Hammerhead ribozyme activity and oligonucleotide duplex stability in mixed solutions of water and organic compounds

PubMed Central

Nakano, Shu-ichi; Kitagawa, Yuichi; Miyoshi, Daisuke; Sugimoto, Naoki

2014-01-01

Nucleic acids are useful for biomedical targeting and sensing applications in which the molecular environment is different from that of a dilute aqueous solution. In this study, the influence of various types of mixed solutions of water and water-soluble organic compounds on RNA was investigated by measuring the catalytic activity of the hammerhead ribozyme and the thermodynamic stability of an oligonucleotide duplex. The compounds with a net neutral charge, such as poly(ethylene glycol), small primary alcohols, amide compounds, and aprotic solvent molecules, added at high concentrations changed the ribozyme-catalyzed RNA cleavage rate, with the magnitude of the effect dependent on the NaCl concentration. These compounds also changed the thermodynamic stability of RNA base pairs of an oligonucleotide duplex and its dependence on the NaCl concentration. Specific interactions with RNA molecules and reduced water activity could account for the inhibiting effects on the ribozyme catalysis and destabilizing effects on the duplex stability. The salt concentration dependence data correlated with the dielectric constant, but not with water activity, viscosity, and the size of organic compounds. This observation suggests the significance of the dielectric constant effects on the RNA reactions under molecular crowding conditions created by organic compounds. PMID:25161873

Effect of Cavity Size of Mesoporous Silica on Short DNA Duplex Stability.

PubMed

Masuda, Tsubasa; Shibuya, Yuuta; Arai, Shota; Kobayashi, Sayaka; Suzuki, Sotaro; Kijima, Jun; Itoh, Tetsuji; Sato, Yusuke; Nishizawa, Seiichi; Yamaguchi, Akira

2018-05-15

We studied the stabilities of short (4- and 3-bp) DNA duplexes within silica mesopores modified with a positively charged trimethyl aminopropyl (TMAP) monolayer (BJH pore diameter 1.6-7.4 nm). The DNA fragments with fluorescent dye were introduced into the pores, and their fluorescence resonance energy transfer (FRET) response was measured to estimate the structuring energies of the short DNA duplexes under cryogenic conditions (temperature 233-323 K). The results confirmed the enthalpic stability gain of the duplex within size-matched pores (1.6 and 2.3 nm). The hybridization equilibrium constants found for the size-matched pores were 2 orders of magnitude larger than those for large pores (≥3.5 nm), and this size-matching effect for the enhanced duplex stability was explained by a tight electrostatic interaction between the duplex and the surface TMAP groups. These results indicate the requirement of the precise regulation of mesopore size to ensure the stabilization of hydrogen-bonded supramolecular assemblies.

Approximation methods for the stability analysis of complete synchronization on duplex networks

NASA Astrophysics Data System (ADS)

Han, Wenchen; Yang, Junzhong

2018-01-01

Recently, the synchronization on multi-layer networks has drawn a lot of attention. In this work, we study the stability of the complete synchronization on duplex networks. We investigate effects of coupling function on the complete synchronization on duplex networks. We propose two approximation methods to deal with the stability of the complete synchronization on duplex networks. In the first method, we introduce a modified master stability function and, in the second method, we only take into consideration the contributions of a few most unstable transverse modes to the stability of the complete synchronization. We find that both methods work well for predicting the stability of the complete synchronization for small networks. For large networks, the second method still works pretty well.

Influence of PNA containing 8-aza-7-deazaadenine on structure stability and binding affinity of PNA·DNA duplex: insights from thermodynamics, counter ion, hydration and molecular dynamics analysis.

PubMed

Gupta, Sharad K; Sur, Souvik; Prasad Ojha, Rajendra; Tandon, Vibha

2013-07-01

This paper describes the synthesis of a novel 8-aza-7-deazapurin-2,6-diamine (DPP)-containing peptide nucleic acid (PNA) monomer and Boc protecting group-based oligomerization of PNA, replacing adenine (A) with DPP monomers in the PNA strand. The PNA oligomers were synthesized against the biologically relevant SV40 promoter region (2494-AATTTTTTTTATTTA-2508) of pEGFP-N3 plasmid. The DPP-PNA·DNA duplex showed enhanced stability as compared to normal duplex (A-PNA·DNA). The electronic distribution of DPP monomer suggested that DPP had better electron donor properties over 2,6-diamino purine. UV melting and thermodynamic analysis revealed that the PNA oligomer containing a diaminopyrazolo(3,4-d)pyrimidine moiety (DPP) stabilized the PNA·DNA hybrids compared to A-PNA·DNA. DPP-PNA·DNA duplex showed higher water activity (Δnw = 38.5) in comparison to A-PNA·DNA duplex (Δnw = 14.5). The 50 ns molecular dynamics simulations of PNA·DNA duplex containing DPP or unmodified nucleobase-A showed average H-bond distances in the DPP-dT base pair of 2.90 Å (OH-N bond) and 2.91 Å (NH-N bond), which were comparably shorter than in the A-dT base pair, in which the average distances were 3.18 Å (OH-N bond) and 2.97 Å (NH-N bond), and there was one additional H-bond in the DPP-dT base pair of around 2.98 Å (O2H-N2 bond), supporting the higher stability of DPP-PNA·DNA. The analysis of molecular dynamics simulation data showed that the system binding free energy increased at a rate of approximately -4.5 kcal mol(-1) per DPP base of the PNA·DNA duplex. In summary, increased thermal stability, stronger hydrogen bonding and more stable conformation in the DPP-PNA·DNA duplex make it a better candidate as antisense/antigene therapeutic agents.

Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex.

PubMed

Kanaori, K; Tamura, Y; Wada, T; Nishi, M; Kanehara, H; Morii, T; Tajima, K; Makino, K

1999-12-07

The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA

Backbone conformation affects duplex initiation and duplex propagation in hybridisation of synthetic H-bonding oligomers.

PubMed

Iadevaia, Giulia; Núñez-Villanueva, Diego; Stross, Alexander E; Hunter, Christopher A

2018-06-06

Synthetic oligomers equipped with complementary H-bond donor and acceptor side chains form multiply H-bonded duplexes in organic solvents. Comparison of the duplex forming properties of four families of oligomers with different backbones shows that formation of an extended duplex with three or four inter-strand H-bonds is more challenging than formation of complexes that make only two H-bonds. The stabilities of 1 : 1 complexes formed between length complementary homo-oligomers equipped with either phosphine oxide or phenol recognition modules were measured in toluene. When the backbone is very flexible (pentane-1,5-diyl thioether), the stability increases uniformly by an order of magnitude for each additional base-pair added to the duplex: the effective molarities for formation of the first intramolecular H-bond (duplex initiation) and subsequent intramolecular H-bonds (duplex propagation) are similar. This flexible system is compared with three more rigid backbones that are isomeric combinations of an aromatic ring and methylene groups. One of the rigid systems behaves in exactly the same way as the flexible backbone, but the other two do not. For these systems, the effective molarity for formation of the first intramolecular H-bond is the same as that found for the other two backbones, but additional H-bonds are not formed between the longer oligomers. The effective molarities are too low for duplex propagation in these systems, because the oligomer backbones cannot adopt conformations compatible with formation of an extended duplex.

Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

PubMed

Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

2018-02-01

Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

PubMed

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of fluorescent dyes, quenchers, and dangling ends on DNA duplex stability.

PubMed

Moreira, Bernardo G; You, Yong; Behlke, Mark A; Owczarzy, Richard

2005-02-11

Single and dual-labeled fluorescent oligodeoxynucleotides are used in many molecular biology applications. We investigated the effects of commonly used fluorescent dyes and quenchers on the thermodynamic stability of a model probe-target DNA duplex. We demonstrate that those effects can be significant. Fluorescent dyes and quenchers were attached to the probe ends. In certain combinations, these groups stabilized the duplex up to 1.8kcal/mol and increased T(m) up to 4.3 degrees C. None of the groups tested significantly destabilized the duplex. Rank order of potency was, starting with the most stabilizing group: Iowa Black RQ approximately Black Hole 2>Cy5 approximately Cy3>Black Hole 1>QSY7 approximately Iowa Black FQ>Texas Red approximately TAMRA>FAM approximately HEX approximately Dabcyl>TET. Longer linkers decreased stabilizing effects. Hybridizations to targets with various dangling ends were also studied and were found to have only minor effects on thermodynamic stability. Depending on the dye/quencher combination employed, it can be important to include thermodynamic contributions from fluorophore and quencher when designing oligonucleotide probe assays.

N(4)C-ethyl-N(4)C cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of different orientations.

PubMed

Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S

2002-01-22

The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross

Inclusion of methoxy groups inverts the thermodynamic stabilities of DNA-RNA hybrid duplexes: A molecular dynamics simulation study.

PubMed

Suresh, Gorle; Priyakumar, U Deva

2015-09-01

Modified nucleic acids have found profound applications in nucleic acid based technologies such as antisense and antiviral therapies. Previous studies on chemically modified nucleic acids have suggested that modifications incorporated in furanose sugar especially at 2'-position attribute special properties to nucleic acids when compared to other modifications. 2'-O-methyl modification to deoxyribose sugars of DNA-RNA hybrids is one such modification that increases nucleic acid stability and has become an attractive class of compounds for potential antisense applications. It has been reported that modification of DNA strands with 2'-O-methyl group reverses the thermodynamic stability of DNA-RNA hybrid duplexes. Molecular dynamics simulations have been performed on two hybrid duplexes (DR and RD) which differ from each other and 2'-O-methyl modified counterparts to investigate the effect of 2'-O-methyl modification on their duplex stability. The results obtained suggest that the modification drives the conformations of both the hybrid duplexes towards A-RNA like conformation. The modified hybrid duplexes exhibit significantly contrasting dynamics and hydration patterns compared to respective parent duplexes. In line with the experimental results, the relative binding free energies suggest that the introduced modifications stabilize the less stable DR hybrid, but destabilize the more stable RD duplex. Binding free energy calculations suggest that the increased hydrophobicity is primarily responsible for the reversal of thermodynamic stability of hybrid duplexes. Free energy component analysis further provides insights into the stability of modified duplexes. Copyright © 2015 Elsevier Inc. All rights reserved.

Probing of miniPEGγ-PNA-DNA Hybrid Duplex Stability with AFM Force Spectroscopy.

PubMed

Dutta, Samrat; Armitage, Bruce A; Lyubchenko, Yuri L

2016-03-15

Peptide nucleic acids (PNA) are synthetic polymers, the neutral peptide backbone of which provides elevated stability to PNA-PNA and PNA-DNA hybrid duplexes. It was demonstrated that incorporation of diethylene glycol (miniPEG) at the γ position of the peptide backbone increased the thermal stability of the hybrid duplexes (Sahu, B. et al. J. Org. Chem. 2011, 76, 5614-5627). Here, we applied atomic force microscopy (AFM) based single molecule force spectroscopy and dynamic force spectroscopy (DFS) to test the strength and stability of the hybrid 10 bp duplex. This hybrid duplex consisted of miniPEGγ-PNA and DNA of the same length (γ(MP)PNA-DNA), which we compared to a DNA duplex with a homologous sequence. AFM force spectroscopy data obtained at the same conditions showed that the γ(MP)PNA-DNA hybrid is more stable than the DNA counterpart, 65 ± 15 pN vs 47 ± 15 pN, respectively. The DFS measurements performed in a range of pulling speeds analyzed in the framework of the Bell-Evans approach yielded a dissociation constant, koff ≈ 0.030 ± 0.01 s⁻¹ for γ(MP)PNA-DNA hybrid duplex vs 0.375 ± 0.18 s⁻¹ for the DNA-DNA duplex suggesting that the hybrid duplex is much more stable. Correlating the high affinity of γ(MP)PNA-DNA to slow dissociation kinetics is consistent with prior bulk characterization by surface plasmon resonance. Given the growing interest in γ(MP)PNA as well as other synthetic DNA analogues, the use of single molecule experiments along with computational analysis of force spectroscopy data will provide direct characterization of various modifications as well as higher order structures such as triplexes and quadruplexes.

Base opening in RNA and DNA duplexes: implication for RNA stability.

PubMed

Chen, Y Z; Mohan, V; Griffey, R H

2000-05-01

The energetics of a low-energy single base opening in several RNA duplex crystal structures has been calculated and compared to DNA duplexes. Base opening in RNA appears to have an overall preference towards the major groove, similar to results previously reported for B-DNA. Movement of each of the adenine, uracil, and cytosine bases into the minor groove is blocked by a high-energy barrier due to severe close contact with neighboring bases. Guanine bases are able to open towards both grooves because of the unique orientation of the base that avoids steric clash along the opening pathway. RNA bases are found to have a substantially smaller major groove opening extent than that of their B-DNA counterparts. A comparison with base opening behavior of A-DNA duplexes suggests that this difference results from helix constraint associated with A-form backbone conformation. The reduced opening extent correlates with the RNA duplex stability and is consistent with observed slower imino proton exchange rates in RNA duplexes.

Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

PubMed

Panczyk, Tomasz; Wolski, Pawel

2018-06-01

This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

PubMed

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Predicting RNA Duplex Dimerization Free-Energy Changes upon Mutations Using Molecular Dynamics Simulations.

PubMed

Sakuraba, Shun; Asai, Kiyoshi; Kameda, Tomoshi

2015-11-05

The dimerization free energies of RNA-RNA duplexes are fundamental values that represent the structural stability of RNA complexes. We report a comparative analysis of RNA-RNA duplex dimerization free-energy changes upon mutations, estimated from a molecular dynamics simulation and experiments. A linear regression for nine pairs of double-stranded RNA sequences, six base pairs each, yielded a mean absolute deviation of 0.55 kcal/mol and an R(2) value of 0.97, indicating quantitative agreement between simulations and experimental data. The observed accuracy indicates that the molecular dynamics simulation with the current molecular force field is capable of estimating the thermodynamic properties of RNA molecules.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Interpretation of dynamic tensile behavior by austenite stability in ferrite-austenite duplex lightweight steels.

PubMed

Park, Jaeyeong; Jo, Min Cheol; Jeong, Hyeok Jae; Sohn, Seok Su; Kwak, Jai-Hyun; Kim, Hyoung Seop; Lee, Sunghak

2017-11-16

Phenomena occurring in duplex lightweight steels under dynamic loading are hardly investigated, although its understanding is essentially needed in applications of automotive steels. In this study, quasi-static and dynamic tensile properties of duplex lightweight steels were investigated by focusing on how TRIP and TWIP mechanisms were varied under the quasi-static and dynamic loading conditions. As the annealing temperature increased, the grain size and volume fraction of austenite increased, thereby gradually decreasing austenite stability. The strain-hardening rate curves displayed a multiple-stage strain-hardening behavior, which was closely related with deformation mechanisms. Under the dynamic loading, the temperature rise due to adiabatic heating raised the austenite stability, which resulted in the reduction in the TRIP amount. Though the 950 °C-annealed specimen having the lowest austenite stability showed the very low ductility and strength under the quasi-static loading, it exhibited the tensile elongation up to 54% as well as high strain-hardening rate and tensile strength (1038 MPa) due to appropriate austenite stability under dynamic loading. Since dynamic properties of the present duplex lightweight steels show the excellent strength-ductility combination as well as continuously high strain hardening, they can be sufficiently applied to automotive steel sheets demanded for stronger vehicle bodies and safety enhancement.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

2016-07-01

Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

PubMed

Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

2014-01-25

Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage

PubMed Central

Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan

2012-01-01

ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876

Structural studies of the 5'-phenazinium-tethered matched and G-A-mismatched DNA duplexes by NMR spectroscopy.

PubMed

Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J

1993-05-01

The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry

Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

PubMed

Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

2015-10-12

A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

PubMed Central

O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

2006-01-01

Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes

PubMed Central

Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina

2011-01-01

Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethlyl-glycine backbone. The crystal structure of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATCGG)2 (pdb: 3MBS), and the other containing the same nucleobase pairs and a central pair of bipyridine ligands (pdb: 3MBU), has been solved with a resolution of 1.2 Å and 1.05 Å, respectively. The non-modified PNA duplex adopts a P-type helical structure s i m i l a r t o that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. These results support the notion that while PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines are bulged out of the duplex and are aligned parallel to the minor groove of the PNA. In the case of the bipyridine-containing PNA, two bipyridines from adjacent PNA duplexes form a π-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are π-stacking with adjacent nucleobase pairs and adopt an intrahelical geometry [Johar et al., Chem. Eur. J., 2008, 14, 2080]. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes. PMID:20859960

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

PubMed

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Spermine Condenses DNA, but Not RNA Duplexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.

Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 basemore » pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.« less

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

PubMed

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

PubMed

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synthesis of 5-(1,2,3-triazol-4-yl)-2'-deoxyuridines by a click chemistry approach: stacking of triazoles in the major groove gives increased nucleic acid duplex stability.

PubMed

Kocalka, Petr; Andersen, Nicolai K; Jensen, Frank; Nielsen, Poul

2007-11-23

A general protocol for converting alkyl and aryl halides into azides and for converting these in situ into 1,4-disubstituted triazoles was applied with 5-ethynyl-2'-deoxyuridine. This afforded three modified 2'-deoxyuridine analogues with either unsubstituted or 1-phenyl-/1-benzyl-substituted triazoles in their 5-positions. Modelling demonstrates coplanarity of the two heteroaromatic rings, and UV spectroscopy showed the uracil pK(a) values to be almost unchanged. The three nucleosides were introduced into nonamer oligonucleotides by phosphoramidite chemistry. The heteroaromatic triazoles became positioned in the major grooves of the short dsDNA and DNA-RNA duplexes. While single modifications led to decreased duplex stability, the stacking of four consecutive modifications led to enhanced duplex stability, especially for DNA-RNA duplexes. The duplex structures were studied by CD spectroscopy and molecular dynamics simulations, which supported the conjecture that the duplex stabilizing effect is due to efficient stacking of the heteroaromatic triazoles.

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

PubMed Central

Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

2016-01-01

RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

Sequence-Selective Formation of Synthetic H-Bonded Duplexes

PubMed Central

2017-01-01

Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (102 to 105 M–1). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor–acceptor sequences are avoided. PMID:28857551

Improved Model for Predicting the Free Energy Contribution of Dinucleotide Bulges to RNA Duplex Stability.

PubMed

Tomcho, Jeremy C; Tillman, Magdalena R; Znosko, Brent M

2015-09-01

Predicting the secondary structure of RNA is an intermediate in predicting RNA three-dimensional structure. Commonly, determining RNA secondary structure from sequence uses free energy minimization and nearest neighbor parameters. Current algorithms utilize a sequence-independent model to predict free energy contributions of dinucleotide bulges. To determine if a sequence-dependent model would be more accurate, short RNA duplexes containing dinucleotide bulges with different sequences and nearest neighbor combinations were optically melted to derive thermodynamic parameters. These data suggested energy contributions of dinucleotide bulges were sequence-dependent, and a sequence-dependent model was derived. This model assigns free energy penalties based on the identity of nucleotides in the bulge (3.06 kcal/mol for two purines, 2.93 kcal/mol for two pyrimidines, 2.71 kcal/mol for 5'-purine-pyrimidine-3', and 2.41 kcal/mol for 5'-pyrimidine-purine-3'). The predictive model also includes a 0.45 kcal/mol penalty for an A-U pair adjacent to the bulge and a -0.28 kcal/mol bonus for a G-U pair adjacent to the bulge. The new sequence-dependent model results in predicted values within, on average, 0.17 kcal/mol of experimental values, a significant improvement over the sequence-independent model. This model and new experimental values can be incorporated into algorithms that predict RNA stability and secondary structure from sequence.

Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B

PubMed Central

Özeş, Ali R.; Feoktistova, Kateryna; Avanzino, Brian C.; Fraser, Christopher S.

2011-01-01

Eukaryotic initiation factor 4A (eIF4A) is a DEAD-box helicase that stimulates translation initiation by unwinding mRNA secondary structure. The accessory proteins, eIF4G, eIF4B, and eIF4H enhance the duplex unwinding activity of eIF4A, but the extent to which they modulate eIF4A activity is poorly understood. Here, we use real time fluorescence assays to determine the kinetic parameters of duplex unwinding and ATP hydrolysis by these initiation factors. To ensure efficient duplex unwinding, eIF4B and eIF4G cooperatively activate the duplex unwinding activity of eIF4A. Our data reveal that eIF4H is much less efficient at stimulating eIF4A unwinding activity than eIF4B, implying that eIF4H is not able to completely substitute for eIF4B in duplex unwinding. By monitoring unwinding and ATPase assays using identical conditions, we demonstrate that eIF4B couples the ATP hydrolysis cycle of eIF4A with strand separation, thereby minimizing non-productive unwinding events. Using duplex substrates with altered GC contents, but with similar predicted thermal stabilities, we further show that the rate of formation of productive unwinding complexes is strongly influenced by the local stability per base pair in addition to the stability of the entire duplex. This finding explains how a change in the GC content of a hairpin while maintaining overall predicted thermal stability is able to influence translation initiation. PMID:21840318

Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

PubMed Central

Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

2018-01-01

Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

2,6-Diaminopurine to TNA: Effect on Duplex Stabilities and on the Efficiency of Template-Controlled Ligations

NASA Technical Reports Server (NTRS)

Wu, Xiaolin; Delgado, Guillermo; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2003-01-01

Replacement of adenine by 2,6-diaminopurine-two nucleobases to be considered equivalent from an etlological point of view-strongly enhances the stability of TNA/TNA, TNA/RNA, or TNA/DNA duplexes and efficiently accelerates template-directed ligation of TNA ligands.

Full-duplex optical communication system

NASA Technical Reports Server (NTRS)

Shay, Thomas M. (Inventor); Hazzard, David A. (Inventor); Horan, Stephen (Inventor); Payne, Jason A. (Inventor)

2004-01-01

A method of full-duplex electromagnetic communication wherein a pair of data modulation formats are selected for the forward and return data links respectively such that the forward data electro-magnetic beam serves as a carrier for the return data. A method of encoding optical information is used wherein right-hand and left-hand circular polarizations are assigned to optical information to represent binary states. An application for an earth to low earth orbit optical communications system is presented which implements the full-duplex communication and circular polarization keying modulation format.

Drastic stability change of X-X mismatch in d(CXG) trinucleotide repeat disorders under molecular crowding condition.

PubMed

Teng, Ye; Pramanik, Smritimoy; Tateishi-Karimata, Hisae; Ohyama, Tatsuya; Sugimoto, Naoki

2018-02-05

The trinucleotide repeat d(CXG) (X = A, C, G or T) is the most common sequence causing repeat expansion disorders. The formation of non-canonical structures, such as hairpin structures with X-X mismatches, has been proposed to affect gene expression and regulation, which are important in pathological studies of these devastating neurological diseases. However, little information is available regarding the thermodynamics of the repeat sequence under crowded cellular conditions where many non-canonical structures such as G-quadruplexes are highly stabilized, while duplexes are destabilised. In this study, we investigated the different stabilities of X-X mismatches in the context of internal d(CXG) self-complementary sequences in an environment with a high concentration of cosolutes to mimic the crowding conditions in cells. The stabilities of full-matched duplexes and duplexes with A-A, G-G, and T-T mismatched base pairs under molecular crowding conditions were notably decreased compared to under dilute conditions. However, the stability of the DNA duplex with a C-C mismatch base pair was only slightly destabilised. Investigating different stabilities of X-X mismatches in d(CXG) sequences is important for improving our understanding of the formation and transition of multiple non-canonical structures in trinucleotide repeat diseases, and may provide insights for pathological studies and drug development. Copyright © 2018 Elsevier Inc. All rights reserved.

Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.

PubMed

Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J

2018-04-06

In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

PubMed

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In

Role of the heat capacity change in understanding and modeling melting thermodynamics of complementary duplexes containing standard and nucleobase-modified LNA.

PubMed

Hughesman, Curtis B; Turner, Robin F B; Haynes, Charles A

2011-06-14

Melting thermodynamic data obtained by differential scanning calorimetry (DSC) are reported for 43 duplexed oligonucleotides containing one or more locked nucleic acid (LNA) substitutions. The measured heat capacity change (ΔC(p)) for the helix-to-coil transition is used to compute the changes in enthalpy and entropy for melting of an LNA-bearing duplex at the T(m) of its corresponding isosequential unmodified DNA duplex to allow rigorous thermodynamic analysis of the stability enhancements provided by LNA substitutions. Contrary to previous studies, our analysis shows that the origin of the improved stability is almost exclusively a net reduction (ΔΔS° < 0) in the entropy gain accompanying the helix-to-coil transition, with the magnitude of the reduction dependent on the type of nucleobase and its base pairing properties. This knowledge and our average measured value for ΔC(p) of 42 ± 11 cal mol(-1) K(-1) bp(-1) are then used to derive a new model that accurately predicts melting thermodynamics and the increased melting temperature (ΔT(m)) of heteroduplexes formed between an unmodified DNA strand and a complementary strand containing any number and configuration of standard LNA nucleotides A, T, C, and G. This single-base thermodynamic (SBT) model requires only four entropy-related parameters in addition to ΔC(p). Finally, DSC data for 20 duplexes containing the nucleobase-modified LNAs 2-aminoadenine (D) and 2-thiothymine (H) are reported and used to determine SBT model parameters for D and H. The data and model suggest that along with the greater stability enhancement provided by D and H bases relative to their corresponding A and T analogues, the unique pseudocomplementary properties of D-H base pairs may make their use appealing for in vitro and in vivo applications.

Capturing a DNA duplex under near-physiological conditions

NASA Astrophysics Data System (ADS)

Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.

2010-10-01

We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.

Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

PubMed

Patel, D J; Canuel, L L

1977-07-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

PubMed Central

Patel, Dinshaw J.; Canuel, Lita L.

1977-01-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

Maximizing synchronizability of duplex networks

NASA Astrophysics Data System (ADS)

Wei, Xiang; Emenheiser, Jeffrey; Wu, Xiaoqun; Lu, Jun-an; D'Souza, Raissa M.

2018-01-01

We study the synchronizability of duplex networks formed by two randomly generated network layers with different patterns of interlayer node connections. According to the master stability function, we use the smallest nonzero eigenvalue and the eigenratio between the largest and the second smallest eigenvalues of supra-Laplacian matrices to characterize synchronizability on various duplexes. We find that the interlayer linking weight and linking fraction have a profound impact on synchronizability of duplex networks. The increasingly large inter-layer coupling weight is found to cause either decreasing or constant synchronizability for different classes of network dynamics. In addition, negative node degree correlation across interlayer links outperforms positive degree correlation when most interlayer links are present. The reverse is true when a few interlayer links are present. The numerical results and understanding based on these representative duplex networks are illustrative and instructive for building insights into maximizing synchronizability of more realistic multiplex networks.

C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.

PubMed

Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E

2015-07-20

Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

PubMed

Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

2016-01-01

We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.

PubMed

Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J

2017-08-01

We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†

PubMed Central

Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.

2010-01-01

Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where

Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

PubMed Central

Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

2015-01-01

Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex

PubMed Central

Ueda, Yu-mi; Zouzumi, Yu-ki; Maruyama, Atsushi; Nakano, Shu-ichi; Sugimoto, Naoki; Miyoshi, Daisuke

2016-01-01

Abstract We systematically investigated effects of molecular crowding with trimethylamine N-oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences. PMID:27933115

Process for stabilizing dimensions of duplex stainless steels for service at elevated temperatures

DOEpatents

Hull, Frederick C.; Tobin, John C.

1981-01-01

Duplex stainless steel materials containing austenite plus delta ferrite, are dimensionally stabilized by heating the material to a reaction temperature between about 1050.degree.-1450.degree. F. (566.degree.-788.degree. C.), holding it at this temperature during transformation of delta ferrite to austenite plus sigma phase, and subsequently heating to a reversion temperature between about 1625.degree.-1750.degree. F. (885.degree.-954.degree. C.), whereby the sigma phase transforms back to ferrite, but the austenite remains dispersed in the ferrite phase. Final controlled cooling permits transformation of ferrite to austenite plus sigma and, later, precipitation of carbides.

Small molecule-mediated duplex formation of nucleic acids with 'incompatible' backbones.

PubMed

Cafferty, Brian J; Musetti, Caterina; Kim, Keunsoo; Horowitz, Eric D; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

2016-04-07

Proflavine, a known intercalator of DNA and RNA, promotes duplex formation by nucleic acids with natural and non-natural backbones that otherwise form duplexes with low thermal stability, and even some that show no sign of duplex formation in the absence of proflavine. These findings demonstrate the potential for intercalators to be used as cofactors for the assembly of rationally designed nucleic acid structures, and could provide fundamental insights regarding intercalation of natural nucleic acid duplexes.

m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

PubMed Central

Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

2016-01-01

The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

PubMed Central

Pasternak, Anna; Wengel, Jesper

2010-01-01

Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222

H-Bond Self-Assembly: Folding versus Duplex Formation.

PubMed

Núñez-Villanueva, Diego; Iadevaia, Giulia; Stross, Alexander E; Jinks, Michael A; Swain, Jonathan A; Hunter, Christopher A

2017-05-17

Linear oligomers equipped with complementary H-bond donor (D) and acceptor (A) sites can interact via intermolecular H-bonds to form duplexes or fold via intramolecular H-bonds. These competing equilibria have been quantified using NMR titration and dilution experiments for seven systems featuring different recognition sites and backbones. For all seven architectures, duplex formation is observed for homo-sequence 2-mers (AA·DD) where there are no competing folding equilibria. The corresponding hetero-sequence AD 2-mers also form duplexes, but the observed self-association constants are strongly affected by folding equilibria in the monomeric states. When the backbone is flexible (five or more rotatable bonds separating the recognition sites), intramolecular H-bonding is favored, and the folded state is highly populated. For these systems, the stability of the AD·AD duplex is 1-2 orders of magnitude lower than that of the corresponding AA·DD duplex. However, for three architectures which have more rigid backbones (fewer than five rotatable bonds), intramolecular interactions are not observed, and folding does not compete with duplex formation. These systems are promising candidates for the development of longer, mixed-sequence synthetic information molecules that show sequence-selective duplex formation.

6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

PubMed

Marathias, V M; Sawicki, M J; Bolton, P H

1999-07-15

The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

NASA Astrophysics Data System (ADS)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

Biophysics of Artificially Expanded Genetic Information Systems. Thermodynamics of DNA Duplexes Containing Matches and Mismatches Involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P).

PubMed

Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D

2017-05-19

Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.

Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif

PubMed Central

Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.

2011-01-01

We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

PubMed

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

PubMed

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses

USDA-ARS?s Scientific Manuscript database

Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...

Force-Induced Rupture of a DNA Duplex: From Fundamentals to Force Sensors.

PubMed

Mosayebi, Majid; Louis, Ard A; Doye, Jonathan P K; Ouldridge, Thomas E

2015-12-22

The rupture of double-stranded DNA under stress is a key process in biophysics and nanotechnology. In this article, we consider the shear-induced rupture of short DNA duplexes, a system that has been given new importance by recently designed force sensors and nanotechnological devices. We argue that rupture must be understood as an activated process, where the duplex state is metastable and the strands will separate in a finite time that depends on the duplex length and the force applied. Thus, the critical shearing force required to rupture a duplex depends strongly on the time scale of observation. We use simple models of DNA to show that this approach naturally captures the observed dependence of the force required to rupture a duplex within a given time on duplex length. In particular, this critical force is zero for the shortest duplexes, before rising sharply and then plateauing in the long length limit. The prevailing approach, based on identifying when the presence of each additional base pair within the duplex is thermodynamically unfavorable rather than allowing for metastability, does not predict a time-scale-dependent critical force and does not naturally incorporate a critical force of zero for the shortest duplexes. We demonstrate that our findings have important consequences for the behavior of a new force-sensing nanodevice, which operates in a mixed mode that interpolates between shearing and unzipping. At a fixed time scale and duplex length, the critical force exhibits a sigmoidal dependence on the fraction of the duplex that is subject to shearing.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Spermine moiety attached to the C-5 position of deoxyuridine enhances the duplex stability of the phosphorothioate DNA/complementary DNA and shows the susceptibility of the substrate to RNase H.

PubMed

Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo

2008-09-01

Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.

Stability of miRNA 5′terminal and seed regions is correlated with experimentally observed miRNA-mediated silencing efficacy

PubMed Central

Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko

2012-01-01

MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

Reducing the background fluorescence in mice receiving fluorophore/inhibitor DNA duplexes.

PubMed

Liang, Minmin; Liu, Xinrong; Liu, Guozheng; Dou, Shuping; Cheng, Dengfeng; Liu, Yuxia; Rusckowski, Mary; Hnatowich, Donald J

2011-02-07

In principle, a DNA duplex consisting of an antisense fluorophore-conjugated major strand hybridized to a shorter complementary inhibitor-conjugated minor strand should provide fluorescence only in the tumor after intravenous administration if designed to remain intact except in the presence in tumor of its mRNA target. While we have obtained impressive tumor images in mice using this approach, there remains some background fluorescence. In this study, tissue homogenates of selected mouse organs were incubated with a test duplex and the kinetics of duplex dissociation in normal tissues were measured. In this manner we were able to identify the liver as the likely major source responsible for the duplex dissociation providing this fluorescence background. Thereafter liver homogenates were used to screen a series of duplex candidates with variable-length minor strands, and dissociation was measured by gel electrophoresis. The selected fluorophore/inhibitor duplex with improved stability displayed an insignificant (P > 0.05) background fluorescence after administration to SKH-1 normal mice and apparently without affecting target mRNA binding in vitro in cell culture or in vivo in tumor bearing mice.

Dynamics of spontaneous flipping of a mismatched base in DNA duplex.

PubMed

Yin, Yandong; Yang, Lijiang; Zheng, Guanqun; Gu, Chan; Yi, Chengqi; He, Chuan; Gao, Yi Qin; Zhao, Xin Sheng

2014-06-03

DNA base flipping is a fundamental theme in DNA biophysics. The dynamics for a B-DNA base to spontaneously flip out of the double helix has significant implications in various DNA-protein interactions but are still poorly understood. The spontaneous base-flipping rate obtained previously via the imino proton exchange assay is most likely the rate of base wobbling instead of flipping. Using the diffusion-decelerated fluorescence correlation spectroscopy together with molecular dynamics simulations, we show that a base of a single mismatched base pair (T-G, T-T, or T-C) in a double-stranded DNA can spontaneously flip out of the DNA duplex. The extrahelical lifetimes are on the order of 10 ms, whereas the intrahelical lifetimes range from 0.3 to 20 s depending on the stability of the base pairs. These findings provide detailed understanding on the dynamics of DNA base flipping and lay down foundation to fully understand how exactly the repair proteins search and locate the target mismatched base among a vast excess of matched DNA bases.

Ligand-Induced Stabilization of a Duplex-like Architecture Is Crucial for the Switching Mechanism of the SAM-III Riboswitch.

