Sample records for parasitology

  1. ForPeerReview Parasitology

    E-print Network

    Breitling, Rainer

    ForPeerReview Parasitology #12;ForPeerReview 1 THE SILICON Faculty of Biomolecular and Life Sciences and Wellcome Centre of Molecular Parasitology, University. M. Bakker, phone: +31 (0) 50 361 1542, e-mail: b.m.bakker@med.umcg.nl Page 1 of 22 Parasitology #12

  2. Vet Parasitology Staff 

    E-print Network

    Unknown

    2011-08-17

    OF SCIENCE August 1964 Ma]or Sub)cot: Veterinary Parasitology THE INFECTIVITY OF BUNOSTOMUM PHLEBOTOMUM TO SHEEP~ RABBITS AND GUINEA PIGS A Thesis By GARY DAVID BORING Approved as to style and content by: i Ma (Chairman of Committee) /7 ~ 3... with the hookworm ~no to ~hl hut u, 1 the 4 lf. Jour. P . , 33. 53 . 1947): 18 (abstract). 20 12. Noble, E. R. , and Noble, G. A. : Parasitology, The Biology of Animal Parasites. 1st ed. Lea & Febiger, 1961, Philadelphia, Pa. 13. 9 tfltt, ). W. : H* t 9 if 1...

  3. [Parasitism and ecological parasitology].

    PubMed

    Balashov, Iu S

    2011-01-01

    Parasitism as one of the life modes is a general biological phenomenon and is a characteristic of all viruses, many taxa of bacteria, fungi, protists, metaphytes, and metazoans. Zooparasitology is focused on studies of parasitic animals, particularly, on their taxonomy, anatomy, life cycles, host-parasite relations, biocoenotic connections, and evolution. Ecological parasitology is a component of ecology, as the scientific study of the relation of living organisms with each other and their surroundings. In the present paper, critical analysis of the problems, main postulates, and terminology of the modern ecological parasitology is given. PMID:21874841

  4. 42 CFR 493.1204 - Condition: Parasitology.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ...2010-10-01 false Condition: Parasitology. 493.1204 Section 493...Testing § 493.1204 Condition: Parasitology. If the laboratory provides services in the subspecialty of Parasitology, the laboratory must meet the...

  5. 42 CFR 493.1204 - Condition: Parasitology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...2013-10-01 false Condition: Parasitology. 493.1204 Section 493...Testing § 493.1204 Condition: Parasitology. If the laboratory provides services in the subspecialty of Parasitology, the laboratory must meet the...

  6. 42 CFR 493.1204 - Condition: Parasitology.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ...2011-10-01 false Condition: Parasitology. 493.1204 Section 493...Testing § 493.1204 Condition: Parasitology. If the laboratory provides services in the subspecialty of Parasitology, the laboratory must meet the...

  7. 42 CFR 493.917 - Parasitology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...2013-10-01 2013-10-01 false Parasitology. 493.917 Section 493.917...and Subspecialty § 493.917 Parasitology. (a) Types of services offered by laboratories. In parasitology there are two types of...

  8. 42 CFR 493.917 - Parasitology.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...2012-10-01 2012-10-01 false Parasitology. 493.917 Section 493.917...and Subspecialty § 493.917 Parasitology. (a) Types of services offered by laboratories. In parasitology there are two types of...

  9. 42 CFR 493.1204 - Condition: Parasitology.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...2014-10-01 false Condition: Parasitology. 493.1204 Section 493...Testing § 493.1204 Condition: Parasitology. If the laboratory provides services in the subspecialty of Parasitology, the laboratory must meet the...

  10. 42 CFR 493.1204 - Condition: Parasitology.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...2012-10-01 false Condition: Parasitology. 493.1204 Section 493...Testing § 493.1204 Condition: Parasitology. If the laboratory provides services in the subspecialty of Parasitology, the laboratory must meet the...

  11. 42 CFR 493.917 - Parasitology.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...2014-10-01 2014-10-01 false Parasitology. 493.917 Section 493.917...and Subspecialty § 493.917 Parasitology. (a) Types of services offered by laboratories. In parasitology there are two types of...

  12. The future of veterinary parasitology

    Microsoft Academic Search

    G. C. Coles

    2001-01-01

    Current evidence suggests research in veterinary parasitology is in decline despite its importance. This is particularly true in the UK where research funds have been diverted into BSE. Decline in interest in veterinary parasitology is at least in part due to the success of major pharmaceutical companies in producing a range of effective and safe anti-parasitic drugs. Research is needed

  13. Parasitology http://journals.cambridge.org/PAR

    E-print Network

    Schnaufer, Achim

    Parasitology http://journals.cambridge.org/PAR Additional services for Parasitology: Email alerts Parasitology / Volume 139 / Special Issue 09 / August 2012, pp 1168 1177 DOI: 10.1017/S0031182012000443 brucei cytoskeleton: advances and opportunities. Parasitology, 139, pp 11681177 doi:10.1017/S

  14. Parasitology http://journals.cambridge.org/PAR

    E-print Network

    Paris-Sud XI, Université de

    Parasitology http://journals.cambridge.org/PAR Additional services for Parasitology: Email alerts. BELTRAN, R. POULIN and C. LAGRUE Parasitology / FirstView Article / October 2012, pp 1 9 DOI: 10.1017/S parvum (Trematoda) life history strategy, size and egg production. Parasitology, Available on CJO doi:10

  15. Wellcome Trust Centre for Molecular Parasitology

    E-print Network

    Rambaut, Andrew

    Wellcome Trust Centre for Molecular Parasitology www.glasgow.ac.uk/centres/wtcmp Study Parasitology infections....... Parasitology Parasitic Worm Izzy #12;#12;#12;#12;Ed Izzy #12;Parasites in Glasgow Most Trust Centre for Molecular Parasitology we work on how parasites such as malaria, sleeping sickness

  16. ELSEVIER Molecular and Biochemical Parasitology 70 (1995) 95-106 PARASITOLOGY

    E-print Network

    Schnaufer, Achim

    1995-01-01

    ELSEVIER Molecular and Biochemical Parasitology 70 (1995) 95-106 MOLECULAR iZkEMICAL PARASITOLOGY. /Molecular and Biochemical Parasitology 70 (1995) 95-106 tode eggshells, and in particular of such modified

  17. 42 CFR 493.1264 - Standard: Parasitology.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 5 2012-10-01 2012-10-01 false Standard: Parasitology. 493.1264 Section 493.1264 Public Health ...Nonwaived Testing Analytic Systems § 493.1264 Standard: Parasitology. (a) The laboratory must have available a...

  18. 42 CFR 493.1264 - Standard: Parasitology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 5 2013-10-01 2013-10-01 false Standard: Parasitology. 493.1264 Section 493.1264 Public Health ...Nonwaived Testing Analytic Systems § 493.1264 Standard: Parasitology. (a) The laboratory must have available a...

  19. 42 CFR 493.1264 - Standard: Parasitology.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 5 2014-10-01 2014-10-01 false Standard: Parasitology. 493.1264 Section 493.1264 Public Health ...Nonwaived Testing Analytic Systems § 493.1264 Standard: Parasitology. (a) The laboratory must have available a...

  20. RESEARCH ARTICLE Parasitological Analyses of the Male Chimpanzees (Pan

    E-print Network

    Muehlenbein, Michael

    RESEARCH ARTICLE Parasitological Analyses of the Male Chimpanzees (Pan troglodytes schweinfurthii of primate ecological parasitology are warranted. For meaningful comparisons to be made, it is important Wiley-Liss, Inc. Key words: intestinal parasites; chimpanzee; parasite richness; ecological parasitology

  1. ELSEVIER Molecular and Biochemical Parasitology 68 (1994) 155-159 PARASITOLOGY

    E-print Network

    Simpson, Larry

    1994-01-01

    ELSEVIER Molecular and Biochemical Parasitology 68 (1994) 155-159 MOLECULAR AND BIOCHE~CAL PARASITOLOGY Short communication Editing and misediting of transcripts of the kinetoplast maxicircle G5 (ND3L/ Molecular and Biochemical Parasitology 68 (1994) 155-159 base-pairing with the cognate gRNA [17]. Another

  2. 42 CFR 493.829 - Standard; Parasitology.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 5 2010-10-01 2010-10-01 false Standard; Parasitology. 493.829 Section 493.829 Public Health CENTERS...Any Combination of These Tests § 493.829 Standard; Parasitology. (a) Failure to attain an overall testing event...

  3. 42 CFR 493.829 - Standard; Parasitology.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 5 2014-10-01 2014-10-01 false Standard; Parasitology. 493.829 Section 493.829 Public Health CENTERS...Any Combination of These Tests § 493.829 Standard; Parasitology. (a) Failure to attain an overall testing event...

  4. 42 CFR 493.829 - Standard; Parasitology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 5 2013-10-01 2013-10-01 false Standard; Parasitology. 493.829 Section 493.829 Public Health CENTERS...Any Combination of These Tests § 493.829 Standard; Parasitology. (a) Failure to attain an overall testing event...

  5. 42 CFR 493.829 - Standard; Parasitology.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 5 2011-10-01 2011-10-01 false Standard; Parasitology. 493.829 Section 493.829 Public Health CENTERS...Any Combination of These Tests § 493.829 Standard; Parasitology. (a) Failure to attain an overall testing event...

  6. 42 CFR 493.829 - Standard; Parasitology.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 5 2012-10-01 2012-10-01 false Standard; Parasitology. 493.829 Section 493.829 Public Health CENTERS...Any Combination of These Tests § 493.829 Standard; Parasitology. (a) Failure to attain an overall testing event...

  7. EXPERIMENTAL PARASITOLOGY 89, 296303 (1998) ARTICLE NO. PR974277

    E-print Network

    Morrissette, Naomi

    1998-01-01

    EXPERIMENTAL PARASITOLOGY 89, 296­303 (1998) ARTICLE NO. PR974277 Toxoplasma gondii: A Family with the cytoskeleton. Experimen- tal Parasitology 89, 296­303. Antigens associated with the conoid and apical pellicle

  8. Molecular and Biochemical Parasitology 105 (2000) 163167 Short communication

    E-print Network

    Beverley, Stephen M.

    2000-01-01

    Molecular and Biochemical Parasitology 105 (2000) 163­167 Short communication Tests of heterologous September 1999 Keywords: Heterologous expression; RNA polymerase I; Kinetoplastida; Trypanosoma brucei www.elsevier.com/locate/parasitology.E. Clayton et al. / Molecular and Biochemical Parasitology 105 (2000) 163­167164 These were transfected

  9. Molecular and Biochemical Parasitology 108 (2000) 249252 Short communication

    E-print Network

    Beverley, Stephen M.

    2000-01-01

    Molecular and Biochemical Parasitology 108 (2000) 249­252 Short communication Blasticidin; Blasticidin S; Blasticidin deaminase; Shuttle vector; Transfection www.elsevier.com/locate/parasitology-6851(00)00210-3 #12;S. Goyard, S.M. Be6erley / Molecular and Biochemical Parasitology 108 (2000) 249­252250 only two

  10. Molecular & Biochemical Parasitology 112 (2001) 139141 Short communication

    E-print Network

    2001-01-01

    Molecular & Biochemical Parasitology 112 (2001) 139­141 Short communication PCR effectiveness; Sex determination of larvae; PCR www.parasitology-online.com. Schistosoma mansoni is a digenean. / Molecular & Biochemical Parasitology 112 (2001) 139­141140 The S. mansoni strain was isolated from man

  11. Molecular and Biochemical Parasitology 110 (2000) 405407 Short communication

    E-print Network

    Beverley, Stephen M.

    2000-01-01

    Molecular and Biochemical Parasitology 110 (2000) 405­407 Short communication Transposition Received 14 April 2000; accepted 12 May 2000 www.elsevier.com/locate/parasitology Plasmodium falciparum Parasitology 110 (2000) 405­407406 fainter bands suggestive of transposition, as seen previously in Leishmania

  12. Molecular and Biochemical Parasitology 107 (2000) 123128 Short communication

    E-print Network

    Spang, Rainer

    2000-01-01

    Molecular and Biochemical Parasitology 107 (2000) 123­128 Short communication Cross Received 7 October 1999; received in revised form 3 December 1999; accepted 15 December 1999 www.elsevier.com/locate/parasitology Parasitology 107 (2000) 123­128124 Two constructs were used for the gene replace- ment which were both

  13. Molecular & Biochemical Parasitology 114 (2001) 245247 Short communication

    E-print Network

    Cross, George

    2001-01-01

    Molecular & Biochemical Parasitology 114 (2001) 245­247 Short communication Virulence¨hme a , George A.M. Cross a, *,3 a Laboratory of Molecular Parasitology, The Rockefeller Uni6ersity, 1230 York A6 www.parasitology-online.com. The infectious stages of Trypanosoma brucei are cov- ered by a homogenous

  14. Molecular & Biochemical Parasitology 113 (2001) 337340 Short communication

    E-print Network

    Beverley, Stephen M.

    2001-01-01

    Molecular & Biochemical Parasitology 113 (2001) 337­340 Short communication A survey); Expression profiling; Gene discovery; Transcriptional regulation; Chromatin www.parasitology-6851(01)00227-4 #12;N.S. Akopyants et al. / Molecular & Biochemical Parasitology 113 (2001) 337­340338 (intergenic

  15. RESEARCH NOTES 1509 and metacyclogenesis of Leishmania infantum. Parasitology Re-

    E-print Network

    Schall, Joseph J.

    RESEARCH NOTES 1509 and metacyclogenesis of Leishmania infantum. Parasitology Re- search 85: 300 in amastigotes and promastigotes. Experimental Parasitology 59: 265­274. MULICHAK, A. M., J. E. WILSON, K and glycosomes. Molecular and Biochem- ical Parasitology 115: 19­28. QUIJADA, L., M. SOTO, C. ALONSO, AND J. M

  16. Molecular & Biochemical Parasitology 117 (2001) 211215 Short communication

    E-print Network

    Cross, George

    2001-01-01

    Molecular & Biochemical Parasitology 117 (2001) 211­215 Short communication Expression Hoek 1 , George A.M. Cross * Laboratory of Molecular Parasitology, The Rockefeller Uni6ersity, 1230 www.parasitology-online.com. The expression sites (ES) of Trypanosoma brucei are multi-allelic loci

  17. Scientific report Molecular biology tools in parasitology.

    E-print Network

    Paris-Sud XI, Université de

    Scientific report Molecular biology tools in parasitology. Their use for identification with molecular biology tools as well as for those who were naive in this respect. The project was that 2 groups of researchers, naive or familiar with molecular biology, could communicate. More than 120 played the game

  18. PCR-based technology in veterinary parasitology

    Microsoft Academic Search

    Robin B. Gasser

    1999-01-01

    DNA technology is having a major impact in many areas of veterinary parasitology. In particular, the polymerase chain reaction (PCR) has found broad applicability because its sensitivity permits enzymatic amplification of gene fragments from minute quantities of nucleic acids derived from limited amounts of parasite material. This paper discusses some recent applications of PCR-based methods to parasites and highlights their

  19. Application of molecular biology in veterinary parasitology

    Microsoft Academic Search

    Roger Prichard

    1997-01-01

    The number of applications of molecular biology in veterinary parasitology is increasing rapidly. The techniques used with eukaryotic cells are generally applicable to the study of parasites and their hosts. The polymerase chain reaction is particularly important for identification and diagnosis of parasites, as well as for many other applications. With species and type specific probes or primers, sensitivities and

  20. Veterinary Parasitology: Looking to the Next Millennium

    Microsoft Academic Search

    R. C. A. Thompson

    1999-01-01

    ‘Veterinary parasitology’ has traditionally been concerned with the control of parasites of livestock and companion animals, with emphasis on chemotherapy and immunoprophylaxis. This will continue, but there must be less reliance on chemical control; the development of alternative strategies will be a major goal over the next ten years. Here, Andrew Thompson takes an optimistic look at the challenges, strengths

  1. Trends in teaching parasitology: the American situation

    Microsoft Academic Search

    Alex D. W. Acholonu

    2003-01-01

    Parasitic infections in both humans and animals are still rampant and appear to be increasing. There is a need for parasitologists, human and animal doctors to contribute toward the global eradication of communicable and food-borne diseases. The need for teaching parasitology, the recommendations and future perspectives are discussed in this article, and it is proposed that macrobiology should be recognized

  2. Real-time quantitative PCR in parasitology

    Microsoft Academic Search

    Andrew S. Bell; Lisa C. Ranford-Cartwright

    2002-01-01

    Standard techniques for counting parasites are often time-consuming, difficult and inaccurate, and occasionally unpleasant. Real-time quantitative polymerase chain reaction has recently been applied to parasitology, specifically Plasmodium, Toxoplasma, Leishmania and Neospora. These techniques are truly quantitative, give results over a range of 6–7 orders of magnitude, are quick to perform and require no manipulations post-amplification. They can be used to

  3. Parasitological Consequences of Overcrowding in Protected Camille Lebarbenchon,1,2

    E-print Network

    Parasitological Consequences of Overcrowding in Protected Areas Camille Lebarbenchon,1,2 Robert the parasitological consequences of the overcrowding of animals in protected wildlife areas. Here, we discuss #12;tions may potentially have parasitological consequences. For instance, while vaccines

  4. Molecular & Biochemical Parasitology 175 (2011) 2129 Contents lists available at ScienceDirect

    E-print Network

    Gelb, Michael

    2011-01-01

    Molecular & Biochemical Parasitology 175 (2011) 21­29 Contents lists available at ScienceDirect Molecular & Biochemical Parasitology Identification of inhibitors for putative malaria drug targets among

  5. Molecular & Biochemical Parasitology 113 (2001) 199213 Pteridine salvage throughout the Leishmania infectious cycle

    E-print Network

    Beverley, Stephen M.

    2001-01-01

    Molecular & Biochemical Parasitology 113 (2001) 199­213 Pteridine salvage throughout the Leishmania; Dihydrofolate reductase; Pteridine reductase; HPLC biopterin assay www.parasitology-online.com. 1. Introduction

  6. Molecular and Biochemical Parasitology, 61 (1993) 127 136 127 Elsevier Science Publishers B.V.

    E-print Network

    Simpson, Larry

    1993-01-01

    Molecular and Biochemical Parasitology, 61 (1993) 127 136 127 Elsevier Science Publishers B; and Clnstitute of Parasitology, Czech Academy of Sciences, Ceske Budejovice, Czech Republic (Received 17 February

  7. WAAVP\\/Pfizer Award for Excellence in Teaching Veterinary Parasitology: Teaching of veterinary parasitology – quo vadis?

    Microsoft Academic Search

    J Eckert

    2000-01-01

    Some thoughts on training and recruitment of academic teachers and future trends in teaching veterinary parasitology are presented with emphasis on the European situation. It is underlined that research is an indispensable basis for academic teaching. Besides a broad scientific background of the teacher, motivation and teaching methods are also important. Many academic teachers do not receive formal training in

  8. Mixed models: getting the best use of parasitological data

    E-print Network

    Paterson, Steve

    of the experiment if only destructive sampling can be used. Analogously, it may be possible to design sampling in parasitological data be dealt with? One approach is to design the experiment or sampling regime such that only

  9. Parasitological serendipity: from Schistocephalus to Echinococcus.

    PubMed

    Smyth, J D

    1990-07-01

    Attention is drawn to the situation nowadays, whereby workers are encouraged to undertake research which appears useful or of economic importance, although the History of Science indicates that many major discoveries have been the result of 'serendipity'--'the chance observation falling on the receptive eye'. Some of the more important examples in Medicine and Parasitology are reviewed. The author then relates how he was given a stickleback infected with the plerocercoid of Schistocephalus solidus, an episode which eventually led to the successful in vitro culture of the adult of this species. Attention is also drawn to the largely unrecognized work of the Danish Veterinarian, P. C. Abildgaard, who in 1789 demonstrated that this species completed its life cycle in a bird, thus establishing, for the first time, the transmission of a parasite from one host to another. The in vitro culture of S. solidus led to the development of successful in vitro techniques for Ligula intestinalis and for Echinococcus granulosus and E. multilocularis. The observation that E. granulosus of horse origin failed to grow in vitro led eventually to the concept of physiological 'strains' of E. granulosus, now a subject of much international research. PMID:2210935

  10. Veterinary Parasitology 115 (2003) 125145 Control of tsetse flies and trypanosomes

    E-print Network

    Aksoy, Serap

    2003-01-01

    Veterinary Parasitology 115 (2003) 125­145 Control of tsetse flies and trypanosomes using molecular. Aksoy / Veterinary Parasitology 115 (2003) 125­145 agencies, agricultural sector and the scientific

  11. Molecular and Biochemical Parasitology 96 (1998) 125137 Identification and characterisation of a functional peroxidoxin

    E-print Network

    Schnaufer, Achim

    1998-01-01

    Molecular and Biochemical Parasitology 96 (1998) 125­137 Identification and characterisation-6851(98)00122-4 #12;M.P. Le6ick et al. / Molecular and Biochemical Parasitology 96 (1998) 125­137126 ganisms

  12. Reprinted from THE JOURNAL OF PARASITOLOGY Vol. 57, No.4, August 1971

    E-print Network

    Reprinted from THE JOURNAL OF PARASITOLOGY Vol. 57, No.4, August 1971 p. 900 Made in United Slates. It is probable that a more thorough parasitological study would reveal that this species hosts other parasites

  13. Molecular and Biochemical Parasitology 94 (1998) 8797 The effects of protein farnesyltransferase inhibitors on

    E-print Network

    Gelb, Michael

    1998-01-01

    Molecular and Biochemical Parasitology 94 (1998) 87­97 The effects of protein farnesyltransferase and Biochemical Parasitology 94 (1998) 87­9788 the protozoan parasites Trypanosoma cruzi (T. cruzi) and Leishmania

  14. Current status and challenge of Human Parasitology teaching in China

    PubMed Central

    Peng, Hong-Juan; Zhang, Chao; Wang, Chun-Mei; Chen, Xiao-Guang

    2012-01-01

    Parasitic infection profile in China has been changed greatly with the rapid economic development in China since the 1980s, such as the tremendous decreased infection rate of the soil-borne helminthiasis, the elimination of filariasis, the control of malaria, and the initiation to eradicate malaria in 2020. Some food-borne parasitic infections have increased such as Clonorchiasis, Cysticercosis, and Echinococcosis, probably because of the increased chances of eating out. This trend directly affected the status of Human Parasitology teaching in medical universities, such as the shorten length of this course, re-adjusted contents structure and teaching manners, even the change of the name of this course. In this paper, we analyzed the current status and challenges of Human Parasitology teaching in medical universities, and discussed the requisite contents and manners in course delivery and measures to improve the quality of Human Parasitology teaching in China. PMID:23265609

  15. Molecular and Biochemical Parasitology 99 (1999) 89101 A tightly regulated inducible expression system for conditional

    E-print Network

    Cross, George

    1999-01-01

    Molecular and Biochemical Parasitology 99 (1999) 89­101 A tightly regulated inducible expression Wirtz, Simone Leal, Claudia Ochatt, George A. M. Cross * Laboratory of Molecular Parasitology Parasitology 99 (1999) 89­10190 T. brucei PARP promoter, has been described previously [2,3]. Activity

  16. ORIGINAL PAPER Pathological and parasitological findings in a wild red titi

    E-print Network

    Paris-Sud XI, Université de

    ORIGINAL PAPER Pathological and parasitological findings in a wild red titi monkey, Callicebus, like on Barro Colorado island (Milton 1996). Here, we report pathological and parasitological findings at the Estación Biológica Quebrada Blanco (EBQB) during a field study on the comparative parasitology of sympatric

  17. Molecular and Biochemical Parasitology 84 (1997) 189201 Analysis of Trypanosoma brucei 6sg expression site switching

    E-print Network

    Cross, George

    1997-01-01

    Molecular and Biochemical Parasitology 84 (1997) 189­201 Analysis of Trypanosoma brucei 6sg expression site switching in vitro David Horn, George A.M. Cross* Laboratory of Molecular Parasitology / Molecular and Biochemical Parasitology 84 (1997) 189­201190 variation involves the mutually exclusive and se

  18. Molecular and Biochemical Parasitology 100 (1999) 517 Knockout of the glutamate dehydrogenase gene in bloodstream

    E-print Network

    Simpson, Larry

    1999-01-01

    Molecular and Biochemical Parasitology 100 (1999) 5­17 Knockout of the glutamate dehydrogenase gene of Parasitology, Rockefeller Uni6ersity, New York, NY 10021, USA e Laboratoire d'Immunologie et Biologie Mole reserved. PII: S0166-6851(99)00024-9 #12;A.M. Este´6ez et al. / Molecular and Biochemical Parasitology 100

  19. Parasitology Today, vol. IO,no.5, I994 203 Methods in Mallecular

    E-print Network

    Read, Andrew

    Parasitology Today, vol. IO,no.5, I994 203 Methods in Mallecular Biology, Vol. 2 I: Protocols in Molecular Parasitology edited bylohn .E.Hyde, t-lumana Press, 1993. $59.50 (xiv + 4 70 pages) ISBN 0 89603 239 6 Molecular parasitology means different things to different people. For some, it conjures up

  20. Molecular & Biochemical Parasitology 119 (2002) 217223 A low-background inducible promoter system in Leishmania

    E-print Network

    Schnaufer, Achim

    2002-01-01

    Molecular & Biochemical Parasitology 119 (2002) 217­223 A low-background inducible promoter system resistance gene; LD1 locus; Leishmania dono6ani; Luciferase gene www.parasitology-online.com 1. Introduction. / Molecular & Biochemical Parasitology 119 (2002) 217­223218 TIS [8]. When targeted into th

  1. Veterinary Parasitology 193 (2013) 365374 Contents lists available at SciVerse ScienceDirect

    E-print Network

    Maizels, Rick

    2013-01-01

    Veterinary Parasitology 193 (2013) 365­374 Contents lists available at SciVerse ScienceDirect Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar Toxocara canis: Molecular basis / Veterinary Parasitology 193 (2013) 365­374 predation, allow the parasite to reach its final definiti

  2. Molecular and Biochemical Parasitology 111 (2000) 309317 Genetic manipulation indicates that ARD1 is an essential

    E-print Network

    Cross, George

    2000-01-01

    Molecular and Biochemical Parasitology 111 (2000) 309­317 Genetic manipulation indicates that ARD1. Keywords: Acetylation; Acetyltransferase; Protein modification; Trypanosoma brucei www.parasitology. / Molecular and Biochemical Parasitology 111 (2000) 309­317310 ferase activity is lost in ard1 or nat1 mutants

  3. Molecular & Biochemical Parasitology 112 (2001) 183191 Cloning of a pyruvate phosphate dikinase from Trypanosoma

    E-print Network

    Schnaufer, Achim

    2001-01-01

    Molecular & Biochemical Parasitology 112 (2001) 183­191 Cloning of a pyruvate phosphate dikinase; Gluconeogenesis www.parasitology-online.com 1. Introduction In general, metabolic intermediates in biochemical.A. Maldonado, A.H. Fairlamb / Molecular & Biochemical Parasitology 112 (2001) 183­191184 phofructokinase

  4. Molecular & Biochemical Parasitology 160 (2008) 171174 Contents lists available at ScienceDirect

    E-print Network

    Cross, George

    2008-01-01

    Molecular & Biochemical Parasitology 160 (2008) 171­174 Contents lists available at ScienceDirect Molecular & Biochemical Parasitology Short technical report Analysis of the Trypanosoma brucei cell cycle of Molecular Parasitology, The Rockefeller University, 1230 York Avenue, New York, NY 10065, USA b Laboratory

  5. Molecular and Biochemical Parasitology 103 (1999) 6169 Entamoeba histolytica lacks trypanothione metabolism

    E-print Network

    Schnaufer, Achim

    1999-01-01

    Molecular and Biochemical Parasitology 103 (1999) 61­69 Entamoeba histolytica lacks trypanothione; Entamoeba histolytica; Evolution; Mitochondrion www.elsevier.com/locate/parasitology 1. Introduction All-6851(99)00118-8 #12;M.R. Ariyanayagam, A.H. Fairlamb / Molecular and Biochemical Parasitology 103 (1999) 61­6962 in E

  6. Molecular and Biochemical Parasitology 103 (1999) 3548 Conditional expression of glycosylphosphatidylinositol

    E-print Network

    Cross, George

    1999-01-01

    Molecular and Biochemical Parasitology 103 (1999) 35­48 Conditional expression of Molecular Parasitology, The Rockefeller Uni6ersity, 1230 York A6enue, New York, NY 10021, USA b Institut fu www.elsevier.com/locate/parasitology Abbre6iations: AChE, Acetylcholinesterase; BLE, Phleomycin

  7. Molecular & Biochemical Parasitology 154 (2007) 134140 Single nucleotide polymorphisms identification in expressed

    E-print Network

    Neshich, Goran

    2007-01-01

    Molecular & Biochemical Parasitology 154 (2007) 134­140 Single nucleotide polymorphisms of Cellular and Molecular Parasitology, Centro de Pesquisas Ren´e Rachou, Funda¸c~ao Oswaldo Cruz, Av. Augusto reading frame Corresponding author at: Laboratory of Cellular and Molecular Parasitology, Centro de

  8. Molecular and Biochemical Parasitology 111 (2000) 261273 The molecular karyotype of the megabase chromosomes of

    E-print Network

    Cross, George

    2000-01-01

    Molecular and Biochemical Parasitology 111 (2000) 261­273 The molecular karyotype of the megabase 1QP UK b Laboratory of Molecular Parasitology, The Rockefeller Uni6ersity, New York, New York 10021; Expression sites www.parasitology-online.com. Abbre6iations: VSG, variant surface glycoprotein; VSG, variant

  9. WAAVP\\/Pfizer Award for Excellence in Veterinary Parasitology Research

    Microsoft Academic Search

    D. R Hennessy

    2000-01-01

    Being presented with the WAAVP Pfizer award for excellence in parasitological research is the pinnacle of my career. In accepting I acknowledge the support that I have received from workmates, colleagues, friends and family over the years that I have been involved in this field of endeavour. Parasitic disease is the most significant threat to the Australian sheep industry. A

  10. The role of molecular biology in veterinary parasitology

    Microsoft Academic Search

    Roger Prichard; Andy Tait

    2001-01-01

    The tools of molecular biology are increasingly relevant to veterinary parasitology. The sequencing of the complete genomes of Caenorhabditis elegans and other helminths and protozoa is allowing great advances in studying the biology, and improving diagnosis and control of parasites. Unique DNA sequences provide very high levels of specificity for the diagnosis and identification of parasite species and strains, and

  11. Behavioral parasitology and perspectives on miracidial host-finding

    Microsoft Academic Search

    Kenneth S. Saladin

    1979-01-01

    This paper proposes and outlines a new interdiscipline, ‘behavioral parasitology,’ and presents some interpretations in one of the leading themes of this field, miracidial chemosensitivity to snails. Controversies over miracidial attraction and species-specificity are considered from the standpoints of the distinction between taxis and kinesis, the need for a stimulus gradient, and the possibility of an early phase in a

  12. An integrated parasitology: revealing the elephant through tradition and invention

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The field of parasitology contributes to the elucidation of patterns and processes in evolution, ecology and biogeography, of fundamental importance across the biosphere, leading to a thorough understanding of biodiversity and varied responses to global change. Foundations from taxonomic and systema...

  13. A Hypermedia Computer-Aided Parasitology Tutoring System.

    ERIC Educational Resources Information Center

    Theodoropoulos, Georgios; Loumos, Vassili

    A hypermedia tutoring system for teaching parasitology to college students was developed using an object oriented software development tool, Knowledge Pro. The program was designed to meet four objectives: knowledge incorporation, tutoring, indexing of key words for Boolean search, and random generation of quiz questions with instant scoring. The…

  14. An integrated parasitology: revealing the elephant through tradition and invention.

    PubMed

    Hoberg, Eric P; Agosta, Salvatore J; Boeger, Walter A; Brooks, Daniel R

    2015-04-01

    The field of parasitology contributes to the elucidation of patterns and processes in evolution, ecology, and biogeography that are of fundamental importance across the biosphere, leading to a thorough understanding of biodiversity and varied responses to global change. Foundations from taxonomic and systematic information drive biodiversity discovery and foster considerable infrastructure and integration of research programs. Morphological, physiological, behavioral, life-history, and molecular data can be synthesized to discover and describe global parasite diversity, in a timely manner. In fully incorporating parasitology in policies for adaptation to global change, parasites and their hosts should be archived and studied within a newly emergent conceptual universe (the 'Stockholm Paradigm'), embracing the inherent complexity of host-parasite systems and improved explanatory power to understand biodiversity past, present, and future. PMID:25488772

  15. Biology 3322.03 (Fall term 2010) PARASITOLOGY Dr. Tatiana Rossolimo

    E-print Network

    Adl, Sina

    Biology 3322.03 (Fall term 2010) PARASITOLOGY Dr. Tatiana Rossolimo E-mail: rossolimo B- C+ C C- D Parasitology 3322 90-100 85-89.9 80-84.9 77-79.9 73-76.9 70-72.9 65-69.9 60-64.9 55-61.9 50-54.9 Recommended textbook (not mandatory): G.D.Schmidt &L.S.Roberts. Foundations of parasitology

  16. [On the contribution of Prof. Yu. S. Balashov to the fundamental parasitology].

    PubMed

    Ryss, A Iu

    2013-01-01

    Brief review of main conceptions of Yu. S. Balasov in fundamental parasitology: types of host-parasite relations, evolution, transmissive infections, econiches, population structure, parasite communities. PMID:24455903

  17. Experimental Parasitology 91, 5969 (1999) Article ID expr.1998.4350, available online at http://www.idealibrary.com on

    E-print Network

    Lowenberger, Carl

    1999-01-01

    Experimental Parasitology 91, 59­69 (1999) Article ID expr.1998.4350, available online at http. Experimen- tal Parasitology 91, 59­69. During the development of Plasmodium sp. within the mosquito midgut

  18. Molecular and Biochemical Parasitology 93 (1998) 7380 Are tRNAs imported into the mitochondria of kinetoplastid

    E-print Network

    Simpson, Larry

    1998-01-01

    Molecular and Biochemical Parasitology 93 (1998) 73­80 Are tRNAs imported into the mitochondria. / Molecular and Biochemical Parasitology 93 (1998) 73­8074 tion in baker's yeast mitochondria [1], is trans

  19. Trends in undergraduate teaching of parasitology in medical schools of Pakistan

    Microsoft Academic Search

    Vikram Mehraj; Taimur Saleem; Saima Lalani; Nadia Sani; Imran Khan; Fatima Afridi; Hina Irfan; Mohammad Asim Beg

    2010-01-01

    OBJECTIVE: Parasitic diseases are a major public health problem in the tropical and sub tropical countries including the subcontinent region. We aimed to assess methods of Parasitology education in medical schools of Karachi Pakistan.METHODS: Ten medical schools in Karachi, Pakistan were sent a structured questionnaire collecting information on different aspects of Parasitology education. The collected data was analyzed using SPSS

  20. External quality assessment schemes raise standards: evidence from the UKNEQAS parasitology subschemes

    Microsoft Academic Search

    M M Kettelhut; P L Chiodini; H Edwards; A Moody

    2003-01-01

    Background: The burden of parasitic disease imported into the temperate zone is increasing, and in the tropics remains very high. Thus, high quality diagnostic parasitology services are needed, but to implement clinical governance a measure of quality of service is required.Aim: To examine performance in the United Kingdom National External Quality Assessment Scheme for Parasitology for evidence of improved standards

  1. Parasitology Research (2012) 111: 341-351 DOI 10.1007/s00436-012-2845-6

    E-print Network

    Paris-Sud XI, Université de

    2012-01-01

    1 Parasitology Research (2012) 111: 341-351 DOI 10.1007/s00436-012-2845-6 Preprint A quick-27Jun2012 Author manuscript, published in "Parasitology Research 111, 1 (2012) 341-351" DOI : 10.1007/s. 2009; Vannier-Santos and Lenzi 2011). However, parasitology has been often ill-considered (Vickerman

  2. Molecular and Biochemical Parasitology 99 (1999) 167181 Characterization of protein Ser/Thr phosphatases of the malaria

    E-print Network

    Schnaufer, Achim

    1999-01-01

    Molecular and Biochemical Parasitology 99 (1999) 167­181 Characterization of protein Ser, USA 2 Di6ision of Molecular Parasitology and Biological Chemistry, Wellcome Trust Building, Department. / Molecular and Biochemical Parasitology 99 (1999) 167­181168 1. Introduction Protein phosphatases are key

  3. Molecular and Biochemical Parasitology 106 (2000) 2135 Cell-cycle and developmental regulation of TbRAB31

    E-print Network

    Schnaufer, Achim

    2000-01-01

    Molecular and Biochemical Parasitology 106 (2000) 21­35 Cell-cycle and developmental regulation Parasitology, Department of Biochemistry, Imperial College of Science, Technology and Medicine, Exhibition Road recognised by cross-reacting antibodies to mammalian www.elsevier.com/locate/parasitology Abbre6iations: b

  4. Molecular and Biochemical Parasitology 103 (1999) 251259 T7 RNA polymerase-driven transcription in mitochondria of

    E-print Network

    Simpson, Larry

    1999-01-01

    Molecular and Biochemical Parasitology 103 (1999) 251­259 T7 RNA polymerase-driven transcription: Kinetoplast DNA; L. tarentolae; T. brucei; Mitochondria; T7 RNA polymerase www.elsevier.com/locate/parasitology. / Molecular and Biochemical Parasitology 103 (1999) 251­259252 of both transcription and translation

  5. Molecular and Biochemical Parasitology 104 (1999) 93105 The Leishmania dono6ani LD1 locus gene ORFG encodes a

    E-print Network

    Beverley, Stephen M.

    1999-01-01

    Molecular and Biochemical Parasitology 104 (1999) 93­105 The Leishmania dono6ani LD1 locus gene; Transporter www.elsevier.com/locate/parasitology 1. Introduction Leishmania are protozoan parasites and Biochemical Parasitology 104 (1999) 93­10594 20 million people are estimated to suffer from leishmaniasis

  6. Molecular and Biochemical Parasitology 94 (1998) 5366 In situ analysis of a variant surface glycoprotein expression-site

    E-print Network

    Cross, George

    1998-01-01

    Molecular and Biochemical Parasitology 94 (1998) 53­66 In situ analysis of a variant surface * Laboratory of Molecular Parasitology, The Rockefeller Uni6ersity (Box 185), 1230 York A6enue, New York, NY / Molecular and Biochemical Parasitology 94 (1998) 53­6654 protein gene (6sg) is located at the end

  7. Parasitological and clinical studies on human scabies in Cairo.

    PubMed

    Sarwat, M A; el Okbi, L M; el Sayed, M M; el Okbi, S M; el Deeb, H K

    1993-12-01

    This study is a parasitological and clinical study on human scabies. This study was carried out on 100 patients attending the Dermatology Outpatient Clinic at Ain Shams University Hospitals, including 54 males and 46 females. All patients were subjected to detailed history taking, complete dermatological examination including Skin Scraping Test and Burrow Ink Test. Younger patients attended the dermatology clinic earlier than older patients, who usually delayed their visits until complications occurred. Scratching, erythematous papules and secondary infected lesions were the commonest lesions. The hands, wrist and external genitalia were the most frequently affected sites while the feet, ankles, knees and back were the least affected. Burrows could only be detected in 40% of patients. The most frequent sites were the web spaces, external genitalia, and finger sides. Burrow Ink Test was positive among 85% of patients with burrows while mites could be identified by Skin Scraping Test in 55% of patients. The most frequent clinical manifestations in the parasitologically positive patients were itching, burrows, and papules, and the most frequent sites were the web spaces, and the finger sides. Multiple sites affection was the characteristic feature among the preschool age children who represented 14% of cases. PMID:8308357

  8. Clinical and parasitological study on scabies in Sirte, Libya.

    PubMed

    Fathy, Fouad M; El-Kasah, Fathi; El-Ahwal, Abdulla M

    2010-12-01

    The present work aimed to determine the risk factors, clinical and parasitological skin lesion features and effective drug regimens. Study was carried out on 200 patients referred to dermatology outpatient clinics in Sirte-Libya. Each was subjected to detailed questionnaire, dermatological skin examination, parasitological skin scraping test (SST), burrow ink test (BIT), drug administration and follow up. Results revealed that females 59%, children 37.5% and military personnel 18% of immigrant families were particularly prone to scabies infestation. Effective risk factors included overcrowding, bed sharing, low hygienic and education levels. Commonest skin lesions included erythematous papules 93%, excoriated papules 77.5%, burrows 66%, pustulation 31%, vesicles 21.5 and nodules 3%. Predilection lesion sites were hand 86%, wrist 82%, abdomen 56%, male external genitalia 64.5% and female breast 28%. Specific SST was positive in 67.3% of cases, particularly sensitive in early cases with short itching duration. BIT was positive in 62%. Topical permethrin proved more effective than precipitated sulpher with cure rates of of 100% and 85.3% in 21% and 75% of cases, respectively. Ivermectin was 100% effective in 4% of cases. PMID:21268539

  9. Sticklebacks as model hosts in ecological and evolutionary parasitology.

    PubMed

    Barber, Iain

    2013-11-01

    The three-spined stickleback is a small teleost fish, native to coastal regions of the Northern Hemisphere, which has emerged as a key model organism in evolutionary biology and ecology. Sticklebacks possess a well-documented and experimentally amenable parasite fauna, and are well suited to both laboratory and field parasitological investigation. As a consequence, sticklebacks have been extensively used as model hosts in studies of host-parasite interactions, and these studies have provided considerable insight into the roles of parasites in ecology and evolutionary biology. In this review, I discuss key advances in our understanding of host-parasite interactions that have arisen from studies involving stickleback hosts, highlight areas of current research activity, and identify potentially promising areas for future research. PMID:24145060

  10. [Geographical Information Systems and remote sensing technologies in parasitological epidemiology].

    PubMed

    Rinaldi, L; Cascone, C; Sibilio, G; Musella, V; Taddei, R; Cringoli, G

    2004-06-01

    Parasites have natural habitats in the same way as a species: they are found in focal areas where the spatial distribution of the parasite, host, vector and required environmental conditions coincide. The spatial distribution of parasites is, therefore, a function of the interaction between abiotic and biotic environmental factors. The boundaries of distributions are not strictly fixed in space and time and may fluctuate with climate and other components of the environment or anthropical factors. Geographic Information Systems (GIS) and remote sensing (RS) technologies are being used increasingly to study the spatial and temporal patterns of disease. GIS can be used to complement conventional ecological monitoring and modelling techniques, and provide means to portray complex relationships in the ecology of disease. In addition, the use of GIS and RS to identify environmental features allows determination of risk factors and delimitation of areas at risk, permitting more rational allocation of resources for cost-effective control. Since 1996, GIS have been used in our territorial cross-sectional and longitudinal parasitological surveys in order to experiment new applications to plan sampling protocols and to display quickly, clearly, and analytically the spatial and/or temporal distribution of parasitological data. The use of GIS allowed us to draw the following types of descriptive parasitological maps: distribution maps, distribution maps with proportioned peaks, choroplethic maps with proportioned peaks, point distribution maps and point distribution maps with proportioned peaks. In a recent study, GIS and RS technologies have been used also to identify environmental features that influence the distribution of paramphistomosis in sheep from the southern Italian Apennines and to develop a preliminary risk assessment model. A GIS was constructed using RS and landscape feature data together with paramphistome positive survey records from 197 georeferenced ovine farms with animals pasturing in an area of the southern Italian Apennines. The GIS for the study area was constructed utilizing the following environmental variables: Normalized Difference Vegetation Index (NDVI), land cover, elevation, slope, aspect, and total length of rivers. In addition, data regarding the presence of watercourses smaller than rivers, namely, streams, springs and brooks were recorded in the field. All these variables were then calculated for "buffer zones" consisting of the areas included in a circle of 3 Km diameter centred on 197 farms. The environmental data obtained were analyzed by univariate and multivariate statistical analyses using the paramphistome farm coprological status (positive/negative) as the dependent variable. A multivariate stepwise discriminant analysis model was developed that included moors and heathland, sclerophyllus and coniferous forest vegetation, autumn-winter NDVI and presence of streams, springs and brooks on pasture. The variables entered in the model are consistent with the environmental requirements of paramphistomes and their snail intermediate host. In particular, the land cover types entered in the model in this area are indicators of marginal uncultivable and sloping zones where typically there is the presence of water (permanently or temporarily). In addition, since NDVI can be used as an indicator of regional thermal-moisture regime, the distribution of farms positive for paramphistomosis corresponding to relatively high values of winter NDVI indicated the presence of adequate moisture and temperatures favourable to the rumen fluke and the snails. In conclusion, GIS and RS are useful to define the habitats of parasites, especially for those with strong environmental determinants, and to produce forecasting maps requested for the planning and the monitoring of control strategies on small and large scale. PMID:15305690

  11. Annals ofTropical Medicine and Parasitology, Vo!' 77, No.5, 527-533 (1983) Immediate-type skin reactivity to extracts of the

    E-print Network

    Cranston, Peter S.

    1983-01-01

    Annals ofTropical Medicine and Parasitology, Vo!' 77, No.5, 527-533 (1983) Immediate-type skin of Medical Microbiology and Parasitology, Faculty rif Medicine, University rif Khartoum, Sudan ROSEMARY D

  12. BAITING RED FOXES IN AN URBAN AREA: A CAMERA TRAP STUDY DANIEL HEGGLIN,1 Institute of Parasitology, University of Zurich, Winterthurerstrasse 266a, 8057 Zurich, Switzerland

    E-print Network

    Richner, Heinz

    BAITING RED FOXES IN AN URBAN AREA: A CAMERA TRAP STUDY DANIEL HEGGLIN,1 Institute of Parasitology, University of Bern, Länggassstrasse 122, 3012 Bern, Switzerland PETER DEPLAZES, Institute of Parasitology

  13. PARASITOLOGY 2008, 135(10):1179-11881 Effects of laboratory culture on compatibility between snails and schistosomes

    E-print Network

    Boyer, Edmond

    PARASITOLOGY 2008, 135(10):1179-11881 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24, published in "Parasitology 135, 10 (2008) 1179-1188" DOI : 10.1017/S0031182008004745 #12;28 29 30 31 32 33

  14. Molecular & Biochemical Parasitology 116 (2001) 2534 CAP5.5, a life-cycle-regulated, cytoskeleton-associated protein is a

    E-print Network

    Schnaufer, Achim

    2001-01-01

    Molecular & Biochemical Parasitology 116 (2001) 25­34 CAP5.5, a life-cycle-regulated, cytoskeleton: Acylation; Calpains; Cytoskeleton; Differentiation; Protease; Trypanosome www.parasitology-online.com. 10166-6851(01)00296-1 #12;C. Hertz-Fowler et al. / Molecular & Biochemical Parasitology 116 (2001) 25

  15. Parasitology Research, in press (accepted 24 January 2012) A quick and simple method, usable in the field, for collecting parasites in

    E-print Network

    Paris-Sud XI, Université de

    1 Parasitology Research, in press (accepted 24 January 2012) A quick and simple method, usable in "Parasitology Research 111, 1 (2012) 341-351" DOI : 10.1007/s00436-012-2845-6 #12;2 Abstract Many methods have 2000; Hoberg et al. 2009; Vannier-Santos and Lenzi 2011). However, parasitology has been often ill

  16. 2013, Korean Society for Parasitology and Tropical Medicine This is an OpenAccess article distributed under the terms of the Creative Commons

    E-print Network

    Paris-Sud XI, Université de

    231 © 2013, Korean Society for Parasitology and Tropical Medicine This is an OpenAccess article of Parasitology & Medical Entomology, Faculty of Medicine, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz, 50300 Kuala Lumpur, Malaysia; 2 Department of Parasitology, Faculty of Medicine, University

  17. Molecular & Biochemical Parasitology 136 (2004) 1123 The LPG1 gene family of Leishmania major

    E-print Network

    Beverley, Stephen M.

    2004-01-01

    Molecular & Biochemical Parasitology 136 (2004) 11­23 The LPG1 gene family of Leishmania major Kai December 2003; accepted 23 February 2004 Abstract In Leishmania major, the core of the abundant surface identical copies located at the telomeres of chromosomes 5, 19, and 32 based on Leishmania genome project

  18. Molecular and Biochemical Parasitology 94 (1998) 2740 Leishmania dono6ani has distinct

    E-print Network

    Beverley, Stephen M.

    1998-01-01

    Molecular and Biochemical Parasitology 94 (1998) 27­40 Leishmania dono6ani has distinct) is the predominant surface glycoconjugate of Leishmania promastigotes and plays several roles in the infectious cycle-genetic approach to resolve this issue. An lpg- mutant of Leishmania dono6ani, JEDI, was obtained by antibody

  19. Review The Interplay of Molecular Biology and Veterinary Parasitology: A Need of the Time

    Microsoft Academic Search

    ABDUL JABBAR; ZAFAR IQBAL; GHULAM MUHAMMAD; MUHAMMAD NISAR KHAN; RAO ZAHID ABBAS; ZIA-UD-DIN SANDHU; MUHAMMAD LATEEF

    The tools of molecular biology are increasingly relevant to veterinary parasitology. The techniques used with eukaryotic cells are generally applicable to the study of parasites and their hosts. The sequencing of the complete genomes of helminths and protozoa is allowing great advances in studying the biology, and improving diagnosis and control of parasites. Unique DNA sequences provide very high levels

  20. Differentiation of commercially important flatfish populations along the Portuguese coast: Evidence from morphology and parasitology

    Microsoft Academic Search

    Joana F. Marques; Célia M. Teixeira; Henrique N. Cabral

    2006-01-01

    The population differentiation of seven flatfish species, Citharus linguatula, Lepidorhombus boscii, Platichthys flesus, Microchirus azevia, Solea lascaris, Solea senegalensis and Solea solea, widely distributed along the eastern north Atlantic and occurring in sympatry along the Portuguese coast was studied using morphological and parasitological data. Fish were obtained from commercial fishing vessels operating in three locations along the Portuguese coast (north,

  1. CANINE VISCERAL LEISHMANIASIS IN COLOMBIA: RELATIONSHIP BETWEEN CLINICAL AND PARASITOLOGIC STATUS AND INFECTIVITY FOR SAND FLIES

    Microsoft Academic Search

    BRUNO L. TRAVI; CARLOS J. TABARES; HORACIO CADENA; CRISTINA FERRO; YANETH OSORIO

    2001-01-01

    We studied the reservoir competency of canines with distinct clinical presentations of Leishmania chagasi infection. The parasitologic status of asymptomatic and symptomatic dogs was determined by standard culture methods Infectivity was assessed by multiple xenodiagnoses with Lutzomyia longipalpis, over a period of 2-11 months. Asymp- tomatic dogs were non-infective (0 of 5) while 2 of 7 oligosymptomatic dogs infected L.

