TFIIEalpha(336-439) is capable of competing with p53 for a common binding site on p62/Tfb1 and that TFIIEalpha(336-439) and the diphosphorylated form (pS46/pT55) of p53 TAD2 have similar binding constants. NMR structural studies reveal that TFIIEalpha(336-439) contains a small domain (residues 395-433) folded in a novel betabetaalphaalphaalpha topology. NMR mapping studies demonstrate that two unstructured regions (residues 377-393 and residues 433-439) located on either side of the folded domain appear to be required for TFIIEalpha(336-439) binding to p62/Tfb1 and that these two unstructured regions are held close to each other in three-dimensional space by the novel structured domain. We also demonstrate that, like p53, TFIIEalpha(336-439) can activate transcription in vivo. These results point to an important interplay between the general transcription factor TFIIEalpha and the tumor suppressor protein p53 in regulating transcriptional activation that may be modulated by the phosphorylation status of p53. PMID:18160537

  1. IKK is a therapeutic target in KRAS-Induced lung cancer with disrupted p53 activity

    PubMed Central

    Bassères, Daniela S.; Ebbs, Aaron; Cogswell, Patricia C.; Baldwin, Albert S.

    2014-01-01

    Activating mutations in KRAS are prevalent in cancer, but therapies targeted to oncogenic RAS have been ineffective to date. These results argue that targeting downstream effectors of RAS will be an alternative route for blocking RAS-driven oncogenic pathways. We and others have shown that oncogenic RAS activates the NF-κB transcription factor pathway and that KRAS-induced lung tumorigenesis is suppressed by expression of a degradation-resistant form of the IκBα inhibitor or by genetic deletion of IKKβ or the RELA/p65 subunit of NF-κB. Here, genetic and pharmacological approaches were utilized to inactivate IKK in human primary lung epithelial cells transformed by KRAS, as well as KRAS mutant lung cancer cell lines. Administration of the highly specific IKKβ inhibitor Compound A (CmpdA) led to NF-κB inhibition in different KRAS mutant lung cells and siRNA-mediated knockdown of IKKα or IKKβ reduced activity of the NF-κB canonical pathway. Next, we determined that both IKKα and IKKβ contribute to oncogenic properties of KRAS mutant lung cells, particularly when p53 activity is disrupted. Based on these results, CmpdA was tested for potential therapeutic intervention in the Kras-induced lung cancer mouse model (LSL-KrasG12D) combined with loss of p53 (LSL-KrasG12D/p53fl/fl). CmpdA treatment was well tolerated and mice treated with this IKKβ inhibitor presented smaller and lower grade tumors than mice treated with placebo. Additionally, IKKβ inhibition reduced inflammation and angiogenesis. These results support the concept of targeting IKK as a therapeutic approach for oncogenic RAS-driven tumors with altered p53 activity. PMID:24955217

  2. Depression of p53-independent Akt survival signals after high-LET radiation in mutated p53 cells

    NASA Astrophysics Data System (ADS)

    Ohnishi, Takeo; Takahashi, Akihisa; Nakagawa, Yosuke

    Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses the activities of serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signals were analyzed with Western blotting analysis 1 h, 2 h, 3 h and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis.Akt-related protein levels were decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G _{2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and depresses cell growth by suppressing Akt-related signals, even in the mp53 cells.

  3. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype

    PubMed Central

    Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

    2015-01-01

    Background A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. Methods The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. Results p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. Conclusion In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways. PMID:26447864

  4. Stabilization of p53 in Influenza A Virus-infected Cells Is Associated with Compromised MDM2-mediated Ubiquitination of p53*

    PubMed Central

    Wang, Xiaodu; Deng, Xufang; Yan, Wenjun; Zhu, Zixiang; Shen, Yang; Qiu, Yafeng; Shi, Zixue; Shao, Donghua; Wei, Jianchao; Xia, Xianzhu; Ma, Zhiyong

    2012-01-01

    Influenza A virus (IAV) induces apoptosis of infected cells. In response to IAV infection, p53, a tumor suppressor involved in regulating apoptosis and host antiviral defense, accumulates and becomes activated. This study was undertaken to examine the mechanism of p53 accumulation in IAV-infected cells. Here we show that p53 accumulation in IAV-infected cells results from protein stabilization, which was associated with compromised Mdm2-mediated ubiquitination of p53. In IAV-infected cells, p53 was stabilized and its half-life was remarkably extended. The ladders of polyubiquitinated p53 were not detectable in the presence of the proteasome inhibitor MG132 and were less sensitive to proteasome-mediated degradation. IAV infection did not affect the abundance of Mdm2, a major ubiquitin E3 ligase responsible for regulating p53 ubiquitination and degradation, but weakened the interaction between p53 and Mdm2. Viral nucleoprotein (NP) was able to increase the transcriptional activity and stability of p53. Furthermore, NP was found to associate with p53 and to impair the p53-Mdm2 interaction and Mdm2-mediated p53 ubiquitination, demonstrating its role in inhibiting Mdm2-mediated p53 ubiquitination and degradation. PMID:22474335

  5. Deregulation of Internal Ribosome Entry Site-Mediated p53 Translation in Cancer Cells with Defective p53 Response to DNA Damage

    PubMed Central

    Halaby, Marie-Jo; Harris, Benjamin R. E.; Miskimins, W. Keith; Cleary, Margot P.

    2015-01-01

    Synthesis of the p53 tumor suppressor and its subsequent activation following DNA damage are critical for its protection against tumorigenesis. We previously discovered an internal ribosome entry site (IRES) at the 5′ untranslated region of the p53 mRNA. However, the connection between IRES-mediated p53 translation and p53's tumor suppressive function is unknown. In this study, we identified two p53 IRES trans-acting factors, translational control protein 80 (TCP80), and RNA helicase A (RHA), which positively regulate p53 IRES activity. Overexpression of TCP80 and RHA also leads to increased expression and synthesis of p53. Furthermore, we discovered two breast cancer cell lines that retain wild-type p53 but exhibit defective p53 induction and synthesis following DNA damage. The levels of TCP80 and RHA are extremely low in both cell lines, and expression of both proteins is required to significantly increase the p53 IRES activity in these cells. Moreover, we found cancer cells transfected with a shRNA against TCP80 not only exhibit decreased expression of TCP80 and RHA but also display defective p53 induction and diminished ability to induce senescence following DNA damage. Therefore, our findings reveal a novel mechanism of p53 inactivation that links deregulation of IRES-mediated p53 translation with tumorigenesis. PMID:26391949

  6. Reactivating p53 functions by suppressing its novel inhibitor iASPP: a potential therapeutic opportunity in p53 wild-type tumors

    PubMed Central

    Dong, Peixin; Ihira, Kei; Hamada, Junichi; Watari, Hidemichi; Yamada, Takahiro; Hosaka, Masayoshi; Hanley, Sharon J.B.; Kudo, Masataka; Sakuragi, Noriaki

    2015-01-01

    Although mutational inactivation of p53 is found in 50% of all human tumors, a subset of tumors display defective p53 function, but retain wild-type (WT) p53. Here, direct and indirect mechanisms leading to the loss of WT p53 activities are discussed. We summarize the oncogenic roles of iASPP, an inhibitor of WT p53, in promoting proliferation, invasion, drug or radiation-resistance and metastasis. From the therapeutic view, we highlight promising perspectives of microRNA-124, peptide and small molecules that reduce or block iASPP for the treatment of cancer. High iASPP expression enhances proliferation, aggressive behavior, the resistance to radiation/chemotherapy and correlates with poor prognosis in a range of human tumors. Overexpression of iASPP accelerates tumorigenesis and invasion through p53-dependent and p53-independent mechanisms. MicroRNA-124 directly targets iASPP and represses the growth and invasiveness of cancer cells. The disruption of iASPP-p53 interaction by a p53-derived peptide A34 restores p53 function in cancer cells. The inhibition of iASPP phosphorylation with small molecules induces p53-dependent apoptosis and growth suppression. The mechanisms underlying aberrant expression of iASPP in human tumors should be further investigated. Reactivating WT p53 functions by targeting its novel inhibitor iASPP holds promise for potential therapeutic interventions in the treatment of WT p53-containing tumors. PMID:26343523

  7. Small-Molecule NSC59984 Restores p53 Pathway Signaling and Antitumor Effects against Colorectal Cancer via p73 Activation and Degradation of Mutant p53.

    PubMed

    Zhang, Shengliang; Zhou, Lanlan; Hong, Bo; van den Heuvel, A Pieter J; Prabhu, Varun V; Warfel, Noel A; Kline, Christina Leah B; Dicker, David T; Kopelovich, Levy; El-Deiry, Wafik S

    2015-09-15

    The tumor-suppressor p53 prevents cancer development via initiating cell-cycle arrest, cell death, repair, or antiangiogenesis processes. Over 50% of human cancers harbor cancer-causing mutant p53. p53 mutations not only abrogate its tumor-suppressor function, but also endow mutant p53 with a gain of function (GOF), creating a proto-oncogene that contributes to tumorigenesis, tumor progression, and chemo- or radiotherapy resistance. Thus, targeting mutant p53 to restore a wild-type p53 signaling pathway provides an attractive strategy for cancer therapy. We demonstrate that small-molecule NSC59984 not only restores wild-type p53 signaling, but also depletes mutant p53 GOF. NSC59984 induces mutant p53 protein degradation via MDM2 and the ubiquitin-proteasome pathway. NSC59984 restores wild-type p53 signaling via p73 activation, specifically in mutant p53-expressing colorectal cancer cells. At therapeutic doses, NSC59984 induces p73-dependent cell death in cancer cells with minimal genotoxicity and without evident toxicity toward normal cells. NSC59984 synergizes with CPT11 to induce cell death in mutant p53-expressing colorectal cancer cells and inhibits mutant p53-associated colon tumor xenograft growth in a p73-dependent manner in vivo. We hypothesize that specific targeting of mutant p53 may be essential for anticancer strategies that involve the stimulation of p73 in order to efficiently restore tumor suppression. Taken together, our data identify NSC59984 as a promising lead compound for anticancer therapy that acts by targeting GOF-mutant p53 and stimulates p73 to restore the p53 pathway signaling. PMID:26294215

  8. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    PubMed Central

    2013-01-01

    Background Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. Methods We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. Results By different assays in isogenic HCT116p53+/+ and HCT116 p53-/- cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53+/+ but not in HCT116 p53-/- xenografts in vivo. In addition, R2 sensitized HCT116p53+/+ cells to doxorubicin and 5-fluorouracil. Conclusions Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches. PMID:23841915

  9. Low doses of arsenic, via perturbing p53, promotes tumorigenesis.

    PubMed

    Ganapathy, Suthakar; Li, Ping; Fagman, Johan; Yu, Tianqi; Lafontant, Jean; Zhang, Guojun; Chen, Changyan

    2016-09-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure. PMID:27425828

  10. p53 protects against genome instability following centriole duplication failure

    PubMed Central

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  11. [Quality control of recombinant oncolytic adenovirus/p53].

    PubMed

    Gao, Kai; Bi, Hua; Ding, You-Xue; Li, Yong-Hong; Han, Chun-Mei; Guo, Ying; Rao, Chun-Ming

    2011-12-01

    To establish a detection method of oncolytic adenovirus/p53 and standard of quality control, human telomerase reverse transcriptase (hTERT) promoter, CMV fusion promoter containing hypoxia reaction element (HRE) and p53 gene were identified by vector DNA restriction enzyme digestion and PCR analysis. The result conformed that all modified regions were in consistent with theoretical ones. Particle number was 2.0 x 10(11) mL(-1) determined by UV (A260). Infectious titer was 5.0 x 10(10) IU mL(-1) analyzed by TCID50. In vitro p53 gene expression in human lung cancer cell H1299 was determined by ELISA, and A450 ratio of nucleoprotein in virus infection group to control group was 5.2. Antitumor potency was evaluated by cytotoxicity assay using human lung cancer cell A549, and the MOI(IC50) of this gene therapy preparation was 1.0. The tumor cells targeted replication ability of recombinant virus was determined by TCID50 titer ratio of filial generation virus between human lung cancer cell A549 and human diploid epidermal fibrolast BJ cells after infected by virus with same MOI. TCID50 titer ratio of tumor cell infection group to normal cell infection control group was 398. The IE-HPLC purity of virus was 99.5%. There was less than 1 copy of wild type adenovirus within 1 x 10(7) VP recombinant virus. Other quality control items were complied with corresponding requirements in the guidance for human somatic cell therapy and gene therapy and Chinese pharmacopeia volume III. The detection method of oncolytic adenovirus/p53 was successfully established for quality control standard. The study also provided reference for quality control of other oncolytic viral vector products. PMID:22375422

  12. p53 protein oxidation in cultured cells in response to pyrrolidine dithiocarbamate: a novel method for relating the amount of p53 oxidation in vivo to the regulation of p53-responsive genes.

    PubMed Central

    Wu, H H; Thomas, J A; Momand, J

    2000-01-01

    A novel method was developed to determine the oxidation status of proteins in cultured cells. Methoxy-polyethylene glycol-maleimide MW 2000 (MAL-PEG) was used to covalently tag p53 protein that was oxidized at cysteine residues in cultured cells. Treatment of MCF7 breast cancer cells with pyrrolidine dithiocarbamate (PDTC), a metal chelator, resulted in a minimum of 25% oxidation of p53. The oxidized p53 had an average of one cysteine residue oxidized per p53 protein molecule. The effect of PDTC treatment on downstream components of the p53 signal-transduction pathway was tested. PDTC treatment prevented actinomycin D-mediated up-regulation of two p53 effector gene products, murine double minute clone 2 oncoprotein and p21(WAF1/CIP1) (where WAF1 corresponds to wild-type p53-activated fragment 1 and CIP1 corresponds to cyclin-dependent kinase-interacting protein 1). Actinomycin D treatment led to accumulation of p53 protein in the nucleus. However, when cells were simultaneously treated with PDTC and actinomycin D, p53 accumulated in both the nucleus and the cytoplasm. The data indicate that an average of one cysteine residue per p53 protein molecule is highly sensitive to oxidation and that p53 can be efficiently oxidized by PDTC in cultured cells. PDTC-mediated oxidation of p53 correlates with altered p53 subcellular localization and reduced activation of p53 downstream effector genes. The novel method for detecting protein oxidation detailed in the present study may be used to determine the oxidation status of specific proteins in cells. PMID:10998350

  13. Yin Yang 1 Promotes Thymocyte Survival by Downregulating p53.

    PubMed

    Chen, Liang; Foreman, Daniel P; Sant'Angelo, Derek B; Krangel, Michael S

    2016-03-15

    Yin Yang 1 (YY1) is a zinc finger protein that functions as a transcriptional activator or repressor and participates in multiple biological processes, including development and tumorigenesis. To investigate the role of YY1 in developing T cells, we used mouse models that depleted YY1 at two distinct stages of thymocyte development. When YY1 was depleted in CD4(-)CD8(-) double-negative thymocytes, development to the CD4(+)CD8(+) double-positive stage was impaired, due to increased apoptosis that prevented expansion of post-β-selection thymocytes. When YY1 was depleted in double-positive thymocytes, they underwent increased cell-autonomous apoptosis in vitro and displayed a shorter lifespan in vivo, as judged by their ability to undergo secondary Vα-to-Jα recombination. Mechanistically, we found that the increased apoptosis in YY1-deficient thymocytes was attributed to overexpression of p53, because concurrent loss of p53 completely rescued the developmental defects of YY1-deficient thymocytes. These results indicated that YY1 functions as a critical regulator of thymocyte survival and that it does so by suppressing the expression of p53. PMID:26843327

  14. v-Src Generates a p53-Independent Apoptotic Signal

    PubMed Central

    Webb, Brian L.; Jimenez, Elsa; Martin, G. Steven

    2000-01-01

    Evasion of apoptosis appears to be a necessary event in tumor progression. Some oncogenes, such as c-myc and E1A, induce apoptosis in the absence of survival factors. However, others, such as bcl-2 and v-src, activate antiapoptotic pathways. For v-Src, these antiapoptotic pathways are dependent on the function of Ras, phosphatidylinositol (PI) 3-kinase, and Stat3. Here we asked whether v-Src can activate a proapoptotic signal when survival signaling is inhibited. We show that when the functions of Ras and PI 3-kinase are inhibited, v-src-transformed Rat-2 fibroblasts undergo apoptosis, evidenced by loss of adherence, nuclear fragmentation, and chromosomal DNA degradation. The apoptotic response is dependent on activation of caspase 3. Under similar conditions nontransformed Rat-2 cells undergo considerably lower levels of apoptosis. Apoptosis induced by v-Src is accompanied by a loss of mitochondrial membrane potential and release of cytochrome c and is blocked by overexpression of bcl-2, indicating that it is mediated by the mitochondrial pathway. However apoptosis induced by v-Src is not accompanied by an increase in the level of p53 and is not dependent on p53 function. Thus v-Src generates a p53-independent proapoptotic signal. PMID:11094078

  15. Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction

    EPA Science Inventory

    Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protei...

  16. A SENSITIVE IMMUNOFLUORESCENCE ASSAY FOR DETECTION OF P53 PROTEIN ACCUMULATION IN SPUTUM

    EPA Science Inventory

    p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...

  17. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi

    2015-01-01

    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  18. Limiting the power of p53 through the ubiquitin proteasome pathway

    PubMed Central

    Pant, Vinod

    2014-01-01

    The ubiquitin proteasome pathway is critical in restraining the activities of the p53 tumor suppressor. Numerous E3 and E4 ligases regulate p53 levels. Additionally, deubquitinating enzymes that modify p53 directly or indirectly also impact p53 function. When alterations of these proteins result in increased p53 activity, cells arrest in the cell cycle, senesce, or apoptose. On the other hand, alterations that result in decreased p53 levels yield tumor-prone phenotypes. This review focuses on the physiological relevance of these important regulators of p53 and their therapeutic implications. PMID:25128494

  19. Molecular mechanisms of nutlin-3 involve acetylation of p53, histones and heat shock proteins in acute myeloid leukemia

    PubMed Central

    2014-01-01

    Background The small-molecule MDM2 antagonist nutlin-3 has proved to be an effective p53 activating therapeutic compound in several preclinical cancer models, including acute myeloid leukemia (AML). We and others have previously reported a vigorous acetylation of the p53 protein by nutlin-treatment. In this study we aimed to investigate the functional role of this p53 acetylation in nutlin-sensitivity, and further to explore if nutlin-induced protein acetylation in general could indicate novel targets for the enhancement of nutlin-based therapy. Results Nutlin-3 was found to enhance the acetylation of p53 in the human AML cell line MOLM-13 (wild type TP53) and in TP53 null cells transfected with wild type p53 cDNA. Stable isotope labeling with amino acids in cell culture (SILAC) in combination with immunoprecipitation using an anti-acetyl-lysine antibody and mass spectrometry analysis identified increased levels of acetylated Histone H2B, Hsp27 and Hsp90 in MOLM-13 cells after nutlin-treatment, accompanied by downregulation of total levels of Hsp27 and Hsp90. Intracellular levels of heat shock proteins Hsp27, Hsp40, Hsp60, Hsp70 and Hsp90α were correlated to nutlin-sensitivity for primary AML cells (n = 40), and AML patient samples with low sensitivity to nutlin-3 tended to express higher levels of heat shock proteins than more responsive samples. Combination therapy of nutlin-3 and Hsp90 inhibitor geldanamycin demonstrated synergistic induction of apoptosis in AML cell lines and primary AML cells. Finally, TP53 null cells transfected with a p53 acetylation defective mutant demonstrated decreased heat shock protein acetylation and sensitivity to nutlin-3 compared to wild type p53 expressing cells. Conclusions Altogether, our results demonstrate that nutlin-3 induces acetylation of p53, histones and heat shock proteins, and indicate that p53 acetylation status and the levels of heat shock proteins may participate in modulation of nutlin-3 sensitivity in AML

  20. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide

    SciTech Connect

    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschella, Giuseppe

    2008-04-04

    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53.

  1. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide.

    PubMed

    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschellà, Giuseppe

    2008-04-01

    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53. PMID:18230339

  2. CTLA-4 blockade enhances the therapeutic effect of an attenuated poxvirus vaccine targeting p53 in an established murine tumor model.

    PubMed

    Espenschied, Jonathan; Lamont, Jeffrey; Longmate, Jeff; Pendas, Solange; Wang, Zhongde; Diamond, Don J; Ellenhorn, Joshua D I

    2003-03-15

    p53 is overexpressed by half of all cancers, and is an attractive target for a vaccine approach to immunotherapy. p53 overexpression is frequently the result of point mutations, which leaves the majority of the protein in its wild-type form. Therefore, the majority of p53 sequence is wild type, making it a self-protein for which tolerance plays a role in limiting immune responses. To overcome tolerance to p53, we have expressed wild-type murine p53 in the nonpathogenic attenuated poxvirus, modified vaccinia virus Ankara (recombinant modified vaccinia virus Ankara expressing wild-type murine p53 (rMVAp53)). Mice immunized with rMVAp53 vaccine developed vigorous p53-specific CTL responses. rMVAp53 vaccine was evaluated for its ability to inhibit the outgrowth of the syngeneic murine sarcoma Meth A, which overexpresses mutant p53. Mice were inoculated with a lethal dose (5 x 10(5) cells injected s.c.) of Meth A tumor cells and vaccinated by i.p. injection 3 days later with 5 x 10(7) PFU of rMVAp53. The majority of mice remained tumor free and resistant to rechallenge with Meth A tumor cells. We wished to determine whether rMVAp53 immunization could effect the rejection of an established, palpable Meth A tumor. In subsequent experiments, mice were injected with 10(6) Meth A tumor cells, and treated 6 days later with anti-CTLA-4 Ab (9H10) and rMVAp53. The majority of treated mice had complete tumor regression along with lasting tumor immunity. In vivo Ab depletion confirmed that the antitumor effect was primarily CD8 and to a lesser extent CD4 dependent. These experiments demonstrate the potential of a novel cell-free vaccine targeting p53 in malignancy. PMID:12626601

  3. E3 ubiquitin ligase TRIM32 negatively regulates tumor suppressor p53 to promote tumorigenesis.

    PubMed

    Liu, Ju; Zhang, C; Wang, X L; Ly, P; Belyi, V; Xu-Monette, Z Y; Young, K H; Hu, W; Feng, Z

    2014-11-01

    Tumor suppressor p53 has a key role in maintaining genomic stability and preventing tumorigenesis through its regulation of cellular stress responses, including apoptosis, cell cycle arrest and senescence. To ensure its proper levels and functions in cells, p53 is tightly regulated mainly through post-translational modifications, such as ubiquitination. Here, we identified E3 ubiquitin ligase TRIM32 as a novel p53 target gene and negative regulator to regulate p53-mediated stress responses. In response to stress, such as DNA damage, p53 binds to the p53 responsive element in the promoter of the TRIM32 gene and transcriptionally induces the expression of TRIM32 in cells. In turn, TRIM32 interacts with p53 and promotes p53 degradation through ubiquitination. Thus, TRIM32 negatively regulates p53-mediated apoptosis, cell cycle arrest and senescence in response to stress. TRIM32 is frequently overexpressed in different types of human tumors. TRIM32 overexpression promotes cell oncogenic transformation and tumorigenesis in mice in a largely p53-dependent manner. Taken together, our results demonstrated that as a novel p53 target and a novel negative regulator for p53, TRIM32 has an important role in regulation of p53 and p53-mediated cellular stress responses. Furthermore, our results also revealed that impairing p53 function is a novel mechanism for TRIM32 in tumorigenesis. PMID:25146927

  4. The ribosomal protein S26 regulates p53 activity in response to DNA damage.

    PubMed

    Cui, D; Li, L; Lou, H; Sun, H; Ngai, S-M; Shao, G; Tang, J

    2014-04-24

    Ribosomal proteins have emerged as novel regulators of the Mdm2-p53 feedback loop, especially in the context of ribosomal stress. RPS26 is a recently identified Diamond-Blackfan Anemia-related ribosomal protein and its role in p53 activation has not been previously explored. In this study we found knockdown of RPS26 induced p53 stabilization and activation via a RPL11-dependent mechanism, resulting in p53-dependent cell growth inhibition. Moreover, RPS26 has the ability to interact with Mdm2 and inhibits Mdm2-mediated p53 ubiquitination that leads to p53 stabilization upon overexpression. Importantly, we discovered that RPS26 knockdown impaired p53's ability to transcriptionally activate its target genes in response to DNA damage, without affecting its stability. Accordingly, the cells lost the ability to induce G2/M cell cycle arrest. We further found that upon RPS26 knockdown, the DNA damage induced recruitment of p53 to the promoters of its target genes and p53 acetylation were both greatly reduced. In addition, RPS26 can interact with p53 independent of Mdm2 and coexist in a complex with p53 and p300. These data establish a role of RPS26 in DNA damage response by directly influencing p53 transcriptional activity, and suggest that RPS26 acts distinctively in different scenarios of p53 activation. Our finding also implicates p53 transcriptional activity control as an important mechanism of p53 regulation by ribosomal proteins. PMID:23728348

  5. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    PubMed Central

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  6. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture.

    PubMed

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-11-10

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds 'structural' mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  7. TRIM25 has a dual function in the p53/Mdm2 circuit.

    PubMed

    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

    2015-11-12

    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context. PMID:25728675

  8. Mutant p53 (p53-R248Q) functions as an oncogene in promoting endometrial cancer by up-regulating REGγ.

    PubMed

    Wang, Huihui; Bao, Wei; Jiang, Feizhou; Che, Qi; Chen, Zheng; Wang, Fangyuan; Tong, Huan; Dai, Chenyun; He, Xiaoying; Liao, Yun; Liu, Binya; Sun, Jing; Wan, Xiaoping

    2015-05-01

    P53 mutation plays a pivotal role in tumorigenesis of endometrial cancer (EC), here we report that the gain-of-function mutant p53-R248Q targets the proteasome activator REGγ to promote EC progression. Increased p53 expression significantly correlated with high pathological grade and lymph node metastasis in EC specimens. Manipulation of p53-R248Q in EC cells caused coincident changes in REGγ expression, and chromatin immunoprecipitation coupled with PCR further indicated that p53-R248Q bound to the REGγ gene promoter at a p53 responsive element. Silencing of REGγ in EC cells attenuated the cell proliferation, migration and invasion abilities, whereas overexpression of p53-R248Q rescued these activities. Overexpression of REGγ also induced an epithelial-mesenchymal transition phenotype. Moreover, a mouse xenograft tumor model showed that REGγ promoted tumor growth, further demonstrating a p53-R248Q-REGγ oncogenic pathway. Finally, examination of EC and normal endometrium specimens confirmed the oncogenic role of REGγ, in that REGγ was more highly overexpressed in p53-positive specimens than in p53-negative specimens. Our data suggest that REGγ is a promising therapeutic target for EC with the p53-R248Q mutation. PMID:25697482

  9. Akt phosphorylates myc-associated zinc finger protein (MAZ), releases P-MAZ from the p53 promoter, and activates p53 transcription.