PubMed

Suresh, Gorle; Srinivasan, Harini; Nanda, Shivani; Priyakumar, U Deva

2016-06-21

Riboswitches are structured RNA motifs that control gene expression by sensing the concentrations of specific metabolites and make up a promising new class of antibiotic targets. S-Adenosylmethionine (SAM)-III riboswitch, mainly found in lactic acid bacteria, is involved in regulating methionine and SAM biosynthetic pathways. SAM-III riboswitch regulates the gene expression by switching the translation process on and off with respect to the absence and presence of the SAM ligand, respectively. In this study, an attempt is made to understand the key conformational transitions involved in ligand binding using atomistic molecular dynamics (MD) simulations performed in an explicit solvent environment. G26 is found to recognize the SAM ligand by forming hydrogen bonds, whereas the absence of the ligand leads to opening of the binding pocket. Consistent with experimental results, the absence of the SAM ligand weakens the base pairing interactions between the nucleobases that are part of the Shine-Dalgarno (SD) and anti-Shine-Dalgarno (aSD) sequences, which in turn facilitates recognition of the SD sequence by ribosomes. Detailed analysis reveals that a duplex-like structure formed by nucleotides from different parts of the RNA and the adenine base of the ligand is crucial for the stability of the completely folded state in the presence of the ligand. Previous experimental studies have shown that the SAM-III riboswitch exists in equilibrium between the unfolded and partially folded states in the absence of the ligand, which completely folds upon binding of the ligand. Comparison of the results presented here to the available experimental data indicates the structures obtained using the MD simulations resemble the partially folded state. Thus, this study provides a detailed understanding of the fully and partially folded structures of the SAM-III riboswitch in the presence and absence of the ligand, respectively. This study hypothesizes a dual role for the SAM ligand

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

PubMed

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

PubMed Central

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

Acid-induced exchange of the imino proton in G.C pairs.

PubMed Central

Nonin, S; Leroy, J L; Gueron, M

1996-01-01

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

Acid-induced exchange of the imino proton in G.C pairs.

PubMed

Nonin, S; Leroy, J L; Gueron, M

1996-02-15

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

Synthesis of native-like crosslinked duplex RNA and study of its properties.

PubMed

Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

2017-04-01

A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA. Copyright © 2017. Published by Elsevier Ltd.

[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

PubMed

Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

2015-04-01

To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

Comprehensive Deformation Analysis of a Newly Designed Ni-Free Duplex Stainless Steel with Enhanced Plasticity by Optimizing Austenite Stability

NASA Astrophysics Data System (ADS)

Moallemi, Mohammad; Zarei-Hanzaki, Abbas; Eskandari, Mostafa; Burrows, Andrew; Alimadadi, Hossein

2017-08-01

A new metastable Ni-free duplex stainless steel has been designed with superior plasticity by optimizing austenite stability using thermodynamic calculations of stacking fault energy and with reference to literature findings. Several characterization methods comprising optical microscopy, magnetic phase measurements, X-ray diffraction (XRD) and electron backscattered diffraction were employed to study the plastic deformation behavior and to identify the operating plasticity mechanisms. The results obtained show that the newly designed duplex alloy exhibits some extraordinary mechanical properties, including an ultimate tensile strength of 900 MPa and elongation to fracture of 94 pct due to the synergistic effects of transformation-induced plasticity and twinning-induced plasticity. The deformation mechanism of austenite is complex and includes deformation banding, strain-induced martensite formation, and deformation-induced twinning, while the ferrite phase mainly deforms by dislocation slip. Texture analysis indicates that the Copper and Rotated Brass textures in austenite (FCC phase) and {001}<110> texture in ferrite and martensite (BCC phases) are the main active components during tensile deformation. The predominance of these components is logically related to the strain-induced martensite and/or twin formation.

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

PubMed

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

PubMed

Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

2015-02-17

Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

PubMed

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

ESI-MS Investigation of an Equilibrium between a Bimolecular Quadruplex DNA and a Duplex DNA/RNA Hybrid

NASA Astrophysics Data System (ADS)

Birrento, Monica L.; Bryan, Tracy M.; Samosorn, Siritron; Beck, Jennifer L.

2015-07-01

Electrospray ionization mass spectrometry (ESI-MS) conditions were optimized for simultaneous observation of a bimolecular qDNA and a Watson-Crick base-paired duplex DNA/RNA hybrid. The DNA sequence used was telomeric DNA, and the RNA contained the template for telomerase-mediated telomeric DNA synthesis. Addition of RNA to the quadruplex DNA (qDNA) resulted in formation of the duplex DNA/RNA hybrid. Melting profiles obtained using circular dichroism spectroscopy confirmed that the DNA/RNA hybrid exhibited greater thermal stability than the bimolecular qDNA in solution. Binding of a 13-substituted berberine ( 1) derivative to the bimolecular qDNA stabilized its structure as evidenced by an increase in its stability in the mass spectrometer, and an increase in its circular dichroism (CD) melting temperature of 10°C. The DNA/RNA hybrid did not bind the ligand extensively and its thermal stability was unchanged in the presence of ( 1). The qDNA-ligand complex resisted unfolding in the presence of excess RNA, limiting the formation of the DNA/RNA hybrid. Previously, it has been proposed that DNA secondary structures, such as qDNA, may be involved in the telomerase mechanism. DNA/RNA hybrid structures occur at the active site of telomerase. The results presented in the current work show that if telomeric DNA was folded into a qDNA structure, it is possible for a DNA/RNA hybrid to form as is required during template alignment. The discrimination of ligand ( 1) for binding to the bimolecular qDNA over the DNA/RNA hybrid positions it as a useful compound for probing the role(s), if any, of antiparallel qDNA in the telomerase mechanism.

The effect of nonenzymatic glycation on the stability and conformation of two deoxyoligonucleotide duplexes: a spectroscopic analysis by circular dichroism.

PubMed

Dutta, Udayan; Cohenford, Menashi A; Dain, Joel A

2007-01-15

Advanced glycation end products (AGEs) play a significant role in the pathophysiology of diabetes leading to such conditions as atherosclerosis, cataract formation, and renal dysfunction. While the formation of nucleoside AGEs was previously demonstrated, no extensive studies have been performed to assess the effect of AGEs on DNA structure and folding. The objective of this study was to investigate the nonenzymatic glycation of two DNA oligonucleotide duplexes with one duplex consisting of deoxy-poly(A)15 and deoxy-poly(T)15 and the other consisting of deoxy-poly(GA)15 and deoxy-poly(CT)15. With D-glucose, D-galactose, D/L-glyceraldehyde, and D-glucosamine serving as the model glycating carbohydrates, D-glucosamine was found to exhibit the greatest effect on the stability and structure of the oligonucleotide duplexes, a finding that was confirmed by circular dichroism. The nonenzymatic glycation of deoxy-poly(AT) by D-glucosamine destabilized the deoxy-poly(AT) structure and changed its conformation from A form to X form. D-glucosamine also altered the conformation of deoxy-poly(GA)15 and deoxy-poly(CT)15 from A form to B form. Capillary electrophoresis and ultraviolet and fluorescence spectroscopy revealed that, of the various purines and pyrimidines, 2'-deoxyguanosine and guanine were most reactive with D-glucosamine. The nonenzymatic modification of nucleic acids warrants further investigation because this phenomenon may occur in vivo, altering DNA structure and/or function.

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The loss of a hydrogen bond: Thermodynamic contributions of a non-standard nucleotide

PubMed Central

Jolley, Elizabeth A.

2017-01-01

Abstract Non-standard nucleotides are ubiquitous in RNA. Thermodynamic studies with RNA duplexes containing non-standard nucleotides, whether incorporated naturally or chemically, can provide insight into the stability of Watson–Crick pairs and the role of specific functional groups in stabilizing a Watson–Crick pair. For example, an A-U, inosine•U and pseudouridine•A pair each form two hydrogen bonds. However, an RNA duplex containing a central I•U pair or central Ψ•A pair is 2.4 kcal/mol less stable or 1.7 kcal/mol more stable, respectively, than the corresponding duplex containing an A-U pair. In the non-standard nucleotide purine, hydrogen replaces the exocyclic amino group of A. This replacement results in a P•U pair containing only one hydrogen bond. Optical melting studies were performed with RNA duplexes containing P•U pairs adjacent to different nearest neighbors. The resulting thermodynamic parameters were compared to RNA duplexes containing A-U pairs in order to determine the contribution of the hydrogen bond involving the exocyclic amino group. Results indicate a loss of 1.78 kcal/mol, on average, when an internal P•U replaces A-U in an RNA duplex. This value is compared to the thermodynamics of a hydrogen bond determined by similar methods. Nearest neighbor parameters were derived for use in free energy and secondary structure prediction software. PMID:28180321

Photophysical Characterization of Enhanced 6-Methylisoxanthopterin Fluorescence in Duplex DNA.

PubMed

Moreno, Andrew; Knee, J L; Mukerji, Ishita

2016-12-08

The structure and dynamic motions of bases in DNA duplexes and other constructs are important for understanding mechanisms of selectivity and recognition of DNA-binding proteins. The fluorescent guanine analogue, 6-methylisoxanthopterin 6-MI, is well suited to this purpose as it exhibits an unexpected 3- to 4-fold increase in relative quantum yield upon duplex formation when incorporated into the following sequences: ATFAA, AAFTA, or ATFTA (where F represents 6-MI). To better understand some of the factors leading to the 6-MI fluorescence increase upon duplex formation, we characterized the effect of local sequence and structural perturbations on 6-MI photophysics through temperature melts, quantum yield measurements, fluorescence quenching assays, and fluorescence lifetime measurements. By examining 21 sequences we have determined that the duplex-enhanced fluorescence (DEF) depends on the composition of bases adjacent to 6-MI and the presence of adenines at locations n ± 2 from the probe. Investigation of duplex stability and local solvent accessibility measurements support a model in which the DEF arises from a constrained geometry of 6-MI in the duplex, which remains H-bonded to cytosine, stacked with adjacent bases and inaccessible to quenchers. Perturbation of DNA structure through the introduction of an unpaired base 3' to 6-MI or a mismatched basepair increases 6-MI dynamic motion leading to fluorescence quenching and a reduction in quantum yield. Molecular dynamics simulations suggest the enhanced fluorescence results from a greater degree of twist at the X-F step relative to the quenched duplexes examined. These results point to a model where adenine residues located at n ± 2 from 6-MI induce a structural geometry with greater twist in the duplex that hinders local motion reducing dynamic quenching and producing an increase in 6-MI fluorescence.

The influence of sequence context and length on the kinetics of DNA duplex formation from complementary hairpins possessing (CNG) repeats.

PubMed

Paiva, Anthony M; Sheardy, Richard D

2005-04-20

The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.

Kinematic stability of roller pairs in free rolling contact

NASA Technical Reports Server (NTRS)

Savage, M.; Loewenthal, S. H.

1976-01-01

A set of generalized stability equations was developed for roller pairs in free rolling contact. A symmetric, dual contact model was used. Four possible external contact profiles that possess continuous contacting surfaces were studied. It was found that kinematic stability would be insured if the larger radius of transverse curvature, in absolute value, and the smaller rolling radius both exist on the roller that has the apex of its conical surface outboard of its main body. The stability criteria developed are considered to be useful for assessing axial restraint requirements for a variety of roller mechanisms and in the selection of roller contact geometry for traction drive devices.

Water-evaporation reduction by duplex films: application to the human tear film.

PubMed

Cerretani, Colin F; Ho, Nghia H; Radke, C J

2013-09-01

Water-evaporation reduction by duplex-oil films is especially important to understand the physiology of the human tear film. Secreted lipids, called meibum, form a duplex film that coats the aqueous tear film and purportedly reduces tear evaporation. Lipid-layer deficiency is correlated with the occurrence of dry-eye disease; however, in-vitro experiments fail to show water-evaporation reduction by tear-lipid duplex films. We review the available literature on water-evaporation reduction by duplex-oil films and outline the theoretical underpinnings of spreading and evaporation kinetics that govern behavior of these systems. A dissolution-diffusion model unifies the data reported in the literature and identifies dewetting of duplex films into lenses as a key challenge to obtaining significant evaporation reduction. We develop an improved apparatus for measuring evaporation reduction by duplex-oil films including simultaneous assessment of film coverage, stability, and temperature, all under controlled external mass transfer. New data reported in this study fit into the larger body of work conducted on water-evaporation reduction by duplex-oil films. Duplex-oil films of oxidized mineral oil/mucin (MOx/BSM), human meibum (HM), and bovine meibum (BM) reduce water evaporation by a dissolution-diffusion mechanism, as confirmed by agreement between measurement and theory. The water permeability of oxidized-mineral-oil duplex films agrees with those reported in the literature, after correction for the presence of mucin. We find that duplex-oil films of bovine and human meibum at physiologic temperature reduce water evaporation only 6-8% for a 100-nm film thickness pertinent to the human tear film. Comparison to in-vivo human tear-evaporation measurements is inconclusive because evaporation from a clean-water surface is not measured and because the mass-transfer resistance is not characterized. Copyright © 2013 Elsevier B.V. All rights reserved.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Hands-on work fine-tunes X-band PIN-diode duplexer

NASA Astrophysics Data System (ADS)

Schneider, P.

1985-06-01

Computer-aided design (CAD) programs for fabricating PIN-diode duplexers are useful in avoiding time-consuming cut-and-try techniques. Nevertheless, to attain minimum insertion loss, only experimentation yields the optimum microstrip circuitry. A PIN-diode duplexer, consisting of two SPST PIN-diode switches and a pair of 3-dB Lange microstrip couplers, designed for an X-band transmit/receive module exemplifies what is possible when computer-derived designs and experimentation are used together. Differences between the measured and computer-generated figures for insertion loss can be attributed to several factors not included in the CAD program - for example, radiation and connector losses. Mechanical tolerances of the microstrip PC board and variations in the SMA connector-to-microstrip transition contribute to the discrepancy.

Laser Safety Method For Duplex Open Loop Parallel Optical Link

DOEpatents

Baumgartner, Steven John; Hedin, Daniel Scott; Paschal, Matthew James

2003-12-02

A method and apparatus are provided to ensure that laser optical power does not exceed a "safe" level in an open loop parallel optical link in the event that a fiber optic ribbon cable is broken or otherwise severed. A duplex parallel optical link includes a transmitter and receiver pair and a fiber optic ribbon that includes a designated number of channels that cannot be split. The duplex transceiver includes a corresponding transmitter and receiver that are physically attached to each other and cannot be detached therefrom, so as to ensure safe, laser optical power in the event that the fiber optic ribbon cable is broken or severed. Safe optical power is ensured by redundant current and voltage safety checks.

Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.

PubMed

Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo

2013-11-15

We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

PubMed

Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

2014-03-07

Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

Duplex Healing of Selectively Thiolated Guanosine Mismatches through a Cd2+ Chemical Stimulus.

PubMed

Lunn, Samantha M L; Hribesh, Samira; Whitfield, Colette J; Hall, Michael J; Houlton, Andrew; Bronowska, Agnieszka K; Tuite, Eimer M; Pike, Andrew R

2018-03-25

The on-column selective conversion of guanosine to thioguanosine (tG) yields modified oligomers that exhibit destabilisation over the fully complementary duplex. Restoration to a stabilised duplex is induced through thio-directed Cd 2+ coordination; a route for healing DNA damage. Short oligomers are G-specifically thiolated through a modified on-column protocol without the need for costly thioguanosine phosphoramidites. Addition of Cd 2+ ions to a duplex containing a highly disrupted tG central mismatch sequence, 3'-A 6 tG 4 T 6 -5', suggests a (tG) 8 Cd 2 central coordination regime, resulting in increased base stacking and duplex stability. Equilibrium molecular dynamic calculations support the hypothesis of metal-induced healing of the thiolated duplex. The 2 nm displacement of the central tG mismatched region is dramatically reduced after the addition of a chemical stimuli, Cd 2+ ions, returning to a minimized fluctuational state comparable to the unmodified fully complementary oligomer. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

PubMed

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

PubMed Central

Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

2015-01-01

The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

PubMed Central

Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

2016-01-01

Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

PubMed

Nonin, S; Leroy, J L; Guéron, M

1995-08-22

We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

PubMed Central

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

PubMed

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

PubMed

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structural variations of single and tandem mismatches in RNA duplexes: a joint MD simulation and crystal structure database analysis.

PubMed

Halder, Sukanya; Bhattacharyya, Dhananjay

2012-10-04

Internal loops within RNA duplex regions are formed by single or tandem basepairing mismatches with flanking canonical Watson-Crick basepairs on both sides. They are the most common motif observed in RNA secondary structures and play integral functional and structural roles. In this report, we have studied the structural features of 1 × 1, 2 × 2, and 3 × 3 internal loops using all-atom molecular dynamics (MD) simulation technique with explicit solvent model. As MD simulation is intricately dependent on the choice of force-field and these are often rather approximate, we have used both the most popular force-fields for nucleic acids-CHARMM27 and AMBER94-for a comparative analysis. We find that tandem noncanonical basepairs forming 2 × 2 and 3 × 3 internal loops are considerably more stable than the single mismatches forming 1 × 1 internal loops, irrespective of the force field. We have also analyzed crystal structure database to study the conservation of these helical fragments in the corresponding sets of RNA structures. We observe that the nature of stability in MD simulations mimic their fluctuating natures in crystal data sets also, probably indicating reliable natures of both the force fields to reproduce experimental results. We also notice significant structural changes in the wobble G:U basepairs present in these double helical stretches, leading to a biphasic stability for these wobble pairs to release the deformational strains introduced by internal loops within duplex regions.

Thermodynamic insights into 2-thiouridine-enhanced RNA hybridization

PubMed Central

Larsen, Aaron T.; Fahrenbach, Albert C.; Sheng, Jia; Pian, Julia; Szostak, Jack W.

2015-01-01

Nucleobase modifications dramatically alter nucleic acid structure and thermodynamics. 2-thiouridine (s2U) is a modified nucleobase found in tRNAs and known to stabilize U:A base pairs and destabilize U:G wobble pairs. The recently reported crystal structures of s2U-containing RNA duplexes do not entirely explain the mechanisms responsible for the stabilizing effect of s2U or whether this effect is entropic or enthalpic in origin. We present here thermodynamic evaluations of duplex formation using ITC and UV thermal denaturation with RNA duplexes containing internal s2U:A and s2U:U pairs and their native counterparts. These results indicate that s2U stabilizes both duplexes. The stabilizing effect is entropic in origin and likely results from the s2U-induced preorganization of the single-stranded RNA prior to hybridization. The same preorganizing effect is likely responsible for structurally resolving the s2U:U pair-containing duplex into a single conformation with a well-defined H-bond geometry. We also evaluate the effect of s2U on single strand conformation using UV- and CD-monitored thermal denaturation and on nucleoside conformation using 1H NMR spectroscopy, MD and umbrella sampling. These results provide insights into the effects that nucleobase modification has on RNA structure and thermodynamics and inform efforts toward improving both ribozyme-catalyzed and nonenzymatic RNA copying. PMID:26240387

Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

PubMed Central

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2014-01-01

The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

PubMed Central

Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

2014-01-01

Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

The cardiac muscle duplex as a method to study myocardial heterogeneity

PubMed Central

Solovyova, O.; Katsnelson, L.B.; Konovalov, P.V.; Kursanov, A.G.; Vikulova, N.A.; Kohl, P.; Markhasin, V.S.

2014-01-01

This paper reviews the development and application of paired muscle preparations, called duplex, for the investigation of mechanisms and consequences of intra-myocardial electro-mechanical heterogeneity. We illustrate the utility of the underlying combined experimental and computational approach for conceptual development and integration of basic science insight with clinically relevant settings, using previously published and new data. Directions for further study are identified. PMID:25106702

Plastomes of the green algae Hydrodictyon reticulatum and Pediastrum duplex (Sphaeropleales, Chlorophyceae).

PubMed

McManus, Hilary A; Sanchez, Daniel J; Karol, Kenneth G

2017-01-01

Comparative studies of chloroplast genomes (plastomes) across the Chlorophyceae are revealing dynamic patterns of size variation, gene content, and genome rearrangements. Phylogenomic analyses are improving resolution of relationships, and uncovering novel lineages as new plastomes continue to be characterized. To gain further insight into the evolution of the chlorophyte plastome and increase the number of representative plastomes for the Sphaeropleales, this study presents two fully sequenced plastomes from the green algal family Hydrodictyaceae (Sphaeropleales, Chlorophyceae), one from Hydrodictyon reticulatum and the other from Pediastrum duplex . Genomic DNA from Hydrodictyon reticulatum and Pediastrum duplex was subjected to Illumina paired-end sequencing and the complete plastomes were assembled for each. Plastome size and gene content were characterized and compared with other plastomes from the Sphaeropleales. Homology searches using BLASTX were used to characterize introns and open reading frames (orfs) ≥ 300 bp. A phylogenetic analysis of gene order across the Sphaeropleales was performed. The plastome of Hydrodictyon reticulatum is 225,641 bp and Pediastrum duplex is 232,554 bp. The plastome structure and gene order of H. reticulatum and P. duplex are more similar to each other than to other members of the Sphaeropleales. Numerous unique open reading frames are found in both plastomes and the plastome of P. duplex contains putative viral protein genes, not found in other Sphaeropleales plastomes. Gene order analyses support the monophyly of the Hydrodictyaceae and their sister relationship to the Neochloridaceae. The complete plastomes of Hydrodictyon reticulatum and Pediastrum duplex , representing the largest of the Sphaeropleales sequenced thus far, once again highlight the variability in size, architecture, gene order and content across the Chlorophyceae. Novel intron insertion sites and unique orfs indicate recent, independent invasions into

Thermodynamic Signature of DNA Damage: Characterization of DNA with a 5-Hydroxy-2'-deoxycytidine•2'-Deoxyguanosine Base Pair

PubMed Central

Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry

2012-01-01

Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945

Influence of 5-N-carboxamide modifications on the thermodynamic stability of oligonucleotides

PubMed Central

Wolk, Steven K.; Shoemaker, Richard K.; Mayfield, Wes S.; Mestdagh, Andrew L.; Janjic, Nebojsa

2015-01-01

We have recently shown that the incorporation of modified nucleotides such as 5-N-carboxamide-deoxyuridines into random nucleic acid libraries improves success rates in SELEX experiments and facilitates the identification of ligands with slow off-rates. Here we report the impact of these modifications on the thermodynamic stability of both duplexes and intramolecular ‘single-stranded’ structures. Within duplexes, large, hydrophobic naphthyl groups were destabilizing relative to the all natural DNA duplex, while the hydrophilic groups exhibited somewhat improved duplex stability. All of the significant changes in stability were driven by opposing contributions from the enthalpic and entropic terms. In contrast, both benzyl and naphthyl modifications stabilized intramolecular single-stranded structures relative to their natural DNA analogs, consistent with the notion that intramolecular folding allows formation of novel, stabilizing hydrophobic interactions. Imino proton NMR data provided evidence that elements of the folded structure form at temperatures well below the Tm, with a melting transition that is distinctly less cooperative when compared to duplex DNA. Although there are no data to suggest that the unmodified DNA sequences fold into structures similar to their modified analogs, this still represents clear evidence that these modifications impart thermodynamic stability to the folded structure not achievable with unmodified DNA. PMID:26438535

Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

2001-04-01

Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

PubMed

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Adenine radicals generated in alternating AT duplexes by direct absorption of low-energy UV radiation.

PubMed

Banyasz, Akos; Ketola, Tiia; Martínez-Fernández, Lara; Improta, Roberto; Markovitsi, Dimitra

2018-04-17

There is increasing evidence that the direct absorption of photons with energies that are lower than the ionization potential of nucleobases may result in oxidative damage to DNA. The present work, which combines nanosecond transient absorption spectroscopy and quantum mechanical calculations, studies this process in alternating adenine-thymine duplexes (AT)n. We show that the one-photon ionization quantum yield of (AT)10 at 266 nm (4.66 eV) is (1.5 ± 0.3) × 10-3. According to our PCM/TD-DFT calculations carried out on model duplexes composed of two base pairs, (AT)1 and (TA)1, simultaneous base pairing and stacking does not induce important changes in the absorption spectra of the adenine radical cation and deprotonated radical. The adenine radicals, thus identified in the time-resolved spectra, disappear with a lifetime of 2.5 ms, giving rise to a reaction product that absorbs at 350 nm. In parallel, the fingerprint of reaction intermediates other than radicals, formed directly from singlet excited states and assigned to AT/TA dimers, is detected at shorter wavelengths. PCM/TD-DFT calculations are carried out to map the pathways leading to such species and to characterize their absorption spectra; we find that, in addition to the path leading to the well-known TA* photoproduct, an AT photo-dimerization path may be operative in duplexes.

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed Central

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-01-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-02-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

Duplex gall bladder: bystander or culprit.

PubMed

Kumar, Jogender; Yadav, Arushi

2017-08-30

Gall bladder (GB) duplication is a rare anatomical malformation, which can be detected by preoperative imaging study. We present a case of duplex gall bladder in a 14-year-old boy who presented with abdominal pain. On ultrasound, he had right nephrolithiasis and duplex gall bladder. Duplex gall bladder was confirmed on MR cholangiopancreatography. There was a dilemma for surgical management of duplex gall bladder; however, he became asymptomatic after conservative treatment. Prophylactic surgery is not recommended for asymptomatic incidentally detected duplex gall bladder. Radiologists and paediatric surgeons should be sensitised about the exact anatomy of this entity. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Smectic phase in suspensions of gapped DNA duplexes

DOE PAGES

Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; ...

2016-11-15

Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, in spite of the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue thatmore » this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. These results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.« less

A sensitive duplex nanoparticle-assisted PCR assay for identifying porcine epidemic diarrhea virus and porcine transmissible gastroenteritis virus from clinical specimens.

PubMed

Zhu, Yu; Liang, Lin; Luo, Yakun; Wang, Guihua; Wang, Chunren; Cui, Yudong; Ai, Xia; Cui, Shangjin

2017-02-01

In this study, a novel duplex nanoparticle-assisted polymerase chain reaction (nanoPCR) assay was developed to detect porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). Two pairs of primers were designed based on the conserved region within the N gene of PEDV and TGEV. In a screening of 114 clinical samples from four provinces in China for PEDV and TGEV, 48.2 and 3.5 % of the samples, respectively, tested positive. Under optimized conditions, the duplex nanoPCR assay had a detection limit of 7.6 × 10 1 and 8.5 × 10 1 copies μL -1 for PEDV and TGEV, respectively. The sensitivity of the duplex nanoPCR assay was ten times higher than that of a conventional PCR assay. Moreover, no fragments were amplified when the duplex nanoPCR assay was used to test samples containing other porcine viruses. Our results indicate that the duplex nanoPCR assay described here is useful for the rapid detection of PEDV and TGEV and can be applied in clinical diagnosis.

The energetic basis of the DNA double helix: a combined microcalorimetric approach

PubMed Central

Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.

2015-01-01

Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541

NMR structure of the DNA decamer duplex containing double T*G mismatches of cis-syn cyclobutane pyrimidine dimer: implications for DNA damage recognition by the XPC-hHR23B complex.

PubMed

Lee, Joon-Hwa; Park, Chin-Ju; Shin, Jae-Sun; Ikegami, Takahisa; Akutsu, Hideo; Choi, Byong-Seok

2004-01-01

The cis-syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC-hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC-hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC-hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC-hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3' T*G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T*G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T*G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6-4) adduct, which is efficiently recognized by the XPC-hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC-hHR23B complex to DNA.

Enzyme architecture: optimization of transition state stabilization from a cation-phosphodianion pair.

PubMed

Reyes, Archie C; Koudelka, Astrid P; Amyes, Tina L; Richard, John P

2015-04-29

The side chain cation of R269 lies at the surface of l-glycerol 3-phosphate dehydrogenase (GPDH) and forms an ion pair to the phosphodianion of substrate dihydroxyacetone phosphate (DHAP), which is buried at the nonpolar protein interior. The R269A mutation of GPDH results in a 110-fold increase in K(m) (2.8 kcal/mol effect) and a 41,000-fold decrease in k(cat) (6.3 kcal/mol effect), which corresponds to a 9.1 kcal/mol destabilization of the transition state for GPDH-catalyzed reduction of DHAP by NADH. There is a 6.7 kcal/mol stabilization of the transition state for the R269A mutant GPDH-catalyzed reaction by 1.0 M guanidinium ion, and the transition state for the reaction of the substrate pieces is stabilized by an additional 2.4 kcal/mol by their covalent attachment at wildtype GPDH. These results provide strong support for the proposal that GPDH invests the 11 kcal/mol intrinsic phosphodianion binding energy of DHAP in trapping the substrate at a nonpolar active site, where strong electrostatic interactions are favored, and obtains a 9 kcal/mol return from stabilizing interactions between the side chain cation and transition state trianion. We propose a wide propagation for the catalytic motif examined in this work, which enables strong transition state stabilization from enzyme-phosphodianion pairs.

Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation

PubMed Central

Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

2017-01-01

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024

Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.

PubMed

Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

2017-05-23

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.

Prolonged CT urography in duplex kidney.

PubMed

Gong, Honghan; Gao, Lei; Dai, Xi-Jian; Zhou, Fuqing; Zhang, Ning; Zeng, Xianjun; Jiang, Jian; He, Laichang

2016-05-13

Duplex kidney is a common anomaly that is frequently associated with multiple complications. Typical computed tomography urography (CTU) includes four phases (unenhanced, arterial, parenchymal and excretory) and has been suggested to considerably aid in the duplex kidney diagnosi. Unfortunately, regarding duplex kidney with prolonged dilatation, the affected parenchyma and tortuous ureters demonstrate a lack of or delayed excretory opacification. We used prolonged-delay CTU, which consists of another prolonged-delay phase (1- to 72-h delay; mean delay: 24 h) to opacify the duplicated ureters and affected parenchyma. Seventeen patients (9 males and 8 females; age range: 2.5-56 y; mean age: 40.4 y) with duplex kidney were included in this study. Unenhanced scans did not find typical characteristics of duplex kidney, except for irregular perirenal morphology. Duplex kidney could not be confirmed on typical four-phase CTU, whereas it could be easily diagnosed in axial and CT-3D reconstruction using prolonged CTU (prolonged-delay phase). Between January 2005 and October 2010, in this review board-approved study (with waived informed consent), 17 patients (9 males and 8 females; age range: 2.5 ~ 56 y; mean age: 40.4 y) with suspicious duplex kidney underwent prolonged CTU to opacify the duplicated ureters and confirm the diagnosis. Our results suggest the validity of prolonged CTU to aid in the evaluation of the function of the affected parenchyma and in the demonstration of urinary tract malformations.

Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.; Bowman, B.R.; Ueno, Y.

2008-11-03

The predominant product of aberrant DNA methylation is the genotoxic lesion N7-methyl-2{prime}-deoxyguanosine (m{sup 7}dG). M{sup 7}dG is recognized and excised by lesion-specific DNA glycosylases, namely AlkA in E. coli and Aag in humans. Structural studies of m{sup 7}dG recognition and catalysis by these enzymes have been hampered due to a lack of efficient means by which to incorporate the chemically labile m{sup 7}dG moiety site-specifically into DNA on a preparative scale. Here we report a solution to this problem. We stabilized the lesion toward acid-catalyzed and glycosylase-catalyzed depurination by 2{prime}-fluorination and toward base-catalyzed degradation using mild, nonaqueous conditions in themore » DNA deprotection reaction. Duplex DNA containing 2{prime}-fluoro-m{sup 7}dG (Fm{sup 7}dG) cocrystallized with AlkA as a host-guest complex in which the lesion-containing segment of DNA was nearly devoid of protein contacts, thus enabling the first direct visualization of the N7-methylguanine lesion nucleobase in DNA. The structure reveals that the base-pairing mode of Fm{sup 7}dG:C is nearly identical to that of G:C, and Fm{sup 7}dG does not induce any apparent structural disturbance of the duplex structure. These observations suggest that AlkA and Aag must perform a structurally invasive interrogation of DNA in order to detect the presence of intrahelical m{sup 7}dG lesions.« less

Zoster duplex: a clinical report and etiologic analysis.

PubMed

Zhang, Feng; Zhou, Jin

2015-01-01

Herpes zoster (HZ) duplex is a rare disease presentation. The mechanisms of varicella zoster virus (VZV) reactivation in multiple dermal regions are unknown. To present a HZ duplex case occurring in an immunocompetent woman and to analyze the possible underlying causes of HZ duplex. We present a HZ duplex case in an immunocompetent woman and analyzed the possible contributing factors in 36 HZ duplex cases. Continuously distributed variables were categorized by numbers and percentages. In our study, 24 cases (66.7%) were from Asia, 16 cases (44.4%) were in individuals ≥ 50 years of age, and 17 cases (47.2%) occurred in immunocompromised patients. Of the 36 cases, 23 involved women (63.9%) and 13 involved men. Eighteen patients suffering from HZ duplex, 13 of which were women (72.2%), did not suffer from any chronic systemic disease or have a long history of taking drugs. HZ duplex is a rare event that can occur in both immunocompetent and immunosuppressed individuals. HZ duplex might be associated with the Asia region, advanced age, immunosuppression, and being female.

Direct Duplex Detection: An Emerging Tool in the RNA Structure Analysis Toolbox.

PubMed

Weidmann, Chase A; Mustoe, Anthony M; Weeks, Kevin M

2016-09-01

While a variety of powerful tools exists for analyzing RNA structure, identifying long-range and intermolecular base-pairing interactions has remained challenging. Recently, three groups introduced a high-throughput strategy that uses psoralen-mediated crosslinking to directly identify RNA-RNA duplexes in cells. Initial application of these methods highlights the preponderance of long-range structures within and between RNA molecules and their widespread structural dynamics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Thermodynamic and structural characterization of 2′-nitrogen-modified RNA duplexes

PubMed Central

Pham, John W.; Radhakrishnan, Ishwar; Sontheimer, Erik J.

2004-01-01

2′-aminonucleosides are commonly used as sites of post-synthetic chemical modification within nucleic acids. As part of a larger cross-linking strategy, we appended alkyl groups onto the N2′ position of 2′-amino-modified RNAs via 2′-ureido and 2′-amido linkages. We have characterized the thermodynamics of 2′-amino, 2′-alkylamido and 2′-alkylureido-modified RNA duplexes and show that 2′-ureido-modified RNAs are significantly more stable than analogous 2′-amido-modified RNAs. Using NMR spectroscopy and NMR-based molecular modeling of 2′-modified RNA duplexes, we examined the effects that 2′-nitrogen modifications have on RNA helices. Our data suggest that the 2′-ureido group forms a specific intra-nucleoside interaction that cannot occur within 2′-amido-modified helices. These results indicate that 2′-ureido modifications are superior to analogous 2′-amido ones for applications that require stable base pairing. PMID:15247335

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

2003-01-01

The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

Duplex ultrasound

MedlinePlus

Vascular ultrasound; Peripheral vascular ultrasound ... A duplex ultrasound combines: Traditional ultrasound: This uses sound waves that bounce off blood vessels to create pictures. Doppler ultrasound: This ...

Experience with duplex bearings in narrow angle oscillating applications

NASA Technical Reports Server (NTRS)

Phinney, D. D.; Pollard, C. L.; Hinricks, J. T.

1988-01-01

Duplex ball bearings are matched pairs on which the abutting faces of the rings have been accurately ground so that when the rings are clamped together, a controlled amount of interference (preload) exists across the balls. These bearings are vulnerable to radial temperature gradients, blocking in oscillation and increased sensitivity to contamination. These conditions decrease the service life of these bearings. It was decided that an accelerated thermal vacuum life test should be conducted. The test apparatus and results are described and the rationale is presented for reducing a multiyear life test on oil lubricated bearings to less than a year.

Energetics, Ion and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

PubMed

Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A

2018-06-22

Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.