  2. Molecular & Biochemical Parasitology 114 (2001) 169181 Telomere shortening and cell cycle arrest in Trypanosoma brucei

    E-print Network

    Cross, George

    2001-01-01

    Molecular & Biochemical Parasitology 114 (2001) 169­181 Telomere shortening and cell cycle arrest of time exhibited shortening and increased size heterogeneity of their telomeres and the cell cycle-loops. This structure is also present in mammalian cells and is thought to reflect the presence of telomere

  3. A bibliometric analysis of research productivity in Parasitology by different world regions during a 9-year period (1995–2003)

    Microsoft Academic Search

    Matthew E Falagas; Paraskevi A Papastamataki; Ioannis A Bliziotis

    2006-01-01

    BACKGROUND: The objective of this study was to estimate the research productivity of different world regions in the field of Parasitology. METHODS: Using the PubMed database we retrieved articles from journals included in the \\

  4. Web-Based Virtual Microscopy for Parasitology: A Novel Tool for Education and Quality Assurance

    PubMed Central

    Linder, Ewert; Lundin, Mikael; Thors, Cecilia; Lebbad, Marianne; Winiecka-Krusnell, Jadwiga; Helin, Heikki; Leiva, Byron; Isola, Jorma; Lundin, Johan

    2008-01-01

    Background The basis for correctly assessing the burden of parasitic infections and the effects of interventions relies on a somewhat shaky foundation as long as we do not know how reliable the reported laboratory findings are. Thus virtual microscopy, successfully introduced as a histopathology tool, has been adapted for medical parasitology. Methodology/Principal Findings Specimens containing parasites in tissues, stools, and blood have been digitized and made accessible as a “webmicroscope for parasitology” (WMP) on the Internet (http://www.webmicroscope.net/parasitology).These digitized specimens can be viewed (“navigated” both in the x-axis and the y-axis) at the desired magnification by an unrestricted number of individuals simultaneously. For virtual microscopy of specimens containing stool parasites, it was necessary to develop the technique further in order to enable navigation in the z plane (i.e., “focusing”). Specimens were therefore scanned and photographed in two or more focal planes. The resulting digitized specimens consist of stacks of laterally “stiched” individual images covering the entire area of the sample photographed at high magnification. The digitized image information (?10 GB uncompressed data per specimen) is accessible at data transfer speeds from 2 to 10 Mb/s via a network of five image servers located in different parts of Europe. Image streaming and rapid data transfer to an ordinary personal computer makes web-based virtual microscopy similar to conventional microscopy. Conclusion/Significance The potential of this novel technique in the field of medical parasitology to share identical parasitological specimens means that we can provide a “gold standard”, which can overcome several problems encountered in quality control of diagnostic parasitology. Thus, the WMP may have an impact on the reliability of data, which constitute the basis for our understanding of the vast problem of neglected tropical diseases. The WMP can be used also in the absence of a fast Internet communication. An ordinary PC, or even a laptop, may function as a local image server, e.g., in health centers in tropical endemic areas. PMID:18941514

  5. [Observations on Blastocystis hominis and Cyclospora cayetanensis in routine parasitological examinations].

    PubMed

    Alarcón, Ruth Semira Rodriguez; Amato Neto, Vicente; Gakiya, Erika; Bezerra, Rita Cristina

    2007-01-01

    We report some observations made from routine parasitological examinations on feces. The methods of Faust et al. and of spontaneous sedimentation in water are not enough to identify Blastocystis hominis. Significant percentage presence of this protozoan was found, especially when staining with iron hematoxylin was performed. Cyclospora cayetanensis was found in 0.7% of the cases, which suggests that this parasite should also routinely be investigated by appropriate techniques. PMID:17568902

  6. Diagnosis of subclinical equine theileriosis in center of Iran using parasitological and molecular methods.

    PubMed

    Bahrami, S; Ghadrdan, A R; Mirabdollahi, S M; Fayed, M R

    2014-03-01

    A total of 105 blood samples from healthy horses from different stables in Yazd province, center of Iran, were examined for the presence of Theileria equi infection using parasitological and molecular methods. Out of the 105 samples, the parasitological method detected T. equi infection in 5 (4.76%) cases while the PCR method gave 24 (22.86%) positive results. Age, gender and breed were not determined as risk factors for T. equi infection in this study. Since blood samples were taken from healthy animals, this implies that 22.86% of horses had subclinical theileriosis in the current study. In conclusion, this study demonstrated that T. equi is present in horses in the center of Iran. Despite the healthy appearance of horses, these carrier animals can transmit the parasites to ticks and are a potential continuous source for maintaining and disseminating the organisms to the horse population. We concluded that it is important to make further studies on definitive host and vectors in the respective areas. PMID:24862050

  7. Parasitology Today, vol. 16, no. 3, 2000 127 A number of parasite genome projects are under way, and

    E-print Network

    Ramaswamy, Ram

    Parasitology Today, vol. 16, no. 3, 2000 127 A number of parasite genome projects are under way for the analysis of parasite genomes. The nucleotide sequences of the entire genomes of sev- eral organisms analysis, or via the so-called `functional gen- omics approach'1. In parasitic species, such analysis may

  8. An internationally recognized quality assurance system for diagnostic parasitology in animal health and food safety, with example data on trichinellosis

    Microsoft Academic Search

    Alvin A. Gajadhar; Lorry B. Forbes

    2002-01-01

    A quality assurance (QA) system was developed for diagnostic parasitology and implemented for several diagnostic assays including fecal flotation and sedimentation assays, trichomonad culture assay, and the testing of pork and horse meat for Trichinella to facilitate consistently reliable results. The system consisted of a validated test method, procedures to confirm laboratory capability, and protocols for documentation, reporting, and monitoring.

  9. World Association for the Advancement of Veterinary Parasitology (WAAVP) guidelines for evaluating the effectiveness of anthelmintics in chickens and turkeys

    Microsoft Academic Search

    T. A Yazwinski; H. D Chapman; R. B Davis; T Letonja; L Pote; L Maes; J Vercruysse; D. E Jacobs

    2003-01-01

    These guidelines have been prepared to assist in the planning, operation and interpretation of studies designed to assess the effectiveness of drugs against helminth parasites of chickens and turkeys. They are the first to be compiled under the auspices of the World Association for the Advancement of Veterinary Parasitology (WAAVP) for these parasites. The advantages and disadvantages of the widely

  10. [Methodical features of the molding of diagnostic competences in medical parasitology workers].

    PubMed

    Dovgalev, A S; Astanina, S Iu; Avdiukhina, T I; Serdiuk, A P; Imamkuliev, K D

    2015-01-01

    The paper provides a rationale for a procedure to mold diagnostic competences in medical workers of the laboratories of therapeutic-and-prophylactic institutions and hygiene and epidemiology centers, Russian Federal Service for Supervision of Consumer Rights Protection and Human Welfare. The methodical features of molding diagnostic competences in the above contingents are the design and organization of an educational process by applying systems integration and competence-based approaches; increased active self-directed learning of audience; a procedure to organize its unsupervised extracurricular activities. Professional habits and skills in laboratory specialists should be molded on the basis of didactic principles and in compliance with the found methodical patterns. The eventual result (molded competences) and its compliance with the practical health care requirements is assessed using all control types (incoming, running, intermediate, and ultimate ones). This ensures the stability and predictability of molding diagnostic competences in parasitology specialists. PMID:25850323

  11. Computer-assisted instruction in parasitology: a cross-over design.

    PubMed

    Sanprasert, Vivornpun; Jaratsing, Pornpun; Nuchprayoon, Issarang; Nuchprayoon, Surang

    2005-09-01

    We report here the results of the study using CAI compared to the hard copy for study of lessons in parasitology. We evaluated the CAI compared to hard copy lessons in 60 students, attending the third-year parasitology course at Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand. The students were randomly divided into two groups (30 each). The lessons tested were Ascaris lumbricoides and Enterobius vermicularis, which were prepared as CAI and hard copy form. Using a cross-over design, the first group was provided CAI form on the topic of A. lumbricoides, then switched to hard copy form on the topic of E. vermicularis. The second group was provided hard copy form on the topic of A. lumbricoides, then switched to CAI form on the topic of E. vermicularis. After 30 minute reading, the 10-multiple choice question test was provided for each topic. There was no significant difference of the scores between 2 groups. The most students (91.67%) had more satisfaction when using CAI compared to hard copy in terms of easy to use, convenient to use, less time consuming, more understandable, more attractive to read, and less stress for study. There were 32.8% students complaining that reading hard copy was boring. Other comments were stress when reading (2%), more difficult (17.2%) and more time needed to search specific information (17.2%), and wasting papers (17.2%). However 58.6% still complained problems when using CAL. About 25% had physical discomfort (e.g. Headache, eye pain), and 25% had difficulty to access to use CAI (e.g. no computers available, problems with computer or network error). We suggested that instructors should create and improve CAI lessons in biomedical sciences both in quantity and quality (e.g. content with details, pictures, narrations). PMID:16623031

  12. Comparative feasibility of implementing rapid diagnostic test and microscopy for parasitological diagnosis of malaria in Uganda

    PubMed Central

    2011-01-01

    Background In Uganda, parasite-based diagnosis is recommended for every patient suspected to have malaria before prescribing anti-malarials. However, the majority of patients are still treated presumptively especially in low-level health units. The feasibility of implementing parasite-based diagnosis for uncomplicated malaria in rural health centres (HCs) was investigated with a view to recommending measures for scaling up the policy. Methods Thirty HCs were randomized to implement parasite-based diagnosis based on rapid diagnostic tests [RDTs] (n = 10), blood microscopy (n = 10) and presumptive diagnosis (control arm) (n = 10). Feasibility was assessed by comparing the proportion of patients who received parasite-based diagnosis; with a positive malaria parasite-based diagnosis who received artemether-lumefantrine (AL); with a negative malaria parasite-based diagnosis who received AL; and patient waiting time. Clinicaltrials.gov: NCT00565071. Results 102, 087 outpatients were enrolled. Patients were more likely to be tested in the RDT 44, 565 (96.6%) than in microscopy arm 19, 545 (60.9%) [RR: 1.59]. RDTs reduced patient waiting time compared to microscopy and were more convenient to health workers and patients. Majority 23, 804 (99.7%) in presumptive arm were prescribed AL. All (100%) of patients who tested positive for malaria in RDT and microscopy arms were prescribed anti-malarials. Parasitological-based diagnosis significantly reduced AL prescription in RDT arm [RR: 0.62] and microscopy arm [RR: 0.72] compared to presumptive treatment. Among patients not tested in the two intervention arms, 12, 044 (96.1%) in microscopy and 965 (61.6%) in RDT arm were treated with AL [RR: 1.56]. Overall 10, 558 (29.4%) with negative results [5, 110 (23.4%) in RDT and 5, 448 (39.0%) in microscopy arms] were prescribed AL. Conclusion It was more feasible to implement parasite-based diagnosis for malaria using RDT than with microscopy. A high proportion of patients with negative malaria results are still prescribed anti-malarials. There is need to increase access to parasite-based diagnosis where microscopy is used. In order to fully harness the benefits of parasitological confirmation of malaria, it is necessary to reduce the prescription of anti-malarials in negative patients. PMID:22182758

  13. Pathological and parasitological traits in experimentally infected cats with Gnathostoma binucleatum (Spirurida: Gnathostomatidae).

    PubMed

    Alvarez-Guerrero, C; Muñoz-Guzmán, M A; Alba-Hurtado, F

    2014-08-29

    This study aims to describe some of the unknown pathological and parasitological traits of experimental feline gnathostomosis. Thirteen female cats were orally inoculated with 30 advanced third-stage Gnathostoma binucleatum larvae and were euthanized at various post-infection (p.i.) periods. Clinically, the cats presented with nausea, vomiting, abdominal pain and other nonspecific signs. None of the cats shed eggs in their fecal matter. One cat, euthanized at 6 months p.i., developed a fibrous vascular nodule 2-3 cm in diameter within its gastric wall. The nodule contained caverns filled with mucous and bloody fluid as well as a juvenile worm. The histological characteristics of the nodule were observed, and the morphology of the juvenile worm was revealed using scanning electron microscopy. Another cat, euthanized at 10 months p.i., was found to have a larva within its diaphragm. Infected cats developed increased antibody titers against antigens of G. binucleatum adults and larvae beginning in the first month p.i., and these titers were maintained until the end of the experiment, suggesting the presence of undetected migrating larvae. The low number of cats with parasites and poor development of the parasites found suggest that cats have a low susceptibility to infection by G. binucleatum and cast doubt on the importance of domestic cats in maintaining the biological cycle of this parasite in nature. PMID:24877783

  14. Serological and parasitological study and report of the first case of human babesiosis in Colombia.

    PubMed

    Ríos, Leonardo; Alvarez, Gonzalo; Blair, Silvia

    2003-01-01

    A study on the presence of Babesia in humans was performed in Puerto Berr o (Latitude 6.50deg. Longitude: -74.38deg. River: Magdalena. Area: 74.410km , Colombia-South America). Indirect immunofluorescence, thin and thick blood smears were used to study 194 individuals. Patients were grouped according to their risk-factors for Babesia infection: (group 1) individuals with fever, chills, sweating and other malaria-type symptoms; (group 2) symptomatic and asymptomatic individuals from local cattle ranches, which were enrolled in an active form, and (group 3) workers from the local slaughterhouse. Seven individuals were serologically positive for Babesia: Three individuals presented IgM antibodies against B. bovis, while one had IgG against this species; one individual had IgM against B. bigemina, another had IgG and a third both IgM and IgG against this species. Only one individual was parasitologically positive for Babesiaand serologically positive for Babesia bovis (IgM 1:64) PMID:12937727

  15. Parasitological and hematological aspects of co-infection with Angiostrongylus vasorum and Ancylostoma caninum in dogs.

    PubMed

    Dracz, Ruth Massote; Mozzer, Lanuze Rose; Fujiwara, Ricardo Toshio; Lima, Walter dos Santos

    2014-02-24

    Dogs are frequently infected by one or more species of endoparasites, which can lead to secondary infections that cause high morbidity and death. In this context, 2 nematode species are of veterinary importance: Angiostrongylus vasorum, which is a parasite of the pulmonary artery and right ventricle in domestic and wild canids, and Ancylostoma caninum, which is a parasite of the small intestine in felids and domestic and wild canids. We used 20 mongrel dogs that were divided into groups and infected as follows: Group A included 5 uninfected dogs, Group B included 5 dogs infected with A. vasorum, Group C included 5 dogs infected with A. caninum, and Group D included 5 dogs co-infected with A. vasorum and A. caninum. Parasitological and hematological monitoring were performed. The counts of larvae and eggs shed in the feces varied throughout the collection period. Moreover, negativation was not observed in any of the infected groups. The animals in Group C had macrocytic and hypochromic anemia, whereas the animals in Group D had macrocytic and normochromic anemia. Infected dogs also presented with eosinophilia and lymphocytosis. These data from coproparasitological techniques provide an improved assessment of disease severity and a more thorough understanding of parasitism in the host. PMID:24373514

  16. Frontiers of parasitology research in the People's Republic of China: infection, diagnosis, protection and surveillance

    PubMed Central

    2012-01-01

    Control and eventual elimination of human parasitic diseases in the People's Republic of China (P.R. China) requires novel approaches, particularly in the areas of diagnostics, mathematical modelling, monitoring, evaluation, surveillance and public health response. A comprehensive effort, involving the collaboration of 188 scientists (>85% from P.R. China) from 48 different institutions and universities (80% from P.R. China), covers this collection of 29 articles published in Parasites & Vectors. The research mainly stems from a research project entitled “Surveillance and diagnostic tools for major parasitic diseases in P.R. China” (grant no. 2008ZX10004-011) and highlights the frontiers of research in parasitology. The majority of articles in this thematic series deals with the most important parasitic diseases in P.R. China, emphasizing Schistosoma japonicum, Plasmodium vivax and Clonorchis sinensis plus some parasites of emerging importance such as Angiostrongylus cantonensis. Significant achievements have been made through the collaborative research programme in the following three fields: (i) development of strategies for the national control programme; (ii) updating the surveillance data of parasitic infections both in human and animals; and (iii) improvement of existing, and development of novel, diagnostic tools to detect parasitic infections. The progress is considerable and warrants broad validation efforts. Combined with the development of improved tools for diagnosis and surveillance, integrated and multi-pronged control strategies should now pave the way for elimination of parasitic diseases in P.R. China. Experiences and lessons learned can stimulate control and elimination efforts of parasitic diseases in other parts of the world. PMID:23036110

  17. Performance of Parasitological and Molecular Techniques for the Diagnosis and Surveillance of Gambiense Sleeping Sickness

    PubMed Central

    Mumba Ngoyi, Dieudonné; Ali Ekangu, Rosine; Mumvemba Kodi, Marie France; Pyana, Patient Pati; Balharbi, Fatima; Decq, Mélanie; Kande Betu, Victor; Van der Veken, Wim; Sese, Claude; Menten, Joris; Büscher, Philippe; Lejon, Veerle

    2014-01-01

    Objectives Recently, improvements have been made to diagnostics for gambiense sleeping sickness control but their performance remains poorly documented and may depend on specimen processing prior to examination. In a prospective study in the Democratic Republic of the Congo, we compared the diagnostic performance of several parasite detection techniques, immune trypanolysis and of m18S PCR on whole blood stored in a stabilisation buffer or dried on filter paper. Methods Individuals with CATT whole blood (WB) titer ?1?4 or with clinical signs indicative for sleeping sickness were examined for presence of trypanosomes in lymph node aspirate (LNA) and/or in blood. Blood was examined with Capillary Centrifugation Technique (CTC), mini-Anion Exchange Centrifugation Technique (mAECT) and mAECT on buffy coat (BC). PCR was performed on whole blood (i) stored in guanidine hydrochloride EDTA (GE) stabilisation buffer and (ii) dried on filter paper, and repeatability and reproducibility were assessed. Immune trypanolysis (TL) was performed on plasma. Results A total of 237 persons were included. Among 143 parasitologically confirmed cases, 85.3% had a CATT-WB titre of ?1/8, 39.2% were positive in LNA, 47.5% in CTC, 80.4% in mAECT-WB, 90.9% in mAECT-BC, 95.1% in TL and up to 89.5% in PCR on GE-stabilised blood. PCR on GE-stabilised blood showed highest repeatability (87.8%) and inter-laboratory reproducibility (86.9%). Of the 94 non-confirmed suspects, respectively 39.4% and 23.4% were TL or PCR positive. Suboptimal specificity of PCR and TL was also suggested by latent class analysis. Conclusion The combination of LNA examination with mAECT-BC offered excellent diagnostic sensitivity. For PCR, storage of blood in stabilisation buffer is to be preferred over filter paper. TL as well as PCR are useful for remote diagnosis but are not more sensitive than mAECT-BC. For TL and PCR, the specificity, and thus usefulness for management of non-confirmed suspects remain to be determined. PMID:24921941

  18. Bovine fasciolosis at increasing altitudes: Parasitological and malacological sampling on the slopes of Mount Elgon, Uganda

    PubMed Central

    2012-01-01

    Background To clarify the extent and putative transmission zone of bovine fasciolosis on the slopes of Mount Elgon, Uganda, conjoint parasitological and malacological surveys, inclusive of inspection of animals at slaughter, were undertaken at increasing altitudes. Results A total of 239 cattle were sampled across eight locations ranging in elevation from 1112-2072?m. Faecal material was examined for presence of Fasciola eggs and sera were tested by ELISA for antibodies against Fasciola antigens. Bolstering this, 38 cattle at slaughter from 2 abattoir sites at 1150?m and 1947?m were inspected; in addition, wild buffalo stool (n?=?10) opportunistically picked within Mount Elgon National Park (MENP) at 3640?m was examined. By faecal egg detection, prevalence of Fasciola gigantica at low (<1500?m) and high (>1500?m) altitude sites was 43.7% (95% CI 35.4-52.2) and 1.1% (95% CI 0.0-6.0), respectively, while by ELISA was much higher, low altitude - 77.9% (95% CI 69.7-85.4) and high altitude - 64.5% (95% CI 51.3-76.3). The decline in prevalence with increasing altitude was corroborated by abattoir sampling. Thirty seven aquatic habitats, ranging from 1139-3937?m in altitude were inspected for freshwater snails, 12 of which were within MENP. At lower altitudes, Lymnaea (Radix) natalensis was common, and often abundant, but at higher altitudes became much rarer ceasing to be found above 1800?m. On the other hand, Lymnaea (Galba) truncatula was found only at altitudes above 3000?m and within MENP alone. The snail identifications were confirmed by DNA analysis of the ribosomal 18S gene. Conclusions Active infections of F. gigantica in cattle are common in lower altitude settings but appear to diminish with increasing elevation. This is likely due to a growing paucity of intermediate hosts, specifically populations of L. natalensis for which a natural boundary of 1800?m appeared. Although F. hepatica was not encountered, the presence of several populations of L. truncatula at elevations over 3000?m point towards a potential transmission zone within MENP should this parasite be introduced. PMID:22958402

  19. 862 THE JOURNAL OF PARASITOLOGY, VOL. 89, NO. 4, AUGUST 2003 DUBEY, J. P., AND G. DESMONTS. 1987. Serological responses of equids

    E-print Network

    Poulin, Robert

    Sarcocystis falcatula and Sarcocystis neurona. Journal of Parasitology 87: 824­832. GULLAND, F. M. D., L. J. LOWENSTINE, J. M. LAPOINTE, T. SPRAKER, AND D. P. KING. 1997. Herpesvirus infection in stranded Pacific. DUIGNAN, A. E. MARSH, F. M. GULLAND, B. C. BARR, D. K. NAYDAN, D. P. KING, C. A. FARMAN, K. A. BUREK

  20. In Their Own Words Or: Symptoms of Morgellons and Neurocutaneous Syndrome (Ncs) Upon First Examination at the Parasitology Center, Inc. (Pci)

    Microsoft Academic Search

    Omar M. Amin

    2010-01-01

    Upon first examination at Parasitology Center, Inc. (PCI), Scottsdale, Arizona, prospective Neuro- cutaneous Syndrome (NCS) and Morgellons patients are required to fill out a Requisition Form in which they are asked to describe their symptoms. The body of this article is a compilation of statements by 166 patients in their own words, describing their symptoms at the time, the cause

  1. Experimental chemotherapy of Trypanosoma cruzi infection: persistence of parasite antigens and positive serology in parasitologically cured mice.

    PubMed Central

    Andrade, S. G.; Freitas, L. A.; Peyrol, S.; Pimentel, A. R.; Sadigursky, M.

    1991-01-01

    Mice infected with Trypanosoma cruzi, but parasitologically cured after specific chemotherapy, continued to exhibit positive indirect immunofluorescence serological tests 3-6 months after the therapy. Treatment of trypanosome antigens with monospecific antisera produced in rabbits, and examination by immunoelectron-microscopy following peroxidase labelling disclosed the presence of membrane deposits in cell processes in the spleens of the mice. Similar deposits were observed in the external membranes of T. cruzi amastigotes in the spleens of acutely infected mice, but not in normal control mice. No reaction occurred in tissues not previously treated with the monospecific anti-T. cruzi serum. Positive cells in treated and cured mice, as well as in the not cured or untreated control mice, were located in germinal centres of the splenic white pulp and presented long and branching cytoplasmic processes, which are indicative of dendritic cells of the lymphoid follicles of the spleen. Images Fig. 1 Fig. 2 Fig. 3 PMID:1907221

  2. Malaria prevalence pattern observed in the highland fringe of Butajira, Southern Ethiopia: A longitudinal study from parasitological and entomological survey

    PubMed Central

    2011-01-01

    Background In Ethiopia, information regarding highland malaria transmission is scarce, and no report has been presented from Butajira highland so far whether the appearance of malaria in the area was due to endemicity or due to highland malaria transmission. Thus this study aimed to determine the presence and magnitude of malaria transmission in Butajira. Methods For parasitological survey, longitudinal study was conducted from October to December 2006. The entomological surveys were done from October to December 2006 and continued from April to May 2007. Both parasitological and entomological surveys were done using standard procedures. Results The parasitological result in all the survey months (October-December) showed an overall detection rate of 4.4% (48/1082) (CI 95%; 3.2-5.7%) malaria parasite. Among infected individuals, 32 (3.0%) of the infection was due to Plasmodium vivax and the rest 16 (1.5%) were due to Plasmodium falciparum. The highest prevalence 39(3.6%) of the parasite was observed in age groups of above 15 years old. Among the total tested, 25(2.3%) of males and 23(2.1%) of females had malaria infection. Among tested individuals, 38(5.3%) and 10 (2.7%) of infection was occurred in Misrak-Meskan (2100 m a.s.l) and Mirab-Meskan (2280 m a.s.l), respectively which was statistically significant (X2 = 3.72, P < 0.05). Although the prevalence pattern of Plasmodium species declined from October to December, the trend was non-significant (X2 for trend = 0.49, P > 0.05). The entomological survey showed a collection of 602 larvae and 80 adult Anopheles. Anopheles christyi was the dominant species both in the first (45.3%) and in the second (35.4%) surveys; where as, Anopheles gambiae sensu lato comprised 4.7% and 14.6%, in the first and second surveys, respectively. Anopheles gambiae s.l comprises 55% of the adult collection, and both species were collected more from outdoors (57.5%). The number of An. christyi was higher in Mirab-Meskan (58. 3%) than Misrak-Meskan (41.7%) (P < 0.05). Conclusion Malaria parasite and its vectors were found to be common during transmission periods in the highland fringes of Butajira. Thus, health education about the risk of malaria and its control programme in the area must be given adequate attention to minimize potential epidemics. In addition, the current study should be complemented from sero-epidemiological, prospective longitudinal and retrospective studies along with metrological and ecological factors, and socio-demographic data before concluding in favour of highland malaria transmission in the area. In light of its abundance, which coincided with the malaria transmission seasons, the possible role of An. christyi as a secondary vector in the highlands must be further investigated by including blood meal sources detection. PMID:21649923

  3. Evaluation of parasitological and molecular techniques for the diagnosis and assessment of cure of schistosomiasis mansoni in a low transmission area

    PubMed Central

    Siqueira, Liliane Maria Vidal; Gomes, Luciana Inácia; Oliveira, Edward; de Oliveira, Eduardo Ribeiro; de Oliveira, Áureo Almeida; Enk, Martin Johannes; Carneiro, Nídia Figueiredo; Rabello, Ana; Coelho, Paulo Marcos Zech

    2015-01-01

    This study evaluated parasitological and molecular techniques for the diagnosis and assessment of cure of schistosomiasis mansoni. A population-based study was performed in 201 inhabitants from a low transmission locality named Pedra Preta, municipality of Montes Claros, state of Minas Gerais, Brazil. Four stool samples were analysed using two techniques, the Kato-Katz® (KK) technique (18 slides) and the TF-Test®, to establish the infection rate. The positivity rate of 18 KK slides of four stool samples was 28.9% (58/201) and the combined parasitological techniques (KK+TF-Test®) produced a 35.8% positivity rate (72/201). Furthermore, a polymerase chain reaction (PCR)-ELISA assay produced a positivity rate of 23.4% (47/201) using the first sample. All 72 patients with positive parasitological exams were treated with a single dose of Praziquantel® and these patients were followed-up 30, 90 and 180 days after treatment to establish the cure rate. Cure rates obtained by the analysis of 12 KK slides were 100%, 100% and 98.4% at 30, 90 and 180 days after treatment, respectively. PCR-ELISA revealed cure rates of 98.5%, 95.5% and 96.5%, respectively. The diagnostic and assessment of cure for schistosomiasis may require an increased number of KK slides or a test with higher sensitivity, such as PCR-ELISA, in situations of very low parasite load, such as after therapeutic interventions. PMID:25946244

  4. The use of fish metabolic, pathological and parasitological indices in pollution monitoring . II. The Red Sea and Mediterranean

    NASA Astrophysics Data System (ADS)

    Diamant, A.; Banet, A.; Paperna, I.; Westernhagen, H. v.; Broeg, K.; Kruener, G.; Koerting, W.; Zander, S.

    ??The complex interactions between parasites, hosts and the environment are influenced by the stability of the ecosystem. Heteroxenous parasites, with complex, multiple-host life cycles, can persist only in habitats where the full range of their required hosts are present. Conversely, in impoverished environments such as those impacted by environmental stress, monoxenous species that have simple, single-host life cycles are likely to predominate. In the present study, we analyzed the ratio between heteroxenous and monoxenous (H/M) parasites as well as parasite species richness (SH/SM) and species diversity in rabbitfish (Siganus rivulatus) collected from several sites in the Red Sea. The rabbitfish is a Suez Canal immigrant, well established in the eastern Mediterranean, and fish were also collected from a site on the Mediterranean coast of Israel. Separate treatment of the micro- and macroparasite components of the rabbitfish parasite communities in the Red Sea suggested that macroparasites only - monogenea and gut parasites - were better indicators than the parasite community as a whole. Quantification of macroparasites is accurate, saves time and effort, produces more accurate data and better differentiates between sites. Higher H/M ratios and SH/SM ratios were found in the rabbitfish collected at the ecologically stable habitat of the coral reef compared to rabbitfish from sandy habitat or mariculture-impacted sandy habitat. The results of the study emphasized the negative impacts of cage mariculture on the environment. The rabbitfish collected near the mariculture farms supported the poorest and least diverse parasite communities of all sampled sites, with virtual depletion of heteroxenous species, and even reduction of gill monogenean infections on the hosts. When results from the Mediterranean sites were compared with those of the Red Sea, the data showed full representation of monoxenous parasites (all but one of Red Sea origin), while heteroxenous species were completely absent. We may therefore regard the Mediterranean as a simulation model for a severely environmentally deteriorated, impoverished habitat, in which all or part of the intermediate host species have been depleted, enabling survival of the monoxenous parasite species only. Parasitological investigations were supplemented by testing the activity of cytochrome P 450- dependent mono-oxygenase EROD as a measure of exposure, and lysosomal stability as a measure of toxic effect in the liver of rabbitfish. The results underline the parasitological findings, showing that fish caught at the impacted sandy beach location in the Red Sea have significantly higher EROD activity and a decreased membrane stability compared with animals from the coral reef. In comparison, EROD activity values in rabbitfish from the Mediterranean Sea were double, while lysosomal membrane stability was half that measured at the most impacted Red Sea location.

  5. Performance of LBSap Vaccine after Intradermal Challenge with L. infantum and Saliva of Lu. longipalpis: Immunogenicity and Parasitological Evaluation

    PubMed Central

    Roatt, Bruno Mendes; Aguiar-Soares, Rodrigo Dian de Oliveira; Vitoriano-Souza, Juliana; Coura-Vital, Wendel; Braga, Samuel Leôncio; Corrêa-Oliveira, Rodrigo; Martins-Filho, Olindo Assis; Teixeira-Carvalho, Andréa; de Lana, Marta; Gontijo, Nelder Figueiredo; Marques, Marcos José; Giunchetti, Rodolfo Cordeiro; Reis, Alexandre Barbosa

    2012-01-01

    In the last decade, the search for new vaccines against canine visceral leishmaniasis has intensified. However, the pattern related to immune protection during long periods after experimental infection in vaccine trials is still not fully understood. Herein, we investigated the immunogenicity and parasitological levels after intradermal challenge with Leishmania infantum plus salivary gland extract in dogs immunized with a vaccine composed of L. braziliensis antigens plus saponin as an adjuvant (LBSap vaccine). The LBSap vaccine elicited higher levels of total anti-Leishmania IgG as well as both IgG1 and IgG2. Furthermore, dogs vaccinated had increased levels of lymphocytes, particularly circulating B cells (CD21+) and both CD4+ and CD8+ T lymphocytes. LBSap also elicited an intense in vitro cell proliferation associated with higher levels of CD4+ T lymphocytes specific for vaccine soluble antigen and soluble lysate of L. infantum antigen even 885 days after experimental challenge. Furthermore, LBSap vaccinated dogs presented high IFN-? and low IL-10 and TGF-?1 expression in spleen with significant reduction of parasite load in this tissue. Overall, our results validate the potential of LBSap vaccine to protect against L. infantum experimental infection and strongly support further evaluation of efficiency of LBSap against CVL in natural infection conditions. PMID:23189161

  6. Weibull statistical analysis of tensile strength of vascular bundle in inner layer of moso bamboo culm in molecular parasitology and vector biology.

    PubMed

    Le, Cui; Wanxi, Peng; Zhengjun, Sun; Lili, Shang; Guoning, Chen

    2014-07-01

    Bamboo is a radial gradient variation composite material against parasitology and vector biology, but the vascular bundles in inner layer are evenly distributed. The objective is to determine the regular size pattern and Weibull statistical analysis of the vascular bundle tensile strength in inner layer of Moso bamboo. The size and shape of vascular bundles in inner layer are similar, with an average area about 0.1550 mm2. A statistical evaluation of the tensile strength of vascular bundle was conducted by means of Weibull statistics, the results show that the Weibull modulus m is 6.1121 and the accurate reliability assessment of vascular bundle is determined. PMID:25016270

  7. Efficacy of Cyclooctadepsipeptides and Aminophenylamidines against Larval, Immature and Mature Adult Stages of a Parasitologically Characterized Trichurosis Model in Mice

    PubMed Central

    Kulke, Daniel; Krücken, Jürgen; Harder, Achim; von Samson-Himmelstjerna, Georg

    2014-01-01

    Background The genus Trichuris includes parasites of major relevance in veterinary and human medicine. Despite serious economic losses and enormous impact on public health, treatment options against whipworms are very limited. Additionally, there is an obvious lack of appropriately characterized experimental infection models. Therefore, a detailed parasitological characterization of a Trichuris muris isolate was performed in C57BL/10 mice. Subsequently, the in vivo efficacies of the aminophenylamidines amidantel, deacylated amidantel (dAMD) and tribendimidine as well as the cyclooctadepsipeptides emodepside and in particular PF1022A were analyzed. This was performed using various administration routes and treatment schemes targeting histotropic and further developed larval as well as immature and mature adult stages. Methodology/Principal Findings Duration of prepatent period, time-dependent localization of larvae during period of prepatency as well as the duration of patency of the infection were determined before drugs were tested in the characterized trichurosis model. Amidantel showed no effect against mature adult T. muris. Tribendimidine showed significantly higher potency than dAMD after oral treatments (ED50 values of 6.5 vs. 15.1 mg/kg). However, the opposite was found for intraperitoneal treatments (ED50 values of 15.3 vs. 8.3 mg/kg). When emodepside and PF1022A were compared, the latter was significantly less effective against mature adults following intraperitoneal (ED50 values of 6.1 vs. 55.7 mg/kg) or subcutaneous (ED50 values of 15.2 vs. 225.7 mg/kg) administration. Only minimal differences were observed following oral administration (ED50 values of 2.7 vs. 5.2 mg/kg). Triple and most single oral doses with moderate to high dosages of PF1022A showed complete efficacy against histotropic second stage larvae (3×100 mg/kg or 1×250 mg/kg), further developed larvae (3×10 mg/kg or 1×100 mg/kg) and immature adults (3×10 mg/kg or 1×100 mg/kg). Histotropic first stage larvae were only eliminated after three doses of PF1022A (3×100 mg/kg) but not after a single dose. Conclusions/Significance These results indicate that the cyclooctadepsipeptides are a drug class with promising candidates for further evaluation for the treatment of trichurosis of humans and livestock animals in single dose regimens. PMID:24587460

  8. Physiology, pharmacology and parasitology

    Microsoft Academic Search

    D. R. Hennessy

    1997-01-01

    The developing resistance to current chemical classes of broad-spectrum anthelmintics and insecticides presents an undeniable threat to the long-term viability of the animal health industry. Alternative treatment strategies including vaccines, biological control and breeding of parasite-resistant animals are unlikely to be widely available in the near future and even then they will be integrated with chemotherapy. The significant cost of

  9. Benefits from Network "Parasitology"

    ERIC Educational Resources Information Center

    Tornudd, Elin

    1976-01-01

    Discussion of experience gained by the Finnish central library for technology in off-line use of computer-based services, both selective dissemination of information and retrospective searches offered by the Royal Institute of Technology Library and the Biomedical Documentation Centre in Stockholm, as well as the Technological Library of Denmark…

  10. High plasma levels of nitrogen oxides are associated with severe disease and correlate with rapid parasitological and clinical cure in Plasmodium falciparum malaria.

    PubMed

    Kremsner, P G; Winkler, S; Wildling, E; Prada, J; Bienzle, U; Graninger, W; Nüssler, A K

    1996-01-01

    Plasma levels of nitrogen oxide (NO), neopterin and C-reactive protein (CRP) were compared in 3 groups of Gabonese patients with Plasmodium falciparum malaria before and after therapy: adults with uncomplicated malaria, children with uncomplicated malaria, and children with severe malaria. Plasma levels of all 3 molecules were significantly higher in severe malaria than in uncomplicated malaria. High levels of neopterin and CRP during the acute phase of malaria significantly correlated with slow parasitological and clinical cure after therapy. In contrast, high NO plasma levels during the acute phase of malaria predicted accelerated cure. These findings provide further evidence for the protective role of NO in malaria. However, as NO levels were highest in severe disease, overproduction may be harmful for the patients. PMID:8730311

  11. Blastocystis Isolates from Patients with Irritable Bowel Syndrome and from Asymptomatic Carriers Exhibit Similar Parasitological Loads, but Significantly Different Generation Times and Genetic Variability across Multiple Subtypes.

    PubMed

    Vargas-Sanchez, Gie-Bele; Romero-Valdovinos, Mirza; Ramirez-Guerrero, Celedonio; Vargas-Hernandez, Ines; Ramirez-Miranda, Maria Elena; Martinez-Ocaña, Joel; Valadez, Alicia; Ximenez, Cecilia; Lopez-Escamilla, Eduardo; Hernandez-Campos, Maria Elena; Villalobos, Guiehdani; Martinez-Hernandez, Fernando; Maravilla, Pablo

    2015-01-01

    Blastocystis spp is a common intestinal parasite of humans and animals that has been associated to the etiology of irritable bowel syndrome (IBS); however, some studies have not found this association. Furthermore, many biological features of Blastocystis are little known. The objective of present study was to assess the generation times of Blastocystis cultures, from IBS patients and from asymptomatic carriers. A total of 100 isolates were obtained from 50 IBS patients and from 50 asymptomatic carriers. Up to 50 mg of feces from each participant were cultured in Barret's and in Pavlova's media during 48 h. Initial and final parasitological load were measured by microscopy and by quantitative PCR. Amplicons were purified, sequenced and submitted to GenBank; sequences were analysed for genetic diversity and a Bayesian inference allowed identifying genetic subtypes (ST). Generation times for Blastocystis isolates in both media, based on microscopic measures and molecular assays, were calculated. The clinical symptoms of IBS patients and distribution of Blastocystis ST 1, 2 and 3 in both groups was comparable to previous reports. Interestingly, the group of cases showed scarce mean nucleotide diversity (?) as compared to the control group (0.011±0.016 and 0.118±0.177, respectively), whilst high gene flow and small genetic differentiation indexes between different ST were found. Besides, Tajima's D test showed negative values for ST1-ST3. No statistical differences regarding parasitological load between cases and controls in both media, as searched by microscopy and by qPCR, were detected except that parasites grew faster in Barret's than in Pavlova's medium. Interestingly, slow growth of isolates recovered from cases in comparison to those of controls was observed (p<0.05). We propose that generation times of Blastocystis might be easily affected by intestinal environmental changes due to IBS probably because virulent strains with slow growth may be selected, reducing their genetic variability. PMID:25923708

  12. World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) second edition of guidelines for evaluating the efficacy of anthelmintics in ruminants (bovine, ovine, caprine)

    Microsoft Academic Search

    I. B. Wood; N. K. Amaral; K. Bairden; J. L. Duncan; T. Kassai; J. B. Malone; J. A. Pankavich; R. K. Reinecke; O. Slocombe; S. M. Taylor; J. Vercruysse

    1995-01-01

    The first edition of the W.A.A.V.P. anthelmintic guidelines for ruminants was published in 1982. Since then improved parasitological procedures have been developed, new therapeutic and prophylactic products have appeared requiring different test methods, and registration authorities are requesting more detailed record keeping and data validation. This second edition addresses these developments and fulfills the original goal of publishing guidelines for

  13. Supplementation of moist and dehydrated citrus pulp in the diets of sheep artificially and naturally infected with gastrointestinal nematodes on the parasitological parameters and performance.

    PubMed

    Nordi, E C P; Costa, R L D; David, C M G; Parren, G A E; Freitas, A C B; Lameirinha, L P; Katiki, L M; Bueno, M S; Quirino, C R; Gama, P E; Bizzo, H R; Chagas, A C S

    2014-10-15

    The inclusion of industrial byproducts such as citrus pulp in the composition of animal diets has been widely recommended due to sustainability aspects and their high level of carbohydrates. Limonene is found in citrus pulp and has been described elsewhere as a major compound of citrus essential oils with excellent anthelmintic activity. The objective of this study was to evaluate the parasitological parameters of lambs artificially infected (Experiment 1) with Haemonchus contortus and naturally infected (Experiment 2) by gastrointestinal nematodes, fed diets with dehydrated citrus pulp or silage of moist orange pulp. Both experiments had three treatments (C: control, DP: diet+dehydrated citrus pulp, and MP: diet+silage of moist orange pulp). The diets were isoproteic (11% crude protein) and the concentrate was corrected every 14 days according to animal weight. Parasitological parameters were evaluated for both experiments each 14 days (body weight, body condition; fecal egg counts-FEC, egg hatch assay-EHA, coproculture, and packed cell volume-PCV). Analysis of variance (GLM of the SAS software) was performed with repeated measures in time, and the means were compared by the Tukey test. Gas chromatography with mass spectrometry was used to detect constituents of dry or moist citrus pulp. Dehydrated citrus pulp had 0.02% essential oil (major compounds were 85.9% limonene and 7.6% valencene). Moist orange pulp contained 1.5% essential oil (major compounds were 65.5% limonene and 31.2% alpha- and gamma-terpineol). In both experiments, the weight gain among the treatments was similar (p>0.05) demonstrating that both moist and dehydrated orange pulp can be used to replace corn kernels to feed infected lambs. The supplementation with orange pulp did not decrease natural or artificial infections of gastrointestinal nematodes according to the FEC results (p>0.05). However, PCV increased from animals fed dehydrated and moist pulp in natural infection (Experiment 2, p<0.05) in comparison with the control group. In addition, the consumption of the dehydrated citrus pulp from animals infected with H. contortus (Experiment 1) caused lower hatching rates after 42 days of consumption (p<0.05), suggesting a tendency to shed fewer eggs to the environment. PMID:25282048

  14. Overview on cysteine protease inhibitors as chemotherapy for Schistosomiasis mansoni in mice and also its effect on the parasitological and immunological profile.

    PubMed

    Farid, A; Malek, A Abdel; Rabie, I; Helmy, A; El Amir, A M

    2013-12-15

    The present study evaluated the use of 3 types of Cysteine Protease Inhibitors (CPIs) with praziquantel (PZQ) as chemotherapy against schistosomiasis mansoni in mice. All groups were going to assessment of fluromethylketone (FMK), Vinyl Sulfone (VS) and Sodium Nitro Prussid (SNP) by measurement of parasitological, immunological and histological parameters. In our study, The ova count/gm liver or intestine on with PZQ treatment showed 99.1 and 95.2% Percent Reduction (PR), respectively compared to control group. The most effective CPI was FMK when combined with PZQ recording 99.8 and 99.6% PR for liver and intestine, respectively. Regarding to the oogram pattern, FMK, VS and SNP treatment either at 3 or 5 wk PI revealed marked decrease in the immature and mature ova counts and an increase of the dead ova percentages. The effect of CPIs was studied on the PR of Mean Granuloma Diameter (MGD) and Mean Granuloma Number (MGN) of infected treated groups compared to infected control and PZQ treated groups. FMK treatment proved to be highly was effective against S. mansoni in mice disintegrating ova and reduction in granulomatous size and numbers. The microscopic examination of liver sections of infected mice showed a large cellular granuloma with living central ova. sections of Infected mice liver treated with FMK or VS alone or combined with PZQ showed a great reduction in granuloma size as small cellular granuloma with central degenerated ova. We observed that these CPIs alone or combined with PZQ could effectively block schistosomal activity and prevented its growth and differentiation. Briefly, the best schistosomicidal effect of CPIs, that gained by drug administration orally in a dose of 50 mg kg(-1) mouse, was observed with FMK. This was followed by VS and lastly with SNP. These results gave evidence that CPIs can selectively arrest parasite replication without untoward toxicity to the host. PMID:24517000

  15. Biochemical and Parasitological Studies on the Effect of hUCB-Selected CD34+ Progenitor/Stem Cells in Mice Infected with Schistosoma mansoni

    PubMed Central

    Abou-Zied, Akram M.; Soliman, Rasha H.; Hefila, Shorouk M.; Imam, Samir A.

    2014-01-01

    Background and Objectives: Placenta and blood that remained in the umbilical cord is routinely available as a discarded tissue after deliveries and it is free of any legal, moral, ethical or religious objections, providing a high number of multipotent CD34+ progenitor and stem cells. Using ex vivo isolated CD34+ cells from human umbilical cord blood (hUCB) have emerged as promising candidates to treat various diseases, including exogenous pathogenic infections. We have expanded to build a rational approach to study the effect of CD34+ cells after damaged liver tissues by the devastating human parasitic flatworm Schistosoma mansoni. Methods and Results: Experimental studies were conducted in the Department of Zoology, Faculty of Science and Departments of Parasitology and Physiology, Faculty of Medicine, SCU, Egypt. We have studied the impact of ex vivo preparation of CD34+ cells from hUCB on S. mansoni-induced liver fibrosis de novo, and treated for shorter and longer periods in vivo. Ova count, ALT and albumin were measured at specific time interval and histopathological examination of liver was conducted to confirm the biochemical results. The data obtained were statistically analyzed by ANOVA between groups. It was found that the administration of CD34+ cells have modestly reduced liver damage; reduced the S. mansoni infection associated elevation in serum levels of ALT; significantly improved serum levels of albumin and reduced egg granuloma diameter in the livers. Conclusions: We demonstrated that CD34+ cells can markedly ameliorated liver fibrosis in vivo and may be beneficial for therapy to recover organ structure and/or function of S. mansoni-infected mice. PMID:25473447

  16. A study of onchocerciasis with severe skin and eye lesions in a hyperendemic zone in the forest of southwestern Cameroon: clinical, parasitologic, and entomologic findings.

    PubMed

    Somo, R M; Enyong, P A; Fobi, G; Dinga, J S; Lafleur, C; Agnamey, P; Ngosso, A; Ngolle, E M

    1993-01-01

    Prior to the initiation of an onchocerciasis control program based on the mass administration of ivermectin in the rain forest of southwestern Cameroon, a preliminary baseline study of the area was conducted. The results of this study showed that onchocerciasis was hyperendemic in the area. Skin symptoms and signs were observed including pruritus (67.4% of the population examined), onchocerca nodules (51.6%), skin depigmentation (18.5%), and hanging groins (5.7%). Except for pruritus, the prevalence of these symptoms increased with age. Of the eyes examined, 44.9% had microfilariae in the anterior chamber, 33.5% had choroidoretinitis, 28.0% had punctate keratitis, 8.3% had papillary abnormalities, and 3.6% had sclerosing keratitis. Vision in 10.5% of the eyes examined was classified as blind or very poor (visual acuity = 0-0.10), in 15.7% as poor (visual acuity = 0.11-0.39), and in 73.8% as good (visual acuity = 0.4-1.00). Unlike previous reports that have linked serious ocular damage mainly to savanna onchocerciasis, the present study showed that forest onchocerciasis also caused significant ocular pathology, including blindness. Parasitologically, positive skin snips were recorded for 92.7% of the persons examined, with both sexes being equally infected. The parasite load, expressed as the geometric mean number of microfilariae per skin snip, was 53.6, and was much higher in males than in females. The flv vector, Simulium squamosum, had a high infection rate of 7.5% infective females in Bakumba and 6.8% infective females in Ngbandi, the two fly-catching points. The transmission potential was 266 infective larvae per person per month in Bakumba and 189 in Ngbandi. PMID:8427383

  17. PCR amplification reactions in parasitology

    Microsoft Academic Search

    Henk L. Smits; Rudy A. Hartskeerl

    1995-01-01

    The development of PCR systems for the detection and identification of pathogenic human parasites has only recently started. Evaluation of most of these methods is still lacking. Most likely these methods will need considerable improvement before reliable diagnostic methods become available. Only for some parasitic diseases, such as cutaneous leishmaniasis, PCR has already proven to be of potential diagnostic value,

  18. Parasitological and nutritional status of school-age and preschool-age children in four villages in Southern Leyte, Philippines: Lessons for monitoring the outcome of Community-Led Total Sanitation.

    PubMed

    Belizario, Vicente Y; Liwanag, Harvy Joy C; Naig, June Rose A; Chua, Paul Lester C; Madamba, Manuel I; Dahildahil, Roy O

    2015-01-01

    While preventive chemotherapy remains to be a major strategy for the prevention and control of soil-transmitted helminthiases (STH), improvements in water, sanitation, and hygiene (WASH) comprise the long-term strategy to achieve sustained control of STH. This study examined the parasitological and nutritional status of school-age and preschool-age children in four villages in Southern Leyte, Philippines where two of the villages attained Open-Defecation-Free (ODF) status after introduction of Community-Led Total Sanitation (CLTS). A total of 341 children (89.0% of the total eligible population) submitted stool samples which were examined using the Kato-Katz technique. Results showed that 27.9% of the total stool samples examined had at least one type of STH (cumulative prevalence), while 7.9% had moderate-heavy intensity infections. Between the two villages where CLTS was introduced, Buenavista had a significantly higher cumulative prevalence of STH at 67.4% (p<0.001) and prevalence of moderate-heavy intensity STH at 23.5% (p=0.000), while Caubang had a significantly lower cumulative prevalence at 4.9% and prevalence of moderate-heavy intensity at 1.8%. On the other hand, the non-CLTS villages of Bitoon and Saub had similar rates for cumulative prevalence (16.7% and 16.8%, respectively; p=0.984) and prevalence of moderate-heavy intensity STH (2.0% and 3.1%, respectively; p=1.000). The findings may be explained by factors that include possible reversion to open defecation, non-utilization of sanitary facilities, and mass drug administration (MDA) coverage, although further studies that can accurately assess the impact of CLTS are recommended. While this study was descriptive, the data indicate no clear pattern among the parasitological and nutritional parameters, as well as the presence of CLTS in the village, suggesting the need to monitor the ODF status of villages on a regular basis even after the end of CLTS activities to ensure the sustainability of the CLTS approach. In order to achieve effective control of STH, deeper collaboration between the WASH and STH sectors are recommended where partners can work together in the area of monitoring and evaluation that may include improved parasitological and nutritional status in high-risk groups, as well as sustainable behavior change as outcome indicators. PMID:25255966

  19. [A case study of singular spectrum analysis application in parasitology: dynamics of prevalence of Cryptocotyle concavum and Bunocotyle progenetica trematode parthenitae in Hydrobia ventrosa snails at the White Sea].

    PubMed

    Levakin, I A; Nikolaev, K E; Galaktionov, K V

    2013-01-01

    In this study parasitological data were analyzed by different methods of revealing the structure of time series, namely auto-correlation analysis (ACA), Fourier spectrum analysis (SA) and singular spectrum analysis (SSA), and the results of these analysis were compared (SSA makes it possible to present non-stationary time series as a sum of independent components and to determine the contribution of each component into the dispersion of the initial series--Golyandina et al., 2001). This case study was based on the result of 10-year-long monitoring of changes in the prevalence of Cryptocotyle concavum and Bunocotyle progenetica trematode parthenitae in intertidal snails Hydrobia ventrosa at the White Sea (in total, 45 observations). ACA did not reveal any statistically significant oscillations in the analyzed series. The application of SSA and SA allowed us to reveal at least two quasi-periodical components. In addition, SSA made it possible to reveal a significant dome-shaped trend in the prevalence of B. progenetica parthenitae, which were described by SA as an oscillation with a period equal to the duration of the study, as well as to give proof that there was no trend in the changes of C. concavum parthenitae prevalence. The components (modes) extracted by the SSA described the changes in the prevalence better that the harmonics extracted by the SA. In particular, SSA modes (contrary to SA harmonics) reflected that the amplitude of oscillations of the B. progenetica prevalence increased as the prevalence grew. The sums of SSA modes correlated more with initial prevalence series that the sums of SA harmonics. A possible interpretation of the trends and modes extracted by the SSA in the light of the transmission features of the investigated trematode species in the study area was proposed. PMID:23866616

  20. Parasitology http://journals.cambridge.org/PAR

    E-print Network

    Schnaufer, Achim

    in successful chemotherapy. In animal models, treatment of African trypanosomiasis with difluoromethylornithine lowered the dose of antimony required to cure the infection. Key words: trypanosomiasis, leishmaniasis immunochemotherapy remains in its infancy. This review article covers those areas in trypanosomiasis

  1. [Diagnostic kits in parasitology: which controls?].