    PubMed

    Lee, Wei-Ping; Lan, Keng-Hsin; Li, Chung-Pin; Chao, Yee; Lin, Han-Chieh; Lee, Shou-Dong

    2016-05-28

    The p53 protein is a cell cycle regulator. When the cell cycle progresses, p53 plays an important role in putting a brake on the G1 phase to prevent unwanted errors during cell division. Akt is a downstream kinase of receptor tyrosine kinase. Upon activation, Akt phorphorylates IKK that then phosphorylates IκB and releases NF-κB, leading to transcriptional activation of Dmp1. Dmp1 is a transcriptional activator of Arf. It has been known that oncogene activation stabilizes p53 through transcriptional activation of Arf, which then binds and inhibits Mdm2. In the current study, we show that myc-associated zinc finger protein (MAZ) is a transcriptional repressor of the p53 promoter. Akt phosphorylates MAZ at Thr385, and the phosphorylated MAZ is released from the p53 promoter, leading to transcriptional activation of p53, a new mechanism that contributes to increased p53 protein pool during oncogene activation. PMID:26902421

  10. Escape from p53-mediated tumor surveillance in neuroblastoma: switching off the p14(ARF)-MDM2-p53 axis.

    PubMed

    Van Maerken, T; Vandesompele, J; Rihani, A; De Paepe, A; Speleman, F

    2009-12-01

    A primary failsafe program against unrestrained proliferation and oncogenesis is provided by the p53 tumor suppressor protein, inactivation of which is considered as a hallmark of cancer. Intriguingly, mutations of the TP53 gene are rarely encountered in neuroblastoma tumors, suggesting that alternative p53-inactivating lesions account for escape from p53 control in this childhood malignancy. Several recent studies have shed light on the mechanisms by which neuroblastoma cells circumvent the p53-driven antitumor barrier. We review here these mechanisms for evasion of p53-mediated growth control and conclude that deregulation of the p14(ARF)-MDM2-p53 axis seems to be the principal mode of p53 inactivation in neuroblastoma, opening new perspectives for targeted therapeutic intervention. PMID:19779493

  11. Cloning and characterization of a novel gene PDRG that is differentially regulated by p53 and ultraviolet radiation.

    PubMed

    Luo, Xiuquan; Huang, Ying; Sheikh, M Saeed

    2003-10-16

    We report the cloning and characterization of a novel p53 and DNA damage-regulated gene (PDRG). The human and mouse PDRG sequences are highly homologous and contain open reading frames of 133 amino acids each with molecular masses of 15.5 and 15.3 kDa, respectively. PDRG codes for a novel protein that does not show similarity to any known protein in the databases. Human PDRG is predominantly expressed in normal testis and exhibits reduced but detectable expression in other organs. GFP-tagged PDRG was predominantly detected as aggregates that appeared to reside in a distinct subcellular compartment. PDRG mRNA was upregulated by ultraviolet radiation (UV) but downregulated by tumor suppressor p53. UV is known to transcriptionally upregulate the expression of certain genes by activating the transcription factor Oct-1, while p53 has been reported to suppress transcription of certain genes by directly binding to a novel head-to-tail response element. Cloning and sequence analysis of PDRG promoter revealed the presence of Oct-1-binding element and a putative head-to-tail-type p53-binding site. Indeed, UV as well as exogenous Oct-1 independently increased PDRG promoter activity, suggesting that UV could mediate PDRG upregulation via Oct-1. Exogenous wild-type p53 was found to downregulate the PDRG promoter activity indicating that wild-type p53 transcriptionally suppresses the expression of PDRG and may mediate its effect via the putative head-to-tail response element. Furthermore, stable expression of exogenous PDRG was found to decrease the clonogenic survival after UV irradiation, which highlights the significance of PDRG in facilitating UV-induced killing. PMID:14562055

  12. p53-Dependent DNA damage response sensitive to editing-defective tRNA synthetase in zebrafish.

    PubMed

    Song, Youngzee; Shi, Yi; Carland, Tristan M; Lian, Shanshan; Sasaki, Tomoyuki; Schork, Nicholas J; Head, Steven R; Kishi, Shuji; Schimmel, Paul

    2016-07-26

    Brain and heart pathologies are caused by editing defects of transfer RNA (tRNA) synthetases, which preserve genetic code fidelity by removing incorrect amino acids misattached to tRNAs. To extend understanding of the broader impact of synthetase editing reactions on organismal homeostasis, and based on effects in bacteria ostensibly from small amounts of mistranslation of components of the replication apparatus, we investigated the sensitivity to editing of the vertebrate genome. We show here that in zebrafish embryos, transient overexpression of editing-defective valyl-tRNA synthetase (ValRS(ED)) activated DNA break-responsive H2AX and p53-responsive downstream proteins, such as cyclin-dependent kinase (CDK) inhibitor p21, which promotes cell-cycle arrest at DNA damage checkpoints, and Gadd45 and p53R2, with pivotal roles in DNA repair. In contrast, the response of these proteins to expression of ValRS(ED) was abolished in p53-deficient fish. The p53-activated downstream signaling events correlated with suppression of abnormal morphological changes caused by the editing defect and, in adults, reversed a shortened life span (followed for 2 y). Conversely, with normal editing activities, p53-deficient fish have a normal life span and few morphological changes. Whole-fish deep sequencing showed genomic mutations associated with the editing defect. We suggest that the sensitivity of p53 to expression of an editing-defective tRNA synthetase has a critical role in promoting genome integrity and organismal homeostasis. PMID:27402763

  13. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

    PubMed Central

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

    2015-01-01

    Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

  14. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53.

    PubMed

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Vande Pol, Scott; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

    2016-01-28

    The p53 pro-apoptotic tumour suppressor is mutated or functionally altered in most cancers. In epithelial tumours induced by 'high-risk' mucosal human papilloma viruses, including human cervical carcinoma and a growing number of head-and-neck cancers, p53 is degraded by the viral oncoprotein E6 (ref. 2). In this process, E6 binds to a short leucine (L)-rich LxxLL consensus sequence within the cellular ubiquitin ligase E6AP. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 (ref. 4). Neither E6 nor E6AP are separately able to recruit p53 (refs 3, 5), and the precise mode of assembly of E6, E6AP and p53 is unknown. Here we solve the crystal structure of a ternary complex comprising full-length human papilloma virus type 16 (HPV-16) E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumour suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against oncogenesis mediated by human papilloma virus. PMID:26789255

  15. p53 alteration in morphologically normal/benign breast tissue in patients with triple-negative high-grade breast carcinomas: breast p53 signature?

    PubMed

    Wang, Xi; Stolla, Moritz; Ring, Brian Z; Yang, Qi; Laughlin, Todd S; Rothberg, Paul G; Skinner, Kristin; Hicks, David G

    2016-09-01

    p53 alterations have been identified in approximately 23% of breast carcinomas, particularly in hormone receptor-negative high-grade carcinomas. It is considered to be an early event in breast carcinogenesis. Nevertheless, the putative precursor lesion of high-grade breast carcinoma remains elusive. Breast excision specimens from 93 triple-negative high-grade invasive ductal carcinomas, 48 estrogen receptor (ER)-positive/progesterone receptor-positive/Her2-negative non-high-grade invasive ductal carcinomas, and 50 mammoplasty breasts were selected. At least 2 tissue blocks with tumor and adjacent benign tissue were sectioned and subjected to immunohistochemistry staining for p53. TP53 gene sequencing was performed on select tumors. Further immunohistochemistry staining for ER and Ki-67 was performed on consecutive sections of tissue with p53-positive normal/benign cells. Of the 93 high-grade carcinomas, 51 (55%) were positive for p53 alteration, whereas only 3 (6.25%) of the 48 non-high-grade carcinomas were p53 altered. Focal p53 positivity in adjacent normal/benign breast tissue was identified in 19 cases, and 18 of them also had p53 alteration in their carcinomas. Only 1 case had focal p53 staining in normal/benign tissue, but the tumor was negative for p53 alteration. No p53 staining positivity was identified in the mammoplasty specimens. The p53-stained normal/benign cells were ER negative and did not show an increase in the Ki-67 labeling index. These findings indicate that the p53 staining positivity in normal/benign breast tissue is not a random event. It could be considered as the "p53 signature" in breast and serve as an indicator for future potential risk of p53-positive high-grade breast carcinoma. PMID:27246177

  16. A dynamic p53-mdm2 model with distributed delay

    NASA Astrophysics Data System (ADS)

    Horhat, Raluca; Horhat, Raul Florin

    2014-12-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcripion factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. In this paper, the dynamic P53-Mdm2 interaction model with distributed delays is investigated. Both weak and Dirac kernels are taken into consideration. For Dirac case, the Hopf bifurcation is investigated. Some numerical examples are finally given for justifying the theoretical results.

  17. Crystal structure of a p53 core tetramer bound to DNA

    SciTech Connect

    Malecka, K.A.; Ho, W.C.; Marmorstein, R.

    2009-09-02

    The tumor suppressor p53 regulates downstream genes in response to many cellular stresses and is frequently mutated in human cancers. Here, we report the use of a crosslinking strategy to trap a tetrameric p53 DNA-binding domain (p53DBD) bound to DNA and the X-ray crystal structure of the protein/DNA complex. The structure reveals that two p53DBD dimers bind to B form DNA with no relative twist and that a p53 tetramer can bind to DNA without introducing significant DNA bending. The numerous dimer-dimer interactions involve several strictly conserved residues, thus suggesting a molecular basis for p53DBD-DNA binding cooperativity. Surface residue conservation of the p53DBD tetramer bound to DNA highlights possible regions of other p53 domain or p53 cofactor interactions.

  18. A Novel Function for p53: Regulation of Growth Cone Motility through Interaction with Rho Kinase

    PubMed Central

    Qin, Qingyu; Baudry, Michel; Liao, Guanghong; Noniyev, Albert; Galeano, James; Bi, Xiaoning

    2009-01-01

    The transcription factor p53 suppresses tumorgenesis by regulating cell proliferation and migration. We investigated whether p53 could also control cell motility in postmitotic neurons. P53 isoforms recognized by phospho-p53-specific (at Ser15) or “mutant” conformation specific antibodies were highly and specifically expressed in axons and axonal growth cones in primary hippocampal neurons. Inhibition of p53 function by inhibitors, siRNAs, or by dominant negative forms, induced axonal growth cone collapse, whereas p53 over-expression led to larger growth cones. Furthermore, deletion of the p53 nuclear export signal blocked its axonal distribution and induced growth cone collapse. P53 inhibition-induced axonal growth cone collapse was significantly reduced by the Rho kinase (ROCK) inhibitor, Y27632. Our results reveal a new function for p53 as a critical regulator of axonal growth cone behavior by suppressing ROCK activity. PMID:19386914

  19. Characterization, expression and silencing by RNAi of p53 from Penaeus monodon.

    PubMed

    Dai, Wenting; Qiu, Lihua; Zhao, Chao; Fu, Mingjun; Ma, Zhenhua; Zhou, Falin; Yang, Qibin

    2016-06-01

    The tumor suppressor p53 is a sequence-specific transcription factor, whose target genes can regulate genomic stability, the cellular response to DNA damage and cell-cycle progression. In the present study, the full-length complementary DNA (cDNA) sequence of p53 gene from Penaeus monodon (Pmp53) was cloned by the technology of rapid amplification of cDNA ends (RACE). The cDNA of Pmp53 was 2239 bp, encoding a protein of 450 amino acids with calculated molecular weight of 50.62 kDa. The temporal expression of Pmp53 in different tissues (ovary, heart, intestine, brain, muscles, stomach and gills) and different developmental stages of ovary was investigated by real-time quantitative PCR (RT-qPCR). The lowest expression level of Pmp53 was observed in the stomach, while the highest expression level was detected in the brain. During the ovary development stages, the expression level of Pmp53 reached the peak at stage III. RNA interference (RNAi) and serotonin (5-hydroxytryptamine, 5-HT) injection experiments were conducted to study the expression profile of Pmp53 and PmCDK2 (cyclin-dependent kinase 2, CDK2). Knocked down of Pmp53 by dsRNA-p53 was sequence-specific and successful. Expression levels of Pmp53 and PmCDK2 in ovary of P. monodon were significantly increased at 12-96 h post 5-HT injection. These results indicate that Pmp53 may be involved in the regulation of ovarian development of P. monodon. PMID:27112755

  20. Bisindole-PBD regulates breast cancer cell proliferation via SIRT-p53 axis.

    PubMed

    Sarma, Pranjal; Bag, Indira; Ramaiah, M Janaki; Kamal, Ahmed; Bhadra, Utpal; Pal Bhadra, Manika

    2015-01-01

    In a previous study we reported the role of potent bisindole-PBD conjugate as an inclusion in the arsenal of breast cancer therapeutics. In breast cancer cell proliferation, PI3K/AKT/mTOR pathway plays a crucial role by prosurvival mechanism that inhibits programmed cell death. Here, 2 breast cancer cells lines, MCF-7 and MDA-MB-231 were treated with Vorinostat (suberoylanilide hydroxamic acid / SAHA) and bisindole-PBD (5b). We have investigated the effect on PI3K/AKT/mTOR pathway and SIRT expression including epigenetic regulation. There was consistent decrease in the level of PI3K, AKT, mTOR proteins upon treatment of 5b in both MCF-7 and MDA-MB-231 cell lines compared to untreated controls. Treatment with caspase inhibitor (Q-VD-OPH) confirmed that the effect of 5b on PI3K signaling was ahead of apoptosis. Real time PCR and western blot analysis showed profound reduction in the mRNA and protein levels of SIRT1 and SIRT2. Molecular docking studies also supported the interaction of 5b with various amino acids of SIRT2 proteins. Treatment with 5b caused epigenetic changes that include increase of acetylated forms of p53, increase of histone acetylation at p21 promoter as well as decrease in methylation state of p21 gene. Compound 5b thus acts as SIRT inhibitor and cause p53 activation via inhibition of growth factor signaling and activation of p53 dependent apoptotic signaling. This present study focuses bisindole-PBD on epigenetic alteration putting 5b as a promising therapeutic tool in the realm of breast cancer research. PMID:26192233

  1. Tetramerization-defects of p53 result in aberrant ubiquitylation and transcriptional activity.

    PubMed

    Lang, Valérie; Pallara, Chiara; Zabala, Amaia; Lobato-Gil, Sofia; Lopitz-Otsoa, Fernando; Farrás, Rosa; Hjerpe, Roland; Torres-Ramos, Monica; Zabaleta, Lorea; Blattner, Christine; Hay, Ronald T; Barrio, Rosa; Carracedo, Arkaitz; Fernandez-Recio, Juan; Rodríguez, Manuel S; Aillet, Fabienne

    2014-07-01

    The tumor suppressor p53 regulates the expression of genes involved in cell cycle progression, senescence and apoptosis. Here, we investigated the effect of single point mutations in the oligomerization domain (OD) on tetramerization, transcription, ubiquitylation and stability of p53. As predicted by docking and molecular dynamics simulations, p53 OD mutants show functional defects on transcription, Mdm2-dependent ubiquitylation and 26S proteasome-mediated degradation. However, mutants unable to form tetramers are well degraded by the 20S proteasome. Unexpectedly, despite the lower structural stability compared to WT p53, p53 OD mutants form heterotetramers with WT p53 when expressed transiently or stably in cells wild type or null for p53. In consequence, p53 OD mutants interfere with the capacity of WT p53 tetramers to be properly ubiquitylated and result in changes of p53-dependent protein expression patterns, including the pro-apoptotic proteins Bax and PUMA under basal and adriamycin-induced conditions. Importantly, the patient derived p53 OD mutant L330R (OD1) showed the more severe changes in p53-dependent gene expression. Thus, in addition to the well-known effects on p53 stability, ubiquitylation defects promote changes in p53-dependent gene expression with implications on some of its functions. PMID:24816189

  2. Pla2g16 phospholipase mediates gain-of-function activities of mutant p53.

    PubMed

    Xiong, Shunbin; Tu, Huolin; Kollareddy, Madhusudhan; Pant, Vinod; Li, Qin; Zhang, Yun; Jackson, James G; Suh, Young-Ah; Elizondo-Fraire, Ana C; Yang, Peirong; Chau, Gilda; Tashakori, Mehrnoosh; Wasylishen, Amanda R; Ju, Zhenlin; Solomon, Hilla; Rotter, Varda; Liu, Bin; El-Naggar, Adel K; Donehower, Lawrence A; Martinez, Luis Alfonso; Lozano, Guillermina

    2014-07-29

    p53(R172H/+) mice inherit a p53 mutation found in Li-Fraumeni syndrome and develop metastatic tumors at much higher frequency than p53(+/-) mice. To explore the mutant p53 metastatic phenotype, we used expression arrays to compare primary osteosarcomas from p53(R172H/+) mice with metastasis to osteosarcomas from p53(+/-) mice lacking metastasis. For this study, 213 genes were differentially expressed with a P value <0.05. Of particular interest, Pla2g16, which encodes a phospholipase that catalyzes phosphatidic acid into lysophosphatidic acid and free fatty acid (both implicated in metastasis), was increased in p53(R172H/+) osteosarcomas. Functional analyses showed that Pla2g16 knockdown decreased migration and invasion in mutant p53-expressing cells, and vice versa: overexpression of Pla2g16 increased the invasion of p53-null cells. Furthermore, Pla2g16 levels were increased upon expression of mutant p53 in both mouse and human osteosarcoma cell lines, indicating that Pla2g16 is a downstream target of the mutant p53 protein. ChIP analysis revealed that several mutant p53 proteins bind the Pla2g16 promoter at E26 transformation-specific (ETS) binding motifs and knockdown of ETS2 suppressed mutant p53 induction of Pla2g16. Thus, our study identifies a phospholipase as a transcriptional target of mutant p53 that is required for metastasis. PMID:25024203

  3. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    SciTech Connect

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  4. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.

    PubMed

    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong

    2012-05-01

    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  5. Restoring p53 function in cancer: novel therapeutic approaches for applying the brakes to tumorigenesis.

    PubMed

    Di Cintio, Alessandra; Di Gennaro, Elena; Budillon, Alfredo

    2010-01-01

    p53 tumor suppressor gene encodes for a critical cellular protein that regulate the integrity of the cell and can induce cell cycle arrest and/or apoptosis upon cellular stresses of several origins, including chemotherapeutics. Loss of p53 function occurs in an estimated 50% of all cancers by mutations and deletions while in the presence of wild-type p53 alleles other mechanisms may affect the expression and activity of p53. Alternate mechanisms include methylation of the promoter of p53, deletion or epigenetic inactivation of the p53-positive regulator p14/ARF, elevated expression of the p53 regulators murine double minute 2 (MDM2) and MDMX, or alteration of upstream regulators of p53 such as the kinase ATM. MDM2 is a p53 E3 ubiquitin ligase that mediates the ubiquitin-dependent degradation of p53 while p14/ARF is a small MDM2-binding protein that controls the activity of MDM2 by displacing p53 and preventing its degradation. MDMX antagonize p53-dependent transcriptional control by interfering with p53 transactivation function. The understanding of the key role of p53 inactivation in cancer development generated considerable interest in developing compounds that are capable of restoring the p53 functions. Several patents have been issued on such compounds. Adenovirus-based p53 gene therapy as well as small molecules such as PRIMA that can restore the transcriptional transactivation function to mutant p53, or NUTLIN and RITA that interfere with MDM2-directed p53 degradation, have tested in a preclinical setting and some of these approaches are currently in clinical development. PMID:19663772

  6. Shifting p53-induced senescence to cell death by TIS21(/BTG2/Pc3) gene through posttranslational modification of p53 protein.

    PubMed

    Choi, Ok Ran; Ryu, Min Sook; Lim, In Kyoung

    2016-09-01

    Cellular senescence and apoptosis can be regulated by p53 activity, although the underlying mechanism of the switch between the two events remains largely unknown. Cells exposed to cancer chemotherapy can escape to senescence phenotype rather than undergoing apoptosis. By employing adenoviral transduction of p53 or TIS21 genes, we observed shifting of p53 induced-senescence to apoptosis in EJ bladder cancer cells, which express H-RasV12 and mutant p53; transduction of p53 increased H-RasV12 expression along with senescence phenotypes, whereas coexpression with TIS21 (p53+TIS21) induced cell death rather than senescence. The TIS21-mediated switch of senescence to apoptosis was accompanied by nuclear translocation of p53 protein and its modifications on Ser-15 and Ser-46 phosphorylation and acetylations on Lys-120, -320, -373 and -382 residues. Mechanistically, TIS21(/BTG2) regulated posttranslational modification of p53 via enhancing miR34a and Bax expressions as opposed to inhibiting SIRT1 and Bcl2 expression. At the same time, TIS21 increased APAF-1 and p53AIP1 expressions, but inhibited the interaction of p53 with iASPP. In vitro tumorigenicity was significantly reduced in the p53+TIS21 expresser through inhibiting micro-colony proliferation by TIS21. Effect of TIS21 on the regulation of p53 activity was confirmed by knockdown of TIS21 expression by RNA interference. Therefore, we suggest TIS21 expression as an endogenous cell death inducer at the downstream of p53 gene, which might be useful for intractable cancer chemotherapy. PMID:27208501

  7. Epicatechin gallate induces cell death via p53 activation and stimulation of p38 and JNK in human colon cancer SW480 cells.

    PubMed

    Cordero-Herrera, Isabel; Martín, María Angeles; Bravo, Laura; Goya, Luis; Ramos, Sonia

    2013-01-01

    The tea flavonoid epicatechin gallate (ECG) exhibits a wide range of biological activities. In this study, the in vitro anticancer effects of ECG on SW480 colon cancer cell line was investigated by analyzing the cell cycle, apoptosis, key proteins involved in cellular survival/proliferation, namely AKT/phosphatidylinositol-3-kinase (PI3K) and mitogen-activated protein kinases (MAPKs), and the role of p53 in these processes. ECG induced cell cycle arrest at the G0/G1-S phase border associated with the stimulation of p21, p-p53, and p53 and the suppression of cyclins D1 and B1. Exposure of SW480 cells to ECG also led to apoptosis as determined by time-dependent changes in caspase-3 activity, MAPKs [extracellular regulated kinase (ERK), p38, and c-jun amino-terminal kinase (JNK)], p21 and p53 activation, and AKT inhibition. The presence of pifithrin, an inhibitor of p53 function, blocked ECG-induced apoptosis as was manifested by restored cell viability and caspase-3 activity to control values and reestablished the balance among Bcl-2 anti- and proapoptotic protein levels. Interestingly, ECG also inhibited p53 protein and RNA degradation, contributing to the stabilization of p53. In addition, JNK and p38 have been identified as necessary for ECG-induced apoptosis, upon activation by p53. The results suggest that the activation of the p53-p38/JNK cascade is required for ECG-induced cell death in SW480 cells. PMID:23859040

  8. Posttranscriptional Regulation of p53 and Its Targets by RNA-Binding Proteins

    PubMed Central

    Zhang, Jin; Chen, Xinbin

    2009-01-01

    p53 tumor suppressor plays a pivotal role in maintaining genomic integrity and preventing cancer development. The importance of p53 in tumor suppression is illustrated by the observation that about 50% human tumor cells have a dysfunctional p53 pathway. Although it has been well accepted that the activity of p53 is mainly controlled through post-translational modifications, recent studies have revealed that posttranscriptional regulations of p53 by various RNA-binding proteins also play a crucial role in modulating p53 activity and its downstream targets. PMID:19075680

  9. p53-Encoding pDNA Purification by Affinity Chromatography for Cancer Therapy.

    PubMed

    Sousa, Ângela; Queiroz, João A; Sousa, Fani

    2015-01-01

    The gene therapy approach based on reestablishment of p53 tumor suppressor, which acts as a prevailing guardian against malignant cell transformation, is raising new prospects on the outcome of an effective anticancer treatment. It is well known that the success of gene transfer to cells and subsequent expression is strictly affected by the vector manufacturing process. Therefore, several downstream methods have been proposed to achieve high quantities of supercoiled plasmid DNA with pharmaceutical grade purity. Affinity chromatography with amino acids as ligands has recently yielded interesting results because these ligands take advantage of their biological function or chemical structure to promote specific interactions with different nucleic acids. Here, we describe detailed procedures for the preparation and purification of supercoiled plasmid DNA, with the purity degree required by regulatory agencies, by using arginine affinity chromatography. With this methodology pure pDNA is obtained, efficient on eukaryotic cell transfection and biologically active, resulting in the reestablishment of the p53 protein levels in cancer cell lines. PMID:26072404

  10. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    SciTech Connect

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  11. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    SciTech Connect

    Abdelalim, Essam Mohamed; Tooyama, Ikuo

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  12. UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation.

    PubMed

    Du, Cheng; Wu, Hong; Leng, Roger P

    2016-01-19

    Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

  13. The critical role of catalase in prooxidant and antioxidant function of p53

    PubMed Central

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  14. Coordination of the Nuclear and Cytoplasmic Activities of p53 in Response to DNA Damage

    PubMed Central

    Pu, Tian; Zhang, Xiao-Peng; Liu, Feng; Wang, Wei

    2010-01-01

    The tumor suppressor p53 plays a key role in the cellular response to various stresses. Most previous studies have focused on either the nuclear or cytoplasmic proapoptotic functions of p53, ignoring the combination of both functions. To explore how the two functions of p53 are coordinated in the DNA damage response via computer simulation, we construct a model for the p53 network comprising coupled positive and negative feedback loops involving p53, Mdm2, and Akt, as well as PUMA and Bax. In our model p53 is stabilized and accumulates in the nucleus and cytoplasm upon DNA damage. Nuclear p53 induces expression of Mdm2, PTEN, PUMA, and Bax. Cytoplasmic p53 is then released from the p53·Bcl-xL complex by PUMA to activate Bax directly. We find that the switching between low and high protein levels underlies the decision between cell survival and death. Moreover, a balance between the nuclear and cytoplasmic p53 levels and appropriate levels of Akt and PUMA are required for reliable cell fate decision. Our results indicate that coordination of the transcription-dependent and -independent activities of p53 is important in determining cellular outcomes. These findings advance our understanding of the mechanism for p53-mediated cellular responses and provide clues to p53-based cancer therapy. PMID:20858413

  15. STAT5A is regulated by DNA damage via the tumor suppressor p53.

    PubMed

    Mukhopadhyay, Utpal K; Cass, Jamaica; Raptis, Leda; Craig, Andrew W; Bourdeau, Véronique; Varma, Sonal; SenGupta, Sandip; Elliott, Bruce E; Ferbeyre, Gerardo

    2016-06-01

    Here we report that the STAT5A transcription factor is a direct p53 transcriptional target gene. STAT5A is well expressed in p53 wild type cells but not in p53-null cells. Inhibition of p53 reduces STAT5A expression. DNA damaging agents such as doxorubicin also induced STAT5A expression in a p53 dependent manner. Two p53 binding sites were mapped in the STAT5A gene and named PBS1 and PBS2; these sites were sufficient to confer p53 responsiveness in a luciferase reporter gene. Chromatin immunoprecipitation experiments revealed that PBS2 has constitutive p53 bound to it, while p53 binding to PBS1 required DNA damage. In normal human breast lobules, weak p53 staining correlated with regions of intense STAT5A staining. Interestingly, in a cohort of triple negative breast tumor tissues there was little correlation between regions of p53 and STAT5A staining, likely reflecting a high frequency of p53 mutations that stabilize the protein in these tumors. We thus reveal an unexpected connection between cytokine signaling and p53. PMID:26876578

  16. Exogenous p53 and ASPP2 expression enhances rAdV-TK/GCV-induced death in hepatocellular carcinoma cells lacking functional p53

    PubMed Central

    Guo, Xianghua; Wei, Feili; Yin, Jiming; Zang, Yunjin; Li, Ning; Chen, Dexi

    2016-01-01

    Suicide gene therapy using herpes simplex virus-1 thymidine kinase (HSV-TK) in combination with ganciclovir (GCV) has emerged as a potential new method for treating cancer. We hypothesize that the efficacy of HSV-TK/GCV therapy is at least partially dependent on p53 status in hepatocellular carcinoma (HCC) patients. Using recombinant adenoviral vectors (rAdV), TK, p53, and ASPP2 were overexpressed individually and in combination in Hep3B (p53 null) and HepG2 (p53 wild-type) cell lines and in primary HCC tumor cells. p53 overexpression induced death in Hep3B cells, but not HepG2 cells. ASPP2 overexpression increased rAdV-TK/GCV-induced HepG2 cell death by interacting with endogenous p53. Similarly, ASPP2 reduced survival in rAdV-TK/GCV-treated primary HCC cells expressing p53 wild-type but not a p53 R249S mutant. Mutated p53 was unable to bind to ASPP2, suggesting that the increase in rAdV-TK/GCV-induced cell death resulting from ASPP2 overexpression was dependent on its interaction with p53. Additionally, γ-H2AX foci, ATM phosphorylation, Bax, and p21 expression increased in rAdV-TK/GCV-treated HepG2 cells as compared to Hep3B cells. This suggests that the combined use of HSV-TK, GCV, rAdV-p53 and rAdV-ASPP2 may improve therapeutic efficacy in HCC patients lacking functional p53. PMID:26934443

  17. Gene expression profiling analysis reveals arsenic-induced cell cycle arrest and apoptosis in p53-proficient and p53-deficient cells through differential gene pathways

    SciTech Connect

    Yu Xiaozhong Robinson, Joshua F.; Gribble, Elizabeth; Hong, Sung Woo; Sidhu, Jaspreet S.; Faustman, Elaine M.