Chirality- and sequence-selective successive self-sorting via specific homo- and complementary-duplex formations

PubMed Central

Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji

2015-01-01

Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Benefits of Automatic Duplexing Fact Sheet

EPA Pesticide Factsheets

This resource provides a how-to duplex guide, informs the reader on the benefits and cost savings from automatic duplexing, and several off the shelf print management software options for your facility.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

PubMed

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

Structural energetics of the adenine tract from an intrinsic transcription terminator.

PubMed

Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

2010-04-02

Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

Hybrid recursive active filters for duplexing in RF transmitter front-ends

NASA Astrophysics Data System (ADS)

Gottardo, Giuseppe; Donati, Giovanni; Musolff, Christian; Fischer, Georg; Felgentreff, Tilman

2016-08-01

Duplex filters in modern base transceiver stations shape the channel in order to perform common frequency division duplex operations. Usually, they are designed as cavity filters, which are expensive and have large dimensions. Thanks to the emerging digital technology and fast digital converters, it is possible to transfer the efforts of designing analog duplex filters into digital numeric algorithms applied to feedback structures, operating on power. This solution provides the shaping of the signal spectrum directly at the output of the radio frequency (RF) power amplifiers (PAs) relaxing the transmitter design especially in the duplexer and in the antenna sections. The design of a digital baseband feedback applied to the analog power RF amplifiers (hybrid filter) is presented and verified by measurements. A model to describe the hybrid system is investigated, and the relation between phase and resonance peaks of the resulting periodic band-pass transfer function is described. The stability condition of the system is analyzed using Nyquist criterion. A solution involving a number of digital feedback and forward branches is investigated defining the parameters of the recursive structure. This solution allows the closed loop system to show a periodic band pass with up to 500 kHz bandwidth at the output of the RF amplifier. The band-pass magnitude reaches up to 17 dB selectivity. The rejection of the PA noise in the out-of-band frequencies is verified by measurements. The filter is tested with a modulated LTE (Long Term Evolution) signal showing an ACPR (Adjacent Channel Power Ratio) enhancement of 10 dB of the transmitted signal.

How does hydroxyl introduction influence the double helical structure: the stabilization of an altritol nucleic acid:ribonucleic acid duplex

PubMed Central

Ovaere, Margriet; Sponer, Jiri; Sponer, Judit E.; Herdewijn, Piet; Van Meervelt, Luc

2012-01-01

Altritol nucleic acids (ANAs) are a promising new tool in the development of artificial small interfering ribonucleic acids (siRNAs) for therapeutical applications. To mimic the siRNA:messenger RNA (mRNA) interactions, the crystal structure of the ANA:RNA construct a(CCGUAAUGCC-P):r(GGCAUUACGG) was determined to 1.96 Å resolution which revealed the hybrid to form an A-type helix. As this A-form is a major requirement in the RNAi process, this crystal structure confirms the potential of altritol-modified siRNAs. Moreover, in the ANA strands, a new type of intrastrand interactions was found between the O2′ hydroxyl group of one residue and the sugar ring O4′ atom of the next residue. These interactions were further investigated by quantum chemical methods. Besides hydration effects, these intrastrand hydrogen bonds may also contribute to the stability of ANA:RNA duplexes. PMID:22638588

Duplex kidney: not just a drooping lily.

PubMed

Doery, Ashlea J; Ang, Eileen; Ditchfield, Michael R

2015-04-01

Duplex kidneys are common, mostly asymptomatic and of no clinical significance. However, they can be associated with significant pathology, often with long-term morbidity. There is minimal literature on the review of the duplex kidney, its associated anomalies and complications. The purpose of this paper is to review our experience of imaging the spectrum of abnormalities associated with duplex kidneys in the paediatric population and correlate this with contemporary literature. A retrospective review of the radiology database in a tertiary paediatric centre was performed. A word search of the Radiology Information System for 'duplex' of patients under the age of 16 was undertaken and limited to studies performed between 2006 and 2013. Two hundred seventy-four patients were identified (age range 0-16, median 3 years, gender 59.9% female) who had 836 studies: ultrasound 598/836 (71.6%), nuclear medicine 180/836 (21.5%), micturating cystourethrogram 52/836 (6.2%), MRI 5/836 (<1%) and CT scan 1/836 (<1%). Patients were categorised as duplex and no complication (151/274 = 55.1%), upper moiety obstruction, lower moiety reflux/scarring, multicystic dysplastic kidney, abnormal ureteric insertion and other pathology. Duplex kidneys are common and often not clinically significant. However, this study demonstrates almost 50% of paediatric patients investigated for duplex kidneys had complications requiring treatment. The most common complications were upper moiety obstruction associated with a ureterocele and lower moiety vesicoureteric reflux. Ultrasound was the most common modality for early detection of these complications. © 2015 The Royal Australian and New Zealand College of Radiologists.

Stacked-unstacked equilibrium at the nick site of DNA.

PubMed

Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

2004-09-17

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Methods And Devices For Characterizing Duplex Nucleic Acid Molecules

DOEpatents

Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen

2005-08-30

Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

2002-01-01

The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

Duplex ultrasound surveillance after carotid artery endarterectomy.

PubMed

Al Shakarchi, Julien; Lowry, Danielle; Nath, Jay; Khawaja, Aurangzaib Z; Inston, Nicholas; Tiwari, Alok

2016-06-01

After carotid endarterectomy (CEA), patients have been regularly followed up by duplex ultrasound imaging. However, the evidence for long-term follow-up is not clear, especially if the results from an early duplex scan are normal. This study assessed and systematically reviewed the evidence base for long-term surveillance after CEA and a normal early scan. Electronic databases were searched for studies assessing duplex surveillance after CEA in accordance with Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. The primary outcome for this study was the incidence of restenosis after a normal early scan. The secondary outcome was the number of reinterventions after a normal early scan. The review included seven studies that reported 2317 procedures. Of those patients with a normal early scan, 2.8% (95% confidence interval, 0.7%-6%) developed a restenosis, and 0.4% (95% confidence interval, 0%-0.9%) underwent a reintervention for their restenosis during the follow-up period. This review confirms that routine postoperative duplex ultrasound surveillance after CEA is not necessary if the early duplex scan is normal. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

PubMed

Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

1987-09-15

We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.

Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

NASA Technical Reports Server (NTRS)

Egli, M.; Usman, N.; Rich, A.

1993-01-01

We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

Orbiting pairs of walking droplets: Dynamics and stability

NASA Astrophysics Data System (ADS)

Oza, Anand U.; Siéfert, Emmanuel; Harris, Daniel M.; Moláček, Jan; Bush, John W. M.

2017-05-01

A decade ago, Couder and Fort [Phys. Rev. Lett. 97, 154101 (2006)], 10.1103/PhysRevLett.97.154101 discovered that a millimetric droplet sustained on the surface of a vibrating fluid bath may self-propel through a resonant interaction with its own wave field. We here present the results of a combined experimental and theoretical investigation of the interactions of such walking droplets. Specifically, we delimit experimentally the different regimes for an orbiting pair of identical walkers and extend the theoretical model of Oza et al. [J. Fluid Mech. 737, 552 (2013)], 10.1017/jfm.2013.581 in order to rationalize our observations. A quantitative comparison between experiment and theory highlights the importance of spatial damping of the wave field. Our results also indicate that walkers adapt their impact phase according to the local wave height, an effect that stabilizes orbiting bound states.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

NASA Astrophysics Data System (ADS)

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

PubMed Central

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308

Time-resolved fluorescent properties of 8-vinyl-deoxyadenosine and 2-amino-deoxyribosylpurine exhibit different sensitivity to their opposite base in duplexes.

PubMed

Kenfack, Cyril A; Piémont, Etienne; Ben Gaied, Nouha; Burger, Alain; Mély, Yves

2008-08-14

8-Vinyl-deoxyadenosine (8VA) has been recently introduced as a fluorescent analogue of adenosine that is less perturbing and less quenched than the well-established 2-amino-deoxyribosylpurine (2AP) probe when inserted in oligonucleotides. To further validate 8VA as a fluorescent substitute of A, we compared the ability of 8VA and 2AP in sequences of the type d(CGT TTT XNX TTT TGC) (with N=8VA or 2AP and X=T and C) to discriminate the nature of the opposite base (Y) in duplexes. For both probes, systematic variations in the amplitudes of the short- and long-lived lifetimes of the fluorescence intensity decays as well as in the amplitude of the fast rotational correlation time of the fluorescence anisotropy decays were observed as a function of the nature of Y. From these parameters, we inferred a stability order 8VA-T > 8VA-G > 8VA-A > 8VA-C, similar to the stability order with the native A base, but different from the stability order with 2AP. Using a combination of molecular mechanics and ab initio calculations, we found that the time-resolved parameters of 8VA, but not the 2AP ones, correlate well with the geometry and the strength of the A-Y base-pairing interaction. This may be rationalized by the smaller structural and electronic perturbations induced by the vinyl group in position 8 as compared to the amino group at position 2. As a consequence, substitution of A by 8VA in a base pair was found to only minimally modify the structure and interaction energy of the base pair. Thus, 8VA can be used as a fluorescent substitute of the natural A, to straightforwardly discriminate the nature of the opposite base. This may find interesting applications notably in the elucidation of the mechanisms and dynamics of the DNA mismatch repair system.

Duplex and triplex formation of mixed pyrimidine oligonucleotides with stacking of phenyl-triazole moieties in the major groove.

PubMed

Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul

2011-08-05

5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.

Characterizing AISI 1045 steel surface duplex-treated by alternating current field enhanced pack aluminizing and nitriding

NASA Astrophysics Data System (ADS)

Xie, Fei; Zhang, Ge; Pan, Jianwei

2018-02-01

Thin cases and long treating time are shortcomings of conventional duplex treatment of aluminizing followed by nitriding (DTAN). Alternating current field (ACF) enhanced DTAN was carried out on AISI 1045 steel by applying an ACF to treated samples and treating agents with a pair of electrodes for overcoming those shortcomings. By investigating cases' structures, phases, composition and hardness distributions of differently treated samples, preliminary studies were made on characterizations of the ACF enhanced duplex treatment to AISI 1045 steel. The results show that, with the help of the ACF, the surface Al-rich phase Al5Fe2 formed in conventional pack aluminizing can be easily avoided and the aluminizing process is dramatically promoted. The aluminizing case can be nitrided either with conventional pack nitriding or ACF enhanced pack nitriding. By applying ACF to pack nitriding, the diffusion of nitrogen into the aluminizing case is promoted. AlN, Fe2∼3N and solid solution of N in iron are efficiently formed as a result of reactions of N with the aluminizing case. A duplex treated case with an effective thickness of more than 170 μm can be obtained by the alternating current field enhanced 4 h pack aluminizing plus 4 h pack nitriding.

Ultra-short silicon MMI duplexer

NASA Astrophysics Data System (ADS)

Yi, Huaxiang; Huang, Yawen; Wang, Xingjun; Zhou, Zhiping

2012-11-01

The fiber-to-the-home (FTTH) systems are growing fast these days, where two different wavelengths are used for upstream and downstream traffic, typically 1310nm and 1490nm. The duplexers are the key elements to separate these wavelengths into different path in central offices (CO) and optical network unit (ONU) in passive optical network (PON). Multimode interference (MMI) has some benefits to be a duplexer including large fabrication tolerance, low-temperature dependence, and low-polarization dependence, but its size is too large to integrate in conventional case. Based on the silicon photonics platform, ultra-short silicon MMI duplexer was demonstrated to separate the 1310nm and 1490nm lights. By studying the theory of self-image phenomena in MMI, the first order images are adopted in order to keep the device short. A cascaded MMI structure was investigated to implement the wavelength splitting, where both the light of 1310nm and 1490nm was input from the same port, and the 1490nm light was coupling cross the first MMI and output at the cross-port in the device while the 1310nm light was coupling through the first and second MMI and output at the bar-port in the device. The experiment was carried on with the SOI wafer of 340nm top silicon. The cascaded MMI was investigated to fold the length of the duplexer as short as 117μm with the extinct ratio over 10dB.

l-Proline and RNA Duplex m-Value Temperature Dependence.

PubMed

Schwinefus, Jeffrey J; Baka, Nadia L; Modi, Kalpit; Billmeyer, Kaylyn N; Lu, Shutian; Haase, Lucas R; Menssen, Ryan J

2017-08-03

The temperature dependence of l-proline interactions with the RNA dodecamer duplex surface exposed after unfolding was quantified using thermal and isothermal titration denaturation monitored by uv-absorbance. The m-value quantifying proline interactions with the RNA duplex surface area exposed after unfolding was measured using RNA duplexes with GC content ranging between 17 and 83%. The m-values from thermal denaturation decreased with increasing GC content signifying increasingly favorable proline interactions with the exposed RNA surface area. However, m-values from isothermal titration denaturation at 25.0 °C were independent of GC content and less negative than those from thermal denaturation. The m-value from isothermal titration denaturation for a 50% GC RNA duplex decreased (became more negative) as the temperature increased and was in nearly exact agreement with the m-value from thermal denaturation. Since RNA duplex transition temperatures increased with GC content, the more favorable proline interactions with the high GC content duplex surface area observed from thermal denaturation resulted from the temperature dependence of proline interactions rather than the RNA surface chemical composition. The enthalpy contribution to the m-value was positive and small (indicating a slight increase in duplex unfolding enthalpy with proline) while the entropic contribution to the m-value was positive and increased with temperature. Our results will facilitate proline's use as a probe of solvent accessible surface area changes during biochemical reactions at different reaction temperatures.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

PubMed

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Transcranial Duplex Sonography Predicts Outcome following an Intracerebral Hemorrhage.

PubMed

Camps-Renom, P; Méndez, J; Granell, E; Casoni, F; Prats-Sánchez, L; Martínez-Domeño, A; Guisado-Alonso, D; Martí-Fàbregas, J; Delgado-Mederos, R

2017-08-01

Several radiologic features such as hematoma volume are related to poor outcome following an intracerebral hemorrhage and can be measured with transcranial duplex sonography. We sought to determine the prognostic value of transcranial duplex sonography in patients with intracerebral hemorrhage. We conducted a prospective study of patients diagnosed with spontaneous intracerebral hemorrhage. Transcranial duplex sonography examinations were performed within 2 hours of baseline CT, and we recorded the following variables: hematoma volume, midline shift, third ventricle and lateral ventricle diameters, and the pulsatility index in both MCAs. We correlated these data with the CT scans and assessed the prognostic value of the transcranial duplex sonography measurements. We assessed early neurologic deterioration during hospitalization and mortality at 1-month follow-up. We included 35 patients with a mean age of 72.2 ± 12.8 years. Median baseline hematoma volume was 9.85 mL (interquartile range, 2.74-68.29 mL). We found good agreement and excellent correlation between transcranial duplex sonography and CT when measuring hematoma volume ( r = 0.791; P < .001) and midline shift ( r = 0.827; P < .001). The logistic regression analysis with transcranial duplex sonography measurements showed that hematoma volume was an independent predictor of early neurologic deterioration (OR, 1.078; 95% CI, 1.023-1.135) and mortality (OR, 1.089; 95% CI, 1.020-1.160). A second regression analysis with CT variables also demonstrated that hematoma volume was associated with early neurologic deterioration and mortality. When we compared the rating operation curves of both models, their predictive power was similar. Transcranial duplex sonography showed an excellent correlation with CT in assessing hematoma volume and midline shift in patients with intracerebral hemorrhage. Hematoma volume measured with transcranial duplex sonography was an independent predictor of poor outcome. © 2017 by

Chip-to-Chip Half Duplex Spiking Data Communication over Power Supply Rails

NASA Astrophysics Data System (ADS)

Hashida, Takushi; Nagata, Makoto

Chip-to-chip serial data communication is superposed on power supply over common Vdd/Vss connections through chip, package, and board traces. A power line transceiver demonstrates half duplex spiking communication at more than 100Mbps. A pair of transceivers consumes 1.35mA from 3.3V, at 130Mbps. On-chip power line LC low pass filter attenuates pseudo-differential communication spikes by 30dB, purifying power supply current for internal circuits. Bi-directional spiking communication was successfully examined in a 90-nm CMOS prototype setup of on-chip waveform capturing. A micro controller forwards clock pulses to and receives data streams from a comparator based waveform capturer formed on a different chip, through a single pair of power and ground traces. The bit error rate is small enough not to degrade waveform acquisition capability, maintaining the spurious free dynamic range of higher than 50dB.

A most spectrum-efficient duplexing system: CDD

NASA Astrophysics Data System (ADS)

Lee, William C. Y.

2001-10-01

The game to play in wireless communications when it comes to increasing spectrum efficiency is to eliminate interference. Currently, all cellular systems use FDD (Frequency Division Duplexing) in an attempt to eliminate the interference from the adjacent cells. Through the use of many technologies only one type of interference remains and that is the adjacent base-tohome mobile interference. TDD (Time Division Duplexing) has not been used for mobile cellular systems, not only because of the adjacent base-to-home mobile interference, but also because of the additional adjacent base-to-home base interference, and adjacent mobile-to-home mobile interference. Therefore, TDD can only be used for small, confined area systems. CDD (Code Division Duplexing) can eliminate all three kinds of interference; the adjacent base-to-home mobile, the adjacent baseto-home base, and the adjacent mobile- to- home in cellular systems. Eliminating each of these interferences makes CDD the most spectrum efficient duplexing system. This talk will elaborate on a set of smart codes, which will make an efficient CDD system a reality.

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

PubMed Central

2011-01-01

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

RNA Tertiary Interactions in a Riboswitch Stabilize the Structure of a Kink Turn

PubMed Central

Schroeder, Kersten T.; Daldrop, Peter; Lilley, David M.J.

2011-01-01

Summary The kink turn is a widespread RNA motif that introduces an acute kink into the axis of duplex RNA, typically comprising a bulge followed by a G⋅A and A⋅G pairs. The kinked conformation is stabilized by metal ions, or the binding of proteins including L7Ae. We now demonstrate a third mechanism for the stabilization of k-turn structure, involving tertiary interactions within a larger RNA structure. The SAM-I riboswitch contains an essential standard k-turn sequence that kinks a helix so that its terminal loop can make a long-range interaction. We find that some sequence variations in the k-turn within the riboswitch do not prevent SAM binding, despite preventing the folding of the k-turn in isolation. Furthermore, two crystal structures show that the sequence-variant k-turns are conventionally folded within the riboswitch. This study shows that the folded structure of the k-turn can be stabilized by tertiary interactions within a larger RNA structure. PMID:21893284

Solution structure and base pair opening kinetics of the i-motif dimer of d(5mCCTTTACC): a noncanonical structure with possible roles in chromosome stability.

PubMed

Nonin, S; Phan, A T; Leroy, J L

1997-09-15

Repetitive cytosine-rich DNA sequences have been identified in telomeres and centromeres of eukaryotic chromosomes. These sequences play a role in maintaining chromosome stability during replication and may be involved in chromosome pairing during meiosis. The C-rich repeats can fold into an 'i-motif' structure, in which two parallel-stranded duplexes with hemiprotonated C.C+ pairs are intercalated. Previous NMR studies of naturally occurring repeats have produced poor NMR spectra. This led us to investigate oligonucleotides, based on natural sequences, to produce higher quality spectra and thus provide further information as to the structure and possible biological function of the i-motif. NMR spectroscopy has shown that d(5mCCTTTACC) forms an i-motif dimer of symmetry-related and intercalated folded strands. The high-definition structure is computed on the basis of the build-up rates of 29 intraresidue and 35 interresidue nuclear Overhauser effect (NOE) connectivities. The i-motif core includes intercalated interstrand C.C+ pairs stacked in the order 2*.8/1.7*/1*.7/2.8* (where one strand is distinguished by an asterisk and the numbers relate to the base positions within the repeat). The TTTA sequences form two loops which span the two wide grooves on opposite sides of the i-motif core; the i-motif core is extended at both ends by the stacking of A6 onto C2.C8+. The lifetimes of pairs C2.C8+ and 5mC1.C7+ are 1 ms and 1 s, respectively, at 15 degrees C. Anomalous exchange properties of the T3 imino proton indicate hydrogen bonding to A6 N7 via a water bridge. The d(5mCCTTTTCC) deoxyoligonucleotide, in which position 6 is occupied by a thymidine instead of an adenine, also forms a symmetric i-motif dimer. However, in this structure the two TTTT loops are located on the same side of the i-motif core and the C.C+ pairs are formed by equivalent cytidines stacked in the order 8*.8/1.1*/7*.7/2.2*. Oligodeoxynucleotides containing two C-rich repeats can fold and dimerize

A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

PubMed Central

Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

2003-01-01

A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

Mapping Structurally Defined Guanine Oxidation Products along DNA Duplexes: Influence of Local Sequence Context and Endogenous Cytosine Methylation

PubMed Central

2015-01-01

DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2′-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated MeCG dinucleotides and at 5′ Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of MeCG sequences may be caused by a lowered ionization potential of guanine bases paired with MeC and the preferential intercalation of riboflavin photosensitizer adjacent to MeC:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational “hotspots” at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer. PMID:24571128

Mesophase stabilization in ionic liquid crystals through pairing equally shaped mesogenic cations and anions

DOE PAGES

Stappert, Kathrin; Lipinski, Gregor; Kopiec, Gabriel; ...

2015-07-23

The synthesis and properties of a set of novel ionic liquid crystals with congruently shaped cations and anions are reported to check whether pairing mesogenic cations with mesogenic anions leads to a stabilization of a liquid crystalline phase. To that avail 1-alkyl-3-methyl-triazolium cations with an alkyl chain length of 10, 12, and 14 carbon atoms have been combined with p-alkyloxy-benzenesulfonate anions with different alkyl chain lengths (n = 10, 12, and 14). The corresponding triazolium iodides have been synthesized as reference compounds where the cation and anion have strong size and shape mismatch. The mesomorphic behavior of all compounds ismore » studied by differential scanning calorimetry and polarizing optical microscopy. All compounds except 1-methyl-3-decyltriazolium iodide, which qualifies as an ionic liquid, are thermotropic ionic liquid crystals. All other compounds adopt smectic A phases. As a result, a comparison of the thermal phase behavior of the 1-methyl-3-decyltriazolium bromides to the corresponding p-alkoxy-benzensulfonates reveals that definitely the mesophase is stabilized by pairing the rod-shaped 1-alkyl-3-methyltriazolium cation with a rod-like anion of similar size.« less

Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

PubMed Central

Shen, Xiulong; Corey, David R

2018-01-01

Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

PubMed

Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

1998-09-23

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

Activation Energies for Dissociation of Double Strand Oligonucleotide Anions: Evidence for Watson–Crick Base Pairing in Vacuo

PubMed Central

Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.

2005-01-01

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487

Electron Beam Welding of Duplex Steels with using Heat Treatment

NASA Astrophysics Data System (ADS)

Schwarz, Ladislav; Vrtochová, Tatiana; Ulrich, Koloman

2010-01-01

This contribution presents characteristics, metallurgy and weldability of duplex steels with using concentrated energy source. The first part of the article describes metallurgy of duplex steels and the influence of nitrogen on their solidification. The second part focuses on weldability of duplex steels with using electron beam aimed on acceptable structure and corrosion resistance performed by multiple runs of defocused beam over the penetration weld.

Reducing duplex examinations in patients with iatrogenic pseudoaneurysms.

PubMed

Stone, Patrick A; Aburahma, Ali F; Flaherty, Sarah K

2006-06-01

Ultrasound-guided thrombin injection has become the initial treatment of choice for femoral access-related pseudoaneurysms. Patients typically undergo serial duplex examinations to assess for spontaneous resolution of small iatrogenic pseudoaneurysms (IPSAs) (<2.5 cm), or may require repeated diagnostic, therapeutic, and follow-up studies for larger IPSAs (>2.5 cm). We evaluated the impact of a revised treatment algorithm that includes primary treatment of both small (<2.5 cm) and larger pseudoaneurysms (>2.5 cm), rather than observation of smaller ones, and attempts to establish a single duplex examination via a point-of-care treatment strategy. We reviewed 105 consecutive patients treated with ultrasound-guided thrombin injection from July 2001 through September 2004. Patient, IPSAs, characteristics, and treatment methods were examined. The number of duplex examinations per patient was evaluated over the treatment interval. Also, published cost data were used to compare primary treatment of small ISPAs vs observation with serial duplex examinations. Successful thrombosis occurred in 103 (98.1%) of 105 treated pseudoaneurysms. No minor or major complications occurred after thrombin injection in either small or large ISPAs, and both failures requiring operation were in the large aneurysm group. The recurrence rate for the series was 1.9% (2/105), and both recurrences were successfully treated with an additional thrombin injection. A single injection was successful in treating 43 (97.7%) of 44 small (<2.5 cm) IPSAs, and one required a second injection. Patients had an average of 3.3 duplex examinations in our first year of treatment experience, which declined to 1.5 by our third year with the institution of a point-of-care service model for all pseudoaneurysms. Based on this decreased use of duplex examination and an average treatment cohort of 35 IPSA patients per year our institution, we determined this results in a reduction of 35 hours of laboratory time and

The Duplex Society.

ERIC Educational Resources Information Center

Schorr, Alvin L.

1984-01-01

The duplex society, in which the poor live in close proximity to others but in a separate compartment, is already with us. Unless something deeply changes about family income, more than one-third of future generations will come to adulthood having spent a portion of their childhood in official poverty. (RM)

The coupling between stability and ion pair formation in magnesium electrolytes from first-principles quantum mechanics and classical molecular dynamics

DOE PAGES

Rajput, Nav Nidhi; Qu, Xiaohuui; Sa, Niya; ...

2015-02-10

Here in this work we uncover a novel effect between concentration dependent ion pair formation and anion stability at reducing potentials, e.g., at the metal anode. Through comprehensive calculations using both first-principles as well as well-benchmarked classical molecular dynamics over a matrix of electrolytes, covering solvents and salt anions with a broad range in chemistry, we elucidate systematic correlations between molecular level interactions and composite electrolyte properties, such as electrochemical stability, solvation structure, and dynamics. We find that Mg electrolytes are highly prone to ion pair formation, even at modest concentrations, for a wide range of solvents with different dielectricmore » constants, which have implications for dynamics as well as charge transfer. Specifically, we observe that, at Mg metal potentials, the ion pair undergoes partial reduction at the Mg cation center (Mg 2+ -> Mg +), which competes with the charge transfer mechanism and can activate the anion to render it susceptible to decomposition. Specifically, TFSI exhibits a significant bond weakening while paired with the transient, partially reduced Mg +. In contrast, BH 4 $-$ and BF 4 $-$ are shown to be chemically stable in a reduced ion pair configuration. Furthermore, we observe that higher order glymes as well as DMSO improve the solubility of Mg salts, but only the longer glyme chains reduce the dynamics of the ions in solution. This information provides critical design metrics for future electrolytes as it elucidates a close connection between bulk solvation and cathodic stability as well as the dynamics of the salt.« less

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

PubMed

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

PubMed Central

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Effects of magnesium ions on the stabilization of RNA oligomers of defined structures.

PubMed Central

Serra, Martin J; Baird, John D; Dale, Taraka; Fey, Bridget L; Retatagos, Kimberly; Westhof, Eric

2002-01-01

Optical melting was used to determine the stabilities of 11 small RNA oligomers of defined secondary structure as a function of magnesium ion concentration. The oligomers included helices composed of Watson-Crick base pairs, GA tandem base pairs, GU tandem base pairs, and loop E motifs (both eubacterial and eukaryotic). The effect of magnesium ion concentration on stability was interpreted in terms of two simple models. The first assumes an uptake of metal ion upon duplex formation. The second assumes nonspecific electrostatic attraction of metal ions to the RNA oligomer. For all oligomers, except the eubacterial loop E, the data could best be interpreted as nonspecific binding of metal ions to the RNAs. The effect of magnesium ions on the stability of the eubacterial loop E was distinct from that seen with the other oligomers in two ways. First, the extent of stabilization by magnesium ions (as measured by either change in melting temperature or free energy) was three times greater than that observed for the other helical oligomers. Second, the presence of magnesium ions produces a doubling of the enthalpy for the melting transition. These results indicate that magnesium ion stabilizes the eubacterial loop E sequence by chelating the RNA specifically. Further, these results on a rather small system shed light on the large enthalpy changes observed upon thermal unfolding of large RNAs like group I introns. It is suggested that parts of those large enthalpy changes observed in the folding of RNAs may be assigned to variations in the hydration states and types of coordinating atoms in some specifically bound magnesium ions and to an increase in the observed cooperativity of the folding transition due to the binding of those magnesium ions coupling the two stems together. Brownian dynamic simulations, carried out to visualize the metal ion binding sites, reveal rather delocalized ionic densities in all oligomers, except for the eubacterial loop E, in which precisely

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

PubMed Central

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

PubMed Central

Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

2008-01-01

Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for

Phase transformations in cast duplex stainless steels

NASA Astrophysics Data System (ADS)

Kim, Yoon-Jun

Duplex stainless steels (DSS) constitute both ferrite and austenite as a matrix. Such a microstructure confers a high corrosion resistance with favorable mechanical properties. However, intermetallic phases such as sigma (sigma) and chi (chi) can also form during casting or high-temperature processing and can degrade the properties of the DSS. This research was initiated to develop time-temperature-transformation (TTT) and continuous-cooling-transformation (CCT) diagrams of two types of cast duplex stainless steels, CD3MN (Fe-22Cr-5Ni-Mo-N) and CD3MWCuN (Fe-25Cr-7Ni-Mo-W-Cu-N), in order to understand the time and temperature ranges for intermetallic phase formation. The alloys were heat treated isothermally or under controlled cooling conditions and then characterized using conventional metallographic methods that included tint etching, and also using electron microscopy (SEM, TEM) and wavelength dispersive spectroscopy (WDS). The kinetics of intermetallic-phase (sigma + chi) formation were analyzed using the Johnson-Mehl-Avrami (JMA) equation in the case of isothermal transformations and a modified form of this equation in the case of continuous cooling transformations. The rate of intermetallic-phase formation was found to be much faster in CD3MWCuN than CD3MN due mainly to differences in the major alloying contents such as Cr, Ni and Mo. To examine in more detail the effects of these elements of the phase stabilities, a series of eight steel castings was designed with the Cr, Ni and Mo contents systematically varied with respect to the nominal composition of CD3MN. The effects of varying the contents of alloying additions on the formation of intermetallic phases were also studied computationally using the commercial thermodynamic software package, Thermo-Calc. In general, a was stabilized with increasing Cr addition and chi by increasing Mo addition. However, a delicate balance among Ni and other minor elements such as N and Si also exists. Phase equilibria in

Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

PubMed Central

Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

2016-01-01

A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

The Formation of Martensitic Austenite During Nitridation of Martensitic and Duplex Stainless Steels

NASA Astrophysics Data System (ADS)

Zangiabadi, Amirali; Dalton, John C.; Wang, Danqi; Ernst, Frank; Heuer, Arthur H.

2017-01-01

Isothermal martensite/ferrite-to-austenite phase transformations have been observed after low-temperature nitridation in the martensite and δ-ferrite phases in 15-5 PH (precipitation hardening), 17-7 PH, and 2205 (duplex) stainless steels. These transformations, in the region with nitrogen concentrations of 8 to 16 at. pct, are consistent with the notion that nitrogen is a strong austenite stabilizer and substitutional diffusion is effectively frozen at the paraequilibrium temperatures of our experiments. Our microstructural and diffraction analyses provide conclusive evidence for the martensitic nature of these phase transformations.

Criteria for the Segmentation of Vowels on Duplex Oscillograms.

ERIC Educational Resources Information Center

Naeser, Margaret A.

This paper develops criteria for the segmentation of vowels on duplex oscillograms. Previous vowel duration studies have primarily used sound spectrograms. The use of duplex oscillograms, rather than sound spectrograms, permits faster production (real time) at less expense (adding machine paper may be used). The speech signal can be more spread…

Synthesis of peptide nucleic acids containing pyridazine derivatives as cytosine and thymine analogs, and their duplexes with complementary oligodeoxynucleotides.

PubMed

Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

2015-03-20

Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.

Duplex-guided percutaneous transluminal angioplasty in iliac arterial occlusive disease.

PubMed

Krasznai, A G; Sigterman, T A; Welten, R J; Heijboer, R; Sikkink, C J J M; van de Akker, L H J M; Bouwman, L H

2013-11-01

Chronic renal insufficiency (CRI) is a growing global problem. PTA can be performed without nephrotoxic contrast, utilizing Doppler-ultrasound (Duplex) guidance. Duplex-guided infra-inguinal interventions and access-related interventions have been reported. Duplex-guided iliac interventions have not been performed to any extent because of the anatomic location. In our study we evaluated the safety and efficacy of Duplex-guided percutaneous transluminal angioplasty (DuPTA) in iliac arteries. From June 2012 until February 2013, 31 patients (35 iliac lesions), underwent DuPTA. Indications ranged from Rutherford 3 to 5. Preoperative evaluation included Ankle Brachial Index (ABI), Duplex and MRA. Procedural success was defined as crossing the lesion with a guidewire and dilating or stenting the lesion. Clinical success was defined as 50% reduction in peak systolic velocity (PSV) or clinical improvement. PSV was evaluated after PTA, then at 2 weeks. Clinical results were assessed 2 weeks after the procedure. Procedural success was achieved in 94% of patients (33/35), all of whom also had clinical success. Post-procedural PSV reduction showed an average improvement of 63% (431 cm/s to 153 cm/s). Mean preoperative ABI was 0.72 and improved to 0.88 postoperatively. PTA using Duplex-guidance in significant iliac stenosis is a safe method with major advantages in patients at high risk for developing contrast-induced nephropathy. Copyright © 2013 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

A Prospective, Randomized Trial of Routine Duplex Ultrasound Surveillance on Arteriovenous Fistula Maturation.

PubMed

Han, Ahram; Min, Seung-Kee; Kim, Mi-Sook; Joo, Kwon Wook; Kim, Jungsun; Ha, Jongwon; Lee, Joongyub; Min, Sang-Il

2016-10-07

Use of arteriovenous fistulas, the most preferred type of access for hemodialysis, is limited by their high maturation failure rate. The aim of this study was to assess whether aggressive surveillance with routine duplex ultrasound and intervention can decrease the maturation failure rate of arteriovenous fistulas. We conducted a single-center, parallel-group, randomized, controlled trial of patients undergoing autogenous arteriovenous fistula. Patients were randomly assigned (1:1) to either the routine duplex or selective duplex group. In the routine duplex group, duplex ultrasound and physical examination were performed 2, 4, and 8 weeks postoperatively. In the selective duplex group, duplex examination was performed only when physical examination detected an abnormality. The primary end point was the maturation failure rate 8 weeks after fistula creation. Maturation failure was defined as the inability to achieve clinical maturation ( i.e. , a successful first use) and failure to achieve sonographic maturation (fistula flow >500 ml/min and diameter >6 mm) within 8 weeks. Between June 14, 2012, and June 25, 2014, 150 patients were enrolled (75 patients in each group), and 118 of those were included in the final analysis. The maturation failure rate was lower in the routine duplex group (8 of 59; 13.6%) than in the selective duplex group (15 of 59; 25.4%), but the difference was not statistically significant (odds ratio, 0.46; 95% confidence interval, 0.18 to 1.19; P =0.10). Factors associated with maturation failure were women (odds ratio, 3.84; 95% confidence interval, 1.05 to 14.06; P =0.04), coronary artery disease (odds ratio, 6.36; 95% confidence interval, 1.62 to 24.95; P <0.01), diabetes (odds ratio, 6.10; 95% confidence interval, 1.76 to 21.19; P <0.01), and the preoperative cephalic vein diameter (odds ratio, 0.30; 95% confidence interval, 0.13 to 0.71; P <0.01). Postoperative routine duplex surveillance failed to prove superiority compared with

Measuring secondary phases in duplex stainless steels

NASA Astrophysics Data System (ADS)

Calliari, I.; Brunelli, K.; Dabalà, M.; Ramous, E.