    PubMed

    Rossi, P

    2004-06-01

    The development of new diagnostic tools particularly for some parasitic "neglected diseases", is slowed or even hindered by limited resources assigned for basic and applied research in public institution and private sector. Even if the time-line and costs needed for developing a new In Vitro Diagnostic (IVD) test are generally lower compared to vaccines or new drugs, industry is poorly engaged in investing resources due to the perception of limited markets. To accelerate the development of diagnostics for the world's most deadly diseases, the World Health Organization's (WHO) Special Programme for Research and Training in Tropical Diseases (TDR), the United Nations Development Programme, the World Bank and the Gates Foundation, last year launched a new initiative, FIND (Foundation for Innovative New Diagnostics, www.finddiagnostics.org). The aim is to "apply the latest biotechnology innovations to develop and validate affordable diagnostic tests for diseases of the developing world". Ideally, a new diagnostic test should be accurately evaluated prior to use in medical practice. The first step would be a pre-clinical evaluation, an analytic study to determine its laboratory performance. A crucial point in this phase is the calibration of reagents (antigens, antibodies, DNA probes, etc.) against a standard reference preparation. WHO, through the WHO International Laboratories for Biological Standards, "provides International Biological Reference Preparations which serve as reference sources of defined biological activity expressed in an internationally agreed unit" (www.who.int/biologicals/IBRP/index.htm). Standardization allows "comparison of biological measurements worldwide" and ensures the reliability of diagnostic procedures. These preparations are generally intended for use in the characterization of the activity of secondary reference preparations (regional, national or in-house working standards). Unfortunately, international reference standards for parasitic diseases are not available at present, except for Toxoplasma antibodies. The first international standard reagent for Anti-Toxoplasma Serum was established in 1968 and at present, an international standard reference serum, Anti-toxoplasma serum, human TOXM is available at the National Institute for Biological Standards and Control (NIBSC) in UK. Several collaborative, multicenter studies were carried out to assess the performance of different methods and commercial tests for the diagnosis of toxoplasmosis, by providing to participating laboratories a panel of well-defined sera to be tested. A four-phase process following well-accepted methodological standards for the development of diagnostics, analogous to those internationally accepted for drugs and vaccines was recently proposed. The pre-clinical evaluation, the analytic study to assess sensitivity, specificity, predictive values in laboratory (phase I), should be followed by a proof of principle study to distinguish diseased from healthy persons in easily accessible populations (phase II). The evaluation of test performance in populations of intended use (phase III), and finally the delineation of cost-effectiveness and societal impact of new tests in comparison with existing tools (phase IV) should complete the validation procedure. In this context, national regulatory agencies play a major role in pre-market approval and post-market surveillance of IVDs. The European Community in 1998 approved a directive (Directive 98/79/EC) which rules the marketing of IVD medical devices, in order to harmonise the performance levels and standards in European countries. But, among IVDs for parasitic diseases, only those to detect congenital toxoplasmosis are submitted to defined procedures to provide the verification of products before their placing on the market and the surveillance after their marketing by a notified body, which perform appropriate examinations, tests and inspections to production facilities to verify if the device meets the requirements of the directive. In U.

  2. Parasitology Research Founded as Zeitschrift fr

    E-print Network

    Rynkiewicz, Evelyn C.

    sampled two rodent hosts, white- footed mice (Peromyscus leucopus), and prairie voles (Microtus, Peromyscus that had higher tick burdens also exhibited significantly higher bacterial killing ability and no relationship with bacterial killing ability. Microtus had higher burdens of mites in each order than Peromyscus

  3. PARASITOLOGY: A Game of Cat and Mouth

    NSDL National Science Digital Library

    Sarah K. Volkman (Harvard School of Public Health; Department of Immunology and Infectious Diseases)

    2003-01-17

    Access to the article is free, however registration and sign-in are required. The protozoan parasite Toxoplasma gondii has been remarkably successful, infecting 30 to 50% of the world's population, many of whom are asymptomatic. In their Perspective, Volkman and Hartl discuss new work (Su et al.) that reveals the secret of the parasite's success. The three predominant strains of T. gondii-sibling progeny of a single cross that took place 10,000 years ago-all show greatly enhanced oral transmission between intermediate vertebrate hosts.

  4. Companion animal parasitology: a clinical perspective

    Microsoft Academic Search

    Peter J Irwin

    2002-01-01

    In recent years there have been many changes to the ways that clinical veterinary science is conducted and nowhere is this more evident than in companion animal practice. Veterinarians working with pet dogs and cats are facing new challenges associated with the emergence and re-emergence of parasitic diseases. Some, such as Neospora caninum, have been recently recognised; others like Giardia

  5. Parasitology Research Founded as Zeitschrift fr

    E-print Network

    Sehgal, Ravinder

    of maebl, an erythrocyte-binding gene, in Plasmodium gallinaceum Criseyda Martinez, Timothy Marzec Identification and expression of maebl, an erythrocyte-binding gene, in Plasmodium gallinaceum Criseyda Martinez broad patterns of host switching and host specificity. The erythrocyte in- vasion mechanism

  6. Genome mining offers a new starting point for parasitology research.

    PubMed

    Lv, Zhiyue; Wu, Zhongdao; Zhang, Limei; Ji, Pengyu; Cai, Yifeng; Luo, Shiqi; Wang, Hongxi; Li, Hao

    2015-02-01

    Parasites including helminthes, protozoa, and medical arthropod vectors are a major cause of global infectious diseases, affecting one-sixth of the world's population, which are responsible for enormous levels of morbidity and mortality important and remain impediments to economic development especially in tropical countries. Prevalent drug resistance, lack of highly effective and practical vaccines, as well as specific and sensitive diagnostic markers are proving to be challenging problems in parasitic disease control in most parts of the world. The impressive progress recently made in genome-wide analysis of parasites of medical importance, including trematodes of Clonorchis sinensis, Opisthorchis viverrini, Schistosoma haematobium, S. japonicum, and S. mansoni; nematodes of Brugia malayi, Loa loa, Necator americanus, Trichinella spiralis, and Trichuris suis; cestodes of Echinococcus granulosus, E. multilocularis, and Taenia solium; protozoa of Babesia bovis, B. microti, Cryptosporidium hominis, Eimeria falciformis, E. histolytica, Giardia intestinalis, Leishmania braziliensis, L. donovani, L. major, Plasmodium falciparum, P. vivax, Trichomonas vaginalis, Trypanosoma brucei and T. cruzi; and medical arthropod vectors of Aedes aegypti, Anopheles darlingi, A. sinensis, and Culex quinquefasciatus, have been systematically covered in this review for a comprehensive understanding of the genetic information contained in nuclear, mitochondrial, kinetoplast, plastid, or endosymbiotic bacterial genomes of parasites, further valuable insight into parasite-host interactions and development of promising novel drug and vaccine candidates and preferable diagnostic tools, thereby underpinning the prevention and control of parasitic diseases. PMID:25563615

  7. THE SCIENTIFIC RESEARCH PROGRAMMES OF LAKATOS AND APPLICATIONS IN PARASITOLOGY

    Microsoft Academic Search

    Summary: The methodology of scientific research programme (MSRP) proposed by Lakatos was in the line of the proposals made by Popper. MSRP were intended for constructing and evaluating research programme, which is unique among philosophers of science. Surprisingly, scientists dedicated to research in mathematics, physic or biology have not used much MRSP. This could be due to the fact that

  8. Molecular and Biochemical Parasitology 97 (1998) 221224 Short communication

    E-print Network

    Beverley, Stephen M.

    1998-01-01

    , Keith Gull n , Alasdair Ivens p , John Kelly q , Daniel Lawson r , John Lebowitz s , Phelix Majiwa Washington Uni6ersity, St. Louis, Missouri, USA i Max-Planck-Institut fu¨r Biochemie, Munchen, Germany j of Cellular Pathology, Brussels, Belgium w Seattle Biomedical Research Institute, Seattle, Washington, USA x

  9. Molecular & Biochemical Parasitology 149 (2006) 117120 Short communication

    E-print Network

    Schnaufer, Achim

    2006-01-01

    . 1A). The pre- dicted disordered segments by Russell/Linding definition for TryS are at amino acid glutathionylspermidine synthetase (GspS) from Escherichia coli [6]. GspS typically shares about 48% amino acid similarity, an inter-domain region of 64 amino acids (residues174­236), as well as the N- and C-terminal segments (Fig

  10. A new lungworm in muskoxen: an exploration in Arctic parasitology

    Microsoft Academic Search

    Susan J Kutz; Eric P Hoberg; Lydden Polley

    2001-01-01

    Ruminants are vital elements of the Holarctic ecosystem. Little is known, however, of the structure or biology of their parasite fauna, particularly in North America. Global warming, coupled with increasing human activity in the Arctic, requires enhanced international interdisciplinary efforts to better understand the many factors, including parasites, that influence the population health of caribou, reindeer, muskoxen and wild sheep.

  11. Genomics: from novel genes to new therapeutics in parasitology

    Microsoft Academic Search

    Jesus A. Gutierrez

    2000-01-01

    The advent of rapid DNA sequencing technologies is generating vast quantities of raw genomic information ranging from in-depth analysis of the expressed genes to complete sequencing of genomes at an increasing rate (bioinformatics). However, it is the functional characterisation of a specific gene product that is the key limiting factor for validation as targets for high throughput assay development. The

  12. Marine parasitology with special reference to Japanese fisheries and mariculture

    Microsoft Academic Search

    K. Ogawa

    1996-01-01

    Marine parasites with special relation to Japanese fisheries and mariculture include various types of pathogens: those causing mortality, deformity, weight loss, etc.; those giving unesthetic appearances to the hosts; those which are zoonotic. Japanese mariculture typically utilizes net cage culture systems in coastal areas. Parasite invasion in such systems is more difficult to control practically than in freshwater facilities. The

  13. PCR as a diagnostic and quantitative technique in veterinary parasitology

    Microsoft Academic Search

    Dante S. Zarlenga; James Higgins

    2001-01-01

    Over the past 15 years, there has been a dramatic evolution in molecular approaches to study parasites and parasitic diseases. Many of these advancements have been brought about through the development of new applications of the polymerase chain reaction (PCR). Enhancements in sensitivity that can be achieved using PCR now permit scientists to investigate changes at the level of a

  14. Environmental parasitology: relevancy of parasites in monitoring environmental pollution

    Microsoft Academic Search

    Bernd Sures

    2004-01-01

    Parasites can interact with environmental pollution in different ways. On the one hand, parasites can interfere with established bioindication procedures owing to their effects on the physiology and behaviour of the host. This could lead both to false-negative and false-positive indications of pollution. On the other hand, parasites can be used as effect indicators and as accumulation indicators because of

  15. Urban sludge reuse in agriculture: Waste treatment and parasitological risk

    Microsoft Academic Search

    P. G. Gaspard; J. Wiart; J. Schwartzbrod

    1995-01-01

    The development of an extraction-concentration method for the nematode eggs existing in urban treatment-plant sludge made it possible to study the viable nature of these eggs by cultivating them in deionized water at 30°C for 30 days. The criterion selected to show viability was the development of eggs at the larval stage.Sludge samples from various origins (physical, biological and chemical

  16. Hematology, Parasitology, and Serology of Free-Ranging Coyotes (Canis latrans) from South Carolina.

    SciTech Connect

    Miller, Debra, Lee; Schrecengost, Joshua; Merrill, Anita; Kilgo, John; Ray, H., Scott; Karl V. Miller, Karl, V.; Baldwin, Charles, A.

    2009-07-01

    ABSTRACT: Blood and feces were collected from 34 adult (19 males, 15 females) and seven juvenile (three males, one female, three not reported) free-ranging coyotes (Canis latrans) on the US Department of Energy’s Savannah River Site (South Carolina, USA). Significant (P,0.05) hematologic differences by sex were noted for red blood cell counts, hemoglobin, and hematocrit. Biochemical differences by sex occurred only for albumen (P,0.05). Twentyone adults were antibody positive for at least one of four viruses: canine adenovirus type 1 (CAV-1; 68%), West Nile virus (WNV; 60%), Eastern equine encephalitis virus (EEEV; 38%), and Canine distemper virus (CDV; 15%). Of the seven Leptospira serovars tested for, seven (25%) of 28 adults were positive for one or more of five serovars: Pomona, Grippotyphosa, Icterohaemorrhagiae, Bratislava, and Autumnalis. Three (43%) of seven juveniles had seropositivity for a virus, one each for CDV, CAV-1, and WNV. No juveniles were seropositive for EEEV or any of the seven Leptospira serovars. Blood smears of 12 adults were positive for Dirofilaria immitis microfilaria, but blood smears from all juveniles were negative. Parvovirus was identified by electron microscopy from the feces of one adult. Ancylostoma spp., Trichuris spp., and Isospora spp. were observed in fecal samples. These data may aid in understanding the role of coyotes in disease ecology.

  17. Molecular & Biochemical Parasitology 169 (2010) 1219 Contents lists available at ScienceDirect

    E-print Network

    Schnaufer, Achim

    2010-01-01

    t As part of a drug discovery programme to discover new treatments for human African trypanosomiasis- panosomatidae (order Kinetoplastida, suborder Trypanosomatina) responsible for human African trypanosomiasis trypanosomiasis. Note: Crystallographic data have been deposited on PDB with the accession code 2wba

  18. Molecular & Biochemical Parasitology 133 (2004) 4551 Arachidonic acid synthetic pathways of the oyster protozoan parasite,

    E-print Network

    Hartley, Troy W.

    2004-01-01

    of the oyster protozoan parasite, Perkinsus marinus: evidence for usage of a delta-8 pathway Fu-Lin E. Chua Received 24 June 2003; accepted 28 August 2003 Abstract The meront stage of the oyster protozoan parasite; Oyster; Oyster parasite; Perkinsus marinus 1. Introduction Although parasitic protozoans effectively

  19. Molecular & Biochemical Parasitology 155 (2007) 103112 Structural polymorphism and diversifying selection on the pregnancy

    E-print Network

    Samudrala, Ram

    2007-01-01

    selection on the pregnancy malaria vaccine candidate VAR2CSA Joseph Bockhorsta,b, Fangli Luc,1, Joel H 2007 Abstract VAR2CSA is the main candidate for a pregnancy malaria vaccine, but vaccine development. 1. Introduction Pregnancy associated malaria (PAM), a substantial cause of disease and death

  20. Parasitology (1973), 67, 315-331 With 6 figures in the text

    E-print Network

    Cross, George

    1973-01-01

    , 1970; Dixon, Ginger & Williamson, 1972) and for studies on the development of respiratory pathways E T H O D S A N D M A T E R I A L S Trypanosome strains The history, as far as it can be documented

  1. [Epizootiological and parasitological status of the flocks at a poultry combine].

    PubMed

    Kolev, V; Markarian, M; Genchev, G; Donev, A; Tsvetkov, S

    1976-01-01

    A comprehensive epizootiologic study has been carried out at one of the large poultry dressing combines in this country. Results have shown that the part played by infections as against the remaining diseases established in the various technologic categories is as follows: 9 to 23.8 per cent in growing parents; 16.0 to 24.6 per cent in adult parents; and 4.8 to 13.4 per cent in broilers. So far as parasitic diseases are concerned the respective figures are 3.2 to 9.9 per cent, 3.0 to 3.3. per cent, and 2.9 to 3.0 to per cent. The import of birds from France and England intended for satisfying the needs of the poultry dressing combine in Roussé has contributed to the introduction of infections which have later on assumed an epizootic course, such as infections encephalomyelitis, infectious bronchitis, and Marek' disease. The epizootic status has been aggravated with the development of a number of diseases already existing in this country--fowl pox, lymphoid leukosis, chronic respiratory disease, salmonellosis, and above all infections caused by the so-called occasionally pathogenic agents--coli organisms, staphylococci, and Pseudomonas. Of the parasitic diseases only coccidiosis has developed, being caused by a variety of species: Eimeria acervulina, Eimeria necatrix, Eimeria maxima, Eimeria muvati and Eimeria tenella. The absence of helminth infections is due to the routinely adopted technological practice of raising birds in confinement and the strict veterinary control and guard. On the basis of the results obtained and the conclusions drawn some more effective prophylactic measures are suggested correcting and supplementing the existing prophylactic programme. PMID:960544

  2. Experimental Parasitology 112 (2006) 1320 www.elsevier.com/locate/yexpr

    E-print Network

    Read, Andrew

    2006-01-01

    : Reverse transcription PCR for the detection and quantiWcation of transmission stage malaria parasites, Liverpool L3 5QA, UK c Department of Biochemistry, Faculty of Medicine, Sultan Qaboos University, Oman-PCR) techniques to detect and quantify the transmission stages (gametocytes) of Plasmodium chabaudi malaria

  3. Lack of Artemisinin Resistance in Plasmodium falciparum in Uganda Based on Parasitological and Molecular Assays.

    PubMed

    Cooper, Roland A; Conrad, Melissa D; Watson, Quentin D; Huezo, Stephanie J; Ninsiima, Harriet; Tumwebaze, Patrick; Nsobya, Samuel L; Rosenthal, Philip J

    2015-08-01

    We evaluated markers of artemisinin resistance in Plasmodium falciparum isolated in Kampala in 2014. By standard in vitro assays, all isolates were highly sensitive to dihydroartemisinin (DHA). By the ring-stage survival assay, after a 6-h DHA pulse, parasitemia was undetectable in 40 of 43 cultures at 72 h. Two of 53 isolates had nonsynonymous K13-propeller gene polymorphisms but did not have the mutations associated with resistance in Asia. Thus, we did not see evidence for artemisinin resistance in Uganda. PMID:26033725

  4. 668 THE JOURNAL OF PARASITOLOGY, VOL. 92, NO. 3, JUNE 2006 TCCTCTAAATAGACTAAAATACCGCCAAATTCTTTAAG

    E-print Network

    Sheridan, Jennifer

    is organized into a searchable database (http://www.toxodb.org) including 10 cov- erage of the genome, tags from serial analysis of gene expression, and 72,000 expressed sequence tags. To fully capitalize on these data, sequence analysis must be complemented with functional genomics ap- proaches, necessitating

  5. Theileriosis in Uganda. Parasitological and serological responses in cattle continually exposed to natural infection

    Microsoft Academic Search

    J. Robson; V. Pedersen; G. Uilenberg; G. M. Odeke

    1981-01-01

    Cattle living in a circumscribed area in Uganda, where bothTheileria parva andT. mutans occurred naturally, were monitored for periods of up to 1 year by examination of blood and lymph node smears for parasites and the indirect fluorescent antibody test for antibodies toTheileria. Uninfected control cattle were added at intervals to ensure continuous challenge and to monitor the challenge. Although

  6. Babesiosis in dogs and cats—Expanding parasitological and clinical spectra

    Microsoft Academic Search

    Laia Solano-Gallego; Gad Baneth

    2011-01-01

    Canine babesiosis caused by different Babesia species is a protozoal tick-borne disease with worldwide distribution and global significance. Historically, Babesia infection in dogs was identified based on the morphologic appearance of the parasite in the erythrocyte. All large forms of Babesia were designated Babesia canis, whereas all small forms of Babesia were considered to be Babesia gibsoni. However, the development

  7. Molecular and Biochemical Parasitology 90 (1997) 395397 Erratum to ``Surprising diversity and distribution of spliced

    E-print Network

    Davis, Richard E.

    1997-01-01

    ,enolasetrans-splicing,andidentificationofflatwormSLRNAs/genes Hostandsourceb Organisma ClassificationEnolasetrans-splicingc SLRNAandGened PhylumHermitcrabshells(Woods+Polycladida(Order)+ Hole,MA) Free-living(HalfMoonBay,Polycladida(Order)NDh +Notoplanaspp. CA) Free-living(WoodsHole,MA) Free-living(CarolinaBiologi-Phagocatamorgani-Tricladida(Order)ND cals) PolychoeruscarmalensisFree-living

  8. Recent Laboratory Contributions to the Control of Yellow Fever: (Section of Tropical Diseases and Parasitology).

    PubMed

    Hindle, E

    1933-12-01

    THE MOST IMPORTANT RECENT LABORATORY CONTRIBUTIONS TO THE CONTROL OF YELLOW FEVER WILL BE BRIEFLY SUMMARIZED UNDER THREE HEADINGS: (1) Methods of diagnosis, (2) Transmission, and (3) Protection.(1) Methods of diagnosis.-The development of improved methods of identification, in particular by immunity tests, has made it possible to diagnose yellow fever with much greater certainty. Moreover, since the immunity following an attack of the disease is usually of life-long duration, it is possible to determine what proportion of any particular population has been infected and also how long any district has been free from infection. The application of immunity tests to the delimitation of endemic zones, especially in West Africa, has led to a great increase in our knowledge, and yellow fever has been found to have a much wider distribution than was previously suspected. Among other methods of recognizing the disease may be mentioned complement-fixation tests and also in post-mortem material the histopathology of the liver.(2) Methods of transmission. Indirect.-The main factors in the transmision of the disease by mosquitoes have been elucidated, and the relations between the course of the infection in monkeys (and also presumably in man) and the infectivity of these animals to mosquitoes. It is found that the blood becomes infective at a very early stage, before febrile symptoms develop, and that infectivity usually disappears three to four days after the onset of fever, owing to the presence of immune bodies in the blood. It is evident that any yellow fever patient must be considered to have been capable of infecting mosquitoes before showing any signs of the disease. Many other species of mosquitoes in addition to the Aëdes aegypti have now been shown capable of transmitting yellow fever.Direct.-It is now known that it is possible to acquire yellow fever in the absence of mosquitoes, through handling infected material. Many cases of laboratory infection have now been recorded in which other sources of infection can be definitely excluded.(3) Protection.-The most important advance in this direction has been the development of practicable methods of vaccination. The use of attenuated virus was followed by the use of virus and immune serum. The development of the latter has depended mainly on the discovery that when yellow fever virus is inoculated intracerebrally into mice, after a few passages it acquires neurotropic affinities and loses to a great extent its capacity for producing a general infection. The use of such virus, combined with human or animal immune serum, has been found to result in the development of a high degree of immunity comparable in intensity with that following an attack of the disease. PMID:19989606

  9. Experimental Parasitology 113 (2006) 17 www.elsevier.com/locate/yexpr

    E-print Network

    Roche, Benjamin

    2006-01-01

    of the glucose-6-phosphate isomerase gene in Trypanosoma cruzi Hélène Broutin ¤ , Frédérique Tarrieu, Michel online 10 January 2006 Abstract Trypanosoma cruzi, the agent of Chagas disease, has a basically clonal. Index Descriptors and Abbreviations: Trypanosoma cruzi; Glucose-6-phosphate isomerase locus; Discrete

  10. Poster Presentations 1. EMAN MOSTAFA, DEPT. OF PARASITOLOGY, ZAGAZIG UNIVERSITY, EGYPT

    E-print Network

    Arnold, Jonathan

    . ANGELA D. PACK, CTEGD AND DEPT. OF MICROBIOLOGY, UGA PROTECTIVE TRYPANOSOMA CRUZI SPECIFIC RESPONSES EXPRESSION LIBRARIES IN TRYPANOSOMA BRUCEI: WHERE DO WE STAND????? 11. MELISSA T. MATTEE, DEPT. OF ENTOMOLOGY IN TRYPANOSOMA BRUCEI: GLUCOSE SENSING? 13. OUSMAN MAHMUD, CTEGD AND DEPT. OF GENETICS, UGA EVOLUTIONARY HISTORY

  11. Available online at www.sciencedirect.com Molecular & Biochemical Parasitology 157 (2008) 3243

    E-print Network

    Gelb, Michael

    2008-01-01

    ­43 Protein geranylgeranyltransferase-I of Trypanosoma cruzi Kohei Yokoyamaa,, John R. Gillespieb, Wesley C; Protein geranylgeranyltransferase-I; Protein farnesyltransferase; CaaX motif; Trypanosoma cruzi; Chagas farnesyltransferase; PGGT-II, protein geranylgeranyltransferase type-II; T. cruzi, Trypanosoma cruzi; GGPP

  12. Experimental Parasitology 114 (2006) 279288 www.elsevier.com/locate/yexpr

    E-print Network

    2006-01-01

    matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2006.04.005 Trypanosoma cruzi 19 stocks of Trypanosoma cruzi and 2 stocks of Trypanosoma cruzi marenkellei showed that only 56. Index Descriptors and Abbreviations: Trypanosoma cruzi; Minicircles; Kinetoplast DNA (kDNA) polymorphism

  13. Vector identification and clinical, hematological, biochemical, and parasitological characteristics of camel (Camelus dromedarius) theileriosis in Egypt.

    PubMed

    Youssef, Shereen Youssef; Yasien, Safaa; Mousa, Waheed Mohamed Ali; Nasr, Soad Mohamed; El-Kelesh, Eman Ahmed Mohamed; Mahran, Khalid Mohamed; Abd-El-Rahman, Azza Hassan

    2015-04-01

    The objectives of the present study were to identify a possible tick vector and to determine the prevalence of camel theileriosis in Egypt using blood smears stained with Giemsa's stain and PCR assay. Hemogram and serum biochemical constituents were also investigated. A total of 243 camels, aged 3-5 years, were examined. The results revealed that 75 (30.86 %) camels were infected with Theileria spp. of Giemsa-stained blood smears. Hyalomma dromedarii was identified as the carrier tick of Theileria spp. Multinucleated sporoblast and free sporozoite were observed in the salivary gland smears from collecting ticks. PCR result revealed that Theileria annulata was the most abundant in camels (60 %) followed by Theileria spp. (10 %). Macrocytic hypochromic anemia was recorded in the infected camels with T. annulata. Leukocytosis, neutrophilia, eosinophilia, and lymphopenia were also observed in the infected group. In the serum of infected camels, total proteins, albumin, ?-globulin, and A/G ratio were significantly decreased (P?

  14. Molecular & Biochemical Parasitology 182 (2012) 9396 Contents lists available at SciVerse ScienceDirect

    E-print Network

    McFadden, Geoff

    2012-01-01

    in the parasite pellicle and at polar apices. These observations support current models for gliding motility intracellular parasites that infect a range of animal hosts and are the cause of significant human diseases apicomplexan parasites share a common cell architecture and mode of loco- motion. This process, called gliding

  15. Bovine trypanosomiasis in southern Tanzania: parasitological and serological survey of prevalence.

    PubMed

    Connor, R J; Halliwell, R W

    1987-08-01

    In a survey for bovine trypanosomiasis blood smears from 1,617 cattle at 72 sites were examined. Trypanosomes were found in 93 cattle, representing 16% of the cattle in herds in which trypanosomiasis was confirmed. Of the positive cattle 56% had infections with T. congolense, 17% T. vivax and 2.2% T. brucei. Five cattle had mixed infections and in 18 cattle the species was not identified. Sera from 1,352 cattle were tested using microelisa. Ten out of 16 sites, at which no trypanosomes were found in blood smears and at which trypanocides were in use, had over 15% seropositive cattle compared with five of 19 sites at which trypanocides were not in use. It was concluded that the microelisa was a useful aid to the diagnosis of bovine trypanosomiasis and that there is a need for accurate records of drug use and livestock movements to be kept. The serious risk of drug resistant strains of trypanosomes emerging due to the uncontrolled use of trypanocides is emphasised. PMID:3660451

  16. Parasitological impact of 2-year preventive chemotherapy on schistosomiasis and soil-transmitted helminthiasis in Uganda

    Microsoft Academic Search

    Yaobi Zhang; Artemis Koukounari; Narcis Kabatereine; Fiona Fleming; Francis Kazibwe; Edridah Tukahebwa; J Russell Stothard; Joanne P Webster; Alan Fenwick

    2007-01-01

    BACKGROUND: Schistosomiasis and soil-transmitted helminthiasis (STH) are among the neglected tropical diseases in Africa. A national control program for these diseases was initiated in Uganda during March 2003. Annual treatment with praziquantel and albendazole was given to schoolchildren in endemic areas and to adults in selected communities where local prevalence of Schistosoma mansoni in schoolchildren was high. METHODS: The impact

  17. Towards a nucleic acid-based diagnosis in clinical parasitology and mycology

    Microsoft Academic Search

    Stéphane Bretagne; Jean-Marc Costa

    2006-01-01

    BackgroundMultiple in-house polymerase chain reaction (PCR) assays for the diagnosis of parasitic and fungal diseases have been reported. Encouraging results have been published to anticipate or improve the diagnosis. However, the absence of standardized methods has led to discrepant results. As a consequence, these tests are not recognized as consensual diagnostic criteria.

  18. Parasitology as a Teaching Tool: Isolation of Apicomplexan Cysts from Store-Bought Meat

    ERIC Educational Resources Information Center

    Eggleston, Tracy L.; Fitzpatrick, Eileen; Hager, Kristin M.

    2008-01-01

    There are obstacles to teaching science; however, these obstacles are not insurmountable. One obstacle is the students themselves. Students often labor under the misconception or anxiety that the course material will be too difficult to understand, or boring (mind-numbing), or that the information learned will not be applicable in their day-to-day…

  19. Environmental parasitology: What can parasites tell us about human impacts on the environment?

    Microsoft Academic Search

    K. D. Lafferty

    1997-01-01

    There are a variety of ways that environmental changes affect parasites, suggesting that information on parasites can indicate anthropogenic impacts. Parasitism may increase if the impact reduces host resistance or increases the density of intermediate or definitive hosts. Parasitism may decrease if definitive or intermediate host density declines or parasites suffer higher mortality directly (eg. from toxic effects on parasites)

  20. Molecular genetic approaches to parasite identification: their value in diagnostic parasitology and systematics

    Microsoft Academic Search

    D. P. McManus; J. Bowles

    1996-01-01

    A wide range of approaches is available to parasitologists to aid in specific parasite identification and to formulate phylogenetic relationships. This review emphasises the usefulness of molecular genetic techniques, especially DNA-based procedures, in addressing problems of identification, characterisation and phylogeny of parasites. It should be stressed that an understanding of the various DNA approaches, techniques and target genes most likely

  1. Environmental Parasitology: Y~hat can Parasites tell us about Human Impacts on the Environment?

    Microsoft Academic Search

    K. D. Lafferty

    1997-01-01

    There are a variety of ways that environmental changes affect parasites, suggesting that information on parasites can indicate anthropogenic impacts. Parasitism may in- creese if the ~mpact reduces host resistance or increases the density of intermediate or definitive hosts. Parasitism may decrease if definitive or intermediate host density declines or parasites suffer higher mortality directly (eg. from toxic effects on

  2. A phylogeny for the pomatiopsidae (Gastropoda: Rissooidea): a resource for taxonomic, parasitological and biodiversity studies

    PubMed Central

    2014-01-01

    Background The Pomatiopsidae are reported from northern India into southern China and Southeast Asia, with two sub-families, the Pomatiopsinae (which include freshwater, amphibious, terrestrial and marine species) and the freshwater Triculinae. Both include species acting as intermediate host for species of the blood-fluke Schistosoma which cause a public health problem in East Asia. Also, with around 120 species, triculine biodiversity exceeds that of any other endemic freshwater molluscan fauna. Nevertheless, the origins of the Pomatiopsidae, the factors driving such a diverse radiation and aspects of their co-evolution with Schistosoma are not fully understood. Many taxonomic questions remain; there are problems identifying medically relevant species. The predicted range is mostly unsurveyed and the true biodiversity of the family is underestimated. Consequently, the aim of the study was to collect DNA-sequence data for as many pomatiopsid taxa as possible, as a first step in providing a resource for identification of epidemiologically significant species (by non-malacologists), for use in resolving taxonomic confusion and for testing phylogeographical hypotheses. Results The evolutionary radiation of the Triculinae was shown to have been rapid and mostly post late Miocene. Molecular dating indicated that the radiation of these snails was driven first by the uplift of the Himalaya and onset of a monsoon system, and then by late-Pliocene global warming. The status of Erhaia as Anmicolidae is supported. The genera Tricula and Neotricula are shown to be non-monophyletic and the tribe Jullieniini may be polyphyletic (based on convergent characters). Triculinae from northern Vietnam could be derived from Gammatricula of Fujian/Yunnan, China. Conclusions The molecular dates and phylogenetic estimates in this study are consistent with an Australasian origin for the Pomatiopsidae and an East to West radiation via Oligocene Borneo-Philippines island hopping to Japan and then China (Triculinae arising mid-Miocene in Southeast China), and less so with a triculine origin in Tibet. The lack of monophyly in the medically important genera and indications of taxonomic inaccuracies, call for further work to identify epidemiologically significant taxa (e.g., Halewisia may be potential hosts for Schistosoma mekongi) and highlight the need for surveys to determine the true biodiversity of the Triculinae. PMID:24548800

  3. Clinical pathology and parasitologic evaluation of free-living nestlings of the Hyacinth Macaw (Anodorhynchus hyacinthinus).

    PubMed

    Allgayer, M C; Guedes, N M R; Chiminazzo, C; Cziulik, M; Weimer, T A

    2009-10-01

    This study evaluated the health status and established hematologic and serum biochemistry parameters for free-living nestlings of the Hyacinth Macaw (Anodorhynchus hyacinthinus) from the Brazilian Pantanal (19 degrees 51'-19 degrees 58'S; 56 degrees 17'-56 degrees 24'W), for four consecutive years (from December 2003 through December 2006). Physical examinations indicated that all the birds were in good health. Endoparasites and blood parasites were not detected in any of the nestlings, and ectoparasites seemed to be limited to Philornis sp. (Diptera: Muscidae). Significantly higher levels of total white blood cells and heterophils, glucose, total protein, triglycerides, and phosphorus were observed in females. In females, higher cholesterol levels and packed cell volumes were observed in older birds, and total white blood cell and heterophil counts were higher in young animals. In males, uric acid levels were higher in older individuals. Wild Pantanal Hyacinth Macaws feed on only two species of palm nuts (Acrocomia totai and Scheelea phalerta). This limited food habit has a strong impact on population size and may alter the clinical pathology parameters of these birds. Therefore, knowledge of blood levels in normal individuals is essential to assess the physiologic and pathologic condition of wild macaws, to assess the effects of environmental changes on their health, and to contribute to conservation strategies of this endangered species. PMID:19901373

  4. Molecular and Biochemical Parasitology 93 (1998) 163165 Erratum to ``Gene linkage and steady state RNAs suggest

    E-print Network

    Davis, Richard E.

    1998-01-01

    in parentheses. (B) Linkage between UbCRBP and the trans-spliced enolase gene in Fasciola hepatica. Only the 3% end of Fasciola UbCRBP (accession No. U91748) and a portion of enolase exon 2 are shown (exon 1 is the Fasciola spliced leader [37]). Letters and shading are the same as in (A). (C) Multiple alignment

  5. Systematic Parasitology 38: 111130, 1997. 111 c 1997 Kluwer Academic Publishers. Printed in the Netherlands.

    E-print Network

    Ivanenko, Viatcheslav N.

    with Flustra foliacea L. (Bryozoa) from the White Sea V.N. Ivanenko and A.V. Smurov Department of Invertebrate in the Kandalaksha Bay of the White Sea. This is the first siphonostomatoid copepod to be reported in association Asterias rubens L. (see R¨ottger; 1969, 1971), has been found in the White Sea. Our investigation of its

  6. 336 Parasitology Today, vol. IO,no.9, I994 Applications of Molecular Marker

    E-print Network

    Severson, David

    (Plasmodium), lymphatic filariasis (Wuchereria and Brugia) and many arboviruses (most notably yellow fever been de- veloped for the yellow fever mosquito, A and dengue fever). The most successful efforts towards controlling these diseases have been ac- complished

  7. Parasitological and physicochemical characterization of raw sewage from the city of Sidi Yahia of Gharb (Morocco

    Microsoft Academic Search

    D. Belghyti

    The urban and industrial growth is the engine of development, but the pollution produced by industry, households and agriculture has long since passed the threshold of purification capacity with adverse consequences on the health and the environment. The wastewater from the urban commune of Sidi Yahia Gharb, are drained without treatment in the Oued Tiflet. Our study focused on the

  8. The effectiveness of computer-based teaching packages in supporting student learning of parasitology

    Microsoft Academic Search

    Alan Gunn; Sarah J Pitt

    The usefulness of providing students with information via electronic notes, a website and a self-assessment quiz was assessed in three ways. Students' perceptions of each package were gauged through questionnaires; their patterns of use of the electronic support was monitored via the computer system and the effect of provision of these materials on performance was measured by marks in the

  9. Monitoring of parasitological contamination in treated wastewater from activated sludge system

    Microsoft Academic Search

    Silvana A. Cutolo; Maria H. Matté; Aristides A. Rocha

    2006-01-01

    Purpose – The goal of this paper is to detect helminth eggs in treated wastewater for sanitary control, using them as biological indicators of wastewater quality. Design\\/methodology\\/approach – Samples were taken from the Municipal Wastewater Treatment Plant of the Metropolitan Area. To concentrate the samples, centrifugation-flotation on 33 percent zinc sulphate was applied. Findings – The study revealed the constant

  10. Journal of Parasitology Diversity and phylogenetic relationships of hemosporidian parasites in birds of Socorro

    E-print Network

    Sehgal, Ravinder

    the disease threats the Socorro dove may face, the avifauna of Socorro Island, with a specific focus in the avifauna of the Galápagos Islands, continental Latin America and Europe. Microscopic examination revealed dove may face, the avifauna of Socorro Island, with a specific focus on Socorro ground doves Columbina

  11. 75 FR 48698 - Medicare, Medicaid and CLIA Programs; COLA (Formerly the Commission on Office Laboratory...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-11

    ... Microbiology, including Bacteriology, Mycobacteriology, Mycology, Parasitology, Virology. Diagnostic Immunology, including... Microbiology, including Bacteriology, Mycobacteriology, Mycology, Parasitology, Virology. Diagnostic Immunology,...

  12. 78 FR 12323 - Announcement of the Re-Approval of the Commission on Office Laboratory Accreditation (COLA) as an...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-22

    ... Microbiology, including Bacteriology, Mycobacteriology, Mycology, Parasitology, Virology. Diagnostic Immunology, including... Microbiology, including Bacteriology, Mycobacteriology, Mycology, Parasitology, Virology. Diagnostic Immunology,...

  13. Gene Action and Cellular Function in Parasitic Protozoa Genomics and post-genomics in parasitology: genome babble or

    E-print Network

    Schnaufer, Achim

    of 300 million cases with 2400 million people at risk. Each of the parasitic protozoan diseases, African, with those for other protozoan parasites and worms being developed rapidly [1]. In the following I will restrict myself to discussion of the protozoan parasites in the main. The genomes of these parasites

  14. Serum antibody responses in pigs trickle-infected with Ascaris and Trichuris: Heritabilities and associations with parasitological findings.

    PubMed

    Kringel, Helene; Thamsborg, Stig Milan; Petersen, Heidi Huus; Göring, Harald Heinz Herbert; Skallerup, Per; Nejsum, Peter

    2015-07-30

    A humoral immune response following helminth infection in pigs is well documented. However, it has been difficult to confirm the existence of antibody mediated resistance against the large roundworm, Ascaris suum, and whipworm, Trichuris suis, in experimental settings by correlating worm burdens or egg excretion with specific antibody levels. We set out to investigate the association between worm load and T. suis and A. suum specific serum antibody levels (IgG1, IgG2 and IgA) against excretory-secretory products of adults and third stage larvae, respectively, measured at 0, 7 and 14 weeks p.i. in a trickle-infected F1-resource-population of crossbred pigs (n=195). Furthermore, we wanted to determine the heritability of these antibody isotypes during the course of infection. Most pigs remained infected with A. suum throughout the experiment while they expelled T. suis between 7 and 14 weeks post infection (p.i.). Parasite specific IgG1 and IgA were significantly (P<0.001) elevated after 7 and 14 weeks of infection, whereas parasite specific IgG2 levels only changed slightly at 14 weeks p.i.. However, the observed association between specific antibody isotype levels and faecal egg counts and macroscopic worm load was weak. The relative heritabilities of the different parasite specific isotypes were assessed and resulted in significant heritability estimates for parasite specific IgG1 and IgA. The highest heritabilities were found for A. suum specific IgG1 (h(2)=0.41 and 0.46 at 7 and 14 weeks p.i., respectively). Thus, the present study demonstrates that host genetic factors influence the IgG1 and IgA antibody isotype responses specific to two of the most common gastrointestinal nematodes of swine whereas specific antibody levels were poorly associated with egg excretion and the presence of macroscopic worms. PMID:26095952

  15. MicroRNA Transcriptome Profiling in Heart of Trypanosoma cruzi-Infected Mice: Parasitological and Cardiological Outcomes

    PubMed Central

    Navarro, Isabela Cunha; Ferreira, Frederico Moraes; Nakaya, Helder I.; Baron, Monique Andrade; Vilar-Pereira, Gláucia; Pereira, Isabela Resende; Silva, Ana Maria Gonçalves; Real, Juliana Monte; De Brito, Thales; Chevillard, Christophe; Lannes-Vieira, Joseli; Kalil, Jorge; Cunha-Neto, Edecio; Ferreira, Ludmila Rodrigues Pinto

    2015-01-01

    Chagas disease is caused by the parasite Trypanosoma cruzi, and it begins with a short acute phase characterized by high parasitemia followed by a life-long chronic phase with scarce parasitism. Cardiac involvement is the most prominent manifestation, as 30% of infected subjects will develop abnormal ventricular repolarization with myocarditis, fibrosis and cardiomyocyte hypertrophy by undefined mechanisms. Nevertheless, follow-up studies in chagasic patients, as well as studies with murine models, suggest that the intensity of clinical symptoms and pathophysiological events that occur during the acute phase of disease are associated with the severity of cardiac disease observed during the chronic phase. In the present study we investigated the role of microRNAs (miRNAs) in the disease progression in response to T. cruzi infection, as alterations in miRNA levels are known to be associated with many cardiovascular disorders. We screened 641 rodent miRNAs in heart samples of mice during an acute infection with the Colombiana T.cruzi strain and identified multiple miRNAs significantly altered upon infection. Seventeen miRNAs were found significantly deregulated in all three analyzed time points post infection. Among these, six miRNAs had their expression correlated with clinical parameters relevant to the disease, such as parasitemia and maximal heart rate-corrected QT (QTc) interval. Computational analyses identified that the gene targets for these six miRNAs were involved in networks and signaling pathways related to increased ventricular depolarization and repolarization times, important factors for QTc interval prolongation. The data presented here will guide further studies about the contribution of microRNAs to Chagas heart disease pathogenesis. PMID:26086673

  16. 982 THEJOURNALOF PARASITOLOGY,VOL. 85, NO. 5, OCTOBER1999 J. Parasitol., 85(5), 1999 p. 982-984

    E-print Network

    Schall, Joseph J.

    , false positives. Blood samples from western fence lizards (Sceloporus oc- cidentalis, California in the laboratory (S. occidentalis) or of a species in which infection with Plasmo- dium is rare (A. evermanni

  17. [Parasitological factors impeding the transmission of the agent of babesiosis (Babesia microti) to man from the tick Ixodes persulcatus].

    PubMed

    Korenberg, E I; Nefedova, V V; Kovalevsky, Yu V; Sorokina, Yu V; Gorelova, N B

    2015-01-01

    Based on the analysis of own and literature data, it is concluded that the following ma- in permanent system of ecologicalarasitological factors prevents the effective vector functions of the tick I. persulcatus in transmission of B. microti: lack of distinct nymphs' anthropophily; small spontaneous invasion of hungry adults; a duration of the parasitic phase in humans is insufficient to complete the sporogonic development, because victims interrupt the phase. Therefore, not excluding the possibility of sporadic babesiosis disea- ses, it can be stated that within the boundaries of a vast territory, where the taiga tick is the only potential source of infection for humans, the B. microti infection has not, and will not reach significant values in infectious pathology. PMID:26016332

  18. Molecular and Biochemical Parasitology, 19 (1986) 149-161 Impaired drug uptake in methotrexate resistant Crithidia fasciculata

    E-print Network

    Simpson, Larry

    1986-01-01

    uptake in methotrexate resistant Crithidia fasciculata without changes in dihydrofolate reductase to methotrexate (MTX), an inhibitor of dihydrofolate reductase (DHFR). When cells are challenged with 2-S M.M MTX; Leishmania major; Methotrexate; Drug resistance; Methotrexate transport; Dihydrofolate re- ductase

  19. Detection of Trypanosoma cruzi infection in naturally infected dogs and cats using serological, parasitological and molecular methods.

    PubMed

    Enriquez, G F; Cardinal, M V; Orozco, M M; Schijman, A G; Gürtler, R E

    2013-06-01

    Domestic dogs and cats are major domestic reservoir hosts of Trypanosoma cruzi and a risk factor for parasite transmission. In this study we assessed the relative performance of a polymerase chain reaction assay targeted to minicircle DNA (kDNA-PCR) in reference to conventional serological tests, a rapid dipstick test and xenodiagnosis to detect T. cruzi infection in dogs and cats from an endemic rural area in northeastern Argentina. A total of 43 dogs and 13 cats seropositive for T. cruzi by an immunosorbent assay (ELISA) and an indirect hemagglutination assay (IHA), which had been examined by xenodiagnosis, were also tested by kDNA-PCR. kDNA-PCR was nearly as sensitive as xenodiagnosis for detecting T. cruzi-infectious dogs and cats. kDNA-PCR was slightly more sensitive than xenodiagnosis in seropositive dogs (91% versus 86%, respectively) and cats (77% against 54%, respectively), but failed to detect all of the seropositive individuals. ELISA and IHA detected all xenodiagnosis-positive dogs and both outcomes largely agreed (kappa coefficient, ?=0.92), whereas both assays failed to detect all of the xenodiagnosis-positive cats and their agreement was moderate (?=0.68). In dogs, the sensitivity of the dipstick test was 95% and agreed closely with the outcome of conventional serological tests (?=0.82). The high sensitivity of kDNA-PCR to detect T. cruzi infections in naturally infected dogs and cats supports its application as a diagnostic tool complementary to serology and may replace the use of xenodiagnosis or hemoculture. PMID:23499860

  20. World association for the advancement of veterinary parasitology (WAAVP): second edition of guidelines for evaluating the efficacy of equine anthelmintics

    Microsoft Academic Search

    J. L. Duncan; E. M. Abbott; J. H. Arundel; M. Eysker; T. R. Klei; R. C. Krecek; E. T. Lyons; C. Reinemeyer; J. O. D. Slocombe

    2002-01-01

    These guidelines have been designed to assist in the planning, operation and interpretation of studies which would serve to assess the efficacy of drugs against internal parasites of horses. Although the term anthelmintic is used in the title and text, these guidelines include studies on drug efficacy against larvae of horse bot flies, Gasterophilus spp., which are non-helminth parasites commonly

  1. Clinical and Parasitological Protection in a Leishmania infantum-Macaque Model Vaccinated with Adenovirus and the Recombinant A2 Antigen

    PubMed Central

    Grimaldi, Gabriel; Teva, Antonio; Porrozzi, Renato; Pinto, Marcelo A.; Marchevsky, Renato S.; Rocha, Maria Gabrielle L.; Dutra, Miriam S.; Bruña-Romero, Oscar; Fernandes, Ana-Paula; Gazzinelli, Ricardo T.

    2014-01-01

    Background Visceral leishmaniasis (VL) is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2) protein that protects against experimental L. infantum infections in mice and dogs. Methodology/Principal Findings Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12) adsorbed in alum (rA2/rhIL-12/alum); two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2) followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum); and plasmid DNA encoding A2 gene (DNA-A2) boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2). Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. Conclusions/Significance The remarkable clinical protection induced by A2 in an animal model that is evolutionary close to humans qualifies this antigen as a suitable vaccine candidate against human VL. PMID:24945284

  2. Molecular & Biochemical Parasitology 150 (2006) 1024 Duplication, gene conversion, and genetic diversity in the species-specific

    E-print Network

    Hartl, Daniel L.

    2006-01-01

    , ACS10, ACS11, and ACS12, found in the Plasmodium species Plasmodium falciparum, P. vivax, P. knowlesi diversity in the species-specific acyl-CoA synthetase gene family of Plasmodium falciparum Lara L. Bethkea,1 that in the species Plasmodium falciparum only, a non-subtelomeric acyl-CoA synthetase (ACS) gene has expanded

  3. Molecular and Biochemical Parasitology, 27 (1988) 63-70 63 Peculiar sequence organization of kinetoplast DNA minicircles from

    E-print Network

    Simpson, Larry

    1988-01-01

    , stocks, strains and clones of several kine- toplastid protozoa, including the human patho- gens of kineto- plast DNA molecules has been used as the basis of schizodeme analysis, a biochemical method cloned T. cruzi mini- circles was carried out. Here we describe the se- quence of three minicircles

  4. Trypanosoma brucei MRE11 is non-essential but influences growth, homologous recombination and DNA double-strand break repair

    E-print Network

    Cross, George

    of Molecular Parasitology, The Rockefeller University, Box 185, 1230 York Avenue, New York, NY 10021-6399, USA contributed equally to the project. Molecular & Biochemical Parasitology 125 (2002) 11Á/21 www.parasitology

  5. propagation are directly accessible to anyone with basic statistical knowledge. This should ul-

    E-print Network

    Jackson, Robert B.

    . C. Hetzel, R. M. Anderson, Parasitology 113, 25 (1996). 29. W. Jarra, K. N. Brown, Parasitology 99. J. Bradley, Parasitology 110, 7 (1995). 34. M. S. Russell et al., J. Immunol. 179, 211 (2007). 35. D

  6. 76 FR 29762 - Agency Information Collection Activities; Submission for Office of Management and Budget Review...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-23

    ...share their results with the veterinary parasitology community. FDA plans to survey scientists...veterinarians with expertise in veterinary parasitology using a Web-based tool. The questions...disagreement within the veterinary parasitology community. The survey will query...

  7. 75 FR 39948 - Agency Information Collection Activities; Proposed Collection; Comment Request; “Antiparasitic...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-13

    ...share their results with the veterinary parasitology community. FDA plans to survey scientists...veterinarians with expertise in veterinary parasitology using a web-based tool. The questions...disagreement within the veterinary parasitology community. The survey will query...

  8. Developmental expression and molecular analysis of two Meloidogyne incognita pectate lyase genes*

    E-print Network

    Hussey, Richard S.

    parasitism. q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved). The biochemical International Journal for Parasitology 35 (2005) 685­692 www.parasitology-online.com 0020-7519/$30.00 q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi

  9. Characterisation of a Leishmania mexicana knockout lacking guanosine diphosphate-mannose pyrophosphorylase

    E-print Network

    McFadden, Geoff

    for Parasitology Inc. Keywords: Leishmania; GDP-mannose pyrophosphorylase; Temperature sensitive mutant, nucleases and cysteine proteases International Journal for Parasitology xx (2005) 1­13 www.parasitology-online.com 0020-7519/$30.00 q 2005 Published by Elsevier Ltd on behalf of Australian Society for Parasitology Inc

  10. Molecular characterisation and developmental expression of a cellulose-binding protein gene in the soybean

    E-print Network

    Hussey, Richard S.

    Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: Cellulose, but not on soluble, carboxymethyl-cellulose, substrates 0020-7519/$30.00 q 2004 Australian Society for Parasitology Journal for Parasitology 34 (2004) 1377­1383 www.parasitology-online.com * Note: Nucleotide sequence data

  11. Patterns of host specificity and transmission among parasites of wild primates

    E-print Network

    Pedersen, Amy B.

    as emerging in humans. q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights-pathogen systems (Anderson and May, 1991; International Journal for Parasitology 35 (2005) 647­657 www.parasitology-online.com 0020-7519/$30.00 q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights

  12. Molecular diagnosis of strongyloidiasis in tropical areas: a comparison of conventional and real-time polymerase chain reaction with parasitological methods

    PubMed Central

    de Paula, Fabiana Martins; Malta, Fernanda de Mello; Marques, Priscilla Duarte; Sitta, Renata Barnabé; Pinho, João Renato Rebello; Gryschek, Ronaldo César Borges; Chieffi, Pedro Paulo

    2015-01-01

    This study aimed to evaluate the use of conventional polymerase chain reaction (cPCR) and real-time quantitative PCR (qPCR) in the diagnosis of human strongyloidiasis from stool samples in tropical areas. Stool samples were collected from individuals and were determined to be positive for Strongyloides stercoralis (group I), negative for S. stercoralis (group II) and positive for other enteroparasite species (group III). DNA specific to S. stercoralis was found in 76.7% of group I samples by cPCR and in 90% of group I samples by qPCR. The results show that molecular methods can be used as alternative tools for detecting S. stercoralis in human stool samples in tropical areas. PMID:25946255

  13. Parasitological evaluation of Ro 15-9268, a 9-acridanone-hydrazone derivative against Schistosoma mansoni in mice, and observations on changes in serum enzyme levels.

    PubMed

    Rawi, Sayed; Youssef, Osama Abdel-Ghaffar; Metwally, Aisha; Badawy, Mohamed; Al-Hazmi, Mansour

    2014-01-01

    Schistosoma mansoni is one of the major causes of schistosomiasis prevalent in tropical and subtropical areas, especially in poor communities. It is estimated that at least 90% of those requiring treatment for schistosomiasis live in Africa. The primary control strategy employed for schistosomiasis is mass drug administration (MDA).The aim is to reduce disease through treatments with a single lower dose of Ro 15-9268 as a new antischistosomal drug. In the present search, the efficacy of Ro 15-9268 was studied in mice using a dose of 12.5 mg/kg of body weight (b.wt.) against an Egyptian strain of S. mansoni. This was carried out at 2 days and 3, 4, and 6 weeks post-cercarial exposure of mice. The criteria used were the worm load, oogram pattern and number of ova in the liver and intestine, hepatic enzyme activity, and liver histopathology. The tested agent has led to a significant reduction in worm burden (89.80%) in liver and portomesenteric veins concurrent with a hepatic shift at the second week posttreatment followed by a complete disappearance of worms, 4 weeks postmedication. The oogram of infected animals treated revealed an increased number of dead ova 2 days posttreatment and complete absence of immature and mature ova 2 weeks later. The hepatic and intestinal egg counts significantly declined by about 96 and 98%, respectively, 6 weeks after treatment, and the fecal egg count completely disappeared from stool 4 weeks after medication. The hepatic histopathological changes were improved, ova were markedly degenerated, and worms showed fragmentation and degeneration after drug administration. In conclusion, when Ro 15-9268 was administered to mice infected with the Egyptian strain of S. mansoni, at a low dose level (12.5 mg/kg b.wt.), encouraging results were obtained. The drug showed high efficacy against schistosomal worms as well as histopathological inflammatory changes. PMID:24265055

  14. High plasma levels of nitrogen oxides are associated with severe disease and correlate with rapid parasitological and clinical cure in Plasmodium falciparum malaria

    Microsoft Academic Search

    Peter G. Kremsner; Stefan Winkler; Eckart Wildling; Javier Prada; Ulrich Bienzle; Wolfgang Graninger; Andreas K. Nüssler

    1996-01-01

    Plasma levels of nitrogen oxide (NO), neopterin and C-reactive protein (CRP) were compared in 3 groups of Gabonese patients with Plasmodium falciparum malaria before and after therapy: adults with uncomplicated malaria, children with uncomplicated malaria, and children with severe malaria. Plasma levels of all 3 molecules were significantly higher in severe malaria than in uncomplicated malaria. High levels of neopterin

  15. World Association for the Advancement of Veterinary Parasitology (WAAVP) guidelines for evaluating the efficacy of anticoccidial drugs in chickens and turkeys

    Microsoft Academic Search

    P. A Holdsworth; D. P Conway; M. E McKenzie; A. D Dayton; H. D Chapman; G. F Mathis; J. T Skinner; H.-C Mundt; R. B Williams

    2004-01-01

    These guidelines have been written to aid in the design, implementation and interpretation of studies for the assessment of drug efficacy against Eimeria species in chickens and turkeys. The information provided deals with many aspects of how to conduct controlled studies in battery cages (dose determination), floor pens (dose confirmation), and commercial facilities (field effectiveness studies), the selection of birds,

  16. Experimental Parasitology 94, 201207 (2000) doi:10.1006/expr.2000.4489, available online at http://www.idealibrary.com on

    E-print Network

    Maizels, Rick

    2000-01-01

    subfamilies on the basis of primary sin P (Acc. No. AF009923), X (Gay and Walker 1985; Nagler and sequence We report here the cloning of Tc-cpz-1, a cysteine protease gene1997, Engel et al. 1998; Ward et al Toxocara canis that has a high level of identity (59%) with human 1 The nucleotide sequence of Tc-cpz-1 has

  17. The epidemiology of schistosomiasis in the later stages of a control programme based on chemotherapy: the Basrah study. 1. Descriptive epidemiology and parasitological results.

    PubMed

    Yacoub, A; Southgate, B A

    1987-01-01

    The association between infection with Schistosoma haematobium and various factors including water contact pattern, past history of haematuria and treatment for schistosomiasis and cercarial dermatitis was investigated in Southern Iraq. The study covered mainly primary schoolchildren in different areas of Basrah and in Al-maadan locality where the majority of households with infected schoolchildren occurred. Urine examination was by the sedimentation and Nuclepore filtration methods. S. haematobium infection was very focal in distribution. There was evidence of local transmission in the Al-maadan locality, while in Abu-al-Jawzi schistosomiasis might have been acquired from endemic areas outside Basrah governorate. Swimming, history of haematuria, and history of treatment of schistosomiasis were significantly associated with the level of infection determined by egg count. Cercarial dermatitis, and bathing, washing clothes and fetching water were not significantly associated. The prevalence of infection among male members of households of infected children was significantly higher than that among male members of the remaining households in Al-maadan. There was no evidence of clustering of cases at household level. The implications of these findings for control and for future research on schistosomiasis in Basrah are discussed. PMID:3120370

  18. A community-based trial of ivermectin for onchocerciasis control in the forest of southwestern Cameroon: clinical and parasitologic findings after three treatments.

    PubMed

    Somo, R M; Ngosso, A; Dinga, J S; Enyong, P A; Fobi, G

    1993-01-01

    In the onchocerciasis-endemic rain forest area of the Rumpi Hills in southwestern Cameroon, a community-based trial of ivermectin, given either once or twice a year over a three-year period (1988-1991), confirmed that the drug is a potent microfilaricide. The side effects recorded following the first treatment were edema, fever, pruritus, generalized body pains and lymphadenitis. Following subsequent treatments, the same adverse reactions were recorded, but these were generally milder when compared with those of the first treatment. The prevalence of skin microfilaria (mf) was more reduced in zone two, in which treatment was given every six months (76.9% reduction at the end of one year) than in the zone one, in which treatment was given once a year (7.4% reduction). In both zones, the impact of the drug in reducing the intensity of infection was more significant than that for prevalence. Besides pruritus, other skin symptoms were not significantly modified by ivermectin treatment. Ivermectin reduced the prevalence of ocular mf as well as the mf load of the anterior chamber of the eye, resulting in improvement of certain eye lesions such as punctate keratitis, anterior uveitis, and papillary anomalies. There was also some improvement in visual acuity. The level of participation of the village populations was somewhat low, ranging from 52% to 66%, despite excitement over the drug's additional benefit of expelling intestinal round worms. PMID:8427394

  19. Non-Mendelian transmission of alleles at microsatellite loci: an example in Ixodes ricinus, the vector of Lyme diseaseq

    E-print Network

    for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: Microsatellite loci; Inheritance may result from methylation 0020-7519/$30.00 q 2004 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijpara.2004.04.006 International Journal for Parasitology

  20. Molecular epidemiology and evolutionary genetics of Leishmania parasites

    E-print Network

    congolense. # 1999 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights strains have taken a major place in modern approaches to the International Journal for Parasitology 29 (1999) 1137±1147 0020-7519/99/$20.00 # 1999 Australian Society for Parasitology Inc. Published

  1. MOLECULAR AND CELLULAR BIOLOGY OF HELMINTH

    E-print Network

    Maizels, Rick

    and Experimental Parasitology (Elsevier Journals) #12;MOLECULAR AND CELLULAR BIOLOGY OF HELMINTH Journal of Parasitology 33 (11): 1127-1302 IV. 6-11 September 2005, Hydra, Greece "Molecular and Cellular Biology of Helminth Parasites IV" Special Issue of International Journal of Parasitology 36 (6): 615-733 V

  2. Conservation Ecology & Entomology Department Dr Sonja Matthee

    E-print Network

    Geldenhuys, Jaco

    (Rodentia: Muridae). Parasitology DOI: http://dx.doi.org/10.1017/S003118201200217X 2. Van Der Mescht, L., le for a rodent host and its fleas. Parasitology, 140: 368-377 3. Drexler, J.F., Corman, V.M., Müller, M. A new species of Ixodes (Acari: Ixodidae) from South African Mammals. Journal of Parasitology, 97: 389

  3. RESEARCH NOTES 413 1993. Type I repressors of P Element Mobility. Genetics 135: 81

    E-print Network

    Schall, Joseph J.

    species. Journal of Parasitology 89: 1206­1211. ------, D. R. BROOKS, AND G. PEREZ-PONCE DE LEO´ N. 1999): Molecular and morphological evidence. Journal of Parasitology 85: 935­946. MORAVEC, F. 1992. Observations and classification of the Digenea (Platyhelminthes: Trematoda). International Journal of Parasitology 33: 733

  4. CURRICULUM VITAE Scott D. Snyder

    E-print Network

    Snyder, Scott D.

    -1998. EDUCATION University of Nebraska-Lincoln; Ph.D., Parasitology, August 1996. Wake Forest University; M the oblong turtle, Chelodina oblonga, (Pleurodira: Chelidae) in Western Australia. Comparative Parasitology Parasitology, submitted. Tkach, V. V. and S. D. Snyder. 2009. A new species of blood fluke (Digenea

  5. Brittany F. Sears Curriculum Vitae

    E-print Network

    Rohr, Jason

    of trematode parthenitae in Planorbella trivolvis (Mollusca: Gastropoda). Journal of Parasitology. BF Sears, P? Trends in Parasitology, 27(9): 382-387. BF Sears, P. Anderson, E. C. Greiner. 2011. A new species. Journal of Parasitology, 97(4): 713-716. #12;Academic Positions Aug 2008-present: Presidential Fellow

  6. BioMed Central Page 1 of 13

    E-print Network

    Wirth, Thierry

    Schwenkenbecher1, Katrin Kuhls1 and Gabriele Schönian*1 Address: 1Department of Parasitology, Institute National d'Histoire Naturelle, 16 rue Buffon, 72231 Paris cedex 05, France, 4Department of Parasitology of Medical Protozoology, Martsinovsky Institute of Medical Parasitology and Tropical Medicine, Sechenov

  7. Amphotericin B deoxycholate treatment of visceral leishmaniasis with newer modes of administration and precautions: a study of 938 cases

    Microsoft Academic Search

    C. P. Thakur; R. K. Singh; S. M. Hassan; R. Kumar; S. Narain; Ashok Kumar

    1999-01-01

    Out of 938 parasitologically confirmed patients with visceral leishmaniasis treated with amphotericin B (1 mg\\/kg bodyweight daily infused in 2 h for 20 days), 935 were cured clinically, 933 parasitologically and 931 ultimately (no relapse within 6 months). Two parasitologically ‘not cured’ and 4 relapsed patients were cured with 25 infusions, and 1 with double relapse with 30 infusions. The

  8. Iranian J Parasitol: Vol. 6, No.2, 2011, pp.38-44 *Corresponding author: Tel: 00989111940050, E-mail: ali_hal572002@yahoo.com

    E-print Network

    Citi, Sandra

    , A Eslami1 , I Mobedi2 , O Amin3 , J Mariaux4 , J Mansoori5 , S Tavakol6 1 Department of Parasitology, Iran 2 Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences, Iran 3 Parasitology Center,Inc.(PCI),Tempe, AZ , USA 4 Curator Department

  9. World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) guidelines for evaluating the efficacy of parasiticides for the treatment, prevention and control of flea and tick infestation on dogs and cats

    Microsoft Academic Search

    A. A. Marchiondo; P. A. Holdsworth; P. Green; B. L. Blagburn; D. E. Jacobs

    2007-01-01

    These guidelines are intended to assist the planning and conduct of laboratory and clinical studies to assess the efficacy of ectoparasiticides applied to dogs or cats for the purpose of treating, preventing and controlling flea and tick infestations. The term ectoparasiticide includes insecticidal and acaricidal compounds, as well as insect growth regulators. The range of biological activities accruing from animal

  10. Automated reading and processing of quantitative IgG, IgM, IgA, and IgE isotypic agglutination results in microplates Development and application in parasitology-mycology

    Microsoft Academic Search

    D. Aubert; F. Foudrinier; M. L. Kaltenbach; D. Guyot-Walser; C. Marx-Chemla; R. Geers; H. Lepan; J. M. Pinon

    1995-01-01

    Microplate agglutination techniques represent a simple and commonly used approach for the quantitative or qualitative isotypic analysis of specific antibodies. However, they require optical reading by the investigator and are thus prone to an important degree of variability. In order to solve some of the problems associated with the variability of optical readings, we have used an automatic reader scanning

  11. Montanide™ ISA 71 VG adjuvant enhances antibody and cell-mediated immune responses to profilin subunit antigen vaccination and promotes protection against Eimeria acervulina and Eimeria tenella. Experimental Parasitology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The present study was conducted to investigate the immunoenhancing effects of MontanideTM ISA 71 VG adjuvant on profilin subunit antigen vaccination. Broiler chickens were immunized subcutaneously with a purified Eimeria acervulina recombinant profilin protein, either alone or mixed with ISA 71 VG, ...

  12. Continuous Cultivation of Trypanosoma brucei Blood Stream Forms in a Medium Containing a Low Concentration of Serum Protein without Feeder Cell Layers

    E-print Network

    Cross, George

    of Parasitology, Vol. 75, No. 6. (Dec., 1989), pp. 985-989. Stable URL: http://links.jstor.org/sici?sici=0022-3395%28198912%2975%3A6%3C985%3ACCOTBB%3E2.0.CO%3B2-4 The Journal of Parasitology is currently published by The American- naeus. Journal of Parasitology 73: 1099-1 101. JENSEN,T. 1952. The life-cycle of the fish acantho

  13. Roadmap: Medical Technology Bachelor of Science [AS-BS-MEDT

    E-print Network

    Sheridan, Scott

    Parasitology: Theory and Applications 1 CLS 49020 Clinical Chemistry: Theory 4 Semester Eight: [16 Credit Hours] CLS 49021 Clinical Chemistry: Applications 4 Students who complete the required clinical

  14. 78 FR 40744 - Request for Nominations of Candidates To Serve on the Board of Scientific Counselors (BSC...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-08

    ...infectious diseases and related disciplines, including epidemiology, microbiology, bacteriology, virology, parasitology, mycology, immunology, public health, entomology, clinical medicine, and veterinary medicine, as well as from the general...

  15. 42 CFR 493.821 - Condition: Microbiology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...Tests § 493.821 Condition: Microbiology. The specialty of microbiology includes, for purposes of proficiency testing, the subspecialties of bacteriology, mycobacteriology, mycology, parasitology and...

  16. 76 FR 76416 - Request for Nominations of Candidates To Serve on the Board of Scientific Counselors (BSC...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-07

    ...infectious diseases and related disciplines, including epidemiology, microbiology, bacteriology, virology, parasitology, mycology, immunology, public health, entomology, clinical medicine, and veterinary medicine, as well as from the general...

  17. 42 CFR 493.821 - Condition: Microbiology.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...Tests § 493.821 Condition: Microbiology. The specialty of microbiology includes, for purposes of proficiency testing, the subspecialties of bacteriology, mycobacteriology, mycology, parasitology and...

  18. June 14, 2013Animal Health Diagnostic Center Department of Population Medicine & Diagnostic Sciences

    E-print Network

    Keinan, Alon

    Veterinary Support Services (VSS) Receiving Jeffrey Talcott Medical Records Linda Homer Regulatory Affairs Dr. Patrick McDonough (Acting Director) Parasitology Vacant Infectious Disease Research Program Dr

  19. Follow-up of Card Agglutination Trypanosomiasis Test (CATT) positive but apparently aparasitaemic individuals in Cote d'Ivoire: evidence for a complex and heterogeneous population

    Microsoft Academic Search

    Andre Garcia; Vincent Jamonneau; Eddy Magnus; Claude Laveissiere; Veerle Lejon; Paul N'guessan; Louis N'dri; Nestor Van Meirvenne; Philippe Buscher

    2000-01-01

    Summary The aetiological diagnosis of human African trypanosomiasis (HAT) is based on the detection of the para- site, but currently available parasitological tests have low sensitivity and are hampered by fluctuating para- sitaemia. The identification of seropositive individuals on whom to focus parasitological examination is based on antibody detection by means of the Card Agglutination Trypanosomiasis Test (CATT\\/T.b.gambi- ense). A

  20. Original Article Folia Primatol 2013;84:102114

    E-print Network

    Fedigan, Linda M.

    · Filariopsis · Strongyloides Abstract Neotropical primate parasitology has been dominated by studies of howler.1159/000348287 focused heavily on howler monkeys (Alouatta spp.) [Stuart et al., 1990; Stoner, 1996; Stuart et al., 1998

  1. 76 FR 52328 - Single Source Cooperative Agreement Award for the Gorgas Memorial Institute of Health Studies

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-22

    ...HIV) for the Central American region. GMI has well-established laboratories of virology, parasitology, immunology, genomics, entomology and food and water chemistry. GMI also has departments of epidemiology and biostatistics, chronic disease...

  2. Studies on eimerians (Apicomplexa: Eimeriidae) of wild ruminants.

    PubMed

    Pyziel, Anna

    2012-01-01

    The studies were carried out in W. Stefanski Institute of Parasitology Polish Academy of Sciences. Doctoral thesis defense took place on May 29th 2012. Supervisor: prof. dr hab. Aleksander W. Demiaszkiewicz. PMID:25165763

  3. ENTERIC PARASITES IN WORKERS OCCUPATIONALLY EXPOSED TO SEWAGE

    EPA Science Inventory

    To determine if parasitic infections occur more frequently among workers exposed to wastewater than among controls, parasitologic examinations were performed on stool specimens collected over a 12-month period from sewer and highway maintenance workers. Three of 56 sewer maintena...

  4. Serum proteins, indirect fluorescent antibody titers and complement fixing antibody titers in dexamethasone exacerbated anaplasmosis carrier calves

    E-print Network

    Johnson, Lloran Wesley

    1979-01-01

    proteins were compared with other serological and parasitological parameters of infection. LITERATURE REVIEW Anaplasmosis is a highly infectious disease of cattle recognized principally by clinical signs of fever, anemia, and icterus. Other...

  5. 42 CFR 493.643 - Fee for determination of program compliance.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...Microbiology, which includes one or more of the following subspecialties: (A) Bacteriology. (B) Mycobacteriology. (C) Mycology. (D) Parasitology. (E) Virology. (ii) The specialty of Serology, which includes one or more of the...

  6. 42 CFR 493.909 - Microbiology.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...subspecialties under the specialty of microbiology for which a program may offer proficiency testing are bacteriology, mycobacteriology, mycology, parasitology and virology. Specific criteria for these subspecialties are found at §§ 493.911 through...

  7. 42 CFR 493.643 - Fee for determination of program compliance.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...Microbiology, which includes one or more of the following subspecialties: (A) Bacteriology. (B) Mycobacteriology. (C) Mycology. (D) Parasitology. (E) Virology. (ii) The specialty of Serology, which includes one or more of the...

  8. 42 CFR 493.643 - Fee for determination of program compliance.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...Microbiology, which includes one or more of the following subspecialties: (A) Bacteriology. (B) Mycobacteriology. (C) Mycology. (D) Parasitology. (E) Virology. (ii) The specialty of Serology, which includes one or more of the...

  9. 42 CFR 493.643 - Fee for determination of program compliance.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ...Microbiology, which includes one or more of the following subspecialties: (A) Bacteriology. (B) Mycobacteriology. (C) Mycology. (D) Parasitology. (E) Virology. (ii) The specialty of Serology, which includes one or more of the...

  10. 42 CFR 493.909 - Microbiology.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...subspecialties under the specialty of microbiology for which a program may offer proficiency testing are bacteriology, mycobacteriology, mycology, parasitology and virology. Specific criteria for these subspecialties are found at §§ 493.911 through...

  11. COCCIDIAN PARASITES (APICOMPLEXA: EUCOCCIDORIDA) IN HARDY HEAD FISH, ATHERINOMORUS CAPRICORNENSIS

    EPA Science Inventory

    Authors describe coccidian merozoites (asexual stages) in theexocrine pancreas and oocysts in the gut epithelium of hardy heads,(Woodland) (family Atherinidae) collected at Heron Island, Queensland, Australia, during the pre-ICOPA (International Congress of Parasitology) workshop...

  12. EPIFLUORESCENCE MICROSCOPY AND SOLID PHASE CYTOMETRY AS CONFIRMATORY METHODS FOR THE ENUMERATION OF PROTOZOA BY FLOW CYTOMETRY

    EPA Science Inventory

    The detection of infective protozoan parasites contained in large volume environmental samples represents a unique challenge in environmental parasitology. Compounding this problem is the fact that infective stages of many protozoan parasites do not readily replicate in media or ...

  13. 77 FR 36488 - Marine Mammals; File No. 17350

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-19

    ...on a variety of health- related analyses such as tissue histology, contaminants analyses, infectious disease research, parasitology studies, and stable isotope work. Additionally, tissues would be collected to augment the National Marine Mammal...

  14. Francesco Redi: (1626-1697) Biography

    NSDL National Science Digital Library

    Kimberly A Buettner (Arizona State University Embryo Project Encyclopedia)

    2012-02-23

    An online encyclopedia article about a scientist in the 1600s who was interested in experimental toxicology, parasitology, entomology and developmental biology. He used microscopy to argue against spontaneous generation.

  15. Pulmonary and hepatic echinococcosis in children

    Microsoft Academic Search

    J. Thtimler; A. Mufioz

    1978-01-01

    Eighty children suffering from pulmonary and\\/or hepatic echinococcosis are reported. The epidemiological and parasitological aspects are reviewed, and the importance of the radiological signs and differential diagnosis are emphasized.

  16. LSU Health Sciences Center New Orleans Campus Application for Leave

    E-print Network

    an employee engaged in law enforcement work is disabled while in the performance of duty of a hazardous nature of Medicine ­ Department of Microbiology, Immunology & Parasitology Employee Name From: _____ AM ____PM To ______________________________________________________________________________________________________________ Employee Signature Date Approved by and Title

  17. I N T H I S I S S U E Canada Post Corporation

    E-print Network

    Shoubridge, Eric

    and nutrient removal in a constructed wetland, and salinity effects on root morphology. Guillaume Simard and Applied Mechanics, the Institute of Parasitology, Natural Resource Sciences and Plant Science. Topics

  18. The role of plasmids in antibiotic resistance and virulence of Aeromonas hydrophila

    E-print Network

    Horton, John Randolph

    1987-01-01

    tment of Veter inary Microbiology and Parasitology, Texas A&M Univer sity. The type strain for this species, strain ATCC 7966, was obtained from the American Type Culture Collection. Their identification was verified with a minimum plexus...

  19. Antibiotic administration by osmotic infiltration in the freshwater shrimp, Macrobrachium rosenbergii 

    E-print Network

    Llobrera, Alcestis Trillo

    1980-01-01

    in this study. The shrimp were held in holding facilities at the Texas A&M University, Department of Veterinary Microbiology and Parasitology, Aquatic Animal Medicine Laboratory. Ralston Purina Experimental Marine Ration No. 25 (Checkerboard Square, St... for the degree of MASTER OF SCIENCE August 1980 Major Subject: Veterinary Microbiology and Parasitology ANTIBIOTIC ADMINISTRATION BY OSMOTIC INFILTRATION IN THE FRESHWATER SHRIMP, MACROBRACHIUM ROSENBERGII A Thesis by ALCESTIS TRILLO LLOBRERA Approved...

  20. Supplement 9, Authors: A To Z

    E-print Network

    Doss, Mildred A.; Humphrey, Judith M.; Segal, Dorothy B.

    1959-01-01

    of Technology. Chcs.?Chicago, Illinois. The John Crerar Library. Special Libraries Association Translation Center. Cor?.?Corvallis, Oregon. Library of Oregon State College. Lau.?Lawrence, Kansas. University of Kansas Library. Lacu.?Los Angeles, California...]. (????????? ?????????? ???????? ???????? ? ?????- ?????. ????? ??????????? ?? ????????? ?????????? ???????? ???????? ???????? ? ???????????????????? ???????? ? ??????????). Alma-Ata. Probleme Parasitol. (Borchert).?Probleme der Parasitologic. Vortr?ge der II. Parasitologis- chen Arbeitstagung vom 24.-26. November 1954 in Berlin. Herausgegeben von Professor Dr. A. Borchert. Berlin. Probleme Terap.?Probleme de...

  1. Immunodiagnosis of fascioliasis using sandwich enzyme-linked immunosorbent assay for detection of Fasciola gigantica paramyosin antigen

    PubMed Central

    Abou-Elhakam, Hany Mohamed Adel; Bauomy, Ibraheem Rabia; El Deeb, Somaya Osman; El Amir, Azza Mohamed

    2013-01-01

    Background: Many immunological techniques have been developed over years using the different Fasciola antigens for diagnosis of parasitic infection and to replace the parasitological techniques, which are time consuming and usually lack sensitivity and reproducibility. Materials and Methods: In this study, Fasciola gigantica paramyosin (Pmy) antigen was early detected in cattle sera using sandwich enzyme-linked immunosorbent assay (ELISA), to evaluate the Pmy antigen performance in diagnosis. This work was conducted on 135 cattle blood samples, which were classified according to parasitological investigation into, healthy control (30), fascioliasis (75), and other parasites (30) groups. Results: The sensitivity of Sandwich ELISA was 97.33%, and the specificity was 95%, in comparison with parasitological examination, which recorded 66.66% sensitivity and 100% specificity, respectively. Conclusions: It was clear that the native F. gigantica Pmy is considered as a powerful antigen in early immunodiagnosis of fascioliasis, using a highly sensitive and specific sandwich ELISA technique. PMID:23961441

  2. [Evaluation of different broiler housing conditions on the basis of clinical, pathological, anatomical and laboratory diagnostic criteria--a summary].

    PubMed

    Neumann, V U; Braune, S; Glünder, G; Haas, B; Hinz, K H; Ryll, M; Salisch, H; Sander, I

    1996-03-01

    In a cooperative study, the impact of different broiler housing conditions (see communication BUCHENAUER) on clinical, post-mortem and laboratory diagnostic (microbiological, parasitological, serological, immunological) parameters was investigated in the course of three different fattening period. Clinically, it was observed, that lower stocking densities allowed a relatively higher motility of the birds. On the other hand, necropsy findings, microbiological, parasitological, serological and immunological findings gave no indications that these parameters were influenced statistically significant by either one of the broiler keeping systems. PMID:8721325

  3. RESEARCH Open Access Therapeutic efficacy of fixed dose artesunate-

    E-print Network

    Paris-Sud XI, Université de

    ). Results: Recruited patients numbered 45; five aged clinical and parasitological response (ACPR) exceeding 90% when assessed over 28 days [5,6]. However is available at the end of the article © 2013 Leang et al.; licensee BioMed Central Ltd. This is an Open Access

  4. HUMAN TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN INDIA: THE FIRST CASE REPORT

    Microsoft Academic Search

    PRASHANT P. JOSHI; VIJAY R. SHEGOKAR; RAJARAM M. POWAR; STEPHANE HERDER; RAHUL KATTI; HARSHA R. SALKAR; VIBHAWARI S. DANI; ARADHANA BHARGAVA; JEAN JANNIN; PHILIPPE TRUC

    We report an Indian farmer who had fluctuating trypanosome parasitemia associated with febrile episodes for five months. Morphologic examination of the parasites indicated the presence of large numbers of trypanosomes belonging to the species Trypanosoma evansi, which is normally a causative agent of animal trypanosomiasis known as surra. Basic clinical and biologic examinations are described, using several assays, including parasitologic,

  5. This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research

    E-print Network

    Rohr, Jason

    's personal copy Parasite age-intensity relationships in red-spotted newts: Does immune memory influence immunity for 12 parasite taxa of red-spotted newts (Notophthalmus viridescens), using data from a 2-year parasitological survey of six newt populations. We estimated ages from snout-vent length (SVL) based

  6. [Case report of skin manifestations in infantile Mediterranean kala-azar].

    PubMed

    Ayadi, A; Loukil, M; Lakhoua, R; Boubaker, S; Debbabi, A; Ben Rachid, S B; Jedidi, H

    1992-04-01

    The case of a 19-month-old girl with visceral leishmaniasis and unusual skin manifestations is reported. Emphasis is put on the fact that such manifestations are unusual in Mediterranean infantile leishmaniasis. The clinical features, parasitology, histology, and course of these skin lesions are discussed. PMID:1616241

  7. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper

    Microsoft Academic Search

    Kate?ina Albrechtová; Kamil Sedlák; Klára J. Petrželková; Jan Hlavá?; Andrei D. Mihalca; Alison Lesingirian; Paul W. N. Kanyari; David Modrý

    2011-01-01

    Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae:

  8. Intracellular levels of the viral symbiont CPV in Cryptosporidium parvum correlate with fecundity of the parasite in dairy calves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous reports have cited differences in clinical signs and oocyst output among strains of Cryptosporidium parvum. The purpose of this study was to determine if levels of the C. parvum intracellular viral symbiont CPV correlated with observed clinical and parasitological differences. Calves infe...

  9. Leishmania major: Promastigotes Induce Expression of a Subset of Chemokine Genes in Murine Macrophages

    E-print Network

    Beverley, Stephen M.

    Leishmania major: Promastigotes Induce Expression of a Subset of Chemokine Genes in Murine. 1997. Leishmania major: Promastigotes induce expression of a subset of chemokine genes in murine macrophages. Experimental Parasitology 85, 283­295. Recent studies suggest that Leishmania major promastigotes

  10. Masticatory and skeletal muscle myositis in canine leishmaniasis (Leishmania infantum)

    Microsoft Academic Search

    C. D. Vamvakidis; A. E Koutinas; M. Saridomichelakis; G. Kanakoudis; G. Georgiadis

    2000-01-01

    Twenty-four dogs with a parasitologically and serologically established diagnosis of leishmaniasis were studied to investigate the atrophy of the masticatory muscles which commonly occurs in this disease, and to compare the lesions in the masticatory muscles with those in the cranial tibial muscles. The 24 animals were divided into three groups of eight, group A dogs with no muscular atrophy,

  11. Leishmania spp. and\\/or Trypanosoma cruzi diagnosis in dogs from endemic and nonendemic areas for canine visceral leishmaniasis

    Microsoft Academic Search

    Marcella Zampoli Troncarelli; Janaína Biotto Camargo; Juliana Giantomassi Machado; Simone Baldini Lucheis; Helio Langoni

    2009-01-01

    Due to the phylogenetic similarity between Leishmania spp. and Trypanosoma cruzi (T. cruzi), serological cross-reactions and false-positive results are quite common. This study aimed to elucidate canine leishmaniasis and trypanosomiasis diagnosis by the indirect fluorescent antibody test (IFAT) on serum samples, and direct parasitological examination and polymerase chain reaction (PCR) in liver and spleen samples. One hundred dogs from Zoonosis

  12. PCR identification of Leishmania in diagnosis and control of canine leishmaniasis

    Microsoft Academic Search

    Aparecida H. S. Gomes; Isabelle M. R. Ferreira; Maria L. S. R. Lima; Elaine A. Cunha; Andrea S. Garcia; Maria F. L. Araújo; Vera L. Pereira-Chioccola

    2007-01-01

    Leishmaniases are endemic in many countries, mainly in rural areas. In Brazil, Leishmania infection is responsible for many cases of Leishmaniases, including recent reports in urban regions. Despite their sensitivity, traditional serological and parasitological methods for detecting Leishmaniases have proven inadequate for species discrimination. This study aimed to identify Leishmania species in biological samples by a fast methodology, avoiding “in

  13. Leishmania ( Leishmania) chagasi is not vertically transmitted in dogs

    Microsoft Academic Search

    Hélida M Andrade; Vicente de P. C. P de Toledo; Marcos José Marques; João C França Silva; Wagner L Tafuri; Wilson Mayrink; Odair Genaro

    2002-01-01

    The most frequent and most important mode of human or canine visceral leishmaniasis (CVL) transmission is through the bite of infected sand flies. This study investigates Leishmania (Leishmania) chagasi vertical transmission in offspring of naturally infected dogs. Thus 63 puppies from 18 female dogs with CVL were used. Parasite presence was evaluated through parasitologic and histopathologic examination of lymphatic organs,

  14. Exposing malaria in-host diversity and estimating population diversity by capture-recapture using

    E-print Network

    Read, Andrew

    Exposing malaria in-host diversity and estimating population diversity by capture-recapture using, Blantyre 3, Malawi; d The National Center for Parasitology, Entomology and Malaria Control, Phnom Penh, MD, and approved October 12, 2010 (received for review May 20, 2010) Malaria infections commonly

  15. Program of Study For a Bachelor of Science in Medical Laboratory Sciences Number Course Title Crs.

    E-print Network

    Shihadeh, Alan

    MLSP 208 General and Diagnostic Virology 2 MLSP 259 Diagnostic Serology 1 LABM 201 Clinical Chemistry I 2 LABM 202 Clinical Chemistry II 3 LABM 210 Cytology and Histological Techniques 2 LABM 231 Clinical Parasitology for MLS Students 4 Seminar MLSP 211 Seminar 1 LABM 220 Clinical Chemistry and Endocrinology 4 LABM

  16. Program of Study For a Bachelor of Science in Medical Laboratory Sciences Number Course Title Crs.

    E-print Network

    Shihadeh, Alan

    MLSP 208 General and Diagnostic Virology 2 MLSP 259 Diagnostic Serology 1 LABM 201 Clinical Chemistry I 2 LABM 202 Clinical Chemistry II 2 LABM 210 Cytology and Histological Techniques 2 LABM 233 Genetics 1 MBIM 223 Parasitology for MLS students 4 Seminar MLSP 211 Seminar 1 LABM 220 Clinical Chemistry

  17. History of Medical Laboratory Services in Bahrain. Part II. The Foundation of Modern Laboratory Services (1963-1975)

    Microsoft Academic Search

    F. Al Hilli

    In 1963, Dr George Inglott, a Maltese qualified Pathologist was recruited to be in charge of medical laboratory facilities, which lasted until 1975. He witnessed the foundation of modern laboratory clinical practice in Bahrain. He initially experienced limitations to advice on clinical practice of biochemistry and microbiology (including bacteriology, parasitology, and serology), but there were limited demands from the hospital

  18. Organochlorine Pesticide Residues in Breast Milk in the Republic of Belarus

    Microsoft Academic Search

    E. N. Barkatina; A. L. Pertsovsky; V. I. Murokh; N. D. Kolomiets; O. V. Shulyakovskaya; O. N. Navarich; V. I. Makarevich

    1998-01-01

    Intensive application of organochlorin e pesticides (OChP) in agriculture and medical parasitology and also a high stability of these pesticides to the action of the environment resulted in their spreading all over the globe. In many countries, Commonwealth of Independent States included, application of OChP except lindane is forbidden, however in a number of countries they are being used at

  19. Acute Chagas disease in El Salvador 2000-2012 - need for surveillance and control.

    PubMed

    Sasagawa, Emi; de Aguilar, Ana Vilma Guevara; de Ramírez, Marta Alicia Hernández; Chévez, José Eduardo Romero; Nakagawa, Jun; Cedillos, Rafael Antonio; Kita, Kiyoshi

    2014-04-01

    Several parasitological studies carried out in El Salvador between 2000-2012 showed a higher frequency of acute cases of Chagas disease than that in other Central American countries. There is an urgent need for improved Chagas disease surveillance and vector control programs in the provinces where acute Chagas disease occurs and throughout El Salvador as a whole. PMID:24676660

  20. Chapter 11 of: Food consumption and disease risk -consumer pathogen

    E-print Network

    Flegr, Jaroslav

    (pathogenic) activity without being able to prevent the infection or multiplication. Higher resistance and host species. The main practical objectives of evolutionary parasitology include the development of therapeutic and preventive measures to prevent increase in virulence and resistance in parasites or even help

  1. Investigations on the aetiology of pinching off syndrome in four white-tailed sea eagles (Haliaeetus albicilla) from Germany

    Microsoft Academic Search

    Kerstin Müller; Elvira Schettler; Helga Gerlach; Leo Brunnberg; Hafez Mohamed Hafez; Kim Hattermann; Reimar Johne; Rainer Kollmann; Oliver Krone; Michael Lierz; Sonja Linke; Dörte Lueschow; Annette Mankertz; Hermann Müller; Christina Prusas; Rüdiger Raue; Dirk Soike; Stephanie Speck; Petra Wolf; Kai Frölich

    2007-01-01

    The purpose of this study was to investigate the aetiology of the pinching off syndrome (POS), a generalized feather abnormality affecting free-living nestling of the white-tailed sea eagle (Haliaeetus albicilla) in Europe. For the first time, extensive clinical, haematological, biochemical, virological, bacteriological, nutritional, histopathological, parasitological and electron microscopical examinations were performed on three females and one male suffering from POS.

  2. Some intestinal parasites of Arctic fox, Banks Island, N. W. T.

    PubMed Central

    Eaton, R D; Secord, D C

    1979-01-01

    Small intestinal parasitology of 50 trapped Arctic fox taken on Banks Island, The Northwest Territories, showed a prevalence of Taenia crassiceps (78%), Toxascaris leonina (60%), Echinococcus multilocularis (2%) and Coccidia (2%). Attention is drawn to the absence of Toxocara sp. and of Uncinaria sp. PMID:497890

  3. Some intestinal parasites of Arctic fox, Banks Island, N. W. T.

    PubMed

    Eaton, R D; Secord, D C

    1979-04-01

    Small intestinal parasitology of 50 trapped Arctic fox taken on Banks Island, The Northwest Territories, showed a prevalence of Taenia crassiceps (78%), Toxascaris leonina (60%), Echinococcus multilocularis (2%) and Coccidia (2%). Attention is drawn to the absence of Toxocara sp. and of Uncinaria sp. PMID:497890

  4. Fasciola: Kinetics and Quality of Humoral Responses to Fatty Acid Binding Protein and Cathepsin L Following Delivery as DNA Vaccines in Mice

    Microsoft Academic Search

    Peter M. Smooker; Nicholas J. Kennedy; Kelly R. Steeper; Helen Christopoulos; Terry W. Spithill

    2001-01-01

    Smooker, P. M., Kennedy, N. J., Steeper, K. R., Christopoulos, H., and Spithill, T. W. 2001. Fasciola: Kinetics and quality of humoral responses to fatty acid binding protein and cathepsin l following delivery as DNA vaccines in mice. Experimental Parasitology97, 154–160. The humoral response to DNA vaccination of mice with two important Fasciola antigens has been investigated. Both F. gigantica

  5. Invited Review Autoimmunity in Chagas heart disease

    E-print Network

    Engman, David M.

    Invited Review Autoimmunity in Chagas heart disease J.S. Leon, D.M. Engman* Northwestern University the genesis of autoimmunity in Chagas heart disease: (i) What mechanism(s) are potentially responsible for Parasitology Inc. Keywords: Myocarditis; Chagas heart disease Myosin; Autoimmunity 1. Introduction After

  6. LONGITUDINAL ANALYSIS OF THE DEVELOPMENT OF FILARIAL INFECTION AND ANTIFILARIAL IMMUNITY IN A COHORT OF HAITIAN CHILDREN

    Microsoft Academic Search

    PATRICK J. LAMMIE; MERRYL D. REISS; KATHLEEN A. DIMOCK; THOMAS G. STREIT; JACQUELIN M. ROBERTS; MARK L. EBERHARD

    Longitudinal studies are being conducted in Leogane, Haiti to investigate the relationship between acquisition of filarial infection and development of antifilarial immunity as well as the impact of maternal infection on this relationship. Children (0-24 months of age) residing in Leogane were enrolled and were examined periodically to monitor parasitologic status and to collect serum for antigen and antifilarial antibody

  7. Variation and polymorphism in helminth parasites R. M. MAIZELS"* and A. KURNIAWAN-ATMADJA#

    E-print Network

    Maizels, Rick

    -ATMADJA# " Institute of Cell, Animal and Population Biology, University of Edinburgh, West Mains Road, Edinburgh EH9 3JT, UK # Department of Parasitology, Faculty of Medicine, University of Indonesia, Salemba Raya 6, Jakarta 10430, Indonesia SUMMARY There are strong biological, evolutionary and immunological arguments

  8. Program Director/Principal Investigator (Last, First, Middle): Kohn, Michael Hans PHS 398/2590 (Rev. 11/07) Page 1 Biographical Sketch Format Page

    E-print Network

    Kohn, Michael

    of freshwater parasitic copepods in the Ergasilidae (Copepoda: Poecilostomatoida) based on 18S and 28S rDNA Palombi, 1949 as inferred from ITS- 2 rDNA sequences. Parasitology. 14, 1-9. 7. Chang M. X., Nie P., Liu G and transcription of IRF-1 and IRF-7 in the mandarin fish Siniperca chuatsi. Vet Immunol Immunopathol. 116, 26

  9. A Coproantigen Diagnostic Test for Strongyloides Infection

    Microsoft Academic Search

    Alex M. Sykes; James S. McCarthy

    2011-01-01

    Accurate diagnosis of infection with the parasite Strongyloides stercoralis is hampered by the low concentration of larvae in stool, rendering parasitological diagnosis insensitive. Even if the more sensitive agar plate culture method is used repeated stool sampling is necessary to achieve satisfactory sensitivity. In this manuscript we describe the development of a coproantigen ELISA for diagnosis of infection. Polyclonal rabbit

  10. Efficacy of albendazole against Giardia and hookworm in a remote Aboriginal community in the north of Western Australia

    Microsoft Academic Search

    J. A. Reynoldson; J. M. Behnke; M. Gracey; R. J. Horton; R. Spargo; R. M. Hopkins; C. C. Constantine; F. Gilbert; C. Stead; R. P. Hobbs; R. C. A. Thompson

    1998-01-01

    The parasitological, clinical efficacy and tolerability of albendazole in the treatment for both giardiasis and hookworm infection in a remote Aboriginal population was investigated. Albendazole at a dose rate of 400 mg daily for 5 days was highly effective in reducing hookworm egg numbers and both Giardia antigen and cysts. The 36.6% prevalence of Giardia prior to treatment fell to

  11. Cryptosporidium parvum:PCR-RFLP Analysis of the TRAP-C1 (Thrombospondin-Related Adhesive Protein of Cryptosporidium1) Gene Discriminates between Two Alleles Differentially Associated with Parasite Isolates of Animal and Human Origin

    Microsoft Academic Search

    Furio Spano; Lorenza Putignani; Serena Guida; Andrea Crisanti

    1998-01-01

    Spano, F., Putignani, L., Guida, S., Crisanti, A. 1998.Cryptosporidium parvum: PCR-RFLP analysis of the TRAP-C1 (thrombospondin-related adhesive protein ofCryptosporidium-1) gene discriminates between two alleles differentially associated with parasite isolates of animal and human origin.Experimental Parasitology90,195–198.

  12. SORT BY TEST Animal Health Diagnostic Center Test and Fee Schedule

    E-print Network

    Keinan, Alon

    . Bacteriology6.50 /sample or contract* Acid Fast Stain for Cryptosporidium spp M-F 1-3 days 10g fresh fecal sample wide mouth leak-proof Refrigerate For Cryptosporidium spp Parasitology16.50 or contract* Acidic

  13. Parasites as biological tags for stock discrimination of marine fish: a guide to procedures and methods

    Microsoft Academic Search

    K MacKenzie; P Abaunza

    1998-01-01

    The purpose of this paper is to provide a guide for parasitologists and fishery biologists to the use of parasites as biological tags for stock discrimination of marine fish. Key literature on parasitology and fisheries biology is listed, and the following topics are covered: (1) the general principles involved in the use of parasites as tags in fish population studies

  14. Fernandez, M.L.S., Engels, K.K., Bender, F., Gassel, M., Marhofer, R.J., Mottram, J.C., and Selzer, P.M. (2012) High-throughput screening with the

    E-print Network

    Azzopardi, Leif

    2012-01-01

    Wellcome Trust Centre for Molecular Parasitology, Institute of Infection, Immunity and Inflammation-Seyler-Str. 4, 72076 Tu¨bingen, Germany The poultry disease coccidiosis, caused by infection with Eimeria spp in the human apicomplexan parasite Plasmodium falciparum. EtCYC3a was cloned, expressed in Escherichia coli

  15. Inference of the Phylogenetic Position of Oxymonads Based on Nine Genes: Support for Metamonada and Excavata

    E-print Network

    Flegr, Jaroslav

    few decades has often resolved the branching pattern within major groups of eukaryotes. Foster,à1 and T. Martin Embleyà1 *Department of Parasitology, Faculty of Science, Charles University Circumscribing major eukaryote groups and resolving higher order relationships between them are among the most

  16. [Technics of detection and diagnosis of African trypanosomiasis in humans].

    PubMed

    Stanghellini, A; Roux, J F

    1984-01-01

    The authors review the most recent and sophisticated laboratory techniques for screening and diagnosis of human african trypanosomiasis. Immunological screening: indirect immunofluorescence, card agglutination test. Parasitological diagnosis: hematocrit centrifuge technique, miniature anion exchange/centrifugation, cerebrospinal fluid centrifugation. For each of these techniques, the authors deal successively with principle and method, interest, possible applications. PMID:6394949

  17. John A. Lednicky, Ph.D. Associate Professor

    E-print Network

    Lednicky, John

    projects included work with influenza viruses, alphaviruses, flaviviruses, Bacillus anthracis, SV40, Canine, mycology, parasitology, and virology) #12;2 Work with B. anthracis, Y. pestis Cultivation of alga, Yellow fever virus, etc.), B. anthracis, Y. pestis, various fungi. Experience Associate Professor, Oct. 1

  18. Evaluation of various diagnostic techniques for Trypanosoma evansi infections in naturally infected camels

    Microsoft Academic Search

    K. M. L. Pathak; Yadvendra Singh; N. V. Meirvenne; M. Kapoor

    1997-01-01

    One hundred and eight camels (Camelus dromedarius) from Trypanosoma evansi endemic areas of the Thar Desert of Rajasthan State, India, were evaluated by various diagnostic tests including parasitological tests (wet blood film — WBF, stained thick blood film), chemical test (mercuric chloride), biological test (mouse subinoculation — MSI), and immunodiagnostic tests based on antibody detection (double immunodiffusion test — DID,

  19. The detection of anthelmintic resistance in nematodes of veterinary importance

    Microsoft Academic Search

    G. C. Coles; F. Jackson; R. K. Prichard; G. von Samson-Himmelstjerna; A. Silvestre; M. A. Taylor; J. Vercruysse

    2006-01-01

    Before revised World Association for the Advancement of Veterinary Parasitology (WAAVP) guidelines on the detection of anthelmintic resistance can be produced, validation of modified and new methods is required in laboratories in different parts of the world. There is a great need for improved methods of detection of anthelmintic resistance particularly for the detection of macrocyclic lactone resistance and for

  20. Veterinary Report Spring 2005 Dr. Daniel Rock,

    E-print Network

    Gilbert, Matthew

    Veterinary Report · Spring 2005 q Dr. Daniel Rock, an expert in viral disease research, came aboard as head of the Department of Veterinary Pathobi- ology on March 28. Dr. Rock was formerly research leader for veterinary researchers with expertise in pathology, microbiology, epidemiology, and parasitology," he says

  1. Molecular Diversity of Entodiniomorphid Ciliate Troglodytella abrassarti and Its Coevolution With

    E-print Network

    Republic 18 CEITEC-Central European Institute of Technology, University of Veterinary and Pharmaceutical 3 Department of Pathological Morphology and Parasitology, University of Veterinary and Pharmaceutical Sciences, Palacke´ho 1-3, 612 42 Brno, Czech Republic 4 Research Group Emerging Zoonoses, Robert

  2. Phylogeographic Pattern and Extensive Mitochondrial DNA Divergence Disclose a Species Complex within the

    E-print Network

    Solé-Cava, Antonio M.

    Guadalajara, Ciudad Guzma´n, Me´xico, 7 Center for Health Studies, Universidad del Valle de Guatemala, Guatemala City, Guatemala, 8 Laboratory of Applied Entomology and Parasitology, Facultad de Ciencias Qui´micas y Farmacia, Universidad de San Carlos de Guatemala, Ciudad de Guatemala, Guatemala, 9 Laboratorio de

  3. Schistosomiasis infection in relation to the ABO blood groups among school children in Zimbabwe

    Microsoft Academic Search

    J Ndamba; E Gomo; N Nyazema; N Makaza; K. C Kaondera

    1997-01-01

    The study aimed to establish if there was any relationship between the blood group of the human host and schistosomiasis prevalence, intensity, incidence and related organ pathology. Urine and stool specimens were collected from the 735 school children attending a rural school in Zimbabwe to determine the Schistosoma haematobium and S. mansoni infection status of the children. The parasitology results

  4. 503503503503503Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 92(4): 503-507, Jul./Aug. 1997 Immune Response to Trypanosoma cruzi Shed Acute Phase

    E-print Network

    surveyed for parasitological and serological diagnosis, as well as antibodies directed against SAPA using presenting positive serological diagnosis (IgG specific antibodies). The positive and negative predictive of the infection (positive IgM serology and/or positive buffy coat (BC) test) and in 81.4% of the patients

  5. THE West African Dwarf (WAD) goat is the indigenous breed in the humid and sub-humid zones of West Africa. It is of

    E-print Network

    Nottingham, University of

    -exploited, and continues to rely heavily on entrenched inefficient traditional methods of husbandry to meet the current this also applies to WAD sheep and goats, as similar studies have not been done in these animals. We report contortus B.B. FAKAE, S. N. CHIEJINA, Department of Veterinary Parasitology and Entomology, University

  6. Effects of the Trematode Uvulifer ambloplitis on Juvenile Bluegill Sunfish, Lepomis macrochirus: Ecological Implications

    E-print Network

    Wisenden, Brian D.