    2008-12-15

    Arsenic (As) is a well-known environmental toxicant and carcinogen as well as an effective chemotherapeutic agent. The underlying mechanism of this dual capability, however, is not fully understood. Tumor suppressor gene p53, a pivotal cell cycle checkpoint signaling protein, has been hypothesized to play a possible role in mediating As-induced toxicity and therapeutic efficiency. In this study, we found that arsenite (As{sup 3+}) induced apoptosis and cell cycle arrest in a dose-dependent manner in both p53{sup +/+} and p53{sup -/-} mouse embryonic fibroblasts (MEFs). There was, however, a distinction between genotypes in the apoptotic response, with a more prominent induction of caspase-3 in the p53{sup -/-} cells than in the p53{sup +/+} cells. To examine this difference further, a systems-based genomic analysis was conducted comparing the critical molecular mechanisms between the p53 genotypes in response to As{sup 3+}. A significant alteration in the Nrf2-mediated oxidative stress response pathway was found in both genotypes. In p53{sup +/+} MEFs, As{sup 3+} induced p53-dependent gene expression alterations in DNA damage and cell cycle regulation genes. However, in the p53{sup -/-} MEFs, As{sup 3+} induced a significant up-regulation of pro-apoptotic genes (Noxa) and down-regulation of genes in immune modulation. Our findings demonstrate that As-induced cell death occurs through a p53-independent pathway in p53 deficient cells while apoptosis induction occurs through p53-dependent pathway in normal tissue. This difference in the mechanism of apoptotic responses between the genotypes provides important information regarding the apparent dichotomy of arsenic's dual mechanisms, and potentially leads to further advancement of its utility as a chemotherapeutic agent.

  18. Gene expression profiling analysis reveals arsenic-induced cell cycle arrest and apoptosis in p53-proficient and p53-deficient cells through differential gene pathways

    PubMed Central

    Yu, Xiaozhong; Robinson, Joshua F.; Gribble, Elizabeth; Hong, Sung Woo; Sidhu, Jaspreet S; Faustman, Elaine M

    2008-01-01

    Arsenic (As) is a well-known environmental toxicant and carcinogen as well as an effective chemotherapeutic agent. The underlying mechanism of this dual capability, however, is not fully understood. Tumor suppressor gene p53, a pivotal cell cycle checkpoint signaling protein, has been hypothesized to play a possible role in mediating As-induced toxicity and therapeutic efficiency. In this study, we found that arsenite (As3+) induced apoptosis and cell cycle arrest in a dose-dependent manner in both p53+/+ and p53−/− mouse embryonic fibroblasts (MEFs). There was, however, a distinction between genotypes in the apoptotic response, with a more prominent induction of caspase-3 in the p53−/− cells than in the p53+/+ cells. To examine this difference further, a systems-based genomic analysis was conducted comparing the critical molecular mechanisms between the p53 genotypes in response to As3+. A significant alteration in the Nrf2-mediated oxidative stress response pathway were found in both genotypes. In p53+/+ MEFs, As3+ induced p53-dependent gene expression alterations in DNA damage and cell cycle regulation genes. However, in the p53−/− MEFs, As3+ induced a significant up-regulation of pro-apoptotic genes (Noxa) and down-regulation of genes in immune modulation. Our findings demonstrate that As-induced cell death occurs through a p53-independent pathway in p53 deficient cells while apoptosis induction occurs through p53-dependent pathway in normal tissue. This difference in the mechanism of apoptotic responses between the genotypes provides important information regarding the apparent dichotomy of arsenic’s dual mechanisms, and potentially leads to further advancement of its utility as a chemotherapeutic agent. PMID:18929588

  19. The therapeutic potential of p53 reactivation by nutlin-3a in ALK+ anaplastic large cell lymphoma with wild-type or mutated p53.

    PubMed

    Drakos, E; Atsaves, V; Schlette, E; Li, J; Papanastasi, I; Rassidakis, G Z; Medeiros, L J

    2009-12-01

    p53 is expressed frequently, but is rarely mutated in anaplastic lymphoma kinase (ALK)-positive anaplastic large cell lymphoma (ALCL) tumours. Nutlin-3a is a recently developed small molecule that targets Mdm2, a critical negative regulator of p53, and disrupts the p53-Mdm2 interaction resulting in p53 stabilization and activation. We show that nutlin-3a activates p53 in ALK+ ALCL cells carrying a wild type (wt) or mutated but partially functional p53 gene resulting in p53-dependent cell-cycle arrest and apoptosis. Cell-cycle arrest was associated with upregulation of the cyclin-dependent kinase inhibitor p21. Nutlin-3a-induced apoptotic cell death was accompanied by Bax and Puma upregulation, downregulation of Bcl-xl, survivin, and caspase-3 cleavage, and this was reduced when p53-dependent transactivation activity was inhibited by pifithrin-alpha, or when pifithrin-mu was used to inhibit direct p53 targeting of mitochondria. Nutlin-3a sensitized the activation of the extrinsic apoptotic pathway in wt-p53 ALK+ ALCL cells, in part, through upregulation of DR-5 and downregulation of c-Flip(S/L), and was synergistic with TRAIL in cell death induction. In addition, nutlin-3a treatment enhanced doxorubicin cytotoxicity against ALK+ ALCL cells harbouring mt p53, and this was associated with p73 upregulation. These data suggest that disruption of the p53-mdm2 interaction by nutlin-3a offers a novel therapeutic approach for ALK+ ALCL patients. PMID:19741726

  20. Pontin, a new mutant p53-binding protein, promotes gain-of-function of mutant p53.

    PubMed

    Zhao, Y; Zhang, C; Yue, X; Li, X; Liu, J; Yu, H; Belyi, V A; Yang, Q; Feng, Z; Hu, W

    2015-11-01

    Tumor-suppressor p53 is frequently mutated in human cancers. Many tumor-associated mutant p53 (mutp53) proteins gain new functions in promoting tumorigenesis, defined as gain-of-function (GOF). The mechanisms for mutp53 GOF are not well understood. Here, we report Pontin, a highly conserved AAA+ ATPase important for various cellular functions, as a new mutp53-binding protein. This Pontin-mutp53 interaction promotes mutp53 GOF in invasion, migration and anchorage-independent growth of tumor cells. The ATPase domain of Pontin is crucial for its promoting effect on mutp53 GOF; blocking the ATPase activity of Pontin by a Pontin-specific ATPase inhibitor or an ATPase-deficient dominant-negative Pontin expression vector greatly diminished mutp53 GOF. Pontin promotes mutp53 GOF through regulation of mutp53 transcriptional activity; knockdown of Pontin abolished the transcriptional regulation of mutp53 toward a group of genes. Furthermore, overexpression of Pontin in tumors is associated with the poor survival in cancer patients, especially those containing mutp53. Our results highlight an important role and mechanism for Pontin, a new mutp53 partner, in promoting mutp53 GOF in tumorigenesis. PMID:25857266

  1. Mutations in p53 change phosphatidylinositol acyl chain composition

    PubMed Central

    Naguib, Adam; Bencze, Gyula; Engle, Dannielle; Chio, Iok I. C.; Herzka, Tali; Watrud, Kaitlin; Bencze, Szilvia; Tuveson, David A.; Pappin, Darryl J; Trotman, Lloyd C.

    2014-01-01

    Phosphatidylinositol phosphate (PIP) second messengers relay extracellular growth cues through the phosphorylation status of the inositol sugar, a signal transduction system that is deregulated in cancer. In stark contrast to PIP inositol head group phosphorylation, changes in phosphatidylinositol (PI) lipid acyl chains in cancer have remained ill-defined. Here, we apply a mass spectrometry-based method capable of unbiased high-throughput identification and quantification of cellular PI acyl chain composition. Using this approach we find that PI lipid chains represent a cell-specific fingerprint and are unperturbed by serum-mediated signaling in contrast to the inositol head group. We find that mutation of Trp53 results in PIs containing reduced-length fatty acid moieties. Our results suggest that the anchoring tails of lipid second messengers form an additional layer of PIP signaling in cancer that operates independently of PTEN/PI3-Kinase activity, but is instead linked somehow to p53. PMID:25543136

  2. Mitochondrial localization of the low level p53 protein in proliferative cells

    SciTech Connect

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  3. The tissue dependent interactions between p53 and Bcl-2 in vivo

    PubMed Central

    Wang, Hongshen; Xu, Zhixiang; Li, Bin

    2015-01-01

    To further investigate the role of p53 in apoptosis in vivo and the interaction between p53 and Bcl-2 in the regulation of cellular apoptosis in vivo, we depleted p53 in Bcl-2-null mice. We found that the interaction between p53 and Bcl-2 are tissue dependent. Specifically, loss of p53 in Bcl-2−/− mice inhibits apoptotic induction in spleen and subsequently inhibits the Bcl-2-null-induced spleen atrophy. Furthermore, p53 deficiency overcomes loss of melanocyte stem cell (MSC)-induced apoptosis and subsequently prevents hair graying in Bcl-2- null mice. In addition, p53 deletion partly inhibits apoptosis in hair follicle keratinocytes, leading to the alleviation of hair growth delay in Bcl-2-null mice. However, p53 absence in Bcl-2-null mice cannot restore other defects in Bcl-2-null mice, including retardation of growth, short ears and polycystic kidney disease. PMID:26452131

  4. Intracellular delivery of p53 fused to the basic domain of HIV-1 Tat.

    PubMed

    Ryu, Jiyoon; Lee, Hak Joo; Kim, Kyeong-Ae; Lee, Jae Yong; Lee, Kil Soo; Park, Jinseu; Choi, Soo Young

    2004-04-30

    p53 is a potent tumor suppressor inactivated in many cancers. In this study, the membrane permeability of the HIV-1 Tat basic domain was exploited to introduce functional p53 into cancer cells. We expressed and purified a p53 fusion protein with the HIV-1 Tat basic domain at its N terminus (Tat-p53), and examined its transduction profile and biological activity in cancer cells. Tat-p53 was efficiently delivered to both the cytoplasm and nucleus of cells, and was transcriptionally active, as judged by the level of p21/WAF1 protein and of p21 promoter activity. Transduction of cells with Tat-p53 resulted in apoptotic cell death in both p53 positive and negative human tumor cell lines. These results suggest that Tat-p53 could be useful in cancer therapy. PMID:15179054

  5. Nerve growth factor receptor negates the tumor suppressor p53 as a feedback regulator

    PubMed Central

    Zhou, Xiang; Hao, Qian; Liao, Peng; Luo, Shiwen; Zhang, Minhong; Hu, Guohui; Liu, Hongbing; Zhang, Yiwei; Cao, Bo; Baddoo, Melody; Flemington, Erik K; Zeng, Shelya X; Lu, Hua

    2016-01-01

    Cancer develops and progresses often by inactivating p53. Here, we unveil nerve growth factor receptor (NGFR, p75NTR or CD271) as a novel p53 inactivator. p53 activates NGFR transcription, whereas NGFR inactivates p53 by promoting its MDM2-mediated ubiquitin-dependent proteolysis and by directly binding to its central DNA binding domain and preventing its DNA-binding activity. Inversely, NGFR ablation activates p53, consequently inducing apoptosis, attenuating survival, and reducing clonogenic capability of cancer cells, as well as sensitizing human cancer cells to chemotherapeutic agents that induce p53 and suppressing mouse xenograft tumor growth. NGFR is highly expressed in human glioblastomas, and its gene is often amplified in breast cancers with wild type p53. Altogether, our results demonstrate that cancers hijack NGFR as an oncogenic inhibitor of p53. DOI: http://dx.doi.org/10.7554/eLife.15099.001 PMID:27282385

  6. Reactivating mutant p53 using small molecules as zinc metallochaperones: awakening a sleeping giant in cancer

    PubMed Central

    Blanden, Adam R.; Yu, Xin; Loh, Stewart N.; Levine, Arnold J.; Carpizo, Darren R.

    2016-01-01

    Tumor protein p53 (TP53) is the most commonly mutated gene in human cancer. The majority of mutations are missense, and generate a defective protein that is druggable. Yet, for decades, the small-molecule restoration of wild-type (WT) p53 function in mutant p53 tumors (so-called p53 mutant ‘reactivation’) has been elusive to researchers. The p53 protein requires the binding of a single zinc ion for proper folding, and impairing zinc binding is a major mechanism for loss of function in missense mutant p53. Here, we describe recent work defining a new class of drugs termed zinc metallochaperones that restore WT p53 structure and function by restoring Zn2+ to Zn2+-deficient mutant p53. PMID:26205328

  7. p53 modulates homologous recombination by transcriptional regulation of the RAD51 gene

    PubMed Central

    Arias-Lopez, Carmen; Lazaro-Trueba, Iciar; Kerr, Peter; Lord, Christopher J; Dexter, Tim; Iravani, Marjan; Ashworth, Alan; Silva, Augusto

    2006-01-01

    DNA repair by homologous recombination is involved in maintaining genome stability. Previous data report that wild-type p53 suppresses homologous recombination and physically interacts with Rad51. Here, we show the in vivo binding of wild-type p53 to a p53 response element in the promoter of Rad51 and the downregulation of Rad51 messenger RNA and protein by wild-type p53, favoured by DNA damage. Moreover, wild-type p53 inhibits Rad51 foci formation in response to double-strand breaks, whereas p53 contact mutant R280K fails to repress Rad51 mRNA and protein expression and Rad51 foci formation. We propose that transcriptional repression of Rad51 by p53 participates in regulating homologous recombination, and impaired Rad51 repression by p53 mutants may contribute to malignant transformation. PMID:16322760

  8. PACT is a negative regulator of p53 and essential for cell growth and embryonic development.

    PubMed

    Li, Li; Deng, Binwei; Xing, Guichun; Teng, Yan; Tian, Chunyan; Cheng, Xuan; Yin, Xiushan; Yang, Juntao; Gao, Xue; Zhu, Yunping; Sun, Qihong; Zhang, Lingqiang; Yang, Xiao; He, Fuchu

    2007-05-01

    The tumor suppressor p53 regulates cell cycle progression and apoptosis in response to various types of stress, whereas excess p53 activity creates unwanted effects. Tight regulation of p53 is essential for maintaining normal cell growth. p53-associated cellular protein-testes derived (PACT, also known as P2P-R, RBBP6) is a 250-kDa Ring finger-containing protein that can directly bind to p53. PACT is highly up-regulated in esophageal cancer and may be a promising target for immunotherapy. However, the physiological role of the PACT-p53 interaction remains largely unclear. Here, we demonstrate that the disruption of PACT in mice leads to early embryonic lethality before embryonic day 7.5 (E7.5), accompanied by an accumulation of p53 and widespread apoptosis. p53-null mutation partially rescues the lethality phenotype and prolonged survival to E11.5. Endogenous PACT can interact with Hdm2 and enhance Hdm2-mediated ubiquitination and degradation of p53 as a result of the increase of the p53-Hdm2 affinity. Consequently, PACT represses p53-dependent gene transcription. Knockdown of PACT significantly attenuates the p53-Hdm2 interaction, reduces p53 polyubiquitination, and enhances p53 accumulation, leading to both apoptosis and cell growth retardation. Taken together, our data demonstrate that the PACT-p53 interaction plays a critical role in embryonic development and tumorigenesis and identify PACT as a member of negative regulators of p53. PMID:17470788

  9. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.

    2012-01-01

    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  10. p53 negatively regulates Aurora A via both transcriptional and posttranslational regulation

    PubMed Central

    Wu, Chun-Chi; Yang, Tsung-Ying; Yu, Chang-Tze Ricky; Phan, Liem; Ivan, Cristina; Sood, Anil K.; Hsu, Shih-Lan; Lee, Mong-Hong

    2012-01-01

    p53 plays an important role in mitotic checkpoint, but what its role is remains enigmatic. Aurora A is a Ser/Thr kinase involved in correcting progression of mitosis. Here, we show that p53 is a negative regulator for Aurora A. We found that p53 deficiency leads to Aurora A elevation. Ectopic expression of p53 or DNA damage-induced expression of p53 can suppress the expression of Aurora A. Mechanistic studies show that p53 is a negative regulator for Aurora A expression through both transcriptional and posttranslational regulation. p53 knockdown in cancer cells reduces the level of p21, which, in turn, increases the activity of CDK2 followed by induction of Rb1 hyperphosphorylation and its dissociation with transcriptional factor E2F3. E2F3 can bind to Aurora A gene promoter, potentiating Aurora A gene expression and p53 deficiency, enhancing the binding of E2F3 on Aurora A promoter. Also, p53 deficiency leads to decelerating Aurora A’s turnover rate, due to the fact that p53 deficiency causes the downregulation of Fbw7α, a component of E3 ligase of Aurora A. Consistently, p53 knockdown-mediated Aurora A elevation is mitigated when Fbw7α is ectopically expressed. Thus, p53-mediated Aurora A degradation requires Fbw7α expression. Significantly, inverse correlation between p53 and Aurora A elevation is translated into the deregulation of centrosome amplification. p53 knockdown leads to high percentages of cells with abnormal amplification of centrosome. These data suggest that p53 is an important negative regulator of Aurora A, and that loss of p53 in many types of cancer could lead to abnormal elevation of Aurora A and dysregulated mitosis, which provides a growth advantage for cancer cells. PMID:22894933

  11. Transactivation specificity is conserved among p53 family proteins and depends on a response element sequence code

    PubMed Central

    Ciribilli, Yari; Monti, Paola; Bisio, Alessandra; Nguyen, H. Thien; Ethayathulla, Abdul S.; Ramos, Ana; Foggetti, Giorgia; Menichini, Paola; Menendez, Daniel; Resnick, Michael A.; Viadiu, Hector; Fronza, Gilberto; Inga, Alberto

    2013-01-01

    Structural and biochemical studies have demonstrated that p73, p63 and p53 recognize DNA with identical amino acids and similar binding affinity. Here, measuring transactivation activity for a large number of response elements (REs) in yeast and human cell lines, we show that p53 family proteins also have overlapping transactivation profiles. We identified mutations at conserved amino acids of loops L1 and L3 in the DNA-binding domain that tune the transactivation potential nearly equally in p73, p63 and p53. For example, the mutant S139F in p73 has higher transactivation potential towards selected REs, enhanced DNA-binding cooperativity in vitro and a flexible loop L1 as seen in the crystal structure of the protein–DNA complex. By studying, how variations in the RE sequence affect transactivation specificity, we discovered a RE-transactivation code that predicts enhanced transactivation; this correlation is stronger for promoters of genes associated with apoptosis. PMID:23892287

  12. Treating cancer when pRb and p53 cannot be reactivated

    PubMed Central

    Zhu, Liang

    2015-01-01

    Activation of oncoproteins and inactivation of tumor suppressors induces tumorigenesis. When these events happen upstream of pRb and p53, cancer therapies may initially succeed and then fail when pRb and p53 are activated and then re-inactivated. Therapies might succeed if they remain effective when pRb and p53 are genetically inactivated. PMID:27308498

  13. MDM2 Inhibits Axin-Induced p53 Activation Independently of its E3 Ligase Activity.

    PubMed

    He, Ying; Lian, Guili; Lin, Shuyong; Ye, Zhiyun; Li, Qinxi

    2013-01-01

    MDM2 plays a crucial role in negatively regulating the functions of tumor suppressor p53. Here we show that MDM2 can inhibit Axin-stimulated p53-dependent apoptosis by suppressing p53 phosphorylation at Ser 46 and apoptosis-related p53 transactivational activity. Interestingly, the ubiquitin E3 ligase activity of MDM2 is not required for this inhibitory effect. Mechanically, either wildtype MDM2 or its E3-dead mutant, disrupts the Axin-based HIPK2/p53 complex formation by blocking the binding of p53 and HIPK2 to Axin. MDM2Δp53, a deletion mutant that lacks p53 binding domain fails to exert the inhibitory effect, demonstrating that the interaction of MDM2 and p53, but not its E3 ligase activity toward p53 plays key role in suppressing Axin-stimulated p53 activation. Our results thus have revealed a novel aspect of the mechanism by which MDM2 regulates p53 activities. PMID:23826318

  14. Accumulation of soluble and nucleolar-associated p53 proteins following cellular stress.

    PubMed

    Klibanov, S A; O'Hagan, H M; Ljungman, M

    2001-05-01

    The tumor suppressor p53 is a nucleocytoplasmic shuttling protein that accumulates in the nucleus of cells exposed to various cellular stresses. One important role of nuclear p53 is to mobilize a stress response by transactivating target genes such as the p21(Waf1) gene. In this study, we investigated more closely the localization of p53 in cells following various stresses. Immunocytochemistry of fixed human fibroblasts treated with either UV light, the kinase and transcription inhibitor DRB or the proteasome inhibitor MG132 revealed abundant p53 localized to the nucleus. When cells treated with UV or DRB were permeabilized prior to fixation to allow soluble proteins to diffuse, the nuclear p53 signal was abolished. However, in cells treated with MG132, residual p53 localized to distinct large foci. Furthermore, nucleolin co-localized with p53 to these foci, suggesting that these foci were nucleolar structures. Interestingly, the MDM2 protein was found to co-localize with p53 to nucleolar structures following proteasome inhibition. Our results suggest that the p53 proteins accumulating in the nucleus following UV-irradiation or blockage of transcription are freely soluble and, thus, should be able to roam the nucleus to ensure high occupancy of p53 binding sites. However, inhibition of proteasome activity may be a unique stress in that it leads to the sequestering of p53 proteins to the nucleolus, thereby blunting the p53-mediated transactivation of target genes. PMID:11329373

  15. p53 Promotes Cell Survival Due to the Reversibility of its Cell Cycle Checkpoints

    PubMed Central

    Lukin, Dana J.; Carvajal, Luis A.; Liu, Wen-jun; Resnick-Silverman, Lois; Manfredi, James J.

    2014-01-01

    The tumor suppressor p53 (TP53) has a well-studied role in triggering cell cycle checkpoint in response to DNA damage. Previous studies have suggested that functional p53 enhances chemosensitivity. In contrast, data are presented to show that p53 can be required for cell survival following DNA damage due to activation of reversible cell cycle checkpoints. The cellular outcome to DNA damage is determined by the duration and extent of the stimulus in a p53-dependent manner. In response to transient or low levels of DNA damage, p53 triggers a reversible G2 arrest whereas a sustained p53-dependent cell cycle arrest and senescence follows prolonged or high levels of DNA damage. Regardless of the length of treatment, p53-null cells arrest in G2, but ultimately adapt and proceed into mitosis. Interestingly, they fail to undergo cytokinesis, become multinucleated, and then die from apoptosis. Upon transient treatment with DNA damaging agents, wild-type p53 cells reversibly arrest and repair the damage, whereas p53-null cells fail to do so and die. These data indicate that p53 can promote cell survival by inducing reversible cell cycle arrest, thereby allowing for DNA repair. Thus, transient treatments may exploit differences between wild-type p53 and p53-null cells. PMID:25158956

  16. SnoN activates p53 directly to regulate aging and tumorigenesis.

    PubMed

    Pan, Deng; Zhu, Qingwei; Conboy, Michael J; Conboy, Irina M; Luo, Kunxin

    2012-10-01

    We have identified SnoN as a direct activator of p53 to accelerate aging and inhibit tumorigenesis. SnoN has been shown previously to promote proliferation and transformation by antagonizing TGFβ signaling. We show that elimination of this TGFβ antagonistic activity of SnoN in vivo results in accelerated aging and resistance to tumorigenesis. The SnoN knockin mice display a shortened lifespan, decreased reproductivity, osteoporosis, reduced regenerative capacity, and other aging phenotypes, similar to that found in mice expressing an active p53. These activities of SnoN rely on the ability of SnoN to activate p53. SnoN can bind directly to p53 and compete with Mdm2 for binding to p53, preventing p53 ubiquitination and degradation and additionally facilitating p53 acetylation and phosphorylation. SnoN also binds to p53 on the promoter of p53 responsive genes to promote transcription activation. This activation of p53 by SnoN is necessary for its antitumorigenic and progeria activities in vivo because elimination of one copy of p53 reverses the aging phenotypes and accelerates tumorigenesis. Thus, we have revealed a novel function of SnoN in regulating aging and tumorigenesis by directly activating p53. PMID:22805162

  17. Modeling and controlling the two-phase dynamics of the p53 network: a Boolean network approach

    NASA Astrophysics Data System (ADS)

    Lin, Guo-Qiang; Ao, Bin; Chen, Jia-Wei; Wang, Wen-Xu; Di, Zeng-Ru

    2014-12-01

    Although much empirical evidence has demonstrated that p53 plays a key role in tumor suppression, the dynamics and function of the regulatory network centered on p53 have not yet been fully understood. Here, we develop a Boolean network model to reproduce the two-phase dynamics of the p53 network in response to DNA damage. In particular, we map the fates of cells into two types of Boolean attractors, and we find that the apoptosis attractor does not exist for minor DNA damage, reflecting that the cell is reparable. As the amount of DNA damage increases, the basin of the repair attractor shrinks, accompanied by the rising of the apoptosis attractor and the expansion of its basin, indicating that the cell becomes more irreparable with more DNA damage. For severe DNA damage, the repair attractor vanishes, and the apoptosis attractor dominates the state space, accounting for the exclusive fate of death. Based on the Boolean network model, we explore the significance of links, in terms of the sensitivity of the two-phase dynamics, to perturbing the weights of links and removing them. We find that the links are either critical or ordinary, rather than redundant. This implies that the p53 network is irreducible, but tolerant of small mutations at some ordinary links, and this can be interpreted with evolutionary theory. We further devised practical control schemes for steering the system into the apoptosis attractor in the presence of DNA damage by pinning the state of a single node or perturbing the weight of a single link. Our approach offers insights into understanding and controlling the p53 network, which is of paramount importance for medical treatment and genetic engineering.

  18. Divergence between the high rate of p53 mutations in skin carcinomas and the low prevalence of anti-p53 antibodies

    PubMed Central

    Moch, C; Moysan, A; Lubin, R; Salmonière, P de La; Soufir, N; Galisson, F; Vilmer, C; Venutolo, E; Pelletier, F Le; Janin, A; Basset-Séguin, N

    2001-01-01

    Circulating anti-p53 antibodies have been described and used as tumoural markers in patients with various cancers and strongly correlate with the p53 mutated status of the tumours. No study has yet looked at the prevalence of such antibodies in skin carcinoma patients although these tumours have been shown to be frequently p53 mutated. Most skin carcinoma can be diagnosed by examination or biopsy, but aggressive, recurrent and/or non-surgical cases' follow up would be helped by a biological marker of residual disease. We performed a prospective study looking at the prevalence of anti-p53 antibodies using an ELISA technique in a series of 105 skin carcinoma patients in comparison with a sex- and age-matched control skin carcinoma-free group (n = 130). Additionally, p53 accumulation was studied by immunohistochemistry to confirm p53 protein altered expression in a sample of tumours. Anti-p53 antibodies were detected in 2.9% of the cases, with a higher prevalence in patients suffering from the more aggressive squamous cell type (SCC) of skin carcinoma (8%) than for the more common and slowly growing basal cell carcinoma type or BCC (1.5%). p53 protein stabilization could be confirmed in 80% of tumours studied by IHC. This low level of anti-p53 antibody detection contrasts with the high rate of p53 mutations reported in these tumours. This observation shows that the anti-p53 humoral response is a complex and tissue-specific mechanism. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11747330

  19. Genome-wide analysis of the p53 gene regulatory network in the developing mouse kidney

    PubMed Central

    Li, Yuwen; Liu, Jiao; McLaughlin, Nathan; Bachvarov, Dimcho; El-Dahr, Samir S.

    2013-01-01

    Despite mounting evidence that p53 senses and responds to physiological cues in vivo, existing knowledge regarding p53 function and target genes is largely derived from studies in cancer or stressed cells. Herein we utilize p53 transcriptome and ChIP-Seq (chromatin immunoprecipitation-high throughput sequencing) analyses to identify p53 regulated pathways in the embryonic kidney, an organ that develops via mesenchymal-epithelial interactions. This integrated approach allowed identification of novel genes that are possible direct p53 targets during kidney development. We find the p53-regulated transcriptome in the embryonic kidney is largely composed of genes regulating developmental, morphogenesis, and metabolic pathways. Surprisingly, genes in cell cycle and apoptosis pathways account for <5% of differentially expressed transcripts. Of 7,893 p53-occupied genomic regions (peaks), the vast majority contain consensus p53 binding sites. Interestingly, 78% of p53 peaks in the developing kidney lie within proximal promoters of annotated genes compared with 7% in a representative cancer cell line; 25% of the differentially expressed p53-bound genes are present in nephron progenitors and nascent nephrons, including key transcriptional regulators, components of Fgf, Wnt, Bmp, and Notch pathways, and ciliogenesis genes. The results indicate widespread p53 binding to the genome in vivo and context-dependent differences in the p53 regulon between cancer, stress, and development. To our knowledge, this is the first comprehensive analysis of the p53 transcriptome and cistrome in a developing mammalian organ, substantiating the role of p53 as a bona fide developmental regulator. We conclude p53 targets transcriptional networks regulating nephrogenesis and cellular metabolism during kidney development. PMID:24003036

  20. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

    PubMed

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  1. Immunohistochemical detection of p53 in Wilms' tumors correlates with unfavorable outcome.