2009-01-01

The use of duplex stainless steels is limited by their susceptibility to the formation of dangerous intermetallic phases resulting in detrimental effects on impact toughness and corrosion resistance. This precipitation and the quantitative determinations of the phases have received considerable attention and different precipitation sequences (σ phase, χ phase, and carbides) have been suggested. This study investigates the phase transformation during continuous cooling and isothermal treatments in commercial duplex stainless steel grades and the effects on alloy properties, and compares the most common techniques of analysis.

On the stability analysis of a pair of van der Pol oscillators with delayed self-connection, position and velocity couplings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Kun; Department of Mathematics, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon; Chung, Kwok-wai, E-mail: makchung@cityu.edu.hk

2013-11-15

In this paper, we perform a stability analysis of a pair of van der Pol oscillators with delayed self-connection, position and velocity couplings. Bifurcation diagram of the damping, position and velocity coupling strengths is constructed, which gives insight into how stability boundary curves come into existence and how these curves evolve from small closed loops into open-ended curves. The van der Pol oscillator has been considered by many researchers as the nodes for various networks. It is inherently unstable at the zero equilibrium. Stability control of a network is always an important problem. Currently, the stabilization of the zero equilibriummore » of a pair of van der Pol oscillators can be achieved only for small damping strength by using delayed velocity coupling. An interesting question arises naturally: can the zero equilibrium be stabilized for an arbitrarily large value of the damping strength? We prove that it can be. In addition, a simple condition is given on how to choose the feedback parameters to achieve such goal. We further investigate how the in-phase mode or the out-of-phase mode of a periodic solution is related to the stability boundary curve that it emerges from a Hopf bifurcation. Analytical expression of a periodic solution is derived using an integration method. Some illustrative examples show that the theoretical prediction and numerical simulation are in good agreement.« less

Duplex tab exhaust nozzle

NASA Technical Reports Server (NTRS)

Gutmark, Ephraim Jeff (Inventor); Martens, Steven (nmn) (Inventor)

2012-01-01

An exhaust nozzle includes a conical duct terminating in an annular outlet. A row of vortex generating duplex tabs are mounted in the outlet. The tabs have compound radial and circumferential aft inclination inside the outlet for generating streamwise vortices for attenuating exhaust noise while reducing performance loss.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

PubMed

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

PubMed Central

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

DOE PAGES

Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

2015-01-29

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

Molecular switching behavior in isosteric DNA base pairs.

PubMed

Jissy, A K; Konar, Sukanya; Datta, Ayan

2013-04-15

The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Geometry of an outcrop-scale duplex in Devonian flysch, Maine

USGS Publications Warehouse

Bradley, D.C.; Bradley, L.M.

1994-01-01

We describe an outcrop-scale duplex consisting of 211 exposed repetitions of a single bed. The duplex marks an early Acadian (Middle Devonian) oblique thrust zone in the Lower Devonian flysch of northern Maine. Detailed mapping at a scale of 1:8 has enabled us to measure accurately parameters such as horse length and thickness, ramp angles and displacements; we compare these and derivative values with those of published descriptions of duplexes, and with theoretical models. Shortening estimates based on line balancing are consistently smaller than two methods of area balancing, suggesting that layer-parallel shortening preceded thrusting. ?? 1994.

A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids.

PubMed

Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

2008-06-04

Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.

A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

PubMed

Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

2017-09-20

Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

Duplex Ultrasonography Has Limited Utility in Detection of Postoperative DVT After Primary Total Joint Arthroplasty.

PubMed

Vira, Shaleen; Ramme, Austin J; Alaia, Michael J; Steiger, David; Vigdorchik, Jonathan M; Jaffe, Frederick

2016-07-01

Duplex ultrasound is routinely used to evaluate suspected deep venous thrombosis after total joint arthroplasty. When there is a clinical suspicion for a pulmonary embolism, a chest angiogram (chest CTA) is concomitantly obtained. Two questions were addressed: First, for the population of patients who receive duplex ultrasound after total joint arthroplasty, what is the rate of positive results? Second, for these patients, how many of these also undergo chest CTA for clinical suspicion of pulmonary embolus and how many of these tests are positive? Furthermore, what is the correlation between duplex ultrasound results and chest CTA results? A retrospective chart review was conducted of total joint replacement patients in 2011 at a single institution. Inclusion criteria were adult patients who underwent a postoperative duplex ultrasonography for clinical suspicion of deep venous thrombosis (DVT). Demographic data, result of duplex scan, clinical indications for obtaining the duplex scan, and DVT prophylaxis used were recorded. Additionally, if a chest CTA was obtained for clinical suspicion for pulmonary embolus, results and clinical indication for obtaining the test were recorded. The rate of positive results for duplex ultrasonography and chest CTA was computed and correlated based on clinical indications. Two hundred ninety-five patients underwent duplex ultrasonography of which only 0.7% were positive for a DVT. One hundred three patients underwent a chest CTA for clinical suspicion of a pulmonary embolism (PE) of which 26 revealed a pulmonary embolus, none of which had a positive duplex ultrasound. Postoperative duplex scans have a low rate of positive results. A substantial number of patients with negative duplex results subsequently underwent chest CTA for clinical suspicion for which a pulmonary embolus was found, presumably resulting from a DVT despite negative duplex ultrasound result. A negative duplex ultrasonography should not rule out the presence of a

Clinical utility of carotid duplex ultrasound prior to cardiac surgery.

PubMed

Lin, Judith C; Kabbani, Loay S; Peterson, Edward L; Masabni, Khalil; Morgan, Jeffrey A; Brooks, Sara; Wertella, Kathleen P; Paone, Gaetano

2016-03-01

Clinical utility and cost-effectiveness of carotid duplex examination prior to cardiac surgery have been questioned by the multidisciplinary committee creating the 2012 Appropriate Use Criteria for Peripheral Vascular Laboratory Testing. We report the clinical outcomes and postoperative neurologic symptoms in patients who underwent carotid duplex ultrasound prior to open heart surgery at a tertiary institution. Using the combined databases from our clinical vascular laboratory and the Society of Thoracic Surgery, a retrospective analysis of all patients who underwent carotid duplex ultrasound within 13 months prior to open heart surgery from March 2005 to March 2013 was performed. The outcomes between those who underwent carotid duplex scanning (group A) and those who did not (group B) were compared. Among 3233 patients in the cohort who underwent cardiac surgery, 515 (15.9%) patients underwent a carotid duplex ultrasound preoperatively, and 2718 patients did not (84.1%). Among the patients who underwent carotid screening vs no screening, there was no statistically significant difference in the risk factors of cerebrovascular disease (10.9% vs 12.7%; P = .26), prior stroke (8.2% vs 7.2%; P = .41), and prior transient ischemic attack (2.9% vs 3.3%; P = .24). For those undergoing isolated coronary artery bypass grafting (CABG), 306 (17.8%) of 1723 patients underwent preoperative carotid duplex ultrasound. Among patients who had carotid screening prior to CABG, the incidence of carotid disease was low: 249 (81.4%) had minimal or mild stenosis (<50%); 25 (8.2%) had unilateral moderate stenosis (50%-69%); 10 (3.3%) had bilateral moderate stenosis; 9 (2.9%) had unilateral severe stenosis (70%-99%); 5 (1.6%) had contralateral moderate stenosis; 2 (0.7%) had bilateral severe stenosis; 4 (1.3%) had unilateral occluded with contralateral less than 50% stenosis, 1 (0.3%) had unilateral occluded with contralateral (70%-99%) stenosis; and 1 had bilateral occluded carotid

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

PubMed Central

Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

PubMed

Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Considerations in Duplex Investment.

ERIC Educational Resources Information Center

Wright, Arthur; Goen, Tom

Problems of duplex investment are noted in the introduction to this booklet designed to provide a technique by which the investment decision can be approached, develop estimates of typical costs and returns under differing conditions, and encourage investors to analyze objectives and conditions before the decision to buy or build is made. A…

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

PubMed

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Renal pelvis urothelial carcinoma of the upper moiety in complete right renal duplex: a case report.

PubMed

Zhang, Yiran; Yu, Quanfeng; Zhang, Zhihong; Liu, Ranlu; Xu, Yong

2015-01-01

Urothelial carcinoma (UC) originated from renal pelvis is the common tumor of the urinary system, however, neoplasia of the renal pelvis in duplex kidneys is extremely rare, especially in the complete renal and ureteral duplex cases. We present the first case of renal pelvis UC of the upper moiety in a complete right renal duplex. This male patient has bilateral complete renal and ureteral duplex. To the best of our knowledge, this is the first reported case of renal pelvis UC in a complete renal duplex system. After this experience we feel that the diagnosis of renal pelvis UC in duplex kidneys is not so easy, and once the diagnosis is determined, the whole renal duplex units and bladder cuff or ectopic orifice should be excised radically.

Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

PubMed Central

Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-01-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

PubMed

Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-08-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

PubMed

Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

2017-04-01

Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

52. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

52. Photocopy of copy of original Officers' Duplex Quarters drawing by Copeland, 7 April 1932 (Original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Heating - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

RNA major groove modifications improve siRNA stability and biological activity

PubMed Central

Terrazas, Montserrat; Kool, Eric T.

2009-01-01

RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

PubMed

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

2015-12-02

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A regulatory RNA is involved in RNA duplex formation and biofilm regulation in Sulfolobus acidocaldarius.

PubMed

Orell, Alvaro; Tripp, Vanessa; Aliaga-Tobar, Victor; Albers, Sonja-Verena; Maracaja-Coutinho, Vinicius; Randau, Lennart

2018-05-18

Non-coding RNAs (ncRNA) are involved in essential biological processes in all three domains of life. The regulatory potential of ncRNAs in Archaea is, however, not fully explored. In this study, RNA-seq analyses identified a set of 29 ncRNA transcripts in the hyperthermophilic archaeon Sulfolobus acidocaldarius that were differentially expressed in response to biofilm formation. The most abundant ncRNA of this set was found to be resistant to RNase R treatment (RNase R resistant RNA, RrrR(+)) due to duplex formation with a reverse complementary RNA (RrrR(-)). The deletion of the RrrR(+) gene resulted in significantly impaired biofilm formation, while its overproduction increased biofilm yield. RrrR(+) was found to act as an antisense RNA against the mRNA of a hypothetical membrane protein. The RrrR(+) transcript was shown to be stabilized by the presence of the RrrR(-) strand in S. acidocaldarius cell extracts. The accumulation of these RrrR duplexes correlates with an apparent absence of dsRNA degrading RNase III domains in archaeal proteins.

Insights into Watson–Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A

PubMed Central

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.

2017-01-01

Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571

53. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

53. Photocopy of copy of original Officers' Duplex Quarters drawing by A.G.D., 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Electrical - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

51. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

51. Photocopy of copy of original Officers' Duplex Quarters drawing by B.S. Elliott, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Plumbing - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

CMOS serial link for fully duplexed data communication

NASA Astrophysics Data System (ADS)

Lee, Kyeongho; Kim, Sungjoon; Ahn, Gijung; Jeong, Deog-Kyoon

1995-04-01

This paper describes a CMOS serial link allowing fully duplexed 500 Mbaud serial data communication. The CMOS serial link is a robust and low-cost solution to high data rate requirements. A central charge pump PLL for generating multiphase clocks for oversampling is shared by several serial link channels. Fully duplexed serial data communication is realized in the bidirectional bridge by separating incoming data from the mixed signal on the cable end. The digital PLL accomplishes process-independent data recovery by using a low-ratio oversampling, a majority voting, and a parallel data recovery scheme. Mostly, digital approach could extend its bandwidth further with scaled CMOS technology. A single channel serial link and a charge pump PLL are integrated in a test chip using 1.2 micron CMOS process technology. The test chip confirms upto 500 Mbaud unidirectional mode operation and 320 Mbaud fully duplexed mode operation with pseudo random data patterns.

The Origins of Microtexture in Duplex Ti Alloys (Preprint)

DTIC Science & Technology

2008-06-01

To) June 2008 Journal Article Preprint 4 . TITLE AND SUBTITLE THE ORIGINS OF MICROTEXTURE IN DUPLEX Ti ALLOYS (PREPRINT) 5a. CONTRACT NUMBER In...house 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 62102F 6 . AUTHOR(S) M.G. Glavic (UES, Inc.) B.B. Bartha (United Technologies Corporation...applicable to duplex alpha/beta titanium microstructures. The crystallographic coherency of the primary and secondary alpha phase with the prior beta

Features of residual stresses in duplex stainless steel butt welds

NASA Astrophysics Data System (ADS)

Um, Tae-Hwan; Lee, Chin-Hyung; Chang, Kyong-Ho; Nguyen Van Do, Vuong

2018-04-01

Duplex stainless steel finds increasing use as an alternative to austenitic stainless steel, particularly where chloride or sulphide stress corrosion cracking is of primary concern, due to the excellent combination of strength and corrosion resistance. During welding, duplex stainless steel does not create the same magnitude or distribution of weld-induced residual stresses as those in welded austenitic stainless steel due to the different physical and mechanical properties between them. In this work, an experimental study on the residual stresses in butt-welded duplex stainless steel is performed utilizing the layering technique to investigate the characteristics of residual stresses in the weldment. Three-dimensional thermos-mechanical-metallurgical finite element analysis is also performed to confirm the residual stress measurements.

50. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

50. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University. Detail of front entrance and of gable dormer - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

49. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

49. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Front, rear, and side elevations, and cross-section - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

PubMed Central

Pilch, D S; Brousseau, R; Shafer, R H

1990-01-01

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

PubMed Central

Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2015-01-01

The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide

A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids

PubMed Central

Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

2008-01-01

Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost. PMID:18522756

Hydrogen effects in duplex stainless steel welded joints - electrochemical studies

NASA Astrophysics Data System (ADS)

Michalska, J.; Łabanowski, J.; Ćwiek, J.

2012-05-01

In this work results on the influence of hydrogen on passivity and corrosion resistance of 2205 duplex stainless steel (DSS) welded joints are described. The results were discussed by taking into account three different areas on the welded joint: weld metal (WM), heat-affected zone (HAZ) and parent metal. The corrosion resistance was qualified with the polarization curves registered in a synthetic sea water. The conclusion is that, hydrogen may seriously deteriorate the passive film stability and corrosion resistance to pitting of 2205 DSS welded joints. The presence of hydrogen in passive films increases corrosion current density and decreases the potential of the film breakdown. It was also found that degree of susceptibility to hydrogen degradation was dependent on the hydrogen charging conditions. WM region has been revealed as the most sensitive to hydrogen action.

48. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

48. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Attic and roof, basement, first floor, and second floor plans - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Impact of Duplex arterial mapping on decision making in non-acute ischemic limb patients.

PubMed

Elbadawy, A; Aly, H; Ibrahim, M; Bakr, H

2015-12-01

The aim of this study was to demonstrate the impact of Duplex arterial mapping on decision making in non-acute ischemic limb patient group reporting pain onset between 15 days and 3 months. We prospectively evaluated patients presented with critical limb ischemia who reported pain onset of duration between 15 days and 3 months in one-year period. Our series included thirty cases (mean age=61.3 years old), as Duplex arterial mapping was the sole preoperative imaging tool performed in all of them. All patients, in whom duplex indicated thrombosis in long occluded segments, were candidates for fluoroscopically guided thrombectomy. When Duplex defined chronic arterial occlusions, patients underwent endovascular or bypass revascularisation procedures. Impact of Duplex wall interrogation on decision-making between the two groups (subacute and chronic) was measured. Duplex arterial mapping categorized correctly all 30 patients into either subacute ischemia with removable clot (N.=14) or chronic ischemia (N.=16). Fluoroscopic guided thrombectomy was performed in 14 cases when Duplex advised long occluded arterial segments as indicted by intact intima with echogenic thrombus inside. Bypass surgery was performed in 8 patients. Percutaneous transluminal angioplasty (PTA) was done in 7 cases and thrombendartrectomy of common femoral artery in a single case. One-year patency rate in our series was 86.6%. It was 71.4% in thrombosis group. Limb salvage rate was 93.3%. Duplex arterial mapping could be used to differentiate the subacute ischemia with removable thrombus and chronic arterial occlusions guiding for the best revascularization procedure accordingly.

mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay

PubMed Central

Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.

2013-01-01

We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942

Mg2+ Effect on Argonaute and RNA Duplex by Molecular Dynamics and Bioinformatics Implications

PubMed Central

Nam, Seungyoon; Ryu, Hyojung; Son, Won-joon; Kim, Yon Hui; Kim, Kyung Tae; Balch, Curt; Nephew, Kenneth P.; Lee, Jinhyuk

2014-01-01

RNA interference (RNAi), mediated by small non-coding RNAs (e.g., miRNAs, siRNAs), influences diverse cellular functions. Highly complementary miRNA-target RNA (or siRNA-target RNA) duplexes are recognized by an Argonaute family protein (Ago2), and recent observations indicate that the concentration of Mg2+ ions influences miRNA targeting of specific mRNAs, thereby modulating miRNA-mRNA networks. In the present report, we studied the thermodynamic effects of differential [Mg2+] on slicing (RNA silencing cycle) through molecular dynamics simulation analysis, and its subsequent statistical analysis. Those analyses revealed different structural conformations of the RNA duplex in Ago2, depending on Mg2+ concentration. We also demonstrate that cation effects on Ago2 structural flexibility are critical to its catalytic/functional activity, with low [Mg2+] favoring greater Ago2 flexibility (e.g., greater entropy) and less miRNA/mRNA duplex stability, thus favoring slicing. The latter finding was supported by a negative correlation between expression of an Mg2+ influx channel, TRPM7, and one miRNA’s (miR-378) ability to downregulate its mRNA target, TMEM245. These results imply that thermodynamics could be applied to siRNA-based therapeutic strategies, using highly complementary binding targets, because Ago2 is also involved in RNAi slicing by exogenous siRNAs. However, the efficacy of a siRNA-based approach will differ, to some extent, based on the Mg2+ concentration even within the same disease type; therefore, different siRNA-based approaches might be considered for patient-to-patient needs. PMID:25330448

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

Quality assurance of lower limb venous duplex scans performed by vascular surgeons.

PubMed

Kordowicz, A; Ferguson, G; Salaman, R; Onwudike, M

2015-02-01

Duplex scanning is the gold standard for investigating venous reflux; increasingly surgeons perform these scans themselves. There has been no data published analysing the accuracy of Duplex scans performed by vascular surgeons. We aimed to evaluate an objective method of comparing the results of lower limb Duplex scans performed by one consultant vascular surgeon with those performed by a vascular technologist. We assessed 100 legs with symptomatic varicose veins. Each patient underwent two lower limb venous Duplex scans; one performed by a consultant vascular surgeon and one by a vascular technologist. Scan results were randomised and sent to two consultant vascular surgeons blinded to the identity and experience of the sonographer. They were asked to recommend treatment. A k score was calculated in each case to assess the level of agreement between the scans performed by the consultant and the technologist. Eighty-one patients were studied (53 females). The kappa score for assessor 1 was 0.60 (95%CI:0.44-0.75) and for assessor 2 was 0.62 (95%CI:0.48-0.75). k scores >0.60 represent a substantial strength of agreement. Duplex scans performed by this surgeon were comparable to those performed by a vascular technologist. It is possible to quality-assure duplex performed by vascular surgeons without directly observing the scanning process or reviewing digitally recorded images. We propose standardisation of training, assessment and quality assurance for vascular surgeons wishing to perform ultrasound scans.

Thermal Stability of RNA Structures with Bulky Cations in Mixed Aqueous Solutions.

PubMed

Nakano, Shu-Ichi; Tanino, Yuichi; Hirayama, Hidenobu; Sugimoto, Naoki

2016-10-04

Bulky cations are used to develop nucleic-acid-based technologies for medical and technological applications in which nucleic acids function under nonaqueous conditions. In this study, the thermal stability of RNA structures was measured in the presence of various bulky cations in aqueous mixtures with organic solvents or polymer additives. The stability of oligonucleotide, transfer RNA, and polynucleotide structures was decreased in the presence of salts of tetrabutylammonium and tetrapentylammonium ions, and the stability and salt concentration dependences were dependent on cation sizes. The degree to which stability was dependent on salt concentration was correlated with reciprocals of the dielectric constants of mixed solutions, regardless of interactions between the cosolutes and RNA. Our results show that organic solvents affect the strength of electrostatic interactions between RNA and cations. Analysis of ion binding to RNA indicated greater enhancement of cation binding to RNA single strands than to duplexes in media with low dielectric constants. Furthermore, background bulky ions changed the dependence of RNA duplex stability on the concentration of metal ion salts. These unique properties of large tetraalkylammonium ions are useful for controlling the stability of RNA structures and its sensitivity to metal ion salts. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Defined presentation of carbohydrates on a duplex DNA scaffold.

PubMed

Schlegel, Mark K; Hütter, Julia; Eriksson, Magdalena; Lepenies, Bernd; Seeberger, Peter H

2011-12-16

A new method for the spatially defined alignment of carbohydrates on a duplex DNA scaffold is presented. The use of an N-hydroxysuccinimide (NHS)-ester phosphoramidite along with carbohydrates containing an alkylamine linker allows for on-column labeling during solid-phase oligonucleotide synthesis. This modification method during solid-phase synthesis only requires the use of minimal amounts of complex carbohydrates. The covalently attached carbohydrates are presented in the major groove of the B-form duplex DNA as potential substrates for murine type II C-type lectin receptors mMGL1 and mMGL2. CD spectroscopy and thermal melting revealed only minimal disturbance of the overall helical structure. Surface plasmon resonance and cellular uptake studies with bone-marrow-derived dendritic cells were used to assess the capability of these carbohydrate-modified duplexes to bind to mMGL receptors. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Duplex evaluation following femoropopliteal angioplasty and stenting: criteria and utility of surveillance.

PubMed

Baril, Donald T; Marone, Luke K

2012-07-01

Surveillance following lower extremity bypass, carotid endarterectomy, and endovascular aortic aneurysm repair has become the standard of care at most institutions. Conversely, surveillance following lower extremity endovascular interventions is performed somewhat sporadically in part because the duplex criteria for recurrent stenoses have been ill defined. It appears that duplex surveillance after peripheral endovascular interventions, as with conventional bypass, is beneficial in identifying recurrent lesions which may preclude failure and occlusion. In-stent stenosis following superficial femoral artery angioplasty and stenting can be predicted by both peak systolic velocity and velocity ratio data as measured by duplex ultrasound. Duplex criteria have been defined to determine both ≥50% in-stent stenosis and ≥80% in-stent stenosis. Although not yet well studied, it appears that applying these criteria during routine surveillance may assist in preventing failure of endovascular interventions.

Podiatry Ankle Duplex Scan: Readily Learned and Accurate in Diabetes.

PubMed

Normahani, Pasha; Powezka, Katarzyna; Aslam, Mohammed; Standfield, Nigel J; Jaffer, Usman

2018-03-01

We aimed to train podiatrists to perform a focused duplex ultrasound scan (DUS) of the tibial vessels at the ankle in diabetic patients; podiatry ankle (PodAnk) duplex scan. Thirteen podiatrists underwent an intensive 3-hour long simulation training session. Participants were then assessed performing bilateral PodAnk duplex scans of 3 diabetic patients with peripheral arterial disease. Participants were assessed using the duplex ultrasound objective structured assessment of technical skills (DUOSATS) tool and an "Imaging Score". A total of 156 vessel assessments were performed. All patients had abnormal waveforms with a loss of triphasic flow. Loss of triphasic flow was accurately detected in 145 (92.9%) vessels; the correct waveform was identified in 139 (89.1%) cases. Participants achieved excellent DUOSATS scores (median 24 [interquartile range: 23-25], max attainable score of 26) as well as "Imaging Scores" (8 [8-8], max attainable score of 8) indicating proficiency in technical skills. The mean time taken for each bilateral ankle assessment was 20.4 minutes (standard deviation ±6.7). We have demonstrated that a focused DUS for the purpose of vascular assessment of the diabetic foot is readily learned using intensive simulation training.

Characterization of microstructure and texture across dissimilar super duplex/austenitic stainless steel weldment joint by super duplex filler metal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eghlimi, Abbas, E-mail: a.eghlimi@ma.iut.ac.ir; Shamanian, Morteza; Eskandarian, Masoomeh

In the present paper, microstructural changes across an as-welded dissimilar austenitic/duplex stainless steel couple welded by a super duplex stainless steel filler metal using gas tungsten arc welding process is characterized with optical microscopy and electron back-scattered diffraction techniques. Accordingly, variations of microstructure, texture, and grain boundary character distribution of base metals, heat affected zones, and weld metal were investigated. The results showed that the weld metal, which was composed of Widmanstätten austenite side-plates and allotriomorphic grain boundary austenite morphologies, had the weakest texture and was dominated by low angle boundaries. The welding process increased the ferrite content but decreasedmore » the texture intensity at the heat affected zone of the super duplex stainless steel base metal. In addition, through partial ferritization, it changed the morphology of elongated grains of the rolled microstructure to twinned partially transformed austenite plateaus scattered between ferrite textured colonies. However, the texture of the austenitic stainless steel heat affected zone was strengthened via encouraging recrystallization and formation of annealing twins. At both interfaces, an increase in the special character coincident site lattice boundaries of the primary phase as well as a strong texture with <100> orientation, mainly of Goss component, was observed. - Graphical abstract: Display Omitted - Highlights: • Weld metal showed local orientation at microscale but random texture at macroscale. • Intensification of <100> orientated grains was observed adjacent to the fusion lines. • The austenite texture was weaker than that of the ferrite in all duplex regions. • Welding caused twinned partially transformed austenites to form at SDSS HAZ. • At both interfaces, the ratio of special CSL boundaries of the primary phase increased.« less

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

PubMed

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

PubMed Central

Xie, Ping

2015-01-01

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel. PMID:26473825

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

PubMed

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Assessment of thermal embrittlement in duplex stainless steels 2003 and 2205 for nuclear power applications

DOE PAGES

Tucker, J. D.; Miller, M. K.; Young, G. A.

2015-04-01

Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°Fmore » (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.« less

Duplex recombinase polymerase amplification assays incorporating competitive internal controls for bacterial meningitis detection.

PubMed

Higgins, Owen; Clancy, Eoin; Forrest, Matthew S; Piepenburg, Olaf; Cormican, Martin; Boo, Teck Wee; O'Sullivan, Nicola; McGuinness, Claire; Cafferty, Deirdre; Cunney, Robert; Smith, Terry J

2018-04-01

Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.

Tricriticality in the q-neighbor Ising model on a partially duplex clique.

PubMed

Chmiel, Anna; Sienkiewicz, Julian; Sznajd-Weron, Katarzyna

2017-12-01

We analyze a modified kinetic Ising model, a so-called q-neighbor Ising model, with Metropolis dynamics [Phys. Rev. E 92, 052105 (2015)PLEEE81539-375510.1103/PhysRevE.92.052105] on a duplex clique and a partially duplex clique. In the q-neighbor Ising model each spin interacts only with q spins randomly chosen from its whole neighborhood. In the case of a duplex clique the change of a spin is allowed only if both levels simultaneously induce this change. Due to the mean-field-like nature of the model we are able to derive the analytic form of transition probabilities and solve the corresponding master equation. The existence of the second level changes dramatically the character of the phase transition. In the case of the monoplex clique, the q-neighbor Ising model exhibits a continuous phase transition for q=3, discontinuous phase transition for q≥4, and for q=1 and q=2 the phase transition is not observed. On the other hand, in the case of the duplex clique continuous phase transitions are observed for all values of q, even for q=1 and q=2. Subsequently we introduce a partially duplex clique, parametrized by r∈[0,1], which allows us to tune the network from monoplex (r=0) to duplex (r=1). Such a generalized topology, in which a fraction r of all nodes appear on both levels, allows us to obtain the critical value of r=r^{*}(q) at which a tricriticality (switch from continuous to discontinuous phase transition) appears.

Evaluation of Microstructure and Mechanical Properties in Dissimilar Austenitic/Super Duplex Stainless Steel Joint

NASA Astrophysics Data System (ADS)

Rahmani, Mehdi; Eghlimi, Abbas; Shamanian, Morteza

2014-10-01

To study the effect of chemical composition on microstructural features and mechanical properties of dissimilar joints between super duplex and austenitic stainless steels, welding was attempted by gas tungsten arc welding process with a super duplex (ER2594) and an austenitic (ER309LMo) stainless steel filler metal. While the austenitic weld metal had vermicular delta ferrite within austenitic matrix, super duplex stainless steel was mainly comprised of allotriomorphic grain boundary and Widmanstätten side plate austenite morphologies in the ferrite matrix. Also the heat-affected zone of austenitic base metal comprised of large austenite grains with little amounts of ferrite, whereas a coarse-grained ferritic region was observed in the heat-affected zone of super duplex base metal. Although both welded joints showed acceptable mechanical properties, the hardness and impact strength of the weld metal produced using super duplex filler metal were found to be better than that obtained by austenitic filler metal.

Gas-fired duplex free-piston Stirling refrigerator

NASA Astrophysics Data System (ADS)

Urieli, L.

1984-03-01

The duplex free-piston Stirling refrigerator is a potentially high efficiency, high reliability device which is ideally suited to the home appliance field, in particular as a gas-fired refrigerator. It has significant advantages over other equivalent devices including freedom from halogenated hydrocarbons, extremely low temperatures available at a high efficiency, integrated water heating, and simple burner system control. The design and development of a portable working demonstration gas-fired duplex Stirling refrigeration unit is described. A unique combination of computer aided development and experimental development was used, enabling a continued interaction between the theoretical analysis and practical testing and evaluation. A universal test rig was developed in order to separately test and evaluate major subunits, enabling a smooth system integration phase.

Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

PubMed

Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

2013-07-30

Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

Effects of non-CpG site methylation on DNA thermal stability: a fluorescence study

PubMed Central

Nardo, Luca; Lamperti, Marco; Salerno, Domenico; Cassina, Valeria; Missana, Natalia; Bondani, Maria; Tempestini, Alessia; Mantegazza, Francesco

2015-01-01

Cytosine methylation is a widespread epigenetic regulation mechanism. In healthy mature cells, methylation occurs at CpG dinucleotides within promoters, where it primarily silences gene expression by modifying the binding affinity of transcription factors to the promoters. Conversely, a recent study showed that in stem cells and cancer cell precursors, methylation also occurs at non-CpG pairs and involves introns and even gene bodies. The epigenetic role of such methylations and the molecular mechanisms by which they induce gene regulation remain elusive. The topology of both physiological and aberrant non-CpG methylation patterns still has to be detailed and could be revealed by using the differential stability of the duplexes formed between site-specific oligonucleotide probes and the corresponding methylated regions of genomic DNA. Here, we present a systematic study of the thermal stability of a DNA oligonucleotide sequence as a function of the number and position of non-CpG methylation sites. The melting temperatures were determined by monitoring the fluorescence of donor-acceptor dual-labelled oligonucleotides at various temperatures. An empirical model that estimates the methylation-induced variations in the standard values of hybridization entropy and enthalpy was developed. PMID:26354864

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex.

PubMed

McHugh, Thomas; Beckley, Lila; Sullivan, Terry; Lutes, Chris; Truesdale, Robert; Uppencamp, Rob; Cosky, Brian; Zimmerman, John; Schumacher, Brian

2017-11-15

The role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into the duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. These test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope. Copyright © 2017 Elsevier B.V. All rights reserved.

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex

DOE PAGES

McHugh, Thomas; Beckley, Lila; Sullivan, Terry; ...

2017-04-26

We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex

DOE Office of Scientific and Technical Information (OSTI.GOV)

McHugh, Thomas; Beckley, Lila; Sullivan, Terry

We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less

Synthesis, base pairing and structure studies of geranylated RNA

PubMed Central

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-01-01

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

PubMed Central

Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

1987-01-01

We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

Multistory duplexes with forward dipping roofs, north central Brooks Range, Alaska

USGS Publications Warehouse

Wallace, W.K.; Moore, Thomas E.; Plafker, G.

1997-01-01

The Endicott Mountains allochthon has been thrust far northward over the North Slope parautochthon in the northern Brooks Range. Progressively younger units are exposed northward within the allochthon. To the south, the incompetent Hunt Fork Shale has thickened internally by asymmetric folds and thrust faults. Northward, the competent Kanayut Conglomerate forms a duplex between a floor thrust in Hunt Fork and a roof thrust in the Kayak Shale. To the north, the competent Lisburne Group forms a duplex between a floor thrust in Kayak and a roof thrust in the Siksikpuk Formation. Both duplexes formed from north vergent detachment folds whose steep limbs were later truncated by south dipping thrust faults that only locally breach immediately overlying roof thrusts. Within the parautochthon, the Kayak, Lisburne, and Siksikpuk-equivalent Echooka Formation form a duplex identical to that in the allochthon. This duplex is succeeded abruptly northward by detachment folds in Lisburne. These folds are parasitic to an anticlinorium interpreted to reflect a fault-bend folded horse in North Slope "basement," with a roof thrust in Kayak and a floor thrust at depth. These structures constitute two northward tapered, internally deformed wedges that are juxtaposed at the base of the allochthon. Within each wedge, competent units have been shortened independently between detachments, located mainly in incompetent units. The basal detachment of each wedge cuts upsection forward (northward) to define a wedge geometry within which units dip regionally forward. These dips reflect forward decrease in internal structural thickening by forward vergent folds and hindward dipping thrust faults. Copyright 1997 by the American Geophysical Union.

Circularly polarized luminescence of helically assembled pyrene π-stacks on RNA and DNA duplexes.

PubMed

Nakamura, Mitsunobu; Ota, Fuyuki; Takada, Tadao; Akagi, Kazuo; Yamana, Kazushige

2018-05-01

In this report, we describe the circularly polarized luminescence (CPL) of the RNA duplexes having one to four 2'-O-pyrene modified uridines (Upy) and the DNA duplexes having two, four, and six pyrene modified non-nucleosidic linkers (Py). Both the pyrene π-stack arrays formed on the RNA and DNA double helical structures exhibited pyrene excimer fluorescence. In the pyrene-modified RNA systems, the RNA duplex having four Upys gives CPL emission with g lum value of <0.01 at 480 nm. The structure of pyrene stacks on the RNA duplex may be rigidly regulated with increase in the Upy domains, which resulted in the CPL emission. In the DNA systems, the pyrene-modified duplexes containing two and four Pys exhibited CPL emission with g lum values of <0.001 at 505 nm. The pyrene π-stack arrays presented here show CPL emission. However, the g lum values are relatively small when compared with our previous system consisting of the pyrene-zipper arrays on RNA. © 2018 Wiley Periodicals, Inc.

Duplex development and abandonment during evolution of the Lewis thrust system, southern Glacier National Park, Montana

NASA Astrophysics Data System (ADS)

Yin, An; Kelty, Thomas K.; Davis, Gregory A.