    Effects of the Trematode Uvulifer ambloplitis on Juvenile Bluegill Sunfish, Lepomis macrochirus the following article: Effects of the Trematode Uvulifer ambloplitis on Juvenile Bluegill Sunfish, Lepomis macrochirus: Ecological Implications A. Dennis Lemly; Gerald W. Esch The Journal of Parasitology, Vol. 70, No

  7. Entamoeba gingivalis

    NSDL National Science Digital Library

    Upton, Steve J.

    Kansas State University offers a few pictures and interesting tidbits on tooth amoebas, the toothbrush-fleeing microscopic parasites found where the teeth meet the gums. These photos and facts are part of a tutorial for Steve J. Upton's Animal Parasitology course at Kansas State University. Interestingly, 1% of all females with IUD's harbor uterine E. gingivalis.

  8. ARCTIC BIODIVERSITY: FROM DISCOVERY TO FAUNAL BASELINES-REVEALING THE HISTORY OF A DYNAMIC ECOSYSTEM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Knowledge of parasite biodiversity contributes to new and exciting approaches to understand the structure, history and future of the Arctic fauna. As a discovery- based process the Beringian Coevolution Project and activities under the umbrella of the Research Group for Arctic Parasitology serve as...

  9. 77 FR 66625 - Center for Scientific Review; Notice of Closed Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-06

    ...of Committee: Center for Scientific Review Special Emphasis Panel; AIDS-Associated Opportunistic Infections and Cancer Parasitology. Date: November 28, 2012. Time: 12:00 p.m. to 2:00 p.m. Agenda: To review and evaluate grant...

  10. Anti-cattle tick vaccines: Many candidate antigens, but will a commercially viable product emerge?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This is an invited paper from the editor-in-chief of International Journal for Parasitology who requested a Current Opinion manuscript to discuss the status of anti-cattle tick vaccine research. Arguably the world's most significant arthropod pest of cattle, control of the cattle tick, Rhipicephalus...

  11. Case Studies in Biology.

    ERIC Educational Resources Information Center

    Zeakes, Samuel J.

    1989-01-01

    A case study writing exercise used in a course on parasitology was found to be a powerful learning experience for students because it involved discipline-based technical writing and terminology, brought the students in as evaluators, applied current learning, caused interaction among all students, and simulated real professional activities. (MSE)

  12. Genetic engineering

    SciTech Connect

    Rigby, P.

    1988-01-01

    This series reviews new developments in recombinant DNA technology and its applications. Each volume consists of 3 - 4 mini-reviews. Volume 7 contains two articles on aspects of molecular parasitology and one review on gene expression in animal cells of biotechnological interest.

  13. Information on Vinchucas and Chagas disease.

    NASA Astrophysics Data System (ADS)

    Schenone, H.

    1981-12-01

    Following a significant increase in the number of vinchucas observed at La Silla during the last summer, the Director-General of ESO asked Prof. Hugo Schenone, Director of the Department of Microbiology and Parasitology of the University of Chile to pay a visit to La Silla to investigate the situation. The following gives a summary of the resulting report.

  14. CanadaPostCorporation PublicationsMailAgreement

    E-print Network

    Shoubridge, Eric

    's Desk 3 International Polar Year: Tracking the Impacts of Global Warming 4 Research in a Changing International Polar Year: Tracking the impacts of global warming in the North #12;FACULTY OF AGRICULTURAL change, parasitology, biofuels and bioproducts, and nutrition and health. I thank you for supporting

  15. This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research

    E-print Network

    /CNRS (UMR 2724), F-34394 Montpellier, France d Laboratory of Medicinal Chemistry, Rega InstituteThis article appeared in a journal published by Elsevier. The attached copy is furnished-Claude Dujardina a Department of Parasitology, Institute of Tropical Medicine Antwerp, 2000 Antwerp, Belgium b

  16. Attractor Metabolic Networks Ildefonso M. De la Fuente1,2,3

    E-print Network

    Cortes, Jesus

    , Juan Veguillas1 1 Quantitative Biomedicine Unit, BioCruces Health Research Institute, Barakaldo, Basque Country, Spain, 2 Institute of Parasitology and Biomedicine ``Lo´pez Neyra'', CSIC, Granada, Spain, 3 oscillatory and quasi-stationary catalytic patterns simultaneously emerge. The network adjusts the internal

  17. An epizootic of common loons in coastal waters of North Carolina: Concentrations of elemental contaminants and results of necropsies

    Microsoft Academic Search

    Tom Augspurger; J. C. Franson; Kathryn A. Converse; Paul R. Spitzer; Erica A. Miller

    1998-01-01

    A 1993 die-off of common loons (Gavia immer) in the coastal waters of North Carolina was investigated with emphasis on comparing mercury, selenium, arsenic, and lead between birds from the epizootic and reference specimens. Die-off specimens were emaciated but contained no ingested foreign bodies and no lesions suggestive of infectious disease. Results of bacteriology, virology, parasitology, and botulism testing were

  18. Investigations in the problem of diarrhoea in the Melut district, South Sudan (1981-1982).

    PubMed

    Sixl, W; Sixl-Voigt, B; Stünzner, D; Arbesser, C; Reinthaler, F; Mascher, F; Rosegger, H; Schneeweiss, W; Schuhmann, G

    1987-01-01

    Studies of diseases associated with diarrhoea in the Melut district of South Sudan in the years 1981-1982 showed amoebic dysentery and Rota-virus to be predominate, whereby according to our previous results Yersinia, Campylobacter, Shigella and Salmonella infections also play a role. In addition other parasitological bacterial and viral-infections are presumed. PMID:3443749

  19. Relationships between helminth communities and host traits in Podarcis bocagei and Podarcis carbonelli from NW Portugal

    Microsoft Academic Search

    Vicente Roca; Miguel Angel Carretero; Ana Marques; Diana Barbosa; María Angeles Galdón

    2006-01-01

    A parasitological survey was carried out to determine the relationships between helminth fauna and some biological traits of two host species of lacertid lizards. Size, sex, diet, and season of collection, as well as infracommunities and component communities of Podarcis bocagei and P. carbonelli from Douro litoral (northwest Portugal), have been analysed. In both host species, we found low values

  20. [Seasonal dynamics of the parasite fauna and of the component community structure of parasites of the minnow Phoxinus phoxinus (L.) from the Pechora River. 3].

    PubMed

    Dorovskikh, G N; Stepanov, V G

    2014-01-01

    During January May, 2007, 105 specimens of minnow of the 2+ -- 3+ age were col- lected from the Pechora River in the central homestead of the Pechora-Ilechsky Natural Reserve, and studied using the standard technique of the general parasitological dissection. It was concluded that in a period of studies the component parasite community was in a formation process. PMID:25434238

  1. UNIVERSITY OF SOUTH BOHEMIA IN CESK BUDJOVICE FACULTY OF SCIENCE

    E-print Network

    South Bohemia, University of

    31.10.2011 Zoology 31.10.2011 Parasitology 31.10.2011 Molecular and Cell Biology and Genetics 10 at other faculties, student assessment records) (original plus 2 copies) #12;2 · a list of published number of publications and citation responses and to exceed the required numbers detailed in the table

  2. [Cyclospora cayetanensis - the rare causal agent of diarrhoeal diseases].

    PubMed

    Jelínková, Alena; Kaši?ková, Denisa; Valkoun, Antonín

    2011-06-01

    Cyclospora cayetanensis a casual agent of diarrhoeal diseases, was detected in 6 out of 3 097 patients between February 2009 and March 2010 using standard parasitological methods. Five cases were imported from the endemic countries. One patient was the first case with no travel history in the Czech Republic. PMID:21780026

  3. Integrate Study of a Bolivian Population Infected by Trypanosoma cruzi, the Agent of Chagas Disease

    Microsoft Academic Search

    Simone Frédérique Brenière; Marie France Bosseno; François Noireau; Nina Yacsik; Pascale Liegeard; Christine Aznar; Mireille Hontebeyrie

    2002-01-01

    A cross section of a human population (501 individuals) selected at random, and living in a Bolivian community, highly endemic for Chagas disease, was investigated combining together clinical, parasitological and molecular approaches. Conventional serology and polymerase chain reaction (PCR) indicated an active transmission of the infection, a high seroprevalence (43.3%) ranging from around 12% in < 5 years to 94.7%

  4. A disease complex associated with pigeon circovirus infection, young pigeon disease syndrome

    Microsoft Academic Search

    Rüdiger Raue; Volker Schmidt; Markus Freick; Brinja Reinhardt; Reimar Johne; Ludger Kamphausen; Erhard F. Kaleta; Hermann Müller; Maria-Elisabeth Krautwald-Junghanns

    2005-01-01

    In order to collect more convincing data on the aetiological agent of young pigeon disease syndrome (YPDS), a comprehensive study was performed on pigeons in German lofts with or without outbreaks of YPDS. The investigations included examination of histories, clinical signs and pathology, as well as parasitological and microbiological analysis. Pigeons in their 4th to 12th week of life exhibited

  5. Antibacterial Effect of Some Plant Extracts on Selected Enterobacteriaceae

    Microsoft Academic Search

    I. O. Sule; T. O. Agbabiaka

    2008-01-01

    Vernonia amygdalina (Bitterleaf), Eucalyptus citriodora (Eucalypt) and Phyllanthus amarus (Schum) were investigated for their antibacterial properties against pure cultures of clinical isolates of Escherichia coli, Klebsiella sp., Salmonella sp. and Shigella sp. The isolates were obtained from dept of Medical Microbiology and Parasitology of the University of Ilorin Teaching Hospital. Water and Ethanol were used in the crude extractions of

  6. Evaluation of excretory/secretory Fasciola (Fhes) antigen in diagnosis of human fascioliasis.

    PubMed

    Haseeb, Ahmad N; el-Shazly, Atef M; Arafa, Magdy A S; Morsy, Ayman T A

    2003-04-01

    No doubt, human fascioliasis is an increasing worldwide zoonotic liver fluke. Clinically, human fascioliasis has to be differentially diagnosed from many hepatic diseases as acute & chronic hepatitis, schistosomiasis mansoni, visceral toxocariasis, visceral leishmaniasis, hepatic amoebiasis, biliary tract diseases and others. The parasitological diagnosis based on the demonstration of the eggs in stool, duodenal contents or bile is usually unsatisfactory due to false passage of eggs, ectopic fascioliasis, and failure of immature worm to maturation. So, ELISA-Fhes antigen (Fasciola hepatica excretory/secretory) and IHAT were evaluated in the immunodiagnosis of parasitologically proven cases of human fascioliasis compared with proven cases of human schistosomiasis mansoni and parasite-free individuals. ELISA-Fhes gave 100% sensitivity and 100% specificity. On the other hand, IHAT was less sensitive and less specific. PMID:12739806

  7. Impact of Benznidazole on Infection Course in Mice Experimentally Infected with Trypanosoma cruzi I, II, and IV.

    PubMed

    Gruendling, Ana Paula; Massago, Miyoko; Teston, Ana Paula M; Monteiro, Wuelton M; Kaneshima, Edilson N; Araújo, Silvana M; Gomes, Mônica L; Barbosa, Maria das Graças V; Toledo, Max Jean O

    2015-06-01

    American trypanosomiasis is an emerging zoonosis in the Brazilian Amazon. Studies on benznidazole (BZ) chemotherapy with Trypanosoma cruzi from this region have great relevance, given the different discrete typing units (DTUs) that infect humans in the Amazon and other regions of Brazil. We performed a parasitological, histopathological, and molecular analysis of mice inoculated with strains of T. cruzi I, II, and IV that were BZ-treated during the acute phase of infection. Groups of Swiss mice were inoculated; 13 received oral BZ, whereas the other 13 comprised the untreated controls. Unlike parasitemia, the infectivity and mortality did not vary among the DTUs. Trypanosoma cruzi DNA was detected in all tissues analyzed and the proportion of organs parasitized varied with the parasite DTU. The BZ treatment reduced the most parasitological parameters, tissue parasitism and the inflammatory processes at all infection stages and for all DTUs. However, the number of significant reductions varied according to the DTU and infection phase. PMID:25940197

  8. Sandwich enzyme-linked immunosorbent assay for detection of excretory secretory antigens in humans with fascioliasis.

    PubMed Central

    Espino, A M; Finlay, C M

    1994-01-01

    A sandwich enzyme-linked immunosorbent assay has been developed for the detection of Fasciola hepatica excretory secretory (ES) antigens in stool specimens of infected humans. The assay uses antibodies against F. hepatica ES antigens. A monoclonal antibody (ES78, mouse immunoglobulin G2a) was used to capture ES antigens, and a rabbit polyclonal antibody, peroxidase conjugate, was used to identify ES antigens. Thirteen of 14 patients with parasitological evidence of fascioliasis had a detectable concentration of ES antigens (more than 15 ng/ml). None of the stool specimens from controls and from patients with parasites other than F. hepatica showed a positive reaction, suggesting the absence of cross-reactions in this assay. When the 14 patients were retested 2 months after treatment, all of the specimens from the 11 parasitologically cured patients were negative by the antigen detection assay while the specimens from the 3 patients with persisting F. hepatica eggs in their stools remained positive. PMID:8126178

  9. Current clinical efficacy of chloroquine for the treatment of Plasmodium falciparum infections in urban Dar es Salaam, United Republic of Tanzania.

    PubMed Central

    Premji, Z.; Makwaya, C.; Minjas, J. N.

    1999-01-01

    Reported is the use of a 14-day WHO protocol, which takes into account the clinical, parasitological and haematological responses to antimalarial drugs, to determine the efficacy of chloroquine in the treatment of uncomplicated malaria in young children (n = 200) in urban Dar es Salaam. Chloroquine failure was found in 43% of the children. Of these, 12.5% were considered to be early treatment failures and were given a single dose of sulfadoxine-pyrimethamine. Fever subsided in all children treated with sulfadoxine-pyrimethamine and there were no parasitological failures. In addition, children treated with sulfadoxine-pyrimethamine because of early treatment failure with chloroquine had better haematological recovery than the chloroquine-sensitive group. It is concluded that chloroquine can no longer be considered an effective therapy for P. falciparum malaria in young children in Dar es Salaam. PMID:10534897

  10. [Sulfonamide and toltrazuril therapy of experimental turkey coccidiosis].

    PubMed

    Greuel, E; Mundt, H C; Cortez, S

    1991-04-01

    Following experimental infection of caged turkeys with a mixed oocyst suspension of E. meleagrimitis, E. adenoeides and E. gallopavonis, the efficacy of sulfachlorpyrazine, sulfaquinoxaline + pyrimethamine, sulfaquinoxaline + diaveridine, and toltrazuril was investigated based on clinical and parasitological parameters. Infected turkeys developed severe clinical symptoms. Only weak symptoms were observed in those groups which were treated with the sulfa- and sulfa-DHFR-inhibitors. The toltrazuril-treated group remained free of clinical symptoms. At the 8th day after infection, the clinical lesions coincided with the intensity of the gut lesions together with parasitological findings based on microscopical examination of mucosal smears. The same coincidence was observed for parameters such as oocyst excretion and body weight development. PMID:2065608

  11. Counter-insurgents of the blue revolution? Parasites and diseases affecting aquaculture and science.

    PubMed

    Blaylock, Reginald B; Bullard, Stephen A

    2014-12-01

    Aquaculture is the fastest-growing segment of food production and is expected to supply a growing portion of animal protein for consumption by humans. Because industrial aquaculture developed only recently compared to industrial agriculture, its development occurred within the context of a growing environmental awareness and acknowledgment of environmental issues associated with industrial farming. As such, parasites and diseases have become central criticisms of commercial aquaculture. This focus on parasites and diseases, however, has created a nexus of opportunities for research that has facilitated considerable scientific advances in the fields of parasitology and aquaculture. This paper reviews Myxobolus cerebralis , Lepeophtheirus salmonis , white spot syndrome virus, and assorted flatworms as select marquee aquaculture pathogens, summarizes the status of the diseases caused by each and their impacts on aquaculture, and highlights some of the significant contributions these pathogens have made to the science of parasitology and aquaculture. PMID:25260074

  12. Occurrence of cymothoid isopod from Miri, East Malaysian marine fishes.

    PubMed

    Anand Kumar, A; Rameshkumar, Ganapathy; Ravichandran, Samuthirapandian; Priya, E Rethna; Nagarajan, Ramasamy; Leng, Alex Goh Kwang

    2015-06-01

    To identify the isopod parasite, which has been recorded from Miri, East Malaysian marine fishes. During the present study, four cymothoid isopods are reported three genera, including Cymothoa eremita, Lobothorax typus, Nerocila longispina and Nerocila loveni. Nerocila longispina and N. loveni are also previously reported from Malaysia and two additional cymothoids C. eremita and L. typus are reported for the first record of Miri coast, East Malaysia. New hosts were identified for N. loveni on Chirocentrus dorab for the first time in the world fauna. The Parasitological indexes were calculated. The site of attachment of the parasites on their hosts was also observed. These parasites can cause the damage in gill, eye and internal organ including swim bladder. Marine fish parasitology is a rapidly developing field of aquatic science. PMID:26064001

  13. Comparative therapeutic effect of moxidectin, doramectin and ivermectin on psoroptes mites infestation in buffalo ( Bubalus bubalis )

    Microsoft Academic Search

    Sabry A. El-Khodery; Mitsu Ishii; Salama A. Osman; Magdy H. Al-Gaabary

    2009-01-01

    The aim of the present study was to carry out comparative therapeutic effect of moxidectin pour on, doramectin and ivermectin\\u000a on psoroptes infestation in buffalo. A total of 318 buffalo in 77 small scale herds suspected to have mange mites were examined\\u000a clinically and parasitologically. Fifty-three (16.66%) buffalo in 25 herds were recorded to be infested; 51 (16.35%) with\\u000a psoroptic

  14. Electron and Video-Light Microscopy Analysis of the in Vitro Effects of Pyrantel Pamoate on Giardia lamblia

    Microsoft Academic Search

    Loraine Campanati; Ana Paula Rocha Gadelha; Luiz Henrique Monteiro-Leal

    2001-01-01

    Campanati, L., Gadelha, A. P. R., and Monteiro-Leal, L. H. 2001. Electron and video-light microscopy analysis of the in vitro effects of pyrantel pamoate on Giardia lamblia. Experimental Parasitology97, 9–14. Giardia infection is predominant in the small intestine of vertebrates, where the trophozoites attach to epithelial cells and adversely affect the microvilli and other epithelial cell structures. Giardiasis, the disease

  15. Bovine babesiosis in Guyana: a comparison of the indirect fluorescent antibody (IFA) and complement-fixation (CF) tests in determining the prevalence of Babesia bigemina and Babesia bovis infections 

    E-print Network

    Applewhaite, Lennox Mortimer

    1979-01-01

    BOVINE BABESIOSIS IN GUYANA: A COMPARISON OF THE INDIREC T FLUORESCENT ANTIBODY (IFA) AND COMPLEMENT-FIXATION (CF) TESTS IN DETERMINING THE PREVALENCF. OF BABESIA BIGEMINA AND BABESIA BOVIS INFECTIONS A Thesis by LENNOX MORTIMER APPLEWHAITE... Submitted to the Graduate College of' Texas ASSAM University in partial fulfillment of the reouirement f' or the degree oi MASTER OF SCIENCE August 1979 Major Subject: Veterinary Parasitology BCV NE BABESICSIS IN GUYANA: A COMPARISON OF THE INDIRECT...

  16. Heterologous antagonistic and synergistic interactions between helminths and between helminths and protozoans in concurrent experimental infection of mammalian hosts

    Microsoft Academic Search

    N. Ø. Christensen; P. Nansen; B. O. Fagbemi; J. Monrad

    1987-01-01

    Experimental concurrent infection with two or more parasite species in mammalian host models may result in heterologous antagonistic and synergistic interactions ranging in magnitude from reduced\\/enhanced growth and fecundity to blockage\\/enhancement of establishment\\/expulsion. With some exceptions only, there is a reasonable correlation between the levels of interaction monitored by parasitological and by clinico-pathological parameters. Heterologous antagonistic interactions mediated by functional

  17. Schistosoma mansoni: Adhesion of Mannan-Binding Lectin to Surface Glycoproteins of Cercariae and Adult Worms

    Microsoft Academic Search

    Jens Klabunde; Jürgen Berger; Jens C. Jensenius; Mo-Quen Klinkert; Ulrike E. Zelck; Peter G. Kremsner; Jürgen F. J. Kun

    2000-01-01

    Klabunde, J., Berger, J., Jensenius, J. C., Klinkert, M.-Q., Zelck, U. E., Kremsner, P. G., Kun J. F. J. 2000, Schistosoma mansoni: Adhesion of mannan-binding lectin to surface glycoprotein of cercariae and adult worms. Experimental Parasitology95, 231–239. Schistosoma mansoni is a blood-dwelling trematode which can persist for several years in the vessels of the human host. The schistosomal surface has

  18. First record of trypanosomes from the blood of sculpins (Cottus ricei and C. cognatus) from Lake Superior, WI, USA

    USGS Publications Warehouse

    Pronina, Svetlana V.; Pronin, Nikolai M.; Selgeby, Jim H.

    1999-01-01

    During parasitological research of fishes in Lake Superior (USA) in August-September 1994, infection with trypanosomes of the blood of sculpins (Cottus ricei and C. cognatus) was recorded for the first time. The descriptions of three morphological groups of the genus Trypanosoma: T. sp. I, found in blood of C. ricei, T. sp. II and T. sp. III from blood of C. cognatus, have been provided.

  19. Clinical evaluation of American river otters in a reintroduction study.

    PubMed

    Hoover, J P; Root, C R; Zimmer, M A

    1984-12-01

    Ten American river otters (Lutra canadensis) were evaluated clinically before release into Oklahoma waterways. Otters were immobilized for physical, radiographic, and electrocardiographic examinations and for collection of blood samples. Hematologic and serum biochemical analyses, urinalyses, parasitologic examinations, surgical omental biopsies, and necropsy findings were included. Respiratory tract disease, bacterial and parasitic infections, and starvation apparently were contributing causes of postrelease mortality in 4 of the otters. PMID:6511575

  20. Attenuation of Schistosoma mansoni cercarial infectivity to albino mice by methanol extract of some plant species

    Microsoft Academic Search

    E. G. Kamel; M. A. El-Emam; S. S. M. Mahmoud; F. M. Fouda; F. E. Bayaumy

    2010-01-01

    This study elucidates the activity of certain plants’ methanol extract: Anagallis arvensis, Solanum nigrum (green fruits), Chenopodium ambrosioides, Calendula officinalis and Sesbania sesban, on the infectivity of S. mansoni cercariae to albino mice. Then, some parasitological parameters, e.g. the worm load\\/mouse, number of ova\\/g tissue in liver and intestine and the developmental stages of ova in the small intestinal wall

  1. Infectivity of promastigotes and amastigotes of Leishmania infantum in a canine model for leishmaniosis

    Microsoft Academic Search

    L Campino; G Santos-Gomes; M. J Riça Capela; S Cortes; P Abranches

    2000-01-01

    Seven dogs experimentally infected with amastigotes or culture promastigotes of Leishmaniainfantum MON-1 were observed for a period of up to 38 months. The course of infection was monitored by clinical and parasitological examinations, haematological and serum protein analysis, and by anti-leishmania antibody levels. Two of the three amastigote-inoculated dogs developed a symptomatic infection with haematological and protein alterations, and a

  2. Four Folks 

    E-print Network

    Unknown

    2011-09-05

    EFFICACY OF ORGANOPHOSPHORUS COMPOUNDS IN THE TREATMENT OF DEMODECTIC MANGE IN DOGS A Thesis By MD. MOZZAMMEL HUQ Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE January 1967 Major Subject: Animal Parasitology EFFICACY OF ORGANOPHOSPHORUS COMPOUNDS IN THE TREATMENT OF DEMODECTIC MANGE IN DOGS A Thesis By MD. MOZZAMMEL HUQ Approved as to style and content by: (Chairm n of Committee...

  3. Treatment of Acute Uncomplicated Falciparum Malaria with Artemether-Lumefantrine in Non-immune Populations: A Safety, Efficacy, and Pharmacokinetic Study

    Microsoft Academic Search

    Christoph Hatz; Jaime Soto; Hans Dieter Nothdurft; Thomas Zoller; Thomas Weitzel; Louis Loutan; Francois Bricaire; Frederick Gay; Gerd-Dieter Burchard; Kim Andriano; Gilbert Lefèvre; Patricia Ibarra De Palacios; Blaise Genton

    2008-01-01

    The efficacy and safety of artemether-lumefantrine for the treatment of malaria in non-immune popula- tions are not well defined. In this study, 165 non-immune patients from Europe and non-malarious areas of Colombia with acute, uncomplicated falciparum malaria or mixed infection including P. falciparum were treated with the six-dose regimen of artemether-lumefantrine. The parasitologic cure rate at 28 days was 96.0%

  4. Effi cacy and safety of artemether-lumefantrine dispersible tablets compared with crushed commercial tablets in African infants and children with uncomplicated malaria: a randomised, single-blind, multicentre trial

    Microsoft Academic Search

    Salim Abdulla; Issaka Sagara; Umberto D'Alessandro; Raquel González; Mary Hamel; Bernhards Ogutu; Andreas Mårtensson; John Lyimo; Hamma Maiga; Philip Sasi; Alain Nahum; Elizabeth Juma; Lucas Otieno; Anders Björkman; Hans Peter; Kim Andriano; Marc Cousin; Gilbert Lefèvre; David Ubben

    Methods We did a randomised non-inferiority study on children weighing 5-35 kg with uncomplicated P falciparum malaria in Benin, Kenya, Mali, M ozambique, and Tanzania. The primary outcome measure was PCR-corrected 28-day parasitological cure rate. We aimed to show non-inferiority (with a margin of -5%) of dispersible versus crushed tablet. We constructed an asymptotic one-sided 97·5% CI on the diff

  5. Diagnosis, imaging, and treatment of an unusual cardiac hydatid cyst.

    PubMed

    Fertin, Marie; Mouquet, Frédéric; Lallemant, Robert; Gaxotte, Virginia; Decoene, Christophe; Larrue, Benoît; Dutoit, Emmanuel; deGroote, Pascal; Fayad, Georges

    2006-01-01

    Echinococcosis is endemic in sheep- and cattle-raising areas in Europe, especially in Southern and Central Europe. In France, most cases originated from immigrants from countries where echinococcosis is endemic. Extremely rare native cases have been reported during the last few years in France, especially those concerning isolated cardiac hydatid cyst. In this case report, we propose a complete imaging description of the features of a typical cardiac hydatid cyst from cardiac MRI, complete with surgery, parasitology, and anatomopathology images. PMID:17113016

  6. Cytokine expression during the outcome of canine experimental infection by Leishmania infantum

    Microsoft Academic Search

    Gabriela M Santos-Gomes; Ricardo Rosa; Clara Leandro; Sofia Cortes; Pedro Romão; Henrique Silveira

    2002-01-01

    In this study, the cytokines, interferon-gamma (IFN-?), interleukin-2 (IL-2), IL-12 p40, IL-6 and IL-10, expressed by peripheral blood mononuclear cells of 13 beagle dogs inoculated with Leishmania infantum amastigotes, were analysed during a period of up to 23 months. The course of infection was monitored through clinical and parasitological examinations, haematological alterations and serum antileishmania antibody levels. Dogs developed symptomatic

  7. Baby Elephant at Vet School 

    E-print Network

    Unknown

    2011-08-17

    akimovae) in sheep: Relationship between wool fiber diameter and changes in feed conversion ef. ficiency. Am. J. Vet. Res. , 38: 887-88. Boughton, D. C. and Davis, L. R. , 1943. An experiment with sulfaguanidine in the treatment o acquired bovine..., T. M. , Personal communication, 1978. Dpt. Vet. Parasitology, Texas A & M University, College Sta- tion, Texas 77840. Davis, L. R. , Boughton, D. C. and Bowman, G. W. , 1955 Biology and pathogenicity of Eimeria alabamensis Deem, Am. J. Vet. Res...

  8. Bionomics of malaria vectors in two physiographically different areas of the epidemic-prone Thar Desert, north-western Rajasthan (India)

    Microsoft Academic Search

    B. K Tyagi; S. P Yadav

    2001-01-01

    Entomological and parasitological investigations were carried out on malaria vectors and disease prevalence in two sets of villages, the highly irrigated Indira Gandhi Nahar Pariyojana (IGNP) command-area villages (Madassar and Awai), and the truly desertic non-command (unirrigated) area villages (Kanasar and Khetusar), located in different ecological conditions in the Thar Desert, north-western Rajasthan (India). Malaria prevalence, as determined through sustained

  9. Trypanosoma cruzi: Roles for Perforin-Dependent and Perforin-Independent Immune Mechanisms in Acute Resistance

    Microsoft Academic Search

    Steven P. Nickell; Divya Sharma

    2000-01-01

    Nickell, S. P., and Sharma, D. 2000. Trypanosoma cruzi: Roles for perforin-dependent and perforin-independent immune mechanisms in acute resistance. Experimental Parasitology94, 207–216. CD8+ T cells have been shown to be required for acute resistance to infection with the protozoan parasite, Trypanosoma cruzi, the causative agent of Chagas' disease. However, to date, the mechanism by which CD8+ T cells mediate protection

  10. Rouleaux-Forming Serum Proteins Are Involved in the Rosetting of Plasmodium falciparum-Infected Erythrocytes

    Microsoft Academic Search

    Carl Johan Treutiger; Carin Scholander; Johan Carlson; Keith P. McAdam; John G. Raynes; Lars Falksveden; Mats Wahlgren

    1999-01-01

    Treutiger, C. J., Scholander, C., Carlson, J., McAdam, K. P., Raynes, J. G., Falksveden, L., and Wahlgren, M. 1999. Rouleaux-forming serum proteins are involved in the rosetting of Plasmodium falciparum-infected erythrocytes. Experimental Parasitology93, 215–224. Excessive sequestration of Plasmodium falciparum-infected (pRBC) and uninfected erythrocytes (RBC) in the microvasculature, cytoadherence, and rosetting, have been suggested to be correlated with the development of

  11. A Novel Inhibitor of Factor X Activation from the Salivary Glands of the Bed Bug Cimex lectularius

    Microsoft Academic Search

    Jesus G. Valenzuela; Jorge A. Guimaraes; José M. C. Ribeiro

    1996-01-01

    Valenzuela, J. G., Guimaraes, J. A., and Ribeiro, J. M. C. 1996. A novel inhibitor of factor X activation from the salivary glands of the bed bugCimex lectularius. Experimental Parasitology83,184–190.Cimex lectulariussalivary gland homogenate delayed the recalcification time of human citrated plasma. Separation of the salivary gland homogenate by molecular sieving HPLC chromatography resulted in a single major peak of anticlotting

  12. In utero Treatment of Toxoplasmic Fetopathy with the Combination Pyrimethamine-Sulfadiazine

    Microsoft Academic Search

    J. Couvreur; Ph. Thulliez; F. Daffos; Ch. Aufrant; Y. Bompard; A. Gesquière; G. Desmonts

    1993-01-01

    The mothers of 52 fetuses with toxoplasma fetopathy diagnosed in utero were treated with a combination pyrimethamine-sulfa drug and spiramycine. Their infants were compared to a group of 51 infants whose mothers had received spiramycine alone. Postnatal treatment was identical in both groups. Parasitological investigation of the placenta was positive in 42 and 76.6%; the newborns had a specific IgM

  13. Causal agents of bovine theileriosis in southern Africa

    Microsoft Academic Search

    G. Uilenberg; N. M. Perié; J. A. Lawrence; A. J. DE VOS; R. W. Paling; A. A. M. Spanjer

    1982-01-01

    One pathogenic and 4 mild bovineTheileria strains from southern Africa, all transmitted byRhipicephalus appendiculatus, were compared amongst themselves as well as to bovine and buffalo strains of theT. parva complex from eastern and southern Africa and to bovine strains ofT. taurotragi from Tanzania considered to be derived from eland antelope. Criteria used were parasitological, clinical, serological and cross-immunity characters.

  14. Clinical, haematological and therapeutic studies on tropical theileriosis in water buffaloes ( Bubalus bubalis) in Egypt

    Microsoft Academic Search

    Salama A. Osman; Magdy H. Al-Gaabary

    2007-01-01

    Thirty buffaloes naturally infected with Theileria annulata and 10 parasitologically free controls were used to determine the potential clinical, haematological and therapeutic impact of tropical theileriosis in Egypt. The clinical signs in the infected buffaloes were pyrexia (40.5–41.5°C), enlargement of superficial lymph nodes, slight nasal and ocular discharges, salivation, anaemia and respiratory distress. Eye lesions also were recorded. There was

  15. [First record of species Dicranotaenia synsacculata Macko, 1988 (Cestoda, Hymenolepididae) of the goldeneye Bucephala clangula (Linneus, 1758) in Poland].

    PubMed

    Królaczyk, Katarzyna; Kavetska, Katarzyna M; Kornyushyn, Vadym V

    2010-01-01

    During parasitological studies of 32 specimens of the goldeneye Bucephala clangula L., twenty seven cestode specimens were found. Four of them, isolated from the jejunum of two young female hosts, were determinated as Dicranotaenia synsacculata Macko, 1988. We based on the shape of cirrus fused with sacculus accessorius internus, shape and size of scolex and other organs. This is the first record of this species in Poland. PMID:21179669

  16. Climate, Cattle Rearing Systems and African Animal Trypanosomosis Risk in Burkina Faso

    PubMed Central

    Pagabeleguem, Soumaïla; Sangaré, Mamadou; Bengaly, Zakaria; Akoudjin, Massouroudin; Belem, Adrien M. G.; Bouyer, Jérémy

    2012-01-01

    Background In sub-Saharan countries infested by tsetse flies, African Animal Trypanosomosis (AAT) is considered as the main pathological constraint to cattle breeding. Africa has known a strong climatic change and its population was multiplied by four during the last half-century. The aim of this study was to characterize the impact of production practices and climate on tsetse occurrence and abundance, and the associated prevalence of AAT in Burkina Faso. Methodology/Principal Findings Four sites were selected along a South-north transect of increasing aridity. The study combines parasitological and entomological surveys. For the parasitological aspect, blood samples were collected from 1,041 cattle selected through a stratified sampling procedure including location and livestock management system (long transhumance, short transhumance, sedentary). Parasitological and serological prevalence specific to livestock management systems show a gradual increase from the Sahelian to the Sudano-Guinean area (P<0.05). Livestock management system had also a significant impact on parasitological prevalence (P<0.05). Tsetse diversity, apparent densities and their infection rates overall decreased with aridity, from four species, an apparent density of 53.1 flies/trap/day and an infection rate of 13.7% to an absence at the northern edge of the transect, where the density and diversity of other biting flies were on the contrary highest (p<0.001). Conclusions/Significance The climatic pressure clearly had a negative impact on tsetse abundance and AAT risk. However, the persistency of tsetse habitats along the Mouhoun river loop maintains a high risk of cyclical transmission of T. vivax. Moreover, an “epidemic mechanical livestock trypanosomosis” cycle is likely to occur in the northern site, where trypanosomes are brought in by cattle transhuming from the tsetse infested area and are locally transmitted by mechanical vectors. In Burkina Faso, the impact of tsetse thus extends to a buffer area around their distribution belt, corresponding to the herd transhumance radius. PMID:23166765

  17. Supplement 7, Authors: A To Z

    E-print Network

    Doss, Mildred A.; Humphrey, Judith H.; Segal, Dorothy B.

    1957-01-01

    Hospital de Mujeres y Maternidad del Callao. Callao, Peru. 1792 UNITED STATES DEPARTMENT OF AGRICULTURE Bol. Biol., La Plata.?Bolet?n Biologico. Publi-caci?n del Personal T?cnico del Instituto de Microbiologia, Micologia y Parasitolog?a de la Facultad de... Wissenschaftlichen Un- tersuchung des Schweizerischen Nationalparks. Herausgegeben von der Kommission der Schweizerischen Naturforschenden Gesellschaft zur Wissenschaftlichen Erforschung des Na- tionalparks. R?sultats des Recherches Scienti-fiques Entreprises au...

  18. The prehistoric diet and subsistence of the lower Pecos region, as reflected in coprolites from Baker Cave, Val Verde County, Texas 

    E-print Network

    Sobolik, Kristin Dee

    1988-01-01

    parasitological study and a nutritional analysis of the contents of the coprolites. Based upon the coprolites Baker Cave inhabitants were documented to be using mainly prickly pear cactus, onion iv bulbs and fiber, fish, and rodents in their diets...) a d the oaks (O e c s) are representatives of the oak-cedar zone (Smith and Butterwick 1975; Chadderdon 1983). Other plants observed in the area today include evergreen sumac ( Rhus), Texas ountaln laurel (S~ohoral. prickly pear cactus (0~ski...

  19. [Human dirofilariasis in the Tula region].

    PubMed

    Derzhavina, T Iu; Mertesheva, M A; Chernysheva, A A; Chernikova, E A

    2010-01-01

    The paper describes cases of dirofilariasis in the residents of Tula and the Tula Region. One of the cases does not fit into the traditional concepts. On excising a tumor in an adolescent, two live actively moving nonencapsulated helminths: a male and a female Dirofilaria repens worms were removed, which were identified at the parasitology laboratory, Center of Hygiene and Epidemiology in the Tula Region. PMID:20361637

  20. [Parasite fauna of the burbot Lota lota L. in body of water of the Kol'ski? peninsula].

    PubMed

    Mitenev, V K; Shul'man, B S

    2006-01-01

    The results of a parasitological study of the burbot Lota Iota L. inhabiting the Kola region are presented. 51 species of parasite were found on burbot in 16 waterbodies belonging to the White Sea and Barents Sea basins (Muxosporea - 7, Suctoria - 1, Peritricha - 6, Monogenea - 1, Cestoda - 6, Trematoda - 13, Nematoda - 6, Acanthocephala - 5, Hirudinea - 3, Bivalvia - 1 and Crustacea - 2 species). Data on the infestation of burbot by different parasite species and their prevalence in investigated waterbodies were obtained. PMID:16913298

  1. MALARIA PREVALENCE AND ASSOCIATED RISK FACTORS IN ERITREA

    Microsoft Academic Search

    DAVID M. SINTASATH; TEWOLDE GHEBREMESKEL; MATTHEW LYNCH; ECKHARD KLEINAU; GUSTAVO BRETAS; JOSEPHAT SHILILU; EUGENE BRANTLY; PATRICIA M. GRAVES; JOHN C. BEIER

    2005-01-01

    A parasitological cross-sectional survey was undertaken from September 2000 through February 2001 to estimate the prevalence of malaria parasitemia in Eritrea. A total of 12,937 individuals from 176 villages were screened for both Plasmodium falciparum and Plasmodium vivax parasite species using the OptiMal Rapid Diagnostic Test. Malaria prevalence was generally low but highly focal and variable with the proportion of

  2. Supplement 24, Part 6, Parasite-Subject Catalogue, Treatment

    E-print Network

    Edwards, Shirley J.; Hood, Martha W.; Shaw, Judith H.; Rayburn, Jane D.; Kirby, Margie D.; Hanfman, Deborah T.; Zidar, Judith A.

    1982-01-01

    + Niridazole Wang G et al 1979 Yao Hsueh Hsueh Pao (Acta Pharm Sinica) 14 (6) June 379-384 Wm schistosomiasis, dogs, rhesus monkeys, thera- peutic trials testing agrimophol combined with niridazole Aklomide + Sulfanitran (= Novastat) McLoughlin DK; Chute..., resolution of verminous arterial lesions, and toxicity as influenced by dosage; non-parametric analy- sis applied to radiographic, pathologic and parasitologic observations and data Albendazole Green PE et al 1981 Austral Vet J 57 (2) Feb 79-84 Wa...

  3. The Ceratopogonid Web Page

    NSDL National Science Digital Library

    Dr. Daniel Hagan of the Institute of Anthropology & Parasitology (Georgia Southern University) maintains this Webpage on the Dipteran family Ceratopogonidae. Known to the layperson as "nuisance pests," the Ceratopogonidae include such favorites as biting midges, bloodsucking midges, and sand flies. The homepage offers a wealth of information organized into several extensive bibliographies, checklists, and catalogs; the biannual Ceratopogonidae Information Exchange (CIE) Newsletter; a Directory of Ceratopogonid Researchers; and a collection of WWW links.

  4. Fleas (Siphonaptera)

    NSDL National Science Digital Library

    This large resource, by parasitology researchers at the Zoological Institute of the Russian Academy of Sciences, represents two decades of research on fleas (order Siphonaptera). The site covers (in varied detail) biology, morphology, taxonomy, hosts, distribution, and references/ links (paper and online). Also at the site is a database providing geographic distribution information by taxon (several options). A collection of spectacular scanning microscope images rounds out the site.

  5. Versatile multispectral microscope based on light emitting diodes

    NASA Astrophysics Data System (ADS)

    Brydegaard, Mikkel; Merdasa, Aboma; Jayaweera, Hiran; Ålebring, Jens; Svanberg, Sune

    2011-12-01

    We describe the development of a novel multispectral microscope, based on light-emitting diodes, capable of acquiring megapixel images in thirteen spectral bands from the ultraviolet to the near infrared. The system captures images and spectra in transmittance, reflectance, and scattering modes. We present as examples of applications ground truth measurements for remote sensing and parasitology diagnostics. The system is a general purpose scientific instrument that could be used to develop dedicated simplified instruments with optimal bands and mode selection.

  6. The Unfortunate Nurse A Case Study of Dengue Fever and Social Policy

    NSDL National Science Digital Library

    Karen M. Aguirre

    2007-01-01

    Based on an actual incident in which dengue virus was transmitted by an accidental needlestick, this case study introduces students to “emerging pathogens” and other concepts in parasitology, immunology, epidemiology, and public policy. Students also read a primary paper and learn about two modern techniques widely used in medical and research settings (i.e., EIA and Taqman RT-PCR). The case is suitable for general education biology, cell biology, microbiology, immunology, and science and public policy courses.

  7. Trypanosoma cruzi:Impact of Clonal Evolution of the Parasite on Its Biological and Medical Properties

    Microsoft Academic Search

    Susana Revollo; Bruno Oury; Jean-Pierre Laurent; Christian Barnabé; Virginie Quesney; Valérie Carrière; Sébastien Noël; Michel Tibayrenc

    1998-01-01

    Revollo, S., Oury, B., Laurent, J.-P., Barnabé, C., Quesney, V., Carrière, V., Noël, S., and Tibayrenc, M. 1998.Trypanosoma cruzi:Impact of clonal evolution of the parasite on its biological and medical properties.Experimental Parasitology89,30–39.Trypanosoma cruzipopulations are subdivided into natural clones that can exhibit considerable genetic differences. It has been proposed thatT. cruziclonal structure has a major impact on this parasite's biological properties.

  8. THE MARINE CERCARIAE OF THE WOODS HOLE, MASSACHUSETTS REGION, A REVIEW AND A REVISION

    Microsoft Academic Search

    HORACE W. STUNKARD

    In the early history of helminthology, specific descriptions were based on the morphology of the sexually mature stage of the parasite. But with the discovery of life-cycles, larval stages, asexual reproduction in intermediate hosts, biogeography, paleontology, genetic and parasitic specificity, descriptions are based on more com plete information. In an address on “¿?Parasitology in the world today,”delivered at the opening

  9. Occurrence of a Diploid Type and a New First Intermediate Host of a Human Lung Fluke, Paragonimus westermani, in Korea

    Microsoft Academic Search

    Gab Man Park; K. J. Lee; K. I. Im; T. S. Yong

    2001-01-01

    Park, G. M., Lee, K. J., Im, K. I., Park, H., and Yong, T. S. 2001. Occurrence of a diploid type and a new first intermediate host of a human lung fluke Paragonimus westermani, in Korea. Experimental Parasitology99, 206–212. The biology, chromosome number, and karyotype of a lung fluke, Paragonimus westermani (Kerbert, 1878) collected in Haenam, Haenam-gun Chollanam-do, Korea were

  10. Echinococcus granulosus: DNA Extraction from Germinal Layers Allows Strain Determination in Fertile and Nonfertile Hydatid Cysts

    Microsoft Academic Search

    Laura Kamenetzky; Sergio G. Canova; Eduardo A. Guarnera; Mara C. Rosenzvit

    2000-01-01

    Kamenetzky, L., Canova, S. G., Guarnera, E. A., and Rosenzvit, M. C. 2000. Echinococcus granulosus: DNA extraction from germinal layers allows strain determination in fertile and nonfertile hydatid cysts. Experimental Parasitology95, 122–127. A method for the isolation of Echinococcus granulosus DNA from germinal layers of hydatid cysts is described. The method includes a hexadecyltrimethylammonium bromide\\/chloroform extraction and an adsorption to

  11. Fasciola hepatica: Parasite-Secreted Proteinases Degrade All Human IgG Subclasses: Determination of the Specific Cleavage Sites and Identification of the Immunoglobulin Fragments Produced

    Microsoft Academic Search

    Patricia Berasain; Carlos Carmona; Blas Frangione; John P. Dalton; Fernando Goñi

    2000-01-01

    Berasain, P., Carmona, C., Frangione, B., Dalton, J. P., and Goñi, F. 2000. Fasciola hepatica: Parasite-secreted proteinases degrade all human IgG subclasses: Determination of the specific cleavage sites and identification of the immunoglobulin fragments produced. Experimental Parasitology94, 99–110. The study was focused on the relation ship of Fasciola hepatica-secreted proteinases and human IgG subclasses. Each IgG was incubated at different

  12. Increasing incidence of megabacteriosis in canaries ( Serinus canarius domesticus)

    Microsoft Academic Search

    D. Marlier; C. Leroy; M. Sturbois; V. Delleur; A. Poulipoulis; H. Vindevogel

    2006-01-01

    A total of 312 post-mortem examinations of 178 canaries (Serinus canarius domesticus), 40 parakeets (Melopsittacus undulatus, Nymphicus hollandicus) and 94 parrots (Amazona aestiva, Psitaccus erithacus) were conducted at the Birds and Rabbits Service of the University of Liège, Belgium. After a detailed gross examination, tissue samples were collected for virological and\\/or bacteriological and\\/or parasitological examination to complete the diagnosis. In

  13. Ixodes scapularis: Effects of Repeated Infestations with Pathogen-Free Nymphs on Macrophage and T Lymphocyte Cytokine Responses of BALB\\/c and C3H\\/HeN Mice

    Microsoft Academic Search

    George B. Schoeler; Stephen A. Manweiler; Stephen K. Wikel

    1999-01-01

    Schoeler, G. B., Manweiler, S. A., and Wikel, S. K. 1999. Ixodes scapularis: Effects of repeated infestations with pathogen-free nymphs on macrophage and T lymphocyte cytokine responses of BALB\\/c and C3H\\/HeN mice. Experimental Parasitology92, 239–248. Ixodes scapularis is the principal vector in the United States of Borrelia burgdorferi, the causative agent of Lyme borreliosis, the human granulocytic ehrichiosis agent, and

  14. Giardia lamblia: Effect of Infection with Symptomatic and Asymptomatic Isolates on the Growth of Gerbils ( Meriones unguiculatus)

    Microsoft Academic Search

    Humberto Astiazarán-Garc??a; Martha Espinosa-Cantellano; Guadalupe Castañón; Bibiana Chávez-Mungu??a; Adolfo Mart??nez-Palomo

    2000-01-01

    Astiazarán-Garc??a, H., Espinosa-Cantellano, M., Castañón, G., Chávez-Mungu??a, B., and Mart??nez-Palomo, A. 2000. Giardia lamblia: Effect of infection with symptomatic and asymptomatic isolates on the growth of gerbils (Meriones unguiculatus). Experimental Parasitology95, 128–135. Gerbils (Meriones unguiculatus) were intragastrically inoculated with axenic Giardia lamblia cultures from symptomatic and asymptomatic children. All isolates were able to colonize the duodenum. However, the colonization capacity

  15. Therapeutic efficacy of chloroquine and sulfadoxine/pyrimethamine against Plasmodium falciparum infection in Somalia.

    PubMed Central

    Warsame, M.; Abdillahi, A.; Duale, O. Nur; Ismail, A. Nur; Hassan, A. M.; Mohamed, A.; Warsame, A.

    2002-01-01

    OBJECTIVE: To assess the efficacy of chloroquine and sulfadoxine/pyrimethamine in the treatment of uncomplicated Plasmodium falciparum infections in Somalia. METHODS: Patients with clinical malaria in Merca, an area of high transmission of the disease, were treated with the standard regimens of chloroquine (25 mg/kg) or sulfadoxine/pyrimethamine (25 mg sulfadoxine and 1.25 mg pyrimethamine per kg). Similar patients in Gabiley, an area of low transmission, received the standard regimen of chloroquine. The clinical and parasitological responses were monitored for 14 days. FINDINGS: Chloroquine treatment resulted in clinical failure in 33% (n = 60) and 51% (n = 49) of the patients in Merca and Gabiley respectively. There were corresponding parasitological failures of 77% RII/RIII and 35% RII/RIII. Patients who experienced clinical failure had significantly higher initial parasitaemia than those in whom there was an adequate clinical response, both in Merca (t = 2.2; P t = 2.8; P n = 50) of the patients achieved an adequate clinical response despite a parasitological failure rate of 76% RII/RIII. CONCLUSION: Chloroquine should no longer be considered adequate for treating clinical falciparum malaria in vulnerable groups in the areas studied. Doubts about the therapeutic life of sulfadoxine/pyrimethamine in relation to malaria are raised by the high levels of resistance in the Merca area and underline the need to identify suitable alternatives. PMID:12378287

  16. An explicit immunogenetic model of gastrointestinal nematode infection in sheep

    PubMed Central

    Prada Jiménez de Cisneros, Joaquín; Stear, Michael J.; Mair, Colette; Singleton, Darran; Stefan, Thorsten; Stear, Abigail; Marion, Glenn; Matthews, Louise

    2014-01-01

    Gastrointestinal nematodes are a global cause of disease and death in humans, wildlife and livestock. Livestock infection has historically been controlled with anthelmintic drugs, but the development of resistance means that alternative controls are needed. The most promising alternatives are vaccination, nutritional supplementation and selective breeding, all of which act by enhancing the immune response. Currently, control planning is hampered by reliance on the faecal egg count (FEC), which suffers from low accuracy and a nonlinear and indirect relationship with infection intensity and host immune responses. We address this gap by using extensive parasitological, immunological and genetic data on the sheep–Teladorsagia circumcincta interaction to create an immunologically explicit model of infection dynamics in a sheep flock that links host genetic variation with variation in the two key immune responses to predict the observed parasitological measures. Using our model, we show that the immune responses are highly heritable and by comparing selective breeding based on low FECs versus high plasma IgA responses, we show that the immune markers are a much improved measure of host resistance. In summary, we have created a model of host–parasite infections that explicitly captures the development of the adaptive immune response and show that by integrating genetic, immunological and parasitological understanding we can identify new immune-based markers for diagnosis and control. PMID:25121649

  17. Mebendazole compared with secnidazole in the treatment of adult giardiasis: a randomised, no-inferiority, open clinical trial.