    PubMed Central

    Lahoti, C.; Thorner, P.; Malkin, D.; Yeger, H.

    1996-01-01

    The role of p53 in the pathogenesis and progression of Wilms' tumors is only partly understood. Although p53 mutations were initially reported only in anaplastic Wilms' tumors, we had reported that, of two of twenty-one cases that had a p53 mutation, one tumor showed no evidence of anaplasia. To determine the significance of p53 expression in all clinical stages of Wilms' tumor, twenty-eight cases were analyzed for p53 immunoreactivity. Paraffin sections were immunolabeled with two different monoclonal antibodies, recognizing both mutant and wild-type p53. Fifteen of sixteen tumors in the recurrent/metastatic group and three of twelve tumors in the nonmetastatic/nonrecurrent group showed p53 immunopositivity. Only one of three positive tumors in the latter group showed moderate to strong positivity, whereas twelve of sixteen metastatic/recurrent tumors revealed a similar degree of p53 positivity. The positivity was stronger in the metastasis/recurrences as compared with the corresponding primary tumor. Western blot analysis revealed p53 expression in all of the Wilms' tumors tested, suggesting its involvement in the development of Wilms' tumors. Single-strand conformation polymorphism analysis performed on twenty-three of these tumors revealed p53 mutations in four of fourteen recurrent/metastatic tumors and none in the nonmetastatic/nonrecurrent group. Our results show that, whereas 60% of cases were immunopositive for p53 protein, mutations were detected in only 16% of tumors, indicating that wild-type p53 protein is retained in the other tumors. We conclude that p53 immunopositivity strongly correlates with recurrence/metastasis in Wilms' tumors. Furthermore, the accumulation of p53 in these tumors is not only due to mutations but may also involve stabilization of normal p53 with other proteins. Images Figure 1 Figure 2 Figure 3 PMID:8623926

  2. Cardiac glycosides inhibit p53 synthesis by a mechanism relieved by Src or MAPK inhibition

    PubMed Central

    Wang, Zhen; Zheng, Min; Li, Zhichuan; Li, Ruiguo; Jia, Lijun; Xiong, Xiufang; Southall, Noel; Wang, Shaomeng; Xia, Menghang; Austin, Christopher P.; Zheng, Wei; Xie, Zijian; Sun, Yi

    2009-01-01

    p53 is regulated at the multiple levels. We report here that p53 in multiple lines of human cancer cells is down-regulated by cardiac glycoside drugs, digoxin or ouabain, the potent inhibitors of Na+/K+-ATPase. These drugs reduced the basal levels of p53 protein at nanomolar concentrations in a dose-, time- and cancer cell line-dependent manner, but independent of p53 status of wild type (wt) or mutant. The drugs also reduced the levels of p53 induced by its activators as well as p53 transfected into human cancer cells, regardless of its status. Interestingly, the drugs had no effect on endogenous p53 in two immortalized human cell lines. Mechanistically, p53 reduction did not occur at the mRNA levels, but at the protein levels, as a result of reduced protein synthesis rather than enhanced degradation. The cellular sensitivity to drug-induced p53 reduction was not associated with the levels of α subunits of Na+/K+-ATPase in different cell lines. While lowering extracellular K+ did not reduce p53 as did ouabain and digoxin, it did potentiate both digoxin and ouabain-induced p53 reduction in sensitive lines. Finally, p53 reduction appears to be triggered by activation of Src/MAPK signaling pathways upon drug binding to the Na+/K+-ATPase and can be completely blocked by the inhibitors of Src or MEK. This is the first report that cardiac glycoside drugs, by initiating the Src/MAPK signaling pathways, reduce the p53 levels via inhibition of p53 protein synthesis. The drugs may be useful in the treatment of human cancers with a gain-of-function p53 mutation. PMID:19679550

  3. Reversible induction of translational isoforms of p53 in glucose deprivation

    PubMed Central

    Khan, D; Katoch, A; Das, A; Sharathchandra, A; Lal, R; Roy, P; Das, S; Chattopadhyay, S; Das, S

    2015-01-01

    Tumor suppressor protein p53 is a master transcription regulator, indispensable for controlling several cellular pathways. Earlier work in our laboratory led to the identification of dual internal ribosome entry site (IRES) structure of p53 mRNA that regulates translation of full-length p53 and Δ40p53. IRES-mediated translation of both isoforms is enhanced under different stress conditions that induce DNA damage, ionizing radiation and endoplasmic reticulum stress, oncogene-induced senescence and cancer. In this study, we addressed nutrient-mediated translational regulation of p53 mRNA using glucose depletion. In cell lines, this nutrient-depletion stress relatively induced p53 IRES activities from bicistronic reporter constructs with concomitant increase in levels of p53 isoforms. Surprisingly, we found scaffold/matrix attachment region-binding protein 1 (SMAR1), a predominantly nuclear protein is abundant in the cytoplasm under glucose deprivation. Importantly under these conditions polypyrimidine-tract-binding protein, an established p53 ITAF did not show nuclear-cytoplasmic relocalization highlighting the novelty of SMAR1-mediated control in stress. In vivo studies in mice revealed starvation-induced increase in SMAR1, p53 and Δ40p53 levels that was reversible on dietary replenishment. SMAR1 associated with p53 IRES sequences ex vivo, with an increase in interaction on glucose starvation. RNAi-mediated-transient SMAR1 knockdown decreased p53 IRES activities in normal conditions and under glucose deprivation, this being reflected in changes in mRNAs in the p53 and Δ40p53 target genes involved in cell-cycle arrest, metabolism and apoptosis such as p21, TIGAR and Bax. This study provides a new physiological insight into the regulation of this critical tumor suppressor in nutrient starvation, also suggesting important functions of the p53 isoforms in these conditions as evident from the downstream transcriptional target activation. PMID:25721046

  4. PPM1D phosphatase, a target of p53 and RBM38 RNA-binding protein, inhibits p53 mRNA translation via dephosphorylation of RBM38

    PubMed Central

    Zhang, Min; Xu, Enshun; Zhang, Jin; Chen, Xinbin

    2015-01-01

    PPM1D phosphatase, also called wild-type p53-induced phosphatase 1 (Wip1), promotes tumor development by inactivating the p53 tumor suppressor pathway. RBM38 RNA-binding protein, also called RNPC1 and a target of p53, inhibits p53 mRNA translation, which can be reversed by GSK3 protein kinase via phosphorylation of RBM38 at serine 195. Here we showed that ectopic expression of RBM38 increases, whereas knockdown of RBM38 inhibits, PPM1D mRNA translation. Consistent with this, we found that RBM38 directly binds to PPM1D 3' untranslated region (3’UTR) and promotes expression of a heterologous reporter gene that carries PPM1D 3’UTR in a dose-dependent manner. Interestingly, we showed that PPM1D directly interacts with and dephosphorylates RBM38 at serine 195. Furthermore, we showed that PPM1D modulates p53 mRNA translation and p53-dependent growth suppression through dephosphorylation of RBM38. These findings provide evidence that the crosstalk between PPM1D and RBM38, both of which are targets and modulators of p53, plays a critical role in p53 expression and activity. PMID:25823026

  5. Aspirin acetylates wild type and mutant p53 in colon cancer cells: identification of aspirin acetylated sites on recombinant p53.

    PubMed

    Ai, Guoqiang; Dachineni, Rakesh; Kumar, D Ramesh; Marimuthu, Srinivasan; Alfonso, Lloyd F; Bhat, G Jayarama

    2016-05-01

    Aspirin's ability to inhibit cell proliferation and induce apoptosis in cancer cell lines is considered to be an important mechanism for its anti-cancer effects. We previously demonstrated that aspirin acetylated the tumor suppressor protein p53 at lysine 382 in MDA-MB-231 human breast cancer cells. Here, we extended these observations to human colon cancer cells, HCT 116 harboring wild type p53, and HT-29 containing mutant p53. We demonstrate that aspirin induced acetylation of p53 in both cell lines in a concentration-dependent manner. Aspirin-acetylated p53 was localized to the nucleus. In both cell lines, aspirin induced p21(CIP1). Aspirin also acetylated recombinant p53 (rp53) in vitro suggesting that it occurs through a non-enzymatic chemical reaction. Mass spectrometry analysis and immunoblotting identified 10 acetylated lysines on rp53, and molecular modeling showed that all lysines targeted by aspirin are surface exposed. Five of these lysines are localized to the DNA-binding domain, four to the nuclear localization signal domain, and one to the C-terminal regulatory domain. Our results suggest that aspirin's anti-cancer effect may involve acetylation and activation of wild type and mutant p53 and induction of target gene expression. This is the first report attempting to characterize p53 acetylation sites targeted by aspirin. PMID:26596838

  6. p53MutaGene: an online tool to estimate the effect of p53 mutational status on gene regulation in cancer

    PubMed Central

    Amelio, I; Knight, R A; Lisitsa, A; Melino, G; Antonov, A V

    2016-01-01

    p53MutaGene is the first online tool for statistical validation of hypotheses regarding the effect of p53 mutational status on gene regulation in cancer. This tool is based on several large-scale clinical gene expression data sets and currently covers breast, colon and lung cancers. The tool detects differential co-expression patterns in expression data between p53 mutated versus p53 normal samples for the user-specified genes. Statistically significant differential co-expression for a gene pair is indicative that regulation of two genes is sensitive to the presence of p53 mutations. p53MutaGene can be used in ‘single mode' where the user can test a specific pair of genes or in ‘discovery mode' designed for analysis of several genes. Using several examples, we demonstrate that p53MutaGene is a useful tool for fast statistical validation in clinical data of p53-dependent gene regulation patterns. The tool is freely available at http://www.bioprofiling.de/tp53 PMID:26986515

  7. Genome-scale functional analysis of the human genes modulating p53 activity by regulating MDM2 expression in a p53-independent manner.

    PubMed

    Kim, Dong Min; Choi, Seung-Hyun; Yeom, Young Il; Min, Sang-Hyun; Kim, Il-Chul

    2016-09-16

    MDM2, a critical negative regulator of p53, is often overexpressed in leukemia, but few p53 mutations are found, suggesting that p53-independent MDM2 expression occurs due to alterations in MDM2 upstream regulators. In this study, a high MDM2 transcription level was observed (41.17%) regardless of p53 expression in patient with acute myeloid leukemia (AML). Therefore, we performed genome-scale functional screening of the human genes modulating MDM2 expression in a p53-independent manner. We searched co-expression profiles of genes showing a positive or negative pattern with MDM2 expression in a DNA microarray database, selected1089 links, and composed a screening library of 368 genes. Using MDM2 P1 and P2 promoter-reporter systems, we screened clones regulating MDM2 transcriptions in a p53-independent manner by overexpression. Nine clones from the screening library showed enhanced MDM2 promoter activity and MDM2 expression in p53-deficient HCT116 cells. Among them, six clones, including NTRK2, GNA15, SFRS2, EIF5A, ELAVL1, and YWHAB mediated MAPK signaling for expressing MDM2. These results indicate that p53-independent upregulation of MDM2 by increasing selected clones may lead to oncogenesis in AML and that MDM2-modulating genes are novel potential targets for AML treatment. PMID:27524244

  8. The novel partnership of L-GILZ and p53: a new affair in cancer?

    PubMed Central

    Ayroldi, Emira; Marchetti, Cristina; Riccardi, Carlo

    2015-01-01

    A recent report from our laboratory reveals how long glucocorticoid-induced leucine zipper (L-Gilz) protein binds to p53 and mouse double minute 2 homolog (Mdm2), thus dissociating the p53/Mdm2 complex and activating p53 with subsequent activation of downstream genes p21 and p53 upregulated modulator of apoptosis (Puma). p53 activation appears to be the mechanism by which both basal and glucocorticoid (GC)-induced L-Gilz inhibits proliferation and induces antioncogenic activity in human cancer. PMID:27308427

  9. The anti-leukemic activity of sodium dichloroacetate in p53mutated/null cells is mediated by a p53-independent ILF3/p21 pathway

    PubMed Central

    Agnoletto, Chiara; Brunelli, Laura; Melloni, Elisabetta; Pastorelli, Roberta; Casciano, Fabio; Rimondi, Erika; Rigolin, Gian Matteo; Cuneo, Antonio; Secchiero, Paola; Zauli, Giorgio

    2015-01-01

    B-chronic lymphocytic leukemia (B-CLL) patients harboring p53 mutations are invariably refractory to therapies based on purine analogues and have limited treatment options and poor survival. Having recently demonstrated that the mitochondria-targeting small molecule sodium dichloroacetate (DCA) exhibits anti-leukemic activity in p53wild-type B-CLL cells, the aim of this study was to evaluate the effect of DCA in p53mutated B-CLL cells and in p53mutated/null leukemic cell lines. DCA exhibited comparable cytotoxicity in p53wild-type and p53mutated B-CLL patient cell cultures, as well as in p53mutated B leukemic cell lines (MAVER, MEC-1, MEC-2). At the molecular level, DCA promoted the transcriptional induction of p21 in all leukemic cell types investigated, including p53null HL-60. By using a proteomic approach, we demonstrated that DCA up-regulated the ILF3 transcription factor, which is a known regulator of p21 expression. The role of the ILF3/p21 axis in mediating the DCA anti-leukemic activity was underscored by knocking-down experiments. Indeed, transfection with ILF3 and p21 siRNAs significantly decreased both the DCA-induced p21 expression and the DCA-mediated cytotoxicity. Taken together, our results emphasize that DCA is a small molecule that merits further evaluation as a therapeutic agent also for p53mutated leukemic cells, by acting through the induction of a p53-independent pathway. PMID:25544776

  10. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    PubMed

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-01

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells. PMID:27551077

  11. Regulation of myo-inositol biosynthesis by p53-ISYNA1 pathway.

    PubMed

    Koguchi, Tomoyuki; Tanikawa, Chizu; Mori, Jinichi; Kojima, Yoshiyuki; Matsuda, Koichi

    2016-06-01

    In response to various cellular stresses, p53 exerts its tumor suppressive effects such as apoptosis, cell cycle arrest, and senescence through the induction of its target genes. Recently, p53 was shown to control cellular homeostasis by regulating energy metabolism, glycolysis, antioxidant effect, and autophagy. However, its function in inositol synthesis was not reported. Through a microarray screening, we found that five genes related with myo-inositol metabolism were induced by p53. DNA damage enhanced intracellular myo-inositol content in HCT116 p53+/+ cells, but not in HCT116 p53-/- cells. We also indicated that inositol 3-phosphate synthase (ISYNA1) which encodes an enzyme essential for myo-inositol biosynthesis as a direct target of p53. Activated p53 regulated ISYNA1 expression through p53 response element in the seventh exon. Ectopic ISYNA1 expression increased myo-inositol levels in the cells and suppressed tumor cell growth. Knockdown of ISYNA1 caused resistance to adriamycin treatment, demonstrating the role of ISYNA1 in p53-mediated growth suppression. Furthermore, ISYNA1 expression was significantly associated with p53 mutation in bladder, breast cancer, head and neck squamous cell carcinoma, lung squamous cell carcinoma, and pancreatic adenocarcinoma. Our findings revealed a novel role of p53 in myo-inositol biosynthesis which could be a potential therapeutic target. PMID:27035231

  12. The transcription factor CREBZF is a novel positive regulator of p53

    PubMed Central

    López-Mateo, Irene; Villaronga, M. Ángeles; Llanos, Susana; Belandia, Borja

    2012-01-01

    CREBZF is a member of the mammalian ATF/CREB family of transcription factors. Here, we describe a novel functional interaction between CREBZF and the tumor suppressor p53. CREBZF was identified in a yeast two-hybrid screen using HEY1, recently characterized as an indirect p53 activator, as bait. CREBZF interacts in vitro with both HEY1 and p53, and CREBZF expression stabilizes and activates p53. Moreover, CREBZF cooperates synergistically with HEY1 to enhance p53 transcriptional activity. On the other hand, partial depletion of endogenous CREBZF diminishes p53 protein levels and inhibits HEY1-mediated activation of p53. CREBZF-positive effects on p53 signaling may reflect, at least in part, an observed induction of posttranslational modifications in p53 known to prevent its degradation. CREBZF expression protects HCT116 cells from UV radiation-induced cell death. In addition, CREBZF expression confers sensitivity to 5-fluorouracil, a p53-activating chemotherapeutic drug. Our study suggests that CREBZF may participate in the modulation of p53 tumor suppressor function. PMID:22983008

  13. Negative Regulation of Tumor Suppressor p53 by microRNA miR-504

    PubMed Central

    Hu, Wenwei; Chan, Chang S.; Wu, Rui; Zhang, Cen; Sun, Yvonne; Song, Jun S.; Tang, Laura H.; Levine, Arnold J.; Feng, Zhaohui

    2010-01-01

    Summary Tumor suppressor p53 plays a central role in tumor prevention. p53 protein levels and activity are under a tight and complex regulation in cells to maintain the proper function of p53. microRNAs play a key role in the regulation of gene expression. Here we report the regulation of p53 through microRNA miR-504. miR-504 acts as a negative regulator of human p53 through its direct binding to two sites in p53 3′-UTR. Overexpression of miR-504 decreases p53 protein levels and functions in cells, including p53 transcriptional activity, p53-mediated apoptosis and cell cycle arrest in response to stress, and furthermore, promotes tumorigenecity of cells in vivo. These results demonstrate the direct negative regulation of p53 by miR-504 as a mechanism for p53 regulation in cells, which highlights the importance of microRNAs in tumorigenesis. PMID:20542001

  14. Transcriptional repressor NIR interacts with the p53-inhibiting ubiquitin ligase MDM2

    PubMed Central

    Heyne, Kristina; Förster, Juliane; Schüle, Roland; Roemer, Klaus

    2014-01-01

    NIR (novel INHAT repressor) can bind to p53 at promoters and inhibit p53-mediated gene transactivation by blocking histone acetylation carried out by p300/CBP. Like NIR, the E3 ubiquitin ligase MDM2 can also bind and inhibit p53 at promoters. Here, we present data indicating that NIR, which shuttles between the nucleolus and nucleoplasm, not only binds to p53 but also directly to MDM2, in part via the central acidic and zinc finger domain of MDM2 that is also contacted by several other nucleolus-based MDM2/p53-regulating proteins. Like some of these, NIR was able to inhibit the ubiquitination of MDM2 and stabilize MDM2; however, unlike these nucleolus-based MDM2 regulators, NIR did not inhibit MDM2 to activate p53. Rather, NIR cooperated with MDM2 to repress p53-induced transactivation. This cooperative repression may at least in part involve p300/CBP. We show that NIR can block the acetylation of p53 and MDM2. Non-acetylated p53 has been documented previously to more readily associate with inhibitory MDM2. NIR may thus help to sustain the inhibitory p53:MDM2 complex, and we present evidence suggesting that all three proteins can indeed form a ternary complex. In sum, our findings suggest that NIR can support MDM2 to suppress p53 as a transcriptional activator. PMID:24413661

  15. The transcription factor CREBZF is a novel positive regulator of p53.

    PubMed

    López-Mateo, Irene; Villaronga, M Ángeles; Llanos, Susana; Belandia, Borja

    2012-10-15

    CREBZF is a member of the mammalian ATF/CREB family of transcription factors. Here, we describe a novel functional interaction between CREBZF and the tumor suppressor p53. CREBZF was identified in a yeast two-hybrid screen using HEY1, recently characterized as an indirect p53 activator, as bait. CREBZF interacts in vitro with both HEY1 and p53, and CREBZF expression stabilizes and activates p53. Moreover, CREBZF cooperates synergistically with HEY1 to enhance p53 transcriptional activity. On the other hand, partial depletion of endogenous CREBZF diminishes p53 protein levels and inhibits HEY1-mediated activation of p53. CREBZF-positive effects on p53 signaling may reflect, at least in part, an observed induction of posttranslational modifications in p53 known to prevent its degradation. CREBZF expression protects HCT116 cells from UV radiation-induced cell death. In addition, CREBZF expression confers sensitivity to 5-fluorouracil, a p53-activating chemotherapeutic drug. Our study suggests that CREBZF may participate in the modulation of p53 tumor suppressor function. PMID:22983008

  16. 9-Hydroxyellipticine alters the conformation and DNA binding characteristics of mutated p53 protein.

    PubMed

    Sugikawa, E; Tsunoda, S; Nakanishi, N; Ohashi, M

    2001-01-01

    The tumor suppressor protein p53 is a phosphoprotein which shows growth and transformation suppression functions. Mutational loss of p53 function is the most frequently detected genetic event in human cancers. We examined whether 9-hydroxyellipticine (9HE), a cytotoxic agent, affected the tertiary structure of mutant p53 and DNA binding characteristics. Although several types of p53 mutants were resistant to degradation by calpain, the p53 mutants treated with 9HE were markedly sensitive to calpain as well as wild-type p53. Furthermore, mutant p53 proteins isolated from 9HE-treated cells regained the ability to bind a wild-type-specific p53 DNA consensus sequence. Wild-type p53 proteins prepared from both untreated and 9HE-treated cells bound the p53 consensus sequence and were degradaded by calpain equally well. These results suggest that 9HE affects the tertiary structure of mutated p53, which results in the restoration of DNA binding characteristics. PMID:11724337

  17. Altered p53 in microdissected, metachronous, premalignant and malignant oral lesions from the same patients

    PubMed Central

    Li, Y-Q; Pavelic, Z P; Wang, L-J; McDonald, J S; Gleich, L; Munck-Wikland, E; Dacic, S; Danilovic, Z; Pavelic, L J; Wilson, K M; Gluckman, J L; Stambrook, P J

    1995-01-01

    Aims—To determine whether mutant p53 alleles harboured by malignant tumours of the oral cavity were also present in previous premalignant lesions at the same site. Methods—Paraffin embedded tumour specimens along with their premalignant counterparts were analysed for p53 alterations using immunohistochemistry, microdissection, polymerase chain reaction amplification, and DNA sequencing. Results—Malignant lesions from five of eight patients showed overexpression of p53 protein by immunohistochemistry. Upon DNA sequencing, two of these five specimens had p53 mutations. Of the five patients whose cancers showed p53 overexpression by immunohistochemistry, three had previous premalignant lesions that also had immunohistochemically detectable p53 protein. However, DNA sequencing showed that none of these three had mutations in the p53 gene. The remaining five premalignant lesions had no immunohistochemically detectable p53 protein. Conclusions—Some premalignant lesions have increased p53 protein which can be detected by staining with antibody to p53. This staining is not caused by mutations in p53 that are found in subsequent tumours at the same site. Images PMID:16696020

  18. Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

    PubMed

    Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

    2016-03-01

    Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality. PMID:26334721

  19. Stress-dependent nucleolin mobilization mediated by p53-nucleolin complex formation.

    PubMed

    Daniely, Yaron; Dimitrova, Diana D; Borowiec, James A

    2002-08-01

    We recently discovered that heat shock causes nucleolin to relocalize from the nucleolus to the nucleoplasm, whereupon it binds replication protein A and inhibits DNA replication initiation. We report that nucleolin mobilization also occurs following exposure to ionizing radiation (IR) and treatment with camptothecin. Mobilization was selective in that another nucleolar marker, upstream binding factor, did not relocalize in response to IR. Nucleolin relocalization was dependent on p53 and stress, the latter initially stimulating nucleolin-p53 complex formation. Nucleolin relocalization and complex formation in vivo were independent of p53 transactivation but required the p53 C-terminal regulatory domain. Nucleolin and p53 also interact directly in vitro, with a similar requirement for p53 domains. These data indicate a novel p53-dependent mechanism in which cell stress mobilizes nucleolin for transient replication inhibition and DNA repair. PMID:12138209

  20. Crosstalk between tumor suppressors p53 and PKCδ: Execution of the intrinsic apoptotic pathways.

    PubMed

    Dashzeveg, Nurmaa; Yoshida, Kiyotsugu

    2016-07-28

    p53 and PKCδ are tumor suppressors that execute apoptotic mechanisms in response to various cellular stresses. p53 is a transcription factor that is frequently mutated in human cancers; it regulates apoptosis in transcription-dependent and -independent ways in response to genotoxic stresses. PKCδ is a serine/threonine protein kinase and mutated in human cancers. Available evidence shows that PKCδ activates p53 by direct and/or indirect mechanisms. Moreover, PKCδ is also implicated in the transcriptional regulation of p53 in response to DNA damage. Recent findings demonstrated that p53, in turn, binds onto the PKCδ promoter and induces its expression upon DNA damage to facilitate apoptosis. Both p53 and PKCδ are associated with the apoptotic mechanisms in the mitochondria by regulating Bcl-2 family proteins to provide mitochondrial outer membrane permeabilization. This review discusses the crosstalk between p53 and PKCδ in the context of apoptotic cell death and cancer therapy. PMID:27130668

  1. PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence

    PubMed Central

    Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

    2015-01-01

    Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773

  2. [p53 activation by PI-3K family kinases after DNA double-strand breaks].

    PubMed

    Pernin, D; Uhrhammer, N; Verrelle, P; Bignon, Y J; Bay, J O

    2000-09-01

    p53 plays a central role in the cellular response to DNA double-strand breaks (DSBs), and to DNA damage in general. The protein kinases ATM, ATR and DNA-PK detect DSBs and transmit this information to p53 by phosphorylation. This phosphorylation dissociates p53 from its negative regulator, mdm2. p53 then undergoes further modification and activates transcription of the genes responsible for cell cycle arrest. In certain circumstances, p53 also activates transcription of the genes responsible for apoptosis. The dysfunction of this cascade of events is oncogenic, with P53 itself being the most commonly mutated gene in malignant cells, although mutations in both the DNA damage sensors and cell cycle checkpoint and apoptosis effectors are frequent. A more complete understanding of p53 and the proteins it interacts with may allow the development of new cancer treatments. PMID:11038413

  3. p53 and Cell Cycle Effects After DNA Damage

    PubMed Central

    Senturk, Emir; Manfredi, James J.