1989-09-01

Geologic mapping in southern Glacier National Park, Montana, reveals the presence of two duplexes sharing the same floor thrust fault, the Lewis thrust. The westernmost duplex (Brave Dog Mountain) includes the low-angle Brave Dog roof fault and Elk Mountain imbricate system, and the easternmost (Rising Wolf Mountain) duplex includes the low-angle Rockwell roof fault and Mt. Henry imbricate system. The geometry of these duplexes suggests that they differ from previously described geometric-kinematic models for duplex development. Their low-angle roof faults were preexisting structures that were locally utilized as roof faults during the formation of the imbricate systems. Crosscutting of the Brave Dog fault by the Mt. Henry imbricate system indicates that the two duplexes formed at different times. The younger Rockwell-Mt. Henry duplex developed 20 km east of the older Brave Dog-Elk Mountain duplex; the roof fault of the former is at a higher structural level. Field relations confirm that the low-angle Rockwell fault existed across the southern Glacier Park area prior to localized formation of the Mt. Henry imbricate thrusts beneath it. These thrusts kinematically link the Rockwell and Lewis faults and may be analogous to P shears that form between two synchronously active faults bounding a simple shear system. The abandonment of one duplex and its replacement by another with a new and higher roof fault may have been caused by (1) warping of the older and lower Brave Dog roof fault during the formation of the imbricate system (Elk Mountain) beneath it, (2) an upward shifting of the highest level of a simple shear system in the Lewis plate to a new decollement level in subhorizontal belt strata (= the Rockwell fault) that lay above inclined strata within the first duplex, and (3) a reinitiation of P-shear development (= Mt. Henry imbricate faults) between the Lewis thrust and the subparallel, synkinematic Rockwell fault.

Solution structure of a modified 2′,5′-linked RNA hairpin involved in an equilibrium with duplex

PubMed Central

Plevnik, Miha; Gdaniec, Zofia; Plavec, Janez

2005-01-01

The isomerization of phosphodiester functionality of nucleic acids from 3′,5′- to a less common 2′,5′-linkage influences the complex interplay of stereoelectronic effects that drive pseudorotational equilibrium of sugar rings and thus affect the conformational propensities for compact or more extended structures. The present study highlights the subtle balance of non-covalent forces at play in structural equilibrium of 2′,5′-linked RNA analogue, 3′-O-(2-methoxyethyl) substituted dodecamer *CG*CGAA*U*U*CG*CG, 3′-MOE-2′,5′-RNA, where all cytosines and uracils are methylated at C5. The NMR and UV spectroscopic studies have shown that 3′-MOE-2′,5′-RNA adopts both hairpin and duplex secondary structures, which are involved in a dynamic exchange that is slow on the NMR timescale and exhibits strand and salt concentration as well as pH dependence. Unusual effect of pH over a narrow physiological range is observed for imino proton resonances with exchange broadening observed at lower pH and relatively sharp lines observed at higher pH. The solution structure of 3′-MOE-2′,5′-RNA hairpin displays a unique and well-defined loop, which is stabilized by Watson–Crick A5·*U8 base pair and by n → π* stacking interactions of O4′ lone-pair electrons of A6 and *U8 with aromatic rings of A5 and *U7, respectively. In contrast, the stem region of 3′-MOE-2′,5′-RNA hairpin is more flexible. Our data highlight the important feature of backbone modifications that can have pronounced effects on interstrand association of nucleic acids. PMID:15788747

Assessing the effect of different operation techniques on postoperative duplex ultrasound quality after carotid endarterectomy.

PubMed

Grambow, E; Heller, T; Wieneke, P; Weiß, C; Klar, E; Weinrich, M

2018-01-01

Duplex ultrasound is the first choice in diagnostics and surveillance of stenoses of the internal carotid arteries before and even after surgery. Therefore, the quality of duplex ultrasound is crucial to investigate these vascular pathologies. Aim of this study was the evaluation whether different surgical techniques affect the postoperative quality of duplex ultrasound. In a time period from January to May 2015 duplex ultrasound of the cervical vessels was performed in 75 patients after unilateral endarterectomy of the internal carotid artery at our department between 2006 and 2012. Thereby, the non-operated contralateral side served as a control. Study groups were defined by the surgical techniques of eversion- or thrombendarterectomy with patch plasty using different patch materials and/or a haemostatic sealant. Duplex ultrasound analysis included acoustic impedance, extinction of ultrasound, thickness of skin and individual anatomic aspects of the patients. Carotid endarterectomy itself reduced intravascular grey levels, skin thickness and increased extinction of duplex ultrasound when compared to the non-operated side of the neck. In contrast, neither the kind of chosen operative technique nor the use of different patch materials or the application of a haemostatic sealant showed an effect in this regards. Whereas carotid endarterectomy per se worsens the quality of postoperative duplex ultrasound, the different analysed surgical techniques as well as used patches and the application of a haemostatic sealant can be assumed to be equal regarding the quality of postoperative ultrasound.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Compact, precision duplex bearing mount for high vibration environments

NASA Technical Reports Server (NTRS)

Bouzakis, George Elias (Inventor); Bowman, James Edward (Inventor); Devine, Edward J. (Inventor); Joffe, Benjamin (Inventor); Segal, Kenneth Neal (Inventor); Webb, Merritt J. (Inventor)

2002-01-01

A duplex bearing mount including at least one duplex bearing having an inner race and an outer race, the inner race disposed within the outer race and being rotatable relative to the outer race about an axis, the inner race having substantially no relative movement relative to the outer race in at least one direction along the axis, the inner and outer races each having first and second axial faces which are respectively located at the same axial end of the duplex bearing. The duplex bearing is radially supported by a housing, and a shaft extends through the inner race, the shaft radially and axially supported by the inner race. A first retainer is connected to the housing and engages the first axial surface of a bearing race, the movement of which race in a first direction along the axis being constrained by the first retainer. A second, resilient retainer is connected to the housing or the shaft and is deflected through engagement with the second axial face of a bearing race, the movement of which race in a second direction along the axis, opposite to the first direction, being constrained by the deflected second retainer. The bearing is preloaded by its being clamped between the first and second retainers, and the second retainer forms at least a portion of a spring having the characteristic of a substantially constant force value correlating to a range of various deflection values, whereby the preload of the bearing is substantially unaffected by variations in the deflection of the second retainer.

Validation of a novel duplex ultrasound objective structured assessment of technical skills (DUOSATS) for arterial stenosis detection.

PubMed

Jaffer, U; Singh, P; Pandey, V A; Aslam, M; Standfield, N J

2014-01-01

Duplex ultrasound facilitates bedside diagnosis and hence timely patient care. Its uptake has been hampered by training and accreditation issues. We have developed an assessment tool for Duplex arterial stenosis measurement for both simulator and patient based training. A novel assessment tool: duplex ultrasound assessment of technical skills was developed. A modified duplex ultrasound assessment of technical skills was used for simulator training. Novice, intermediate experience and expert users of duplex ultrasound were invited to participate. Participants viewed an instructional video and were allowed ample time to familiarize with the equipment. Participants' attempts were recorded and independently assessed by four experts using the modified duplex ultrasound assessment of technical skills. 'Global' assessment was also done on a four point Likert scale. Content, construct and concurrent validity as well as reliability were evaluated. Content and construct validity as well as reliability were demonstrated. The simulator had good satisfaction rating from participants: median 4; range 3-5. Receiver operator characteristic analysis has established a cut point of 22/ 34 and 25/ 40 were most appropriate for simulator and patient based assessment respectively. We have validated a novel assessment tool for duplex arterial stenosis detection. Further work is underway to establish transference validity of simulator training to improved skill in scanning patients. We have developed and validated duplex ultrasound assessment of technical skills for simulator training.

Full Duplex, Spread Spectrum Radio System

NASA Technical Reports Server (NTRS)

Harvey, Bruce A.

2000-01-01

The goal of this project was to support the development of a full duplex, spread spectrum voice communications system. The assembly and testing of a prototype system consisting of a Harris PRISM spread spectrum radio, a TMS320C54x signal processing development board and a Zilog Z80180 microprocessor was underway at the start of this project. The efforts under this project were the development of multiple access schemes, analysis of full duplex voice feedback delays, and the development and analysis of forward error correction (FEC) algorithms. The multiple access analysis involved the selection between code division multiple access (CDMA), frequency division multiple access (FDMA) and time division multiple access (TDMA). Full duplex voice feedback analysis involved the analysis of packet size and delays associated with full loop voice feedback for confirmation of radio system performance. FEC analysis included studies of the performance under the expected burst error scenario with the relatively short packet lengths, and analysis of implementation in the TMS320C54x digital signal processor. When the capabilities and the limitations of the components used were considered, the multiple access scheme chosen was a combination TDMA/FDMA scheme that will provide up to eight users on each of three separate frequencies. Packets to and from each user will consist of 16 samples at a rate of 8,000 samples per second for a total of 2 ms of voice information. The resulting voice feedback delay will therefore be 4 - 6 ms. The most practical FEC algorithm for implementation was a convolutional code with a Viterbi decoder. Interleaving of the bits of each packet will be required to offset the effects of burst errors.

Toward understanding the structural heterogeneity and ion pair stability in dicationic ionic liquids.

PubMed

Li, Song; Bañuelos, José Leobardo; Zhang, Pengfei; Feng, Guang; Dai, Sheng; Rother, Gernot; Cummings, Peter T

2014-12-07

The structural and dynamical properties of dicationic ionic liquids (DILs) [Cn(mim)2](Tf2N)2, that is, 3-methylimidazolium dications separated by an alkyl chain and with bis(trifluoromethylsulfonyl)amide as the anion, were investigated by molecular dynamics (MD) simulation in combination with small/wide-angle X-ray scattering (SWAXS) measurements. Enhanced spatial heterogeneity is observed as the DIL chain length is increased, characterized by the changes in the scattering and the increased heterogeneity order parameter (HOP). Temperature variation imposes only slight influences on the local structures of DILs compared to monocationic ionic liquids (MILs). The peaks at 0.9 Å(-1) and 1.4 Å(-1) of the structure function shift towards low Q as the temperature increases, in a similar manner to MILs, and changes in peak positions in response to temperature changes are reflected in HOP variations. However, the prepeak shift with increasing temperature is ∼3 times smaller in DILs compared to MILs, and both MD and SWAXS indicate a DIL-specific prepeak shifting. Furthermore, the high ion pair/ion cage stability in DILs is indicative of high thermal stability and relative insensitivity of structural heterogeneity to temperature variation, which might be caused by the stronger Coulombic interactions in DILs.

The Dewar photoproduct of thymidylyl(3′→5′)- thymidine (Dewar product) exhibits mutagenic behavior in accordance with the “A rule”

PubMed Central

Lee, Joon-Hwa; Bae, Sung-Hun; Choi, Byong-Seok

2000-01-01

In contrast to the highly mutagenic pyrimidine(6–4)pyrimidone photoproduct, its Dewar valence isomer (Dewar product) has low mutagenic potential and produces a broad range of mutations [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the mutagenic property of the Dewar product, we used experimental NMR restraints and molecular dynamics to determine the solution structure of a Dewar-lesion DNA decamer duplex. This DNA decamer duplex (DW/GA duplex) contains a mismatched base pair between the 3′ T residue of the Dewar lesion (T6) and an opposed G residue (G15). The 3′ T (T6) of the Dewar lesion formed stable hydrogen bonds with the opposing G15 residue. However, the helical bending and unwinding angles of the DW/GA duplex were much larger than those of a second duplex that contains the Dewar lesion and opposing A15 and A16 residues (DW/AA duplex). The DW/GA duplex showed poorer stacking interactions at the two bases of the Dewar product and at the adjacent A7⋅T14 base pair than did the DW/AA duplex. These structural features imply that no thermal stability or conformational benefit is obtained by incorporating a G instead of an A opposite the 3′ T of the Dewar lesion. These properties may thus facilitate the preferential incorporation of an A in accordance with the A rule during translesion replication and lead to the low frequency of 3′ T→C mutations observed at this site. PMID:10758155

Effect of ultrafine grain on tensile behaviour and corrosion resistance of the duplex stainless steel.

PubMed

Jinlong, Lv; Tongxiang, Liang; Chen, Wang; Limin, Dong

2016-05-01

The ultrafine grained 2205 duplex stainless steel was obtained by cold rolling and annealing. The tensile properties were investigated at room temperature. Comparing with coarse grained stainless steel, ultrafine grained sample showed higher strength and plasticity. In addition, grain size changed deformation orientation. The strain induced α'-martensite was observed in coarse grained 2205 duplex stainless steel with large strain. However, the grain refinement inhibited the transformation of α'-martensite;nevertheless, more deformation twins improved the strength and plasticity of ultrafine grained 2205 duplex stainless steel. In addition, the grain refinement improved corrosion resistance of the 2205 duplex stainless steel in sodium chloride solution. Copyright © 2016 Elsevier B.V. All rights reserved.

Preoperative Duplex Scanning is a Helpful Diagnostic Tool in Neurogenic Thoracic Outlet Syndrome.

PubMed

Orlando, Megan S; Likes, Kendall C; Mirza, Serene; Cao, Yue; Cohen, Anne; Lum, Ying Wei; Freischlag, Julie A

2016-01-01

To evaluate the diagnostic role of venous and arterial duplex scanning in neurogenic thoracic outlet syndrome (NTOS). Retrospective review of patients who underwent duplex ultrasonography prior to first rib resection and scalenectomy (FRRS) for NTOS from 2005 to 2013. Abnormal scans included ipsilateral compression (IC) with abduction of the symptomatic extremity (>50% change in subclavian vessel flow), contralateral (asymptomatic side) compression (CC) or bilateral compression (BC). A total of 143 patients (76% female, average age 34, range 13-59) underwent bilateral preoperative duplex scanning. Ipsilateral compression was seen in 44 (31%), CC in 12 (8%), and BC in 14 (10%). Seventy-three (51%) patients demonstrated no compression. Patients with IC more often experienced intraoperative pneumothoraces (49% vs. 25%, P < .05) and had positive Adson tests (86% vs. 61%, P < .02). Compression of the subclavian vein or artery on duplex ultrasonography can assist in NTOS diagnosis. Ipsilateral compression on abduction often correlates with Adson testing. © The Author(s) 2016.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

NASA Astrophysics Data System (ADS)

Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

2005-09-01

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

PubMed

Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

2005-09-22

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

PubMed Central

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

PubMed

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Excited-State Dynamics of a DNA Duplex in a Deep Eutectic Solvent Probed by Femtosecond Time-Resolved IR Spectroscopy.

PubMed

de La Harpe, Kimberly; Kohl, Forrest R; Zhang, Yuyuan; Kohler, Bern

2018-03-08

To better understand how the solvent influences excited-state deactivation in DNA strands, femtosecond time-resolved IR (fs-TRIR) pump-probe measurements were performed on a d(AT) 9 ·d(AT) 9 duplex dissolved in a deep eutectic solvent (DES) made from choline chloride and ethylene glycol in a 1:2 mol ratio. This solvent, known as ethaline, is a member of a class of ionic liquids capable of solubilizing DNA with minimal disruption to its secondary structure. UV melting analysis reveals that the duplex studied here melts at 18 °C in ethaline compared to 50 °C in aqueous solution. Ethaline has an excellent transparency window that facilitates TRIR measurements in the double-bond stretching region. Transient spectra recorded in deuterated ethaline at room temperature indicate that photoinduced intrastrand charge transfer occurs from A to T, yielding the same exciplex state previously detected in aqueous solution. This state decays via charge recombination with a lifetime of 380 ± 10 ps compared to the 300 ± 10 ps lifetime measured earlier in D 2 O solution. The TRIR data strongly suggest that the long-lived exciplex forms exclusively in the solvated duplex, and not in the denatured single strands, which appear to have little, if any, base stacking. The longer lifetime of the exciplex state in the DES compared to aqueous solution is suggested to arise from reduced stabilization of the charge transfer state, resulting in slower charge recombination on account of Marcus inverted behavior.

A Synchronous Digital Duplexing Technique for OFDMA-Based Indoor Communications

NASA Astrophysics Data System (ADS)

Park, Chang-Hwan; Ko, Yo-Han; Kim, Yeong-Jun; Park, Kyung-Won; Jeon, Won-Gi; Paik, Jong-Ho; Lee, Seok-Pil; Cho, Yong-Soo

In this paper, we propose a new digital duplexing scheme, called synchronous digital duplexing (SDD), which can increase data efficiency and flexibility of resource by transmitting uplink signal and downlink signal simultaneously in wireless communication. In order to transmit uplink and downlink signals simultaneously, the proposed SDD obtains mutual information among subscriber stations (SSs) with a mutual ranging symbol. This information is used for selection of transmission time, decision on cyclic suffix (CS) insertion, determination of CS length, and re-establishment of FFT starting point.

Follow-up of renal and mesenteric artery revascularization with duplex ultrasonography

PubMed Central

Taylor, David C.; Houston, Gordon T.M.; Anderson, Caroline; Jameson, Margot; Popatia, Shelley

1996-01-01

Objective To evaluate the long-term anatomic results of renal revascularization procedures using duplex ultrasonography. Design A case series. Setting A university-affiliated hospital. Patients Twenty-five patients who had undergone renal percutaneous transluminal angioplasty (PTA) (18 arteries), renal bypass (10 arteries) and mesenteric bypass (6 arteries). The mean follow-up was 22 months (range from 3 to 48 months) for those who underwent renal PTA, 23 months (range from 1.5 to 70 months) for those who underwent renal bypass and 34 months (range from 8 to 144 months) for those who underwent mesenteric bypass. Main Outcome Measures Patency rates for the three procedures as assessed by duplex ultrasonography. Results Duplex ultrasonography demonstrated patency without stenosis after renal and mesenteric artery revascularization in 14 arteries subjected to renal PTA, 9 arteries subjected to renal bypass and 6 arteries subjected to mesenteric bypass. Three arteries that had renal PTA had recurrent vessel stenosis and one had occlusion. One artery that had renal bypass showed occlusion. Conclusions Renal PTA, renal bypass and mesenteric bypass are durable procedures at 2 years of follow-up, and duplex ultrasonography is a valuable method for assessing the patency of arteries after renal and mesenteric revascularization. PMID:8599785

Effects of chitosan inhibitor on the electrochemical corrosion behavior of 2205 duplex stainless steel

NASA Astrophysics Data System (ADS)

Yang, Se-fei; Wen, Ying; Yi, Pan; Xiao, Kui; Dong, Chao-fang

2017-11-01

The effects of chitosan inhibitor on the corrosion behavior of 2205 duplex stainless steel were studied by electrochemical measurements, immersion tests, and stereology microscopy. The influences of immersion time, temperature, and chitosan concentration on the corrosion inhibition performance of chitosan were investigated. The optimum parameters of water-soluble chitosan on the corrosion inhibition performance of 2205 duplex stainless steel were also determined. The water-soluble chitosan showed excellent corrosion inhibition performance on the 2205 duplex stainless steel. Polarization curves demonstrated that chitosan acted as a mixed-type inhibitor. When the stainless steel specimen was immersed in the 0.2 g/L chitosan solution for 4 h, a dense and uniform adsorption film covered the sample surface and the inhibition efficiency (IE) reached its maximum value. Moreover, temperature was found to strongly influence the corrosion inhibition of chitosan; the inhibition efficiency gradually decreased with increasing temperature. The 2205 duplex stainless steel specimen immersed in 0.4 g/L water-soluble chitosan at 30°C displayed the best corrosion inhibition among the investigated specimens. Moreover, chitosan decreased the corrosion rate of the 2205 duplex stainless steel in an FeCl3 solution.

'Passive-roof' duplex geometry in the frontal structures of the Kirthar and Sulaiman mountain belts, Pakistan

NASA Astrophysics Data System (ADS)

Banks, C. J.; Warburton, J.

Exploration for hydrocarbons over the past few years has greatly improved our understanding of the geometry of frontal mountain belt structures. In this study we introduce and discuss the concept of the 'Passive-roof duplex', using as the main example the Kirthar and Sulaiman Ranges in the Baluchistan Province of Pakistan. Structures similar to those described here have been recognized previously in other mountain belts, and they appear to exist as a common feature in many more frontal regions of mountain belts. Our example of a Passive-roof duplex which we describe from Pakistan is compared briefly with similar structures reported by others. The Passive-roof duplex is here defined as a duplex whose roof thrust has backthrust sense ( Passive-roof thrust) and whose roof sequence (those rocks lying above the roof thrust) remains relatively 'stationary' during foreland directed piggy-back style propagation of horses within the duplex.

Synthesis, base pairing and structure studies of geranylated RNA.

PubMed

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-07-27

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Color-coded duplex sonography for diagnosis of testicular torsion.

PubMed

Zoeller, G; Ringert, R H

1991-11-01

By color-coded duplex sonography moving structures are visualized as red or blue colors within a normal gray-scale B-mode ultrasound image. Thus, blood flow even within small vessels can be visualized clearly. Color-coded duplex sonographic examination was performed in 11 patients who presented with scrotal pain. This method proved to be reliable to differentiate between testicular torsion and testicular inflammation. By clearly demonstrating a lack of intratesticular blood flow in testicular torsion, while avoiding flow in scrotal skin vessels being misinterpreted as intratesticular blood flow, this method significantly decreases the number of patients in whom surgical evaluation is necessary to exclude testicular torsion.

Surgical retroperitoneoscopic and transperitoneoscopic access in varicocelectomy: duplex scan results in pediatric population.

PubMed

Mancini, Stefano; Bulotta, Anna Lavinia; Molinaro, Francesco; Ferrara, Francesco; Tommasino, Giulio; Messina, Mario

2014-12-01

This is a retrospective study to compare duplex scan results of laparoscopic Palomo's technique through retroperitoneal and transperitoneal approach for varicocelectomy in children. We statistically analyzed recurrence, testicular volume growth and complications. Surgical intervention was performed utilizing transperitoneoscopic (group A) or retroperitoneoscopic access (group B). Duplex scan control was performed after 12 months (T1), after 2 years (T2) and the last one at 18 years old in most patients. Statistical analysis was performed using the t-test for parametric data. Differences in proportions were evaluated using χ2 or Fisher's exact test. We treated 120 children (age range 10-17 years) who presented an asymptomatic IV grade of reflux, Coolsaet 1, associated with a left testicular hypotrophy in 36.6% of the cases (44 patients). No post-operative complications were verified. Duplex scan exam showed an increase of left testicular growth in both groups, with complete hypotrophy disappear in patients in both groups after 24 months. Hydrocele, diagnosed clinically and confirmed with duplex scan, was the most frequent post-operative complication (22/120 cases; 18.3%). This study showed the importance of duplex scan at all steps of this vascular pathology in children, and that there is no significantly difference in results between the two surgical techniques except for hydrocele in transperitoneoscopic access. Copyright © 2014 Journal of Pediatric Urology Company. Published by Elsevier Ltd. All rights reserved.

Stable loop in the crystal structure of the intercalated four-stranded cytosine-rich metazoan telomere

NASA Technical Reports Server (NTRS)

Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.

1995-01-01

In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.

Duplex Design Project: Science Pilot Test.

ERIC Educational Resources Information Center

Center for Research on Evaluation, Standards, and Student Testing, Los Angeles, CA.

Work is reported towards the completion of a prototype duplex-design assessment instrument for grade-12 science. The student course-background questionnaire and the pretest section of the two-stage instrument that was developed were administered to all 134 12th-grade students at St. Clairsville High School (Ohio). Based on the information obtained…

Solution structure of a DNA decamer duplex containing the stable 3′ T⋅G base pair of the pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct]: Implications for the highly specific 3′ T → C transition of the (6–4) adduct

PubMed Central

Lee, Joon-Hwa; Hwang, Geum-Sook; Choi, Byong-Seok

1999-01-01

The pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct] is one of the major photoproducts induced by UV irradiation of DNA and occurs at TpT sites. The (6–4) adduct is highly mutagenic and leads most often to a 3′ T → C transition with 85% replicating error frequency [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the specific 3′ T → C transition of the (6–4) adduct, we have used experimental NMR restraints and molecular dynamics to determine the solution structure of a (6–4)-lesion DNA decamer duplex that contains a mismatched base pair between the 3′ T residue and an opposed G residue. Normal Watson–Crick-type hydrogen bonding is retained at the 5′ T of the lesion site. The O2 carbonyl of the 3′ T residue forms hydrogen bonds with the imino and amino protons of the opposed G residue. This potential hydrogen bonding stabilizes the overall helix and restores the highly distorted conformation of the (6–4) adduct to the typical B-form-like DNA structure. This structural feature can explain the marked preference for the insertion of an A residue opposite the 5′ T and a G residue opposite the 3′ T of the (6–4) lesion during trans-lesion synthesis. Thus these insertions yield the predominant 3′ T → C transition. PMID:10359763

Molecular architecture: construction of self-assembled organophosphonate duplexes and their electrochemical characterization.

PubMed

Cattani-Scholz, Anna; Liao, Kung-Ching; Bora, Achyut; Pathak, Anshuma; Hundschell, Christian; Nickel, Bert; Schwartz, Jeffrey; Abstreiter, Gerhard; Tornow, Marc

2012-05-22

Self-assembled monolayers of phosphonates (SAMPs) of 11-hydroxyundecylphosphonic acid, 2,6-diphosphonoanthracene, 9,10-diphenyl-2,6-diphosphonoanthracene, and 10,10'-diphosphono-9,9'-bianthracene and a novel self-assembled organophosphonate duplex ensemble were synthesized on nanometer-thick SiO(2)-coated, highly doped silicon electrodes. The duplex ensemble was synthesized by first treating the SAMP prepared from an aromatic diphosphonic acid to form a titanium complex-terminated one; this was followed by addition of a second equivalent of the aromatic diphosphonic acid. SAMP homogeneity, roughness, and thickness were evaluated by AFM; SAMP film thickness and the structural contributions of each unit in the duplex were measured by X-ray reflection (XRR). The duplex was compared with the aliphatic and aromatic monolayer SAMPs to determine the effect of stacking on electrochemical properties; these were measured by impedance spectroscopy using aqueous electrolytes in the frequency range 20 Hz to 100 kHz, and data were analyzed using resistance-capacitance network based equivalent circuits. For the 11-hydroxyundecylphosphonate SAMP, C(SAMP) = 2.6 ± 0.2 μF/cm(2), consistent with its measured layer thickness (ca. 1.1 nm). For the anthracene-based SAMPs, C(SAMP) = 6-10 μF/cm(2), which is attributed primarily to a higher effective dielectric constant for the aromatic moieties (ε = 5-10) compared to the aliphatic one; impedance spectroscopy measured the additional capacitance of the second aromatic monolayer in the duplex (2ndSAMP) to be C(Ti/2ndSAMP) = 6.8 ± 0.7 μF/cm(2), in series with the first.

Synthesis Structure and Imaging of Oligodeoxyribonucleotides with Tellurium-nucleobase Derivatization

DOE Office of Scientific and Technical Information (OSTI.GOV)

J Sheng; A Hassan; W Zhang

2011-12-31

We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less

Synthesis, structure and imaging of oligodeoxyribonucleotides with tellurium-nucleobase derivatization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, J.; Soares, A.; Hassan, A. E. A.

2011-05-01

We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less

Synthesis, structure and imaging of oligodeoxyribonucleotides with tellurium-nucleobase derivatization

PubMed Central

Sheng, Jia; Hassan, Abdalla E. A.; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S.; Huang, Zhen

2011-01-01

We report here the first synthesis of 5-phenyl–telluride–thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. PMID:21245037

Internal Carotid Artery Hypoplasia: Role of Color-Coded Carotid Duplex Sonography.

PubMed

Chen, Pei-Ya; Liu, Hung-Yu; Lim, Kun-Eng; Lin, Shinn-Kuang

2015-10-01

The purpose of this study was to determine the role of color-coded carotid duplex sonography for diagnosis of internal carotid artery hypoplasia. We retrospectively reviewed 25,000 color-coded carotid duplex sonograms in our neurosonographic database to establish more diagnostic criteria for internal carotid artery hypoplasia. A definitive diagnosis of internal carotid artery hypoplasia was made in 9 patients. Diagnostic findings on color-coded carotid duplex imaging include a long segmental small-caliber lumen (52% diameter) with markedly decreased flow (13% flow volume) in the affected internal carotid artery relative to the contralateral side but without intraluminal lesions. Indirect findings included markedly increased total flow volume (an increase of 133%) in both vertebral arteries, antegrade ipsilateral ophthalmic arterial flow, and a reduced vessel diameter with increased flow resistance in the ipsilateral common carotid artery. Ten patients with distal internal carotid artery dissection showed a similar color-coded duplex pattern, but the reductions in the internal and common carotid artery diameters and increase in collateral flow from the vertebral artery were less prominent than those in hypoplasia. The ipsilateral ophthalmic arterial flow was retrograde in 40% of patients with distal internal carotid artery dissection. In addition, thin-section axial and sagittal computed tomograms of the skull base could show the small diameter of the carotid canal in internal carotid artery hypoplasia and help distinguish hypoplasia from distal internal carotid artery dissection. Color-coded carotid duplex sonography provides important clues for establishing a diagnosis of internal carotid artery hypoplasia. A hypoplastic carotid canal can be shown by thin-section axial and sagittal skull base computed tomography to confirm the final diagnosis. © 2015 by the American Institute of Ultrasound in Medicine.

Development and properties of duplex MgF2/PCL coatings on biodegradable magnesium alloy for biomedical applications.

PubMed

Makkar, Preeti; Kang, Hoe Jin; Padalhin, Andrew R; Park, Ihho; Moon, Byoung-Gi; Lee, Byong Taek

2018-01-01

The present work addresses the performance of polycaprolactone (PCL) coating on fluoride treated (MgF2) biodegradable ZK60 magnesium alloy (Mg) for biomedical application. MgF2 conversion layer was first produced by immersing Mg alloy substrate in hydrofluoric acid solution. The outer PCL coating was then prepared using dip coating technique. Morphology, elements profile, phase structure, roughness, mechanical properties, invitro corrosion, and biocompatibility of duplex MgF2/PCL coating were then characterized and compared to those of fluoride coated and uncoated Mg samples. The invivo degradation behavior and biocompatibility of duplex MgF2/PCL coating with respect to ZK60 Mg alloy were also studied using rabbit model for 2 weeks. SEM and TEM analysis showed that the duplex coating was uniform and comprised of porous PCL film (~3.3 μm) as upper layer with compact MgF2 (~2.2 μm) as inner layer. No significant change in microhardness was found on duplex coating compared with uncoated ZK60 Mg alloy. The duplex coating showed improved invitro corrosion resistance than single layered MgF2 or uncoated alloy samples. The duplex coating also resulted in better cell viability, cell adhesion, and cell proliferation compared to fluoride coated or uncoated alloy. Preliminary invivo studies indicated that duplex MgF2/PCL coating reduced the degradation rate of ZK60 Mg alloy and exhibited good biocompatibility. These results suggested that duplex MgF2/PCL coating on magnesium alloy might have great potential for orthopedic applications.

Development and properties of duplex MgF2/PCL coatings on biodegradable magnesium alloy for biomedical applications

PubMed Central

Makkar, Preeti; Kang, Hoe Jin; Padalhin, Andrew R.; Park, Ihho; Moon, Byoung-Gi

2018-01-01

The present work addresses the performance of polycaprolactone (PCL) coating on fluoride treated (MgF2) biodegradable ZK60 magnesium alloy (Mg) for biomedical application. MgF2 conversion layer was first produced by immersing Mg alloy substrate in hydrofluoric acid solution. The outer PCL coating was then prepared using dip coating technique. Morphology, elements profile, phase structure, roughness, mechanical properties, invitro corrosion, and biocompatibility of duplex MgF2/PCL coating were then characterized and compared to those of fluoride coated and uncoated Mg samples. The invivo degradation behavior and biocompatibility of duplex MgF2/PCL coating with respect to ZK60 Mg alloy were also studied using rabbit model for 2 weeks. SEM and TEM analysis showed that the duplex coating was uniform and comprised of porous PCL film (~3.3 μm) as upper layer with compact MgF2 (~2.2 μm) as inner layer. No significant change in microhardness was found on duplex coating compared with uncoated ZK60 Mg alloy. The duplex coating showed improved invitro corrosion resistance than single layered MgF2 or uncoated alloy samples. The duplex coating also resulted in better cell viability, cell adhesion, and cell proliferation compared to fluoride coated or uncoated alloy. Preliminary invivo studies indicated that duplex MgF2/PCL coating reduced the degradation rate of ZK60 Mg alloy and exhibited good biocompatibility. These results suggested that duplex MgF2/PCL coating on magnesium alloy might have great potential for orthopedic applications. PMID:29608572

Low cost high temperature, duplex coating for superalloys

NASA Technical Reports Server (NTRS)

Young, S. G.; Deadmore, D. L.

1981-01-01

Duplex silicon-slurry/aluminide coating substantially improves high temperature resistance to oxidation and corrosion of nickel base alloys. Coating used in critical sections of power systems like turbojet engines extends their operating capabilities.

Duplex System with Ectopic Ureter Opens into the Posterior Urethra: Case Report.

PubMed

Milicevic, Snjezana; Bijelic, Radojka; Krivokuca, Vladimir; Jakovljevic, Branislava

2018-04-01

Duplicated ureter or Duplex Collecting System is a congenital condition in which the ureteric bud, the embryological origin of the ureter, arises twice, resulting in two ureters draining a single kidney. This congenital anomaly is rare, and even rarer when the duplex system with ectopic ureter is present. This type of congenital anomaly is even more rarely diagnosed and surgically treated in adulthood. This case report presents a case of a 32-year-old male, who had a duplex collecting system with two ureters on the left side. Ectopic ureter, draining the upper pole of the left kidney, opened into the posterior urethra. In our patient, taking into account the clinical perspective, the renal tissue damaging of the upper pole which was not functional, partial nephrectomy and ureterectomy was successfully performed.

Duplex investigations in children: Are clinical signs in children with venous disorders relevant?

PubMed

Birgitte Maessen-Visch, M; Smeets, L; van Vleuten, C

2015-12-01

Ultra sound colored duplex sonography is the preferred method in diagnosing chronic venous disease. Data in children on incidence, indications, and results are lacking. From the total of 9180 duplex investigations performed in our hospital from 2009 to 2012, data on indication and results of the investigation as well as patient characteristics were evaluated retrospectively for the proportion of pediatric patients. Duplex investigations were performed 49 times in 38 children (6-18 years), with an average of 1.3 times (1-6 times) per child. Forty percent showed abnormalities: 17 times deep venous thrombosis was suspected; deep venous thrombosis was objectified in 18%. In the 21 investigations performed for varicosis-related complaints, varicose veins or venous malformations were objectified in 57%. Edema was never a symptom of chronic venous disease. Duplex investigation is not often performed in children. In children with established deep venous thrombosis, a family history with deep venous thrombosis is common. In general, edema was not seen in children with varicose veins and, therefore, does not seem a reliable clinical sign at young age. © The Author(s) 2014.

The minute virus of mice (MVM) nonstructural protein NS1 induces nicking of MVM DNA at a unique site of the right-end telomere in both hairpin and duplex conformations in vitro.

PubMed

Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J

1997-10-01

The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).

Wobble pairs of the HDV ribozyme play specific roles in stabilization of active site dynamics.

PubMed

Sripathi, Kamali N; Banáš, Pavel; Réblová, Kamila; Šponer, Jiří; Otyepka, Michal; Walter, Nils G

2015-02-28

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5') hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5') general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5') hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs.

Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

PubMed Central

Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

2015-01-01

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

Development of nano-structured duplex and ferritic stainless steels by pulverisette planetary milling followed by pressureless sintering

DOE Office of Scientific and Technical Information (OSTI.GOV)

R, Shashanka, E-mail: shashankaic@gmail.com; Chaira, D., E-mail: chaira.debasis@gmail.com

Nano-structured duplex and ferritic stainless steel powders are prepared by planetary milling of elemental Fe, Cr and Ni powder for 40 h and then consolidated by conventional pressureless sintering. The progress of milling and the continuous refinement of stainless steel powders have been confirmed by means of X-ray diffraction and scanning electron microscopy. Activation energy for the formation of duplex and ferritic stainless steels is calculated by Kissinger method using differential scanning calorimetry and is found to be 159.24 and 90.17 KJ/mol respectively. Both duplex and ferritic stainless steel powders are consolidated at 1000, 1200 and 1400 °C in argonmore » atmosphere to study microstructure, density and hardness. Maximum sintered density of 90% and Vickers microhardness of 550 HV are achieved for duplex stainless steel sintered at 1400 °C for 1 h. Similarly, 92% sintered density and 263 HV microhardness are achieved for ferritic stainless steel sintered at 1400 °C. - Highlights: • Synthesized duplex and ferritic stainless steels by pulverisette planetary milling • Calculated activation energy for the formation of duplex and ferritic stainless steels • Studied the effect of sintering temperature on density, hardness and microstructure • Duplex stainless steel exhibits 90% sintered density and microhardness of 550 HV. • Ferritic stainless steel shows 92% sintered density and 263 HV microhardness.« less

Tribocorrosion Failure Mechanism of TiN/SiOx Duplex Coating Deposited on AISI304 Stainless Steel.

PubMed

Chen, Qiang; Xie, Zhiwen; Chen, Tian; Gong, Feng

2016-11-26

TiN/SiO x duplex coatings were synthesized on AISI304 stainless steel by plasma immersion ion implantation and deposition (PIIID) followed by radio frequency magnetron sputtering (RFMS). The microstructure and tribocorrosion failure behaviors of the duplex coatings were investigated by X-ray diffraction, X-ray photoelectron spectroscopy, scanning electron microscopy, atomic force microscopy, reciprocating-sliding tribometer, and electrochemical tests. The as-deposited duplex coating had a two-layered columnar growth structure consisting of face-centered cubic TiN and amorphous SiO x . Sliding tests showed that the TiN interlayer had good adhesion with the substrate, but the SiO x layer suffered from severe delamination failure. Friction force induced a number of micro-cracks in the coating, which provided channels for the diffusion of NaCl solution. The tribocorrosion test showed that the duplex coating exhibited a lower wear-performance in NaCl solution than in ambient atmosphere. Multi-scale chloride ion corrosion occurred simultaneously and substantially degraded the bonding strength of the columnar crystals or neighboring layers. Force-corrosion synergy damage eventually led to multi-degradation failure of the duplex coating. The presented results provide a comprehensive understanding of the tribocorrosion failure mechanism in coatings with duplex architecture.

Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

PubMed

Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

2011-07-01

This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

Venous filling time using air-plethysmography correlates highly with great saphenous vein reflux time using duplex.

PubMed

Lattimer, C R; Azzam, M; Kalodiki, E; Geroulakos, G

2014-03-01

Venous filling time (VFT90) is the time taken to reach 90% of the venous volume in the calf. It is recorded by air-plethysmography (APG(®)) and is assumed to measure global venous reflux duration. However, this has never been confirmed by duplex. The aim of the study was to compare VFT on APG to venous reflux time/duration (RT) measured simultaneously with duplex on the same patients. Twenty-six consecutive patients, M:F = 16:10, age (25-78), C1 = 1, C2 = 4, C3 = 8, C4a = 6, C4b = 4, C5 = 2, C6 = 1, underwent simultaneous APG with duplex. The venous filling index (VFI, mL/second), VFT90 (seconds), great saphenous vein (GSV) RT on duplex, averaged thigh GSV diameter and thigh length (length) between the APG sensor air-cuff and duplex transducer were recorded. The VFT100 was calculated by VFT90/0.9. The additional time taken to fill the thigh was achieved using the VFI, length and deep vein diameter (d), to determine the corrected reflux duration: CRD = VFT100 + (length × πd(2)/4 (1/VFI)). Twenty-five patients are presented. One patient with very mild reflux (VFT90 = 55.9 seconds) had an indeterminate endpoint on duplex and was excluded. The median (range) VFI and GSV diameter was 4.9(1.3-15.5) mL/second and 7(4-17) mm, respectively. The VFT90 and VFT100 both correlated with RT on duplex (Spearman, P < 0.0005) at: r = 0.933, r(2) linear = 0.72 and r = 0.933, r(2) linear = 0.68, respectively. The median (interquartile range) filling time with VFT90 was less than the duplex RT at 24 (16.9) versus 28 (20) seconds respectively, P < 0.0005 (Wilcoxon). The median percentage underestimation improved from 24% to 16% and then 4% using the VFT90, VFT100 and CRD, respectively. This is the first study to compare APG parameters with duplex by performing simultaneous measurements. There was an excellent correlation between the VFT90 versus duplex RT, thereby comparing reverse flow in a single superficial vein against the legs overall venous haemodynamic status. These tests can

Investigation of hot cracking resistance of 2205 duplex steel

NASA Astrophysics Data System (ADS)

Adamiec, J.; Ścibisz, B.

2010-02-01

Austenitic duplex steel of the brand 2205 according to Avesta Sheffield is used for welded constructions (pipelines, tanks) in the petrol industry, chemical industry and food industry. It is important to know the range of high-temperature brittleness in designing welding technology for constructions made of this steel type. There is no data in literature concerning this issue. High-temperature brittleness tests using the simulator of heat flow device Gleeble 3800 were performed. The tests results allowed the evaluation of the characteristic temperatures in the brittleness temperature range during the joining of duplex steels, specifically the nil-strength temperature (NST) and nil-ductility temperatures (NDT) during heating, the strength and ductility recovery temperatures (DRT) during cooling, the Rfparameter (Rf = (Tliquidus - NDT)/NDT) describing the duplex steel inclination for hot cracking, and the brittleness temperature range (BTR). It has been stated that, for the examined steel, this range is wide and amounts to ca. 90 °C. The joining of duplex steels with the help of welding techniques creates a significant risk of hot cracks. After analysis of the DTA curves a liquidus temperature of TL = 1465 °C and a solidus temperature of TS = 1454 °C were observed. For NST a mean value was assumed, in which the cracks appeared for six samples; the temperature was 1381 °C. As the value of the NDT temperature 1367 °C was applied while for DRT the assumed temperature was 1375 °C. The microstructure of the fractures was observed using a Hitachi S-3400N scanning electron microscope (SEM). The analyses of the chemical composition were performed using an energy-dispersive X-ray spectrometer (EDS), Noran System Six of Thermo Fisher Scientific. Essential differences of fracture morphology type over the brittle temperature range were observed and described.

The value and economic analysis of routine postoperative carotid duplex ultrasound surveillance after carotid endarterectomy.

PubMed

AbuRahma, Ali F; Srivastava, Mohit; AbuRahma, Zachary; Jackson, Will; Mousa, Albeir; Stone, Patrick A; Dean, L Scott; Green, Jason

2015-08-01

Several studies have reported on the role of postoperative duplex ultrasound surveillance after carotid endarterectomy (CEA) with varying results. Most of these studies had a small sample size or did not analyze cost-effectiveness. We analyzed 489 of 501 CEA patients with patch closure. All patients had immediate postoperative duplex ultrasound examination and were routinely followed up both clinically and with duplex ultrasound at regular intervals of 1 month, 6 months, 12 months, and every 12 months thereafter. A Kaplan-Meier analysis was used to estimate the rate of ≥50% and ≥80% post-CEA restenosis over time and the time frame of progression from normal to ≥50% or ≥80% restenosis. The cost of post-CEA duplex surveillance was also estimated. Overall, 489 patients with a mean age of 68.5 years were analyzed. Ten of these had residual postoperative ≥50% stenosis, and 37 did not undergo a second duplex ultrasound examination and therefore were not included in the final analysis. The mean follow-up was 20.4 months (range, 1-63 months), with a mean number of duplex ultrasound examinations of 3.6 (range, 1-7). Eleven of 397 patients (2.8%) with a normal finding on immediate postoperative duplex ultrasound vs 4 of 45 (8.9%) with mild stenosis on immediate postoperative duplex ultrasound progressed to ≥50% restenosis (P = .055). Overall, 15 patients (3.1%) had ≥50% restenosis, 9 with 50% to <80% and 4 with 80% to 99% (2 of these had carotid artery stenting reintervention), and 2 had late carotid occlusion. All of these were asymptomatic, except for one who had a transient ischemic attack. The mean time to ≥50% to <80% restenosis was 14.7 months vs 19.8 months for ≥80% restenosis after the CEA. Freedom from restenosis rates were 98%, 96%, 94%, 94%, and 94% for ≥50% restenosis and 99%, 98%, 97%, 97%, and 97% for ≥80% restenosis at 1 year, 2 years, 3 years, 4 years, and 5 years, respectively. Freedom from myocardial infarction, stroke, and deaths was

Microstructure and Antiwear Property of Laser Cladding Ni–Co Duplex Coating on Copper

PubMed Central

Wang, Yiyong; Liang, Zhipeng; Zhang, Junwei; Ning, Zhe; Jin, Hui

2016-01-01

Ni–Co duplex coatings were cladded onto Cu to improve the antiwear properties of Cu products. Prior to laser cladding, n-Al2O3/Ni layers were introduced as interlayers between laser cladding coatings and Cu substrates to improve the laser absorptivity of these substrates and ensure defect-free laser cladding coatings. The structure and morphology of the coatings were characterized by scanning electron microscopy and optical microscopy, and the phases of the coatings were analyzed by X-ray diffraction. Their hardness was measured using a microhardness tester. Experimental results showed that defect-free composite coatings were obtained and that the coatings were metallurgically bonded to the substrates. The surface of the Ni–Co duplex coatings comprised a Co-based solid solution, Cr7C3, (Fe,Ni)23C6, and other strengthening phases. The microhardness and wear resistance of the duplex coatings were significantly improved compared with the Cu substrates. The average microhardness of the cladded coatings was 845.6 HV, which was approximately 8.2 times greater than that of the Cu substrates (102.6 HV). The volume loss of the Cu substrates was approximately 7.5 times greater than that of the Ni–Co duplex coatings after 60 min of sliding wear testing. The high hardness of and lack of defects in the Ni–Co duplex coatings reduced the plastic deformation and adhesive wear of the Cu substrates, resulting in improved wear properties. PMID:28773755

Microstructure and Antiwear Property of Laser Cladding Ni-Co Duplex Coating on Copper.

PubMed

Wang, Yiyong; Liang, Zhipeng; Zhang, Junwei; Ning, Zhe; Jin, Hui

2016-07-28

Ni-Co duplex coatings were cladded onto Cu to improve the antiwear properties of Cu products. Prior to laser cladding, n-Al₂O₃/Ni layers were introduced as interlayers between laser cladding coatings and Cu substrates to improve the laser absorptivity of these substrates and ensure defect-free laser cladding coatings. The structure and morphology of the coatings were characterized by scanning electron microscopy and optical microscopy, and the phases of the coatings were analyzed by X-ray diffraction. Their hardness was measured using a microhardness tester. Experimental results showed that defect-free composite coatings were obtained and that the coatings were metallurgically bonded to the substrates. The surface of the Ni-Co duplex coatings comprised a Co-based solid solution, Cr₇C₃, (Fe,Ni) 23 C₆, and other strengthening phases. The microhardness and wear resistance of the duplex coatings were significantly improved compared with the Cu substrates. The average microhardness of the cladded coatings was 845.6 HV, which was approximately 8.2 times greater than that of the Cu substrates (102.6 HV). The volume loss of the Cu substrates was approximately 7.5 times greater than that of the Ni-Co duplex coatings after 60 min of sliding wear testing. The high hardness of and lack of defects in the Ni-Co duplex coatings reduced the plastic deformation and adhesive wear of the Cu substrates, resulting in improved wear properties.

The morphology and treatment of coexisting ureteropelvic junction obstruction in lower moiety of duplex kidney.

PubMed

Liu, Wei; Zhang, Liujuan; Ma, Rui; Wu, Rongde

2016-10-01

Duplex kidney is a common congenital anomaly of the urinary tract, while ureteropelvic junction obstruction (UPJO) in lower unit of duplex kidney is rare. Surgical treatment can be challenging in such cases. The aim was to report our experience in managements of UPJO in lower moiety of duplex kidney. Among the pediatric patients with duplex system from 2007 to 2013, 7 children were diagnosed with UPJO in lower moiety. Their medical records were retrospectively analyzed, mainly focused on anatomic aspects and operation details. The lower pole UPJO associated with incomplete duplex systems were identified in 6 patients on the left side and 1 on the right side. Median patient age at surgery was 11 months (range 6-84 months). Prenatal hydronephrosis was detected in 4 patients, and 3 had intermittent abdominal pain. Hydronephrosis, thin parenchyma and presence of UPJO in lower moiety could be shown on computed tomography urogram (CTU). The ureters were fused in a "Y" shape without any dilation. Based on the length between UPJO to the confluence in retrograde ureteropyelography, patients were classified into group 1 (5 cases,≤3 cm) and group 2 (2 cases, >3 cm). In group 1, surgical procedure involved end-to-side pyeloureterostomy of the lower pelvis to the ureteral confluence in 4 cases and laparoscopic pyeloureterostomy in one case. The two patients in group 2 underwent laparoscopic pyeloplasty of lower moiety. In all of these patients hydronephrosis gradually improved and no complications were detected during follow-up. UPJO in a duplex kidney requires careful evaluation and treatment should be individualized. Ureteropyeloanastomosis is a feasible treatment for duplex kidneys associated to a functioning lower moiety with UPJO. With the technical improvements in laparoscopic pyeloplasty, this procedure can be performed using laparoscopy. Copyright © 2016 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins.

PubMed

Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa

2016-03-21

Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

Microstructures and mechanical properties of duplex low carbon steel

NASA Astrophysics Data System (ADS)

Alfirano; Eben, U. S.; Hidayat, M.

2018-04-01

The microstructures behavior of duplex cold-rolled low carbon steel for automotive applications has been investigated. Intercritical annealing treatment is commonly used to develop a duplex low carbon steel containing ferrite and martensite. To get a duplex phase ferrite and martensite, the specimens were heated at inter-critical annealing temperature of 775°C - 825°C, for heating time up to 20 minutes, followed by water-quenched. The hardness of specimens was studied. The optical microscopy was used to analyze the microstructures. The optimal annealing conditions (martensite volume fraction approaching 20%) at 775°C with a heating time of 10 minutes was achieved. The highest hardness value was obtained in cold-rolled specimens of 41% in size reduction for intercritical annealing temperature of 825°C. In this condition, the hardness value was 373 HVN. The correlation between intercritical annealing temperature and time can be expressed in the transformation kinetics as fγ/fe = 1-exp(-Ktn) wherein K and n are grain growth rate constant and Avrami’s exponent, respectively. From experiment, the value of K = 0.15 and n = 0.461. Using the relationship between temperatures and heating time, activation energy (Q) can be calculated that is 267 kJ/mol.

Enhancing the corrosion resistance of the 2205 duplex stainless steel bipolar plates in PEMFCs environment by surface enriched molybdenum

NASA Astrophysics Data System (ADS)

Jinlong, Lv; Zhuqing, Wang; Tongxiang, Liang; Ken, Suzuki; Hideo, Miura

Surface molybdenum enrichment on 2205 duplex stainless steel was obtained by the ball milling technique. The electrochemical results showed molybdenum enrichment on the surface of 2205 duplex stainless steel improved its corrosion resistance in a typical proton exchange membrane fuel cell environment. This was mainly attributed to higher molybdenum content in the passive film formed on 2205 duplex stainless steel after ball milling. The decreased donor and acceptor concentrations improved significantly the corrosion resistance of surface molybdenum-enriched 2205 duplex stainless steel bipolar plates in the simulated cathodic proton exchange membrane fuel cells environment. In addition, the interfacial contact resistance of the 2205 duplex stainless steel bipolar plates slightly decreased due to surface molybdenum enrichment.

On the Formation and Properties of Interstrand DNA-DNA Cross-links Forged by Reaction of an Abasic Site With the Opposing Guanine Residue of 5′-CAp Sequences in Duplex DNA

PubMed Central

Johnson, Kevin M.; Price, Nathan E.; Wang, Jin; Fekry, Mostafa I.; Dutta, Sanjay; Seiner, Derrick R.; Wang, Yinsheng; Gates, Kent S.

2014-01-01

We recently reported that the aldehyde residue of an abasic (Ap) site in duplex DNA can generate an interstrand cross-link via reaction with a guanine residue on the opposing strand. This finding is intriguing because the highly deleterious nature of interstrand cross-links suggests that even small amounts of Ap-derived cross-links could make a significant contribution to the biological consequences stemming from the generation of Ap sites in cellular DNA. Incubation of 21-bp duplexes containing a central 5′-CAp sequence under conditions of reductive amination (NaCNBH3, pH 5.2) generated much higher yields of cross-linked DNA than reported previously. At pH 7, in the absence of reducing agents, these Ap-containing duplexes also produced cross-linked duplexes that were readily detected on denaturing polyacrylamide gels. Cross-link formation was not highly sensitive to reaction conditions and, once formed, the cross-link was stable to a variety of work-up conditions. Results of multiple experiments including MALDI-TOF mass spectrometry, gel mobility, methoxyamine capping of the Ap aldehyde, inosine-for-guanine replacement, hydroxyl radical footprinting, and LCMS/MS were consistent with a cross-linking mechanism involving reversible reaction of the Ap aldehyde residue with the N2-amino group of the opposing guanine residue in 5′-CAp sequences to generate hemiaminal, imine, or cyclic hemiaminal cross-links (7-10) that were irreversibly converted under conditions of reductive amination (NaCNBH3/pH 5.2) to a stable amine linkage. Further support for the importance of the exocyclic N2-amino group in this reaction was provided by an experiment showing that installation of a 2-aminopurine-thymine base pair at the cross-linking site produced high yields (15-30%) of a cross-linked duplex at neutral pH, in the absence of NaCNBH3. PMID:23215239

A one-step duplex rRT-PCR assay for the simultaneous detection of duck hepatitis A virus genotypes 1 and 3.

PubMed

Hu, Qin; Zhu, Dekang; Ma, Guangpeng; Cheng, Anchun; Wang, Mingshu; Chen, Shun; Jia, Renyong; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Chen, Xiaoyue

2016-10-01

Duck hepatitis A virus (DHAV) is a highly infectious pathogen that causes significant bleeding lesions in the viscera of ducklings less than 3 weeks old. There are three serotypes of DHAV: serotype 1 (DHAV-1), serotype 2 (DHAV-2) and serotype 3 (DHAV-3). These serotypes have no cross-antigenicity with each other. To establish an rRT-PCR assay for the rapid detection of a mixed infection of DHAV-1 and DHAV-3, two pairs of primers and a pair of matching TaqMan probes were designed based on conserved regions of DHAV-1 VP0 and DHAV-3 VP3. Finally, we established a one-step duplex rRT-PCR assay with high specificity and sensitivity for the simultaneous detection of DHAV-1 and DHAV-3. This method showed no cross-antigenicity with the other pathogens tested, including duck plague virus, Muscovy duck parvovirus, Riemerella anatipestifer, and pathogenic E. coli from ducks. Sensitivity tests identified the minimum detection limits of this method as 98 (DHAV-1) and 10 (DHAV-3) copies/reaction. To validate the method, thirty-eight clinical samples and thirty artificially infected samples collected from dead duck embryos were studied. Thirty-seven samples were positive for DHAV-1, seventeen samples were positive for DHAV-3, and fourteen samples were positive for a mixed infection using the duplex rRT-PCR method. The method established in this study is specific, sensitive, convenient and timesaving and is a powerful tool for detecting DHAV-1, DHAV-3, and their mixed infection and for conducting surveys of pandemic virus strains. Copyright © 2016. Published by Elsevier B.V.

Relationship between ion pair geometries and electrostatic strengths in proteins.

PubMed Central

Kumar, Sandeep; Nussinov, Ruth

2002-01-01

The electrostatic free energy contribution of an ion pair in a protein depends on two factors, geometrical orientation of the side-chain charged groups with respect to each other and the structural context of the ion pair in the protein. Conformers in NMR ensembles enable studies of the relationship between geometry and electrostatic strengths of ion pairs, because the protein structural contexts are highly similar across different conformers. We have studied this relationship using a dataset of 22 unique ion pairs in 14 NMR conformer ensembles for 11 nonhomologous proteins. In different NMR conformers, the ion pairs are classified as salt bridges, nitrogen-oxygen (N-O) bridges and longer-range ion pairs on the basis of geometrical criteria. In salt bridges, centroids of the side-chain charged groups and at least a pair of side-chain nitrogen and oxygen atoms of the ion-pairing residues are within a 4 A distance. In N-O bridges, at least a pair of the side-chain nitrogen and oxygen atoms of the ion-pairing residues are within 4 A distance, but the distance between the side-chain charged group centroids is greater than 4 A. In the longer-range ion pairs, the side-chain charged group centroids as well as the side-chain nitrogen and oxygen atoms are more than 4 A apart. Continuum electrostatic calculations indicate that most of the ion pairs have stabilizing electrostatic contributions when their side-chain charged group centroids are within 5 A distance. Hence, most (approximately 92%) of the salt bridges and a majority (68%) of the N-O bridges are stabilizing. Most (approximately 89%) of the destabilizing ion pairs are the longer-range ion pairs. In the NMR conformer ensembles, the electrostatic interaction between side-chain charged groups of the ion-pairing residues is the strongest for salt bridges, considerably weaker for N-O bridges, and the weakest for longer-range ion pairs. These results suggest empirical rules for stabilizing electrostatic interactions in

Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

PubMed

Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

2017-02-23

Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix

Effect of Urea on G-Quadruplex Stability.

PubMed

Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

2017-07-13

G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

Synthesis, structure and imaging of oligodeoxyribonucleotides with tellurium-nucleobase derivatization.

PubMed

Sheng, Jia; Hassan, Abdalla E A; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S; Huang, Zhen

2011-05-01

We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. © The Author(s) 2011. Published by Oxford University Press.

Microstructure, Properties and Weldability of Duplex Stainless Steel 2101

NASA Astrophysics Data System (ADS)

Ma, Li; Hu, Shengsun; Shen, Junqi

2017-01-01

The continuous development of duplex stainless steels (DSSs) is due to their excellent corrosion resistance in aggressive environments and their mechanical strength, which is usually twice of conventional austenitic stainless steels (ASSs). In this paper, a designed lean duplex stainless steel 2101, with the alloy design of reduced nickel content and increased additions of manganese and nitrogen, is studied by being partly compared with typical ASS 304L steels. The microstructure, mechanical properties, impact toughness, corrosion resistance and weldability of the designed DSS 2101 were conducted. The results demonstrated that both 2101 steel and its weldment show excellent mechanical properties, impact toughness and corrosion resistance, so DSS 2101 exhibits good comprehensive properties and can be used to replace 304L in numerous applications.

Relative stabilities of triple helices composed of combinations of DNA, RNA and 2'-O-methyl-RNA backbones: chimeric circular oligonucleotides as probes.

PubMed

Wang, S; Kool, E T

1995-04-11

Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.

Concurrent infections of pseudorabies virus and porcine bocavirus in China detected by duplex nanoPCR.

PubMed

Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin

2015-07-01

Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

PubMed

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.

PubMed

Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P

2014-07-05

The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the

Development of one novel multiple-target plasmid for duplex quantitative PCR analysis of roundup ready soybean.

PubMed

Zhang, Haibo; Yang, Litao; Guo, Jinchao; Li, Xiang; Jiang, Lingxi; Zhang, Dabing

2008-07-23

To enforce the labeling regulations of genetically modified organisms (GMOs), the application of reference molecules as calibrators is becoming essential for practical quantification of GMOs. However, the reported reference molecules with tandem marker multiple targets have been proved not suitable for duplex PCR analysis. In this study, we developed one unique plasmid molecule based on one pMD-18T vector with three exogenous target DNA fragments of Roundup Ready soybean GTS 40-3-2 (RRS), that is, CaMV35S, NOS, and RRS event fragments, plus one fragment of soybean endogenous Lectin gene. This Lectin gene fragment was separated from the three exogenous target DNA fragments of RRS by inserting one 2.6 kb DNA fragment with no relatedness to RRS detection targets in this resultant plasmid. Then, we proved that this design allows the quantification of RRS using the three duplex real-time PCR assays targeting CaMV35S, NOS, and RRS events employing this reference molecule as the calibrator. In these duplex PCR assays, the limits of detection (LOD) and quantification (LOQ) were 10 and 50 copies, respectively. For the quantitative analysis of practical RRS samples, the results of accuracy and precision were similar to those of simplex PCR assays, for instance, the quantitative results were at the 1% level, the mean bias of the simplex and duplex PCR were 4.0% and 4.6%, respectively, and the statistic analysis ( t-test) showed that the quantitative data from duplex and simplex PCR had no significant discrepancy for each soybean sample. Obviously, duplex PCR analysis has the advantages of saving the costs of PCR reaction and reducing the experimental errors in simplex PCR testing. The strategy reported in the present study will be helpful for the development of new reference molecules suitable for duplex PCR quantitative assays of GMOs.

Comparative study of reproductive skew and pair-bond stability using genealogies from 80 small-scale human societies.

PubMed

Ellsworth, Ryan M; Shenk, Mary K; Bailey, Drew H; Walker, Robert S

2016-05-01

Genealogies contain information on the prevalence of different sibling types that result from past reproductive behavior. Full sibling sets stem from stable monogamy, paternal half siblings primarily indicate male reproductive skew, and maternal half siblings reflect unstable pair bonds. Full and half sibling types are calculated for a total of 61,181 siblings from published genealogies for 80 small-scale societies, including foragers, horticulturalists, agriculturalists, and pastoralists from around the world. Most siblings are full (61%) followed by paternal half siblings (27%) and maternal half siblings (13%). Paternal half siblings are positively correlated with more polygynous marriages, higher at low latitudes, and slightly higher in nonforagers, Maternal half sibling fractions are slightly higher at low latitudes but do not vary with subsistence. Partible paternity societies in Amazonia have more paternal half siblings indicating higher male reproductive skew. Sibling counts from genealogies provide a convenient method to simultaneously investigate the reproductive skew and pair-bond stability dimensions of human mating systems cross-culturally. Am. J. Hum. Biol. 28:335-342, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Structural model of the p14/SF3b155 · branch duplex complex.

PubMed

Schellenberg, Matthew J; Dul, Erin L; MacMillan, Andrew M

2011-01-01

Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14 · bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein-RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14 · duplex interaction must be disrupted before the first step of splicing.

Structural model of the p14/SF3b155·branch duplex complex

PubMed Central

Schellenberg, Matthew J.; Dul, Erin L.; MacMillan, Andrew M.

2011-01-01

Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14•bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein–RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14•duplex interaction must be disrupted before the first step of splicing. PMID:21062891

Dark-bright soliton pairs in nonlocal nonlinear media.

PubMed

Lin, Yuan Yao; Lee, Ray-Kuang

2007-07-09

We study the formation of dark-bright vector soliton pairs in nonlocal Kerr-type nonlinear medium. We show, by analytical analysis and direct numerical calculation, that in addition to stabilize of vector soliton pairs nonlocal nonlinearity also helps to reduce the threshold power for forming a guided bright soliton. With help of the nonlocality, it is expected that the observation of dark-bright vector soliton pairs in experiments becomes more workable.

Comparison of monoplex and duplex RT-PCR assays for the detection of measles virus.

PubMed

Binkhamis, Khalifa; Gillis, Hayley; Lafreniere, Joseph Daniel; Hiebert, Joanne; Mendoza, Lillian; Pettipas, Janice; Severini, Alberto; Hatchette, Todd F; LeBlanc, Jason J

2017-01-01

Rapid and accurate detection of measles virus is important for case diagnosis and public health management. This study compared the performance of two monoplex RT-PCR reactions targeting the H and N genes to a duplex RT-PCR targeting both genes simultaneously. The duplex simplified processing without compromising assay performance characteristic. Copyright © 2016 Elsevier B.V. All rights reserved.

Insights into the structural features and stability of peptide nucleic acid with a D-prolyl-2-aminocyclopentane carboxylic acid backbone that binds to DNA and RNA.

PubMed

Poomsuk, Nattawee; Vilaivan, Tirayut; Siriwong, Khatcharin

2018-06-12

Peptide nucleic acid (PNA) is a powerful biomolecule with a wide variety of important applications. In this work, the molecular structures and binding affinity of PNA with a D-prolyl-2-aminocyclopentane carboxylic acid backbone (acpcPNA) that binds to both DNA and RNA were studied using molecular dynamics simulations. The simulated structures of acpcPNA-DNA and acpcPNA-RNA duplexes more closely resembled the typical structures of B-DNA and A-RNA than the corresponding duplexes of aegPNA. The calculated binding free energies are in good agreement with the experimental results that the acpcPNA-DNA duplex is more stable than the acpcPNA-RNA duplex regardless of the base sequences. The results provide further insights in the relationship between structure and stability of this unique PNA system. Copyright © 2018 Elsevier Inc. All rights reserved.

The microstructure and formation of duplex and black plessite in iron meteorites

NASA Technical Reports Server (NTRS)

Zhang, J.; Williams, D. B.; Goldstein, J. I.

1993-01-01

Two of the most common plessite structures, duplex and black plessite, in the taenite region of the Windmanstatten pattern of two iron meteorites (Grant and Carlton) are characterized using high-resolution electron microscopy and microanalysis techniques. Two types of gamma precipitates, found in the duplex plessite and black plessite regions, respectively, are identified, and their morphologies are described. The formation of the plessite structure is discussed using the information obtained in this study and results of a parallel investigation of decomposed martensitic Fe-Ni laboratory alloys.

A full-duplex CATV/wireless-over-fiber lightwave transmission system.

PubMed

Li, Chung-Yi; Lu, Hai-Han; Ying, Cheng-Ling; Cheng, Chun-Jen; Lin, Che-Yu; Wan, Zhi-Wei; Chen, Jian-Hua

2015-04-06

A full-duplex CATV/wireless-over-fiber lightwave transmission system consisting of one broadband light source (BLS), two optical interleavers (ILs), one intensity modulator, and one phase modulator is proposed and experimentally demonstrated. The downstream light is optically promoted from 10Gbps/25GHz microwave (MW) data signal to 10Gbps/100GHz and 10Gbps/50GHz millimeter-wave (MMW) data signals in fiber-wireless convergence, and intensity-modulated with 50-550 MHz CATV signal. For up-link transmission, the downstream light is phase-remodulated with 10Gbps/25GHz MW data signal in fiber-wireless convergence. Over a 40-km single-mode fiber (SMF) and a 10-m radio frequency (RF) wireless transport, bit error rate (BER), carrier-to-noise ratio (CNR), composite second-order (CSO), and composite triple-beat (CTB) are observed to perform well in such full-duplex CATV/wireless-over-fiber lightwave transmission systems. This full-duplex 100-GHz/50-GHz/25-GHz/550-MHz lightwave transmission system is an attractive alternative. This transmission system not only presents its advancement in the integration of fiber backbone and CATV/wireless feeder networks, but also it provides the advantages of a communication channel for higher data rates and bandwidth.

Duplex Direct Data Distribution System

NASA Technical Reports Server (NTRS)

Greenfield, Israel (Technical Monitor)

2001-01-01

The NASA Glenn Research Center (GRC) is developing and demonstrating communications and network technologies that are helping to enable the near-Earth space Internet. GRC envisions several service categories. The first of these categories is direct data distribution or D3 (pronounced "D-cubed"). Commercially provided D3 will make it possible to download a data set from a spacecraft, like the International Space Station. as easily as one can extract a file from a remote server today, using a file transfer protocol. In a second category, NASA spacecraft will make use of commercial satellite communication (SATCOM) systems. Some of those services will come from purchasing time on unused transponders that cover landmasses. While it is likely there will be gaps in service coverage, Internet services should be available using these systems. This report addresses alternative methods of implementing a full duplex enhancement of the GRC developed experimental Ka-Band Direct Data Distribution (D3) space-to-ground communication link. The resulting duplex version is called the Duplex Direct Data Distribution (D4) system. The D4 system is intended to provide high-data-rate commercial direct or internet-based communications service between the NASA spacecraft in low earth orbit (LEO) and the respective principal investigators associated with these spacecraft. Candidate commercial services were assessed regarding their near-term potential to meet NASA requirements. Candidates included Ka-band and V-band geostationary orbit and non-geostationary orbit satellite relay services and direct downlink ("LEO teleport") services. End-to-end systems concepts were examined and characterized in terms of alternative link layer architectures. Alternatives included a Direct Link, a Relay Link, a Hybrid Link, and a Dual Mode Link. The direct link assessment examined sample ground terminal placements and antenna angle issues. The SATCOM-based alternatives examined existing or proposed commercial

Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

PubMed

Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

2004-12-01

Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

Study of Sigma Phase in Duplex SAF 2507

NASA Astrophysics Data System (ADS)

Fellicia, D. M.; Sutarsis; Kurniawan, B. A.; Wulanari, D.; Purniawan, A.; Wibisono, A. T.

2017-05-01

Super duplex stainless steel is one of the stainless steel which has a combination between high strength properties and excellent corrosion resistance. However, the resistance can decrease by precipitation of sigma phase which is formed at high temperature, for example after welding processes. A series of experiments has been performed to study the effect of solution annealing to existence of sigma phase on super duplex SAF 2507. Variations of solution-annealing temperatures were 1000 °C, 1065 °C and 1125 °C with holding time of 15 and 30 minutes for each temperature. Effect of solution annealing process was characterized by using XRD, SEM, and Optical Microscopy. The result showed precipitation of sigma phase completely dissolved at 1065 °C and 1125 °C because it reformed to austenite. After it was heated at 1065 °C, chromium carbide appeared in ferrite site and grain boundary. The amount of chromium carbide increased with the increasing of solution annealing temperature.

Duplexed sandwich immunoassays on a fiber-optic microarray.

PubMed

Rissin, David M; Walt, David R

2006-03-30

In this paper, we describe a duplexed imaging optical fiber array-based immunoassay for immunoglobulin A (IgA) and lactoferrin. To fabricate the individually addressable array, microspheres were functionalized with highly specific monoclonal antibodies. The microspheres were loaded in microwells etched into the distal face of an imaging optical fiber bundle. Two microsphere-based sandwich immunoassays were developed to simultaneously detect IgA and lactoferrin, two innate immune system proteins found in human saliva. Individual microspheres could be interrogated for the simultaneous measurement of both proteins. The working concentration range for IgA detection was between 700 pM and 100 nM, while the working concentration range for lactoferrin was between 385 pM and 10 nM. The cross-reactivity between detection antibodies and their non-specific targets was relatively low in comparison to the signal generated by the specific binding with their targets. These results suggest that the degree of multiplexing on this fiber-optic array platform can be increased beyond a duplex.