    PubMed

    Almirall, Pedro; Escobedo, Angel A; Ayala, Idalia; Alfonso, Maydel; Salazar, Yohana; Cañete, Roberto; Cimerman, Sergio; Galloso, Martha; Olivero, Ilmaems; Robaina, Maytee; Tornés, Karen

    2011-01-01

    To compare the efficacy and safety of mebendazole and secnidazole in the treatment of giardiasis in adult patients, a single-centre, parallel group, open-label, randomized non-inferiority trial was carried out. One-hundred and 26 participants who had symptomatic Giardia mono-infection took part in the study. Direct wet mount and/or Ritchie concentration techniques and physical examinations were conducted at the time of enrolment and at the follow-up visit. The primary outcome measure was parasitological cure, performed at 3, 5, 10 days post-treatment. Negative faecal specimens for Giardia were ensured by the same parasitological techniques. At follow up (day 10) the parasitological cure rate for the per protocol populations was 88.7% (55/62) for MBZ and 91.8% (56/61) for SNZ. For the intention to treat populations the cure rate at the end of treatment was 85.9% (55/64) for MBZ and 90.3% (56/62) for SNZ. Both analyzes showed there was not significant statistical difference between MBZ and SNZ treatment efficacy. Both drugs were well tolerated, only mild, transient and self-limited side effects were reported and did not require discontinuation of treatment. A 3-day course of mebendazole seems to be as efficacious and safe for treatment of giardiasis as a single dose of secnidazole in adults. PMID:22174992

  18. A conventional polymerase chain reaction-based method for the diagnosis of human schistosomiasis in stool samples from individuals in a low-endemicity area

    PubMed Central

    Carneiro, Teiliane Rodrigues; Peralta, Regina Helena Saramago; Pinheiro, Marta Cristhiany Cunha; de Oliveira, Sara Menezes; Peralta, José Mauro; Bezerra, Fernando Schemelzer Moraes

    2013-01-01

    The aim of this study was to evaluate the efficacy of a polymerase chain reaction (PCR)-based method to detect Schistosoma mansoni DNA in stool samples from individuals living in a low-endemicity area in Brazil. Of the 125 initial stool samples, 80 were ELISA reactive and eggs were identified in 19 of the samples by parasitological examination. For the PCR evaluations, 56 stool samples were selected and divided into five groups. Groups I-IV were scored negative for S. mansoni eggs by parasitological examination. Groups I and II were ELISA reactive, whereas Groups III and IV were ELISA nonreactive. Groups II and III were positive for other intestinal parasites. PCR testing scored eight samples as positive from these four groups. Group V represented the S. mansoni -positive group and it included ELISA-reactive samples that were scored positive for S. mansoni by one or more parasitological examinations (6/19 were positive by Kato-Katz method, 9/17 by saline gradient and 10/13 by Helmintex®). PCR scored 13 of these 19 samples as positive for S. mansoni . We conclude that while none of these methods yielded 100% sensitivity, a combination of techniques should be effective for improving the detection of S. mansoni infection in low-endemicity areas. PMID:24402156

  19. Natural infection of synathropic rodent species Mus musculus and Rattus norvegicus by Leishmania infantum in Sesimbra and Sintra – Portugal

    PubMed Central

    2013-01-01

    Background Canine leishmaniosis caused by Leishmania infantum is a parasitic zoonotic disease transmitted by phlebotomine sandflies (Diptera: Psychodidae). Genus Phlebotomus is the biological vector in the Old World and Lutzomyia in the New World. The dog is the domestic reservoir host but other animals like the fox (Vulpes vulpes) and rodents are known to maintain the infection in both sylvatic and domestic cycles. Methods To identify the role of synanthropic rodents Mus musculus and Rattus norvegicus as reservoir hosts for Leishmania infantum natural infection, 30 rodents were captured under a trap rodent control program in two private dog shelters from Sintra and Sesimbra, located in the Lisbon Metropolitan Area, known to be endemic for canine leishmaniosis in Portugal. Tissue samples were screened for the presence of Leishmania amastigotes by qPCR and parasitological analysis. Results A total of 33.3% (9/27) of Mus musculus rodents revealed the presence of Leishmania spp. DNA while 29.6% (8/27) were positive in the parasitological analysis. Concerning Rattus norvegicus (n=3), one animal revealed infection only by parasitological analysis. Conclusions Our results identified for the first time in Portugal the presence of Leishmania infection in both rodent species. As susceptible hosts, infected Mus musculus and Rattus norvegicus may increase the risk for dog and human infection in households and surrounding areas, enhancing the need for efficient rodent control measures in shelters and risk zones to prevent transmission of the infection. PMID:23566789

  20. Evaluation of a gp63–PCR Based Assay as a Molecular Diagnosis Tool in Canine Leishmaniasis in Tunisia

    PubMed Central

    Guerbouj, Souheila; Djilani, Fattouma; Bettaieb, Jihene; Lambson, Bronwen; Diouani, Mohamed Fethi; Ben Salah, Afif; Ben Ismail, Riadh; Guizani, Ikram

    2014-01-01

    A gp63PCR method was evaluated for the detection and characterization of Leishmania (Leishmania) (L.) parasites in canine lymph node aspirates. This tool was tested and compared to other PCRs based on the amplification of 18S ribosomal genes, a L. infantum specific repetitive sequence and kinetoplastic DNA minicircles, and to classical parasitological (smear examination and/or culture) or serological (IFAT) techniques on a sample of 40 dogs, originating from different L. infantum endemic regions in Tunisia. Sensitivity and specificity of all the PCR assays were evaluated on parasitologically confirmed dogs within this sample (N?=?18) and control dogs (N?=?45) originating from non–endemic countries in northern Europe and Australia. The gp63 PCR had 83.5% sensitivity and 100% specificity, a performance comparable to the kinetoplast PCR assay and better than the other assays. These assays had comparable results when the gels were southern transferred and hybridized with a radioactive probe. As different infection rates were found according to the technique, concordance of the results was estimated by (?) test. Best concordance values were between the gp63PCR and parasitological methods (74.6%, 95% confidence intervals CI: 58.8–95.4%) or serology IFAT technique (47.4%, 95% CI: 23.5–71.3%). However, taken together Gp63 and Rib assays covered most of the samples found positive making of them a good alternative for determination of infection rates. Potential of the gp63PCR-RFLP assay for analysis of parasite genetic diversity within samples was also evaluated using 5 restriction enzymes. RFLP analysis confirmed assignment of the parasites infecting the dogs to L. infantum species and illustrated occurrence of multiple variants in the different endemic foci. Gp63 PCR assay thus constitutes a useful tool in molecular diagnosis of L. infantum infections in dogs in Tunisia. PMID:25153833

  1. Deltamethrin-impregnated bednets as an operational tool for malaria control in a hyper-endemic region of Burundi: impact on vector population and malaria morbidity.

    PubMed

    Van Bortel, W; Delacollette, C; Barutwanayo, M; Coosemans, M

    1996-12-01

    Within the framework of the National Malaria Control Programme Burundi, impregnated bednets were promoted through health care facilities, schools and local administration in Nyanza Lac district. The decision to buy a bednet was left to the inhabitants and, as a result, coverage rates between 6 and 65% were observed at sub-district level. Three intervention regions were specified based on the intervention start date. From November 1992 until March 1995, bi-monthly parasitological and entomological surveys were carried out in two areas each of Region 1 and Region 2. After introduction of impregnated bednets in Region 1 the proportions of children under 5 with high parasitaemia were reduced by 42 and 53% in the 2 parasitological survey areas, where the average bednet coverages were 55 and 44% respectively. In the survey areas of Region 2 (control) no significant change occurred during the same period. During the second part of the intervention from September 1994, when intervention was also operational in Region 2, significant decreases in the proportion of high parasitaemia (63 and 42%) among children under 5 years were obtained in both parasitological survey areas of Region 2 (average coverages of 51 and 29%). The positive output of the intervention was maintained and even reinforced in the survey areas of Region 1. Bednets as a tool for malaria control entail specific problems such as coverage, daily use, reimpregnation, and renewal of old and torn nets. Further evaluation has to point out the possible shift of the clinical spectrum and the age-specific admission of malaria cases to assess the long-term benefit of this control method. PMID:8980597

  2. Randomized Single-Blinded Non-inferiority Trial Of 7 mg/kg Pentamidine Isethionate Versus 4 mg/kg Pentamidine Isethionate for Cutaneous Leishmaniaisis in Suriname

    PubMed Central

    Hu, Ricardo V. P. F.; Straetemans, Masja; Kent, Alida D.; Sabajo, Leslie O. A.; de Vries, Henry J. C.; Lai A Fat, Rudy F. M.

    2015-01-01

    Background Standard treatment of cutaneous leishmaniasis (CL) in Suriname entails three injections of pentamidine isethionate (PI) 4 mg/kg per injection in 7 days (7 day regimen). Compliance to treatment is low and may contribute to increasing therapy failure. A 3 day regimen, including 2 injections of 7 mg/kg in 3 days may increase compliance. Methods In a randomized, single-blinded non-inferiority trial conducted in Suriname, 84 CL patients received the 7 day regimen and 79 CL patients received the 3 day regimen. Primary objective was the proportion of patients clinically cured at 6 weeks follow-up. Secondary objectives were clinical cure at 12 weeks follow-up; parasitological cure at 6 and 12 weeks; adverse and drug related toxicity events recorded one week after the end of treatment and health related quality of life. The non-inferiority margin was set at 15%, 1 sided test, ? = 0.1. Results At 6 weeks follow-up 31 (39%) patients in the 3 day regimen and 41 (49%) patients in the 7 day regimen were clinically cured. Intention to treat (ITT) analyses showed that the difference in proportion clinically cured was -9.6% (90% Confidence Interval (CI): -22.3% to 3.2%). Per protocol (PP) analysis showed that the difference in proportion clinically cured was 0.2% (90% CI: -14.6% to 15.2%). ITT analysis showed that the difference in proportion parasitological cured at 6 weeks was -15.2% (90% CI:-28.0% to -2.5%). PP analyses showed similar results. Non-inferiority could not be concluded for all adverse and toxicological events. Conclusion We cannot conclude that the 3 day regimen is non-inferior to the 7 day regimen regarding proportion clinically and parasitological cured. Therefore there is no evidence to change the current standard practice of the 7 day regimen for the treatment of CL in Suriname. PMID:25793773

  3. PubMed Central

    Simarro, P. P.; Sima, F. O.; Mir, M.; Mateo, M. J.; Roche, J.

    1991-01-01

    The object of this study was to (a) reduce the prevalence of sleeping sickness by serological testing, parasitological examination, and treatment of every infected person; (b) determine the maximum acceptable interval between serological surveys; and (c) define the impact of vector control, using monopyramidal non-impregnated traps, on the transmission. For this sero-parasitological survey, the focus in Luba was divided into three zones as follows: Epicentre A (with high prevalence, 27.5%), Epicentre B (with average prevalence, 8.3%), and Peripheral C (with moderate prevalence, 3.0%). Differences in the prevalence rates in the Epicentres and Peripheral zone permitted the use of three different approaches for control and epidemiological follow-up of the disease: (1) Serological examination of the entire population was carried out by the indirect immunofluorescent antibody test (IFAT), with six-month intervals in Epicentres A and B and once a year in the Peripheral zone C. (2) Diagnosis and treatment: all IFAT seropositives were examined in Luba hospital for parasites, and every parasitologically confirmed patient was treated according to the WHO protocol of 1983. Another serological test (CATT) was applied to cases in which trypanosomes were not present and if this was positive, the CSF was examined. Cases with parasites and abnormal CSF were treated with melarsoprol, and those with a normal CSF received pentamidine. CATT-negative and parasite-negative cases were considered to be false-positives by IFAT and free of the disease. (3) Vector control: 74 monopyramidal traps (18 traps per km2) were set up in Epicentre A. The flies captured were collected once a month and sent to the programme's laboratory where they were identified and counted.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1934239

  4. Impact of the Use of a Rapid Diagnostic Test for Visceral Leishmaniasis on Clinical Practice in Ethiopia: A Retrospective Study

    PubMed Central

    Diro, Ermias; Lynen, Lutgarde; Assefa, Mahlet; Takele, Yegnasew; Mengesha, Bewketu; Adem, Emebet; Mohammed, Rezika; Kimutai, Robert; Hailu, Asrat; Boelaert, Marleen; van Griensven, Johan

    2015-01-01

    Background Diagnostic guidelines for Visceral Leishmaniasis (VL) in the East African region are complex. Patients meeting the VL clinical case definition should be tested by rK39 rapid diagnostic test (RDT) followed by the Direct Agglutination Test (DAT) or tissue aspiration if RDT-negative. Otherwise, RDT-positive patients should be started on VL treatment. We evaluated how this guideline is adhered to by assessing the routine clinical practice in a university hospital in North-West Ethiopia. Methods Retrospective record analysis was done for all patients who had an rK39-RDT done at University of Gondar (UoG) Hospital between June 2012 and June 2013. We described the diagnostic work-up performed and the proportion initiated on VL treatment by test result. Results/Findings From a total of 928 patients tested, 308 (33.2%) were rK39 RDT-positive. Spleen or bone marrow aspiration was done for 237 (77.2%) RDT-positive patients. Of these, 165 were confirmed parasitologically, yielding a positive predictive value of 69.6%. Only 126 (20.3%) of the 620 patients with a negative rK39 test underwent further testing by tissue aspiration, of which 22 (17.5%) were also parasitology positive. HIV test results were available for 570 (61.4%) patients and 36 (6.3%) were HIV-infected. Of the 187 parasitologically confirmed patients, 182 (97.3%) were started on VL treatment. Conclusions / Discussion A negative rK39 test was often not followed by further testing and a positive rK39 test result was followed by tissue aspiration in three out of four cases. Further research is required to understand why the diagnostic work-up did not comply with the guidelines, including evaluating adherence to the VL clinical case definition and quality of rK39-RDT testing. PMID:25965564

  5. Coenurus gaigeri cyst in the thigh of a goat and its successful management.

    PubMed

    Madhu, D N; Mahan, Tamil; Sudhakar, N R; S Maurya, P; Banerjee, P S; Sahu, Shivani; Pawde, A M

    2014-09-01

    A 11 month old female goat was presented to Polyclinic, IVRI with the history of swelling in the left hind leg on the inner aspect of thigh and inguinal region. Physical and radiological examination revealed a large fluctuating fluid filled bladder with distinct dimension. The cyst was successfully removed along with its membrane and parasitological examination revealed it as a Coenurus gaigeri, the intermediate stage of T. multiceps gaigeri. The animal recovered completely by 10th postoperative day without any complications. This is being described in detail as under. PMID:25035586

  6. Field trial of three different Plasmodium vivax- detecting rapid diagnostic tests with and without evaporative cool box storage in Afghanistan

    Microsoft Academic Search

    Amy FW Mikhail; Toby J Leslie; Mohammad I Mayan; Rohullah Zekria; Nader Mohammad; Mohammad A Hasanzai; Najibullah Safi; Christopher JM Whitty; Mark Rowland

    2011-01-01

    Background  Accurate parasitological diagnosis of malaria is essential for targeting treatment where more than one species coexist. In\\u000a this study, three rapid diagnostic tests (RDTs) (AccessBio CareStart (CSPfPan), CareStart PfPv (CSPfPv) and Standard Diagnostics\\u000a Bioline (SDBPfPv)) were evaluated for their ability to detect natural Plasmodium vivax infections in a basic clinic setting. The potential for locally made evaporative cooling boxes (ECB)

  7. The infectivity of Bunostomum phlebotomum to sheep, rabbits and guinea pigs 

    E-print Network

    Boring, Gary David

    1964-01-01

    THE INFECT1VITY OP BUNOSTOMUM PHLEBOTOMUM TO SHEEP, RABBITS AND GUINEA PIGS A Thesis By GARY DAVID BORING Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE August 1964 Ma]or Sub)cot: Veterinary Parasitology THE INFECTIVITY OF BUNOSTOMUM PHLEBOTOMUM TO SHEEP~ RABBITS AND GUINEA PIGS A Thesis By GARY DAVID BORING Approved as to style and content by: i Ma (Chairman of Committee) /7 ~ 3...

  8. Malaria epidemics in Europe after the First World War: the early stages of an international approach to the control of the disease.

    PubMed

    Gachelin, Gabriel; Opinel, Annick

    2011-06-01

    The severity and endemicity of malaria declined gradually in Europe until WWI. During and after the war, the number of malaria cases increased substantially and peaked in 1922-1924. This prompted the Hygiene Commission of the League of Nations to establish a Malaria Commission in 1923 to define the most efficient anti-malaria procedures. Additionally, between 1924 and 1930 there were several international meetings and collaborations concerning malaria, which involved the main institutes of parasitology and the Rockefeller Foundation. The Commission reports, the guidelines for anti-malaria campaigns and the scientific programs which came out of these meetings and collaborations are analyzed in the present paper. PMID:21779694

  9. Serum proteins, indirect fluorescent antibody titers and complement fixing antibody titers in dexamethasone exacerbated anaplasmosis carrier calves 

    E-print Network

    Johnson, Lloran Wesley

    1979-01-01

    proteins were compared with other serological and parasitological parameters of infection. LITERATURE REVIEW Anaplasmosis is a highly infectious disease of cattle recognized principally by clinical signs of fever, anemia, and icterus. Other...Callon in 1973 revised the 17 figure to approximately 100 million dollars. i'h i lg' i g *of pls ~Aal ~mx ' i, p *'i i tt i, ithaca* y* Ii that infects erythrocytes of cattle causi'ng acute infec- 12 tious anemia. It is most often transmitted mechanically...

  10. [Organization of studies of the "gnus" complex of bloodsucking dipterans (Diptera: Culicidae, Ceratopogonidae, Tabanidae) by Yu. S. Balashov].

    PubMed

    Medvedev, S G

    2013-01-01

    The paper gives a historical account of investigations of mosquitoes, black flies and horseflies carried out by the staff of the Laboratory of Parasitology, Zoological Institute RAS, supervised by a corresponding member of the Russian Academy of Sciences, Prof Yu. S. Balashov, during 1979-1994. The research team of the laboratory explored the local fauna, relative abundance, seasonal dynamics, diurnal activity, longevity of a mass flight activity, annual fluctuations of the number, and age content of populations of various mosquito, black fly and horsefly species in the territory of Leningrad, Novgorod and Pskov Provinces. Attack peculiarities of various horse fly species were studied with the use of individual labeling. PMID:24455908

  11. Infection with Crenosoma striatum lungworm in Long-eared Hedgehog (Hemiechinus auritus) in Kerman province southeast of Iran.

    PubMed

    Mirzaei, Mohammad

    2014-12-01

    Hedgehogs are distributed in different areas of Iran. Unfortunately, clinical and parasitological studies on parasites of hedgehogs are very few. Crenosoma striatum is a common lungworm in hedgehogs. C. striatum infection can cause weight loss, dry cough, bronchitis with ulcerous reactions based on secondary bacterial infections, pulmonary damage, thickening of the tracheal wall, and pulmonary emphysema up to cardiovascular failure. In this survey, six dead hedgehogs (Hemiechinus auritus) were investigated for lungworm infection. All the six hedgehogs had C. striatum infection in their lungs. PMID:25732884

  12. Temporal and spatial distribution of the black-legged tick, Ixodes scapularis, in Texas and its association with climate variation 

    E-print Network

    Santelises, Joshua Steven

    2013-02-06

    and the population frequency of I. scapularis. However, global climate change has been implicated in having a potentially serious 4 effect on the future spatial and temporal distribution of vector-borne diseases (Gray 2007). The abiotic environment plays a... and hosts of certain North American ticks. J. Parasitology 31:1-52 Brownstein, J.S., T.R. Holford, and D. Fish. 2005. Effect of climate change on Lyme disease risk in North America. EcoHealth 2:38-46. Diuk-Wasser, M.A., V. Gwenael, P. Cislo, G.W. Hoen...

  13. Studies on transmission and incidence of Trypanosoma theileri, Laveran 1902 

    E-print Network

    Betancourt Echeverry, Antonio

    1972-01-01

    is lovingly dedicated to ny wife Beatriz and to mp scn Antonio Jose'. 'Ihe author ~ appreciation to his Chairman, Dr. Thomas J. Galvin for his counsel and ccntinuous enmuragmnent toward the cxxnpleticn of this paper; to Dr. Rurel R. Bell, Head.... and the University of Nebraska ? I. C. A. project to work toward the M. S. degree in Veterinary Parasitology at Ibxas A&M University. He was married on N~ 8, 1969, to Beatriz Lopez of Manizales, Colanbia, and is the father of one child. The typist for this thesis...

  14. Efficacy of sulphadoxine-pyrimethamine for intermittent preventive treatment of malaria in pregnancy, Mansa, Zambia

    PubMed Central

    2014-01-01

    Background Intermittent preventive treatment of malaria in pregnancy (IPTp) with sulphadoxine-pyrimethamine (SP) decreases adverse effects of malaria during pregnancy. Zambia implemented its IPTp-SP programme in 2003. Emergence of SP-resistant Plasmodium falciparum threatens this strategy. The quintuple mutant haplotype (substitutions in N51I, C59R, S108N in dhfr and A437G and K540E in dhps genes), is associated with SP treatment failure in non-pregnant patients with malaria. This study examined efficacy of IPTp-SP and presence of the quintuple mutant among pregnant women in Mansa, Zambia. Methods In Mansa, an area with high malaria transmission, HIV-negative pregnant women presenting to two antenatal clinics for the 1st dose of IPTp-SP with asymptomatic parasitaemia were enrolled and microscopy for parasitaemia was done weekly for five weeks. Outcomes were parasitological failure and adequate parasitological response (no parasitaemia during follow-up). Polymerase chain reaction assays were employed to distinguish recrudescence from reinfection, and identify molecular markers of SP resistance. Survival analysis included those who had reinfection and incomplete follow-up (missed at least one follow-up). Results Of the 109 women included in the study, 58 (53%) completed all follow-up, 34 (31%) had incomplete follow-up, and 17 (16%) were lost to follow-up after day 0. Of those who had complete follow-up, 15 (26%, 95% confidence interval [CI] [16–38]) had parasitological failure. For the 92 women included in the survival analysis, median age was 20 years (interquartile range [IQR] 18–22), median gestational age was 22 weeks (IQR range 20–24), and 57% were primigravid. There was no difference in time to failure in primigravid versus multigravid women. Of the 84 women with complete haplotype data for the aforementioned loci of the dhfr and dhps genes, 53 (63%, 95% CI [50–70]) had quintuple mutants (two with an additional mutation in A581G of dhps). Among women with complete follow-up and quintuple mutants, 22% had parasitological failure versus 0% without (p?=?0.44). Conclusions While underpowered, this study found 26% failure rates of SP given the moderate prevalence of the quintuple mutant haplotype. Despite the presence of resistance, SP retained some efficacy in clearing parasites in pregnant women, and may remain a viable option for IPTp in Zambia. PMID:24909578

  15. HIV/AIDS, parasites and co-infections: publication patterns in China

    PubMed Central

    Tian, Li-Guang; Steinmann, Peter; Chen, Jia-Xu; Chen, Shao-Hong; Zhou, Xiao-Nong

    2009-01-01

    Background Since its discovery, HIV/AIDS has arguably captured more attention among the Chinese biomedical research community than most other infectious diseases. Traditional parasitic diseases, on the other hand, are perceived as being increasingly neglected. However, it has long been recognized that interactions between HIV and other infective agents, including parasites, influence the health status of people living with HIV/AIDS. This study aimed at systematically reviewing the Chinese scientific literature on HIV/AIDS and parasites between 1986 and 2006 in order to substantiate or refute these claims, and to highlight neglected research areas. Results Searching the three largest Chinese scientific literature databases, in the China National Knowledge Infrastructure (CNKI) a total of 24,511 citations dealing with HIV/AIDS and 15,398 parasite-specific publications were identified. Wanfang Data and VIP Information (VIP) contained 15,925 and 13,873 entries dealing with HIV/AIDS respectively, while 12,043 and 7,068 hits were scored when searching for parasitological references. The number of publications dealing with HIV/AIDS in China increased exponentially from 6 in 1986 to 3,372 in 2006 whereas the publication activity in the field of parasitology was more erratic and lately started to decline. Epidemiology was the most-reported field of endeavor, accounting for 26.0% and 24.6% of the HIV/AIDS and parasitological literature, respectively, while publications dealing with health education only represented 2.9% and 0.7% of all publications, respectively. The total number of Chinese articles focusing on HIV/AIDS and parasite co-infection was 650, with large year-on-year differences in publication numbers. The single-most frequently studied system was HIV-Pneumocystis carinii co-infection. Conclusion The present study revealed that in China, the fields of parasitic diseases, especially opportunistic parasitic infections linked with HIV/AIDS, is increasingly neglected. This suggests a need to enhance research in the field of opportunistic parasitic infections and parasitology in general. PMID:19589143

  16. [Aythya fuligula--new host for Retinometra pittalugai Lopez-Neyra, 1932 (Cestoda, Hymenolepididae) recorded in Poland for the first time].

    PubMed

    Królaczyk, Katarzyna; Kavetska, Katarzyna M; Kornyushin, Vadim V

    2008-01-01

    During standard parasitological studies of the tufted duck Aythya fuligula (Linnaeus, 1758), obtained from fishermen from West Pomerania, three cestode specimens were found in the jejunum of hosts. They were determined as Retinometra pittalugai (Lopez-Neyra, 1932) on the basis of the cirrus's size, shape of stylet and rostellar hooks. This is the first record of this species in Poland, since this parasite was earlier recorded only in Anas platyrhynchos f. dom., Aythya marila, A. ferina and Bucephala clangula in Spain, in Kamchatka and in Novosibirsk. PMID:19338226

  17. Prevalence of onchocerciasis in Blue Nile valley of western Ethiopia.

    PubMed

    Jira, C

    1993-01-01

    A epidemiological study of Onchocerciasis among different ethnic groups in the Blue Nile valley of Western Ethiopia was conducted to obtain baseline data on disease prevalence, skin snips samples were obtained from 493 persons, representing different ethnic groups (Nilotic and Oromos), living under different geographic and climatic conditions (lowlands, Midland and highland) or Mendi district for parasitological verification. A total of 169 (34%) had microfilariae of the skin by direct microscopy. The highest prevalence rate (81%) was found among the Nilotic people living along the southern banks of the Blue Nile River. Most patient had wide spread skin infection. Epidemiological differences were also observed. PMID:8077003

  18. The Grapes of Staph: Doc Kaiser's Microbiology Web Page

    NSDL National Science Digital Library

    Kaiser, Gary E.

    Dr. Gary Kaiser of The Community College of Baltimore County at Catonsville (Maryland) put together this Lecture/ Lab teaching resource on Microbiology. Organized into four units, the main topics in the Lecture Guide section include Bacteria and Fungi; Protozoa, Viruses, and Nonspecific Body Defenses; Immune Responses; and Microbial Genetics/ Metabolism. Each unit contains a brief summary of the topic, with several links to color illustrations or animations. The online Microbiology Lab Manual covers 22 full labs, from the basics of microscope use and the sizes/ shapes of microorganisms through parasitology. While the site connection is a bit slow, the content/ layout is decent, making this a useful overview and solid introduction to microbiology.

  19. Parasitic central nervous system infections: echinococcus and schistosoma.

    PubMed

    Shahlaie, Kiarash; Hawk, Mark W; Hu, Brian R; Theis, J H; Kim, Kee D

    2005-01-01

    Central nervous system (CNS) manifestations of Echinococcus and Schistosoma infections occur throughout the world, with incidence increasing in developed regions. A detailed literature review generated a current summary on epidemiology, parasitology, pathology, clinical manifestations, imaging studies, diagnosis, and treatment of neuroechinococcosis and neuroschistosomiasis. Recent advancements have been made in diagnosis, treatment, and prevention of these parasitic CNS infections. Ongoing advancements in neuroimaging and diagnostic studies, as well as efforts to better understand the parasite genome and host-parasite relationships, will likely continue to improve patient management. PMID:16622395

  20. [Leishmaniasis in Ecuador. 4. Natural infestation of the dog by Leishmania panamensis].

    PubMed

    Dereure, J; Espinel, I; Barrera, C; Guerrini, F; Martini, A; Echeverria, R; Guderian, R H; Le Pont, F

    1994-03-01

    In two endemic leishmaniasis foci of the Pacific coast of Ecuador 34 dogs suspected of having the disease have been surveyed clinically, serologically and parasitologically; immunofluorescence and electrosyneresis tests, lymph node aspirates, biopsies and smears have been performed. From two dogs with ulcers only one had ulcers on the muzzle and the scrotum infected by Leishmania (L. guyanensis complex). The isolated strain was identified as Leishmania panamensis. The disease was strictly cutaneous. In the study area the dog seems to be more a victim-host than a reservoir. PMID:8024347

  1. The co phylogeny reconstruction problem is NP-complete.

    PubMed

    Ovadia, Y; Fielder, D; Conow, C; Libeskind-Hadas, R

    2011-01-01

    The co phylogeny reconstruction problem is that of finding minimum cost explanations of differences between historical associations. The problem arises in parasitology, molecular systematics, and biogeography. Existing software tools for this problem either have worst-case exponential time or use heuristics that do not guarantee optimal solutions. To date, no polynomial time optimal algorithms have been found for this problem. In this article, we prove that the problem is NP-complete, suggesting that future research on algorithms for this problem should seek better polynomial-time approximation algorithms and heuristics rather than optimal solutions. PMID:20715926

  2. [Knowledge of the endoparasitic fauna of Lama guanicoe Muller, 1776, from the Mitre Peninsula, Tierra del Fuego, Argentina].

    PubMed

    Navone, G T; Merino, M L

    1989-01-01

    Parasitological fauna of Lama guanicoe in the Peninsula Mitre, Tierra del Fuego, Argentina, is analyzed in this paper. Coproparasitological tests of 58 samples were performed, and on this basis, the presence of the following genera was determined: Haemonchus, Marshallagia, Cooperia, Nematodirus, Ostertagia, Trichostrongylus, Oesophagostomun and Chavertia. Marshallagia and Chabertia are reported for the first time for this host. The dung piles are not considered as parasitic barriers. Infections occur in two seasons: at the beginning of the spring and at the beginning of summer, as a survival strategy of parasitic nematodes. Parasites of L. guanicoe would be secondarily acquired form cattle. PMID:2629773

  3. Communications: technology transfer in the developed world.

    PubMed

    Murrell, K D

    1996-08-01

    Support for research is increasingly dependent upon the results of that research having relevance to society's needs and public benefits. This increase pressure to move research results out of the laboratory and into the user's hands. To facilitate this, a variety of technology transfer mechanisms have evolved to facilitate transfer of knowledge and processes. These mechanisms, in addition to their implied benefits for the researchers and the user, often have certain consequences which are unanticipated and cause transfer to fail or not meet expectations. Foremost, cultural change on the part of both private organizations and public laboratories is probably necessary to allow effective partnerships. Coupled with the transfer of knowledge is the opportunity to more effectively explain to society the benefits it receives for its investments in research. Such communication has not been especially successful for veterinary parasitology. However, the revolution in communication (e.g. rise of mass media, computer networks) presents new opportunities to parasitologists to more effectively communicate both technology and knowledge directly to the users, and also to inform supporters, policy-makers and the general public of the relevance and importance of veterinary parasitology in improving society's well-being. This review will discuss these new instruments of communication, the need to construct better messages, the benefits of technology transfer and the various means to meet the challenges associated with transferring research innovation to the user and the marketplace. PMID:8893468

  4. Sandwich mapping of schistosomiasis risk in Anhui Province, China.

    PubMed

    Hu, Yi; Bergquist, Robert; Lynn, Henry; Gao, Fenghua; Wang, Qizhi; Zhang, Shiqing; Li, Rui; Sun, Liqian; Xia, Congcong; Xiong, Chenglong; Zhang, Zhijie; Jiang, Qingwu

    2015-01-01

    Schistosomiasis mapping using data obtained from parasitological surveys is frequently used in planning and evaluation of disease control strategies. The available geostatistical approaches are, however, subject to the assumption of stationarity, a stochastic process whose joint probability distribution does not change when shifted in time. As this is impractical for large areas, we introduce here the sandwich method, the basic idea of which is to divide the study area (with its attributes) into homogeneous subareas and estimate the values for the reporting units using spatial stratified sampling. The sandwich method was applied to map the county-level prevalence of schistosomiasis japonica in Anhui Province, China based on parasitological data collected from sample villages and land use data. We first mapped the county-level prevalence using the sandwich method, then compared our findings with block Kriging. The sandwich estimates ranged from 0.17 to 0.21% with a lower level of uncertainty, while the Kriging estimates varied from 0 to 0.97% with a higher level of uncertainty, indicating that the former is more smoothed and stable compared to latter. Aside from various forms of reporting units, the sandwich method has the particular merit of simple model assumption coupled with full utilization of sample data. It performs well when a disease presents stratified heterogeneity over space. PMID:26054518

  5. A coprological survey of parasites in white-faced capuchins (Cebus capucinus) from Sector Santa Rosa, ACG, Costa Rica.

    PubMed

    Parr, Nigel A; Fedigan, Linda M; Kutz, Susan J

    2013-01-01

    Neotropical primate parasitology has been dominated by studies of howler monkeys (Alouatta spp.), whereas the literature on the parasites of other platyrrhines is relatively sparse. We analysed the faeces of white-faced capuchins (Cebus capucinus) in a Costa Rican tropical dry forest and recovered 8 parasite taxa (Filariopsis barretoi,Giardia duodenalis, Strongyloides sp., Prosthenorchis sp., a spirurid nematode, a subulurid nematode, a strongylid nematode and a cestode). F. barretoi and Strongyloides sp. were the most prevalent parasites and were recovered from 84 and 76% of the sampled individuals, respectively. Individual capuchins were infected with an average of 1.89 parasite species. Capuchins host a diverse suite of parasites belonging to several taxonomic groups (Nematoda, Cestoda, Acanthocephala, Protozoa) and including species with direct and indirect life cycles. Many capuchin parasites are transmitted through the consumption of invertebrate intermediate hosts making diet a critical component of capuchin-parasite ecology. This study represents the most intensive parasitological survey of wild capuchin monkeys to date. PMID:23571310

  6. Description of six autochthonous cases of canine visceral leishmaniasis diagnosed in Pedregulho (São Paulo, Brazil).

    PubMed

    Abreu, Cássia Regina de; Parpinelli, Ana Cláudia; Lima, Romeika Reis de; Dias, Luis Gustavo Gosuen Gonçalves; Pereira, Lucas de Freitas; Dias, Fernanda Gosuen Gonçalves

    2015-01-01

    Visceral leishmaniasis is an infectious disease of chronic, emerging and zoonotic nature that presents various degrees of severity. In Brazil, this illness is caused by Leishmania infantum (Leishmania chagasi), which is transmitted by the bite of the sand fly Lutzomyia longipalpis, and dogs are its main reservoir. Given the increasing spread of this disease across Brazil, the aim of this study was to report on six cases of canine visceral leishmaniasis, diagnosed in June 2013, in the city of Pedregulho, State of São Paulo, considered to be a non-endemic area and free of phlebotomine sand flies. The diagnosis was based on clinical signs of the patients and additional tests (serological and parasitological). It was concluded that the diagnosis of leishmaniasis is complex because the clinical signs are similar to other systemic diseases, thus justifying the importance of parasitological test of bone marrow, considered "gold standard", in the confirmation of the disease. In addition, the area was not, until now, considered risk place, despite notification. PMID:26154962

  7. [Endemic onchocerciasis in forested zones of Ivory Coast: prevalence rate and microfilarial densities].

    PubMed

    Diarrassouba, S; Traore, S; Riviere, F

    1996-01-01

    Since 1974 grassy plain areas of the western Africa have been protected by the Onchocerciasis Control Programme, but wooded endemic areas are also of concerned to countries in the region. Numerous studies have been performed to study endemic features of onchocerciasis in wooded areas. A parasitologic/entomologic survey was conducted between April and October 1990 in 5 villages in wooded areas located in Cote d'Ivoire. The parasitologic survey consisted of blood-free skin snips taken from both iliac crests of all subjects one year or over. Microfilarial counts performed after soaking biopsy material in distilled water for 30 minutes allowed characterization of the disease in the area. Overall microfilariae were found in 60.51% of the population indicating that onchocerciasis was highly endemic. The level of endemicity varied from one village to another. Prevalence was same in the two sexes and increased with age. Microfilarial density was the same in men and women up to the age of 9 years. After that time the density was at least twofold higher in men than in women at the same age. Although onchocerciasis is highly endemic in the area, blindness is uncommon. PMID:8767795

  8. Evaluation of selected antiprotozoal drugs in the Babesia microti-hamster model.

    PubMed Central

    Marley, S E; Eberhard, M L; Steurer, F J; Ellis, W L; McGreevy, P B; Ruebush, T K

    1997-01-01

    The presently used therapy for Babesia microti infections, a combination of quinine and clindamycin, does not always result in parasitologic cures. To identify possible alternative chemotherapeutic agents for such infections, we screened, in the hamster-B. microti system, 12 antiprotozoal drugs that have either recently been released for human use or were in experimental stages of development at the Walter Reed Army Institute of Research for the treatment of malaria and leishmaniasis. Several well-recognized antimalarial drugs, such as mefloquine, halofantrine, artesunate, and artelenic acid, exhibited little or no effect on parasitemia. Two 8-aminoquinolines, WR006026 [8-(6-diethylaminohexylamino)-6-methoxy-4-methylquinoline dihydrochloride] and WR238605 [8-[(4-amino-1-methylbutyl)amino]-2,6-dimethoxy-4-methyl-5 -(3-trifluoromethylphenoxy-7) quinoline succinate], produced clearance of patent parasitemia. Furthermore, blood from infected hamsters treated with WR238605 via an intramuscular injection failed to infect naive hamsters on subpassage, thus producing a parasitologic cure. These two compounds merit further screening in other systems and may prove useful in treating human babesiosis. PMID:8980761

  9. Helminths found in marmosets (Callithrix penicillata and Callithrixjacchus) introduced to the region of occurrence of golden lion tamarins (Leontopithecusrosalia) in Brazil.

    PubMed

    dos Santos Sales, Indiara; Ruiz-Miranda, Carlos Ramon; de Paula Santos, Clóvis

    2010-07-15

    The introduction of exotic species can increase the risk of extinction of native species through the introduction of new diseases, predation or resource competition. The marmosets Callithrix penicillata and Callithrix jacchus and hybrids of these two species have been introduced to privately owned forests in the lowland Atlantic forest of the Rio de Janeiro State in Brazil, the region of occurrence of the endangered golden lion tamarin, Leontopithecus rosalia. Because the ecology and biology of the marmosets and tamarins is similar, there is a reasonable risk that the marmosets would transmit pathogens such as endo parasites. The objective of this study was to identify the helminth fauna present in the introduced marmosets through an analysis of fecal samples of wild caught animals, and to evaluate the parasitological profile according to age, sex and geographical location. Eggs belonging to the Acanthocephala and Nematoda were found in the feces. One nematode egg type was identified as being Primasubulura jacchi. The ocurrence of nematodes was higher in males, acanthocephala were found in all age groups and sexes and P. jacchi was found with higher frequency in adult females. The geographic distribution analysis revealed that some of the forests had a higher predominance of parasites. Little is known about the pathology of parasites in free living Neotropical mammals, and this knowledge would be necessary to infer about the risk (form a parasitological standpoint) that the marmoset presence represents for the survival of the endangered golden lion tamarin. PMID:20378249

  10. Response of falciparum malaria to different antimalarials in Myanmar.

    PubMed Central

    Ejov, M. N.; Tun, T.; Aung, S.; Sein, K.

    1999-01-01

    The purpose of the study was to ascertain the therapeutic efficacy of different treatments for uncomplicated falciparum malaria in the hospitals in Sagaing, northern and eastern Shan, to facilitate updating the existing national antimalarial drug policy. The proposed 14-day trial for monitoring the efficacy of treatments of uncomplicated falciparum malaria is an efficient method for identifying treatment failure patterns at the intermediate level (township hospital) in the Union of Myanmar. Minimal clinical and parasitological data for days 0-14 were required to classify treatment failure and success. Clinical and parasitiological responses on day 3 and days 4-14 were used as clear examples of early and late treatment failure, respectively. Mefloquine is five times more likely to be effective than chloroquine and sulfadoxine pyrimethamine (S-P), whereas chloroquine and S-P treatments have nearly identical failure patterns. The alarming frequency of clinical and parasitological failure (failure rate > 50%) following chloroquine treatment was reported in Sagaing and following S-P treatment in Sagaing and eastern Shan. PMID:10212515

  11. Preventive prospective of triclosan and triclosan-liposomal nanoparticles against experimental infection with a cystogenic ME49 strain of Toxoplasma gondii.

    PubMed

    El-Zawawy, Lobna A; El-Said, Doaa; Mossallam, Shereen F; Ramadan, Heba S; Younis, Salwa S

    2015-01-01

    The preventative effect of triclosan (TS) and TS liposomal nanoparticles was studied on the early establishment of chronic infection with Toxoplasma gondii (T. gondii). Swiss albino mice were orally infected with 10 cysts of avirulent ME49 strain of T. gondii, and 2 weeks later they were orally treated with dual daily doses of 200mg/kg and 120 mg/kg TS and TS liposomes for 30 days; respectively. Effect of TS and TS liposomes was parasitologically and ultrastructurally evaluated, versus infected non-treated control. Their safety was biochemically assessed. Parasitologically, both TS and TS liposomes induced significant reduction in mice mortality, brain parasite burden and infectivity of cysts obtained from the brains of treated mice. Ultrastructurally, scanning electron microscopy of cysts obtained from infected mice treated with either TS or TS liposomes showed surface irregularities, protrusions and depressions. Transmission electron microscopy revealed disintegration of the cyst wall and vacuolation of the bradyzoites with disintegration of plasma membranes of both cysts and bradyzoites whether treated with TS or TS liposomes. Biochemical study reflected the safety of the TS and TS liposomes. Therefore, TS proved an effective, promising and safe preventive drug against early establishment of chronic toxoplasmosis. Loading TS on liposomes marginally enhanced its efficacy against T. gondii cysts yet allowed its use in a lower dose. PMID:25305510

  12. Clinical laboratory proficiency test performance. Its relationship to structural, process and environmental variables.

    PubMed

    Peddecord, K M; Cada, R L

    1980-03-01

    This comparative analysis of clinical laboratories was intended to develop a more quantitative understanding of environmental, structural, and process variables and their relationships to the quality of laboratory services. The quality of laboratory services was defined as analytic capability demonstrated on proficiency-test specimens of the College of American Pathologists. Independent variables describing the laboratory environment, as well as structural and process aspects of management, were obtained from management reports, staffing records, and workload reports. Although correlations between the eight proficiency testing indices and the independent variables were generally low, a number of significant correlates were evident in three areas: bacteriology, parasitology, and qualitative hematology. Environmental variables describing organizational size were related to proficiency, as were variables dealing with accreditation by the College of American Pathologists and time accredited by the College of American Pathologists. The education and experience of personnel and the percentage of specialized supervisors were related to proficiency-testing success in bacteriology and parasitology. Empirical evidence suggests that the size of the laboratory indirectly affects proficiency in these three tested areas. Presumably, this relationship is mediated through specialization of work and reinforcement of learning. Few significant correlates were evident in the five remaining areas tested: chemistry, quantitative hematology, blood bank, immunology, and syphilis serology. Despite the concentration of personnel resources and other assets in larger laboratories, size appeared to have no effect on proficiency-testing performance in these five areas. PMID:7361716

  13. Sicarius uncinipenis and Deletrocephalus cesarpintoi in captive greater rheas of Minas Gerais State, Brazil.

    PubMed

    Avelar, Isabela de Oliveira; Almeida, Lara Ribeiro de; Santos, Hudson Andrade Dos; Lima, Walter Dos Santos; Lara, Leonardo Bôscoli; Ecco, Roselene

    2014-01-01

    The present study details the pathological and parasitological findings of parasitic ventriculitis and nematode infections in the large intestines of two female Rhea americana americana birds. The birds were housed in captivity, and both exhibited poor body condition and lethargy. The rheas were sent to the Veterinary Hospital of the Veterinary School, Universidade Federal de Minas Gerais (UFMG) and, despite medical care, the clinical condition of the birds did not improve. The birds died two days after admission, and were submitted to necropsy. Gross, histopathology and parasitological analysis resulted in the identification of Sicarius uncinipenis, which is associated with parasitic ventriculitis, while Deletrocephalus cesarpintoi was identified in the large intestine of both rheas. The apparent clinical indications, including loss of appetite and death, combined with the discovery of numerous parasites and other pathology changes, supported the conclusion that the death of the birds was caused by the parasitic infection. Further investigations of these infections in free-living and captive rheas are required, such that accurate data on the incidence and pathogenicity of these parasites can be obtained. PMID:25271456

  14. Jane: a new tool for the cophylogeny reconstruction problem

    PubMed Central

    2010-01-01

    Background This paper describes the theory and implementation of a new software tool, called Jane, for the study of historical associations. This problem arises in parasitology (associations of hosts and parasites), molecular systematics (associations of orderings and genes), and biogeography (associations of regions and orderings). The underlying problem is that of reconciling pairs of trees subject to biologically plausible events and costs associated with these events. Existing software tools for this problem have strengths and limitations, and the new Jane tool described here provides functionality that complements existing tools. Results The Jane software tool uses a polynomial time dynamic programming algorithm in conjunction with a genetic algorithm to find very good, and often optimal, solutions even for relatively large pairs of trees. The tool allows the user to provide rich timing information on both the host and parasite trees. In addition the user can limit host switch distance and specify multiple host switch costs by specifying regions in the host tree and costs for host switches between pairs of regions. Jane also provides a graphical user interface that allows the user to interactively experiment with modifications to the solutions found by the program. Conclusions Jane is shown to be a useful tool for cophylogenetic reconstruction. Its functionality complements existing tools and it is therefore likely to be of use to researchers in the areas of parasitology, molecular systematics, and biogeography. PMID:20181081

  15. Clinical-epidemiologic profile of the schistosomal myeloradiculopathy in Pernambuco, Brazil.

    PubMed

    Araújo, Karina Conceição G M de; Silva, Cristiana da Rosa e; Santos, Alexsandra Glória A dos; Barbosa, Constança Simões; Ferrari, Teresa C A

    2010-07-01

    This was a retrospective descriptive study on a series of cases of schistosomal myeloradiculopathy (SMR) and the aim was to investigate the incidence of this disease and its clinical and epidemiological characteristics in cases diagnosed at three healthcare units in Pernambuco, Brazil between 1994-2006. The data were collected by reviewing the medical records from both the neurological and paediatric outpatient clinics and wards of the Hospital Clinics, Hospital of the Restoration and Pernambuco Mother and Child Institute. To gather the data, a spinal cord schistosomiasis evaluation protocol was used. The diagnoses were based on positive epidemiological evidence of schistosomiasis, clinical findings and laboratory tests (stool parasitological examination or rectal biopsies, magnetic resonance imaging findings and cerebrospinal fluid investigations). A total of 139 cases aged between 2-83 years were found. The most important determinants of SMR were male sex (66.2%), contact with fresh water (91%), origin in endemic regions (39.5%), lower-limb muscle weakness (100%), sensory level at the lower thoracic medulla (40.3%), myeloradicular form (76%) and presence of eggs in the stool parasitological examination (48%). This sample indicates the need for intervention policies guided by diagnostic standardization, thereby avoiding disease under-notification. PMID:20721490

  16. [A rare gastroenteritis pathogen: Cyclospora].

    PubMed

    Ta?bakan, Meltem; Yolasi?maz, Ay?egül; Pullukçu, Hüsnü; S?pah?, O?uz Re?at; Yamazhan, Tansu; Turgay, Nevin; Ulusoy, Sercan

    2010-01-01

    Cyclospora spp. which are coccidian parasites are rare gastroenteritis pathogens. The first cyclosporiasis case in Turkey was reported in 1998 in a patient with AIDS. In this paper we report a case of Cyclospora gastroenteritis, in a patient who was admitted to our hospital and who had had diarrhea, abdominal pain and nausea for ten days. In the anamnesis it was learned that he had travelled to the Black Sea region and had drunk muddy and cloudy water. His physical examination was normal except for increased bowel sounds. There were no leukocytes or erythrocytes in the direct microscopy of the stool and bacteriologic culture did not yield any enteropathogen. Cylospora oocyysts were seen in the parasitologic exmination. The patient was treated with cotrimaxasole (2x1,160/800 mg tablet). There was no pathogen in the repeated stool examination. Our case suggests that parasitologic examination should not be neglected in longlasting diarrhea cases and occasionally Cyclospora may be the causative agent. PMID:20597053

  17. [Epidemiology of urinary schistosomiasis among school children in Péhunco area, Northern Benin. Malacological survey].

    PubMed

    Ibikounlé, M; Ogouyèmi-Hounto, A; de Tové, Y Sissinto Savi; Dansou, A; Courtin, D; Kindé-Gazard, D; Mouahid, G; Moné, H; Massougbodji, A

    2014-08-01

    Schistosomiasis is a public health problem in Benin but prevalence estimates vary widely. Parasitological (from May to September 2010) and malacological surveys (from September 2010 to June 2012) were conducted to determine the current status of urinary schistosomiasis among 1 585 schoolchildren from 18 primary schools of Péhunco area, North-West Benin, using two parasitological tests. Pupils were enrolled with a mean age of 11 years (from 7 to 16 years-old age) and 51.48% of them were girls. Urines samples were examined using both urine reagent strips and filtration method. Structured questionnaires were used to identify environmental and socio-economic factors. Malacological surveys were conducted to ascertain general freshwater snail diversity and specific diversity of the schistosome host snails. The results showed a general prevalence of 29.40% with boys (36.67%) significantly more affected than girls (22.55%). Among the 844 collected snails, 5 species freshwater snails were identified: two species known as potential schistosome intermediate host snails, Bulinus forskalii and B. globosus, and three species known as non-schistosome transmitting snails Lymnaea natalensis, Physa marmorata and Melanoides tuberculata. B. forskalii was a most largely distributed snail and none of snails were found naturally infected by schistosome. No freshwater snails were found naturally infected by schistosome. PMID:24615433

  18. In memoriam: Adriano Mantovani, DVM, 1926-2012. One of the world's most prominent contributors to veterinary public health and a committed advocate of the importance of One Medicine.