    2016-01-01

    Flow cytometry, a valuable technique that employs the principles of light scattering, light excitation, and emission of fluorochrome molecules, can be used to assess the cell cycle position of individual cells based on DNA content. After the permeabilization of cells, the DNA can be stained with a fluorescent dye. Cells which have a 2N amount of DNA can be distinguished from cells with a 4N amount of DNA, making flow cytometry a very useful tool for the analysis of cell cycle checkpoints following DNA damage. A critical feature of the cellular response to DNA damage is the ability to pause and repair the damage so that consequential mutations are not passed along to daughter generations of cells. If cells arrest prior to DNA replication, they will contain a 2N amount of DNA, whereas arrest after replication but before mitosis will result in a 4N amount of DNA. Using this technique, the role that p53 plays in cell cycle checkpoints following DNA damage can be evaluated based on changes in the profile of the G1, S, and G2/M phases of the cell cycle. PMID:23150436

  4. The tumor suppressor, p53 regulates the γA-crystallin gene during mouse lens development.

    PubMed

    Hu, X-H; Nie, Q; Yi, M; Li, T-T; Wang, Z-F; Huang, Z-X; Gong, X-D; Zhou, L; Ji, W-K; Hu, W-F; Liu, J-F; Wang, L; Woodward, Z; Zhu, J; Liu, W-B; Nguyen, Q D; Li, D W-C

    2014-01-01

    The tumor suppressor, p53 regulates a large number of target genes to control cell proliferation and apoptosis. In addition, it is also implicated in the regulation of cell differentiation in muscle, the circulatory system and various carcinoma tissues. We have recently shown that p53 also controls lens differentiation. Regarding the mechanism, we reveal that p53 directly regulates several genes including c-Maf and Prox1, two important transcription factors for lens differentiation, and αA and βA3/A1, the lens differentiation markers. In the present study, we present evidence to show that the γA-crystallin gene distal promoter and the first intron also contain p53 binding sites and are capable of mediating p53 control during mouse lens development. First, gel mobility shifting assays revealed that the p53 protein in nuclear extracts from human lens epithelial cells (HLE) directly binds to the p53 binding sites present in the γA-crystallin gene. Second, the exogenous wild type p53 induces the dose-dependent expression of the luciferase reporter gene driven by the basic promoter containing the γA-crystallin gene p53 binding site. In contrast, the exogenous dominant negative mutant p53 causes a dose-dependent inhibition of the same promoter. Third, ChIP assays revealed that p53 binds to the γA-crystallin gene promoter in vivo. Finally, in the p53 knockout mouse lenses, the expression level of the γAcrystallin gene was found attenuated in comparison with that in the wild type mouse lenses. Together, our results reveal that p53 regulates γA-crystallin gene expression during mouse lens development. Thus, p53 directly regulates all 3 types of crystallin genes to control lens differentiation. PMID:25336329

  5. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

    2015-01-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  6. BAC transgenic mice provide evidence that p53 expression is highly regulated in vivo

    PubMed Central

    Chen, L; Zhang, G X; Zhou, Y; Zhang, C X; Xie, Y Y; Xiang, C; He, X Y; Zhang, Q; Liu, G

    2015-01-01

    p53 is an important tumor suppressor and stress response mediator. Proper control of p53 level and activity is tightly associated with its function. Posttranslational modifications and the interactions with Mdm2 and Mdm4 are major mechanisms controlling p53 activity and stability. As p53 protein is short-lived and hardly detectable in unstressed situations, less is known on its basal level expression and the corresponding controlling mechanisms in vivo. In addition, it also remains obscure how p53 expression might contribute to its functional regulation. In this study, we established bacterial artificial chromosome transgenic E.coli β-galactosidase Z gene reporter mice to monitor p53 expression in mouse tissues and identify important regulatory elements critical for the expression in vivo. We revealed preferentially high level of p53 reporter expressions in the proliferating, but not the differentiated compartments of the majority of tissues during development and tissue homeostasis. In addition, tumors as well as regenerating tissues in the p53 reporter mice also expressed high level of β-gal. Furthermore, both the enhancer box sequence (CANNTG) in the p53 promoter and the 3′ terminal untranslated region element were critical in mediating the high-level expression of the reporter. We also provided evidence that cellular myelocytomatosis oncogene was a critical player regulating p53 mRNA expression in proliferating cells and tissues. Finally, we found robust p53 activation preferentially in the proliferating compartment of mouse tissues upon DNA damage and the proliferating cells exhibited an enhanced p53 response as compared with cells in a quiescent state. Together, these results suggested a highly regulated expression pattern of p53 in the proliferating compartment controlled by both transcriptional and posttranscriptional mechanisms, and such regulated p53 expression may impose functional significance upon stress by setting up a precautionary mode in

  7. Characterization of p53 mutations in colorectal liver metastases and correlation with clinical parameters.

    PubMed

    Tullo, A; D'Erchia, A M; Honda, K; Mitry, R R; Kelly, M D; Habib, N A; Saccone, C; Sbisà, E

    1999-11-01

    The presence and type of mutations of the p53 tumor suppressor gene were determined in 40 patients undergoing curative hepatic resection for metastatic colorectal carcinoma. This represents the largest series in the literature on the screening of p53 mutations for liver metastases. The analysis was performed in exons 5-9 by denaturing gradient gel electrophoresis followed by direct sequencing. Forty-five percent of tumors showed mutation in p53, and this was observed only in exons 5-8. Mutations at codon positions 167, 196, 204, 213, 245, 281, 282, 286, and 306; deletion of codon 251 and of the first nucleotide of codon 252; and Leu residue (CTC) insertion downstream codon 252 are reported for the first time in colorectal liver metastasis. Mutations at codon positions 163, 248, and 273 have been reported previously. Correlation of p53 status with clinical parameters showed that patients with mutated p53 had a statistically higher number of lesions when compared with patients with wild-type p53 (P<0.050). In particular, of patients with mutated p53, 41% had three or more metastases compared with 14% of patients with wild-type p53. Synchronous metastases were present in 70% of the patients with p53 mutations and in only 29% of patients with wild-type p53 (P<0.025). In addition, patients with p53 mutations are more likely to develop recurrence (73%) compared with patients with wild-type p53 (33%; P<0.001). Other factors considered, including preoperative carcinoembryonic antigen level, bilobar distribution, and size of the lesion(s), did not show significant correlation with p53 status. These results suggest that p53 status might be an important prognostic indicator to predict the pattern and likelihood of treatment failure after hepatic resection. PMID:10589767

  8. Controlled Access of p53 to the Nucleus Regulates its Proteasomal Degradation by MDM2

    PubMed Central

    Davis, James R.; Mossalam, Mohanad; Lim, Carol S.

    2013-01-01

    The tumor suppressor p53 can be sent to the proteasome for degradation by placing its nucleo-cytoplasmic shuttling under ligand control. Endogenous p53 is ubiquitinated by MDM2 in the nucleus, and controlling the access of p53 to the nuclear compartment regulates its ubiquitination and proteasomal degradation. This was accomplished by the use of a “protein switch” that places nuclear translocation under the control of externally applied dexamethasone. Fluorescence microscopy revealed that sending protein switch p53 (PS-p53) to the nucleus produces a distinct punctate distribution in both the cytoplasm and nucleus. The nuclear role in accessing the proteasome was investigated by inhibiting classical nuclear export with leptomycin B. Trapping PS-p53 in the nucleus only allows this punctate staining in that compartment, suggesting that PS-p53 must translocate first to the nuclear compartment for cytoplasmic punctate staining to occur. The role of MDM2 binding was explored by inhibiting MDM2/p53 binding with nutlin-3. Inhibition of this interaction blocked both nuclear export and cytoplasmic and nuclear punctate staining, providing evidence that any change in localization after nuclear translocation is due to MDM2 binding. Further, blocking the proteolytic activity of the proteasome maintained the nuclear localization of the construct. Truncations of p53 were made to determine smaller constructs still capable of interacting with MDM2, and their subcellular localization and degradation potential was observed. PS-p53 and a smaller construct, construct containing the two MDM2 binding regions of p53 (Box I+V) were indeed degraded by the proteasome as measured by loss of enhanced green fluorescent protein that was also fused to the construct. The influence of these constructs on p53 gene transactivation function was assessed, and revealed that PS-p53 decreased gene transactivation, while PS-p53(BoxI+V) did not significantly change baseline gene transactivation. PMID

  9. Adenoviral-E2F-1 radiosensitizes p53{sup wild-type} and p53{sup null} human prostate cancer cells

    SciTech Connect

    Nguyen, Khanh H.; Hachem, Paul; Khor, L.-Y.; Salem, Naji; Hunt, Kelly K.; Calkins, Peter R.; Pollack, Alan . E-mail: Alan.Pollack@fccc.edu

    2005-09-01

    Purpose: E2F-1 is a transcription factor that enhances the radiosensitivity of various cell lines by inducing apoptosis. However, there are conflicting data concerning whether this enhancement is mediated via p53 dependent pathways. Additionally, the role of E2F-1 in the response of human prostate cancer to radiation has not been well characterized. In this study, we investigated the effect of Adenoviral-E2F-1 (Ad-E2F-1) on the radiosensitivity of p53{sup wild-type} (LNCaP) and p53{sup null} (PC3) prostate cancer cell lines. Methods and Materials: LNCaP and PC3 cells were transduced with Ad-E2F-1, Adenoviral-Luciferase (Ad-Luc) control vector, or Adenoviral-p53 (Ad-p53). Expression of E2F-1 and p53 was examined by Western blot analysis. Annexin V and caspase 3 + 7 assays were performed to estimate the levels of apoptosis. Clonogenic survival assays were used to determine overall cell death. Statistical significance was determined by analysis of variance, using the Bonferroni method to correct for multiple comparisons. Results: Western blot analysis confirmed the efficacy of transductions with Ad-E2F-1 and Ad-p53. Ad-E2F-1 transduction significantly enhanced apoptosis and decreased clonogenic survival in both cell lines. These effects were compounded by the addition of RT. Although E2F-1-mediated radiosensitization was independent of p53 status, this effect was more pronounced in p53{sup wild-type} LNCaP cells. When PC3 cells were treated with Ad-p53 in combination with RT and Ad-E2F-1, there was at least an additive reduction in clonogenic survival. Conclusions: Our results suggest that Ad-E2F-1 significantly enhances the response of p53{sup wild-type} and p53{sup null} prostate cancer cells to radiation therapy, although radiosensitization is more pronounced in the presence of p53. Ad-E2F-1 may be a useful adjunct to radiation therapy in the treatment of prostate cancer.

  10. Arsenite tolerance in rice (Oryza sativa L.) involves coordinated role of metabolic pathways of thiols and amino acids.

    PubMed

    Tripathi, Preeti; Tripathi, Rudra Deo; Singh, Rana Pratap; Dwivedi, Sanjay; Chakrabarty, Debasis; Trivedi, Prabodh K; Adhikari, Bijan

    2013-02-01

    Thiolic ligands and several amino acids (AAs) are known to build up in plants against heavy metal stress. In the present study, alteration of various AAs in rice and its synchronized role with thiolic ligand was explored for arsenic (As) tolerance and detoxification. To understand the mechanism of As tolerance and stress response, rice seedlings of one tolerant (Triguna) and one sensitive (IET-4786) cultivar were exposed to arsenite (0-25 μM) for 7 days for various biochemical analyses using spectrophotometer, HPLC and ICPMS. Tolerant and sensitive cultivars respond differentially in terms of thiol metabolism, essential amino acids (EEAs) and nonessential amino acids (NEEAs) vis-á-vis As accumulation. Thiol biosynthesis-related enzymes were positively correlated to As accumulation in Triguna. Conversely, these enzymes, cysteine content and GSH/GSSG ratio declined significantly in IET-4786 upon As exposure. The level of identified phytochelatin (PC) species (PC(2), PC(3) and PC(4)) and phytochelatin synthase activity were also more pronounced in Triguna than IET-4786. Nearly all EAAs were negatively affected by As-induced oxidative stress (except phenylalanine in Triguna), but more significantly in IET-4786 than Triguna. However, most of the stress-responsive NEAAs like glutamic acid, histidine, alanine, glycine, tyrosine, cysteine and proline were enhanced more prominently in Triguna than IET-4786 upon As exposure. The study suggests that IET-4786 appears sensitive to As due to reduction of AAs and thiol metabolic pathway. However, a coordinated response of thiolic ligands and stress-responsive AAs seems to play role for As tolerance in Triguna to achieve the effective complexation of As by PCs. PMID:23054772

  11. Cisplatin modulates B-cell translocation gene 2 to attenuate cell proliferation of prostate carcinoma cells in both p53-dependent and p53-independent pathways.

    PubMed

    Chiang, Kun-Chun; Tsui, Ke-Hung; Chung, Li-Chuan; Yeh, Chun-Nan; Feng, Tsui-Hsia; Chen, Wen-Tsung; Chang, Phei-Lang; Chiang, Hou-Yu; Juang, Horng-Heng

    2014-01-01

    Cisplatin is a widely used anti-cancer drug. The B-cell translocation gene 2 (BTG2) is involved in the cell cycle transition regulation. We evaluated the cisplatin effects on prostate cancer cell proliferation and the expressions of BTG2, p53, androgen receptor (AR) and prostate specific antigen (PSA) in prostate carcinoma, p53 wild-type LNCaP or p53-null PC-3, cells. Cisplatin treatments attenuated cell prostate cancer cell growth through inducing Go/G1 cell cycle arrest in lower concentration and apoptosis at higher dosage. Cisplatin treatments enhanced p53 and BTG2 expression, repressed AR and PSA expression, and blocked the activation of androgen on the PSA secretion in LNCaP cells. BTG2 knockdown in LNCaP cells attenuated cisplatin-mediated growth inhibition. Cisplatin enhanced BTG2 gene expression dependent on the DNA fragment located within -173 to -82 upstream of BTG2 translation initiation site in prostate cancer cells. Mutation of the p53 response element from GGGCAGAGCCC to GGGCACC or mutation of the NFκB response element from GGAAAGTCC to GGAAAGGAA by site-directed mutagenesis abolished the stimulation of cisplatin on the BTG2 promoter activity in LNCaP or PC-3 cells, respectively. Our results indicated that cisplatin attenuates prostate cancer cell proliferation partly mediated by upregulation of BTG2 through the p53-dependent pathway or p53-independent NFκB pathway. PMID:24981574

  12. Cisplatin modulates B-cell translocation gene 2 to attenuate cell proliferation of prostate carcinoma cells in both p53-dependent and p53-independent pathways

    PubMed Central

    Chiang, Kun-Chun; Tsui, Ke-Hung; Chung, Li-Chuan; Yeh, Chun-Nan; Feng, Tsui-Hsia; Chen, Wen-Tsung; Chang, Phei-Lang; Chiang, Hou-Yu; Juang, Horng-Heng

    2014-01-01

    Cisplatin is a widely used anti-cancer drug. The B-cell translocation gene 2 (BTG2) is involved in the cell cycle transition regulation. We evaluated the cisplatin effects on prostate cancer cell proliferation and the expressions of BTG2, p53, androgen receptor (AR) and prostate specific antigen (PSA) in prostate carcinoma, p53 wild-type LNCaP or p53-null PC-3, cells. Cisplatin treatments attenuated cell prostate cancer cell growth through inducing Go/G1 cell cycle arrest in lower concentration and apoptosis at higher dosage. Cisplatin treatments enhanced p53 and BTG2 expression, repressed AR and PSA expression, and blocked the activation of androgen on the PSA secretion in LNCaP cells. BTG2 knockdown in LNCaP cells attenuated cisplatin-mediated growth inhibition. Cisplatin enhanced BTG2 gene expression dependent on the DNA fragment located within -173 to -82 upstream of BTG2 translation initiation site in prostate cancer cells. Mutation of the p53 response element from GGGCAGAGCCC to GGGCACC or mutation of the NFκB response element from GGAAAGTCC to GGAAAGGAA by site-directed mutagenesis abolished the stimulation of cisplatin on the BTG2 promoter activity in LNCaP or PC-3 cells, respectively. Our results indicated that cisplatin attenuates prostate cancer cell proliferation partly mediated by upregulation of BTG2 through the p53-dependent pathway or p53-independent NFκB pathway. PMID:24981574

  13. Nitric oxide-induced p53 accumulation and regulation of inducible nitric oxide synthase expression by wild-type p53.

    PubMed Central

    Forrester, K; Ambs, S; Lupold, S E; Kapust, R B; Spillare, E A; Weinberg, W C; Felley-Bosco, E; Wang, X W; Geller, D A; Tzeng, E; Billiar, T R; Harris, C C

    1996-01-01

    The tumor suppressor gene product p53 plays an important role in the cellular response to DNA damage from exogenous chemical and physical mutagens. Therefore, we hypothesized that p53 performs a similar role in response to putative endogenous mutagens, such as nitric oxide (NO). We report here that exposure of human cells to NO generated from an NO donor or from overexpression of inducible nitric oxide synthase (NOS2) results in p53 protein accumulation. In addition, expression of wild-type (WT) p53 in a variety of human tumor cell lines, as well as murine fibroblasts, results in down-regulation of NOS2 expression through inhibition of the NOS2 promoter. These data are consistent with the hypothesis of a negative feedback loop in which endogenous NO-induced DNA damage results in WT p53 accumulation and provides a novel mechanism by which p53 safeguards against DNA damage through p53-mediated transrepression of NOS2 gene expression, thus reducing the potential for NO-induced DNA damage. Images Fig. 1 Fig. 2 Fig. 3 PMID:8637893

  14. Lack of p53 Affects the Expression of Several Brain Mitochondrial Proteins: Insights from Proteomics into Important Pathways Regulated by p53

    PubMed Central

    Fiorini, Ada; Sultana, Rukhsana; Barone, Eugenio; Cenini, Giovanna; Perluigi, Marzia; Mancuso, Cesare; Cai, Jian; Klein, Jon B.; St. Clair, Daret; Butterfield, D. Allan

    2012-01-01

    The tumor suppressor protein p53 has been described “as the guardian of the genome” for its crucial role in regulating the transcription of numerous genes responsible for cells cycle arrest, senescence, or apoptosis in response to various stress signals. Although p53 promotes longevity by decreasing the risk of cancer through activation of apoptosis or cellular senescence, several findings suggest that an increase of its activity may have deleterious effects leading to selected aspects of the aging phenotype and neurodegenerative diseases. There is the link between p53 and oxidative stress, the latter a crucial factor that contributes to neurodegenerative processes like Alzheimer disease (AD). In the present study, using a proteomics approach, we analyzed the impact of lack of p53 on the expression of several brain mitochondrial proteins involved in different pathways, and how lack of p53 may present a target to restore neuronal impairments. Our investigation on isolated brain mitochondria from p53(−/−) mice also provides a better understanding of the p53-mitochondria relationship and its involvement in the development of many diseases. PMID:23209608

  15. P53 functional abnormality in mesenchymal stem cells promotes osteosarcoma development

    PubMed Central

    Velletri, T; Xie, N; Wang, Y; Huang, Y; Yang, Q; Chen, X; Chen, Q; Shou, P; Gan, Y; Cao, G; Melino, G; Shi, Y

    2016-01-01

    It has been shown that p53 has a critical role in the differentiation and functionality of various multipotent progenitor cells. P53 mutations can lead to genome instability and subsequent functional alterations and aberrant transformation of mesenchymal stem cells (MSCs). The significance of p53 in safeguarding our body from developing osteosarcoma (OS) is well recognized. During bone remodeling, p53 has a key role in negatively regulating key factors orchestrating the early stages of osteogenic differentiation of MSCs. Interestingly, changes in the p53 status can compromise bone homeostasis and affect the tumor microenvironment. This review aims to provide a unique opportunity to study the p53 function in MSCs and OS. In the context of loss of function of p53, we provide a model for two sources of OS: MSCs as progenitor cells of osteoblasts and bone tumor microenvironment components. Standing at the bone remodeling point of view, in this review we will first explain the determinant function of p53 in OS development. We will then summarize the role of p53 in monitoring MSC fidelity and in regulating MSC differentiation programs during osteogenesis. Finally, we will discuss the importance of loss of p53 function in tissue microenvironment. We expect that the information provided herein could lead to better understanding and treatment of OS. PMID:26775693

  16. Lysines in the tetramerization domain of p53 selectively modulate G1 arrest.

    PubMed

    Beckerman, Rachel; Yoh, Kathryn; Mattia-Sansobrino, Melissa; Zupnick, Andrew; Laptenko, Oleg; Karni-Schmidt, Orit; Ahn, Jinwoo; Byeon, In-Ja; Keezer, Susan; Prives, Carol

    2016-06-01

    Functional in a tetrameric state, the protein product of the p53 tumor suppressor gene confers its tumor-suppressive activity by transactivating genes which promote cell-cycle arrest, senescence, or programmed cell death. How p53 distinguishes between these divergent outcomes is still a matter of considerable interest. Here we discuss the impact of 2 mutations in the tetramerization domain that confer unique properties onto p53. By changing lysines 351 and 357 to arginine, thereby blocking all post-translational modifications of these residues, DNA binding and transcriptional regulation by p53 remain virtually unchanged. On the other hand, by changing these lysines to glutamine (2KQ-p53), thereby neutralizing their positive charge and potentially mimicking acetylation, p53 is impaired in the induction of cell cycle arrest and yet can still effectively induce cell death. Surprisingly, when 2KQ-p53 is expressed at high levels in H1299 cells, it can bind to and transactivate numerous p53 target genes including p21, but not others such as miR-34a and cyclin G1 to the same extent as wild-type p53. Our findings show that strong induction of p21 is not sufficient to block H1299 cells in G1, and imply that modification of one or both of the lysines within the tetramerization domain may serve as a mechanism to shunt p53 from inducing cell cycle arrest. PMID:27210019

  17. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds

    PubMed Central

    Cino, Elio A.; Soares, Iaci N.; Pedrote, Murilo M.; de Oliveira, Guilherme A. P.; Silva, Jerson L.

    2016-01-01

    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  18. β-Catenin C-terminal signals suppress p53 and are essential for artery formation.

    PubMed

    Riascos-Bernal, Dario F; Chinnasamy, Prameladevi; Cao, Longyue Lily; Dunaway, Charlene M; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E S

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  19. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides

    PubMed Central

    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda

    2016-01-01

    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  20. p53 directly regulates the glycosidase FUCA1 to promote chemotherapy-induced cell death

    PubMed Central

    Baudot, Alice D.; Crighton, Diane; O'Prey, Jim; Somers, Joanna; Sierra Gonzalez, Pablo; Ryan, Kevin M.

    2016-01-01

    ABSTRACT p53 is a central factor in tumor suppression as exemplified by its frequent loss in human cancer. p53 exerts its tumor suppressive effects in multiple ways, but the ability to invoke the eradication of damaged cells by programmed cell death is considered a key factor. The ways in which p53 promotes cell death can involve direct activation or engagement of the cell death machinery, or can be via indirect mechanisms, for example though regulation of ER stress and autophagy. We present here another level of control in p53-mediated tumor suppression by showing that p53 activates the glycosidase, FUCA1, a modulator of N-linked glycosylation. We show that p53 transcriptionally activates FUCA1 and that p53 modulates fucosidase activity via FUCA1 up-regulation. Importantly, we also report that chemotherapeutic drugs induce FUCA1 and fucosidase activity in a p53-dependent manner. In this context, while we found that over-expression of FUCA1 does not induce cell death, RNAi-mediated knockdown of endogenous FUCA1 significantly attenuates p53-dependent, chemotherapy-induced apoptotic death. In summary, these findings add an additional component to p53s tumor suppressive response and highlight another mechanism by which the tumor suppressor controls programmed cell death that could potentially be exploited for cancer therapy. PMID:27315169

  1. Cytoplasmic CUL9/PARC ubiquitin ligase is a tumor suppressor and promotes p53-dependent apoptosis

    PubMed Central

    Pei, Xin-Hai; Bai, Feng; Li, Zhijun; Smith, Matthew D.; Whitewolf, Gabrielle; Jin, Ran; Xiong, Yue

    2011-01-01

    A wide range of cell stresses, including DNA damage, signal to p53 through post-translational modification of p53. The cytoplasmic functions of p53 are emerging as an important constituent of p53’s role in tumor suppression. Here we report that deletion of the Cul9 (formerly Parc) gene, which encodes an E3 ubiquitin ligase that binds to p53 and localizes in the cytoplasm, resulted in spontaneous tumor development, accelerated Eμ-Myc-induced lymphomagenesis and rendered mice susceptible to carcinogenesis. Cul9-p53 double mutant mice exhibited indistinguishable tumor phenotypes as p53 single mutant mice, indicating that the function of Cul9 in tumor suppression is largely mediated by p53. Deletion of Cul9 had no significant effect on cell cycle progression, but attenuated DNA damage-induced apoptosis. Ectopic expression of wild-type CUL9, but not a point mutant CUL9 deficient in p53 binding, promotes apoptosis. These results demonstrate CUL9 as a potential p53 activating E3 ligase in the cytoplasm. PMID:21487039

  2. Renal cell carcinoma escapes death by p53 depletion through transglutaminase 2-chaperoned autophagy

    PubMed Central

    Kang, J H; Lee, J-S; Hong, D; Lee, S-H; Kim, N; Lee, W-K; Sung, T-W; Gong, Y-D; Kim, S-Y

    2016-01-01

    In renal cell carcinoma, transglutaminase 2 (TGase 2) crosslinks p53 in autophagosomes, resulting in p53 depletion and the tumor's evasion of apoptosis. Inhibition of TGase 2 stabilizes p53 and induces tumor cells to enter apoptosis. This study explored the mechanism of TGase 2-dependent p53 degradation. We found that TGase 2 competes with human double minute 2 homolog (HDM2) for binding to p53; promotes autophagy-dependent p53 degradation in renal cell carcinoma (RCC) cell lines under starvation; and binds to p53 and p62 simultaneously without ubiquitin-dependent recognition of p62. The bound complex does not have crosslinking activity. A binding assay using a series of deletion mutants of p62, p53 and TGase 2 revealed that the PB1 (Phox and Bem1p-1) domain of p62 (residues 85–110) directly interacts with the β-barrel domains of TGase 2 (residues 592–687), whereas the HDM2-binding domain (transactivation domain, residues 15–26) of p53 interacts with the N terminus of TGase 2 (residues 1–139). In addition to the increase in p53 stability due to TGase 2 inhibition, the administration of a DNA-damaging anti-cancer drug such as doxorubicin-induced apoptosis in RCC cell lines and synergistically reduced tumor volume in a xenograft model. Combination therapy with a TGase 2 inhibitor and a DNA-damaging agent may represent an effective therapeutic approach for treating RCC. PMID:27031960

  3. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides.

    PubMed

    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda

    2016-03-15

    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  4. The C-terminus of p53 binds the N-terminal domain of MDM2

    PubMed Central

    Poyurovsky, Masha V.; Katz, Chen; Laptenko, Oleg; Beckerman, Rachel; Lokshin, Maria; Ahn, Jinwoo; Byeon, In-Ja L.; Gabizon, Ronen; Mattia, Melissa; Zupnick, Andrew; Brown, Lewis M.; Friedler, Assaf; Prives, Carol

    2010-01-01

    The p53 tumor suppressor interacts with its negative regulator Mdm2 via the former’s N-terminal region and core domain. Yet the extreme p53 C-terminal region contains lysine residues ubiquitinated by Mdm2 and can bear post-translational modifications that inhibit Mdm2–p53 association. We show that, the Mdm2–p53 interaction is decreased upon deletion, mutation or acetylation of the p53 C-terminus. Mdm2 decreases the association of full-length but not C-terminally deleted p53 with a DNA target sequence in vitro and in cells. Further, using multiple approaches we demonstrate that a peptide from p53 C-terminus directly binds Mdm2 N-terminus in vitro. We also show that p300-acetylated p53 binds inefficiently to Mdm2 in vitro, and Nutlin-3 treatment induces C-terminal modification(s) of p53 in cells, explaining the low efficiency of Nutlin-3 in dissociating p53-MDM2 in vitro. PMID:20639885

  5. p53 directly regulates the glycosidase FUCA1 to promote chemotherapy-induced cell death.

    PubMed

    Baudot, Alice D; Crighton, Diane; O'Prey, Jim; Somers, Joanna; Sierra Gonzalez, Pablo; Ryan, Kevin M

    2016-09-01

    p53 is a central factor in tumor suppression as exemplified by its frequent loss in human cancer. p53 exerts its tumor suppressive effects in multiple ways, but the ability to invoke the eradication of damaged cells by programmed cell death is considered a key factor. The ways in which p53 promotes cell death can involve direct activation or engagement of the cell death machinery, or can be via indirect mechanisms, for example though regulation of ER stress and autophagy. We present here another level of control in p53-mediated tumor suppression by showing that p53 activates the glycosidase, FUCA1, a modulator of N-linked glycosylation. We show that p53 transcriptionally activates FUCA1 and that p53 modulates fucosidase activity via FUCA1 up-regulation. Importantly, we also report that chemotherapeutic drugs induce FUCA1 and fucosidase activity in a p53-dependent manner. In this context, while we found that over-expression of FUCA1 does not induce cell death, RNAi-mediated knockdown of endogenous FUCA1 significantly attenuates p53-dependent, chemotherapy-induced apoptotic death. In summary, these findings add an additional component to p53s tumor suppressive response and highlight another mechanism by which the tumor suppressor controls programmed cell death that could potentially be exploited for cancer therapy. PMID:27315169

  6. Development of an adenoviral vector with robust expression driven by p53

    SciTech Connect

    Bajgelman, Marcio C.; Strauss, Bryan E.

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG served as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.

  7. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  8. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds.

    PubMed

    Cino, Elio A; Soares, Iaci N; Pedrote, Murilo M; de Oliveira, Guilherme A P; Silva, Jerson L

    2016-01-01

    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  9. A defect in the p53 response pathway induced by de novo purine synthesis inhibition.