The effects of laser welding parameters on the microstructure of ferritic and duplex stainless steels welds

NASA Astrophysics Data System (ADS)

Pekkarinen, J.; Kujanpää, V.

This study is focused to determine empirically, which microstructural changes occur in ferritic and duplex stainless steels when heat input is controlled by welding parameters. Test welds were done autogenously bead-on-plate without shielding gas using 5 kW fiber laser. For comparison, some gas tungsten arc welds were made. Used test material were 1.4016 (AISI 430) and 1.4003 (low-carbon ferritic) type steels in ferritic steels group and 1.4162 (low-alloyed duplex, LDX2101) and 1.4462 (AISI 2205) type steels in duplex steels group. Microstructural changes in welds were identified and examined using optical metallographic methods.

Unfolding and Targeting Thermodynamics of a DNA Intramolecular Complex with Joined Triplex-Duplex Domains.

PubMed

Johnson, Sarah E; Reiling-Steffensmeier, Calliste; Lee, Hui-Ting; Marky, Luis A

2018-01-25

Our laboratory is interested in developing methods that can be used for the control of gene expression. In this work, we are investigating the reaction of an intramolecular complex containing a triplex-duplex junction with partially complementary strands. We used a combination of isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectroscopy techniques to determine standard thermodynamic profiles for these targeting reactions. Specifically, we have designed single strands to target one loop (CTTTC) or two loops (CTTTC and GCAA) of this complex. Both reactions yielded exothermic enthalpies of -66.3 and -82.8 kcal/mol by ITC, in excellent agreement with the reaction enthalpies of -72.7 and -88.7 kcal/mol, respectively, obtained from DSC Hess cycles. The favorable heat contributions result from the formation of base-pair stacks involving mainly the unpaired bases of the loops. This shows that each complementary strand is able to invade and disrupt the secondary structure. The simultaneous targeting of two loops yielded a more favorable reaction free energy, by approximately -8 kcal/mol, which corresponds to the formation of roughly four base-pair stacks involving the unpaired bases of the 5'-GCAA loop. The main conclusion is that the targeting of loops with a large number of unpaired bases results in a more favorable reaction free energy.

Structure and conversion kinetics of a bi-stable DNA i-motif: broken symmetry in the [d(5mCCTCC)]4 tetramer.

PubMed

Nonin, S; Leroy, J L

1996-08-23

At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.

Duplex-assisted carotid artery stenting without administration of contrast medium for patients with chronic kidney disease or allergic reaction.

PubMed

Mizowaki, Takashi; Fujita, Atsushi; Imahori, Taichiro; Uyama, Atsushi; Inoue, Satoshi; Kohta, Masaaki; Hamaguchi, Hirotoshi; Sasayama, Takashi; Hosoda, Kohkichi; Kohmura, Eiji

2016-07-01

We aimed to investigate the safety and feasibility of duplex-assisted carotid artery stenting (CAS) without administration of contrast medium for the prevention of adverse reactions. Fifteen patients (9 % of all CASs) with severe carotid stenosis (≥70 %) associated with chronic kidney disease (CKD) (stage ≥3) or allergy to contrast medium underwent duplex-assisted CAS without administration of contrast medium over 4 years. The procedural success rate and perioperative complication rates were compared between the duplex-assisted CAS (n = 15) and conventional CAS (n = 153) groups. The technical success rate was 100 % in both groups. Combined stroke or death rates during the post-procedural period did not differ significantly between the duplex-assisted CAS group (0/15, 0 %) and conventional CAS group (4/153, 2.6 %). None of the 14 patients with CKD in the duplex-assisted CAS group experienced further deterioration of renal function. The mean surface radiation dose of participants in the duplex-assisted CAS group (n = 13, 312 ± 131 mGy) was significantly lower than that of the conventional CAS group (n = 31, 1036 ± 571 mGy) (p < 0.001). The mean duration of CAS procedure was not significantly different between the duplex-assisted CAS group (156 ± 39.7 min) and the conventional CAS group (156 ± 37.4 min). Duplex-assisted CAS without administration of contrast medium could be an alternative option in selected patients deemed to be at high risk for renal failure from nephrotoxic contrast medium or who have an allergy to contrast medium.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Architecture Studies Done for High-Rate Duplex Direct Data Distribution (D4) Services

NASA Technical Reports Server (NTRS)

2002-01-01

A study was sponsored to investigate a set of end-to-end system concepts for implementing a high-rate duplex direct data distribution (D4) space-to-ground communications link. The NASA Glenn Research Center is investigating these systems (both commercial and Government) as a possible method of providing a D4 communications service between NASA spacecraft in low Earth orbit and the respective principal investigators using or monitoring instruments aboard these spacecraft. Candidate commercial services were assessed regarding their near-term potential to provide a D4 type of service. The candidates included K-band and V-band geostationary orbit and nongeostationary orbit satellite relay services and direct downlink (D3) services. Internet protocol (IP) networking technologies were evaluated to enable the user-directed distribution and delivery of science data. Four realistic, near-future concepts were analyzed: 1) A duplex direct link (uplink plus downlink communication paths) between a low-Earth-orbit spacecraft and a principal-investigator-based autonomous Earth station; 2) A space-based relay using a future K-band nongeosynchronous-orbit system to handle both the uplink and downlink communication paths; 3) A hybrid link using both direct and relay services to achieve full duplex capability; 4) A dual-mode concept consisting of both a duplex direct link and a space relay duplex link operating independently. The concepts were analyzed in terms of contact time between the NASA spacecraft and the communications service and the achievable data throughput. Throughput estimates for the D4 systems were based on the infusion of advanced communications technology products (single and multibeam K-band phased-arrays and digital modems) being developed by Glenn. Cost estimates were also performed using extrapolated information from both terrestrial and current satellite communications providers. The throughput and cost estimates were used to compare the concepts.

Molecular dynamics correctly models the unusual major conformation of the GAGU RNA internal loop and with NMR reveals an unusual minor conformation.

PubMed

Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H

2018-05-01

The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

The Vibrio parahaemolyticus small RNA RyhB promotes production of the siderophore vibrioferrin by stabilizing the polycistronic mRNA.

PubMed

Tanabe, Tomotaka; Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-08-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938-6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5'-untranslated region of pvsOp mRNA (pvsOp 5'-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5'-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5'-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5'-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target.

The Vibrio parahaemolyticus Small RNA RyhB Promotes Production of the Siderophore Vibrioferrin by Stabilizing the Polycistronic mRNA

PubMed Central

Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-01-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938–6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5′-untranslated region of pvsOp mRNA (pvsOp 5′-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5′-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5′-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5′-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target. PMID:23772063

Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

NASA Astrophysics Data System (ADS)

Brancolini, Giorgia; Di Felice, Rosa

2011-05-01

Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

Sequence distribution of acetaldehyde-derived N2-ethyl-dG adducts along duplex DNA.

PubMed

Matter, Brock; Guza, Rebecca; Zhao, Jianwei; Li, Zhong-ze; Jones, Roger; Tretyakova, Natalia

2007-10-01

Acetaldehyde (AA) is the major metabolite of ethanol and may be responsible for an increased gastrointestinal cancer risk associated with alcohol beverage consumption. Furthermore, AA is one of the most abundant carcinogens in tobacco smoke and induces tumors of the respiratory tract in laboratory animals. AA binding to DNA induces Schiff base adducts at the exocyclic amino group of dG, N2-ethylidene-dG, which are reversible on the nucleoside level but can be stabilized by reduction to N2-ethyl-dG. Mutagenesis studies in the HPRT reporter gene and in the p53 tumor suppressor gene have revealed the ability of AA to induce G-->A transitions and A-->T transversions, as well as frameshift and splice mutations. AA-induced point mutations are most prominent at 5'-AGG-3' trinucleotides, possibly a result of sequence specific adduct formation, mispairing, and/or repair. However, DNA sequence preferences for the formation of acetaldehyde adducts have not been previously examined. In the present work, we employed a stable isotope labeling-HPLC-ESI+-MS/MS approach developed in our laboratory to analyze the distribution of acetaldehyde-derived N2-ethyl-dG adducts along double-stranded oligodeoxynucleotides representing two prominent lung cancer mutational "hotspots" and their surrounding DNA sequences. 1,7,NH 2-(15)N-2-(13)C-dG was placed at defined positions within DNA duplexes derived from the K-ras protooncogene and the p53 tumor suppressor gene, followed by AA treatment and NaBH 3CN reduction to convert N2-ethylidene-dG to N2-ethyl-dG. Capillary HPLC-ESI+-MS/MS was used to quantify N2-ethyl-dG adducts originating from the isotopically labeled and unlabeled guanine nucleobases and to map adduct formation along DNA duplexes. We found that the formation of N2-ethyl-dG adducts was only weakly affected by the local sequence context and was slightly increased in the presence of 5-methylcytosine within CG dinucleotides. These results are in contrast with sequence

Synthesis of 2',4'-propylene-bridged (carba-ENA) thymidine and its analogues: the engineering of electrostatic and steric effects at the bottom of the minor groove for nuclease and thermodynamic stabilities and elicitation of RNase H.

PubMed

Liu, Yi; Xu, Jianfeng; Karimiahmadabadi, Mansoureh; Zhou, Chuanzheng; Chattopadhyaya, Jyoti

2010-11-05

2',4'-Propylene-bridged thymidine (carba-ENA-T) and five 8'-Me/NH(2)/OH modified carba-ENA-T analogues have been prepared through intramolecular radical addition to C═N of the tethered oxime-ether. These carba-ENA nucleosides have been subsequently incorporated into 15mer oligodeoxynucleotides (AON), and their affinity toward cDNA and RNA, nuclease resistance, and RNase H recruitment capability have been investigated in comparison with those of the native and ENA counterparts. These carba-ENAs modified AONs are highly RNA-selective since all of them led to slight thermal stabilization effect for the AON:RNA duplex, but quite large destabilization effect for the AON:DNA duplex. It was found that different C8' substituents (at the bottom of the minor groove) on carba-ENA-T only led to rather small variation of thermal stability of the AON:RNA duplexes. We, however, observed that the parent carba-ENA-T modified AONs exhibited higher nucleolytic stability than those of the ENA-T modified counterparts. The nucleolytic stability of carba-ENA-T modified AONs can be further modulated by C8' substituent to variable extents depending on not only the chemical nature but also the stereochemical orientation of the C8' substituents: Thus, (1) 8'S-Me on carba-ENA increases the nucleolytic stability but 8'R-Me leads to a decreased effect; (2) 8'R-OH on carba-ENA had little, if any, effect on nuclease resistance but 8'S-OH resulted in significantly decreased nucleolytic stability; and (3) 8'-NH(2) substituted carba-ENA leads to obvious loss in the nuclease resistance. The RNA strand in all of the carba-ENA derivatives modified AON:RNA hybrid duplexes can be digested by RNase H1 with high efficiency, even at twice the rate of those of the native and ENA modified counterpart.

A full-duplex working integrated optoelectronic device for optical interconnect

NASA Astrophysics Data System (ADS)

Liu, Kai; Fan, Huize; Huang, Yongqing; Duan, Xiaofeng; Wang, Qi; Ren, Xiaomin; Wei, Qi; Cai, Shiwei

2018-05-01

In this paper, a full-duplex working integrated optoelectronic device is proposed. It is constructed by integrating a vertical cavity surface emitting laser (VCSEL) unit above a resonant cavity enhanced photodetector (RCE-PD) unit. Analysis shows that, the VCSEL unit has a threshold current of 1 mA and a slop efficiency of 0.66 W/A at 849.7 nm, the RCE-PD unit obtains its maximal absorption quantum efficiency of 90.24% at 811 nm with a FWHM of 4 nm. Moreover, the two units of the proposed integrated device can work independently from each other. So that the proposed integrated optoelectronic device can work full-duplex. It can be applied for single fiber bidirectional optical interconnects system.

Investigation of plastic deformation heterogeneities in duplex steel by EBSD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wronski, S., E-mail: wronski@ftj.agh.edu.pl; Tarasiuk, J., E-mail: tarasiuk@ftj.agh.edu.pl; Bacroix, B., E-mail: brigitte.bacroix@univ-paris13.fr

2012-11-15

An EBSD analysis of a duplex steel (austeno-ferritic) deformed in tension up to fracture is presented. The main purpose of the paper is to describe, qualitatively and quantitatively, the differences in the behavior of the two phases during plastic deformation. In order to do so, several topological maps are measured on the deformed state using the electron backscatter diffraction technique. Distributions of grain size, misorientation, image quality factor and texture are then analyzed in detail. - Highlights: Black-Right-Pointing-Pointer Heterogeneities in duplex steel is studied. Black-Right-Pointing-Pointer The behavior of the two phases during plastic deformation is studied. Black-Right-Pointing-Pointer IQ factor distributionmore » and misorientation characteristics are examined using EBSD.« less

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

PubMed

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

Standard duplex criteria overestimate the degree of stenosis after eversion carotid endarterectomy.

PubMed

Benzing, Travis; Wilhoit, Cameron; Wright, Sharee; McCann, P Aaron; Lessner, Susan; Brothers, Thomas E

2015-06-01

The eversion technique for carotid endarterectomy (eCEA) offers an alternative to longitudinal arteriotomy and patch closure (pCEA) for open carotid revascularization. In some reports, eCEA has been associated with a higher rate of >50% restenosis of the internal carotid when it is defined as peak systolic velocity (PSV) >125 cm/s by duplex imaging. Because the conformation of the carotid bifurcation may differ after eCEA compared with native carotid arteries, it was hypothesized that standard duplex criteria might not accurately reflect the presence of restenosis after eCEA. In a case-control study, the outcomes of all patients undergoing carotid endarterectomy by one surgeon during the last 10 years were analyzed retrospectively, with a primary end point of PSV >125 cm/s. Duplex flow velocities were compared with luminal diameter measurements for any carotid computed tomography arteriography or magnetic resonance angiography study obtained within 2 months of duplex imaging, with the degree of stenosis calculated by the methodology used in the North American Symptomatic Carotid Endarterectomy Trial (NASCET) and the European Carotid Surgery Trial (ECST) as well as cross-sectional area (CSA) reduction. Simulations were generated and analyzed by computational model simulations of the eCEA and pCEA arteries. Eversion and longitudinal arteriotomy with patch techniques were used in 118 and 177 carotid arteries, respectively. Duplex follow-up was available in 90 eCEA arteries at a median of 16 (range, 2-136) months and in 150 pCEA arteries at a median of 41 (range, 3-115) months postoperatively. PSV >125 cm/s was present at some time during follow-up in 31% of eCEA and pCEA carotid arteries, each, and in the most recent duplex examination in 7% after eCEA and 21% after pCEA (P = .003), with no eCEA and two pCEA arteries occluding completely during follow-up (P = .29). In 19 carotid arteries with PSV >125 cm/s after angle correction (median, 160 cm/s; interquartile range

A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing

PubMed Central

Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.

1996-01-01

The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508

A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples.

PubMed

Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2016-03-18

Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems.

A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples

PubMed Central

Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2016-01-01

Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems. PMID:26999129

Effects of Hypoxanthine Substitution in Peptide Nucleic Acids Targeting KRAS2 Oncogenic mRNA Molecules: Theory and Experiment

PubMed Central

Sanders, Jeffrey M.; Wampole, Matthew E.; Chen, Chang-Po; Sethi, Dalip; Singh, Amrita; Dupradeau, François-Yves; Wang, Fan; Gray, Brian D.; Thakur, Mathew L.; Wickstrom, Eric

2013-01-01

Genetic disorders can arise from single base substitutions in a single gene. A single base substitution for wild type guanine in the twelfth codon of KRAS2 mRNA occurs frequently to initiate lung, pancreatic, and colon cancer. We have observed single base mismatch specificity in radioimaging of mutant KRAS2 mRNA in tumors in mice by in vivo hybridization with radiolabeled peptide nucleic acid (PNA) dodecamers. We hypothesized that multi-mutant specificity could be achieved with a PNA dodecamer incorporating hypoxanthine, which can form Watson-Crick basepairs with adenine, cytosine, thymine, and uracil. Using molecular dynamics simulations and free energy calculations, we show that hypoxanthine substitutions in PNAs are tolerated in KRAS2 RNA-PNA duplexes where wild type guanine is replaced by mutant uracil or adenine in RNA. To validate our predictions, we synthesized PNA dodecamers with hypoxanthine, and then measured the thermal stability of RNA-PNA duplexes. Circular dichroism thermal melting results showed that hypoxanthine-containing PNAs are more stable in duplexes where hypoxanthine-adenine and hypoxanthine-uracil base pairs are formed than single mismatch duplexes or duplexes containing hypoxanthine-guanine opposition. PMID:23972113

Efficacy and safety of Duplex-guided polidocanol foam sclerotherapy for venous malformations.

PubMed

Ali, Haitham; Saleh, Mahmoud; Mohammed, Walid

2017-06-01

The aim of our study was to report our experience regarding the safety, efficacy of duplex-guided polidocanol (POL) foam sclerotherapy on the overall status of signs and symptoms in patients with venous malformations (VMs). Thirty seven patients with symptomatic extratruncular VMs were treated with duplex-guided POL foam sclerotherapy using Tessari's method. Twenty five patients had limited VMs, while twelve had infiltrating VMs. Postsclerotherapy surveillance was done 6 months after the last sclerotherapy session and comprised both clinical and duplex evaluation. Clinical evaluation entailed a patient self-assessment questionnaire using a four-point scale to rate the degree of symptoms improvement as follows: disappeared, decreased, worsened, or recurred. Findings obtained by duplex scanning were divided into four groups: 1) disappeared group; 2) partially recanalized group; 3) totally recanalized group; and 4) worsened group. There were 20 males and 17 females with mean age of 22.8±5.5 years. There was a significant reduction in the total amount of POL (P=0.0037), the number of sclerotherapy sessions was significantly lesser (P=0.0019), and treatment success was significantly higher (P=0.0495) in patients with limited VMs in comparison to those with infiltrating VMs. No major complications related to sclerotherapy were encountered in both groups. Polidocanol foam sclerotherapy is effective, and safe for treatment of VMs, with high success rate and low risk of major complications. Although associated with relatively high recurrence rate compared with ethanol sclerotherapy, this can be overcome by additional treatment sessions, given the relative simplicity, speed, and safety.

Rapid detection of Opisthorchis viverrini and Strongyloides stercoralis in human fecal samples using a duplex real-time PCR and melting curve analysis.

PubMed

Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

2011-12-01

Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.

The value of pre-discharge Duplex scanning in infrainguinal graft surveillance.

PubMed

Wilson, Y G; Davies, A H; Currie, I C; McGrath, C; Morgan, M; Baird, R N; Lamont, P M

1995-08-01

Protocols and criteria for Duplex-based graft surveillance programmes (GS) vary widely as to the optimum regimens for maximising detection of "at risk" grafts. Few centres recommend starting GS before discharge. The aim of this study was to audit our experience with respect to early scanning. Vascular Studies Unit, Bristol Royal Infirmary. The records of 123 patients entering GS from January 1992 were reviewed. Patients were scanned at 1 week, 6 weeks and 3, 6, 9 and 12 months post-bypass. Haemodynamic criteria used were a peak mean velocity (PMV) less than 45 cm/s and a focal velocity disturbance with a V2/V1 ratio of 1.5 or more. Forty-six abnormalities (37% detection rate) were identified on scans within one week. In all cases, on-table completion studies with either arteriography and/or flow measurements had failed to identify the anomalies subsequently detected by Duplex. At 1 week, six grafts had occluded, 27 had a focal PMV increase (mean V2/V1 ratio: 2.6; range 1.5-4.3), four had low flow velocities, four had arteriovenous fistulae, one contained mobile thrombus, two had retained cusps and two had hamstring entrapment. Of 40 patent, but compromised grafts, 18 warranted immediate investigation. Of the 27 patients with velocity disturbances on Duplex, 25 were simply observed but, eight have since required intervention for definitive stenoses at these sites which, in retrospect, were evident within the first postoperative week. Pre-discharge scanning is a useful modality for detecting technical problems. Intrinsic graft abnormalities, possibly the sites of future definitive stenoses, have been visualised even at 1 week and once identified, can be more closely scrutinised thereafter. Pre-discharge colour Duplex is recommended as standard practice for quality control after infrainguinal bypass.

Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

PubMed Central

Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

2014-01-01

Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

43. View of station from southwest side with duplex keepers' ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

43. View of station from southwest side with duplex keepers' dwelling to the left. USLHB photo by Herbert Bamber, June 9, 1893. - Bodie Island Light Station, Off Highway 12, Nags Head, Dare County, NC

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

PubMed Central

Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

2009-01-01

Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

A Commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century"

ERIC Educational Resources Information Center

Brandt, Steffen

2010-01-01

This article presents the author's commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century," in which Isaac I. Bejar and E. Aurora Graf propose the application of a test design--the duplex design (which was proposed in 1988 by Bock and Mislevy) for application in current accountability assessments.…

Value of delayed duplex ultrasound assessment after endothermal ablation of the great saphenous vein.

PubMed

Ryer, Evan J; Elmore, James R; Garvin, Robert P; Cindric, Matthew C; Dove, James T; Kekulawela, Stephanie; Franklin, David P

2016-08-01

Endothermal ablation (ETA) of the great saphenous vein (GSV) is associated with a small but definite risk of endothermal heat-induced thrombosis (EHIT) extending into the common femoral vein. Follow-up duplex ultrasound imaging to detect EHIT after ETA is considered standard of care, although the exact timing of duplex ultrasound imaging to detect EHIT after ETA remains unclear. We hypothesized that an additional duplex ultrasound assessment 1 week after ETA would not identify a significant number of patients with EHIT and would significantly increase health care costs. This was a retrospective review of consecutive ETA GSV procedures from 2007 to 2014. All patients were evaluated with duplex ultrasound imaging on postprocedure day 1, and 79% of patients underwent a second ultrasound assessment 1 week postprocedure. EHIT was considered present when proximal GSV closure progressed to level ≥4, based on a six-tier classification system. From January 1, 2007, until December 31, 2014, 842 patients underwent GSV ETA. Patients with EHIT were more likely to have had a prior deep venous thrombosis (DVT; P = .002) and a larger GSV (P = .006). Forty-three procedures (5.1%) were classified as having EHIT requiring anticoagulation, based on a level ≥4 proximal closure level. Of the 43 patients with EHIT, 20 (47%) were found on the initial ultrasound assessment performed 24 hours postprocedure, but 19 patients (44%) with EHIT would not have been identified with a single postoperative ultrasound scan performed 24 hours after intervention. These 19 patients had a level ≤3 closure level at the duplex ultrasound scan performed 24 hours postprocedure and progressed to EHIT on the delayed duplex ultrasound scan. Lastly, thrombotic complications in four patients (9%), representing three late DVT and one DVT/pulmonary embolism presenting to another hospital, would not have been identified regardless of the postoperative surveillance strategy. Maximum GSV diameter was the

Comparison of duplex ultrasound with digital subtraction angiography in the assessment of infra-inguinal autologous vein bypass grafts.

PubMed

Griffin, Nick M R; Wright, Isabel A; Buckenham, Tim M

2006-11-01

Postoperative surveillance of infra-inguinal vein grafts has arisen because of the high incidence of vein graft stenoses, which frequently progress to vein graft occlusion. The use of duplex ultrasound as the primary imaging method for graft surveillance is well established. This study aims to compare the accuracy of duplex ultrasound with the reference standard of digital subtraction angiography in the assessment of infra-inguinal vein grafts. Sixty patients underwent routine postoperative duplex ultrasound as part of the local graft surveillance programme. Angiography was subsequently carried out on 18 grafts. Each lower limb arterial tree was divided into three segments (native arteries proximal to the graft, the graft itself and native arteries distal to the graft) resulting in a total of 42 comparisons. Degree of diameter stenosis on ultrasound was compared with angiography findings to determine concordance. Agreement was also expressed as a kappa value. Overall accuracy of duplex ultrasound was 88% (37/42). A kappa value of 0.80 indicates good agreement. In three of the five discordant cases, ultrasound correctly identified a stenosis, but overestimated the degree of stenosis compared with angiography. In each of the remaining two discordant cases, ultrasound identified a focal stenosis that was not apparent on angiography. In both cases, the area of duplex described abnormality responded to balloon angioplasty. Duplex ultrasound as part of the local vein graft surveillance programme is a reliable and accurate method in the detection of failing grafts and in some instances may be more sensitive.

Stabilizing windings for tilting and shifting modes

DOEpatents

Jardin, Stephen C.; Christensen, Uffe R.

1984-01-01

This invention relates to passive conducting loops for stabilizing a plasma ring against unstable tilting and/or shifting modes. To this end, for example, plasma ring in a spheromak is stabilized by a set of four figure-8 shaped loops having one pair on one side of the plasma and one pair on the other side with each pair comprising two loops whose axes are transverse to each other.

Thermoacoustic Duplex Technology for Cooling and Powering a Venus Lander

NASA Astrophysics Data System (ADS)

Walker, A. R.; Haberbusch, M. S.; Sasson, J.

2015-04-01

A Thermoacoustic Stirling Heat Engine (TASHE) is directly coupled to a Pulse Tube Refrigerator (PTR) in a duplex configuration, providing simultaneous cooling and electrical power, thereby suiting the needs of a long-lived Venus lander.

Full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum fiber

PubMed Central

Chen, Shi; Liu, Jun; Zhao, Yifan; Zhu, Long; Wang, Andong; Li, Shuhui; Du, Jing; Du, Cheng; Mo, Qi; Wang, Jian

2016-01-01

We present a full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum (OAM) fiber. OAM+1 and OAM−1 modes carrying 20-Gbit/s quadrature phase-shift keying (QPSK) signals are employed in the downlink and uplink transmission experiments. The observed mode crosstalks are less than −15.2 dB, and the full-duplex crosstalks are less than −12.7 dB. The measured full-duplex optical signal-to-noise ratio (OSNR) penalties at a bit-error rate (BER) of 2 × 10−3 are ~2.4 dB in the downlink transmission and ~2.3 dB in the uplink transmission. The obtained results show favorable full-duplex twisted lights multiplexing data transmission performance in a km-scale OAM fiber link. PMID:27901082

Detection of 12 respiratory viruses by duplex real time PCR assays in respiratory samples.

PubMed

Arvia, Rosaria; Corcioli, Fabiana; Ciccone, Nunziata; Della Malva, Nunzia; Azzi, Alberta

2015-12-01

Different viruses can be responsible for similar clinical manifestations of respiratory infections. Thus, the etiological diagnosis of respiratory viral diseases requires the detection of a large number of viruses. In this study, 6 duplex real-time PCR assays, using EvaGreen intercalating dye, were developed to detect 12 major viruses responsible for respiratory diseases: influenza A and B viruses, enteroviruses (including enterovirus spp, and rhinovirus spp), respiratory syncytial virus, human metapneumovirus, coronaviruses group I (of which CoV 229E and CoV NL63 are part) and II (including CoV OC43 and CoV HKU1), parainfluenza viruses type 1, 2, 3 and 4, human adenoviruses and human bocaviruses. The 2 target viruses of each duplex reaction were distinguishable by the melting temperatures of their amplicons. The 6 duplex real time PCR assays were applied for diagnostic purpose on 202 respiratory samples from 157 patients. One hundred fifty-seven samples were throat swabs and 45 were bronchoalveolar lavages. The results of the duplex PCR assays were confirmed by comparison with a commercial, validated, assay; in addition, the positive results were confirmed by sequencing. The analytical sensitivity of the duplex PCR assays varied from 10(3) copies/ml to 10(4) copies/ml. For parainfluenza virus 2 only it was 10(5) copies/ml. Seventy clinical samples (35%) from 55 patients (30 children and 25 adults) were positive for 1 or more viruses. In adult patients, influenza A virus was the most frequently detected respiratory virus followed by rhinoviruses. In contrast, respiratory syncytial virus was the most common virus in children, followed by enteroviruses, influenza A virus and coronavirus NL63. The small number of samples/patients does not allow us to draw any epidemiological conclusion. Altogether, the results of this study indicate that the 6 duplex PCR assays described in this study are sensitive, specific and cost-effective. Thus, this assay could be

There is no benefit to universal carotid artery duplex screening before a major cardiac surgical procedure.

PubMed

Adams, Brian C; Clark, Ross M; Paap, Christina; Goff, James M

2014-01-01

Perioperative stroke is a devastating complication after cardiac surgery. In an attempt to minimize this complication, many cardiac surgeons routinely preoperatively order carotid artery duplex scans to assess for significant carotid stenosis. We hypothesize that the routine screening of preoperative cardiac surgery patients with carotid artery duplex scans detects few patients who would benefit from carotid intervention or that a significant carotid stenosis reliably predicts stroke risk after cardiac surgery. A retrospective review identified 1,499 patients who underwent cardiac surgical procedures between July 1999 and September 2010. Data collected included patient demographics, comorbidities, history of previous stroke, preoperative carotid artery duplex scan results, location of postoperative stroke, and details of carotid endarterectomy (CEA) procedures before, in conjunction with, or after cardiac surgery. Statistical methods included univariate analysis and Fisher's exact test. Twenty-six perioperative strokes were identified (1.7%). In the 21 postoperative stroke patients for whom there is complete carotid artery duplex scan data, 3 patients had a hemodynamically significant lesion (>70%) and 1 patient underwent unilateral carotid CEA for bilateral disease. Postoperative strokes occurred in the anterior cerebral circulation (69.2%), posterior cerebral circulation (15.4%), or both (15.4%). Patient comorbidities, preoperative carotid artery duplex scan screening velocities, or types of cardiac surgical procedure were not predictive for stroke. Thirteen patients (0.86%) underwent CEA before, in conjunction with, or after cardiac surgery. Two of these patients had symptomatic disease, 1 of whom underwent CEA before and the other after his cardiac surgery. Of the 11 asymptomatic patients, 2 underwent CEA before, 3 concurrently, and 6 after cardiac surgery. Left main disease (≥50% stenosis), previous stroke, and peripheral vascular disease were found to be

A ready-to-use duplex qPCR to detect Leishmania infantum DNA in naturally infected dogs.

PubMed

Rampazzo, Rita de Cássia Pontello; Solcà, Manuela da Silva; Santos, Liliane Celestino Sales; Pereira, Lais de Novaes; Guedes, José Carlos Oliveira; Veras, Patrícia Sampaio Tavares; Fraga, Deborah Bittencourt Mothé; Krieger, Marco Aurélio; Costa, Alexandre Dias Tavares

2017-11-15

Canine visceral leishmaniasis (CVL) is a systemic disease caused by Leishmania infantum. A precise CVL diagnosis would allow for a faster and more specific treatment. Quantitative PCR (qPCR) is a sensitive and specific technique that can diagnose CVL and also monitor parasite load in the animal during the course of the infection or treatment. The aim of this study was to develop a ready-to-use (gelified and freezer-free) duplex qPCR for the identification of infected animals. We combined a new qPCR protocol that detects the canine 18S rRNA gene with an existing protocol for L. infantum kDNA detection, creating a duplex qPCR. This duplex method was then developed into a ready-to-use format. The performance of the duplex and singleplex reactions were compared in the traditional format (liquid and freezer-stored). Furthermore, the duplex qPCR performance was compared between the ready-to-use and traditional formats. The singleplex and new duplex qPCR exhibited the same detection limit in the traditional format (0.1 parasites/reaction). The ready-to-use format showed a detection limit of 1 parasite/reaction without affecting the reaction efficiency. The performance of the new qPCR protocol in the two formats was assessed using canine tissue samples from 82 dogs in an endemic CVL area that were previously characterized by standard serological and parasitological protocols. Splenic aspirates provided a higher rate of positivity (92.9%) followed by skin (50%) and blood (35.7%). The reported detection limits were observed for all tissues studied. Our results show that the amplification of L. infantum kDNA and canine DNA in a single tube, using either the traditional or ready-to-use format, exhibited the same diagnostic performance as amplification of the parasite kDNA alone. The detection of the host gene strengthens the qPCR results by confirming the presence and quality of DNA in the samples and the absence of polymerase inhibitors. The ready-to-use duplex qPCR format

1. VIEW OF STAFF HOUSE (FEATURE 10), FACING SOUTHWEST. DUPLEX ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

1. VIEW OF STAFF HOUSE (FEATURE 10), FACING SOUTHWEST. DUPLEX (FEATURE 7) IS VISIBLE IN THE BACKGROUND AT RIGHT. - Copper Canyon Camp of the International Smelting & Refining Company, Staff House, Copper Canyon, Battle Mountain, Lander County, NV

Quasiparticle pair creation in unstable superflow

NASA Astrophysics Data System (ADS)

Elser, Veit

1995-06-01

Landau's instability mechanism in superflow is considered with special attention given to the role of nonuniformity in the flow. Linear stability analysis applied to the first in a series of approximate microscopic equations for the superfluid reveals a growth rate for Landau's instability proportional to the shear in the flow. In a quasiparticle description, the shear acts as a source of particle pair creation. The observation of roton-pair creation in experiments with electron bubbles in helium is offered as evidence of this phenomenon.

Surveillance Duplex Ultrasonography of Stent Grafts for Popliteal Aneurysms.

PubMed

Pineda, Danielle M; Troutman, Douglas A; Dougherty, Matthew J; Calligaro, Keith D

2016-05-01

Stent grafts, also known as covered stents, have become an increasingly acceptable treatment for popliteal artery aneurysms. However, endovascular exclusion confers lower primary patency compared to traditional open bypass and exclusion. The purpose of this study was to evaluate whether duplex ultrasonography (DU) can reliably diagnose failing stent grafts placed for popliteal artery aneurysms prior to occlusion. Between June 5, 2007, and March 11, 2014, 21 stent grafts (Viabahn; Gore, Flagstaff, Arizona) were placed in 19 patients for popliteal artery aneurysms. All patients had at least 1 follow-up duplex scan postoperatively. Mean follow-up was 28.9 months (9-93 months). Postoperative DU surveillance was performed in our Intersocietal Accreditation Commission noninvasive vascular laboratory at 1 week postprocedure and every 6 months thereafter. Duplex ultrasonography measured peak systolic velocities (PSVs) and ratio of adjacent PSVs (Vr) every 5 cm within the stent graft and adjacent arteries. We retrospectively classified the following factors as "abnormal DU findings": focal PSV > 300 cm/s, uniform PSVs < 50 cm/s throughout the graft, and Vr > 3.0. These DU criteria were derived from laboratory-specific data that we previously published on failing stent grafts placed for lower extremity occlusive disease. Four of the 21 stent grafts presented with symptomatic graft thrombosis within 6 months of a normal DU. Three of these 4 patients presented with rest pain and underwent thrombectomy (2) or vein bypass (1), and 1 elected for nonintervention for claudication. Our results suggest that surveillance DU using criteria established for grafts placed for occlusive disease may not be useful for predicting stent graft failure in popliteal artery aneurysms. © The Author(s) 2016.

Drastic stabilization of parallel DNA hybridizations by a polylysine comb-type copolymer with hydrophilic graft chain.