    PubMed

    2012-01-01

    Adriano Mantovani was born in 1926 in Altedo, Malalbergo (Bologna). After graduating in veterinary medicine from Bologna University in 1948, he gained his Masters in public health from the University of Minnesota in 1952 and qualified to lecture in microbiology and immunology in 1957 and in parasitology in 1963. He held numerous positions over the years: Assistant, Aide and Vice-Director of the Istituto Zooprofilattico Sperimentale di Teramo(1949-1962), Researcher at the Faculty of Medicine in Rome (1962-1965), Professor of Infectious Diseases, Prophylaxis and Veterinary Police Work at the Faculty of Veterinary Medicine in Bologna, Director of the Institute of the same name (1965-1982) and Research Manager and Director of the Parasitology Laboratory at the Italian National Institute of Health and the WHO/FAO Collaboration Centre for Veterinary Public Health in Rome (1983-1991). He was active in numerous national and international organisations, including as a member of the National Health Council (1974-1982), Secretary of the World Federation of Parasitologists (1971-1987) and from 1972 President, Vice President or presenter in various WHO, FAO and OIE working groups. He worked in numerous countries in Africa, Asia, Europe, Latin America and North America as an expert, presenter and lecturer. From 1978, the year in which the Mediterranean Zoonoses Control Plan was established, he was one of the major collaborators of the WHO Mediterranean Zoonoses Control Centre in Athens (MZCC). In 1989, he was the first Italian to be awarded the OIE's international award for contributions to veterinary public health and in 2001 was publicly recognised by the MZCC for his many years of activities carried out to support the zoonoses control plan and promote well-being in the Mediterranean. He had been a member of the Italian National Guard's Commission for Predicting and Preventing Great Risks since 1994. In 2002, he was presented with the Italian Parasitology Society's Battista Grassi medal. He covered leading roles in the executive boards of various Italian and international scientific associations, including the Italian Small Animal Veterinary Association, the World Association for the Advancement of Veterinary Parasitology, the Italian Society of Tropical Medicine, the Italian Society of Parasitology, the World Association for the History of Veterinary Medicine and the World Small Animal Veterinary Association. Professor Mantovani's principal areas of activity were in veterinary public health, above all the epidemiology and control of zoonoses and animal diseases, veterinary urban hygiene, health education and veterinary actions in emergency situations. His interests were not limited to transmissible diseases but included all problems connected with the relationship between humans, animals and the environment in both urban and rural areas, especially disadvantaged areas. He was particularly involved in the development and organisation of public veterinary services, the social and economic aspects of health and animal production and prevention and control activities. He was a committed advocate of the overriding importance of One Medicine and inter- and intra-professional cooperation. He authored over 250 publications. PMID:22485009

  19. Obituary

    PubMed

    Khalil

    1998-09-01

    Sheila Willmott, (1921-1998)CAB International and the Editor, Assistant Editor and Editorial Board of the Journal of Helminthology wish to express their deepest sympathy to the family and friends of Sheila Willmott who died on 8 May 1998 after a very short illness. Sheila served as Editor of the Journal of Helminthology from 1980 to 1986.Dr Lotfi Khalil, formerly Deputy Director of the International Institute of Parasitology at St Albans, worked closely with Sheila and has written the following tribute.John W. Lewis, EditorSheila Willmott was a leading contributor to the dissemination of parasitic information before the development of computerization and information technology. She was born on 8 June, 1921, in London, and was educated at Tollington High School for Girls, Chelsea Polytechnic and University College, London. She did her PhD at the London School of Hygiene and Tropical Medicine under the supervision of Professor John Buckley, the subject of her thesis being the study of amphistome digeneans. Her studies were interrupted as a result of the Second World War when she was 'drafted' as a Rodent Instructor at the Ministry of Agriculture, Fisheries and Food. After completing her PhD, she was appointed Assistant Lecturer in Zoology at the University College of South Wales and Monmouthshire, Cardiff. In 1951, Professor R.T. Leiper, the Director of the Bureau of Agricultural Parasitology (Helminthology) recruited her as a Scientific Information Officer. She was appointed Assistant Director of the Bureau in 1954, and Director in 1961, where she stayed until her retirement in 1980.During her period as Director of the Bureau, which was sited in the White House in the centre of St Albans, she maintained and improved the high quality of Helminthological Abstracts and, in 1976, accepted the extra burden of starting and producing Protozoological Abstracts. In 1979, she initiated and edited a primary journal, Systematic Parasitology, devoted to papers on the taxonomy and systematics of parasites, published by Junk. The activities of the Bureau were greatly expanded and she initiated the taxonomic laboratories to provide a worldwide service for the identification of animal helminths and plant-parasitic nematodes and to undertake taxonomic research. A vast helminth reference collection was started, and the Bureau became a recognized centre for the deposition of type specimens. The library of the Bureau accumulated an enormous number of reference books, journals and reprints, and provided a photocopying service supplying, at short notice, copies of papers and publications. A number of books and other publications, including the CIH Keys to the Nematode Parasites of Vertebrates, were produced and edited by her and others. She also persuaded the Natural Environment Research Council to finance the Fisheries Helminthology Unit which she established at the Bureau in 1960, where it remained until it was transferred to Plymouth as part of the Institute for Marine Environmental Research. The Bureau's name and status were changed to the Commonwealth Institute of Helminthology, Commonwealth Institute of Parasitology and, finally, the International Institute of Parasitology.As Director, she travelled extensively and visited Commonwealth and other countries, where she gave a number of seminars on information services and the work of the Institute and the Commonwealth Agricultural Bureaux (CAB) as a whole. She encouraged contact with Eastern Europe and visited Poland, Czechoslovakia, Hungary, Bulgaria and the USSR. She initiated the system of exchange publications with these countries, and this resulted in the exposure of the literature from these countries to other research workers when abstracts of these papers appeared in Helminthological Abstracts in English. Her links with Eastern Europe resulted in her editing three volumes of taxonomic monographs produced in English by Czech and Russian scientists. (ABSTRACT TRUNCATED) PMID:9765367

  20. Management of febrile children under five years in hospitals and health centres of rural Ghana

    PubMed Central

    2014-01-01

    Background The case management of febrile children in hospitals’ and health centres’ pre-roll out of the new WHO policy on parasitological diagnosis was assessed. The delivery of artemisinin combination therapy (ACT) at these two levels of the health system was compared. Methods Structured observations and exit interviews of 1,222 febrile children attending five hospitals and 861 attending ten health centres were conducted in six districts of the Brong Ahafo Region of Ghana. Effectiveness of delivery of case management of malaria was assessed. Proportions of children receiving ACT, anti-malarial monotherapy and antibiotics were described. Predictors of: a febrile child being given an ACT, a febrile child being given an antibiotic and of carers knowing how to correctly administer the ACT were assessed using logistic regression models stratified by hospitals and health centres. Results The system’s effectiveness of delivering an ACT to febrile children diagnosed with malaria (parasitologically or clinically) was 31.4 and 42.4% in hospitals and health centres, respectively. The most ineffective process was that of ensuring that carers knew how to correctly administer the ACT. Overall 278 children who were not given an ACT were treated with anti-malarial monotherapy other than quinine. The majority of these children, 232/278 were given amodiaquine, 139 of these were children attending hospitals and 93 attending health centres. The cadre of health staff conducting consultation was a common predictor of the outcomes of interest. Presenting symptoms and examinations conducted were predictive of being given an ACT in hospitals and antibiotic in hospitals and health centres but not of being given an ACT in health centres. Treatment-seeking factors were predictive of being given an ACT if it was more than seven days since the fever began and an antibiotic in hospitals but not in health centres. Conclusion Interventions to improve adherence to negative parasitological tests are needed, together with guidance on dispensing of antibiotics, but improving the education of carers on how to administer ACT will lead to the greatest immediate increase in the effectiveness of case management. Guidance is needed on implementation of the new test-based treatment for malaria policy in health facilities. PMID:25008574

  1. Geographical patterns and predictors of malaria risk in Zambia: Bayesian geostatistical modelling of the 2006 Zambia national malaria indicator survey (ZMIS)

    PubMed Central

    2010-01-01

    Background The Zambia Malaria Indicator Survey (ZMIS) of 2006 was the first nation-wide malaria survey, which combined parasitological data with other malaria indicators such as net use, indoor residual spraying and household related aspects. The survey was carried out by the Zambian Ministry of Health and partners with the objective of estimating the coverage of interventions and malaria related burden in children less than five years. In this study, the ZMIS data were analysed in order (i) to estimate an empirical high-resolution parasitological risk map in the country and (ii) to assess the relation between malaria interventions and parasitaemia risk after adjusting for environmental and socio-economic confounders. Methods The parasitological risk was predicted from Bayesian geostatistical and spatially independent models relating parasitaemia risk and environmental/climatic predictors of malaria. A number of models were fitted to capture the (potential) non-linearity in the malaria-environment relation and to identify the elapsing time between environmental effects and parasitaemia risk. These models included covariates (a) in categorical scales and (b) in penalized and basis splines terms. Different model validation methods were used to identify the best fitting model. Model-based risk predictions at unobserved locations were obtained via Bayesian predictive distributions for the best fitting model. Results Model validation indicated that linear environmental predictors were able to fit the data as well as or even better than more complex non-linear terms and that the data do not support spatial dependence. Overall the averaged population-adjusted parasitaemia risk was 20.0% in children less than five years with the highest risk predicted in the northern (38.3%) province. The odds of parasitaemia in children living in a household with at least one bed net decreases by 40% (CI: 12%, 61%) compared to those without bed nets. Conclusions The map of parasitaemia risk together with the prediction error and the population at risk give an important overview of the malaria situation in Zambia. These maps can assist to achieve better resource allocation, health management and to target additional interventions to reduce the burden of malaria in Zambia significantly. Repeated surveys will enable the evaluation of the effectiveness of on-going interventions. PMID:20122148

  2. Efficacy of 5-Nitroimidazoles for the Treatment of Giardiasis: A Systematic Review of Randomized Controlled Trials

    PubMed Central

    Deshpande, Abhishek; Thota, Priyaleela; Roman, Yuani; Hernandez, Adrian V.

    2014-01-01

    Background Giardiasis is one of the most common causes of diarrheal disease worldwide and 5-nitroimidazoles (5-NI) are the most commonly prescribed drugs for the treatment of giardiasis. We evaluated the efficacy of 5-nitroimidazoles (5-NI) in the treatment of giardiasis in a systematic review of randomized controlled trials (RCTs). Methodology/Principal Findings We conducted a comprehensive literature search in PubMed-Medline, Scopus, Web of Science and Cochrane Library for RCTs evaluating the efficacy of 5-NI vs. control (placebo or active treatment) on parasitological cure in patients with parasitologically-demonstrated giardiasis. The search was performed in May 2013 with no language restriction by two authors independently. The efficacy outcome was parasitological cure, and harmful outcomes were abdominal pain, bitter or metallic taste, and headache. We included 30 RCTs (n?=?3,930). There was a significant and slightly higher response rate with 5-NI in giardiasis treatment (RR 1.06, 95%CI 1.02–1.11, p?=?0.005). There was high heterogeneity among studies (I2?=?72%). The response rates for metronidazole, tinidazole and secnidazole were similar (RR 1.05, 95%CI 1.01–1.09, p?=?0.01; RR 1.32 95%CI 1.10–1.59, p?=?0.003; and RR 1.18 95%CI 0.93–1.449, p?=?0.18, respectively). On subgroup analyses, the response rates did not vary substantially and high heterogeneity persisted (I2?=?57%–80%). Harmful outcomes were uncommon, and 5-NIs were associated with lower risk of abdominal pain, and higher risk of both bitter or metallic taste and headache. Conclusions Studies investigating the efficacy of 5-NI in giardiasis treatment are highly heterogeneous. 5-NIs have a slightly better efficacy and worse profile for mild harmful outcomes in the treatment of giardiasis in comparison to controls. Larger high quality RCTs are needed to further assess efficacy and safety profiles of 5-NI. PMID:24625554

  3. Quality of uncomplicated malaria case management in Ghana among insured and uninsured patients

    PubMed Central

    2014-01-01

    Introduction The National Health Insurance Act, 2003 (Act 650) established the National Health Insurance Scheme (NHIS) in Ghana with the aim of increasing access to health care and improving the quality of basic health care services for all citizens. The main objective is to assess the effect of health insurance on the quality of case management for patients with uncomplicated malaria, ascertaining any significant differences in treatment between insured and non-insured patients. Method A structured questionnaire was used to collect data from 523 respondents diagnosed with malaria and prescribed malaria drugs from public and private health facilities in 3 districts across Ghana’s three ecological zones. Collected information included initial examinations performed on patients (temperature, weight, age, blood pressure and pulse); observations of malaria symptoms by trained staff, laboratory tests conducted and type of drugs prescribed. Insurance status of patients, age, gender, education level and occupation were asked in the interviews. Results Of the 523 patients interviewed, only 40 (8%) were uninsured. Routine recording of the patients’ age, weight, and temperature was high in all the facilities. In general, assessments needed to identify suspected malaria were low in all the facilities with hot body/fever and headache ranking the highest and convulsion ranking the lowest. Parasitological assessments in all the facilities were also very low. All patients interviewed were prescribed ACTs which is in adherence to the drug of choice for malaria treatment in Ghana. However, there were no significant differences in the quality of malaria treatment given to the uninsured and insured patients. Conclusion Adherence to the standard protocol of malaria treatment is low. This is especially the case for parasitological confirmation of all suspected malaria patients before treatment with an antimalarial as currently recommended for the effective management of malaria in the country. The results show that about 16 percent of total sample were parasitologically tested. Effective management of the disease demands proper diagnosis and treatment and therefore facilities need to be adequately supplied with RDTs or be equipped with well functioning laboratories to provide adequate testing. PMID:25056139

  4. Clinical, laboratory and ultrasonography features of proven human fascioliasis.

    PubMed

    Haseeb, Ahmed N; El-Shazly, Atef M; Arafa, Magdy A S; Morsy, Ayman T A

    2003-08-01

    Examination of twenty parasitologically proven human cases of fascioliasis showed the following clinical, laboratory and ultrasonography results: (1) Both sexes are susceptible to fascioliasis. The smallest one was a child 3-year old. (2) The most important clinical manifestations are: a- abdominal distention and flatulence (30%), b- right upper quadrant pains (25%), colicky abdominal pains (25%), d- pallor (25%), and etympanitic abdomen (25%). Nevertheless, 15% of the patients showed no symptoms. (3) The most significant items in the CBC and liver function tests are: a- significantly high eosinophilia, b-high alkaline phosphatase, and c- low haemoglobin. Besides, two fascioliasis patients had high serum bilirubin. (4) Ultrasonography diagnosed only nine fascioliasis patients (45%). The result was critically discussed. PMID:14964655

  5. Urogenital myiasis caused by Psychoda albipennis in a child

    PubMed Central

    Demir, Ay?egül Do?an; Iraz, Meryem; ?pek, Duygu Neval Say?n

    2015-01-01

    Urogenital myiasis results when flies lay their eggs near the exit of the urethra and the larvae proceed upward along the urogenital tract. In this case report, a 10 year-old female patient diagnosed with urogenital myiasis was reported. The patient presented with complaints including painful and frequent urination, genital pruritus and moving larvae in urine. The patient had received Enterobius vermicularis treatment previously for two times. A 24-hour urine sample was collected and two black larvae were found in the urine. It was found that these larvae were fourth-stage larvae of Psychoda albipennis. Although there was no risk factor, the patient was affected with this rare parasitological disease. This case was presented to draw attention to myiasis in children. Myiasis may be observed in individuals with a favourable hygiene status and a high socioeconomical level. If a detailed history is not taken and appropriate laboratory tests are not performed, the diagnosis may be missed.

  6. Redescription of Clinostomum phalacrocoracis metacercariae (Digenea: Clinostomidae) in cichlids from Lake Kinneret, Israel.

    PubMed

    Caffara, Monica; Davidovich, Nadav; Falk, Rama; Smirnov, Margarita; Ofek, Tamir; Cummings, David; Gustinelli, Andrea; Fioravanti, Maria L

    2014-01-01

    Clinostomidae are digeneans characterized by a complex taxonomic history, continuously under revision based on both morphological and molecular analysis. Among the 14 species considered valid so far Clinostomum phalacrocoracis has been well described only at the adult stage, whereas the morphology of the metacercarial stage has been reported only once. During a parasitological survey carried out on 262 wild cichlids sampled from Lake Kinneret (Israel) metacercariae referable to C. phalacrocoracis were found in 18 fingerlings. In this study, we report this clinostomid species for the first time in wild fish from Israel describing the metacercarial stage of Clinostomum phalacrocoracis, coupling its morphological description with molecular analysis carried out on ITS rDNA and COI mtDNA sequences. PMID:24986336

  7. Detection of Schistosoma mansoni Antibodies in a Low-Endemicity Area Using Indirect Immunofluorescence and Circumoval Precipitin Test

    PubMed Central

    Carvalho do Espírito-Santo, Maria Cristina; Pinto, Pedro Luiz; Gargioni, Cybele; Viviana Alvarado-Mora, Monica; Pagliusi Castilho, Vera Lúcia; Pinho, João Ranato Rebello; de Albuquerque Luna, Expedito José; Borges Gryschek, Ronaldo Cesar

    2014-01-01

    Parasitological diagnostic methods for schistosomiasis lack sensitivity, especially in regions of low endemicity. The objective of this study was to determine the prevalence of Schistosoma mansoni infections by antibody detection using the indirect immunofluorescence assay (IFA-IgM) and circumoval precipitin test (COPT). Serum samples of 572 individuals were randomly selected. The IFA-IgM and COPT were used to detect anti-S. mansoni antibodies. Of the patients studied, 15.9% (N = 91) were IFA-IgM positive and 5.1% (N = 29) had COPT reactions (P < 0.001 by McNemar's test). Immunodiagnostic techniques showed higher infection prevalence than had been previously estimated. This study suggests that combined use of these diagnostic tools could be useful for the diagnosis of schistosomiasis in epidemiological studies in areas of low endemicity. PMID:24639303

  8. A Case of Secondary Ophthalmomyiasis Caused by Chrysomya bezziana (Diptera: Calliphoridae)

    PubMed Central

    Berenji, Fariba; Hosseini-Farash, Bibi Razieh; Marvi-Moghadam, Narges

    2015-01-01

    Myiasis is the invasion of vertebrates' tissue by the larvae of a fly of the order Diptera. The objective of this paper is to present a rare case of secondary myiasis of ocular infestation by Chrysomya bezziana. A 55-year-old female from Sar village of Mazandaran Province, northern Iran), referred to Khatam Al-Anbia Hospital of Mashhad with extensive destruction of left orbital cavity. Existence of larvae was the major complaint in recent months. Some live larvae were removed from her destructed left eye. Primary diagnosis was myiasis of left upper lid (LUL) and suspected recurrent Basal cell carcinoma (BCC). The laboratory diagnosis was done in parasitology lab of Imam Reza Hospital of Mashhad and collected larvae were identified and confirmed to be larvae of the C. bezziana (Diptera: Calliphoridae). It is a case report of secondary ophtalmiomyiasis due to C. bezziana of a patient lives in Mazandaran Province.

  9. Decisions for the future

    PubMed Central

    Horii, Toshihiro

    2014-01-01

    Music and science have always been my passion. Ultimately, though, the scale was tipped in favor of science. And I lived out my science dreams in trying to grasp as many facets of it as possible. As a biologist, I didn’t stay in one stream and thus, I have embraced not only molecular biology but parasitology as well. This was way back 1980s, when such a research career was viewed highly unusual in a Japanese context. My commitment to malaria and vaccine development follows the same path. I believe one has to integrate knowledge on a wide variety of academic fields— gene expressions, protein structure, epidemiology, immunology—to achieve significant success. Similar to life itself, one has to be prepared well to be able to accept and interpret as widely as possible what one may term as “accidental results” or “accidental elements.” PMID:24832717

  10. Epidemiology of seasonal falciparum malaria in an urban area of Senegal

    PubMed Central

    Vercruysse, J.; Jancloes, M.; Van de Velden, L.

    1983-01-01

    A 15-month longitudinal survey was carried out to examine entomological and parasitological aspects of human malaria transmission in Pikine, a city located in the Sudan savanna zone on the Cap Vert peninsula in the west of Senegal. The anopheline population was sampled twice weekly indoors by night human bait capture. During the same period, thick and thin blood films were collected from 296 children at 2-month intervals. Anopheles arabiensis was the only species responsible for transmission of Plasmodium falciparum. The parasite rate showed a positive correlation with both the entomological inoculation rate and the vectorial capacity. In Pikine, malaria is epidemic and probably unstable, and the population enjoys a variable degree of immunity. PMID:6360402

  11. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  12. Checklist of Helminth parasites of Amphibians from South America.

    PubMed

    Campião, Karla Magalhães; Morais, Drausio Honorio; Dias, Olívia Tavares; Aguiar, Aline; Toledo, Gislayne; Tavares, Luiz Eduardo Roland; Da Silva, Reinaldo José

    2014-01-01

    Parasitological studies on helminths of amphibians in South America have increased in the past few years. Here, we present a list with summarized data published on helminths of South American amphibians from 1925 to 2012, including a list of helminth parasites, host species, and geographic records. We found 194 reports of helminths parasitizing 185 amphibian species from eleven countries: Argentina, Brazil, Chile, Colombia, Equador, French Guyana, Guyana, Paraguay, Peru, Uruguay and Venezuela. Helminth biodiversity includes 278 parasite species of the groups Acanthocephala, Nematoda, Cestoda, Monogenea and Trematoda. A list of helminth parasite species per host, and references are also presented. This contribution aims to document the biodiversity of helminth parasites in South American amphibians, as well as identify gaps in our knowledge, which in turn may guide subsequent studies.  PMID:25082165

  13. Molecular Identification of Leishmania Species Using Samples Obtained from Negative Stained Smears

    PubMed Central

    Mohaghegh, MA; Fata, A; Salehi, GH; Berenji, F; bazzaz, M Mousavi; Rafatpanah, H; Parian, M; Movahedi, A

    2013-01-01

    Background Cutaneous Leishmaniasis (CL) is a parasitic skin disease. Diagnosis primarily is based on clinical signs and microscopic observation of parasite on direct stained smears or tissue sections. Sensitivity of direct smear is not as high as molecular methods. The aim of this study was to identify and characterize Leishmania species among the negative direct smears obtained from skin ulcers suspected to CL by PCR method. Methods Among 81 patients with suspicious skin lesions to CL referred to the Parasitology lab, negative Giemsa stained smears were collected. DNA extraction performed by scraping stained smears, then PCR was performed. Results Among the DNA extracted from smears, L. tropica was isolated from 9 (11.1%) of the smears and L.major was not isolated from any samples. Conclusion Direct microscopy on stained smears for diagnosis of leishmaniasis is not enough accurate. PCR is recommended for clinically suspected lesions with negative result of direct smear. PMID:23914250

  14. Identification of Leishmania infantum in Puerto Iguazú, Misiones, Argentina.

    PubMed

    Acosta, Lucrecia; Díaz, Ricardo; Torres, Pedro; Silva, Gustavo; Ramos, Marina; Fattore, Gladys; Deschutter, Enrique J; Bornay-Llinares, Fernando J

    2015-01-01

    The emergence of zoonotic visceral leishmaniasis (ZVL) in Latin America is a growing public health problem. The urbanization of ZVL has been observed in different countries around the world, and there are a growing number of reports drawing attention to the emergence of this infection in new locations, as well as its increase in previously established areas of endemicity. In the city of Posadas, Misiones province, Northeastern Argentina, the transmission of ZVL associated with canines and Lutzomyia longipalpis was first reported in 2006. In the city of Puerto Iguazú, also in Misiones province, the first human case of ZVL was reported in February 2014. From 209 surveyed dogs, 15 (7.17%) were identified as positive by serological and/or parasitological methods. Amplification was observed in 14 samples and in all cases the species implicated was Leishmania infantum. To the authors' knowledge, this is the first molecular characterization of L. infantum from dogs in this area. PMID:25923899

  15. IDENTIFICATION OF Leishmania infantum IN PUERTO IGUAZÚ, MISIONES, ARGENTINA

    PubMed Central

    ACOSTA, Lucrecia; DÍAZ, Ricardo; TORRES, Pedro; SILVA, Gustavo; RAMOS, Marina; FATTORE, Gladys; DESCHUTTER, Enrique J.; BORNAY-LLINARES, Fernando J.

    2015-01-01

     The emergence of zoonotic visceral leishmaniasis (ZVL) in Latin America is a growing public health problem. The urbanization of ZVL has been observed in different countries around the world, and there are a growing number of reports drawing attention to the emergence of this infection in new locations, as well as its increase in previously established areas of endemicity. In the city of Posadas, Misiones province, Northeastern Argentina, the transmission of ZVL associated with canines and Lutzomyia longipalpis was first reported in 2006. In the city of Puerto Iguazú, also in Misiones province, the first human case of ZVL was reported in February 2014. From 209 surveyed dogs, 15 (7.17%) were identified as positive by serological and/or parasitological methods. Amplification was observed in 14 samples and in all cases the species implicated was Leishmania infantum. To the authors’ knowledge, this is the first molecular characterization of L. infantum from dogs in this area. PMID:25923899

  16. A report on the genital myiasis by Wohlfahrtia magnifica in camel herds in southwest of Iran.

    PubMed

    Pirali Kheirabadi, Khodadad; Dehghani Samani, Amir; Rajabi Vardanjani, Hossein

    2014-01-01

    Myiasis is a disease of vertebrate animals caused by different fly larvae. Wohlfahrtia magnifica is responsible for serious losses in animal husbandry in Eurasia. Larvae of W. magnifica parasitize several warm-blooded vertebrates and are responsible for a severe traumatic myiasis of mucosal membranes or wounds. This myiasis has been reported in many European areas, but for the first time was reported from Iran. Larvae infestation was observed in five camels out of 35 (14.28%) around the perinea and vaginal region of camels in a herd in southwest of Iran. The larvae samples were collected and transferred to the laboratory of parasitology for identification. This is the first report of infestation of a camel herd (camelus dromedarius) in Iran. The treatment was performed and prevented the loss from camels and improved their physical condition. Although the myiasis is not a lethal disorder, however knowledge of the disease is necessary from preventive, diagnostic and curative standpoint. PMID:25610587

  17. Urogenital myiasis caused by Psychoda albipennis in a child.

    PubMed

    Demir, Ay?egül Do?an; Iraz, Meryem; ?pek, Duygu Neval Say?n

    2015-03-01

    Urogenital myiasis results when flies lay their eggs near the exit of the urethra and the larvae proceed upward along the urogenital tract. In this case report, a 10 year-old female patient diagnosed with urogenital myiasis was reported. The patient presented with complaints including painful and frequent urination, genital pruritus and moving larvae in urine. The patient had received Enterobius vermicularis treatment previously for two times. A 24-hour urine sample was collected and two black larvae were found in the urine. It was found that these larvae were fourth-stage larvae of Psychoda albipennis. Although there was no risk factor, the patient was affected with this rare parasitological disease. This case was presented to draw attention to myiasis in children. Myiasis may be observed in individuals with a favourable hygiene status and a high socioeconomical level. If a detailed history is not taken and appropriate laboratory tests are not performed, the diagnosis may be missed. PMID:26078699

  18. A Case of Secondary Ophthalmomyiasis Caused by Chrysomya bezziana (Diptera: Calliphoridae).

    PubMed

    Berenji, Fariba; Hosseini-Farash, Bibi Razieh; Marvi-Moghadam, Narges

    2015-06-01

    Myiasis is the invasion of vertebrates' tissue by the larvae of a fly of the order Diptera. The objective of this paper is to present a rare case of secondary myiasis of ocular infestation by Chrysomya bezziana. A 55-year-old female from Sar village of Mazandaran Province, northern Iran), referred to Khatam Al-Anbia Hospital of Mashhad with extensive destruction of left orbital cavity. Existence of larvae was the major complaint in recent months. Some live larvae were removed from her destructed left eye. Primary diagnosis was myiasis of left upper lid (LUL) and suspected recurrent Basal cell carcinoma (BCC). The laboratory diagnosis was done in parasitology lab of Imam Reza Hospital of Mashhad and collected larvae were identified and confirmed to be larvae of the C. bezziana (Diptera: Calliphoridae). It is a case report of secondary ophtalmiomyiasis due to C. bezziana of a patient lives in Mazandaran Province. PMID:26114150

  19. PubMed Central

    Viens, P.; Morisset, R.; Clermont, R.

    1982-01-01

    Intestinal bilharziasis (or schistosomiasis) is becoming more and more frequent among Canadian travellers who come in contact with natural soft waters in tropical countries. The clinical signs accompanying contamination, the prodrome and the chronic phase are inconstant, but eosinophilia is often the warning sign, and specific seroparasitologic findings suggest the diagnostic investigation, Five tourists from Quebec became infected while travelling in Martinique. The clinical, parasitologic and serologic features that led to the diagnosis are described. The prodome (a flu-like syndrome with eosinophilia) is underlined. Treatment with niridazole was effective, as confirmed by the absence of Schistosoma mansoni eggs (or the presence of dead eggs) in specimens from rectal biopsies performed subsequently. Images FIG. 2 PMID:7059888

  20. Redescription of Clinostomum phalacrocoracis metacercariae (Digenea: Clinostomidae) in cichlids from Lake Kinneret, Israel

    PubMed Central

    Caffara, Monica; Davidovich, Nadav; Falk, Rama; Smirnov, Margarita; Ofek, Tamir; Cummings, David; Gustinelli, Andrea; Fioravanti, Maria L.

    2014-01-01

    Clinostomidae are digeneans characterized by a complex taxonomic history, continuously under revision based on both morphological and molecular analysis. Among the 14 species considered valid so far Clinostomum phalacrocoracis has been well described only at the adult stage, whereas the morphology of the metacercarial stage has been reported only once. During a parasitological survey carried out on 262 wild cichlids sampled from Lake Kinneret (Israel) metacercariae referable to C. phalacrocoracis were found in 18 fingerlings. In this study, we report this clinostomid species for the first time in wild fish from Israel describing the metacercarial stage of Clinostomum phalacrocoracis, coupling its morphological description with molecular analysis carried out on ITS rDNA and COI mtDNA sequences. PMID:24986336

  1. Endoparasites of Wild Rodents in Southeastern Iran

    PubMed Central

    Nateghpour, Mehdi; Motevalli-Haghi, Afsaneh; Akbarzadeh, Kamran; Akhavan, Amir Ahmad; Mohebali, Mehdi; Mobedi, Iraj; Farivar, Leila

    2015-01-01

    Background: This study was aimed to collect wild rodents for endoparasites determination in some parts of Sistan and Baluchistan Province, southeastern Iran nearby Pakistan and Afghanistan countries. Methods: A total of 100 wild rodents were captured alive with cage traps. Various samples were collected from blood and feces, also impression smear prepared from different organs. The samples were prepared by formalin-ether or stained with Giemsa, after that were examined under microscope. Results: All the caught rodents (47 Tatera indica, 44 Meriones hurriana, 5 Gerbilus nanus and 4 Meriones libycus) were studied for endoparasites emphasizing to their zoonotic aspects. Endoparasites including Spirurida, Hymenolepis diminuta, Hymenolepis nana feraterna, Trichuris trichiura, Skerjabino taenia, Trichostrongylus spp, Entamoeba muris, Chilomastix mesnili and Leishmania spp were parasitologically identified. Conclusion: Among 9 genera or species of the identified parasites at least 5 of them have zoonotic and public health importance.

  2. Parasites or Cohabitants: Cruel Omnipresent Usurpers or Creative “Éminences Grises”?

    PubMed Central

    Vannier-Santos, Marcos A.; Lenzi, Henrique L.

    2011-01-01

    This paper presents many types of interplays between parasites and the host, showing the history of parasites, the effects of parasites on the outcome of wars, invasions, migrations, and on the development of numerous regions of the globe, and the impact of parasitic diseases on the society and on the course of human evolution. It also emphasizes the pressing need to change the look at the parasitism phenomenon, proposing that the term “cohabitant” is more accurate than parasite, because every living being, from bacteria to mammals, is a consortium of living beings in the pangenome. Even the term parasitology should be replaced by cohabitology because there is no parasite alone and host alone: both together compose a new adaptive system: the parasitized-host or the cohabitant-cohabited being. It also suggests switching the old paradigm based on attrition and destruction, to a new one founded on adaptation and living together. PMID:21785696

  3. Diseases of salamanders

    USGS Publications Warehouse

    Converse, K.A.; Green, D.E.

    2005-01-01

    Few diseases are reported in salamanders. Two notable exceptions are infections by Ranavirus and Ichthyophonus. Except for mortality events associated with ranaviruses in tiger salamanders (Ambystoma tigrinum) and spotted salamanders (A. maculatum), dieoffs of salamanders are rarely detected or reported. Diseases presented in this chapter are those encountered in free-living salamanders of the United States and Canada. A few additional diseases that are occasionally seen in captive and zoo animals have been reviewed by Green (2001). This chapter on Diseases of Salamanders will address five common infectious diseases of free-living larval and adult salamanders: Ranavirus (iridovims) infection Chytrid fungal infection Ichthyophoniasis Clinostomum metacercaria Chiggers Many helminthic parasites infect salamanders, but with few exceptions, these infections are unlikely to cause illness (morbidity) or death (mortality). Readers are referred to parasitology texts for a review of protozoan, helminthic and ectoparasitic organisms of amphibians (Flynn, 1973; Poynton and Whitaker, 2001).

  4. Efficacy of alphacypermetrin pour-on against natural Werneckiella equi infestation on donkeys (Equus asinus).

    PubMed

    Veneziano, Vincenzo; Neglia, Gianluca; Galietti, Alfredo; Rufrano, Domenico; Bassini, Andrea; Mariani, Ugo; Gokbulut, Cengiz

    2012-09-01

    The chewing louse Werneckiella equi is an ectoparasite of donkeys and other equids. Alphacypermethrin (ACYP) is a pyrethroid insecticide commonly used for the control of insects of veterinary and public health concerns. A trial was conducted to assess the efficacy of ACYP against W. equi on naturally infested donkeys. Parasitological investigations were performed on 13 animals. On day 0, the donkeys received ACYP pour-on at the manufacturer's recommended dose rate for cattle. Louse counts were performed on days -1, 7, 14, 21, 28, 35, 42, 49, and 56 at seven predilection sites on the skin of each donkey. ACYP was completely effective (100 %) from day 7, until the end of the study. ACYP was well tolerated by all animals as there were no observed clinical adverse reactions. ACYP was highly effective, safe, user-friendly, and considered to be suitable for the treatment of donkeys for W. equi infestation. PMID:22526295

  5. Spatio-temporal patterns of schistosomiasis japonica in lake and marshland areas in China: the effect of snail habitats.

    PubMed

    Hu, Yi; Gao, Jie; Chi, Meina; Luo, Can; Lynn, Henry; Sun, Liqian; Tao, Bo; Wang, Decheng; Zhang, Zhijie; Jiang, Qingwu

    2014-09-01

    The progress of the integrated control policy for schistosomiasis implemented since 2005 in China, which is aiming at reducing the roles of bovines and humans as infection sources, may be challenged by persistent presence of infected snails in lake and marshland areas. Based on annual parasitologic data for schistosomiasis during 2004-2011 in Xingzi County, a spatio-temporal kriging model was used to investigate the spatio-temporal pattern of schistosomiasis risk. Results showed that environmental factors related to snail habitats can explain the spatio-temporal variation of schistosomiasis. Predictive maps of schistosomiasis risk illustrated that clusters of the disease fluctuated during 2004-2008; there was an extensive outbreak in 2008 and attenuated disease occurrences afterwards. An area with an annually constant cluster of schistosomiasis was identified. Our study suggests that targeting snail habitats located within high-risk areas for schistosomiasis would be an economic and sustainable way of schistosomiasis control in the future. PMID:24980498

  6. The method used to sample ulcers influences the diagnosis of cutaneous leishmaniasis.

    PubMed

    Robinson, Ramírez José; Agudelo, Sonia; Muskus, Carlos; Alzate, Juan Fernando; Berberich, Christof; Barker, Douglas C; Vélez, Iván Darío

    2002-04-01

    Before beginning treatment for cutaneous leishmaniasis, parasitological confirmation of the disease is required. The most commonly used diagnostic procedures are microscopy and culture of samples taken from the active edge of the lesion. In this study, we compared the sensitivity of previous diagnostic procedures with the polymerase chain reaction (PCR), using smears taken from the edge of the lesion and its centre. The sensitivity was greater with smears taken from the centre of the lesion, both for microscopical examination (85%) and for PCR (81%), compared to those obtained from the edge of the lesion (69% and 58% respectively). When PCR was carried out on biopsy material from the edge of the lesion the sensitivity was 63%. PMID:12055833

  7. A survey of the intestinal helminths of refugees in Juba, Sudan.

    PubMed

    Marnell, F; Guillet, A; Holland, C

    1992-08-01

    A parasitological survey of refugees based in Juba, Sudan, involving 241 faecal samples, revealed that 66% of the population harboured intestinal helminths. The most commonly found infection was hookworm (36%), followed by Schistosoma mansoni (26%), Strongyloides stercoralis (20%), Hymenolepis nana (11%), Ascaris lumbricoides (1.2%), Trichuris trichiura (0.8%) and Taenia sp. (0.4%). Many of the specimens (42%) harboured a single infection, 21% had double, 2% triple and 1% quadruple infections. Parasite prevalences and intensities were analysed in relation to age, sex, religion and occupation: females (70%) were found to be more infected than males (64%); Muslims (50%) were less infected than Christians (68%) and agriculturalists (90%) were the most infected occupational group. PMID:1463359

  8. [Toxocara sp. eggs and Ancylostoma sp. larva in public parks, Brazil].

    PubMed

    Guimarães, Antônio Marcos; Alves, Endrigo Gabellini Leonel; de Rezende, Glycia Ferreira; Rodrigues, Marcelo Costa

    2005-04-01

    Visceral and cutaneous larva migrans are parasitic zoonoses caused by the infection of larval nematodes Toxocara sp. and Ancylostoma sp. respectively. The objective of this study was to investigate the contamination by Toxocara sp. eggs and Ancylostoma sp. eggs and larva of soil samples collected from public parks and children's playground areas in state of Minas Gerais, Brazil, using both Baermann's method and centrifugal flotation technique. Toxocara sp. and Ancylostoma sp. eggs were observed in soil samples collected from public squares in 17.4% (4/23) and 69.6 (16/23) respectively. In schools and child day care settings the contamination by Ancylostoma sp. larva in sand samples was 11.1% (2/18). Public parks are settings of more potential risk of Toxocara sp. eggs and Ancylostoma sp. infection. Stool parasitology testing of 174 stool samples showed 58% and 23% of Ancylostoma sp and Toxocara sp eggs infection respectively. PMID:15895151

  9. A report on the genital myiasis by Wohlfahrtia magnifica in camel herds in southwest of Iran

    PubMed Central

    Pirali Kheirabadi, Khodadad; Dehghani Samani, Amir; Rajabi Vardanjani, Hossein

    2014-01-01

    Myiasis is a disease of vertebrate animals caused by different fly larvae. Wohlfahrtia magnifica is responsible for serious losses in animal husbandry in Eurasia. Larvae of W. magnifica parasitize several warm-blooded vertebrates and are responsible for a severe traumatic myiasis of mucosal membranes or wounds. This myiasis has been reported in many European areas, but for the first time was reported from Iran. Larvae infestation was observed in five camels out of 35 (14.28%) around the perinea and vaginal region of camels in a herd in southwest of Iran. The larvae samples were collected and transferred to the laboratory of parasitology for identification. This is the first report of infestation of a camel herd (camelus dromedarius) in Iran. The treatment was performed and prevented the loss from camels and improved their physical condition. Although the myiasis is not a lethal disorder, however knowledge of the disease is necessary from preventive, diagnostic and curative standpoint. PMID:25610587

  10. [Age-related dynamics of roach infection rate with Ligula intestinalis (Cestoda: Ligulidae) plerocercoids and probability of its usage for the calculation of host death rate].

    PubMed

    Pronin, N M; Pronina, S V

    2014-01-01

    Results of special parasitological dissections of roach samples from catches with the same fishing gear and at the same station (Monakhovo Cove, Chivyrkui Bay of the Lake Baikal) and at the same time in different years (1998-2002) are given. Stability of age-related dynamics of roach infection rate with Ligula intestinalisis in different years with the maximum of prevalence and mean abundance in fish of 3+ age, and the following sharp decrease in these rates in elder age groups, was revealed. Basing on prevalence decreasing of a single roach generation, the rate of fish mortality during its growth from age group 3+ to 4+ was estimated as 15.9-20.7%. PMID:25693329

  11. [Several years of observation of the incidence of Trichomonas vaginalis infections among female workers in a single industrial plant].

    PubMed

    Grys, E

    1990-01-01

    During 5 years cycle a prophylactic gynaecological, cytological and parasitological examinations of 1918 women were performed. 12.8% of women were infected with T. vaginalis. Decreasing percentage of infections was observed: from 9.92% in 1984 to 2.2% in 1988. In the I. of Papanicolaou cervical smears T. vaginalis has been found in 1.60% of cases, in the II.--in 5.2%, in the III.--in 14.29%, and in the IV.--in 22.22% of cases. In women with normal cervix uteri T. vaginalis have been found in 5.01% of cases, and in women with hypertrophied cervix and partially epidermized ectopy with ovula nabothi in 15.28% of cases. PMID:2131693

  12. Parasites as valuable stock markers for fisheries in Australasia, East Asia and the Pacific Islands.

    PubMed

    Lester, R J G; Moore, B R

    2015-01-01

    Over 30 studies in Australasia, East Asia and the Pacific Islands region have collected and analysed parasite data to determine the ranges of individual fish, many leading to conclusions about stock delineation. Parasites used as biological tags have included both those known to have long residence times in the fish and those thought to be relatively transient. In many cases the parasitological conclusions have been supported by other methods especially analysis of the chemical constituents of otoliths, and to a lesser extent, genetic data. In analysing parasite data, authors have applied multiple different statistical methodologies, including summary statistics, and univariate and multivariate approaches. Recently, a growing number of researchers have found non-parametric methods, such as analysis of similarities and cluster analysis, to be valuable. Future studies into the residence times, life cycles and geographical distributions of parasites together with more robust analytical methods will yield much important information to clarify stock structures in the area. PMID:24598117

  13. Cost of co-infection controlled by infectious dose combinations and food availability.

    PubMed

    Fellous, Simon; Koella, Jacob C

    2010-04-01

    To what extent the combined effect of several parasite species co-infecting the same host (i.e. polyparasitism) affects the host's fitness is a crucial question of ecological parasitology. We investigated whether the ecological setting can influence the co-infection's outcome with the mosquito Aedes aegypti and two parasites: the microsporidium Vavraia culicis and the gregarine Ascogregarina culicis. The cost of being infected by the two parasites depended on the interaction between the two infectious doses and host food availability. The age at pupation of the mosquito was delayed most when the doses of the two parasites were highest and little food was available. As infectious dose increases with the parasites' prevalence and intensity of transmission, the cost of being co-infected depends on the epidemiological status of the two parasite species. PMID:20033214

  14. Detection of IgA anti-Entamoeba histolytica in the patients' saliva.

    PubMed

    El Hamshary, Eman M; Arafa, Wafaa A S

    2004-12-01

    E. histolytica is a protozoan parasite with worldwide distribution. The diagnosis of this parasite still depends on the microscopic examination. Determination of the sIgA in the different body fluid proves to be of diagnostic value in many pathogens. To find out the potentials of salivary sIgA in diagnosis of intestinal amoebiasis, 30 patients with parasitologic proved E. histolytica and 30 cross-matched negative controls were selected for levels of salivary sIgA using radial immunodiffuion technique. The result showed a high significant increase in the mean concentration of salivary sIgA in patients rather controls. However, six negative controls gave positive sIgA. So, salivary IgA concentration has a predictive diagnostic values of intestinal amoebiasis, when the stool examination is practically impossible as well as in tissue amoebiasis. PMID:15658064

  15. [Instituto de Investigaciones Clinicas "Dr. Américo Negrette": 55 years of excellent research versus global economic recession].

    PubMed

    Valero Cedeño, Nereida Josefina

    2014-12-01

    The Instituto de Investigaciones Clínicas "Dr. Américo Negrette" belongs to the Faculty of Medicine at University of Zulia in Maracaibo, Zulia State, Venezuela. It was created on December 4, 1959 by Dr. Américo Negrette. Today, with 55 years of existence, the Institute seeks to fulfill the mission that characterizes it, based on the values instilled by its founder and maintained by subsequent generations, whose research projects are implemented through seven research sections: Biochemistry, Hematologic Research, Neuropharmacology and Neuroscience, Immunology and Cell Biology, Clinical Neurochemistry, Parasitology and Virology. The research originated in these laboratories have become national and international points of reference, despite the current economic situation with budget deficits that put at risk the quality and originality of their projects with negative consequences on the productivity and applications for health population, reasons of biomedical research. PMID:25558749

  16. [Spatiotemporal analysis of the infection of the Red Fox (Vulpes vulpes L.) with Echinococcus multilocularis in Saxony-Anhalt].

    PubMed

    Denzin, Nicolai; Schliephake, Annette; Wirth, Alice

    2009-01-01

    A total of 2757 Red Foxes from 952 locations were examined parasitologically for Echinococcus multilocularis between the years 1998 and 2007 at the State Office of Consumer Protection Saxony-Anhalt. This examination was carried out in parallel to rabies monitoring. A period-prevalence of 17.4% of infection was found. Employing different cluster tests spatial as well as spatiotemporal clusters were detected. Spatial clusters remained largely stable throughout the complete time interval and were situated in the Southwest of the state. Spatiotemporal clusters comprised the time intervals 2004-2007 and 2005-2007, respectively. It could be demonstrated that prevalence also increased significantly in the state's overall area for the time interval 2005-2007 as compared to the interval 1998-2004. The effect of this situation and development on the risk of humans to contract Alveolar Echinococcosis in Saxony-Anhalt is discussed. PMID:19350806

  17. Population Pharmacokinetics of Intravenous Artesunate: A Pooled Analysis of Individual Data From Patients With Severe Malaria

    PubMed Central

    Zaloumis, S G; Tarning, J; Krishna, S; Price, R N; White, N J; Davis, T M E; McCaw, J M; Olliaro, P; Maude, R J; Kremsner, P; Dondorp, A; Gomes, M; Barnes, K; Simpson, J A

    2014-01-01

    There are ~660,000 deaths from severe malaria each year. Intravenous artesunate (i.v. ARS) is the first-line treatment in adults and children. To optimize the dosing regimen of i.v. ARS, the largest pooled population pharmacokinetic study to date of the active metabolite dihydroartemisinin (DHA) was performed. The pooled dataset consisted of 71 adults and 195 children with severe malaria, with a mixture of sparse and rich sampling within the first 12?h after drug administration. A one-compartment model described the population pharmacokinetics of DHA adequately. Body weight had the greatest impact on DHA pharmacokinetics, resulting in lower DHA exposure for smaller children (6–10?kg) than adults. Post hoc estimates of DHA exposure were not significantly associated with parasitological outcomes. Comparable DHA exposure in smaller children and adults after i.v. ARS was achieved under a dose modification for intramuscular ARS proposed in a separate analysis of children. PMID:25372510

  18. Immunogenicity and protective efficacy of affinity-purified Plasmodium falciparum exoantigens in Aotus nancymai monkeys.

    PubMed

    James, M A; Fajfar-Whetstone, C J; Kakoma, I; Buese, M M; Clabaugh, G W; Hansen, R; Ristic, M

    1991-03-01

    Soluble Plasmodium falciparum polypeptides, affinity-purified from culture supernatant fluids using sequential immunoadsorptions employing both monoclonal and polyclonal antibodies, induced protective immunity against experimental falciparum malaria in Peruvian Aotus nancymai monkeys. Susceptible monkeys were vaccinated with polypeptides affinity-purified from supernatant fluids of P. falciparum Indochina I/CDC cultures. Eighteen animals (6 immunized with purified antigens plus adjuvants, 6 injected with only the adjuvant preparation, and 6 untreated) were challenged with whole blood containing monkey-adapted virulent organisms of the Indochina I/CDC strain. Selected hematologic, serologic and parasitologic profiles served as potential indicators of protection. This immunogen, when fortified with an aluminum hydroxide/Quil-A saponin adjuvant combination, elicited good antibody responses to major P. falciparum antigens. Protection in vaccinated animals was evidenced by a significantly limited reduction in hematocrit and hemoglobin levels and a relatively moderate course of infection after homologous needle-challenge with Aotus monkey-adapted P. falciparum parasites. PMID:2052857

  19. Helminth fauna of the Iberian lynx, Lynx pardinus.

    PubMed

    Torres, J; Garciá-Perea, R; Gisbert, J; Feliu, C

    1998-09-01

    Specimens of 12 helminth species were collected from carcasses of eight Lynx pardinus (Temminck, 1827), a carnivore endemic to the Iberian Peninsula. These species included: Brachylaima sp. (12.5%) (Trematoda); Taenia pisiformis (12.5%), T. polyacantha (25%), T. taeniaeformis (25%) and Mesocestoides litteratus (37.5%) (Cestoda); Eucoleus aerophilus (12.5%), Ancylostoma tubaeforme (12.5%), Toxocara cati (37.5%), Toxascaris leonina (62.5%), Vigisospirura potekhina potekhina (12.5%), Mastophorus muris (12.5%) and Physaloptera praeputialis (12.5%) (Nematoda). The helminth fauna in Iberian lynx is compared with that of L. canadensis and L. rufus in America, and for L. lynx in Eurasia. The potential relationships between the parasitological data and some geographical, historical and dietary factors are discussed. PMID:9765373

  20. Estimation of malaria incidence in northern Namibia in 2009 using Bayesian conditional-autoregressive spatial-temporal models.

    PubMed

    Alegana, Victor A; Atkinson, Peter M; Wright, Jim A; Kamwi, Richard; Uusiku, Petrina; Katokele, Stark; Snow, Robert W; Noor, Abdisalan M

    2013-12-01

    As malaria transmission declines, it becomes increasingly important to monitor changes in malaria incidence rather than prevalence. Here, a spatio-temporal model was used to identify constituencies with high malaria incidence to guide malaria control. Malaria cases were assembled across all age groups along with several environmental covariates. A Bayesian conditional-autoregressive model was used to model the spatial and temporal variation of incidence after adjusting for test positivity rates and health facility utilisation. Of the 144,744 malaria cases recorded in Namibia in 2009, 134,851 were suspected and 9893 were parasitologically confirmed. The mean annual incidence based on the Bayesian model predictions was 13 cases per 1000 population with the highest incidence predicted for constituencies bordering Angola and Zambia. The smoothed maps of incidence highlight trends in disease incidence. For Namibia, the 2009 maps provide a baseline for monitoring the targets of pre-elimination. PMID:24238079

  1. Towards a Paradigm Shift in the Treatment of Chronic Chagas Disease

    PubMed Central

    Alarcón de Noya, B.; Araujo-Jorge, T.; Grijalva, M. J.; Guhl, F.; López, M. C.; Ramsey, J. M.; Ribeiro, I.; Schijman, A. G.; Sosa-Estani, S.; Torrico, F.; Gascon, J.

    2014-01-01

    Treatment for Chagas disease with currently available medications is recommended universally only for acute cases (all ages) and for children up to 14 years old. The World Health Organization, however, also recommends specific antiparasite treatment for all chronic-phase Trypanosoma cruzi-infected individuals, even though in current medical practice this remains controversial, and most physicians only prescribe palliative treatment for adult Chagas patients with dilated cardiomyopathy. The present opinion, prepared by members of the NHEPACHA network (Nuevas Herramientas para el Diagnóstico y la Evaluación del Paciente con Enfermedad de Chagas/New Tools for the Diagnosis and Evaluation of Chagas Disease Patients), reviews the paradigm shift based on clinical and immunological evidence and argues in favor of antiparasitic treatment for all chronic patients. We review the tools needed to monitor therapeutic efficacy and the potential criteria for evaluation of treatment efficacy beyond parasitological cure. Etiological treatment should now be mandatory for all adult chronic Chagas disease patients. PMID:24247135

  2. Multiple parasites mediate balancing selection at two MHC class II genes in the fossorial water vole: insights from multivariate analyses and population genetics.