    PubMed

    Bronder, Julie L; Moran, Richard G

    2003-12-01

    p53 is believed to sense cellular ribonucleotide depletion in the absence of DNA strand breaks and to respond by imposition of a p21-dependent G1 cell cycle arrest. We now report that the p53-dependent G1 checkpoint is blocked in human carcinoma cell lines after inhibition of de novo purine synthesis by folate analogs inhibitory to glycinamide ribonucleotide formyltransferase (GART). p53 accumulated in HCT116, MCF7, or A549 carcinoma cells upon GART inhibition, but, surprisingly, transcription of several p53 targets, including p21cip1/waf1, was impaired. The mechanism of this defect was examined. The p53 accumulating in these cells was nuclear but was not phosphorylated at serines 6, 15, and 20, nor was it acetylated at lysines 373 or 382. The DDATHF-stabilized p53 bound to the p21 promoter in vitro and in vivo but did not activate histone acetylation over the p53 binding sites in the p21 promoter that is an integral part of the transcriptional response mediated by the DNA damage pathway. We concluded that the robust initial response of the p53 pathway to GART inhibitors is not transcriptionally propagated to target genes due to a defect in p53 post-translational modifications and a failure to open chromatin structure despite promoter binding of this unmodified p53. PMID:14517211

  10. Nucleolar protein GLTSCR2 stabilizes p53 in response to ribosomal stresses

    PubMed Central

    Lee, S; Kim, J-Y; Kim, Y-J; Seok, K-O; Kim, J-H; Chang, Y-J; Kang, H-Y; Park, J-H

    2012-01-01

    p53 is a key regulator of cell growth and death by controlling cell cycle progression and apoptosis under conditions of stress such as DNA damage or oncogenic stimulation. As these processes are critical for cell function and inhibition of tumor development, p53 regulatory pathways are strictly monitored in cells. Recently, it was recognized that nucleolar proteins, including nucleophosmin/B23, ribosomal protein L11, and alternate reading frame (ARF), form the nucleolus-ARF-murine double minute 2 (MDM2) axis in p53 regulatory pathways, which increases p53 stability by suppressing the activity of MDM2. In this work, we show that nucleolar protein glioma tumor-suppressor candidate region gene 2 (GLTSCR2) translocates to the nucleoplasm under ribosomal stress, where it interacts with and stabilizes p53 and inhibits cell cycle progression without the involvement of the major upstream p53 regulator, ARF. Furthermore, ectopic expression of GLTSCR2 significantly suppressed growth of cancer cells in a xenograft animal model via p53-dependent pathway. Our data identify GLTSCR2 as a new member of the nucleolus–nucleoplasmic axis for p53 regulation. ARF-independent direct regulation of p53 by GLTSCR2 may be a key mechanism and therapeutic target for cell death or growth inhibition when nucleolus-ARF-p53 pathways are inactivated by genetic or epigenetic modifications of ARF, which are the second most common types of genetic change observed in human cancers. PMID:22522597

  11. Decrease of mitochondrial p53 during late apoptosis is linked to its dephosphorylation on serine 20

    PubMed Central

    Castrogiovanni, Cédric; Vandaudenard, Marie; Waterschoot, Béranger; De Backer, Olivier; Dumont, Patrick

    2015-01-01

    Following a genotoxic stress, the tumor suppressor p53 translocates to mitochondria to take part in direct induction of apoptosis, via interaction with BCL-2 family members such as BAK and BAX. We determined the kinetics of the mitochondrial translocation of p53 in HCT-116 and PA-1 cells exposed to different genotoxic stresses (doxorubicin, camptothecin, UVB). This analysis revealed an early escalation in the amount of mitochondrial p53, followed by a peak amount and a decrease of mitochondrial p53 at later time points. We show that the serine 20 phosphorylated form of p53 is present at the mitochondria and that the decrease of p53 mitochondrial level during late apoptosis correlates with a decrease of Ser-20 phosphorylation. Moreover, the S20A p53 mutant translocates well to mitochondria after a genotoxic stress but its mitochondrial localization is very low during late apoptosis when compared to wt p53. The S20A mutant also appears to be compromised for interaction with BAK. We propose here that the level of serine 20 phosphorylation is influential on p53 mitochondrial localization during late apoptosis. Additionally, we report the presence of a new ≃45 kDa caspase-cleaved fragment of p53 in the cytosolic and mitochondrial fractions of apoptotic cells. PMID:26252178

  12. Radiation response and cell cycle regulation of p53 rescued malignant keratinocytes

    SciTech Connect

    Niemantsverdriet, Maarten; Jongmans, Wim; Backendorf, Claude . E-mail: backendo@chem.leidenuniv.nl

    2005-10-15

    Mutations in the tumor suppressor gene p53 were found in more than 90% of all human squamous cell carcinomas (SCC). To study the function of p53 in a keratinocyte background, a tetracycline-controlled p53 transgene was introduced into a human SCC cell line (SCC15), lacking endogenous p53. Conditional expression of wild-type p53 protein upon withdrawal of tetracycline was accompanied with increased expression of p21{sup WAF1/Cip1} resulting in reduced cell proliferation. Flow-cytometric analysis revealed that these cells were transiently arrested in the G1/S phase of the cell cycle. However, when SCC15 cells expressing p53 were exposed to ionizing radiation (IR), a clear shift from a G1/S to a G2/M cell cycle arrest was observed. This effect was greatly depending on the presence of wild-type p53, as it was not observed to the same extent in SCC15 cells lacking p53. Unexpectedly, the p53- and IR-dependent G2/M cell cycle arrest in the keratinocyte background was not depending on increased expression or stabilization of 14-3-3{sigma}, a p53-regulated effector of G2/M progression in colorectal cancer cells. In keratinocytes, 14-3-3{sigma} (stratifin) is involved in terminal differentiation and its cell cycle function in this cell type might diverge from the one it fulfills in other cellular backgrounds.

  13. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-01-01

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: http://dx.doi.org/10.7554/eLife.02200.001 PMID:24867637

  14. Renal cell carcinoma escapes death by p53 depletion through transglutaminase 2-chaperoned autophagy.

    PubMed

    Kang, J H; Lee, J-S; Hong, D; Lee, S-H; Kim, N; Lee, W-K; Sung, T-W; Gong, Y-D; Kim, S-Y

    2016-01-01

    In renal cell carcinoma, transglutaminase 2 (TGase 2) crosslinks p53 in autophagosomes, resulting in p53 depletion and the tumor's evasion of apoptosis. Inhibition of TGase 2 stabilizes p53 and induces tumor cells to enter apoptosis. This study explored the mechanism of TGase 2-dependent p53 degradation. We found that TGase 2 competes with human double minute 2 homolog (HDM2) for binding to p53; promotes autophagy-dependent p53 degradation in renal cell carcinoma (RCC) cell lines under starvation; and binds to p53 and p62 simultaneously without ubiquitin-dependent recognition of p62. The bound complex does not have crosslinking activity. A binding assay using a series of deletion mutants of p62, p53 and TGase 2 revealed that the PB1 (Phox and Bem1p-1) domain of p62 (residues 85-110) directly interacts with the β-barrel domains of TGase 2 (residues 592-687), whereas the HDM2-binding domain (transactivation domain, residues 15-26) of p53 interacts with the N terminus of TGase 2 (residues 1-139). In addition to the increase in p53 stability due to TGase 2 inhibition, the administration of a DNA-damaging anti-cancer drug such as doxorubicin-induced apoptosis in RCC cell lines and synergistically reduced tumor volume in a xenograft model. Combination therapy with a TGase 2 inhibitor and a DNA-damaging agent may represent an effective therapeutic approach for treating RCC. PMID:27031960

  15. β-Catenin C-terminal signals suppress p53 and are essential for artery formation

    PubMed Central

    Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  16. Resveratrol contributes to chemosensitivity of malignant mesothelioma cells with activation of p53.

    PubMed

    Lee, Yoon-Jin; Park, Ihl-Sung; Lee, Yong-Jin; Shim, Jung-Hyun; Cho, Moon-Kyun; Nam, Hae-Seon; Park, Ji Woong; Oh, Myung-Ho; Lee, Sang-Han

    2014-01-01

    Resveratrol is a naturally occurring polyphenolic phytoalexin with chemopreventive properties. We previously reported a synergistic anti-proliferative effect of resveratrol and clofarabine against malignant mesothelioma (MM) cells. Here, we further investigated molecular mechanisms involved in the synergistic interaction of these compounds in MM MSTO-211H cells. Resveratrol, in combination with clofarabine, time-dependently induced a strong cytotoxic effect with the nuclear accumulation of phospho-p53 (p-p53) in MSTO-211H cells, but not in normal mesothelial MeT-5A cells. Combination treatment up-regulated the levels of p-p53, cleaved caspase-3, and cleaved PARP proteins. Gene silencing with p53-targeting siRNA attenuated the sensitivity of cells to the combined treatment of two compounds. Analyses of p53 DNA binding assay, p53 reporter gene assay, and RTP-CR toward p53-regulated genes, including Bax, PUMA, Noxa and p21, demonstrated that induced p-p53 is transcriptionally active. These results were further confirmed by the siRNA-mediated knockdown of p53 gene. Combination treatment significantly caused the accumulation of cells at G1 phase with the increases in the sub-G0/G1 peak, DNA ladder, nuclear fragmentation, and caspase-3/7 activity. Taken together, these results demonstrate that resveratrol and clofarabine synergistically elicit apoptotic signal via a p53-dependent pathway, and provide a scientific rationale for clinical evaluation of resveratrol as a promising chemopotentiator in MM. PMID:24239893

  17. Small-molecule inhibitor of p53 binding to mitochondria protects mice from gamma radiation.

    PubMed

    Strom, Evguenia; Sathe, Swati; Komarov, Pavel G; Chernova, Olga B; Pavlovska, Ivanda; Shyshynova, Inna; Bosykh, Dmitry A; Burdelya, Lyudmila G; Macklis, Roger M; Skaliter, Rami; Komarova, Elena A; Gudkov, Andrei V

    2006-09-01

    p53-dependent apoptosis contributes to the side effects of cancer treatment, and genetic or pharmacological inhibition of p53 function can increase normal tissue resistance to genotoxic stress. It has recently been shown that p53 can induce apoptosis through a mechanism that does not depend on transactivation but instead involves translocation of p53 to mitochondria. To determine the impact of this p53 activity on normal tissue radiosensitivity, we isolated a small molecule named pifithrin-mu (PFTmu, 1) that inhibits p53 binding to mitochondria by reducing its affinity to antiapoptotic proteins Bcl-xL and Bcl-2 but has no effect on p53-dependent transactivation. PFTmu has a high specificity for p53 and does not protect cells from apoptosis induced by overexpression of proapoptotic protein Bax or by treatment with dexamethasone (2). PFTmu rescues primary mouse thymocytes from p53-mediated apoptosis caused by radiation and protects mice from doses of radiation that cause lethal hematopoietic syndrome. These results indicate that selective inhibition of the mitochondrial branch of the p53 pathway is sufficient for radioprotection in vivo. PMID:16862141

  18. 2-Phenylethynesulfonamide (PES) uncovers a necrotic process regulated by oxidative stress and p53.

    PubMed

    Mattiolo, Paolo; Barbero-Farran, Ares; Yuste, Víctor J; Boix, Jacint; Ribas, Judit

    2014-10-01

    2-Phenylethynesulfonamide (PES) or pifithrin-μ is a promising anticancer agent with preferential toxicity for cancer cells. The type of cell death and the molecular cascades activated by this compound are controversial. Here, we demonstrate PES elicits a caspase- and BAX/BAK-independent non-necroptotic necrotic cell death, since it is not inhibited by necrostatin-1. This process is characterized by an early generation of reactive oxygen species (ROS) resulting in p53 up-regulation. Accordingly, thiolic antioxidants protect cells from PES-induced death. Furthermore, inhibiting the natural sources of glutathione with l-buthionine-sulfoximine (BSO) strongly cooperates with PES in triggering cytotoxicity. Genetically modified p53-null or p53 knocked-down cells show resistance to PES-driven necrosis. The predominant localization of p53 in chromatin-enriched fractions added to the up-regulation of the p53-responsive gene p21, strongly suggest the involvement of a transcription-dependent p53 program. On the other hand, we report an augmented production of ROS in p53-positive cells that, added to the increased p53 content in response to PES-elicited ROS, suggests that p53 and ROS are mutually regulated in response to PES. In sum, p53 up-regulation by ROS triggers a positive feedback loop responsible of further increasing ROS production and reinforcing PES-driven non-necroptotic necrosis. PMID:25139326

  19. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    PubMed

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  20. Regulation of p53 in NIH3T3 mouse fibroblasts following hyperosmotic stress.

    PubMed

    Lambert, Ian Henry; Enghoff, Maria Stine; Brandi, Marie-Luise; Hoffmann, Else Kay

    2015-06-01

    The aim of this project was to analyze the regulation of p53 expression in NIH3T3 fibroblasts under the influence of increasing hyperosmotic stress. Expression of p53 showed a biphasic response pattern in NIH3T3 cells under increasing osmotic stress (337 mOsm to 737 mOsm) with a maximum at 587 mOsm. Under isotonic conditions p53 expression increased after addition of the proteasome inhibitor MG132 indicating that cellular p53 levels in unperturbed cells is kept low by proteasomal degradation. However, under hypertonic conditions p53 synthesis as well as p53 degradation were significantly reduced and it is demonstrated that the increase in p53 expression observed when tonicity is increased from 337 to 587 mOsm reflects that degradation is more inhibited than synthesis, whereas the decrease in p53 expression at higher tonicities reflects that synthesis is more inhibited than degradation. The activity of the p53 regulating proteins p38 MAP kinase and the ubiquitin ligase MDM2 were studied as a function of increasing osmolarity. MDM2 protein expression was unchanged at all osmolarities, whereas MDM2 phosphorylation (Ser(166)) increased at osmolarities up to 537 mOsm and remained constant at higher osmolarities. Phosphorylation of p38 increased at osmolarities up to 687 mOsm which correlated with an increased phosphorylation of p53 (Ser(15)) and the decreased p53 degradation. Caspase-3 activity increased gradually with hypertonicity and at 737 mOsm both Caspase-3 activity and annexin V binding are high even though p53 expression and activity are low, indicating that initiation of apoptosis under severe hypertonic conditions is not strictly controlled by p53. PMID:26056062

  1. Mathematical modelling of p53 basal dynamics and DNA damage response.

    PubMed

    Chong, Ket Hing; Samarasinghe, Sandhya; Kulasiri, Don

    2015-01-01

    The p53 tumour suppressor protein is a transcription factor that activates genes that result in cell cycle arrest, DNA damage repair, senescence or apoptosis. Recent individual cell studies have indicated that p53 activation is highly regulated in response to stressed conditions and non-stressed (normal proliferating) conditions in cells. The aim of this research is to investigate the design principles behind the precise regulation of p53 activation, under normal and stressed conditions. We extended the Sun et al. (2011) mathematical model of delay differential equations by incorporating the most recently found molecular interactions and hypotheses. In particular, we found that the core regulatory network consists of ATM, Mdm2, MdmX, Wip1 and p53. Our model of the p53 core regulatory feedback mechanisms can reproduce a series of repeated pulses in stressed conditions with appropriate induction of cell cycle arrest, and one or two spontaneous pulses (basal dynamics) in non-stressed conditions and these are consistent with the recent experimental findings. Our results show that the p53 spontaneous pulses are due to intrinsic DNA double strand breaks in normal proliferating cells, and p53 auto-regulation (positive feedback loop) allows threshold activation of p53 in generating these pulses. It also shows that the p53 dynamics are excitable; bifurcation analysis revealed a spectrum of p53 behaviour under stressed and non-stressed (normal) conditions on the basis of stress signal activation rate, and characterised p53 dynamics as Type II excitability. Additionally, the model makes testable predictions on pharmacological intervention to reactivate p53. Importantly, we reveal novel findings on the mechanism of threshold activation of p53 pulsatile and oscillatory dynamics that are important for its physiological function as the guardian of the genome. PMID:25433195

  2. Regulation of the p53 response and its relationship to cancer.

    PubMed

    Meek, David W

    2015-08-01

    p53 has been studied intensively as a major tumour suppressor that detects oncogenic events in cancer cells and eliminates them through senescence (a permanent non-proliferative state) or apoptosis. Consistent with this role, p53 activity is compromised in a high proportion of all cancer types, either through mutation of the TP53 gene (encoding p53) or changes in the status of p53 modulators. p53 has additional roles, which may overlap with its tumour-suppressive capacity, in processes including the DNA damage response, metabolism, aging, stem cell differentiation and fertility. Moreover, many mutant p53 proteins, termed 'gain-of-function' (GOF), acquire new activities that help drive cancer aggression. p53 is regulated mainly through protein turnover and operates within a negative-feedback loop with its transcriptional target, MDM2 (murine double minute 2), an E3 ubiquitin ligase which mediates the ubiquitylation and proteasomal degradation of p53. Induction of p53 is achieved largely through uncoupling the p53-MDM2 interaction, leading to elevated p53 levels. Various stress stimuli acting on p53 (such as hyperproliferation and DNA damage) use different, but overlapping, mechanisms to achieve this. Additionally, p53 activity is regulated through critical context-specific or fine-tuning events, mediated primarily through post-translational mechanisms, particularly multi-site phosphorylation and acetylation. In the present review, I broadly examine these events, highlighting their regulatory contributions, their ability to integrate signals from cellular events towards providing most appropriate response to stress conditions and their importance for tumour suppression. These are fascinating aspects of molecular oncology that hold the key to understanding the molecular pathology of cancer and the routes by which it may be tackled therapeutically. PMID:26205489

  3. Absence of p21 expression is associated with abnormal p53 in human breast carcinomas.

    PubMed Central

    Ellis, P. A.; Lonning, P. E.; Borresen-Dale, A.; Aas, T.; Geisler, S.; Akslen, L. A.; Salter, I.; Smith, I. E.; Dowsett, M.

    1997-01-01

    The p53 tumour-suppressor gene is important in the regulation of cell growth and apoptosis, and loss of functional wild-type activity may be associated with tumour formation and resistance to therapy. Differentiation of functionally normal wild-type protein from mutant or abnormal protein remains difficult using either immunohistochemical assays or mutational DNA sequencing. p21(WAF1/CIP1) (p21) is induced by wild type p53 and plays an important role in promoting cell cycle arrest. To test the hypothesis that p21 protein expression may act as a downstream marker of tumours from patients with locally advanced breast cancer before treatment with doxorubicin, pretreatment p53 status had been characterized in 63 tumours by p53 protein immunostaining and DNA mutational analysis. There was a significant association between immunostaining for p53 and the presence of p53 mutations (P = 0.01). Of 56 patients available for determination of p21, 31 (55%) expressed p21 protein. Twenty-eight out of 31 patients (90%) positive for p21 had low negative p53 protein expression, whereas only 3 of 13 patients (23%) with high p53 expressed p21 (P = 0.009). No association was seen between p21 protein expression and p53 mutations (P = 0.24). The combination of p53 and p21 immunostaining results improved the specificity of the immunostaining but at a cost of significant reduction in sensitivity. Immunohistochemical assessment of p21 protein expression is inversely associated with abnormal p53 protein in human breast cancer. The detection of p21 protein expression in combination with p53 protein expression did not improve the ability of immunohistochemistry (IHC) to differentiate between normal and mutant p53 protein. Images Figure 1 PMID:9275025

  4. Thymidylate synthase protein and p53 mRNA form an in vivo ribonucleoprotein complex.

    PubMed

    Chu, E; Copur, S M; Ju, J; Chen, T M; Khleif, S; Voeller, D M; Mizunuma, N; Patel, M; Maley, G F; Maley, F; Allegra, C J

    1999-02-01

    A thymidylate synthase (TS)-ribonucleoprotein (RNP) complex composed of TS protein and the mRNA of the tumor suppressor gene p53 was isolated from cultured human colon cancer cells. RNA gel shift assays confirmed a specific interaction between TS protein and the protein-coding region of p53 mRNA, and in vitro translation studies demonstrated that this interaction resulted in the specific repression of p53 mRNA translation. To demonstrate the potential biological role of the TS protein-p53 mRNA interaction, Western immunoblot analysis revealed nearly undetectable levels of p53 protein in TS-overexpressing human colon cancer H630-R10 and rat hepatoma H35(F/F) cell lines compared to the levels in their respective parent H630 and H35 cell lines. Polysome analysis revealed that the p53 mRNA was associated with higher-molecular-weight polysomes in H35 cells compared to H35(F/F) cells. While the level of p53 mRNA expression was identical in parent and TS-overexpressing cell lines, the level of p53 RNA bound to TS in the form of RNP complexes was significantly higher in TS-overexpressing cells. The effect of TS on p53 expression was also investigated with human colon cancer RKO cells by use of a tetracycline-inducible system. Treatment of RKO cells with a tetracycline derivative, doxycycline, resulted in 15-fold-induced expression of TS protein and nearly complete suppression of p53 protein expression. However, p53 mRNA levels were identical in transfected RKO cells in the absence and presence of doxycycline. Taken together, these findings suggest that TS regulates the expression of p53 at the translational level. This study identifies a novel pathway for regulating p53 gene expression and expands current understanding of the potential role of TS as a regulator of cellular gene expression. PMID:9891091

  5. Thymidylate Synthase Protein and p53 mRNA Form an In Vivo Ribonucleoprotein Complex

    PubMed Central

    Chu, Edward; Copur, Sitki M.; Ju, Jingfang; Chen, Tian-men; Khleif, Samir; Voeller, Donna M.; Mizunuma, Nobuyuki; Patel, Mahendra; Maley, Gladys F.; Maley, Frank; Allegra, Carmen J.

    1999-01-01

    A thymidylate synthase (TS)-ribonucleoprotein (RNP) complex composed of TS protein and the mRNA of the tumor suppressor gene p53 was isolated from cultured human colon cancer cells. RNA gel shift assays confirmed a specific interaction between TS protein and the protein-coding region of p53 mRNA, and in vitro translation studies demonstrated that this interaction resulted in the specific repression of p53 mRNA translation. To demonstrate the potential biological role of the TS protein-p53 mRNA interaction, Western immunoblot analysis revealed nearly undetectable levels of p53 protein in TS-overexpressing human colon cancer H630-R10 and rat hepatoma H35(F/F) cell lines compared to the levels in their respective parent H630 and H35 cell lines. Polysome analysis revealed that the p53 mRNA was associated with higher-molecular-weight polysomes in H35 cells compared to H35(F/F) cells. While the level of p53 mRNA expression was identical in parent and TS-overexpressing cell lines, the level of p53 RNA bound to TS in the form of RNP complexes was significantly higher in TS-overexpressing cells. The effect of TS on p53 expression was also investigated with human colon cancer RKO cells by use of a tetracycline-inducible system. Treatment of RKO cells with a tetracycline derivative, doxycycline, resulted in 15-fold-induced expression of TS protein and nearly complete suppression of p53 protein expression. However, p53 mRNA levels were identical in transfected RKO cells in the absence and presence of doxycycline. Taken together, these findings suggest that TS regulates the expression of p53 at the translational level. This study identifies a novel pathway for regulating p53 gene expression and expands current understanding of the potential role of TS as a regulator of cellular gene expression. PMID:9891091

  6. EWS-FLI1 Suppresses NOTCH-Activated p53 in Ewing’s Sarcoma

    PubMed Central

    Ban, Jozef; Bennani-Baiti, Idriss M.; Kauer, Max; Schaefer, Karl-Ludwig; Poremba, Christopher; Jug, Gunhild; Schwentner, Raphaela; Smrzka, Oskar; Muehlbacher, Karin; Aryee, Dave N.T.; Kovar, Heinrich

    2016-01-01

    Although p53 is the most frequently mutated gene in cancer, half of human tumors retain wild-type p53, whereby it is unknown whether normal p53 function is compromised by other cancer-associated alterations. One example is Ewing’s sarcoma family tumors (ESFT), where 90% express wild-type p53. ESFT are characterized by EWS-FLI1 oncogene fusions. Studying 6 ESFT cell lines, silencing of EWS-FLI1 in a wild-type p53 context resulted in increased p53 and p21WAF1/CIP1 levels, causing cell cycle arrest. Using a candidate gene approach, HEY1 was linked to p53 induction. HEY1 was rarely expressed in 59 primary tumors, but consistently induced upon EWS-FLI1 knockdown in ESFT cell lines. The NOTCH signaling pathway targets HEY1, and we show NOTCH2 and NOTCH3 to be expressed in ESFT primary tumors and cell lines. Upon EWS-FLI1 silencing, NOTCH3 processing accompanied by nuclear translocation of the activated intracellular domain was observed in all but one p53-mutant cell line. In cell lines with the highest HEY1 induction, NOTCH3 activation was the consequence of JAG1 transcriptional induction. JAG1 modulation by specific siRNA, NOTCH-processing inhibition by either GSI or ectopic NUMB1, and siRNA-mediated HEY1 knockdown all inhibited p53 and p21WAF1/CIP1 induction. Conversely, forced expression of JAG1, activated NOTCH3, or HEY1 induced p53 and p21WAF1/CIP1. These results indicate that suppression of EWS-FLI1 reactivates NOTCH signaling in ESFT cells, resulting in p53-dependent cell cycle arrest. Our data link EWS-FLI1 to the NOTCH and p53 pathways and provide a plausible basis both for NOTCH tumor suppressor effects and oncogenesis of cancers that retain wild-type p53. PMID:18757425

  7. Regulation of p53 in NIH3T3 mouse fibroblasts following hyperosmotic stress

    PubMed Central

    Lambert, Ian Henry; Enghoff, Maria Stine; Brandi, Marie-Luise; Hoffmann, Else Kay

    2015-01-01

    The aim of this project was to analyze the regulation of p53 expression in NIH3T3 fibroblasts under the influence of increasing hyperosmotic stress. Expression of p53 showed a biphasic response pattern in NIH3T3 cells under increasing osmotic stress (337 mOsm to 737 mOsm) with a maximum at 587 mOsm. Under isotonic conditions p53 expression increased after addition of the proteasome inhibitor MG132 indicating that cellular p53 levels in unperturbed cells is kept low by proteasomal degradation. However, under hypertonic conditions p53 synthesis as well as p53 degradation were significantly reduced and it is demonstrated that the increase in p53 expression observed when tonicity is increased from 337 to 587 mOsm reflects that degradation is more inhibited than synthesis, whereas the decrease in p53 expression at higher tonicities reflects that synthesis is more inhibited than degradation. The activity of the p53 regulating proteins p38 MAP kinase and the ubiquitin ligase MDM2 were studied as a function of increasing osmolarity. MDM2 protein expression was unchanged at all osmolarities, whereas MDM2 phosphorylation (Ser166) increased at osmolarities up to 537 mOsm and remained constant at higher osmolarities. Phosphorylation of p38 increased at osmolarities up to 687 mOsm which correlated with an increased phosphorylation of p53 (Ser15) and the decreased p53 degradation. Caspase-3 activity increased gradually with hypertonicity and at 737 mOsm both Caspase-3 activity and annexin V binding are high even though p53 expression and activity are low, indicating that initiation of apoptosis under severe hypertonic conditions is not strictly controlled by p53. PMID:26056062

  8. Wild-type p53 and p73 negatively regulate expression of proliferation related genes.

    PubMed

    Scian, M J; Carchman, E H; Mohanraj, L; Stagliano, K E R; Anderson, M A E; Deb, D; Crane, B M; Kiyono, T; Windle, B; Deb, S P; Deb, S

    2008-04-17

    When normal cells come under stress, the wild-type (WT) p53 level increases resulting in the regulation of gene expression responsible for growth arrest or apoptosis. Here we show that elevated levels of WT p53 or its homologue, p73, inhibit expression of a number of cell cycle regulatory and growth promoting genes. Our analysis also identified a group of genes whose expression is differentially regulated by WT p53 and p73. We have infected p53-null H1299 human lung carcinoma cells with recombinant adenoviruses expressing WT p53, p73 or beta-galactosidase, and have undertaken microarray hybridization analyses to identify genes whose expression profile is altered by p53 or p73. Quantitative real-time PCR verified the repression of E2F-5, centromere protein A and E, minichromosome maintenance proteins (MCM)-2, -3, -5, -6 and -7 and human CDC25B after p53 expression. 5-Fluorouracil treatment of colon carcinoma HCT116 cells expressing WT p53 results in a reduction of the cyclin B2 protein level suggesting that DNA damage may indeed cause repression of these genes. Transient transcriptional assays verified that WT p53 repressed promoters of a number of these genes. Interestingly, a gain-of-function p53 mutant instead upregulated a number of these promoters in transient transfection. Using promoter deletion mutants of MCM-7 we have found that WT p53-mediated repression needs a minimal promoter that contains a single E2F site and surrounding sequences. However, a single E2F site cannot be significantly repressed by WT p53. Many of the genes identified are also repressed by p21. Thus, our work shows that WT p53 and p73 repress a number of growth-related genes and that in many instances this repression may be through the induction of p21. PMID:17982488

  9. Splice-acceptor site mutation in p53 gene of hu888 zebrafish line.

    PubMed

    Piasecka, Alicja; Brzuzan, Paweł; Woźny, Maciej; Ciesielski, Sławomir; Kaczmarczyk, Dariusz

    2015-02-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response, which has been a subject of intense research for over 30 years. Recently, a zebrafish line which carries splice site mutation (G>T) in intron 8 of p53 gene (p53 (hu888) ), encoding the p53 paralogue, was developed (The Zebrafish Mutation Project). To uncover molecular effects of the mutation, we raised hu888 zebrafish line to adulthood and analyzed DNA, mRNA data, and protein levels of p53 to assess their potential contribution in molecular mechanisms of the mutant fish. To obtain zebrafish individuals homozygous for the point mutation, p53 (hu888) carriers were repeatedly incrossed but only heterozygous mutants (p53 (hu888/+) ) or p53-wild type hu888 zebrafish (p53 (+/+) ) were identified in their progeny. By evaluation of p53 expression changes in the liver of mutant and wild type hu888 zebrafish as well as of Tübingen reference strain, we demonstrated that two types of splicing occurred in each case: a classical one and the alternative splicing which involves the activation of cryptic splice-acceptor site in the exon 9 of zebrafish p53 pre-mRNA. The alternative splicing event results in a deletion 12 nucleotides in the mature mRNA, and produces a shortened variant of p53 protein. Interestingly, expression of p53 protein in liver of both heterozygous and wild type hu888 zebrafish was highly reduced compared to that in the reference strain. PMID:25183022

  10. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53.