PubMed

Miyoshi, Daisuke; Ueda, Yu-Mi; Shimada, Naohiko; Nakano, Shu-Ichi; Sugimoto, Naoki; Maruyama, Atsushi

2014-09-01

Electrostatic interactions play a major role in protein-DNA interactions. As a model system of a cationic protein, herein we focused on a comb-type copolymer of a polycation backbone and dextran side chains, poly(L-lysine)-graft-dextran (PLL-g-Dex), which has been reported to form soluble interpolyelectrolyte complexes with DNA strands. We investigated the effects of PLL-g-Dex on the conformation and thermodynamics of DNA oligonucleotides forming various secondary structures. Thermodynamic analysis of the DNA structures showed that the parallel conformations involved in both DNA duplexes and triplexes were significantly and specifically stabilized by PLL-g-Dex. On the basis of thermodynamic parameters, it was further possible to design DNA switches that undergo structural transition responding to PLL-g-Dex from an antiparallel duplex to a parallel triplex even with mismatches in the third strand hybridization. These results suggest that polycationic molecules are able to induce structural polymorphism of DNA oligonucleotides, because of the conformation-selective stabilization effects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comprehensive Educational Assessment for the States: The Duplex Design.

ERIC Educational Resources Information Center

Bock, R. Darrell; Mislevy, Robert

State testing programs often attempt to provide annual information for use in student guidance and qualification, school and program evaluation, and broad policy decisions. With the development of a new type of assessment instrument, the "duplex design," the several functions of state testing programs can be served in a single test…

Comprehensive Educational Assessment for the States: The Duplex Design.

ERIC Educational Resources Information Center

Bock, R. Darrell; Mislevy, Robert J.

1988-01-01

The duplex design is proposed for educational assessment within a state school system. For individual students, scaled proficiency measures that are suitable for guidance and certification at various levels of attainment are provided. For classrooms or larger units, the design can supply group level measures for evaluation and research. (SLD)

How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

PubMed

Shanker, Sudhanshu; Bandyopadhyay, Pradipta

2017-08-01

The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

QCD pairing in primordial nuggets

NASA Astrophysics Data System (ADS)

Lugones, G.; Horvath, J. E.

2003-08-01

We analyze the problem of boiling and surface evaporation of quark nuggets in the cosmological quark-hadron transition. Recently, it has been shown that QCD pairing modifies the stability properties of strange quark matter. More specifically, strange quark matter in a color-flavor locked state was found to be absolutely stable for a much wider range of the parameters than ordinary unpaired strange quark matter (G. Lugones and J. E. Horvath, Phys. Rev. D, 66, 074017 (2002)). Assuming that primordial quark nuggets are actually formed we analyze the consequences of pairing on the rates of boiling and surface evaporation in order to determine whether they could have survived.

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Orbitally limited pair-density-wave phase of multilayer superconductors

NASA Astrophysics Data System (ADS)

Möckli, David; Yanase, Youichi; Sigrist, Manfred

2018-04-01

We investigate the magnetic field dependence of an ideal superconducting vortex lattice in the parity-mixed pair-density-wave phase of multilayer superconductors within a circular cell Ginzburg-Landau approach. In multilayer systems, due to local inversion symmetry breaking, a Rashba spin-orbit coupling is induced at the outer layers. This combined with a perpendicular paramagnetic (Pauli) limiting magnetic field stabilizes a staggered layer dependent pair-density-wave phase in the superconducting singlet channel. The high-field pair-density-wave phase is separated from the low-field BCS phase by a first-order phase transition. The motivating guiding question in this paper is: What is the minimal necessary Maki parameter αM for the appearance of the pair-density-wave phase of a superconducting trilayer system? To address this problem we generalize the circular cell method for the regular flux-line lattice of a type-II superconductor to include paramagnetic depairing effects. Then, we apply the model to the trilayer system, where each of the layers are characterized by Ginzburg-Landau parameter κ0 and a Maki parameter αM. We find that when the spin-orbit Rashba interaction compares to the superconducting condensation energy, the orbitally limited pair-density-wave phase stabilizes for Maki parameters αM>10 .

Targeting human c-Myc promoter duplex DNA with actinomycin D by use of multi-way analysis of quantum-dot-mediated fluorescence resonance energy transfer.

PubMed

Gholami, Somayeh; Kompany-Zareh, Mohsen

2013-07-01

Actinomycin D (Act D), an oncogenic c-Myc promoter binder, interferes with the action of RNA polymerase. There is great demand for high-throughput technology able to monitor the activity of DNA-binding drugs. To this end, binding of 7-aminoactinomycin D (7AAD) to the duplex c-Myc promoter was investigated by use of 2D-photoluminescence emission (2D-PLE), and the resulting data were subjected to analysis by use of convenient and powerful multi-way approaches. Fluorescence measurements were performed by use of the quantum dot (QD)-conjugated c-Myc promoter. Intercalation of 7AAD within duplex base pairs resulted in efficient energy transfer from drug to QD via fluorescence resonance energy transfer (FRET). Multi-way analysis of the three-way data array obtained from titration experiments was performed by use of restricted Tucker3 and hard trilinear decomposition (HTD). These techniques enable analysis of high-dimensional and complex data from nanobiological systems which include several spectrally overlapped structures. It was almost impossible to obtain robust and meaningful information about the FRET process for such high overlap data by use of classical analysis. The soft approach had the important advantage over univariate classical methods of enabling us to investigate the source of variance in the fluorescence signal of the DNA-drug complex. It was established that hard trilinear decomposition analysis of FRET-measured data overcomes the problem of rank deficiency, enabling calculation of concentration profiles and pure spectra for all species, including non-fluorophores. The hard modeling approach was also used for determination of equilibrium constants for the hybridization and intercalation equilibria, using nonlinear fit data analysis. The intercalation constant 3.6 × 10(6) mol(-1) L and hybridization stability 1.0 × 10(8) mol(-1) L obtained were in good agreement with values reported in the literature. The analytical concentration of the QD-labeled DNA

Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170174 computers ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170-174 computers - Beale Air Force Base, Perimeter Acquisition Vehicle Entry Phased-Array Warning System, Techinical Equipment Building, End of Spencer Paul Road, north of Warren Shingle Road (14th Street), Marysville, Yuba County, CA

Effect of solution treatment on microstructure and properties of duplex stainless steel

NASA Astrophysics Data System (ADS)

Wang, X. Y.; Luo, J. M.; Huang, L. Q.; Wang, H. B.; Ma, C. W.

2017-09-01

The influence of solution treatment on microstructure and properties of 2205 duplex stainless steel (DSS) was studied. The microstructure, precipitates and corrosion resisting property were observed and analyzed by means of optical microscopy (OM), scanning electron microscopy (SEM) and electrochemical methods. The results showed that a large number of brittle σ-phase precipitates, which deteriorate the plasticity and corrosion resistance of the material, were easy to produce in the duplex stainless steel under the low temperature. The precipitation of σ-phase can be decreased and the plasticity and corrosion resistance can be improved by increasing solution temperature. In addition, the ferrite content increases with the increase of solution temperature, while less affected by cooling rate.

Solution structure of a DNA duplex containing a cis-diammineplatinum(II) 1,3-d(GTG) intrastrand cross-link, a major adduct in cells treated with the anticancer drug carboplatin.

PubMed

Teuben, J M; Bauer, C; Wang, A H; Reedijk, J

1999-09-21

The platinum 1,3-d(GXG) intrastrand cross-link is one of the adducts formed in the reaction of the antitumor drug cisplatin with DNA, and in fact the major adduct found in cells treated with the cisplatin analogue carboplatin. To determine the 3D structure of this adduct, the duplex d(CTCTGTGTCTC).d(GAGACACAGAG)], where GTG denotes a platinum 1,3-intrastrand cross-link, was prepared and studied with high-resolution (1)H NMR. The solution structure was determined using the SPEDREF protocol, which includes an iterative NOE-restrained refinement procedure. Calculated and recorded NOE spectra were found to be in good agreement (NMR R factor 22%). The studied duplex is more distorted from B-DNA than previously determined structures of the 1,2-d(GG) intrastrand adducts. The base pairing is lost for the 5'G-C and the central T-A base pair in the GTG lesion, and the central thymine is extruded from the minor groove. To accommodate this lesion, the minor groove is widened, and the 5'-guanine ribose adopts an N-type conformation. The helix is unwound locally and is significantly bent toward the major groove. Significant difference between the structural distortion of the 1, 3-d(GTG) cross-link and other Pt-DNA cross-links sheds new light on the observed differences in protein recognition of these lesions, and thus on the possible differences in mechanisms of action of the various Pt-DNA adducts formed in treatment with platinum anticancer complexes.

Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes.

PubMed

Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide

2010-07-30

Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.

Ethidium and proflavine binding to a 2',5'-linked RNA duplex.

PubMed

Horowitz, Eric D; Hud, Nicholas V

2006-12-06

Despite over 40 years of physical investigations, fundamental questions persist regarding the energetics of RNA and DNA intercalation. The dramatic unwinding of a nucleic acid duplex upon intercalation immediately suggests that the nucleic acid backbone should play a significant role in dictating the free energy of intercalation. However, the contribution of the backbone to intercalation free energy is difficult to appreciate given the intertwined energetics associated with intercalation (e.g., pi-pi stacking and solvent effects). Fluorescence titrations were used to determine the association constants of two known intercalators, proflavine and ethidium, for duplex 2',5'-linked RNA. Proflavine was found to bind 2',5' RNA with an association constant 25-fold greater than that measured for standard, 3',5'-linked RNA. In contrast, ethidium binds 2',5' RNA less favorably than standard RNA.

Stability and kinetics of G-quadruplex structures

PubMed Central

Lane, Andrew N.; Chaires, J. Brad; Gray, Robert D.; Trent, John O.

2008-01-01

In this review, we give an overview of recent literature on the structure and stability of unimolecular G-rich quadruplex structures that are relevant to drug design and for in vivo function. The unifying theme in this review is energetics. The thermodynamic stability of quadruplexes has not been studied in the same detail as DNA and RNA duplexes, and there are important differences in the balance of forces between these classes of folded oligonucleotides. We provide an overview of the principles of stability and where available the experimental data that report on these principles. Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes. Techniques that are commonly applied to the determination of the structure, stability and folding are discussed in terms of information content and limitations. Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium. The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence. PMID:18718931

Dual origin of pairing in nuclei

NASA Astrophysics Data System (ADS)

Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.

2016-11-01

The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

A Survey of Aspartate Phenylalanine and Glutamate Phenylalanine Interactions in the Protein Data Bank: Searching for Anion Pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Philip, Vivek M; Harris, Jason B; Adams, Rachel M

Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242 8249]. To study the role of anion interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused onmore » identification of Phe Asp or Glu pairs separated by less than 7 in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura Morokuma energy calculations were performed on roughly 19000 benzene formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (2 to 7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion pairs are found throughout protein structures, in helices as well as strands. Numerous pairs also had nearby cation interactions as well as potential stacking. While more than 1000 structures did not contain an anion pair, the 3134 remaining structures contained approximately 2.6 anion pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.« less

Thermal stability comparison of nanocrystalline Fe-based binary alloy pairs

DOE PAGES

Clark, Blythe G.; Hattar, Khalid Mikhiel; Marshall, Michael Thomas; ...

2016-03-24

Here, the widely recognized property improvements of nanocrystalline (NC) materials have generated significant interest, yet have been difficult to realize in engineering applications due to the propensity for grain growth in these interface-dense systems. While traditional pathways to thermal stabilization can slow the mobility of grain boundaries, recent theories suggest that solute segregation in NC alloy can reduce the grain boundary energy such that thermodynamic stabilization is achieved. Following the predictions of Murdock et al., here we compare for the first time the thermal stability of a predicted NC stable alloy (Fe-10at.% Mg) with a predicted non-NC stable alloy (Fe-10at.%more » Cu) using the same processing and characterization methodologies. Results indicate improved thermal stability of the Fe-Mg alloy in comparison to the Fe-Cu, and observed microstructures are consistent with those predicted by Monte Carlo simulations.« less

Duplex-imprinted nano well arrays for promising nanoparticle assembly

NASA Astrophysics Data System (ADS)

Li, Xiangping; Manz, Andreas

2018-02-01

A large area nano-duplex-imprint technique is presented in this contribution using natural cicada wings as stamps. The glassy wings of the cicada, which are abundant in nature, exhibit strikingly interesting nanopillar structures over their membrane. This technique, with excellent performance despite the nonplanar surface of the wings, combines both top-down and bottom-up nanofabrication techniques. It transitions micro-nanofabrication from a cleanroom environment to the bench. Two different materials, dicing tape with an acrylic layer and a UV optical adhesive, are used to make replications at the same time, thus achieving duplex imprinting. The promise of a large volume of commercial manufacturing of these nanostructure elements can be envisaged through this contribution to speeding up the fabrication process and achieving a higher throughput. The contact angle of the replicated nanowell arrays before and after oxygen plasma was measured. Gold nanoparticles (50 nm) were used to test how the nanoparticles behaved on the untreated and plasma-treated replica surface. The experiments show that promising nanoparticle self-assembly can be obtained.

Direct Determination of the Equilibrium Unbinding Potential Profile for a Short DNA Duplex from Force Spectroscopy Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noy, A

2004-05-04

Modern force microscopy techniques allow researchers to use mechanical forces to probe interactions between biomolecules. However, such measurements often happen in non-equilibrium regime, which precludes straightforward extraction of the equilibrium energy information. Here we use the work averaging method based on Jarzynski equality to reconstruct the equilibrium interaction potential from the unbinding of a complementary 14-mer DNA duplex from the results of non-equilibrium single-molecule measurements. The reconstructed potential reproduces most of the features of the DNA stretching transition, previously observed only in equilibrium stretching of long DNA sequences. We also compare the reconstructed potential with the thermodynamic parameters of DNAmore » duplex unbinding and show that the reconstruction accurately predicts duplex melting enthalpy.« less

Efficacy of duplex ultrasound surveillance after infrainguinal vein bypass may be enhanced by identification of characteristics predictive of graft stenosis development.

PubMed

Tinder, Chelsey N; Chavanpun, Joe P; Bandyk, Dennis F; Armstrong, Paul A; Back, Martin R; Johnson, Brad L; Shames, Murray L

2008-09-01

Controversy regarding the efficacy of duplex ultrasound surveillance after infrainguinal vein bypass led to an analysis of patient and bypass graft characteristics predictive for development of graft stenosis and a decision of secondary intervention. Retrospective analysis of a contemporary, consecutive series of 353 clinically successful infrainguinal vein bypasses performed in 329 patients for critical (n = 284; 80%) or noncritical (n = 69; 20%) limb ischemia enrolled in a surveillance program to identify and repair duplex-detected graft stenosis. Variables correlated with graft stenosis and bypass repair included: procedure indication, conduit type (saphenous vs nonsaphenous vein; reversed vs nonreversed orientation), prior bypass graft failure, postoperative ankle-brachial index (ABI) < 0.85, and interpretation of the first duplex surveillance study as "normal" or "abnormal" based on peak systolic velocity (PSV) and velocity ratio (Vr) criteria. Overall, 126 (36%) of the 353 infrainguinal bypasses had 174 secondary interventions (endovascular, 100; surgery, 74) based on duplex surveillance; resulting in 3-year Kaplan-Meier primary (46%), assisted-primary (80%), and secondary (81%) patency rates. Characteristics predictive of duplex-detected stenosis leading to intervention (PSV: 443 +/- 94 cm/s; Vr: 8.6 +/- 9) were: "abnormal" initial duplex testing indicating moderate (PSV: 180-300 cm/s, Vr: 2-3.5) stenosis (P < .0001), non-single segment saphenous vein conduit (P < .01), warfarin drug therapy (P < .01), and redo bypass grafting (P < .001). Procedure indication, postoperative ABI level, statin drug therapy, and vein conduit orientation were not predictive of graft revision. The natural history of 141 (40%) bypasses with an abnormal first duplex scan differed from "normal" grafts by more frequent (51% vs 24%, P < .001) and earlier (7 months vs 11 months) graft revision for severe stenosis and a lower 3-year assisted primary patency (68% vs 87%; P < .001). In 52

Validation of a novel venous duplex ultrasound objective structured assessment of technical skills for the assessment of venous reflux.

PubMed

Jaffer, Usman; Normahani, Pasha; Lackenby, Kimberly; Aslam, Mohammed; Standfield, Nigel J

2015-01-01

Duplex ultrasound measurement of reflux time is central to the diagnosis of venous incompetence. We have developed an assessment tool for Duplex measurement of venous reflux for both simulator and patient-based training. A novel assessment tool, Venous Duplex Ultrasound Assessment of Technical Skills (V-DUOSATS), was developed. A modified DUOSATS was used for simulator training. Participants of varying skill level were invited to viewed an instructional video and were allowed ample time to familiarize with the Duplex equipment. Attempts made by the participants were recorded and independently assessed by 3 expert assessors and 5 novice assessors using the modified V-DUOSATS. "Global" assessment was also done by expert assessors on a 4-point Likert scale. Content, construct, and concurrent validities as well as reliability were evaluated. Content and construct validity as well as reliability were demonstrated. Receiver operator characteristic analysis-established cut points of 19/22 and 21/30 were most appropriate for simulator and patient-based assessment, respectively. We have validated a novel assessment tool for Duplex venous reflux measurement. Further work is required to establish transference validity of simulator training to improve skill in scanning patients. We have developed and validated V-DUOSATS for simulator training. Copyright © 2015 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Molecular detection of infectious bronchitis and Newcastle disease viruses in broiler chickens with respiratory signs using Duplex RT-PCR.

PubMed

Saba Shirvan, Aylar; Mardani, Karim

2014-01-01

Infectious bronchitis (IB) and Newcastle disease (ND) are highly contagious and the most economically important diseases of the poultry affecting respiratory tract and causing economic losses in poultry industry throughout the world. In the present study, the simultaneous detection and differentiation of causative agents of these diseases were investigated using duplex-RT-PCR. RNA was extracted from vaccinal and reference strains of infectious bronchitis virus (IBV) and Newcastle disease virus (NDV) and then cDNA was synthesized. Using two universal primer sets for detection of IBV and NDV, the duplex-RT-PCR was developed. In order to assess the efficiency of the developed duplex RT-PCR, a number of 12 broiler farms with the symptoms of respiratory tract infection was sampled (trachea, lung and kidney were sampled from affected birds suspicious for IBV and NDV infections). After RNA extraction from tissues and cDNA synthesis, the presence of IBV and NDV genome were investigated using duplex-PCR. The results showed that three of twelve examined broiler farms were positive for IBV and two farms were positive for NDV and IBV. The results revealed that the duplex-RT-PCR is a quick and sensitive procedure for simultaneously detecting IBV and NDV in birds with respiratory infections.

Human CST has independent functions during telomere duplex replication and C-strand fill-in

PubMed Central

Wang, Feng; Stewart, Jason A.; Kasbek, Christopher; Zhao, Yong; Wright, Woodring E.; Price, Carolyn M.

2012-01-01

Summary Human CST (CTC1-STN1-TEN1) is an RPA-like complex that is needed for efficient replication through the telomere duplex and genome-wide replication restart after fork stalling. Here we show that STN1/CST has a second function in telomere replication during G-overhang maturation. Analysis of overhang structure after STN1 depletion revealed normal kinetics for telomerase-mediated extension in S-phase but a delay in subsequent overhang shortening. This delay resulted from a defect in C-strand fill-in. Short telomeres exhibited the fill-in defect but normal telomere duplex replication, indicating that STN1/CST functions independently in these processes. Our work also indicates that the requirement for STN1/CST in telomere duplex replication correlates with increasing telomere length and replication stress. Our results provide the first direct evidence that STN1/CST participates in C-strand fill-in. They also demonstrate that STN1/CST participates in two mechanistically separate steps during telomere replication and identify CST as a novel replication factor that solves diverse replication-associated problems. PMID:23142664

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Nitride alloy layer formation of duplex stainless steel using nitriding process

NASA Astrophysics Data System (ADS)

Maleque, M. A.; Lailatul, P. H.; Fathaen, A. A.; Norinsan, K.; Haider, J.

2018-01-01

Duplex stainless steel (DSS) shows a good corrosion resistance as well as the mechanical properties. However, DSS performance decrease as it works under aggressive environment and at high temperature. At the mentioned environment, the DSS become susceptible to wear failure. Surface modification is the favourable technique to widen the application of duplex stainless steel and improve the wear resistance and its hardness properties. Therefore, the main aim of this work is to nitride alloy layer on the surface of duplex stainless steel by the nitriding process temperature of 400°C and 450°C at different time and ammonia composition using a horizontal tube furnace. The scanning electron microscopy and x-ray diffraction analyzer are used to analyse the morphology, composition and the nitrided alloy layer for treated DSS. The micro hardnesss Vickers tester was used to measure hardness on cross-sectional area of nitrided DSS. After nitriding, it was observed that the hardness performance increased until 1100 Hv0.5kgf compared to substrate material of 250 Hv0.5kgf. The thickness layer of nitride alloy also increased from 5μm until 100μm due to diffusion of nitrogen on the surface of DSS. The x-ray diffraction results showed that the nitride layer consists of iron nitride, expanded austenite and chromium nitride. It can be concluded that nitride alloy layer can be produced via nitriding process using tube furnace with significant improvement of microstructural and hardness properties.

Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

PubMed

Pang, Jie; Zhang, Ziping; Jin, Haizhu

2016-03-15

Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright

Adjacent bin stability evaluating for feature description

NASA Astrophysics Data System (ADS)

Nie, Dongdong; Ma, Qinyong

2018-04-01

Recent study improves descriptor performance by accumulating stability votes for all scale pairs to compose the local descriptor. We argue that the stability of a bin depends on the differences across adjacent pairs more than the differences across all scale pairs, and a new local descriptor is composed based on the hypothesis. A series of SIFT descriptors are extracted from multiple scales firstly. Then the difference value of the bin across adjacent scales is calculated, and the stability value of a bin is calculated based on it and accumulated to compose the final descriptor. The performance of the proposed method is evaluated with two popular matching datasets, and compared with other state-of-the-art works. Experimental results show that the proposed method performs satisfactorily.

Ultrashort Nucleic Acid Duplexes Exhibit Long Wormlike Chain Behavior with Force-Dependent Edge Effects

NASA Astrophysics Data System (ADS)

Whitley, Kevin D.; Comstock, Matthew J.; Chemla, Yann R.

2018-02-01

Despite their importance in biology and use in nanotechnology, the elastic behavior of nucleic acids on "ultrashort" (<15 nt ) length scales remains poorly understood. Here, we use optical tweezers combined with fluorescence imaging to observe directly the hybridization of oligonucleotides (7-12 nt) to a complementary strand under tension and to measure the difference in end-to-end extension between the single-stranded and duplex states. Data are consistent with long-polymer models at low forces (<8 pN ) but smaller than predicted at higher forces (>8 pN ), the result of the sequence-dependent duplex edge effects.

Development of a Duplex Ultrasound Simulator and Preliminary Validation of Velocity Measurements in Carotid Artery Models.

PubMed

Zierler, R Eugene; Leotta, Daniel F; Sansom, Kurt; Aliseda, Alberto; Anderson, Mark D; Sheehan, Florence H

2016-07-01

Duplex ultrasound scanning with B-mode imaging and both color Doppler and Doppler spectral waveforms is relied upon for diagnosis of vascular pathology and selection of patients for further evaluation and treatment. In most duplex ultrasound applications, classification of disease severity is based primarily on alterations in blood flow velocities, particularly the peak systolic velocity (PSV) obtained from Doppler spectral waveforms. We developed a duplex ultrasound simulator for training and assessment of scanning skills. Duplex ultrasound cases were prepared from 2-dimensional (2D) images of normal and stenotic carotid arteries by reconstructing the common carotid, internal carotid, and external carotid arteries in 3 dimensions and computationally simulating blood flow velocity fields within the lumen. The simulator displays a 2D B-mode image corresponding to transducer position on a mannequin, overlaid by color coding of velocity data. A spectral waveform is generated according to examiner-defined settings (depth and size of the Doppler sample volume, beam steering, Doppler beam angle, and pulse repetition frequency or scale). The accuracy of the simulator was assessed by comparing the PSV measured from the spectral waveforms with the true PSV which was derived from the computational flow model based on the size and location of the sample volume within the artery. Three expert examiners made a total of 36 carotid artery PSV measurements based on the simulated cases. The PSV measured by the examiners deviated from true PSV by 8% ± 5% (N = 36). The deviation in PSV did not differ significantly between artery segments, normal and stenotic arteries, or examiners. To our knowledge, this is the first simulation of duplex ultrasound that can create and display real-time color Doppler images and Doppler spectral waveforms. The results demonstrate that an examiner can measure PSV from the spectral waveforms using the settings on the simulator with a mean absolute error

Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

PubMed

Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

1997-05-16

The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

Effect of Rolling and Subsequent Annealing on Microstructure, Microtexture, and Properties of an Experimental Duplex Stainless Steel

NASA Astrophysics Data System (ADS)

Mandal, Arka; Patra, Sudipta; Chakrabarti, Debalay; Singh, Shiv Brat

2017-12-01

A lean duplex stainless steel (LDSS) has been prepared with low-N content and processed by different thermo-mechanical schedules, similar to the industrial processing that comprised hot-rolling, cold-rolling, and annealing treatments. The microstructure developed in the present study on low-N LDSS has been compared to that of high-N LDSS as reported in the literature. As N is an austenite stabilizer, lower-N content reduced the stability of austenite and the austenite content in low-N LDSS with respect to the conventional LDSS. Due to low stability of austenite in low-N LDSS, cold rolling resulted in strain-induced martensitic transformation and the reversion of martensite to austenite during subsequent annealing contributed to significant grain refinement within the austenite regions. δ-ferrite grains in low-N LDSS, on the other hand, are refined by extended recovery mechanism. Initial solidification texture (mainly cube texture) within the δ-ferrite region finally converted into gamma-fiber texture after cold rolling and annealing. Although MS-brass component dominated the austenite texture in low-N LDSS after hot rolling and cold rolling, that even transformed into alpha-fiber texture after the final annealing. Due to the significant grain refinement and formation of beneficial texture within both austenite and ferrite, good combination of strength and ductility has been achieved in cold-rolled and annealed sample of low-N LDSS steel.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

PubMed

Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

PubMed Central

Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

Thermodynamic stability of RNA structures formed by CNG trinucleotide repeats. Implication for prediction of RNA structure.

PubMed

Broda, Magdalena; Kierzek, Elzbieta; Gdaniec, Zofia; Kulinski, Tadeusz; Kierzek, Ryszard

2005-08-16

Trinucleotide repeat expansion diseases (TREDs) are correlated with elongation of CNG DNA and RNA repeats to pathological level. This paper shows, for the first time, complete data concerning thermodynamic stabilities of RNA with CNG trinucleotide repeats. Our studies include the stability of oligoribonucleotides composed of two to seven of CAG, CCG, CGG, and CUG repeats. The thermodynamic parameters of helix propagation correlated with the presence of multiple N-N mismatches within CNG RNA duplexes were also determined. Moreover, the total stability of CNG RNA hairpins, as well as the contribution of trinucleotide repeats placed only in the stem or loop regions, was evaluated. The improved thermodynamic parameters allow to predict much more accurately the thermodynamic stabilities and structures of CNG RNAs.

Toward a 3D dynamic model of a faulty duplex ball bearing

NASA Astrophysics Data System (ADS)

Kogan, Gideon; Klein, Renata; Kushnirsky, Alex; Bortman, Jacob

2015-03-01

Bearings are vital components for safe and proper operation of machinery. Increasing efficiency of bearing diagnostics usually requires training of health and usage monitoring systems via expensive and time-consuming ground calibration tests. The main goal of this research, therefore, is to improve bearing dynamics modeling tools in order to reduce the time and budget needed to implement the health and usage monitoring approach. The proposed three-dimensional ball bearing dynamic model is based on the classic dynamic and kinematic equations. Interactions between the bodies are simulated using non-linear springs combined with dampers described by Hertz-type contact relation. The force friction is simulated using the hyperbolic-tangent function. The model allows simulation of a wide range of mechanical faults. It is validated by comparison to known bearing behavior and to experimental results. The model results are verified by demonstrating numerical convergence. The model results for the two cases of single and duplex angular ball bearings with axial deformation in the outer ring are presented. The qualitative investigation provides insight into bearing dynamics, the sensitivity study generalizes the qualitative findings for similar cases, and the comparison to the test results validates model reliability. The article demonstrates the variety of the cases that the 3D bearing model can simulate and the findings to which it may lead. The research allowed the identification of new patterns generated by single and duplex bearings with axially deformed outer race. It also enlightened the difference between single and duplex bearing manifestation. In the current research the dynamic model enabled better understanding of the physical behavior of the faulted bearings. Therefore, it is expected that the modeling approach has the potential to simplify and improve the development process of diagnostic algorithms. • A deformed outer race of a single axially loaded bearing is

DNA CTG triplet repeats involved in dynamic mutations of neurologically related gene sequences form stable duplexes

NASA Technical Reports Server (NTRS)

Smith, G. K.; Jie, J.; Fox, G. E.; Gao, X.

1995-01-01

DNA triplet repeats, 5'-d(CTG)n and 5'-d(CAG)n, are present in genes which have been implicated in several neurodegenerative disorders. To investigate possible stable structures formed by these repeating sequences, we have examined d(CTG)n, d(CAG)n and d(CTG).d(CAG)n (n = 2 and 3) using NMR and UV optical spectroscopy. These studies reveal that single stranded (CTG)n (n > 2) forms stable, antiparallel helical duplexes, while the single stranded (CAG)n requires at least three repeating units to form a duplex. NMR and UV melting experiments show that the Tm increases in the order of [(CAG)3]2 < [(CTG)3]2 << (CAG)3.(CTG)3. The (CTG)3 duplex is stable and exhibits similar NMR spectra in solutions containing 0.1-4 M NaCl and at a pH range from 4.6 to 8.8. The (CTG)3 duplex, which contains multiple-T.T mismatches, displays many NMR spectral characteristics similar to those of B-form DNA. However, unique NOE and 1H-31P coupling patterns associated with the repetitive T.T mismatches in the CTG repeats are discerned. These results, in conjunction with recent in vitro studies suggest that longer CTG repeats may form hairpin structures, which can potentially cause interruption in replication, leading to dynamic expansion or deletion of triplet repeats.

Phase transitions in the q -voter model with noise on a duplex clique

NASA Astrophysics Data System (ADS)

Chmiel, Anna; Sznajd-Weron, Katarzyna

2015-11-01

We study a nonlinear q -voter model with stochastic noise, interpreted in the social context as independence, on a duplex network. To study the role of the multilevelness in this model we propose three methods of transferring the model from a mono- to a multiplex network. They take into account two criteria: one related to the status of independence (LOCAL vs GLOBAL) and one related to peer pressure (AND vs OR). In order to examine the influence of the presence of more than one level in the social network, we perform simulations on a particularly simple multiplex: a duplex clique, which consists of two fully overlapped complete graphs (cliques). Solving numerically the rate equation and simultaneously conducting Monte Carlo simulations, we provide evidence that even a simple rearrangement into a duplex topology may lead to significant changes in the observed behavior. However, qualitative changes in the phase transitions can be observed for only one of the considered rules: LOCAL&AND. For this rule the phase transition becomes discontinuous for q =5 , whereas for a monoplex such behavior is observed for q =6 . Interestingly, only this rule admits construction of realistic variants of the model, in line with recent social experiments.

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

PubMed Central

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Corrosion behavior of 2205 duplex stainless steel.

PubMed

Platt, J A; Guzman, A; Zuccari, A; Thornburg, D W; Rhodes, B F; Oshida, Y; Moore, B K

1997-07-01

The corrosion of 2205 duplex stainless steel was compared with that of AISI type 316L stainless steel. The 2205 stainless steel is a potential orthodontic bracket material with low nickel content (4 to 6 wt%), whereas the 316L stainless steel (nickel content: 10 to 14 wt%) is a currently used bracket material. Both stainless steels were subjected to electrochemical and immersion (crevice) corrosion tests in 37 degrees C, 0.9 wt% sodium chloride solution. Electrochemical testing indicates that 2205 has a longer passivation range than 316L. The corrosion rate of 2205 was 0.416 MPY (milli-inch per year), whereas 316L exhibited 0.647 MPY. When 2205 was coupled to 316L with equal surface area ratio, the corrosion rate of 2205 reduced to 0.260 MPY, indicating that 316L stainless steel behaved like a sacrificial anode. When 316L is coupled with NiTi, TMA, or stainless steel arch wire and was subjected to the immersion corrosion test, it was found that 316L suffered from crevice corrosion. On the other hand, 2205 stainless steel did not show any localized crevice corrosion, although the surface of 2205 was covered with corrosion products, formed when coupled to NiTi and stainless steel wires. This study indicates that considering corrosion resistance, 2205 duplex stainless steel is an improved alternative to 316L for orthodontic bracket fabrication when used in conjunction with titanium, its alloys, or stainless steel arch wires.

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng; Li, Feng; Ganguly, Manjori

2008-11-14

Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less

Consequences of Normalizing Transcriptomic and Genomic Libraries of Plant Genomes Using a Duplex-Specific Nuclease and Tetramethylammonium Chloride

PubMed Central

Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

2013-01-01

Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce. PMID:23409088

Consequences of normalizing transcriptomic and genomic libraries of plant genomes using a duplex-specific nuclease and tetramethylammonium chloride.

PubMed

Matvienko, Marta; Kozik, Alexander; Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

2013-01-01

Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce.

Comparison of duplex PCR and phenotypic analysis in differentiating Candida dubliniensis from Candida albicans from oral samples.

PubMed

Sampath, Asanga; Weerasekera, Manjula; Dilhari, Ayomi; Gunasekara, Chinthika; Bulugahapitiya, Uditha; Fernando, Neluka; Samaranayake, Lakshman

2017-12-01

Candida dubliniensis shares a wide range of phenotypic characteristics with Candida albicans including a common trait called germ tube positivity. Hence, laboratory differentiation of these two species is cumbersome. Duplex PCR analyses for C. albicans and C. dubliniensis was performed directly on DNA extracted from a total of 122 germ tube positive isolates derived from 100 concentrated oral rinse samples from a random cohort of diabetics attending a clinic in Sri Lanka. These results were confirmed by DNA sequencing of internal transcribed spacer (ITS) region of rDNA of the yeasts. Performance efficacy of duplex PCR was then compared with phenotypic identification using a standard battery of phenotypic tests. Of the 122 germ tube positive isolates three were identified by duplex PCR as C. dubliniensis and the remainder as C. albicans. On the contrary, when the standard phenotypic tests, sugar assimilation and chlamydospore formation, were used to differentiate the two species 13 germ tube positive isolates were erroneously identified as C. dubliniensis. Duplex PCR was found to be rapid, sensitive and more specific than phenotypic identification methods in discriminating C. dubliniensis from C. albicans. This is also the first report on the oral carriage of C. dubliniensis in a Sri Lankan population.

A survey of aspartate-phenylalanine and glutamate-phenylalanine interactions in the protein data bank: searching for anion-π pairs.

PubMed

Philip, Vivek; Harris, Jason; Adams, Rachel; Nguyen, Don; Spiers, Jeremy; Baudry, Jerome; Howell, Elizabeth E; Hinde, Robert J

2011-04-12

Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-π pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-π interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe-Asp or -Glu pairs separated by less than 7 Å in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-π pairs are found throughout protein structures, in helices as well as β strands. Numerous pairs also had nearby cation-π interactions as well as potential π-π stacking. While more than 1000 structures did not contain an anion-π pair, the 3134 remaining structures contained approximately 2.6 anion-π pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.