    PubMed

    Tollenaere, C; Bryja, J; Galan, M; Cadet, P; Deter, J; Chaval, Y; Berthier, K; Ribas Salvador, A; Voutilainen, L; Laakkonen, J; Henttonen, H; Cosson, J-F; Charbonnel, N

    2008-09-01

    We investigated the factors mediating selection acting on two MHC class II genes (DQA and DRB) in water vole (Arvicola scherman) natural populations in the French Jura Mountains. Population genetics showed significant homogeneity in allelic frequencies at the DQA1 locus as opposed to neutral markers (nine microsatellites), indicating balancing selection acting on this gene. Moreover, almost exhaustive screening for parasites, including gastrointestinal helminths, brain coccidia and antibodies against viruses responsible for zoonoses, was carried out. We applied a co-inertia approach to the genetic and parasitological data sets to avoid statistical problems related to multiple testing. Two alleles, Arte-DRB-11 and Arte-DRB-15, displayed antagonistic associations with the nematode Trichuris arvicolae, revealing the potential parasite-mediated selection acting on DRB locus. Selection mechanisms acting on the two MHC class II genes thus appeared different. Moreover, overdominance as balancing selection mechanism was showed highly unlikely in this system. PMID:18624885

  3. Long-term effect of toltrazuril on growth performances of dairy heifers and beef calves exposed to natural Eimeria zuernii and Eimeria bovis infections.

    PubMed

    Veronesi, Fabrizia; Diaferia, Manuela; Viola, Orfeo; Fioretti, Daniela Piergili

    2011-11-01

    The long-term effects of a toltrazuril treatment against natural Eimeria bovis and/or Eimeria zuernii infections were investigated in comparison with diclazuril and untreated controls on two dairy (Italian Friesian breed) and two beef (Chianina breed) farms. At each trial site, 30 calves were allocated into three groups of 10 calves each: T (treated with toltrazuril), D (treated with diclazuril) and C (left untreated). For 40 weeks post-treatment, the calves were weighed and examined clinically and parasitologically. The oocyst counts as well as the number of scour days were significantly lower in the T group than in the D and C groups. Final bodyweights and body condition scores of the T group exceeded those of groups C and D. The results confirmed that toltrazuril was highly efficacious, safe and provided productive benefits in dairy and beef calves. PMID:21144780

  4. History and development of research on wildlife parasites in southern Africa, with emphasis on terrestrial mammals, especially ungulates.

    PubMed

    Junker, Kerstin; Horak, Ivan G; Penzhorn, Banie

    2015-04-01

    The history of wildlife parasitology in South Africa, and to some extent southern Africa, is reviewed, giving a brief overview of the early years and following its development from the founding of the Onderstepoort Veterinary Institute in 1908 until the turn of the century. An emphasis is placed on game species. The main findings on protozoan parasites, including those of carnivores, are presented, starting in the 1890s and leading up to the first decade of the 21st century. Important developments with regard to the studies of arthropod and helminth parasites took place during a period of three decades, starting from the 1970s. Because of the sheer volume of work done by parasitologists during this time, this particular part of the overview concentrates on South African authors or authors working in South Africa at the time, and is limited to hosts that are members of the order Perissodactyla and the superorder Cetartiodactyla. PMID:25830101

  5. Helminth parasitic infections of the central nervous system: a diagnostic approach.

    PubMed

    Othman, Ahmad A; Bruschi, Fabrizio; Ganna, Ahmed A

    2014-04-01

    Helminth parasitic infections of the central nervous system (CNS) occur worldwide with high prevalence in tropical and subtropical countries. Clinical evaluation of patients is mandatory, and it is convenient to group the clinical manifestations into syndromes: for example space-occupying lesions, meningitis, and encephalitis. The history should focus on residence or travel to endemic areas, diet, activities, intercurrent medical conditions, and associated clinical clues. Direct parasitological diagnosis can be reached by cerebrospinal fluid and cerebral tissue examination either by microscopy, culture, or immunological techniques. Immunodiagnosis by detection of parasite antibodies or antigens in serum could provide indirect evidence of parasitic infections. In addition, various imaging and radiological techniques e.g., computed tomography (CT) scan and magnetic resonance imaging (MRI) complement the diagnostic work-up of CNS diseases. Finally, the helminthic CNS infections of global impact, such as schistosomiasis, neurotoxocariasis, Strongyloides infection, neurotrichinosis, neurocysticercosis, and echinococcosis will be briefly discussed as regards the principal clinical and diagnostic features. PMID:24961012

  6. Intestinal protozoa and helminths among Terena Indians in the State of Mato Grosso do Sul: high prevalence of Blastocystis hominis.

    PubMed

    Aguiar, José Ivan Albuquerque; Gonçalves, Alessandra Queiroga; Sodré, Fernando Campos; Pereira, Severino Dos Ramos; Bóia, Márcio Neves; de Lemos, Elba Regina Sampaio; Daher, Roberto Ruhman

    2007-01-01

    A parasitological survey was carried out among Terena Indians living in the Tereré settlement in the municipality of Sidrolândia, State of Mato Grosso do Sul, Brazil. Single samples of feces from 313 Indians were processed by means of the spontaneous sedimentation method. In the population studied, 73.5% were infected with at least one intestinal parasite or commensal. Protozoa predominated. Blastocystis hominis (40.9%), Entamoeba coli (33.2%) and Entamoeba histolytica/Entamoeba dispar (31.6%) were the most common. Bivariate analysis showed that females were generally more infected and presented higher rates of infection by Entamoeba histolytica/Entamoeba dispar and Entamoeba coli. Males were more infected by hookworms and Strongyloides stercoralis than females. The precarious sanitary conditions of the Tereré settlement are probably a contributory factor towards the high prevalence of intestinal protozoa. PMID:18200414

  7. Chewing lice (Phthiraptera) from Calidris fuscicollis (Aves: Scolopacidae) in Southern Brazil.

    PubMed

    Gomes, Sâmara Nunes; Pesenti, Tatiana Cheuiche; Cirne, Maximiano Pinheiro; Müller, Gertrud

    2014-08-01

    During April and September from 2010 to 2012, 80 birds of the species Calidris fuscicollis (white-rumped sandpiper) were collected for parasitological studies in the southern coast of Rio Grande do Sul, under ICMBIO license No. 26234-1. For ectoparasite collection, the birds were first submerged in water with detergent. The parasites found were fixed in 70% alcohol, cleared in 10% potassium hydroxide and mounted in Canada balsam. Of 80 birds examined, 79% were parasitized. Actornithophilus umbrinus (47.5%), Actornithophilus lacustris (37.5%), Actornithophilus spp. (13.75%), Carduiceps zonarius (26.25%), Lunaceps incoenis (27.5%), and Lunaceps spp. (16.25%) were the species found with their respective prevalence. We record for the first time parasitism by chewing lice in Calidris fuscicollis. PMID:24742904

  8. Hematological parameters associated with parasitism in pike, Esox lucius caught from Anzali wetland.

    PubMed

    Fallah, Farzin Jamalzad; Khara, Hossein; Rohi, Javad Daghigh; Sayadborani, Mohammad

    2015-06-01

    This study involved 120 pike, Esox lucius, captured from Anzali wetland. Parasite fauna were identified in captured fish. Also, changes of haematological parameters were compared both infected and uninfected fish. Parasitological inspections revealed the following infestations: Skin: Lernea cyprinacea, Argulus foliaceus (Crustacean) and Tricodina sp. (Ciliatea). Gill: Dactylogyrus sp. (Digenea) and Tetraonchus monenteron (Monogenea). Eye: Diplostomum spathaceum (Digenea). Gut: Eustrongylides exises, Rhipdocotyle illense, Raphidascaris acus (Nematode), Corynosoma Strumosum (Acanthocephala). Most prevalence and intensity were related to Eustrongylides exises and Rhipdocotyle illense. Following haematological parameters were evaluated: haematocrit, haemoglobin concentration, erythrocyte and leukocyte counts, mean cell volume (MCV), mean cell haemoglobin, mean cell haemoglobin concentration lymphocytes, monocytes and eosinophils. Significant difference was found for MCV between infected and uninfected fish. PMID:26064009

  9. Sulfalene with pyrimethamine and chloroquine with pyrimethamine in single-dose treatment of Plasmodium falciparum infections

    PubMed Central

    Storey, J.; Rossi-Espagnet, A.; Mandel, S. P. H.; Matsushima, T.; Lietaert, P.; Thomas, D.; Brøgger, S.; Duby, C.; Gramiccia, G.

    1973-01-01

    A comparative trial was carried out in northern Nigeria of the ability of the drug combinations chloroquine—pyrimethamine and sulfalene—pyrimethamine to clear the peripheral blood stream of asexual forms of P. falciparum within 7 days. The reappearance of asexual P. falciparum forms within the 70-day follow-up period and the occurrence of vomiting during the 2-3 hours following administration of the drugs were also recorded. The purpose of the trial was to choose the more suitable of the two drug combinations for repeated mass administration in the intervention phase of a collaborative field research project in the epidemiology and control of malaria in the African savannah. No differences were observed between the two drug combinations from a parasitological point of view. However, the sulfalene—pyrimethamine combination was found easier to administer and occasioned fewer records of vomiting. It was therefore recommended for use in the project. PMID:4603037

  10. Joseph Leidy

    NSDL National Science Digital Library

    Joseph Leidy was the leading American expert on anatomy and vertebrate paleontology during the mid nineteenth century and author of over 200 scientific texts. Philadelphia's Academy of Natural Sciences, where Leidy worked, is fortunate to have a great portion of Leidy's collections. The Academy has put together this nice, illustrated site on Leidy's important work. The section on fossils includes a hypertext list of specific names with links to photographs, illustrations, and descriptions of the specimens. Be sure not to miss the section on the duckbilled dinosaur Hadrosaurus foulkii, the subject of Leidy's best known monograph. Other highlights are an overview of Leidy's other scientific work, including forays into parasitology and protozoology and his Professorship in Anatomy, a timeline biography, and a thorough index.

  11. CellPress: Trends Journals Online

    NSDL National Science Digital Library

    Sixteen review journals from Elsevier Trends Journals are now available online to BioMedNet members (BioMedNet membership is free but requires registration) via trends Online. Journals included in this service are Trends in Biochemical Sciences, Trends in Biotechnology, Trends in Cell Biology, Trends in Cognitive Sciences, Drug Discovery Today, Trends in Ecology & Evolution, Trends in Endocrinology, Trends in Genetics, Immunology Today, Trends in Microbiology, Molecular Medicine Today, Trends in Neuroscience, Parasitology Today, Pharmaceutical Science & Technology Today, Trends in Pharmacological Sciences, and Trends in Plant Science. These journals are freely accessible until May 1, 1999. Afterwards, access is available only to subscribers of each particular Trends journal. Full-text articles from January 1998 can be viewed in both HTML and .pdf formats.

  12. Sex differences in the malnourished status of Chinese children due to schistosomiasis infections and inadequate dietary intake.

    PubMed

    Zhou, Huan; He, Yongkang; Ohtsuka, Ryutaro

    2005-01-01

    Based on nutritional and parasitological examinations of 389 children aged 10-13 years in five primary schools in the schistosomiasis endemic Dongting Lake region of China, the causal factors of their retarded growth, represented by height, weight, mid-upper arm circumference and body mass index, were investigated. Among the four parasites, schistosomiasis infection due to Schistosoma japonicum played a significant role, with higher rates in girls than in boys. Praziquantel treatment of schistosomiasis decreased the infection rate and improved the children's growth. For dietary intake factors, the contribution of protein to total energy intake, which was lower in girls than in boys, had the greatest effect on the growth patterns. The sex difference in growth retardation is judged to be attributable to the traditional norms, such as girls spending more time in infested environments and gender discrimination in food distribution. PMID:16077466

  13. Causes of mortality of albatross chicks at Midway Atoll

    USGS Publications Warehouse

    Sileo, L.; Sievert, P.R.; Samuel, M.D.

    1990-01-01

    As part of an investigation of the effect of plastic ingestion on seabirds in Hawaii, we necropsied the carcasses of 137 Laysan albatross (Diomedea immutabilis) chicks from Midway Atoll in the Pacific Ocean during the summer of 1987. Selected tissues were collected for microbiological, parasitological, toxicological or histopathological examinations. Dehydration was the most common cause of death. Lead poisoning, trauma, emaciation (starvation) and trombidiosis were other causes of death; nonfatal nocardiosis and avian pox also were present. There was no evidence that ingested plastic caused mechanical lesions or mortality in 1987, but most of the chicks had considerably less plastic in them than chicks from earlier years. Human activity (lead poisoning and vehicular trauma) caused mortality at Midway Atoll and represented additive mortality for pre-fledgling albatrosses.

  14. [Peculiarities of the biology and parasite fauna of juvenile Atlantic salmon (Salmo salar L.) in the Pista River (White Sea Basin), according to the Gyrodactylus salaris infestation].

    PubMed

    Ieshko, E P; Shchurov, I L; Shul'man, B S; Barskaia, Iu Iu; Lebedeva, D I; Shirokov, V A

    2012-01-01

    Juvenile salmon Salmo salar m. sebago Girard from the Pista River system (the White Sea Basin) was investigated. The data on species composition and occurrence peculiarities of Gyrodactylus salaris Malmberg, 1957 are given. This monogenean is the alien species for the river system and it is recorded for the first time. It is shown that the distribution of the parasite abundance is can be described as the negative binomial distribution; variations of its parameters (k and p) were also characterized. Parasitological data obtained, as well as the data describing the characteristics of growth and age structure of juvenile salmon population, suggest the potential influence of G. salaris infection on the degree of survival of fishes in the lake-river system examined. PMID:23285741

  15. [Human echinococcosis in Poland in 2003-2010 according to the serological tests results of NIPH-NIH].

    PubMed

    Wnukowska, Natalia; Salamatin, Rus?an; Go?ab, Elzbieta

    2011-01-01

    In 2003-2010 5483 persons suspected of echinococcosis were examined for Echinococcus granulosus and Echinococcus multilocularis infections using serological tests in the Department of Medical Parasitology National Institute of Public Health - National Institute of Hygiene. The screening test ELISA (Bordier Affinity Products S. A.), confirmation tests Western-blot (LDBIO Diagnostics, Lyon-France) and ELISA Em2 plus (Bordier Affinity Products S.A) were applied. Within 235 persons posistive for in screening test, 162 were confirmed with Echinococcus granulosus and 33 - E. multilocularis. In 40 cases the tests failed to determine the Echinococcus species. In the period of 2006-2010 the linear decrease of percentage of positive results was observed. However, the information about the continuously growing population of red fox in Poland, together with the growing percentage of the animals infected with E. multilocularis, suggests the need for continuous monitoring of human alveococcosis. PMID:22184948

  16. Pseudosuccinea columella (Say 1817) (Gastropoda, Lymnaeidae), snail host of Fasciola hepatica: first record for France in the wild.

    PubMed

    Pointier, Jean-Pierre; Coustau, Christine; Rondelaud, Daniel; Theron, André

    2007-10-01

    The lymnaeid snail Pseudosuccinea columella has shown strong invasive capabilities in the last decades, and this species has now a worldwide distribution. So far, the presence of this snail in Europe was restricted to botanical gardens, but the recent discovery of a few specimens along the banks of the Lot River, southwestern France is the first record of this species in the wild. The first generation of this P. columella isolate obtained in the laboratory was used for parasitological tests with a French Fasciola hepatica sample. Experimental infections showed that 100% of snails (n=26) developed infection when exposed to F. hepatica miracidia. Consequences for the epidemiology of F. hepatica transmission in France are discussed. PMID:17661191

  17. A geographic information system applied to a malaria field study in western Kenya.

    PubMed

    Hightower, A W; Ombok, M; Otieno, R; Odhiambo, R; Oloo, A J; Lal, A A; Nahlen, B L; Hawley, W A

    1998-03-01

    This paper describes use of the global positioning system (GPS) in differential mode (DGPS) to obtain highly accurate longitudes, latitudes, and altitudes of 1,169 houses, 15 schools, 40 churches, four health care centers, 48 major mosquito breeding sites, 10 borehole wells, seven shopping areas, major roads, streams, the shore of Lake Victoria, and other geographic features of interest associated with a longitudinal study of malaria in 15 villages in western Kenya. The area mapped encompassed approximately 70 km2 and included 42.0 km of roads, 54.3 km of streams, and 15.0 km of lake shore. Location data were entered into a geographic information system for map production and linkage with various databases for spatial analyses. Spatial analyses using parasitologic and entomologic data are presented as examples. Background information on DGPS is presented along with estimates of effort and expense to produce the map information. PMID:9546401

  18. [Intestinal parasitosis in Indians of the Mapuera community (Oriximiná, State of Pará, Brazil): high prevalence of Blastocystis hominis and finding of Cryptosporidium sp and Cyclospora cayetanensis].

    PubMed

    Borges, Jaila Dias; Alarcón, Ruth Semira Rodríguez; Neto, Vicente Amato; Gakiya, Erika

    2009-01-01

    Occurrences of intestinal parasitosis in Indians of the Mapuera community (Oriximiná, State of Pará, Brazil) were evaluated. Within the context of group assessment, this study makes a contribution towards adequate knowledge of this subject, which is significant from a medical-sanitary point of view. Parasitological examination of feces from 83 individuals, performed using four different methods, could be considered to have reasonable amplitude for establishing diagnoses. Protozoan cysts and helminth eggs of many types were found, even with significant percentages. The frequent presence of Blastocystis hominis (57.8%), along with findings of Cryptosporidium sp (3.6%) and Cyclospora cayetanensis (10.8%), deserved highlighting with specific comments. The findings show that these Indians live in an environment in which poor hygiene conditions prevail. In particular, these facilitate the dissemination of protozoa and helminths through contact with the soil or through intake of contaminated water and food. PMID:19684989

  19. Epidemiological investigation of an acute case of Chagas disease in an area of active transmission in Peruvian Amazon region.

    PubMed

    Cabrera, Rufino; Vega, Silvia; Cáceres, Abraham G; Ramal, A César; Alvarez, Carlos; Ladera, Pedro; Pinedo, Raul; Chuquipiondo, Gladys

    2010-01-01

    The study objective was to investigate an acute case of Chagas disease in the San Pedro de Shishita community, Pebas District, in the Peruvian Amazon basin, a non-endemic area. Both parents of the index case (acute case) were thoroughly interviewed, a seroepidemiological survey was carried out in the community, parasitological exams were carried out only in relatives of the index case, and triatomine bugs were searched for inside houses, peridomiciliary, and in wild environments. Seroprevalence for IgG anti-T. cruzi antibodies was 1/104 (0.96%), using an ELISA test and an indirect immunofluorescence assay. Panstrongylus geniculatus and Rhodnius pictipes adults were found. The index case is autochthonous from San Pedro de Shishita, but the source of transmission is unknown. PMID:21049232

  20. Human helminthosis in a rural community of Plateau State, Nigeria.

    PubMed

    Onwuliri, C O; Imandeh, N G; Okwuosa, V N

    1992-11-01

    Urine and faecal samples were obtained from 1,517 people in Fier, a typical rural village in Plateau State, Nigeria, for a parasitological survey among the population. 643 (42.39%) persons were found to be infected with altogether 9 helminths, namely: Ascaris lumbricoides, hookworm, Taenia sp., Trichuris trichiura, Enterobius vermicularis, Schistosoma mansoni, S. haematobium, Hymenolepis nana and Strongyloides stercoralis. Age and religion as opposed to sex, type of sewage system, and type of housing had a significant effect (P < 0.05) on the prevalence rates of the helminths in the population. Snail vector survey for schistosomatosis revealed the presence of Bulinus (Bulinus) truncatus, Bulinus (Physopsis) globosus and Biomphalaria pfeifferi with the latter being the most common with brevifurcate cercariae, and xiphidiocercariae being the most common cercariae harboured by the snails. PMID:1456465

  1. Dermanyssus gallinae infestation: an unusual cause of scalp pruritus treated with permethrin shampoo.

    PubMed

    Dogramaci, Asena Cigdem; Culha, Gulnaz; Ozçelik, Semra

    2010-09-01

    Dermanyssus gallinae is a blood parasite of wild birds, but it is also a pest in the poultry industry. It occasionally bites mammals and thus rarely creates skin problems such as itching, papules, vesicles, and dermatitis. A 92-year-old man presented with severe itch on his head, particularly at night. He had been misdiagnosed with senile pruritus and treated with antihistamines and topical corticosteroids with temporary relief of the symptoms. On the basis of clinical and parasitological findings, D. gallinae dermatitis was diagnosed. Decontamination of the patient's immediate environment was not helpful. The patient was successfully treated using a 1% permethrin shampoo once a week for 2 weeks. During 3 months of follow-up he was free of symptoms. The case is of significance because most dermatologists have difficulty identifying ectoparasitoses, such as those that arise within new or atypical conditions. PMID:20687864

  2. [Cyclospora cayetanensis infection. Laboratory diagnosis].

    PubMed

    Vázquez Tsuji, O; Jiménez Domínguez, R; Campos Rivera, T; Valencia Rojas, S; Romero Cabello, R; Gamez Aranda, V; Martínez-Barbabosa, I

    2000-01-01

    Cyclospora cayetanensis is an Apicomplexa protozoa which was found to cause gastroenteritis in humans in 1979. This paper reviews the laboratory diagnosis of the disease. The usefulness of direct examination of fresh fecal matter with special acid-fast stains is emphasized as well as the morphometric differentiation between this organism and other similar coccidia. The paper reviews the sporulation technique of Cyclospora cayetanensis for the recognition and differentiation of artifacts and green-blue algae. Another aspect discussed is the morphology of the parasite in histological sections and with electromicroscopic examination whereby tissue morphology changes caused by the microorganism can be identified. The experience of the Service and Laboratory of Parasitology of the Instituto Nacional de Pediatría of Mexico in the laboratory diagnosis of this protozoosis is described. The paper is oriented towards the inclussion of Cyclospora cayetanensis in the diagnostic protocols for the study of diarrheas in our health Institutions. PMID:10948829

  3. Helminth parasites of native Hawaiian freshwater fishes: an example of extreme ecological isolation.

    PubMed

    Font, W F; Tate, D C

    1994-10-01

    The Hawaiian Islands harbor a depauperate native freshwater fish fauna comprised of 4 endemic gobies (Gobiidae) and 1 endemic sleeper (Eleotridae). We hypothesized that the natural helminth parasite community of these stream fishes would be depauperate because of colonizing constraints. In the absence of exotic fishes, native fishes in streams of Hanakapi'ai and Nu'alolo valleys harbored no adult helminth parasites. In Hakalau Stream on Hawai'i and Wainiha River on Kaua'i, we found introduced swordtails and guppies (Poeciliidae); here, the native gobioid fishes shared species of helminths with poeciliids. They were the nematode Camallanus cotti, the Asian tapeworm Bothriocephalus acheilognathi, and the leech Myzobdella lugubris. Such parasitological data should be incorporated into management plans for the conservation of native Hawaiian stream fishes as these parasites have been previously demonstrated to cause disease. PMID:7931902

  4. Decisions for the future.

    PubMed

    Horii, Toshihiro

    2014-01-01

    Music and science have always been my passion. Ultimately, though, the scale was tipped in favor of science. And I lived out my science dreams in trying to grasp as many facets of it as possible. As a biologist, I didn't stay in one stream and thus, I have embraced not only molecular biology but parasitology as well. This was way back 1980s, when such a research career was viewed highly unusual in a Japanese context. My commitment to malaria and vaccine development follows the same path. I believe one has to integrate knowledge on a wide variety of academic fields--gene expressions, protein structure, epidemiology, immunology--to achieve significant success. Similar to life itself, one has to be prepared well to be able to accept and interpret as widely as possible what one may term as "accidental results" or "accidental elements." PMID:24832717

  5. Essential veterinary education in infectious diseases of livestock and related scientific disciplines.

    PubMed

    Pastoret, P P; Vallat, B

    2009-08-01

    The World Organisation for Animal Health (commonly referred to bythe acronym of its original French name Office International des Epizooties [OIE]) was created in 1924 with the aim of controlling the international spread of infectious animal diseases. The OIE mandate has broadened since then, but the prevention and control of infectious and parasitic diseases are still at the heart of OIE activities. To plan and implement effective disease control strategies the Veterinary Services of OIE Member Countries need well-educated veterinarians who have extensive knowledge of how and why outbreaks of infectious animal diseases occur and spread and how they can be prevented and controlled. The teaching of fundamental scientific disciplines - virology, bacteriology, parasitology, epidemiology, risk analysis, immunology and vaccinology--is therefore a vital component of all veterinary education programmes. PMID:20128461

  6. Willingness-to-pay for a rapid malaria diagnostic test and artemisinin-based combination therapy from private drug shops in Mukono district, Uganda

    PubMed Central

    Hansen, Kristian Schultz; Pedrazzoli, Debora; Mbonye, Anthony; Clarke, Sian; Cundill, Bonnie; Magnussen, Pascal; Yeung, Shunmay

    2013-01-01

    In Uganda, as in many parts of Africa, the majority of the population seek treatment for malaria in drug shops as their first point of care; however, parasitological diagnosis is not usually offered in these outlets. Rapid diagnostic tests (RDTs) for malaria have attracted interest in recent years as a tool to improve malaria diagnosis, since they have proved accurate and easy to perform with minimal training. Although RDTs could feasibly be performed by drug shop vendors, it is not known how much customers would be willing to pay for an RDT if offered in these settings. We conducted a contingent valuation survey among drug shop customers in Mukono District, Uganda. Exit interviews were undertaken with customers aged 15 years and above after leaving a drug shop having purchased an antimalarial and/or paracetamol. The bidding game technique was used to elicit the willingness-to-pay (WTP) for an RDT and a course of artemisinin-based combination therapy (ACT) with and without RDT confirmation. Factors associated with WTP were investigated using linear regression. The geometric mean WTP for an RDT was US$0.53, US$1.82 for a course of ACT and US$2.05 for a course of ACT after a positive RDT. Factors strongly associated with a higher WTP for these commodities included having a higher socio-economic status, no fever/malaria in the household in the past 2 weeks and if a malaria diagnosis had been obtained from a qualified health worker prior to visiting the drug shop. The findings further suggest that the WTP for an RDT and a course of ACT among drug shop customers is considerably lower than prevailing and estimated end-user prices for these commodities. Increasing the uptake of ACTs in drug shops and restricting the sale of ACTs to parasitologically confirmed malaria will therefore require additional measures. PMID:22589226

  7. Thiamin supplementation does not reduce the frequency of adverse events after anti-malarial therapy among patients with falciparum malaria in southern Laos

    PubMed Central

    2014-01-01

    Background In a recent study one third of Lao patients presenting with uncomplicated Plasmodium falciparum malaria had biochemical evidence of thiamin deficiency, which was associated with a higher incidence of adverse events. Thiamin supplementation might, therefore, reduce adverse events in this population. Methods An exploratory, double-blind, parallel group, placebo-controlled, superiority trial of thiamin supplementation in patients of all ages with uncomplicated and severe falciparum malaria was conducted in Xepon District, Savannakhet Province, southern Laos. Patients were randomly assigned to either oral thiamin 10 mg/day for 7 days immediately after standard anti-malarial treatment then 5 mg daily until day 42, or identical oral placebo. Results After interim analyses when 630 patients (314 in thiamin and 316 in placebo groups) had been recruited, the trial was discontinued on the grounds of futility. On admission biochemical thiamin deficiency (alpha???25%) was present in 27% of patients and 9% had severe deficiency (alpha?>?31%). After 42 days of treatment, the frequency of thiamin deficiency was lower in the thiamin (2%, 1% severe) compared to the placebo (11%, 3% severe) groups (p??0.05). Clinical, haematological, and parasitological responses to treatment did not differ significantly between the two groups. Conclusion Thiamin supplementation reduced biochemical thiamin deficiency among Lao malaria patients following anti-malarial drug treatment, but it did not reduce the frequency of adverse events after anti-malarial therapy or have any detected clinical or parasitological impact. Trial registration ISRCTN 85411059 PMID:25027701

  8. Intestinal coccidiosis of anadromous and landlocked alewives, Alosa pseudoharengus, caused by Goussia ameliae n. sp. and G. alosii n. sp. (Apicomplexa: Eimeriidae)

    PubMed Central

    Lovy, Jan; Friend, Sarah E.

    2015-01-01

    Anadromous alewives, Alosa pseudoharengus, have experienced significant population level declines caused by factors including habitat destruction. Alewives occur in two different life histories, anadromous and landlocked forms. The landlocked alewife evolved from ancestral anadromous populations, resulting in an exclusively freshwater and phenotypically unique form. The occurrence of parasites in a host is linked to the environment, making alewives an ideal model to compare parasitology within a single species with contrasting life histories. Currently, little information exists on the presence and impacts of parasites in these fish populations; the present study sets out to better understand coccidiosis in the threatened anadromous populations and to understand how coccidian parasites compare in both life history forms. The intestinal coccidian, Goussia ameliae n. sp., was described infecting the pyloric cecum of 76% and 86% of young-of-the-year and adult anadromous alewives, respectively, from the Maurice River, New Jersey, USA. The coccidian was found in landlocked alewife populations with a prevalence of 92% and 34% in YOY and adult fish, respectively. An analysis of the small subunit 18S ribosomal RNA gene of G. ameliae from both life history forms demonstrated that the coccidian had 100% sequence identity, confirming the same parasite species in both forms. Though genetic analysis demonstrated G. ameliae to be identical, some differences were observed in sporulation and morphology of the parasite within the two populations. The sporocysts in anadromous populations were shorter and wider, and sporulation timing differed from that of landlocked fish. These differences may either be attributed to differences in the host type or to the sporulation environment. Lastly, alewives from landlocked populations were frequently co-infected with a second coccidian species in the posterior intestine, which occurred at a lower prevalence. This species, G. alosii n. sp., was described based on morphological characters of the sporulated oocysts in fresh parasitological preparations. PMID:25853050

  9. Spatial and temporal variations relevant to tsetse control in the Bipindi focus of southern Cameroon

    PubMed Central

    2013-01-01

    Background Human African Trypanosomiasis (HAT) remains a public health problem in many poor countries. Due to lack of financial resources in these countries, cost-effective strategies are needed for efficient control of this scourge, especially the tsetse vector. It was shown that perennial water sources maintain a favourable biotope for tsetse flies and thus the transmission dynamics of sleeping sickness. The present paper aimed at assessing the transmission dynamics of HAT in a forest environment where the hydrographic network is important. Methods Two entomological surveys were carried out in July 2009 and March 2010 in the Bipindi sleeping sickness focus of the South Region of Cameroon. Entomological and parasitological data were collected during both trapping periods (including the climate variations throughout a year) and compared to each other. The level of risk for transmission of the disease during each trapping period was also evaluated at the trap level and materialised on the map of the Bipindi focus. Results Glossina palpalis palpalis was the most prevalent tsetse fly species captured in this focus. The overall densities of tsetse flies as well as the risk for transmission of HAT in the Bipindi focus were significantly higher in July than in March. At the trap level, we observed that these parameters were almost constant, whatever the trapping period, when the biotope included perennial water sources. Conclusions This study shows that the spatial distribution of traps, as well as the temporal climatic variations might influence entomological and parasitological parameters of HAT and that the presence of perennial water sources in biotopes would favour the development of tsetse flies and thus the transmission of sleeping sickness. These factors should, therefore, be taken into account in order to provide more efficient vector control. PMID:23815985

  10. Prevalence of hookworm infection: a retrospective study in Kumasi

    PubMed Central

    Walana, Williams; Aidoo, Eric Nana Kofi; Tay, Samuel Crowther Kofi

    2014-01-01

    Objective To establish the prevalence of hookworm infection among patients who reported at the parasitology laboratory of the Komfo Anokye Teaching Hospital for intestinal parasitic investigation. Method This retrospective study covered available data from January 2001 to December 2011. Records of patients referred to the parasitology laboratory of the hospital were manually reviewed for hookworm infection. Data on age, sex and status of hookworm infection (either present or absent) were retrieved and analyzed by using Microsoft Excel 2007 statistical package. Results A total of 47?147 patients was reported at the laboratory for intestinal parasitic investigation. Among these patients, 158 patient were positive, representing an overall prevalence of 0.3% (158/47?147). Among the positive cases, the study revealed that the proportion of individuals in age groups <1, 1 to 9, 10 to 19, 20 to 29 and 30 to 39 years were 1.3% (2), 10.8% (17), 16.5% (26), 27.2% (43) and 23.4% (37) respectively. Furthermore, people in age group 40 to 49, 50 to 59 and ?60 years were infected in the proportion of 8.7% (14), 5.7% (9) and 7.0% (11) respectively. Among the infected patients, the number of females was 62.7% (99) while that of males was 37.3% (59). The yearly prevalence rate dropped consistently from 0.84% in 2001 to 0.11% in 2005. However it increased marginally in 2006 (0.27%) and dropped to 0.00% in 2011. Conclusion Hookworm infestation was found to be generally high between April and August. However the overall prevalence was relatively low among the study population. PMID:25183072

  11. Immunodetection of Fasciola gigantica Circulating Antigen in Sera of Infected Individuals for Laboratory Diagnosis of Human Fascioliasis

    PubMed Central

    Attallah, Abdelfattah M.; Bughdadi, Faisal A.; El-Shazly, Atef M.

    2013-01-01

    Currently, the laboratory diagnosis of human fascioliasis is based on the parasitological examination of parasite eggs in stool specimens and serological detection of specific antibodies in serum samples, which are often unreliable diagnostic approaches. Ideally, a sensitive and specific diagnostic test for Fasciola infection should be based on the detection of circulating Fasciola antigen, which implies active infection. Here, a 27-kDa-molecular-mass antigen was identified in a Fasciola gigantica adult worm antigen preparation, excretory-secretory products, and sera from F. gigantica-infected individuals, and it was not detected in antigenic extracts of other parasites and sera from noninfected individuals. The target antigen was isolated and partially characterized as a protein. Immunoperoxidase staining located the target epitope within teguments and guts of F. gigantica adult worms. The performance characteristics of a newly developed enzyme-linked immunosorbent assay (ELISA) based on F. gigantica circulating antigen detection in serum (FgCA-27 ELISA) were investigated using sera of 120 parasitologically diagnosed F. gigantica-infected individuals and 80 noninfected individuals. The area under the receiving operating characteristic (ROC) curve (AUC) for ELISA was significantly high (AUC = 0.961, P < 0.0001) for discriminating Fasciola-infected and noninfected individuals. The developed assay showed high degrees of sensitivity, specificity, and efficiency (>93%), and a significant correlation (r = 0.715, P < 0.0001) between antigen level and parasite egg count was shown. In conclusion, a 27-kDa Fasciola antigen was identified in sera of F. gigantica-infected individuals. A highly sensitive and specific Fasciola antigen detection assay, FgCA-27 ELISA, was developed for laboratory diagnosis of human fascioliasis. PMID:23945158

  12. Immunodetection of Fasciola gigantica circulating antigen in sera of infected individuals for laboratory diagnosis of human fascioliasis.

    PubMed

    Attallah, Abdelfattah M; Bughdadi, Faisal A; El-Shazly, Atef M; Ismail, Hisham

    2013-10-01

    Currently, the laboratory diagnosis of human fascioliasis is based on the parasitological examination of parasite eggs in stool specimens and serological detection of specific antibodies in serum samples, which are often unreliable diagnostic approaches. Ideally, a sensitive and specific diagnostic test for Fasciola infection should be based on the detection of circulating Fasciola antigen, which implies active infection. Here, a 27-kDa-molecular-mass antigen was identified in a Fasciola gigantica adult worm antigen preparation, excretory-secretory products, and sera from F. gigantica-infected individuals, and it was not detected in antigenic extracts of other parasites and sera from noninfected individuals. The target antigen was isolated and partially characterized as a protein. Immunoperoxidase staining located the target epitope within teguments and guts of F. gigantica adult worms. The performance characteristics of a newly developed enzyme-linked immunosorbent assay (ELISA) based on F. gigantica circulating antigen detection in serum (FgCA-27 ELISA) were investigated using sera of 120 parasitologically diagnosed F. gigantica-infected individuals and 80 noninfected individuals. The area under the receiving operating characteristic (ROC) curve (AUC) for ELISA was significantly high (AUC = 0.961, P < 0.0001) for discriminating Fasciola-infected and noninfected individuals. The developed assay showed high degrees of sensitivity, specificity, and efficiency (>93%), and a significant correlation (r = 0.715, P < 0.0001) between antigen level and parasite egg count was shown. In conclusion, a 27-kDa Fasciola antigen was identified in sera of F. gigantica-infected individuals. A highly sensitive and specific Fasciola antigen detection assay, FgCA-27 ELISA, was developed for laboratory diagnosis of human fascioliasis. PMID:23945158

  13. Systematic analysis of funding awarded for antimicrobial resistance research to institutions in the UK, 1997–2010

    PubMed Central

    Head, Michael G.; Fitchett, Joseph R.; Cooke, Mary K.; Wurie, Fatima B.; Atun, Rifat; Hayward, Andrew C.; Holmes, Alison; Johnson, Alan P.; Woodford, Neil

    2014-01-01

    Objectives To assess the level of research funding awarded to UK institutions specifically for antimicrobial resistance-related research and how closely the topics funded relate to the clinical and public health burden of resistance. Methods Databases and web sites were systematically searched for information on how infectious disease research studies were funded for the period 1997–2010. Studies specifically related to antimicrobial resistance, including bacteriology, virology, mycology and parasitology research, were identified and categorized in terms of funding by pathogen and disease and by a research and development value chain describing the type of science. Results The overall dataset included 6165 studies receiving a total investment of £2.6 billion, of which £102 million was directed towards antimicrobial resistance research (5.5% of total studies, 3.9% of total spend). Of 337 resistance-related projects, 175 studies focused on bacteriology (40.2% of total resistance-related spending), 42 focused on antiviral resistance (17.2% of funding) and 51 focused on parasitology (27.4% of funding). Mean annual funding ranged from £1.9 million in 1997 to £22.1 million in 2009. Conclusions Despite the fact that the emergence of antimicrobial resistance threatens our future ability to treat many infections, the proportion of the UK infection-research spend targeting this important area is small. There are encouraging signs of increased investment in this area, but it is important that this is sustained and targeted at areas of projected greatest burden. Two areas of particular concern requiring more investment are tuberculosis and multidrug-resistant Gram-negative bacteria. PMID:24038777

  14. A Comparison of Multiple Methods for Estimating Parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and Its Application for Studying Infection in Natural Populations

    PubMed Central

    Maia, João P.; Harris, D. James; Carranza, Salvador; Gómez-Díaz, Elena

    2014-01-01

    Identifying factors influencing infection patterns among hosts is critical for our understanding of the evolution and impact of parasitism in natural populations. However, the correct estimation of infection parameters depends on the performance of detection and quantification methods. In this study, we designed a quantitative PCR (qPCR) assay targeting the 18 S rRNA gene to estimate prevalence and intensity of Hepatozoon infection and compared its performance with microscopy and PCR. Using qPCR, we also compared various protocols that differ in the biological source and the extraction methods. Our results show that the qPCR approach on DNA extracted from blood samples, regardless of the extraction protocol, provided the most sensitive estimates of Hepatozoon infection parameters; while allowed us to differentiate between mixed infections of Adeleorinid (Hepatozoon) and Eimeriorinid (Schellackia and Lankesterella), based on the analysis of melting curves. We also show that tissue and saline methods can be used as low-cost alternatives in parasitological studies. The next step was to test our qPCR assay in a biological context, and for this purpose we investigated infection patterns between two sympatric lacertid species, which are naturally infected with apicomplexan hemoparasites, such as the genera Schellackia (Eimeriorina) and Hepatozoon (Adeleorina). From a biological standpoint, we found a positive correlation between Hepatozoon intensity of infection and host body size within each host species, being significantly higher in males, and higher in the smaller sized host species. These variations can be associated with a number of host intrinsic factors, like hormonal and immunological traits, that require further investigation. Our findings are relevant as they pinpoint the importance of accounting for methodological issues to better estimate infection in parasitological studies, and illustrate how between-host factors can influence parasite distributions in sympatric natural populations. PMID:24743340

  15. Epidemiology of canine leishmaniasis in southern Bahia, Brazil.

    PubMed

    Leça Júnior, Nilo Fernandes; Guedes, Paula Elisa Brandão; Santana, Lailla Nascimento; Almeida, Valter Dos Anjos; Carvalho, Fábio Santos; Albuquerque, George Rego; Wenceslau, Amauri Arias; Munhoz, Alexandre Dias; Silva, Fabiana Lessa

    2015-08-01

    Leishmaniosis is a zoonosis caused by protozoa of the genus Leishmania. American cutaneous leishmaniosis (ACL) is mainly caused by the species L. amazonensis and L. braziliensis, and American visceral leishmaniosis (AVL) is caused by L. infantum chagasi. In addition to their proven roles as reservoirs of AVL, dogs are also suspected by researchers to be reservoirs of ACL due to reports of this infection in domestic environments and of infected dogs in endemic areas. The aim of this study was to detect Leishmania sp. infection in dogs from Vila Operária, Buerarema, Bahia, using parasitological tests, indirect immunofluorescent assay (IFA) and polymerase chain reaction (PCR). Furthermore, this study also aimed to identify risk factors associated with illness in dogs in this locality by conducting an epidemiological survey. For this purpose, 292 dogs were clinically evaluated for the presence of skin lesions, and the dogs that showed these changes were submitted to scarification injury to enable preparation of slides for microscopic study of amastigotes. Subsequently, the dogs underwent blood sampling for serological (IFA) and molecular (PCR) tests. Additionally, the owners of the dogs answered an epidemiological questionnaire to facilitate the identification of risk factors for exposure of dogs to pathogens of ACL. Of the 292 dogs studied, 13 (4.5%) had lesions suggestive of ACL, but with a negative parasitological examination and 147 (50.3%) were seropositive according to the IFA. Of the 273 dogs studied using PCR test, 10 (3.66%) were positive for L. braziliensis, and all samples were negative for L. infantum chagasi. Wastelands in the peridomicile and the presence of light in the household were risk factors associated with ACL. The results show that Vila Operária has asymptomatic dogs with ACL and that the detection sensitivity of the IFA was higher than that of PCR for the infected dogs. PMID:25917715

  16. Potential impact of host immunity on malaria treatment outcome in Tanzanian children infected with Plasmodium falciparum

    PubMed Central

    Enevold, Anders; Nkya, Watoky MMM; Theisen, Michael; Vestergaard, Lasse S; Jensen, Anja TR; Staalsoe, Trine; Theander, Thor G; Bygbjerg, Ib C; Alifrangis, Michael

    2007-01-01

    Background In malaria endemic areas children may recover from malaria after chemotherapy in spite of harbouring genotypically drug-resistant Plasmodium falciparum. This phenomenon suggests that there is a synergy between drug treatment and acquired immunity. This hypothesis was examined in an area of moderately intense transmission of P. falciparum in Tanzania during a drug trail with sulphadoxine-pyrimethamine (SP) or amodiaquine (AQ). Methods One hundred children with uncomplicated malaria were treated with either SP or AQ and followed for 28 days. Mutations in parasite genes related to SP and AQ-resistance as well as human sickle cell trait and alpha-thalassaemia were determined using PCR and sequence-specific oligonucleotide probes and enzyme-linked immunosorbent assay (SSOP-ELISA), and IgG antibody responses to a panel of P. falciparum antigens were assessed and related to treatment outcome. Results Parasitological or clinical treatment failure (TF) was observed in 68% and 38% of children receiving SP or AQ, respectively. In those with adequate clinical and parasitological response (ACPR) compared to children with TF, and for both treatment regimens, prevalence and levels of anti-Glutamate-rich Protein (GLURP)-specific IgG antibodies were significantly higher (P < 0.001), while prevalence of parasite haplotypes associated with SP and AQ resistance was lower (P = 0.02 and P = 0.07, respectively). Interestingly, anti-GLURP-IgG antibodies were more strongly associated with treatment outcome than parasite resistant haplotypes, while the IgG responses to none of the other 11 malaria antigens were not significantly associated with ACPR. Conclusion These findings suggest that GLURP-specific IgG antibodies in this setting contribute to clearance of drug-resistant infections and support the hypothesis that acquired immunity enhances the clinical efficacy of drug therapy. The results should be confirmed in larger scale with greater sample size and with variation in transmission intensity. PMID:18021388

  17. Spatially Explicit Burden Estimates of Malaria in Tanzania: Bayesian Geostatistical Modeling of the Malaria Indicator Survey Data

    PubMed Central

    Gosoniu, Laura; Msengwa, Amina; Lengeler, Christian; Vounatsou, Penelope

    2012-01-01

    A national HIV/AIDS and malaria parasitological survey was carried out in Tanzania in 2007–2008. In this study the parasitological data were analyzed: i) to identify climatic/environmental, socio-economic and interventions factors associated with child malaria risk and ii) to produce a contemporary, high spatial resolution parasitaemia risk map of the country. Bayesian geostatistical models were fitted to assess the association between parasitaemia risk and its determinants. Bayesian kriging was employed to predict malaria risk at unsampled locations across Tanzania and to obtain the uncertainty associated with the predictions. Markov chain Monte Carlo (MCMC) simulation methods were employed for model fit and prediction. Parasitaemia risk estimates were linked to population data and the number of infected children at province level was calculated. Model validation indicated a high predictive ability of the geostatistical model, with 60.00% of the test locations within the 95% credible interval. The results indicate that older children are significantly more likely to test positive for malaria compared with younger children and living in urban areas and better-off households reduces the risk of infection. However, none of the environmental and climatic proxies or the intervention measures were significantly associated with the risk of parasitaemia. Low levels of malaria prevalence were estimated for Zanzibar island. The population-adjusted prevalence ranges from in Kaskazini province (Zanzibar island) to in Mtwara region. The pattern of predicted malaria risk is similar with the previous maps based on historical data, although the estimates are lower. The predicted maps could be used by decision-makers to allocate resources and target interventions in the regions with highest burden of malaria in order to reduce the disease transmission in the country. PMID:22649486

  18. Spatially explicit burden estimates of malaria in Tanzania: bayesian geostatistical modeling of the malaria indicator survey data.

    PubMed

    Gosoniu, Laura; Msengwa, Amina; Lengeler, Christian; Vounatsou, Penelope

    2012-01-01

    A national HIV/AIDS and malaria parasitological survey was carried out in Tanzania in 2007-2008. In this study the parasitological data were analyzed: i) to identify climatic/environmental, socio-economic and interventions factors associated with child malaria risk and ii) to produce a contemporary, high spatial resolution parasitaemia risk map of the country. Bayesian geostatistical models were fitted to assess the association between parasitaemia risk and its determinants. bayesian kriging was employed to predict malaria risk at unsampled locations across Tanzania and to obtain the uncertainty associated with the predictions. Markov chain Monte Carlo (MCMC) simulation methods were employed for model fit and prediction. Parasitaemia risk estimates were linked to population data and the number of infected children at province level was calculated. Model validation indicated a high predictive ability of the geostatistical model, with 60.00% of the test locations within the 95% credible interval. The results indicate that older children are significantly more likely to test positive for malaria compared with younger children and living in urban areas and better-off households reduces the risk of infection. However, none of the environmental and climatic proxies or the intervention measures were significantly associated with the risk of parasitaemia. Low levels of malaria prevalence were estimated for Zanzibar island. The population-adjusted prevalence ranges from 0.29% in Kaskazini province (Zanzibar island) to 18.65% in Mtwara region. The pattern of predicted malaria risk is similar with the previous maps based on historical data, although the estimates are lower. The predicted maps could be used by decision-makers to allocate resources and target interventions in the regions with highest burden of malaria in order to reduce the disease transmission in the country. PMID:22649486

  19. Head-to-head comparison of three vaccination strategies based on DNA and raw insect-derived recombinant proteins against Leishmania.

    PubMed

    Todolí, Felicitat; Rodríguez-Cortés, Alhelí; Núñez, María Del Carmen; Laurenti, Márcia D; Gómez-Sebastián, Silvia; Rodríguez, Fernando; Pérez-Martín, Eva; Escribano, José M; Alberola, Jordi

    2012-01-01

    Parasitic diseases plague billions of people among the poorest, killing millions annually, and causing additional millions of disability-adjusted life years lost. Leishmaniases affect more than 12 million people, with over 350 million people at risk. There is an urgent need for efficacious and cheap vaccines and treatments against visceral leishmaniasis (VL), its most severe form. Several vaccination strategies have been proposed but to date no head-to-head comparison was undertaken to assess which is the best in a clinical model of the disease. We simultaneously assayed three vaccination strategies against VL in the hamster model, using KMPII, TRYP, LACK, and PAPLE22 vaccine candidate antigens. Four groups of hamsters were immunized using the following approaches: 1) raw extracts of baculovirus-infected Trichoplusia ni larvae expressing individually one of the four recombinant proteins (PROT); 2) naked pVAX1 plasmids carrying the four genes individually (DNA); 3) a heterologous prime-boost (HPB) strategy involving DNA followed by PROT (DNA-PROT); and 4) a Control including empty pVAX1 plasmid followed by raw extract of wild-type baculovirus-infected T. ni larvae. Hamsters were challenged with L. infantum promastigotes and maintained for 20 weeks. While PROT vaccine was not protective, DNA vaccination achieved protection in spleen. Only DNA-PROT vaccination induced significant NO production by macrophages, accompanied by a significant parasitological protection in spleen and blood. Thus, the DNA-PROT strategy elicits strong immune responses and high parasitological protection in the clinical model of VL, better than its corresponding naked DNA or protein versions. Furthermore, we show that naked DNA coupled with raw recombinant proteins produced in insect larvae biofactories -the cheapest way of producing DNA-PROT vaccines- is a practical and cost-effective way for potential "off the shelf" supplying vaccines at very low prices for the protection against leishmaniases, and possibly against other parasitic diseases affecting the poorest of the poor. PMID:23236448

  20. Head-to-Head Comparison of Three Vaccination Strategies Based on DNA and Raw Insect-Derived Recombinant Proteins against Leishmania

    PubMed Central

    Núñez, María del Carmen; Laurenti, Márcia D.; Gómez-Sebastián, Silvia; Rodríguez, Fernando; Pérez-Martín, Eva; Escribano, José M.

    2012-01-01

    Parasitic diseases plague billions of people among the poorest, killing millions annually, and causing additional millions of disability-adjusted life years lost. Leishmaniases affect more than 12 million people, with over 350 million people at risk. There is an urgent need for efficacious and cheap vaccines and treatments against visceral leishmaniasis (VL), its most severe form. Several vaccination strategies have been proposed but to date no head-to-head comparison was undertaken to assess which is the best in a clinical model of the disease. We simultaneously assayed three vaccination strategies against VL in the hamster model, using KMPII, TRYP, LACK, and PAPLE22 vaccine candidate antigens. Four groups of hamsters were immunized using the following approaches: 1) raw extracts of baculovirus-infected Trichoplusia ni larvae expressing individually one of the four recombinant proteins (PROT); 2) naked pVAX1 plasmids carrying the four genes individually (DNA); 3) a heterologous prime-boost (HPB) strategy involving DNA followed by PROT (DNA-PROT); and 4) a Control including empty pVAX1 plasmid followed by raw extract of wild-type baculovirus-infected T. ni larvae. Hamsters were challenged with L. infantum promastigotes and maintained for 20 weeks. While PROT vaccine was not protective, DNA vaccination achieved protection in spleen. Only DNA-PROT vaccination induced significant NO production by macrophages, accompanied by a significant parasitological protection in spleen and blood. Thus, the DNA-PROT strategy elicits strong immune responses and high parasitological protection in the clinical model of VL, better than its corresponding naked DNA or protein versions. Furthermore, we show that naked DNA coupled with raw recombinant proteins produced in insect larvae biofactories –the cheapest way of producing DNA-PROT vaccines– is a practical and cost-effective way for potential “off the shelf” supplying vaccines at very low prices for the protection against leishmaniases, and possibly against other parasitic diseases affecting the poorest of the poor. PMID:23236448