    PubMed

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-12-15

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-type p53 binds to a domain of TDG promoter containing two p53 consensus response elements (p53RE) and activates its transcription. Next, we have used a panel of cell lines with different p53 status to demonstrate that TDG mRNA and protein expression levels are induced in a p53-dependent manner under different conditions. This panel includes isogenic breast and colorectal cancer cell lines with wild-type or inactive p53, esophageal squamous cell carcinoma cell lines lacking p53 or expressing a temperature-sensitive p53 mutant and normal human bronchial epithelial cells. Induction of TDG mRNA expression is accompanied by accumulation of TDG protein in both nucleus and cytoplasm, with nuclear re-localization occurring upon DNA damage in p53-competent, but not -incompetent, cells. These observations suggest a role for p53 activity in TDG nuclear translocation. Overall, our results show that TDG expression is directly regulated by p53, suggesting that loss of p53 function may affect processes mediated by TDG, thus negatively impacting on genetic and epigenetic stability. PMID:23165212

  11. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53

    PubMed Central

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-01-01

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-type p53 binds to a domain of TDG promoter containing two p53 consensus response elements (p53RE) and activates its transcription. Next, we have used a panel of cell lines with different p53 status to demonstrate that TDG mRNA and protein expression levels are induced in a p53-dependent manner under different conditions. This panel includes isogenic breast and colorectal cancer cell lines with wild-type or inactive p53, esophageal squamous cell carcinoma cell lines lacking p53 or expressing a temperature-sensitive p53 mutant and normal human bronchial epithelial cells. Induction of TDG mRNA expression is accompanied by accumulation of TDG protein in both nucleus and cytoplasm, with nuclear re-localization occurring upon DNA damage in p53-competent, but not -incompetent, cells. These observations suggest a role for p53 activity in TDG nuclear translocation. Overall, our results show that TDG expression is directly regulated by p53, suggesting that loss of p53 function may affect processes mediated by TDG, thus negatively impacting on genetic and epigenetic stability. PMID:23165212

  12. Extensive Post-translational Modification of Active and Inactivated Forms of Endogenous p53*

    PubMed Central

    DeHart, Caroline J.; Chahal, Jasdave S.; Flint, S. J.; Perlman, David H.

    2014-01-01

    The p53 tumor suppressor protein accumulates to very high concentrations in normal human fibroblasts infected by adenovirus type 5 mutants that cannot direct assembly of the viral E1B 55-kDa protein-containing E3 ubiquitin ligase that targets p53 for degradation. Despite high concentrations of nuclear p53, the p53 transcriptional program is not induced in these infected cells. We exploited this system to examine select post-translational modifications (PTMs) present on a transcriptionally inert population of endogenous human p53, as well as on p53 activated in response to etoposide treatment of normal human fibroblasts. These forms of p53 were purified from whole cell lysates by means of immunoaffinity chromatography and SDS-PAGE, and peptides derived from them were subjected to nano-ultra-high-performance LC-MS and MS/MS analyses on a high-resolution accurate-mass MS platform (data available via ProteomeXchange, PXD000464). We identified an unexpectedly large number of PTMs, comprising phosphorylation of Ser and Thr residues, methylation of Arg residues, and acetylation, ubiquitinylation, and methylation of Lys residues—for example, some 150 previously undescribed modifications of p53 isolated from infected cells. These modifications were distributed across all functional domains of both forms of the endogenous human p53 protein, as well as those of an orthologous population of p53 isolated from COS-1 cells. Despite the differences in activity, including greater in vitro sequence-specific DNA binding activity exhibited by p53 isolated from etoposide-treated cells, few differences were observed in the location, nature, or relative frequencies of PTMs on the two populations of human p53. Indeed, the wealth of PTMs that we have identified is consistent with a far greater degree of complex, combinatorial regulation of p53 by PTM than previously anticipated. PMID:24056736

  13. Targeting Mdmx to treat breast cancers with wild-type p53

    PubMed Central

    Haupt, S; Buckley, D; Pang, J-MB; Panimaya, J; Paul, P J; Gamell, C; Takano, E A; Ying Lee, Y; Hiddingh, S; Rogers, T-M; Teunisse, A F A S; Herold, M J; Marine, J-C; Fox, S B; Jochemsen, A; Haupt, Y

    2015-01-01

    The function of the tumor suppressor p53 is universally compromised in cancers. It is the most frequently mutated gene in human cancers (reviewed). In cases where p53 is not mutated, alternative regulatory pathways inactivate its tumor suppressive functions. This is primarily achieved through elevation in the expression of the key inhibitors of p53: Mdm2 or Mdmx (also called Mdm4) (reviewed). In breast cancer (BrCa), the frequency of p53 mutations varies markedly between the different subtypes, with basal-like BrCas bearing a high frequency of p53 mutations, whereas luminal BrCas generally express wild-type (wt) p53. Here we show that Mdmx is unexpectedly highly expressed in normal breast epithelial cells and its expression is further elevated in most luminal BrCas, whereas p53 expression is generally low, consistent with wt p53 status. Inducible knockdown (KD) of Mdmx in luminal BrCa MCF-7 cells impedes the growth of these cells in culture, in a p53-dependent manner. Importantly, KD of Mdmx in orthotopic xenograft transplants resulted in growth inhibition associated with prolonged survival, both in a preventative model and also in a treatment model. Growth impediment in response to Mdmx KD was associated with cellular senescence. The growth inhibitory capacity of Mdmx KD was recapitulated in an additional luminal BrCa cell line MPE600, which expresses wt p53. Further, the growth inhibitory capacity of Mdmx KD was also demonstrated in the wt p53 basal-like cell line SKBR7 line. These results identify Mdmx growth dependency in wt p53 expressing BrCas, across a range of subtypes. Based on our findings, we propose that Mdmx targeting is an attractive strategy for treating BrCas harboring wt p53. PMID:26181202

  14. Loss of P53 facilitates invasion and metastasis of prostate cancer cells.

    PubMed

    Wang, Yi; Zhang, Y X; Kong, C Z; Zhang, Z; Zhu, Y Y

    2013-12-01

    Prostate cancer is a lethal cancer for the invasion and metastasis in its earlier period. P53 is a tumor suppressor gene which plays a critical role on safeguarding the integrity of genome. However, loss of P53 facilitates or inhibits the invasion and metastasis of tumor is still suspended. In this study, we are going to explain whether loss of P53 affect the invasion and metastasis of prostate cancer cells. To explore whether loss of P53 influences the invasion and metastasis ability of prostate cancer cells, we first compared the invasion ability of si-P53 treated cells and control cells by wound healing, transwell assay, and adhesion assay. We next tested the activity of MMP-2, MMP-9, and MMP-14 by western blot and gelatin zymography. Moreover, we employed WB and IF to identify the EMT containing E-cad, N-cad, vimentin, etc. We also examined the expression of cortactin, cytoskeleton, and paxillin by immunofluorescence, and tested the expression of ERK and JNK by WB. Finally, we applied WB to detect the expression of FAK, Src, and the phosphorylation of them to elucidate the mechanism of si-P53 influencing invasion and metastasis. According to the inhibition rate of si-P53, we choose the optimized volume of si-P53. With the volume, we compare the invasion and metastasis ability of Du145 and si-P53 treated cells. We find si-P53 promotes the invasion and metastasis in prostate cancer cells, increases the expression and activity of MMP-2/9 and MMP-14. Also, si-P53 promotes EMT and cytoskeleton rearrangement. Further analyses explain that this effect is associated with FAK-Src signaling pathway. Loss of P53 promotes the invasion and metastasis ability of prostate cancer cells and the mechanism is correlated with FAK-Src signaling pathway. P53 is involved in the context of invasion and metastasis. PMID:23982184

  15. P53 dependent and independent apoptosis induced by lidamycin in human colorectal cancer cells.

    PubMed

    Chen, Lihui; Jiang, Jianming; Cheng, Chunlei; Yang, Ajing; He, Qiyang; Li, Diandong; Wang, Zhen

    2007-06-01

    Enediyne compound is one class of antibiotics with very potent anti-cancer activity. However, the role of p53 in enediyne antibiotic-induced cell killing remains elusive. Here we reported the involvement of p53 signaling pathway in apoptosis induction by lidamycin (LDM), a member of the enediyne antibiotic family. We found that LDM at low drug concentration of 10 nmol/L induces apoptotic cell death much more effectively in human colorectal cancer cells with wild type p53 than those with mutant or deleted p53. p53 is functionally activated as an early event in response to low dose LDM that precedes the significant apoptosis induction. The primarily activation of mitochondria as well as the activation of p53 transcriptional targets such as Puma, Bad and Bax in HCT116 p53 wild type cells further demonstrates the key role of p53 in mediating the compound-induced apoptosis. This is further supported by the observation that the absence of Bax or Puma decreases apoptosis dramatically while Bcl-2 overexpression confers partially resistance after drug treatment. Activation of p53 signaling pathway leads to activation of caspases and caspases inhibitor VAD-fmk completely blocks low dose LDM induced apoptosis through the inhibition of mitochondria pathway. In contrast, LDM at higher concentration causes rapid apoptosis through more direct DNA damaging mechanism that is independent of activation of p53 and caspases and cannot be blocked by caspase inhibitor. Taken together, LDM induces apoptosis in a p53-dependent manner when given at low doses, but in a p53-independent manner when given at high doses. This dosage-dependent regimen can be applied to cancer clinic based upon the p53 status of cancer patients. PMID:17534142

  16. Transcriptional regulation of mitotic checkpoint gene MAD1 by p53.

    PubMed

    Chun, Abel C S; Jin, Dong-Yan

    2003-09-26

    p53 regulates a number of genes through transcriptional activation and repression. p53-dependent mitotic checkpoint has been described, but the underlying mechanism is still obscure. Here we examined the effect of p53 on the expression of a human mitotic checkpoint protein, Mitosis Arrest Deficiency 1 (MAD1), in cultured human cells. The expression of MAD1 was reduced when the cells were overexpressing exogenously introduced wild-type p53. The same reduction was also observed when the cells were treated with anticancer agents 5-fluorouracil and cisplatin or were irradiated with UV. Consistently, MAD1 promoter activity diminished in a dose-dependent manner when induced by p53, indicating that p53 repressed MAD1 at a transcriptional level. Intriguingly, several tumor hot spot mutations in p53 (V143A, R175H, R248W, and R273H) did not abolish the ability of p53 to repress MAD1 expression. By serial truncation of the MAD1 promoter, we confined the p53-responsive element to a 38-bp region that represents a novel sequence distinct from the known p53 consensus binding site. Trichostatin A, a histone deacetylase inhibitor, relieved the p53 transrepression activity on MAD1. Chromatin immunoprecipitation assay revealed that p53, histone deacetylase 1, and co-repressor mSin3a associated with the MAD1 promoter in vivo. Taken together, our findings suggest a regulatory mechanism for the mitotic checkpoint in which MAD1 is inhibited by p53. PMID:12876282

  17. A Temperature Sensitive Variant of p53 Drives p53-Dependent MicroRNA Expression without Evidence of Widespread Post-Transcriptional Gene Silencing

    PubMed Central

    Cabrita, Miguel A.; Vanzyl, Erin J.; Hamill, Jeff D.; Pan, Elysia; Marcellus, Kristen A.; Tolls, Victoria J.; Alonzi, Rhea C.; Pastic, Alyssa; Rambo, Teeghan M. E.; Sayed, Hadil; McKay, Bruce C.

    2016-01-01

    The p53 tumour suppressor is a transcription factor that can regulate the expression of numerous genes including many encoding proteins and microRNAs (miRNAs). The predominant outcomes of a typical p53 response are the initiation of apoptotic cascades and the activation of cell cycle checkpoints. HT29-tsp53 cells express a temperature sensitive variant of p53 and in the absence of exogenous DNA damage, these cells preferentially undergo G1 phase cell cycle arrest at the permissive temperature that correlates with increased expression of the cyclin-dependent kinase inhibitor p21WAF1. Recent evidence also suggests that a variety of miRNAs can induce G1 arrest by inhibiting the expression of proteins like CDK4 and CDK6. Here we used oligonucleotide microarrays to identify p53-regulated miRNAs that are induced in these cells undergoing G1 arrest. At the permissive temperature, the expression of several miRNAs was increased through a combination of either transcriptional or post-transcriptional regulation. In particular, miR-34a-5p, miR-143-3p and miR-145-5p were strongly induced and they reached levels comparable to that of reference miRNAs (miR-191 and miR-103). Importantly, miR-34a-5p and miR-145-5p are known to silence the Cdk4 and/or Cdk6 G1 cyclin-dependent kinases (cdks). Surprisingly, there was no p53-dependent decrease in the expression of either of these G1 cdks. To search for other potential targets of p53-regulated miRNAs, p53-downregulated mRNAs were identified through parallel microarray analysis of mRNA expression. Once again, there was no clear effect of p53 on the repression of mRNAs under these conditions despite a remarkable increase in p53-induced mRNA expression. Therefore, despite a strong p53 transcriptional response, there was no clear evidence that p53-responsive miRNA contributed to gene silencing. Taken together, the changes in cell cycle distribution in this cell line at the permissive temperature is likely attributable to transcriptional

  18. Molecular cloning, characterization, and expression analysis of p53 from the oriental river prawn, Macrobrachium nipponense, in response to hypoxia.

    PubMed

    Sun, Shengming; Gu, Zhimin; Fu, Hongtuo; Zhu, Jian; Ge, Xianping; Xuan, Fujun

    2016-07-01

    The tumor suppressor gene p53 plays a critical role in safeguarding the integrity of the genome in mammalian cells. It acts as a sequence-specific transcription factor. Once p53 is activated by a variety of cellular stresses, it transactivates downstream target genes and regulates the cell cycle and apoptosis. However, little is known about the functions of the p53 pathway in prawns in response to hypoxia. In this study, the cDNA of p53 from the oriental river prawn, Macrobrachium nipponense, (Mnp53) was cloned using a combination of homology cloning and rapid amplification of cDNA ends. The full-length cDNA of Mnp53 has 2130 bp, including an open reading frame of 1125 bp that encodes a polypeptide of 374 amino acids with a predicted molecular weight of 41.9 kDa and a theoretical isoelectric point of 6.9. Quantitative real-time (qRT)-PCR assays revealed that Mnp53 was ubiquitously expressed in all examined tissues, but at high levels in the hepatopancreas. In addition, we studied respiratory bursts and reactive oxygen species (ROS) production in the hepatopancreas of M. nipponense. Our results suggest that oxidative stress occurred in prawns in response to hypoxia and that apoptosis was associated with an increase in caspase-3 mRNA expression. qRT-PCR and western blot results confirmed that hypoxic stress induced the upregulation of Mnp53 at mRNA and protein levels. Furthermore, immunohistochemistry showed remarkable changes in immunopositive staining after the same hypoxic treatment. These results suggest that hypoxia-induced oxidative stress may cause apoptosis and cooperatively stimulate the expression of Mnp53. PMID:27044329

  19. The importance of p53 pathway genetics in inherited and somatic cancer genomes.

    PubMed

    Stracquadanio, Giovanni; Wang, Xuting; Wallace, Marsha D; Grawenda, Anna M; Zhang, Ping; Hewitt, Juliet; Zeron-Medina, Jorge; Castro-Giner, Francesc; Tomlinson, Ian P; Goding, Colin R; Cygan, Kamil J; Fairbrother, William G; Thomas, Laurent F; Sætrom, Pål; Gemignani, Federica; Landi, Stefano; Schuster-Böckler, Benjamin; Bell, Douglas A; Bond, Gareth L

    2016-03-24

    Decades of research have shown that mutations in the p53 stress response pathway affect the incidence of diverse cancers more than mutations in other pathways. However, most evidence is limited to somatic mutations and rare inherited mutations. Using newly abundant genomic data, we demonstrate that commonly inherited genetic variants in the p53 pathway also affect the incidence of a broad range of cancers more than variants in other pathways. The cancer-associated single nucleotide polymorphisms (SNPs) of the p53 pathway have strikingly similar genetic characteristics to well-studied p53 pathway cancer-causing somatic mutations. Our results enable insights into p53-mediated tumour suppression in humans and into p53 pathway-based cancer surveillance and treatment strategies. PMID:27009395

  20. Alterations in Mitochondrial and Endoplasmic Reticulum Signaling by p53 Mutants

    PubMed Central

    Giorgi, Carlotta; Bonora, Massimo; Missiroli, Sonia; Morganti, Claudia; Morciano, Giampaolo; Wieckowski, Mariusz R.; Pinton, Paolo

    2016-01-01

    The p53 protein is probably the most important tumor suppressor, acting as a nuclear transcription factor primarily through the modulation of cell death. However, currently, it is well accepted that p53 can also exert important transcription-independent pro-cell death actions. Indeed, cytosolic localization of endogenous wild-type or transactivation-deficient p53 is necessary and sufficient for the induction of apoptosis and autophagy. Here, we present the extra-nuclear activities of p53 associated with the mitochondria and the endoplasmic reticulum, highlighting the activities of the p53 mutants on these compartments. These two intracellular organelles play crucial roles in the regulation of cell death, and it is now well established that they also represent sites where p53 can accumulate. PMID:26942128

  1. p53-independent functions of the p19ARF tumor suppressor

    PubMed Central

    Weber, Jason D.; Jeffers, John R.; Rehg, Jerold E.; Randle, David H.; Lozano, Guillermina; Roussel, Martine F.; Sherr, Charles J.; Zambetti, Gerard P.

    2000-01-01

    The p19ARF tumor suppressor antagonizes Mdm2 to induce p53-dependent cell cycle arrest. Individual TKO (triple knock out) mice nullizygous for ARF, p53, and Mdm2 develop multiple tumors at a frequency greater than those observed in animals lacking both p53 and Mdm2 or p53 alone, demonstrating that p19ARF can act independently of the Mdm2-p53 axis in tumor surveillance. Reintroduction of ARF into TKO mouse embryo fibroblasts (MEFs), but not into those lacking both p53 and ARF, arrested the cell division cycle in the G1 phase. Inhibition of the retinoblastoma protein had no effect on the ability of ARF to arrest TKO MEFs. Thus, in the absence of Mdm2, p19ARF interacts with other targets to inhibit cell proliferation. PMID:10995391

  2. Accumulation of Tumor Suppressor P53 in Rat Muscle After a Space Flight

    NASA Astrophysics Data System (ADS)

    Ohnishi, T.; Wang, X.; Fukuda, S.; Takahashi, A.; Ohnishi, K.; Nagaoka, S.

    Tumor suppressor p53 functions as a cell cycle checkpoint under stressful conditions. Early studies have shown that genotoxic stress activates p53 pathway. Recently, many kinds of non-genotoxic stress such as heat shock, cold shock, and low pH also have been found to activate p53 pathway. The effects on living organism remains to be explored. Here, we show that an 18-day space flight induced a 3.6 fold accumulation of p53 in rat skeletal muscle. This results suggests that the p53 pathway plays a role in safeguarding genomic stability against the stressful space environments and supports our previous observation of p53 accumulation in rat skin after a space flight

  3. Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

    PubMed

    Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

    2016-11-01

    Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. PMID:26572807

  4. Nuclear expression of p53 in mature tumor endothelium of retinoblastoma.

    PubMed

    Lee, Byung Joo; Kim, Jin Hyoung; Jo, Dong Hyun; Kim, Kyu-Won; Yu, Young Suk; Kim, Jeong Hun

    2014-08-01

    The present study aimed to investigate the p53 expression pattern in tumor cells and in mature tumor vascular endothelium of retinoblastoma. Nuclear p53 accumulation was observed in most of the tumor cells in both the human and orthotopic retinoblastoma animal models using SNUOT-Rb1 and Y79 cells. In the orthotopic animal model, some of the tumor vascular endothelium also demonstrated nuclear p53 immunoreactivity, and the ratio of p53 positivity among the total mature tumor vascular endothelium was slightly higher in the Y79 cell model when compared with the SNUOT-Rb1 cell model. In addition, in the human retinoblastoma specimens, 32.9% of the tumor vascular endothelium showed p53 nuclear staining. In conclusion, some of the mature tumor vascular endothelium in both the human and orthotopic models of retinoblastoma share the same cytogenetic abnormality (an abnormal nuclear accumulation of p53) with retinoblastoma cells. PMID:24898002

  5. p53-dependent Nestin regulation links tumor suppression to cellular plasticity in liver cancer.

    PubMed

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F; Evert, Matthias; Michurina, Tatyana V; Dow, Lukas E; Banito, Ana; Katz, Sarah F; Kastenhuber, Edward R; Weissmueller, Susann; Huang, Chun-Hao; Lechel, Andre; Andersen, Jesper B; Capper, David; Zender, Lars; Longerich, Thomas; Enikolopov, Grigori; Lowe, Scott W

    2014-07-31

    The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protein nestin in an Sp1/3 transcription-factor-dependent manner and that Nestin is required for tumor initiation in vivo. Moreover, loss of p53 facilitates dedifferentiation of mature hepatocytes into nestin-positive progenitor-like cells, which are poised to differentiate into hepatocellular carcinomas (HCCs) or cholangiocarcinomas (CCs) in response to lineage-specific mutations that target Wnt and Notch signaling, respectively. Many human HCCs and CCs show elevated nestin expression, which correlates with p53 loss of function and is associated with decreased patient survival. Therefore, transcriptional repression of Nestin by p53 restricts cellular plasticity and tumorigenesis in liver cancer. PMID:25083869

  6. Nitric oxide-induced cellular stress and p53 activation in chronic inflammation

    PubMed Central

    Hofseth, Lorne J.; Saito, Shin'ichi; Hussain, S. Perwez; Espey, Michael G.; Miranda, Katrina M.; Araki, Yuzuru; Jhappan, Chamelli; Higashimoto, Yuichiro; He, Peijun; Linke, Steven P.; Quezado, Martha M.; Zurer, Irit; Rotter, Varda; Wink, David A.; Appella, Ettore; Harris, Curtis C.

    2003-01-01

    Free radical-induced cellular stress contributes to cancer during chronic inflammation. Here, we investigated mechanisms of p53 activation by the free radical, NO. NO from donor drugs induced both ataxia-telangiectasia mutated (ATM)- and ataxia-telangiectasia mutated and Rad3-related-dependent p53 posttranslational modifications, leading to an increase in p53 transcriptional targets and a G2/M cell cycle checkpoint. Such modifications were also identified in cells cocultured with NO-releasing macrophages. In noncancerous colon tissues from patients with ulcerative colitis (a cancer-prone chronic inflammatory disease), inducible NO synthase protein levels were positively correlated with p53 serine 15 phosphorylation levels. Immunostaining of HDM-2 and p21WAF1 was consistent with transcriptionally active p53. Our study highlights a pivotal role of NO in the induction of cellular stress and the activation of a p53 response pathway during chronic inflammation. PMID:12518062

  7. p53 dependent Nestin regulation links tumor suppression to cellular plasticity in liver cancer

    PubMed Central

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F; Evert, Matthias; Michurina, Tatyana V; Dow, Lukas E; Banito, Ana; Katz, Sarah F; Kastenhuber, Edward R; Weissmueller, Susann; Huang, Chun-Hao; Lechel, Andre; Andersen, Jesper B; Capper, David; Zender, Lars; Longerich, Thomas; Enikolopov, Grigori; Lowe, Scott W

    2014-01-01

    Summary The p53 tumor suppressor coordinates a series of anti-proliferative responses that restrict the expansion of malignant cells and, as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor cell-associated protein nestin in an Sp1/3 transcription factor-dependent manner and that nestin is required for tumor initiation in vivo. Moreover, loss of p53 facilitates dedifferentiation of mature hepatocytes into nestin-positive progenitor-like cells, which are poised to differentiate into hepatocellular carcinomas (HCCs) or cholangiocarcinomas (CCs) in response to lineage-specific mutations that target Wnt and Notch signaling, respectively. Many human HCCs and CCs show elevated nestin expression, which correlates with p53 loss of function and is associated with decreased patient survival. Therefore, transcriptional repression of Nestin by p53 restricts cellular plasticity and tumorigenesis in liver cancer. PMID:25083869

  8. An Effective Virtual Screening Protocol To Identify Promising p53-MDM2 Inhibitors.

    PubMed

    Tortorella, Paolo; Laghezza, Antonio; Durante, Milena; Gomez-Monterrey, Isabel; Bertamino, Alessia; Campiglia, Pietro; Loiodice, Fulvio; Daniele, Simona; Martini, Claudia; Agamennone, Mariangela

    2016-06-27

    The p53-MDM2 interaction is a well-known protein-protein contact, and its disruption is a key event for p53 activation and induction of its oncosuppressor response. The design of small molecules that can block the p53-MDM2 interaction and reactivate the p53 function is a promising strategy for cancer therapy. To date, several compounds have been identified as p53-MDM2 inhibitors, and X-ray structures of MDM2 complexed with several ligands are available in the Brookhaven Protein Data Bank. These data have been exploited to compile a hierarchical virtual screening protocol. The first steps were aimed at selecting a focused library, which was submitted in parallel to docking and pharmacophore model alignment. Selected compounds were subjected to inhibition assays of both cellular vitality (MTT) and p53-MDM2 interaction (ELISA and co-immunoprecipitation), disclosing four nanomolar inhibitors. PMID:27269808

  9. pRB-Dependent, J Domain-Independent Function of Simian Virus 40 Large T Antigen in Override of p53 Growth Suppression

    PubMed Central

    Gjoerup, Ole; Chao, Herta; DeCaprio, James A.; Roberts, Thomas M.

    2000-01-01

    Simian virus 40 (SV40) large T antigen (LT) can immortalize and transform many cell types. These activities are attributed in large part to the binding and functional inactivation by LT of two major tumor suppressors: p53 and the retinoblastoma protein, pRB. Most effects of LT on pRB have been shown to additionally require an intact J domain, which mediates binding to Hsc70. We show here that the J domain is not required for p53 override in full-length LT. Although LT binds p53, it was shown previously that overcoming a p53-induced cell cycle arrest requires binding to pRB family members (R. S. Quartin et al., J. Virol. 68:1334–1341). We demonstrate that an LT mutant defective for pRB family member binding (K1) can be complemented for efficient override of p53 arrest by a construct encoding the first 135 amino acids of LT with a J domain-inactivating mutation, H42Q. Hence, complementation does not require the J domain, and pRB binding by LT is important for more than dissociating pRB-E2F complexes, which is J dependent. In accordance with this notion, LT alleviates pRB small-pocket-mediated transcriptional repression independently of the J domain. The LT K1 mutant can also be complemented for p53 override by small t antigen (st) in a manner independent of its J domain. Our observations underscore the importance of multiple SV40 functions, two in LT and one in st, that act cooperatively to counteract p53 growth suppression. PMID:10623749

  10. Inhibition of experimental lung metastasis by aerosol delivery of PEI-p53 complexes.

    PubMed

    Gautam, A; Densmore, C L; Waldrep, J C

    2000-10-01

    Mutations in the p53 tumor suppressor gene and the pathways mediated by the p53 protein are common in many human cancers. Replacement of functional p53 by gene therapy is a potential way of combating these cancers and the associated drug resistance and tumor growth. Aerosol delivery of genes is a noninvasive way of targeting genes to the lung for gene therapy. Here we demonstrate, using a murine melanoma lung metastasis model, that aerosol delivery of polyethyleneimine-p53 (PEI-p53) complexes inhibits the growth of lung metastasis. A significantly reduced number of visible foci were observed in C57BL/6 mice injected with B16-F10 melanoma and treated with PEI-p53 complexes by aerosol for 3 weeks at twice a week. Fifty percent of the mice in the PEI-p53-treated group exhibited no visible tumor foci. There was a significant reduction in the lung weights of p53-treated mice (P < 0.01) compared to control groups. The tumor burden was also significantly lower (P < 0.001) in mice treated with PEI-p53 complexes. No extrapulmonary metastasis was observed in the groups treated with PEI-p53 complexes compared to 50% of the mice in control groups, which showed metastasis to lymph nodes in the neck or abdomen. Treatment with PEI-p53 aerosol also led to about a 50% increase in the mean length of survival of the mice injected with B16-F10 cells. These data suggest that delivery of the p53 gene by aerosol using PEI as the gene delivery vector can inhibit the growth of lung metastasis. PMID:11020346

  11. Lack of Transcription Factor p53 Exacerbates Elastase-Induced Emphysema in Mice.

    PubMed

    Chrusciel, Sandra; Zysman, Maéva; Caramelle, Philippe; Tiendrebeogo, Arnaud; Baskara, Indoumady; Le Gouvello, Sabine; Chabot, François; Giraudier, Stéphane; Boczkowski, Jorge; Boyer, Laurent

    2016-02-01

    The transcription factor p53 is overexpressed in the lung of patients with emphysema, but it remains unclear if it has a deleterious or protective effect in disease progression. We investigated the role of p53 in the elastase-induced emphysema model and the molecular underlining mechanisms. Wild-type (WT) and p53(-/-) mice were instilled with pancreatic porcine elastase. We quantified emphysema (morphometric analysis), chemokine (C-C motif) ligand 2 (CCL2), and TNF-α in bronchoalveolar lavage (BAL) (ELISA), oxidative stress markers [heme oxygenase 1 (HO1), NAD(P)H dehydrogenase quinone 1 (NQO1), and quantitative RT-PCR], matrix metalloproteinase 12 (MMP12) expression, and macrophage apoptosis (cleaved caspase-3, immunofluorescence). p53 gene expression was up-regulated in the lung of elastase-instilled mice. p53 deletion aggravated elastase-induced emphysema severity, pulmonary inflammation (macrophage and neutrophil numbers and CCL2 and TNF-α levels in BAL), and lung oxidative stress. These findings, except for the increase in CCL2, were reproduced in WT mice transplanted with p53(-/-) bone marrow cells. The increased number of macrophages in p53(-/-) mice was not a consequence of reduced apoptosis or an excess of chemotaxis toward CCL2. Macrophage expression of MMP12 was higher in p53(-/-) mice compared with WT mice after elastase instillation. These findings provide evidence that p53(-/-) mice and WT mice grafted with p53(-/-) bone marrow cells are more prone to developing elastase-induced emphysema, supporting a protective role of p53, and more precisely p53 expressed in macrophages, against emphysema development. The pivotal role played by macrophages in this phenomenon may involve the MMP12-TNF-α pathway. PMID:26106979

  12. Targeted deletion of p53 in the proximal tubule prevents ischemic renal injury.

    PubMed

    Ying, Yuan; Kim, Jinu; Westphal, Sherry N; Long, Kelly E; Padanilam, Babu J

    2014-12-01

    The contribution of p53 to kidney dysfunction, inflammation, and tubular cell death, hallmark features of ischemic renal injury (IRI), remains undefined. Here, we studied the role of proximal tubule cell (PTC)-specific p53 activation on the short- and long-term consequences of renal ischemia/reperfusion injury in mice. After IRI, mice with PTC-specific deletion of p53 (p53 knockout [KO]) had diminished whole-kidney expression levels of p53 and its target genes, improved renal function, which was shown by decreased plasma levels of creatinine and BUN, and attenuated renal histologic damage, oxidative stress, and infiltration of neutrophils and macrophages compared with wild-type mice. Notably, necrotic cell death was attenuated in p53 KO ischemic kidneys as well as oxidant-injured p53-deficient primary PTCs and pifithrin-α-treated PTC lines. Reduced oxidative stress and diminished expression of PARP1 and Bax in p53 KO ischemic kidneys may account for the decreased necrosis. Apoptosis and expression of proapoptotic p53 targets, including Bid and Siva, were also significantly reduced, and cell cycle arrest at the G2/M phase was attenuated in p53 KO ischemic kidneys. Furthermore, IRI-induced activation of TGF-β and the long-term development of inflammation and interstitial fibrosis were significantly reduced in p53 KO mice. In conclusion, specific deletion of p53 in the PTC protects kidneys from functional and histologic deterioration after IRI by decreasing necrosis, apoptosis, and inflammation and modulates the long-term sequelae of IRI by preventing interstitial fibrogenesis. PMID:24854277

  13. Immunohistoselective sequencing (IHSS) of p53 tumor suppressor gene in human oesophageal precancerous lesions.

    PubMed

    Shi, S T; Feng, B; Yang, G Y; Wang, L D; Yang, C S

    1996-10-01

    Accumulation of p53 protein occurs in human oesophageal precancerous lesions and even in near-normal oesophageal epithelium. In some instances, p53 gene mutations have been detected. In many of the cases of p53 protein accumulation in early lesions, however, p53 mutations were not detected due to either the lack of mutation or the low abundance of cells with a mutation. In order to enrich p53 immunostain-positive cells for single strand conformation polymorphism (SSCP) analysis and DNA sequencing, an immunohisto-selective sequencing (IHSS) method was developed. Anti-p53 antibody-peroxidase stained oesophageal tissue sections were subjected to ultraviolet (UV) irradiation to damage the DNA in p53 immunostain-negative cells. The immunostain protected p53 immunostain-positive cells from the UV light and thus preserved the DNA in those cells for PCR amplification. Comparison of the SSCP results from sections with and without UV treatment showed that the IHSS method selectively enriched p53 immunostain-positive cells. With this method, we could analyse mutations in samples with as few as 30 p53 immunostain-positive cells per tissue section. Analysis was carried out on tissues with precancerous lesions from six surgically-resected oesophageal specimens and 13 oesophageal biopsies from symptom-free subjects. The results of mutation analysis for some of the samples were confirmed by microdissection to enrich the p53-positive cells. The mutations in tissues with precancerous lesions were compared with those in the corresponding squamous cell carcinomas. The IHSS method is shown to be a simple and effective way to analyse mutations in p53 immunostain-positive cells. IHSS may also be a general method for molecular analysis of biological specimens after immunohistochemical staining. PMID:8895479

  14. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    PubMed Central

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  15. Bax is upregulated by p53 signal pathway in the SPE B-induced apoptosis.

    PubMed

    Lee, Wei-Ting; Chang, Chia-Wen

    2010-10-01

    We identify integrin α(v)β(3) and Fas as receptors for the streptococcal pyrogenic exotoxin B (SPE B), and G308S (SPE B mutant, glycine at residue 308 is changed to serine), which interacts with Fas only, in our previous study. Here, we explore the signal pathways that regulate proapoptotic protein expression after SPE B stimulation. We find that both SPE B and G308S can stimulate the serine phosphorylation of p53, and p53 phosphorylation is inhibited by the anti-Fas antibody but not by anti-α(V)β(3) antibody. p38 inhibitor and siRNA decrease the activation and translocation of p53 into the nucleus, which executes its transcription activity. These results indicate that after SPE B treatment, p53 is activated and p38 is the upstream of p53. p38 siRNA also decreases the binding of p53 to the bax promoter and interferes with the association of p53 and STAT1. p53, p38, and STAT1 siRNAs downregulate SPE B-induced Bax expression. This shows that SPE B activates the bax promoter via p38/p53 signal pathways through the Fas receptor, and that STAT1 acts as a coactivator of p53. In addition, p38 and p53 siRNAs inhibit SPE B-induced apoptosis. This is consistent with the findings that SPE B upregulates Bax expression through p38/p53 signal pathways that enhance cell apoptosis. PMID:20567883

  16. CD4+ T cell responses to self- and mutated p53 determinants during tumorigenesis in mice.

    PubMed

    Fedoseyeva, E V; Boisgérault, F; Anosova, N G; Wollish, W S; Arlotta, P; Jensen, P E; Ono, S J; Benichou, G

    2000-06-01

    We analyzed CD4+ T helper responses to wild-type (wt) and mutated (mut) p53 protein in normal and tumor-bearing mice. In normal mice, we observed that although some self-p53 determinants induced negative selection of p53-reactive CD4+ T cells, other p53 determinants (cryptic) were immunogenic. Next, BALB/c mice were inoculated with J774 syngeneic tumor cell line expressing mut p53. BALB/c tumor-bearing mice mounted potent CD4+ T cell responses to two formerly cryptic peptides on self-p53. This response was characterized by massive production of IL-5, a Th2-type lymphokine. Interestingly, we found that T cell response was induced by different p53 peptides depending upon the stage of cancer. Mut p53 gene was shown to contain a single mutation resulting in the substitution of a tyrosine by a histidine at position 231 of the protein. Two peptides corresponding to wt and mutated sequences of this region were synthesized. Both peptides bound to the MHC class II-presenting molecule (Ed) with similar affinities. However, only mut p53.225-239 induced T cell responses in normal BALB/c mice, a result strongly suggesting that high-affinity wt p53.225-239 autoreactive T cells had been eliminated in these mice. Surprisingly, CD4+ T cell responses to both mut and wt p53.225-239 peptides were recorded in J774 tumor-bearing mice, a phenomenon attributed to the recruitment of low-avidity p53.225-239 self-reactive T cells. PMID:10820239

  17. Endoplasmic Reticulum Stress Stimulates p53 Expression through NF-κB Activation

    PubMed Central

    Lin, Wan-Chi; Chuang, Yu-Chi; Chang, Yung-Sheng; Lai, Ming-Derg; Teng, Yen-Ni; Su, Ih-Jen; Wang, Clay C. C.; Lee, Kuan-Han; Hung, Jui-Hsiang

    2012-01-01

    Background Induction of apoptosis by endoplasmic reticulum (ER) stress is implicated as the major factor in the development of multiple diseases. ER stress also appears to be a potentially useful major response to many chemotherapeutic drugs and environmental chemical compounds. A previous study has indicated that one major apoptotic regulator, p53, is significantly increased in response to ER stress, and participates in ER stress-induced apoptosis. However, the regulators of p53 expression during ER stress are still not fully understood. Principal Findings In this report, we demonstrate that induction of p53 expression is mediated through NF-κB signaling pathways during ER stress in MCF-7 cells. Tunicamycin or brefeldin A, two ER stress inducers, increased p53 expression in MCF-7 and Hela cells. We found p53 nuclear localization, activity, and phosphorylation at serine 15 on p53 increased during ER stress. Nuclear translocation of NF-κB and activity of NF-κB were also observed during ER stress. ER stress-induced p53 expression was significantly inhibited by coincubation with the NF-κB inhibitor, Bay 11-7082 and downregulation of NF-κB p65 expression. The role of p53 in mediating Brefeldin A-induced apoptosis was also investigated. Induction of p53 expression by Brefeldin A was correlated to Brefeldin A-induced apoptosis. Furthermore, downregulation of p53 expression by p53 siRNA significantly reduced Brefeldin A-induced apoptosis in MCF-7 cells. Significance Taken together, NF-κB activation and induction of p53 expression is essential for ER stress-induced cell death which is important for therapeutic effects of clinical cancer drugs. Our results may provide insight into the mechanism of cancer chemotherapy efficacy that is associated with induction of ER stress. PMID:22859938

  18. MYCN sensitizes neuroblastoma to the MDM2-p53 antagonists Nutlin-3 and MI-63

    PubMed Central

    Gamble, Laura D.; Kees, Ursula R.; Tweddle, Deborah A.; Lunec, John

    2011-01-01

    MYCN amplification is a major biomarker of poor prognosis, occurring in 25-30% of neuroblastomas. MYCN plays contradictory roles in promoting cell growth and sensitizing cells to apoptosis. We have recently shown that p53 is a direct transcriptional target of MYCN in neuroblastoma and that p53-mediated apoptosis may be an important mechanism of MYCN-induced apoptosis. Although p53 mutations are rare in neuroblastoma at diagnosis, the p53/MDM2/p14ARF pathway is often inactivated through MDM2 amplification or p14ARF inactivation. We hypothesised that reactivation of p53 by inhibition of its negative regulator MDM2, using the MDM2-p53 antagonists Nutlin-3 and MI-63, will result in p53-mediated growth arrest and apoptosis especially in MYCN amplified cells. Using the SHEP Tet21N MYCN regulatable system, MYCN(−) cells were more resistant to both Nutlin-3 and MI-63 mediated growth inhibition and apoptosis compared to MYCN(+) cells and siRNA mediated knockdown of MYCN in 4 MYCN amplified cell lines resulted in decreased p53 expression and activation, as well as decreased levels of apoptosis following treatment with MDM2-p53 antagonists. In a panel of 18 neuroblastoma cell lines treated with Nutlin-3 and MI-63, the sub-set amplified for MYCN had a significantly lower mean GI50 value and increased caspase 3/7 activity compared to the non MYCN amplified group of cell lines, but p53 mutant cell lines were resistant to the antagonists regardless of MYCN status. We conclude that amplification or overexpression of MYCN sensitizes neuroblastoma cell lines with wildtype p53 to MDM2-p53 antagonists and that these compounds may therefore be particularly effective in treating high risk MYCN amplified disease. PMID:21725357

  19. Repression of the antiapoptotic molecule galectin-3 by homeodomain-interacting protein kinase 2-activated p53 is required for p53-induced apoptosis.

    PubMed

    Cecchinelli, Barbara; Lavra, Luca; Rinaldo, Cinzia; Iacovelli, Stefano; Gurtner, Aymone; Gasbarri, Alessandra; Ulivieri, Alessandra; Del Prete, Fabrizio; Trovato, Maria; Piaggio, Giulia; Bartolazzi, Armando; Soddu, Silvia; Sciacchitano, Salvatore

    2006-06-01

    Galectin 3 (Gal-3), a member of the beta-galactoside binding lectin family, exhibits antiapoptotic functions, and its aberrant expression is involved in various aspects of tumor progression. Here we show that p53-induced apoptosis is associated with transcriptional repression of Gal-3. Previously, it has been reported that phosphorylation of p53 at Ser46 is important for transcription of proapoptotic genes and induction of apoptosis and that homeodomain-interacting protein kinase 2 (HIPK2) is specifically involved in these functions. We show that HIPK2 cooperates with p53 in Gal-3 repression and that this cooperation requires HIPK2 kinase activity. Gene-specific RNA interference demonstrates that HIPK2 is essential for repression of Gal-3 upon induction of p53-dependent apoptosis. Furthermore, expression of a nonrepressible Gal-3 prevents HIPK2- and p53-induced apoptosis. These results reveal a new apoptotic pathway induced by HIPK2-activated p53 and requiring repression of the antiapoptotic factor Gal-3. PMID:16738336

  20. Two Li-Fraumeni syndrome families with novel germline p53 mutations: loss of the wild-type p53 allele in only 50% of tumours.

    PubMed Central

    Sedlacek, Z.; Kodet, R.; Kriz, V.; Seemanova, E.; Vodvarka, P.; Wilgenbus, P.; Mares, J.; Poustka, A.; Goetz, P.

    1998-01-01

    We describe two Li-Fraumeni syndrome families. Family A was remarkable for two early childhood cases of adrenocortical tumours, family B for a high incidence of many characteristic cancers, including a childhood case of choroid plexus tumour. Using direct sequencing, we analysed exons 5-9 of the p53 gene in constitutional DNA of individuals from both families and found two novel germline mutations in exon 5. In family A, we detected a point substitution in codon 138 (GCC to CCC), which resulted in the replacement of the alanine by a proline residue. Family B harboured a single-base pair deletion in codon 178 (CAC to -AC), resulting in a frameshift and premature chain termination. Three out of six tumours examined from both families, a renal cell carcinoma, a rhabdomyosarcoma and a breast cancer, showed loss of heterozygosity and contained only the mutant p53 allele. The remaining three neoplasms, both adrenocortical tumours and the choroid plexus tumour retained heterozygosity. Immunohistochemistry with anti-p53 antibody confirmed accumulation of p53 protein in tumours with loss of heterozygosity, while the remaining tumours were p53 negative. These results support the view that complete loss of activity of the wild-type p53 need not be the initial event in the formation of all tumours in Li-Fraumeni individuals. Images Figure 3 PMID:9569035

  1. Corp Regulates P53 in Drosophila melanogaster via a Negative Feedback Loop

    PubMed Central

    Chakraborty, Riddhita; Li, Ying; Zhou, Lei; Golic, Kent G.

    2015-01-01

    The tumor suppressor P53 is a critical mediator of the apoptotic response to DNA double-strand breaks through the transcriptional activation of pro-apoptotic genes. This mechanism is evolutionarily conserved from mammals to lower invertebrates, including Drosophila melanogaster. P53 also transcriptionally induces its primary negative regulator, Mdm2, which has not been found in Drosophila. In this study we identified the Drosophila gene companion of reaper (corp) as a gene whose overexpression promotes survival of cells with DNA damage in the soma but reduces their survival in the germline. These disparate effects are shared by p53 mutants, suggesting that Corp may be a negative regulator of P53. Confirming this supposition, we found that corp negatively regulates P53 protein level. It has been previously shown that P53 transcriptionally activates corp; thus, Corp produces a negative feedback loop on P53. We further found that Drosophila Corp shares a protein motif with vertebrate Mdm2 in a region that mediates the Mdm2:P53 physical interaction. In Corp, this motif mediates physical interaction with Drosophila P53. Our findings implicate Corp as a functional analog of vertebrate Mdm2 in flies. PMID:26230084

  2. Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

    PubMed Central

    Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

    2012-01-01

    Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

  3. p53 loss promotes acute myeloid leukemia by enabling aberrant self-renewal

    PubMed Central

    Zhao, Zhen; Zuber, Johannes; Diaz-Flores, Ernesto; Lintault, Laura; Kogan, Scott C.; Shannon, Kevin; Lowe, Scott W.

    2010-01-01

    The p53 tumor suppressor limits proliferation in response to cellular stress through several mechanisms. Here, we test whether the recently described ability of p53 to limit stem cell self-renewal suppresses tumorigenesis in acute myeloid leukemia (AML), an aggressive cancer in which p53 mutations are associated with drug resistance and adverse outcome. Our approach combined mosaic mouse models, Cre-lox technology, and in vivo RNAi to disable p53 and simultaneously activate endogenous KrasG12D—a common AML lesion that promotes proliferation but not self-renewal. We show that p53 inactivation strongly cooperates with oncogenic KrasG12D to induce aggressive AML, while both lesions on their own induce T-cell malignancies with long latency. This synergy is based on a pivotal role of p53 in limiting aberrant self-renewal of myeloid progenitor cells, such that loss of p53 counters the deleterious effects of oncogenic Kras on these cells and enables them to self-renew indefinitely. Consequently, myeloid progenitor cells expressing oncogenic Kras and lacking p53 become leukemia-initiating cells, resembling cancer stem cells capable of maintaining AML in vivo. Our results establish an efficient new strategy for interrogating oncogene cooperation, and provide strong evidence that the ability of p53 to limit aberrant self-renewal contributes to its tumor suppressor activity. PMID:20595231

  4. Autophagy induced by p53-reactivating molecules protects pancreatic cancer cells from apoptosis.

    PubMed

    Fiorini, Claudia; Menegazzi, Marta; Padroni, Chiara; Dando, Ilaria; Dalla Pozza, Elisa; Gregorelli, Alex; Costanzo, Chiara; Palmieri, Marta; Donadelli, Massimo

    2013-03-01

    TP53 mutations compromising p53 transcriptional function occur in more than 50 % of human cancers, including pancreatic adenocarcinoma, and render cancer cells more resistant to conventional therapy. In the last few years, many efforts have been addressed to identify p53-reactivating molecules able to restore the wild-type transcriptionally competent conformation of the mutated proteins. Here, we show that two of these compounds, CP-31398 and RITA, induce cell growth inhibition, apoptosis, and autophagy by activating p53/DNA binding and p53 phosphorylation (Ser15), without affecting the total p53 amount. These effects occur in both wild-type and mutant p53 pancreatic adenocarcinoma cell lines, whereas they are much less pronounced in normal human primary fibroblasts. Furthermore, CP-31398 and RITA regulate the axis SESN1-2/AMPK/mTOR by inducing AMPK phosphorylation on Thr172, which has a crucial role in the autophagic response. The protective role of autophagy in cell growth inhibition by CP-31398 and RITA is supported by the finding that the AMPK inhibitor compound C or the autophagy inhibitors chloroquine or 3-methyladenine sensitize both pancreatic adenocarcinoma cell lines to the apoptotic response induced by p53-reactivating molecules. Our results demonstrate for the first time a survival role for autophagy induced by p53-reactivating molecules, supporting the development of an anti-cancer therapy based on autophagy inhibition associated to p53 activation. PMID:23238993

  5. The prolyl-isomerase Pin1 activates the mitochondrial death program of p53.

    PubMed

    Sorrentino, G; Mioni, M; Giorgi, C; Ruggeri, N; Pinton, P; Moll, U; Mantovani, F; Del Sal, G

    2013-02-01

    In response to intense stress, the tumor protein p53 (p53) tumor suppressor rapidly mounts a direct mitochondrial death program that precedes transcription-mediated apoptosis. By eliminating severely damaged cells, this pathway contributes to tumor suppression as well as to cancer cell killing induced by both genotoxic drugs and non-genotoxic p53-reactivating molecules. Here we have explored the role had in this pathway by the prolyl-isomerase Pin1 (peptidylprolyl cis/trans isomerase, NIMA-interacting 1), a crucial transducer of p53's phosphorylation into conformational changes unleashing its pro-apoptotic activity. We show that Pin1 promotes stress-induced localization of p53 to mitochondria both in vitro and in vivo. In particular, we demonstrate that upon stress-induced phosphorylation of p53 on Ser46 by homeodomain interacting protein kinase 2, Pin1 stimulates its mitochondrial trafficking signal, that is, monoubiquitination. This pathway is induced also by the p53-activating molecule RITA, and we demonstrate the strong requirement of Pin1 for the induction of mitochondrial apoptosis by this compound. These findings have significant implications for treatment of p53-expressing tumors and for prospective use of p53-activating compounds in clinics. PMID:22935610

  6. Radiation-Induced Salivary Gland Dysfunction Results From p53-Dependent Apoptosis

    SciTech Connect

    Avila, Jennifer L.; Grundmann, Oliver; Burd, Randy; Limesand, Kirsten H.

    2009-02-01

    Purpose: Radiotherapy for head-and-neck cancer causes adverse secondary side effects in the salivary glands and results in diminished quality of life for the patient. A previous in vivo study in parotid salivary glands demonstrated that targeted head-and-neck irradiation resulted in marked increases in phosphorylated p53 (serine{sup 18}) and apoptosis, which was suppressed in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Methods and Materials: Transgenic and knockout mouse models were exposed to irradiation, and p53-mediated transcription, apoptosis, and salivary gland dysfunction were analyzed. Results: The proapoptotic p53 target genes PUMA and Bax were induced in parotid salivary glands of mice at early time points after therapeutic radiation. This dose-dependent induction requires expression of p53 because no radiation-induced expression of PUMA and Bax was observed in p53-/- mice. Radiation also induced apoptosis in the parotid gland in a dose-dependent manner, which was p53 dependent. Furthermore, expression of p53 was required for the acute and chronic loss of salivary function after irradiation. In contrast, apoptosis was not induced in p53-/- mice, and their salivary function was preserved after radiation exposure. Conclusions: Apoptosis in the salivary glands after therapeutic head-and-neck irradiation is mediated by p53 and corresponds to salivary gland dysfunction in vivo.

  7. A dynamic model for the p53 stress response networks under ion radiation.

    PubMed

    Qi, J-P; Shao, S-H; Li, D-D; Zhou, G-P

    2007-07-01

    P53 controls the cell cycle arrest and cell apoptosis through interaction with the downstream genes and their signal pathways. To stimulate the investigation into the complicated responses of p53 under the circumstance of ion radiation (IR) in the cellular level, a dynamic model for the p53 stress response networks is proposed. The model can be successfully used to simulate the dynamic processes of generating the double-strand breaks (DSBs) and their repairing, ataxia telangiectasia mutated (ATM) activation, as well as the oscillations occurring in the p53-MDM2 feedback loop. PMID:17072789

  8. 4-Hydroxynonenal induces p53-mediated apoptosis in retinal pigment epithelial cells

    PubMed Central

    Sharma, Abha; Sharma, Rajendra; Chaudhary, Pankaj; Vatsyayan, Rit; Pearce, Virginia; Jeyabal, Prince V.S.; Zimniak, Piotr; Awasthi, Sanjay; Awasthi, Yogesh C.

    2009-01-01

    4-Hydroxynonenal (4-HNE) has been suggested to be involved in stress-induced signaling for apoptosis. In present studies, we have examined the effects of 4-HNE on the intrinsic apoptotic pathway associated with p53 in human retinal pigment epithelial (RPE and ARPE-19) cells. Our results show that 4-HNE causes induction, phosphorylation, and nuclear accumulation of p53 which is accompanied with down regulation of MDM2, activation of the pro-apoptotic p53 target genes viz. p21 and Bax, JNK, caspase3, and onset of apoptosis in treated RPE cells. Reduced expression of p53 by an efficient silencing of the p53 gene resulted in a significant resistance of these cells to 4-HNE-induced cell death. The effects of 4-HNE on the expression and functions of p53 are blocked in GSTA4-4 over expressing cells indicating that 4-HNE-induced, p53-mediated signaling for apoptosis is regulated by GSTs. Our results also show that the induction of p53 in tissues of mGsta4 (-/-) mice correlate with elevated levels of 4-HNE due to its impaired metabolism. Together, these studies suggest that 4-HNE is involved in p53-mediated signaling in in vitro cell cultures as well as in vivo that can be regulated by GSTs. PMID:18930016

  9. Pharmacological activation of wild-type p53 in the therapy of leukemia.

    PubMed

    Kojima, Kensuke; Ishizawa, Jo; Andreeff, Michael

    2016-09-01

    The tumor suppressor p53 is inactivated by mutations in the majority of human solid tumors. Conversely, p53 mutations are rare in leukemias and are only observed in a small fraction of the patient population, predominately in patients with complex karyotype acute myeloid leukemia or hypodiploid acute lymphoblastic leukemia. However, the loss of p53 function in leukemic cells is often caused by abnormalities in p53-regulatory proteins, including overexpression of MDM2/MDMX, deletion of CDKN2A/ARF, and alterations in ATM. For example, MDM2 inhibits p53-mediated transcription, promotes its nuclear export, and induces proteasome-dependent degradation. The MDM2 homolog MDMX is another direct regulator of p53 that inhibits p53-mediated transcription. Several small-molecule inhibitors and stapled peptides targeting MDM2 and MDMX have been developed and have recently entered clinical trials. The clinical trial results of the first clinically used MDM2 inhibitor, RG7112, illustrated promising p53 activation and apoptosis induction in leukemia cells as proof of concept. Side effects of RG7112 were most prominent in suppression of thrombopoiesis and gastrointestinal symptoms in leukemia patients. Predictive biomarkers for response to MDM2 inhibitors have been proposed, but they require further validation both in vitro and in vivo so that the accumulated knowledge concerning pathological p53 dysregulation in leukemia and novel molecular-targeted strategies to overcome this dysregulation can be translated safely and efficiently into novel clinical therapeutics. PMID:27327543

  10. Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

    NASA Astrophysics Data System (ADS)

    Sharifulina, S. A.; Uzdensky, A. B.

    2015-03-01

    The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

  11. Immunohistochemical expression of p53 and its clinicopathological correlation with modified Anneroth's histological grading system

    PubMed Central

    Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G

    2016-01-01

    Introduction and Objectives: Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). Materials and Methods: 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. Statistical Analysis: The results obtained were analyzed using Spearman's Co-relation. Observations and Results: The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Conclusion: Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found. PMID:27194859

  12. p53 targets simian virus 40 large T antigen for acetylation by CBP.

    PubMed

    Poulin, Danielle L; Kung, Andrew L; DeCaprio, James A

    2004-08-01

    Simian virus 40 (SV40) large T antigen (T Ag) interacts with the tumor suppressor p53 and the transcriptional coactivators CBP and p300. Binding of these cellular proteins in a ternary complex has been implicated in T Ag-mediated transformation. It has been suggested that the ability of CBP/p300 to modulate p53 function underlies p53's regulation of cell proliferation and tumorigenesis. In this study, we provide further evidence that CBP activity may be mediated through its synergistic action with p53. We demonstrate that SV40 T Ag is acetylated in vivo in a p53-dependent manner and T Ag acetylation is largely mediated by CBP. The acetylation of T Ag is dependent on its interaction with p53 and on p53's interaction with CBP. We have mapped the site of acetylation on T Ag to the C-terminal lysine residue 697. This acetylation site is conserved between the T antigens of the human polyomaviruses JC and BK, which are also known to interact with